### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = CREBBP)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"CREBBP"	"CREB binding protein"	"16"	"p13.3"	"unknown"	"NC_000016.9"	"UD_130017983935"	""	"https://www.LOVD.nl/CREBBP"	""	"1"	"2348"	"1387"	"600140"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland."	""	"g"	"http://databases.lovd.nl/shared/refseq/CREBBP_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00000"	"2007-06-21 00:00:00"	"00006"	"2022-02-03 11:03:56"	"00006"	"2025-11-13 13:04:16"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00001113"	"CREBBP"	"transcript variant 1"	"002"	"NM_004380.2"	""	"NP_004371.2"	""	""	""	"-204"	"9993"	"7329"	"3775055"	"3930121"	"00000"	"2012-09-13 13:13:09"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 17
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00103"	"MRLIAF"	"mental retardation, language impairment, autistic features (MRLIAF)"	"AD"	"613670"	""	""	""	"00008"	"2013-01-16 09:42:45"	"00006"	"2021-12-10 21:51:32"
"00138"	"autism"	"autism"	""	"209850"	""	""	""	"00084"	"2013-06-04 18:17:33"	"00006"	"2015-12-08 23:54:35"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00714"	"RSTS1"	"Rubinstein-Taybi syndrome, type 1"	"AD"	"180849"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2024-11-20 11:36:38"
"01157"	"CHTE"	"Hypothyroidism, central, testicular enlargement (CHTE)"	"XLR"	"300888"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01544"	"RB1"	"retinoblastoma, type 1"	"AD;SMu"	"180200"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2025-01-14 18:01:23"
"04281"	"CDLS"	"Cornelia de Lange syndrome (CDLS)"	""	""	""	""	""	"00006"	"2015-06-15 14:50:45"	""	""
"05155"	"OPLL"	"ossification, posterior longitudinal ligament spine (OPLL)"	""	""	""	""	""	"00006"	"2016-04-14 16:02:41"	""	""
"05162"	"DD"	"developmental delay (DD)"	""	""	""	""	""	"00006"	"2016-05-10 21:15:54"	"00006"	"2020-05-25 13:52:33"
"05517"	"skeletal dysplasia"	"dysplasia, skeletal"	""	""	""	""	""	"00006"	"2018-11-16 16:43:21"	""	""
"05521"	"seizures"	"seizures"	""	""	""	""	""	"00006"	"2018-11-18 17:02:13"	""	""
"05597"	"DSD"	"disorder of sex development (DSD)"	""	""	""	""	""	"00006"	"2019-04-28 14:45:24"	""	""
"05611"	"NDD"	"neurodevelopmental disorder (NDD)"	""	""	""	""	""	"00006"	"2019-06-19 12:27:20"	"00006"	"2024-12-13 11:12:21"
"05619"	"RSTS"	"Rubinstein-Taybi syndrome (RSTS)"	""	""	""	""	""	"00006"	"2019-07-05 14:41:32"	"00006"	"2021-12-10 21:51:32"
"05620"	"MKHK"	"Menke-Hennekam syndrome"	""	""	""	""	""	"00006"	"2019-07-05 14:50:13"	"00006"	"2021-12-10 21:51:32"
"05621"	"MKHK1"	"Menke-Hennekam syndrome, type 1 (MKHK-1)"	"AD"	"618332"	""	""	""	"00006"	"2019-07-05 14:50:59"	"00006"	"2021-12-10 21:51:32"


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 5
"{{geneid}}"	"{{diseaseid}}"
"CREBBP"	"00139"
"CREBBP"	"00714"
"CREBBP"	"05619"
"CREBBP"	"05620"
"CREBBP"	"05621"


## Individuals ## Do not remove or alter this header ##
## Count = 347
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00000209"	""	""	""	"1"	""	"00037"	"{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}"	""	"M"	"no"	"Netherlands"	""	"0"	""	""	""	""
"00050423"	""	""	""	"1"	""	"00006"	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	"family, 1 affected"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	"Decipher"	""	""	""
"00050666"	""	""	""	"1"	""	"00006"	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	"family, 1 affected"	"M"	""	"United Kingdom (Great Britain)"	""	"0"	"Decipher"	""	""	""
"00080828"	""	""	""	"1"	""	"01758"	"{PMID:Trujillano 2017:27848944}"	"no information from parents"	""	""	""	""	"0"	""	""	""	""
"00081430"	""	""	""	"1"	""	"01783"	""	""	""	""	"China"	""	"0"	""	""	"Han"	""
"00081433"	""	""	""	"1"	""	"01783"	""	""	""	""	"China"	""	"0"	""	""	"Han"	""
"00081440"	""	""	""	"1"	""	"01783"	""	""	""	""	"China"	""	"0"	""	""	"han"	""
"00101390"	""	""	""	"1"	""	"01864"	""	""	"M"	"no"	"China"	">01y08m"	"0"	""	""	""	"P3"
"00102082"	""	""	""	"1"	""	"01864"	""	""	"F"	"no"	"China"	">05y"	"0"	""	""	""	"P11"
"00110731"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110732"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110733"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110734"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110735"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110736"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110737"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110738"	""	""	""	"1"	""	"01353"	""	""	""	""	""	""	"0"	""	""	""	""
"00110739"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110740"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2002:12114483}"	""	""	""	""	""	"0"	""	""	""	""
"00110741"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110742"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110743"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110744"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110745"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110746"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110747"	""	""	""	"1"	""	"00006"	"{PMID:Petrij 1995:7630403}; {OMIM600140:0001}"	""	""	""	""	""	"0"	""	""	""	""
"00110748"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110749"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110750"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110751"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110752"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110753"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110754"	""	""	""	"1"	""	"00006"	"{PMID:Petrij 1995:7630403}; {OMIM600140:0002}"	""	""	""	""	""	"0"	""	""	""	""
"00110755"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110756"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110757"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2002:12114483}"	""	""	""	""	""	"0"	""	""	""	""
"00110758"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110759"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110760"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110761"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2002:12114483}"	""	""	""	""	""	"0"	""	""	""	""
"00110762"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110763"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110764"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110765"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110766"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110767"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110768"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110769"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	"de novo variant"	""	""	""	""	"0"	""	""	""	""
"00110770"	""	""	""	"1"	""	"01353"	"{PMID:Roelfsema 2005:15706485}"	"de novo variant"	""	""	""	""	"0"	""	""	""	""
"00110771"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110772"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110773"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110774"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110775"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110776"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110777"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2002:12114483}"	""	""	""	""	""	"0"	""	""	""	""
"00110778"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110779"	""	""	""	"1"	""	"01353"	"{PMID:Roelfsema 2005:15706485}"	"de novo variant"	""	""	""	""	"0"	""	""	""	""
"00110780"	""	""	""	"1"	""	"02170"	""	""	"F"	"no"	""	""	"0"	""	""	"white"	""
"00110781"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110782"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110783"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110784"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110785"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110786"	""	""	""	"1"	""	"01353"	"Gervasini, personal comunication"	""	""	""	""	""	"0"	""	""	""	""
"00110787"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110788"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110789"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110790"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110791"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110792"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110793"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110794"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	"M"	""	""	""	"0"	""	""	""	""
"00110795"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110796"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110797"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110798"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110799"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110800"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110801"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110802"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110803"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110804"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110805"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2002:12114483}"	"milder phenotype"	""	""	""	""	"0"	""	""	""	""
"00110806"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110807"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110808"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110809"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110810"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110811"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110812"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110813"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110814"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110815"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110816"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110817"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110818"	""	""	""	"1"	""	"01353"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00110819"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110820"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	"de novo variant"	""	""	""	""	"0"	""	""	""	""
"00110821"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}"	""	""	""	""	""	"0"	""	""	""	""
"00110822"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110823"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110824"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110825"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}; {OMIM600140:0006}"	"de novo variant,\r\nchange in PHD finger of HAT domain"	""	""	""	""	"0"	""	""	""	""
"00110826"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110827"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	"parents not tested"	""	""	""	""	"0"	""	""	""	""
"00110828"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110829"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110830"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110831"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}; {OMIM600140:0007}"	""	""	""	""	""	"0"	""	""	""	""
"00110832"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110833"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110834"	""	""	""	"1"	""	"01353"	"Gervasini, personal comunication"	""	""	""	""	""	"0"	""	""	""	""
"00110835"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110836"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	"de novo"	""	""	""	""	"0"	""	""	""	""
"00110837"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110838"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110839"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110840"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110841"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}"	""	""	""	""	""	"0"	""	""	""	""
"00110842"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110843"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110844"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	"de novo variant"	""	""	""	""	"0"	""	""	""	""
"00110845"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110846"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110847"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110848"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110849"	""	""	""	"1"	""	"00006"	"{PMID:Murata 2001:11331617}; {OMIM600140:0004}"	""	""	""	""	""	"0"	""	""	""	""
"00110850"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110851"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110852"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110853"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110854"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110855"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110856"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110857"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110858"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110859"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110860"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110861"	""	""	""	"1"	""	"01353"	""	""	""	""	""	""	"0"	""	""	""	""
"00110862"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110863"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110864"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110865"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110866"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110867"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110868"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110869"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110870"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110871"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110872"	""	""	""	"1"	""	"01353"	"Gervasini, personal comunication"	""	""	""	""	""	"0"	""	""	""	""
"00110873"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110874"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110875"	""	""	""	"1"	""	"01353"	"Gervasini, personal comunication"	""	""	""	""	""	"0"	""	""	""	""
"00110876"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}"	""	""	""	""	""	"0"	""	""	""	""
"00110877"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110878"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110879"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}"	""	""	""	""	""	"0"	""	""	""	""
"00110880"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110881"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110882"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110883"	""	""	""	"1"	""	"00006"	"{PMID:Murata 2001:11331617}"	""	""	""	""	""	"0"	""	""	""	""
"00110884"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110885"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110886"	""	""	""	"1"	""	"00006"	"{PMID:Kalkhoven 2004:15313412}"	"de novo variant"	""	""	""	""	"0"	""	""	""	""
"00110887"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110888"	""	""	""	"1"	""	"01353"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00110889"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110890"	""	""	""	"1"	""	"00006"	"{PMID:Murata 2001:11331617}"	""	""	""	""	""	"0"	""	""	""	""
"00110891"	""	""	""	"1"	""	"00006"	"{PMID:Murata 2001:11331617}"	""	""	""	""	""	"0"	""	""	""	""
"00110892"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110893"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110894"	""	""	""	"1"	""	"01353"	"D.J.M. Peters, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110895"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110896"	""	""	""	"1"	""	"00006"	"{PMID:Udaka 2005:16359492}"	""	""	""	""	""	"0"	""	""	""	""
"00110897"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110898"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110899"	""	""	""	"1"	""	"00006"	"M.J. van Belzen"	""	"F"	""	""	""	"0"	""	""	""	""
"00110900"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110901"	""	""	""	"1"	""	"01353"	"Gervasini, personal communication"	""	""	""	""	""	"0"	""	""	""	""
"00110902"	""	""	""	"1"	""	"01540"	""	"Severe mental retardation"	"F"	"yes"	""	""	"0"	""	""	""	""
"00110903"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110904"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110905"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110906"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110907"	""	""	""	"1"	""	"00006"	"{PMID:Bartsch 2005:16021471}"	""	""	""	""	""	"0"	""	""	""	""
"00110908"	""	""	""	"1"	""	"00006"	"{PMID:Bentivegna 2006:17052327}"	""	""	""	""	""	"0"	""	""	""	""
"00110909"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110910"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110911"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110912"	""	""	""	"1"	""	"00006"	"{PMID:Roelfsema 2005:15706485}"	""	""	""	""	""	"0"	""	""	""	""
"00110913"	""	""	""	"1"	""	"01353"	"M.J. van Belzen"	""	""	""	""	""	"0"	""	""	""	""
"00110914"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00110915"	""	""	""	"1"	""	"00006"	"{PMID:Coupry 2002:12070251}"	""	""	""	""	""	"0"	""	""	""	""
"00144312"	""	""	""	"1"	""	"02342"	""	""	"M"	"?"	"Netherlands"	">16y"	"0"	""	""	""	""
"00144319"	""	""	""	"1"	""	"02342"	""	""	"M"	"no"	""	""	"0"	""	""	""	""
"00144320"	""	""	""	"1"	""	"02342"	""	""	"F"	"no"	""	""	"0"	""	""	""	""
"00144321"	""	""	""	"1"	""	"02342"	""	""	"F"	"?"	""	""	"0"	""	""	""	""
"00144322"	""	""	""	"1"	""	"02342"	""	""	"M"	"?"	""	""	"0"	""	""	""	""
"00144323"	""	""	""	"1"	""	"02342"	""	""	"M"	"?"	""	""	"0"	""	""	""	""
"00144324"	""	""	""	"1"	""	"02342"	""	""	"M"	"?"	""	""	"0"	""	""	""	""
"00144325"	""	""	""	"1"	""	"02342"	""	""	"F"	"?"	""	""	"0"	""	""	""	""
"00144326"	""	""	""	"1"	""	"02342"	""	""	"F"	"?"	""	""	"0"	""	""	""	""
"00144327"	""	""	""	"1"	""	"02342"	""	""	"F"	"?"	""	"05y"	"0"	""	""	""	""
"00144328"	""	""	""	"1"	""	"02342"	""	""	"M"	"?"	""	""	"0"	""	""	""	""
"00231539"	""	""	""	"1"	""	"00006"	"{PMID:Eggers 2016:27899157}"	""	""	""	""	""	"0"	""	""	""	"Pat274"
"00245648"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	"PatC12"
"00245649"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	"PatC13"
"00245650"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"PatC14"
"00245651"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"F"	""	"China"	""	"0"	""	""	""	"PatC15"
"00245652"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"Netherlands"	""	"0"	""	""	""	"PatC16"
"00245653"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"China"	""	"0"	""	""	""	"PatC17"
"00245654"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"PatC18"
"00245655"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"F"	""	"United States"	""	"0"	""	""	""	"PatC19"
"00245656"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"Japan"	""	"0"	""	""	"Europe/Japan"	"PatC20"
"00245657"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"F"	""	"Norway"	"5y"	"0"	""	""	""	"PatC21"
"00245658"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2018:29460469}"	""	"M"	""	"Norway"	""	"0"	""	""	""	"PatC22"
"00245661"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"M"	""	""	""	"0"	""	""	""	"Pat1"
"00245662"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"M"	""	""	""	"0"	""	""	""	"Pat2"
"00245663"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"M"	""	""	"10y"	"0"	""	""	""	"Pat3"
"00245664"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"M"	""	""	""	"0"	""	""	""	"Pat4"
"00245665"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"M"	""	""	""	"0"	""	""	""	"Pat5"
"00245666"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"F"	""	""	""	"0"	""	""	""	"Pat6"
"00245667"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"M"	""	""	""	"0"	""	""	""	"Pat7"
"00245668"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"F"	""	""	""	"0"	""	""	""	"Pat8"
"00245669"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"F"	""	""	""	"0"	""	""	""	"Pat9"
"00245670"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"F"	""	""	""	"0"	""	""	""	"Pat10"
"00245671"	""	""	""	"1"	""	"00006"	"{PMID:Menke 2016:27311832}"	""	"F"	""	""	""	"0"	""	""	""	"Pat11"
"00291455"	""	""	""	"38"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291456"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291457"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291458"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291459"	""	""	""	"20"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291460"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291461"	""	""	""	"8"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295643"	""	""	""	"1"	""	"01164"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00302981"	""	""	""	"1"	""	"00006"	"{PMID:Helbig 2016:26795593}"	""	""	""	"United States"	""	"0"	""	""	""	"Pat26"
"00306193"	""	""	""	"1"	""	"03695"	""	""	"M"	""	"China"	""	""	""	""	""	"91"
"00307257"	""	""	""	"1"	""	"03753"	"{PMID:Mendonca 2021:34478740}"	""	"M"	""	"Brazil"	""	"0"	""	""	""	"Patient 62"
"00307259"	""	""	""	"1"	""	"03753"	"{PMID:Mendonca 2021:34478740}"	""	"F"	""	"Brazil"	""	""	""	""	""	"Patient 66"
"00307938"	""	""	""	"1"	""	"00006"	"{PMID:Anazi 2017:28940097}"	"simplex case"	"F"	""	""	""	"0"	""	""	""	"16DG0402"
"00307939"	""	""	""	"1"	""	"00006"	"{PMID:Anazi 2017:28940097}"	"simplex case"	"M"	""	""	""	"0"	""	""	""	"14DG0467"
"00314991"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1186"
"00314992"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1292"
"00314993"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1295"
"00314994"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1182"
"00314995"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1324"
"00314996"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1326"
"00314997"	""	""	""	"1"	""	"00006"	"{PMID:Squeo 2020:32170002}"	"analysis 263 cases chromatin-related disorder"	""	""	"Italy"	""	"0"	""	""	""	"GDB1196"
"00331384"	""	""	""	"1"	""	"00000"	"{PMID:Maddirevula 2018:29620724}"	"isolated case"	"M"	"no"	""	""	"0"	""	""	"Arab"	"14DG0467"
"00331385"	""	""	""	"1"	""	"00000"	"{PMID:Maddirevula 2018:29620724}"	"isolated case"	"M"	"no"	""	""	"0"	""	""	"Arab"	"12DG2123"
"00331386"	""	""	""	"1"	""	"00000"	"{PMID:Maddirevula 2018:29620724}"	"isolated case"	"M"	"no"	""	""	"0"	""	""	"Arab"	"15DG1125"
"00361498"	""	""	""	"1"	""	"00006"	"{PMID:Anazi 2017:27431290}"	"simplex case"	"M"	"no"	"Saudi Arabia"	""	"0"	""	""	""	"12DG2123"
"00361661"	""	""	""	"1"	""	"00006"	"{PMID:Anazi 2017:27431290}"	"simplex case"	"M"	"no"	"Saudi Arabia"	""	"0"	""	""	""	"15DG1125"
"00361663"	""	""	""	"1"	""	"00006"	"{PMID:Anazi 2017:27431290}"	"simplex case"	"M"	""	"Saudi Arabia"	""	"0"	""	""	""	"15DG1273"
"00374129"	""	""	""	"1"	""	"00006"	"{PMID:Lefebvre 2021:32732226}"	"fetus"	"F"	""	"France"	""	"0"	""	""	""	""
"00397652"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"189764"
"00401641"	""	""	""	"1"	""	"02494"	""	""	"M"	"no"	"Spain"	""	""	""	""	""	"203P"
"00428037"	""	""	""	"1"	""	"00006"	"{PMID:Bournazos 2022:34906502}"	"family, 1 affected"	""	""	"Australia"	""	"0"	""	""	""	"A251"
"00428194"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"209267"
"00431863"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"213718"
"00433676"	""	""	""	"1"	""	"03544"	""	""	"M"	""	""	""	""	""	""	""	""
"00434231"	""	""	""	"1"	""	"00006"	"{PMID:Jackson 2020:32830442}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	"white"	"Fam26105"
"00435255"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"260872"
"00436143"	""	""	""	"1"	""	"01164"	""	""	"M"	"?"	"? (unknown)"	""	"0"	""	""	""	"267430"
"00436370"	""	""	""	"1"	""	"00006"	"{PMID:Yuan 2019:30158690}"	"2-generation family, 1 affected, unaffected non-carrier parents"	""	""	""	""	"0"	""	""	""	"SMC3-Pat4"
"00440396"	""	""	""	"1"	""	"00006"	"{PMID:Nambot 2018:29095811}"	""	""	""	"France"	""	"0"	""	""	""	"PED3295.1"
"00448355"	""	""	""	"1"	""	"01164"	""	"prenatal analysis"	"F"	"no"	"Germany"	""	"0"	""	""	""	"286858"
"00449824"	""	""	""	"1"	""	"03544"	""	""	"M"	"-"	"- (not applicable)"	""	""	""	""	"white"	""
"00451679"	""	""	""	"1"	""	"00006"	"{PMID:Verma 2024:38820863}, {DOI:Verma 2024:10.1016/j.scr.2024.103456}"	""	""	""	"India"	""	"0"	""	""	""	"patient"
"00457746"	""	""	""	"1"	""	"03544"	""	""	"M"	"-"	"- (not applicable)"	""	""	""	""	"white"	""
"00457747"	""	""	""	"1"	""	"03544"	""	""	"F"	"-"	"- (not applicable)"	""	""	""	""	"white"	""
"00457910"	""	""	""	"1"	""	"03544"	""	""	"F"	"-"	"- (not applicable)"	""	""	""	""	"white"	""
"00464074"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464075"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464076"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464077"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464078"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464079"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464080"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464081"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464082"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464083"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464084"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464085"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464086"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464087"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464088"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464089"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464090"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464091"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464092"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464093"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"2-generation family, 1 affected, unaffected non carrier parents"	""	""	"Russia"	""	"0"	""	""	""	""
"00464094"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464095"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464096"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464097"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464098"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464099"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464100"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464101"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464102"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464103"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464104"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464105"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"2-generation family, 1 affected, unaffected non carrier parents"	""	""	"Russia"	""	"0"	""	""	""	""
"00464106"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464107"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464108"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"2-generation family, 1 affected, unaffected non carrier parents"	""	""	"Russia"	""	"0"	""	""	""	""
"00464109"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464110"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464111"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464112"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464113"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464114"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464115"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464116"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464117"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464118"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464119"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464120"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464121"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464122"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464123"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464124"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464125"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464126"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464127"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464128"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464129"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464130"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"2-generation family, 1 affected, unaffected non carrier parents"	""	""	"Russia"	""	"0"	""	""	""	""
"00464131"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464132"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464133"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464134"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464135"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464141"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464142"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464143"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00464144"	""	""	""	"1"	""	"00006"	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	"patient"	""	""	"Russia"	""	"0"	""	""	""	""
"00466078"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"55264"
"00467762"	""	""	""	"1"	""	"01164"	""	""	"M"	"no"	"Germany"	""	"0"	""	""	""	"347452"
"00468780"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00468781"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00468782"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00468783"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00468784"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""
"00468785"	""	""	""	"1"	""	"00006"	"{PMID:Retterer 2016:26633542}"	"analysis proband (1/3040); possible combination of variants not reported"	""	""	"United States"	""	"0"	""	""	""	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 345
"{{individualid}}"	"{{diseaseid}}"
"00000209"	"01157"
"00050423"	"00198"
"00050666"	"00198"
"00080828"	"00714"
"00081430"	"05155"
"00081433"	"05155"
"00081440"	"05155"
"00101390"	"00139"
"00102082"	"00139"
"00110731"	"00714"
"00110732"	"00714"
"00110733"	"00714"
"00110734"	"00714"
"00110735"	"00714"
"00110736"	"00714"
"00110737"	"00714"
"00110738"	"00714"
"00110739"	"00714"
"00110740"	"00714"
"00110741"	"00714"
"00110742"	"00714"
"00110743"	"00714"
"00110744"	"00714"
"00110745"	"00714"
"00110746"	"00714"
"00110747"	"00714"
"00110748"	"00714"
"00110749"	"00714"
"00110750"	"00714"
"00110751"	"00714"
"00110752"	"00714"
"00110753"	"00714"
"00110754"	"00714"
"00110755"	"00714"
"00110756"	"00714"
"00110757"	"00714"
"00110758"	"00714"
"00110759"	"00714"
"00110760"	"00714"
"00110761"	"00714"
"00110762"	"00714"
"00110763"	"00714"
"00110764"	"00714"
"00110765"	"00714"
"00110766"	"00714"
"00110767"	"00714"
"00110768"	"00714"
"00110769"	"00714"
"00110770"	"00714"
"00110771"	"00714"
"00110772"	"00714"
"00110773"	"00714"
"00110774"	"00714"
"00110775"	"00714"
"00110776"	"00714"
"00110777"	"00714"
"00110778"	"00714"
"00110779"	"00714"
"00110780"	"00714"
"00110781"	"00714"
"00110782"	"00714"
"00110783"	"00714"
"00110784"	"00714"
"00110785"	"00714"
"00110786"	"00714"
"00110787"	"00714"
"00110788"	"00714"
"00110789"	"00714"
"00110790"	"00714"
"00110791"	"00714"
"00110792"	"00714"
"00110793"	"00714"
"00110794"	"00714"
"00110795"	"00714"
"00110796"	"00714"
"00110797"	"00714"
"00110798"	"00714"
"00110799"	"00714"
"00110800"	"00714"
"00110801"	"00714"
"00110802"	"00714"
"00110803"	"00714"
"00110804"	"00714"
"00110805"	"00714"
"00110806"	"00714"
"00110807"	"00714"
"00110808"	"00714"
"00110809"	"00714"
"00110810"	"00714"
"00110811"	"00714"
"00110812"	"00714"
"00110813"	"00714"
"00110814"	"00714"
"00110815"	"00714"
"00110816"	"00714"
"00110817"	"00714"
"00110818"	"00198"
"00110819"	"00714"
"00110820"	"00714"
"00110821"	"00714"
"00110822"	"00714"
"00110823"	"00714"
"00110824"	"00714"
"00110825"	"00714"
"00110826"	"00714"
"00110827"	"00714"
"00110828"	"00714"
"00110829"	"00714"
"00110830"	"00714"
"00110831"	"00714"
"00110832"	"00714"
"00110833"	"00714"
"00110834"	"00714"
"00110835"	"00714"
"00110836"	"00714"
"00110837"	"00714"
"00110838"	"00714"
"00110839"	"00714"
"00110840"	"00714"
"00110841"	"00714"
"00110842"	"00714"
"00110843"	"00714"
"00110844"	"00714"
"00110845"	"00714"
"00110846"	"00714"
"00110847"	"00714"
"00110848"	"00714"
"00110849"	"00714"
"00110850"	"00714"
"00110851"	"00714"
"00110852"	"00714"
"00110853"	"00714"
"00110854"	"00714"
"00110855"	"00714"
"00110856"	"00714"
"00110857"	"00714"
"00110858"	"00714"
"00110859"	"00714"
"00110860"	"00714"
"00110861"	"00714"
"00110862"	"00714"
"00110863"	"00714"
"00110864"	"00714"
"00110865"	"00714"
"00110866"	"00714"
"00110867"	"00714"
"00110868"	"00714"
"00110869"	"00714"
"00110870"	"00714"
"00110871"	"00714"
"00110872"	"00714"
"00110873"	"00714"
"00110874"	"00714"
"00110875"	"00714"
"00110876"	"00714"
"00110877"	"00714"
"00110878"	"00714"
"00110879"	"00714"
"00110880"	"00714"
"00110881"	"00714"
"00110882"	"00714"
"00110883"	"00714"
"00110884"	"00714"
"00110885"	"00714"
"00110886"	"00714"
"00110887"	"00714"
"00110888"	"00714"
"00110889"	"00714"
"00110890"	"00714"
"00110891"	"00714"
"00110892"	"00714"
"00110893"	"00714"
"00110894"	"00714"
"00110895"	"00714"
"00110896"	"00714"
"00110897"	"00714"
"00110898"	"00714"
"00110899"	"00714"
"00110900"	"00714"
"00110901"	"00714"
"00110902"	"00139"
"00110903"	"00714"
"00110904"	"00714"
"00110905"	"00714"
"00110906"	"00714"
"00110907"	"00714"
"00110908"	"00714"
"00110909"	"00714"
"00110910"	"00714"
"00110911"	"00714"
"00110912"	"00714"
"00110913"	"00714"
"00110914"	"00714"
"00110915"	"00714"
"00144312"	"00198"
"00144319"	"00198"
"00144320"	"00139"
"00144324"	"00138"
"00144326"	"00138"
"00144327"	"00198"
"00144328"	"00198"
"00231539"	"05597"
"00245648"	"05162"
"00245649"	"05162"
"00245650"	"05162"
"00245651"	"05162"
"00245652"	"05162"
"00245653"	"05162"
"00245654"	"05162"
"00245655"	"05162"
"00245656"	"05162"
"00245657"	"05162"
"00245658"	"05162"
"00245661"	"05162"
"00245662"	"05162"
"00245663"	"05162"
"00245664"	"05162"
"00245665"	"05162"
"00245666"	"05162"
"00245667"	"05162"
"00245668"	"05162"
"00245669"	"05162"
"00245670"	"05162"
"00245671"	"05162"
"00291455"	"00198"
"00291456"	"00198"
"00291457"	"00198"
"00291458"	"00198"
"00291459"	"00198"
"00291460"	"00198"
"00291461"	"00198"
"00295643"	"00198"
"00302981"	"05521"
"00306193"	"00714"
"00307257"	"01544"
"00307259"	"01544"
"00307938"	"00139"
"00307939"	"00139"
"00314991"	"00198"
"00314992"	"00198"
"00314993"	"00198"
"00314994"	"00198"
"00314995"	"00198"
"00314996"	"00198"
"00314997"	"00198"
"00331384"	"05517"
"00331385"	"05517"
"00331386"	"05517"
"00361498"	"00139"
"00361661"	"00139"
"00361663"	"00139"
"00374129"	"00198"
"00397652"	"05621"
"00401641"	"00139"
"00428037"	"00198"
"00428194"	"00714"
"00431863"	"05621"
"00433676"	"05621"
"00434231"	"00198"
"00435255"	"00103"
"00435255"	"05619"
"00436143"	"00714"
"00436370"	"00198"
"00436370"	"04281"
"00440396"	"00198"
"00448355"	"00714"
"00449824"	"00139"
"00451679"	"05619"
"00457746"	"05619"
"00457747"	"00198"
"00457910"	"05611"
"00464074"	"05619"
"00464075"	"05619"
"00464076"	"05619"
"00464077"	"05619"
"00464078"	"05619"
"00464079"	"05619"
"00464080"	"05619"
"00464081"	"05619"
"00464082"	"05619"
"00464083"	"05619"
"00464084"	"05619"
"00464085"	"05619"
"00464086"	"05619"
"00464087"	"05619"
"00464088"	"05619"
"00464089"	"05619"
"00464090"	"05619"
"00464091"	"05619"
"00464092"	"05619"
"00464093"	"05619"
"00464094"	"05619"
"00464095"	"05619"
"00464096"	"05619"
"00464097"	"05619"
"00464098"	"05619"
"00464099"	"05619"
"00464100"	"05619"
"00464101"	"05619"
"00464102"	"05619"
"00464103"	"05619"
"00464104"	"05619"
"00464105"	"05619"
"00464106"	"05619"
"00464107"	"05619"
"00464108"	"05619"
"00464109"	"05619"
"00464110"	"05619"
"00464111"	"05619"
"00464112"	"05619"
"00464113"	"05619"
"00464114"	"05619"
"00464115"	"05619"
"00464116"	"05619"
"00464117"	"05619"
"00464118"	"05619"
"00464119"	"05619"
"00464120"	"05619"
"00464121"	"05619"
"00464122"	"05619"
"00464123"	"05619"
"00464124"	"05619"
"00464125"	"05619"
"00464126"	"05619"
"00464127"	"05619"
"00464128"	"05619"
"00464129"	"05619"
"00464130"	"05619"
"00464131"	"05619"
"00464132"	"05619"
"00464133"	"05619"
"00464134"	"05619"
"00464135"	"05619"
"00464141"	"05619"
"00464142"	"05619"
"00464143"	"05619"
"00464144"	"05619"
"00466078"	"00714"
"00467762"	"05619"
"00468780"	"00198"
"00468781"	"00198"
"00468782"	"00198"
"00468783"	"00198"
"00468784"	"00198"
"00468785"	"00198"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00103, 00138, 00139, 00198, 00714, 01157, 01544, 04281, 05155, 05162, 05517, 05521, 05597, 05611, 05619, 05620, 05621
## Count = 153
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000037035"	"00198"	"00050423"	"00006"	"Isolated (sporadic)"	""	"global developmental delay, abnormal facial shape, growth abnormality, dislocated radial head, microcephaly, severe short stature, constipation, talipes, sensorineural hearing impairment, conductive hearing impairment, supernumerary nipples, precocious puberty in females, stereotypic behavior"	""	""	""	""	""	""	""	""	""	""	""
"0000037278"	"00198"	"00050666"	"00006"	"Isolated (sporadic)"	""	"abnormality of the foot, low-set ears, abnormality of the hairline, delayed speech and language development"	""	""	""	""	""	""	""	""	""	""	""
"0000038984"	"01157"	"00000209"	"00006"	"Familial, X-linked recessive"	""	"central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)"	""	"07y04m"	""	""	""	""	""	""	""	""	""
"0000060397"	"00714"	"00080828"	"01758"	"Familial, autosomal dominant"	""	"Rubinstein-Taybi syndrome (OMIM:180849)"	""	""	""	""	""	""	""	""	""	""	""
"0000061032"	"05155"	"00081430"	"01783"	"Unknown"	""	"thoracic ossification of the ligamentum flavum,\r\nlong regional at the thoracic spine"	""	""	""	""	""	""	""	""	""	""	""
"0000061035"	"05155"	"00081433"	"01783"	"Unknown"	""	"racic ossification of the ligamentum flavum,\r\nlong regional at the thoracic spine"	""	""	""	""	""	""	""	""	""	""	""
"0000061042"	"05155"	"00081440"	"01783"	"Unknown"	""	"thoracic ossification of the ligamentum flavum;\r\nlocalized at the thoracolumbar"	""	""	""	""	""	""	""	""	""	""	""
"0000079595"	"00139"	"00101390"	"01864"	"Isolated (sporadic)"	""	"HP:0000252; HP:0001999; HP:0010442; HP:0006101; HP:0000028; HP:0030490; intellectual disability (HP:0001249)"	""	""	""	""	""	""	""	""	""	""	""
"0000080268"	"00139"	"00102082"	"01864"	"Isolated (sporadic)"	""	"HP:0000252; HP:0001999; HP:0001537; HP:0000733; intellectual disability (HP:0001249)"	""	""	""	""	""	""	""	""	""	""	""
"0000087207"	"00714"	"00110780"	"02170"	"Isolated (sporadic)"	""	"mild (IQ:50-80) mental retardation"	""	""	""	""	""	""	""	""	""	""	""
"0000087208"	"00198"	"00110818"	"01353"	"Isolated (sporadic)"	""	"Intellectual disability and dysmorphic features, but not typical for Rubinstein-Taybi syndrome; no RTS"	""	""	""	""	""	""	""	""	""	""	""
"0000087209"	"00714"	"00110821"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000087210"	"00714"	"00110861"	"01353"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000087211"	"00714"	"00110888"	"01353"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000087212"	"00139"	"00110902"	"01540"	"Isolated (sporadic)"	""	"intellectual disability, dysmorphic features, microphthalmy, coloboma retina, retinis pigmentosis, short stature, small broad thumbs, small hands and feet, aberrations toe"	""	""	""	""	""	""	""	""	""	""	""
"0000117091"	"00139"	"00144312"	"02342"	"Isolated (sporadic)"	"03y-16y"	"birth 40w; birth weight (3310/-0.8); birth length (47/-2); OFC at birth (34/-1.5); mild intellectual disability (HP:0001256)"	""	""	""	""	""	""	""	""	""	""	""
"0000117099"	"00198"	"00144319"	"02342"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000117100"	"00139"	"00144320"	"02342"	"Isolated (sporadic)"	""	"speech delay (HP:0000750)"	""	""	""	""	""	""	""	""	""	"Intellectual disability"	""
"0000117101"	"00138"	"00144324"	"02342"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000173930"	"05597"	"00231539"	"00006"	"Unknown"	""	"syndromic"	""	""	""	""	""	""	""	""	""	"46,XY disorder of sex development"	""
"0000185580"	"05162"	"00245648"	"00006"	"Isolated (sporadic)"	"16y"	"see paper; …; square face, flat face; no sparse hair (-HP:0008070); no prominent forehead (-HP:0011220); no thick eyebrows (-HP:0000574); telecanthi; downslanted palpebral fissures; short palpebral fissures; no ptosis, no blepharophimosis; long eyelashes; no squint; no depressed nasal bridge; no depressed nasal ridge; narrow nasal bridge; no short nose; no short columella; no alae lower inserted than columella; no anteverted nares; underdeveloped alae nasi; no full cheeks; short philtrum; no everted vermilion upper lip; thin vermilion upper lip; high palate; missing teeth; no micrognathia/retrognathia; no short-set/low-set ears; no protruding ears (upper part); no prominent inferior crus of antihelix; no overfolded helix ears; no absent earlobe; no clinodactyly fifth finger; no sandal gap; no cutaneous partial toe syndactyly; no overlapping toes; no fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185581"	"05162"	"00245649"	"00006"	"Isolated (sporadic)"	"18y"	"see paper; …; square face; no sparse hair (-HP:0008070); prominent forehead (HP:0011220); no thick eyebrows (-HP:0000574); no telecanthi, no epicanthi; no up/downslanted palpebral fissures; short palpebral fissures; no ptosis, no blepharophimosis; no long eyelashes; no squint; no depressed nasal bridge; no depressed nasal ridge; narrow nasal bridge; no short nose; no short columella; no alae lower inserted than columella; no anteverted nares; underdeveloped alae nasi; no full cheeks; short philtrum; no everted vermilion upper lip; thin vermilion upper lip; no high palate; no missing teeth; no micrognathia/retrognathia; no short-set/low-set ears; no protruding ears (upper part); no prominent inferior crus of antihelix; no overfolded helix ears; no absent earlobe; no clinodactyly fifth finger; no sandal gap; no cutaneous partial toe syndactyly; no overlapping toes; no fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185582"	"05162"	"00245650"	"00006"	"Isolated (sporadic)"	"18y"	"see paper; …; no square face, no flat face; no sparse hair (-HP:0008070); prominent forehead (HP:0011220); thick eyebrows (HP:0000574); no telecanthi, no epicanthi; upslanted palpebral fissures; no short palpebral fissures; no ptosis, no blepharophimosis; long eyelashes; squint; no depressed nasal bridge; no depressed nasal ridge; narrow nasal bridge; no short nose; no short columella; no alae lower inserted than columella; no anteverted nares; underdeveloped alae nasi; no full cheeks; short philtrum; no everted vermilion upper lip; no thin vermilion upper lip; no missing teeth; no micrognathia/retrognathia; no short-set/low-set ears; protruding ears (upper part); no prominent inferior crus of antihelix; no overfolded helix ears; no absent earlobe; no clinodactyly fifth finger; no sandal gap; no cutaneous partial toe syndactyly; no overlapping toes; no fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185583"	"05162"	"00245651"	"00006"	"Isolated (sporadic)"	"4y"	"see paper; …; no square face, no flat face; sparse hair (HP:0008070); prominent forehead (HP:0011220); no thick eyebrows (-HP:0000574); telecanthi; upslanted palpebral fissures; short palpebral fissures; ptosis, blepharophimosis; no long eyelashes; squint; depressed nasal bridge; depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; anteverted nares; no underdeveloped alae nasi; full cheeks; long philtrum; everted vermilion upper lip; no thin vermilion upper lip; no missing teeth; micrognathia/retrognathia; short-set ears, low-set ears; protruding ears (upper part); prominent inferior crus of antihelix; overfolded helix ears; absent earlobe; no clinodactyly fifth finger; no sandal gap; cutaneous partial toe syndactyly; overlapping toes; fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185584"	"05162"	"00245652"	"00006"	"Isolated (sporadic)"	"57y"	"see paper; …; no square face, no flat face; no sparse hair (-HP:0008070); no prominent forehead (-HP:0011220); no thick eyebrows (-HP:0000574); no telecanthi, no epicanthi; upslanted palpebral fissures; no short palpebral fissures; no ptosis, no blepharophimosis; no long eyelashes; no squint; no depressed nasal bridge; no depressed nasal ridge; narrow nasal bridge; no short nose; no short columella; no alae lower inserted than columella; no anteverted nares; no underdeveloped alae nasi; no full cheeks; long philtrum; no everted vermilion upper lip; thin vermilion upper lip; no high palate; no missing teeth; no micrognathia/retrognathia; no short-set/low-set ears; no protruding ears (upper part); prominent inferior crus of antihelix; no overfolded helix ears; no absent earlobe; no clinodactyly fifth finger; sandal gap; no cutaneous partial toe syndactyly; no overlapping toes; fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185585"	"05162"	"00245653"	"00006"	"Isolated (sporadic)"	"2y"	"see paper; …; square face, flat face; sparse hair (HP:0008070); prominent forehead (HP:0011220); no thick eyebrows (-HP:0000574); telecanthi; upslanted palpebral fissures; short palpebral fissures; ptosis, blepharophimosis; no long eyelashes; squint; depressed nasal bridge; depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; anteverted nares; no underdeveloped alae nasi; full cheeks; long/deep philtrum; everted vermilion upper lip; no thin vermilion upper lip; high palate; micrognathia/retrognathia; low-set ears; protruding ears (upper part); prominent inferior crus of antihelix; overfolded helix ears; absent earlobe; clinodactyly fifth finger; no sandal gap; cutaneous partial toe syndactyly; no overlapping toes; fibular deviation distal halluces; broad halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185586"	"05162"	"00245654"	"00006"	"Isolated (sporadic)"	"4y"	"see paper; …; square face, flat face; no sparse hair (-HP:0008070); prominent forehead (HP:0011220); thick eyebrows (HP:0000574); telecanthi; no up/downslanted palpebral fissures; short palpebral fissures; blepharophimosis; long eyelashes; squint; no depressed nasal bridge; no depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; no anteverted nares; no underdeveloped alae nasi; full cheeks; no philtrum short (s)/long (l)/deep (d); no everted vermilion upper lip; thin vermilion upper lip; high palate; no missing teeth; no micrognathia/retrognathia; short-set ears, low-set ears; no protruding ears (upper part); prominent inferior crus of antihelix; overfolded helix ears; absent earlobe; clinodactyly fifth finger; no sandal gap; no cutaneous partial toe syndactyly; no overlapping toes; no fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185587"	"05162"	"00245655"	"00006"	"Isolated (sporadic)"	"1y"	"see paper; …; square face; sparse hair (HP:0008070); prominent forehead (HP:0011220); no thick eyebrows (-HP:0000574); telecanthi; upslanted palpebral fissures; short palpebral fissures; ptosis, blepharophimosis; no long eyelashes; squint; depressed nasal bridge; depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; anteverted nares; no underdeveloped alae nasi; full cheeks; long philtrum; no everted vermilion upper lip; thin vermilion upper lip; high palate; no missing teeth; micrognathia/retrognathia; low-set ears; protruding ears (upper part); prominent inferior crus of antihelix; overfolded helix ears; absent earlobe; no clinodactyly fifth finger; sandal gap; no cutaneous partial toe syndactyly; overlapping toes; fibular deviation distal halluces; broad halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185588"	"05162"	"00245656"	"00006"	"Isolated (sporadic)"	"8y"	"see paper; …; flat face; no sparse hair (-HP:0008070); no prominent forehead (-HP:0011220); thick eyebrows (HP:0000574); epicanthi; no up/downslanted palpebral fissures; no short palpebral fissures; no ptosis, no blepharophimosis; long eyelashes; no squint; depressed nasal bridge; depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; anteverted nares; no underdeveloped alae nasi; no full cheeks; long philtrum; everted vermilion upper lip; no thin vermilion upper lip; high palate; no missing teeth; micrognathia/retrognathia; no short-set/low-set ears; no protruding ears (upper part); no prominent inferior crus of antihelix; no overfolded helix ears; no absent earlobe; no clinodactyly fifth finger; sandal gap; no cutaneous partial toe syndactyly; no overlapping toes; no fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185589"	"05162"	"00245657"	"00006"	"Isolated (sporadic)"	"5y"	"see paper; …; square face; sparse hair (HP:0008070); prominent forehead (HP:0011220); no thick eyebrows (-HP:0000574); telecanthi, epicanthi; upslanted palpebral fissures; short palpebral fissures; ptosis, blepharophimosis; no long eyelashes; squint; depressed nasal bridge; depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; anteverted nares; no underdeveloped alae nasi; full cheeks; long philtrum; no everted vermilion upper lip; thin vermilion upper lip; high palate; no missing teeth; micrognathia/retrognathia; low-set ears; protruding ears (upper part); no prominent inferior crus of antihelix; overfolded helix ears; no absent earlobe; clinodactyly fifth finger; no sandal gap; cutaneous partial toe syndactyly; no overlapping toes; fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185590"	"05162"	"00245658"	"00006"	"Isolated (sporadic)"	"9y"	"see paper; …; no square face, no flat face; no sparse hair (-HP:0008070); prominent forehead (HP:0011220); no thick eyebrows (-HP:0000574); telecanthi; upslanted palpebral fissures; short palpebral fissures; ptosis, blepharophimosis; no long eyelashes; squint; depressed nasal bridge; depressed nasal ridge; no narrow nasal bridge; short nose; short columella; alae lower inserted than columella; anteverted nares; no underdeveloped alae nasi; full cheeks; long/deep philtrum; everted vermilion upper lip; no thin vermilion upper lip; no high palate; no missing teeth; micrognathia/retrognathia; no short-set/low-set ears; protruding ears (upper part); no prominent inferior crus of antihelix; no overfolded helix ears; no absent earlobe; no sandal gap; no cutaneous partial toe syndactyly; overlapping toes; fibular deviation distal halluces; no broad/narrow halluces"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185593"	"05162"	"00245661"	"00006"	"Isolated (sporadic)"	"8y"	"no flat face, no square face; telecanthi; no up/downslanted palpebral fissures; no short palpebral fissures; no ptosis; no squint; no depressed nasal ridge; no short nose; no broad nasal tip; no short columella; no anteverted nares; no full cheeks; no short/long/deep philtrum; no everted vermilion upper lip; thin vermilion upper lip; high palate; micrognathia/retrognathia; low‐set ears; protruding ears (upper part); no cupped ear; overfolded helix; ulnar deviation finger(s); no clinodactyly fifth finger; no prominent fetal tip pads; sandal gap; no cutaneous partial syndactyly toes; fibular deviation distal phalanx halluces; no broad halluces, no narrow halluces; no prenatal growth retardation; postnatal growth retardation; microcephaly (OFC <3rd centile); hypertrichosis; no highly arched eyebrows; long eyelashes; no down‐slanted palpebral fissures; epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; high palate; micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; moderate intellectual disability; no epilepsy; autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; obesity; frontal upsweep of hair, long eyelashes, broad eyebrows"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185594"	"05162"	"00245662"	"00006"	"Isolated (sporadic)"	"1y6m"	"square face; epicanthi; upslanted palpebral fissures; no ptosis; no squint; depressed nasal ridge; short nose; no broad nasal tip; short columella; anteverted nares; full cheeks; long philtrum; no everted vermilion upper lip; thin vermilion upper lip; no high palate; no micrognathia, no retrognathia; low‐set ears, short-set ears; no protruding ears (upper part); no cupped ear; overfolded helix; no ulnar deviation finger(s); no clinodactyly fifth finger; prominent fetal tip pads; sandal gap; no cutaneous partial syndactyly toes; −; no broad halluces, no narrow halluces; no prenatal growth retardation; no postnatal growth retardation; no microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; no micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; ?broad halluces;; no epilepsy; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity; deep‐set eyes"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185595"	"05162"	"00245663"	"00006"	"Isolated (sporadic)"	"10y"	"downslanted palpebral fissures; no short palpebral fissures; no ptosis; squint; no depressed nasal ridge; no short nose; broad nasal tip; no short columella; no anteverted nares; no full cheeks; no short/long/deep philtrum; no everted vermilion upper lip; no thin vermilion upper lip; high palate; micrognathia/retrognathia; low‐set ears; protruding ears (upper part); no cupped ear; no overfolded helix;; no sandal gap; no cutaneous partial syndactyly toes; fibular deviation distal phalanx halluces; ?broad halluces; no prenatal growth retardation; no postnatal growth retardation; no microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; long eyelashes; down‐slanted palpebral fissures; no epicanthi; convex nasal ridge; low hanging columella; no grimacing smile; no high palate; micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; ?broad halluces; apparent intellectual disability/develop delay; severe intellectual disability; ?epilepsy; autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity; long eyelashes, extra incisor, cryptorchidism, megalocornea low hanging columella, convex nasal ridge"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185596"	"05162"	"00245664"	"00006"	"Isolated (sporadic)"	"16y"	"no flat face, no square face; no epicanthi/no telecanthi; no up/downslanted palpebral fissures; no short palpebral fissures; no ptosis; no squint; no depressed nasal ridge; no short nose; no broad nasal tip; no short columella; no anteverted nares; no full cheeks; no short/long/deep philtrum; no everted vermilion upper lip; no thin vermilion upper lip; no high palate; no micrognathia, no retrognathia; no low‐set ears, no short-set ears; no protruding ears (upper part); no cupped ear; no overfolded helix; no ulnar deviation finger(s); no clinodactyly fifth finger; no prominent fetal tip pads; no sandal gap; no cutaneous partial syndactyly toes; no fibular deviation distal phalanx halluces; ?broad halluces; no prenatal growth retardation; postnatal growth retardation; microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; no micrognathia; no low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; severe intellectual disability; no epilepsy; autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity;"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185597"	"05162"	"00245665"	"00006"	"Isolated (sporadic)"	"5y"	"no flat face, no square face; epicanthi; downslanted palpebral fissures; no short palpebral fissures; no ptosis; squint; depressed nasal ridge; no short nose; no broad nasal tip; no short columella; no anteverted nares; no full cheeks; long philtrum; no everted vermilion upper lip; thin vermilion upper lip; no high palate; micrognathia/retrognathia; low‐set ears; protruding ears (upper part); cupped ear; no overfolded helix; no ulnar deviation finger(s); no clinodactyly fifth finger; no prominent fetal tip pads; no sandal gap;  cutaneous partial syndactyly toes 2 + 3, short toes; fibular deviation distal phalanx halluces; broad halluces; prenatal growth retardation; postnatal growth retardation; microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; down‐slanted palpebral fissures; epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; broad halluces; apparent intellectual disability/develop delay; severe intellectual disability; epilepsy; autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity; frontal upsweep of hair, dolichocephaly, cryptorchidism"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185598"	"05162"	"00245666"	"00006"	"Isolated (sporadic)"	"24y"	"no flat face, no square face; no epicanthi/no telecanthi; upslanted palpebral fissures; no short palpebral fissures; no ptosis; squint; no depressed nasal ridge; no short nose; no broad nasal tip; no short columella; no anteverted nares; no full cheeks; short philtrum; everted vermilion upper lip; no thin vermilion upper lip; micrognathia/retrognathia; no low‐set ears, no short-set ears; no protruding ears (upper part); no cupped ear; no overfolded helix; ulnar deviation finger(s); clinodactyly fifth finger; no prominent fetal tip pads; sandal gap; no cutaneous partial syndactyly toes 2 + 3 + 4 + 5; fibular deviation distal phalanx halluces; narrow halluces; no prenatal growth retardation; postnatal growth retardation; microcephaly (OFC <3rd centile); hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; low hanging columella; no grimacing smile; micrognathia; no low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; severe intellectual disability; no epilepsy; autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; scoliosis; no obesity; deep‐set eyes, low hanging columella, unerupted teeth"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185599"	"05162"	"00245667"	"00006"	"Isolated (sporadic)"	"10y"	"no flat face, no square face; telecanthi; no up/downslanted palpebral fissures; no short palpebral fissures; no ptosis; squint; no depressed nasal ridge; no short nose; no broad nasal tip; no short columella; no anteverted nares; full cheeks; no short/long/deep philtrum; everted vermilion upper lip; no thin vermilion upper lip; no high palate; micrognathia/retrognathia; low‐set ears; protruding ears (upper part); cupped ear; overfolded helix; no ulnar deviation finger(s); clinodactyly fifth finger; no prominent fetal tip pads; sandal gap; no cutaneous partial syndactyly toes; no fibular deviation distal phalanx halluces; narrow halluces; no prenatal growth retardation; no postnatal growth retardation; no microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; no micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; mild intellectual disability; no epilepsy; no autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity;"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185600"	"05162"	"00245668"	"00006"	"Isolated (sporadic)"	"6y"	"square face; telecanthi; no up/downslanted palpebral fissures; short palpebral fissures; ptosis; no squint; no depressed nasal ridge; short nose; broad nasal tip; no short columella; anteverted nares; no full cheeks; deep philtrum; everted vermilion upper lip; no thin vermilion upper lip; no high palate; micrognathia/retrognathia; no low‐set ears, no short-set ears; no protruding ears (upper part); no cupped ear; no overfolded helix; no ulnar deviation finger(s); no clinodactyly fifth finger; no prominent fetal tip pads; sandal gap; no cutaneous partial syndactyly toes; fibular deviation distal phalanx halluces; no broad halluces, no narrow halluces; no prenatal growth retardation; no postnatal growth retardation; microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; no micrognathia; no low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; severe intellectual disability; epilepsy; no cardiovascular anomalies; urinary tract anomalies; no scoliosis; no obesity; tapering fingers"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185601"	"05162"	"00245669"	"00006"	"Isolated (sporadic)"	"4y"	"flat face, square face; telecanthi; upslanted palpebral fissures; short palpebral fissures; ptosis; squint; depressed nasal ridge; short nose; no broad nasal tip; short columella; anteverted nares; no full cheeks; long philtrum, deep philtrum; everted vermilion upper lip; no thin vermilion upper lip; high palate; no micrognathia, no retrognathia; low‐set ears; protruding ears (upper part); no cupped ear; no overfolded helix; no ulnar deviation finger(s); clinodactyly fifth finger; no prominent fetal tip pads; no sandal gap; cutaneous partial syndactyly toes 4 + 5; fibular deviation distal phalanx halluces; no broad halluces, no narrow halluces; no prenatal growth retardation; postnatal growth retardation; microcephaly (OFC <3rd centile); no hypertrichosis; highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; high palate; no micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; severe intellectual disability; no epilepsy; autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity; broad eyebrows"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185602"	"05162"	"00245670"	"00006"	"Isolated (sporadic)"	"10m"	"flat face; telecanthi; upslanted palpebral fissures; short palpebral fissures; ptosis; no squint; depressed nasal ridge; short nose; broad nasal tip; short columella; anteverted nares; full cheeks; long philtrum, deep philtrum; no everted vermilion upper lip; no thin vermilion upper lip; no high palate; micrognathia/retrognathia; low‐set ears, short-set ears; protruding ears (upper part); no cupped ear; overfolded helix; no ulnar deviation finger(s); no clinodactyly fifth finger; no prominent fetal tip pads; no sandal gap; no cutaneous partial syndactyly toes; fibular deviation distal phalanx halluces; no broad halluces, no narrow halluces; prenatal growth retardation; no postnatal growth retardation; microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; no micrognathia; low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces;; no epilepsy; no autism/autism‐like behavior; no cardiovascular anomalies; no urinary tract anomalies; no scoliosis; no obesity; camptodactyly"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000185603"	"05162"	"00245671"	"00006"	"Isolated (sporadic)"	"7y"	"flat face; telecanthi; upslanted palpebral fissures; short palpebral fissures; no ptosis; squint; depressed nasal ridge; short nose; broad nasal tip; short columella; anteverted nares; no full cheeks; long philtrum; no everted vermilion upper lip; no thin vermilion upper lip; no high palate; no micrognathia, no retrognathia; short‐set ears; protruding ears (upper part); cupped ear; no overfolded helix; ulnar deviation finger(s); no clinodactyly fifth finger; prominent fetal tip pads; no sandal gap; no cutaneous partial syndactyly toes; fibular deviation distal phalanx halluces; narrow halluces; no prenatal growth retardation; no postnatal growth retardation; no microcephaly (OFC <3rd centile); no hypertrichosis; no highly arched eyebrows; no long eyelashes; no down‐slanted palpebral fissures; no epicanthi; no convex nasal ridge; no low hanging columella; no grimacing smile; no high palate; no micrognathia; no low‐set ears; no broad thumbs; no angulated thumbs; no broad halluces; apparent intellectual disability/develop delay; moderate intellectual disability; no epilepsy; no autism/autism‐like behavior; cardiovascular anomalies; no urinary tract anomalies; scoliosis; no obesity; tapering fingers, overlapping toes, anteriorly implanted hallux, pointy canine teeth, absent lobe ear"	""	""	""	""	""	""	""	""	"MKHK-1"	"developmental delay"	""
"0000223207"	"00198"	"00295643"	"01164"	"Unknown"	""	"Seizures (HP:0001250); Abnormality of the eyelid (HP:0000492); Broad thumb (HP:0011304); Global developmental delay (HP:0001263)"	""	""	""	""	""	""	""	""	""	""	""
"0000230064"	"05521"	"00302981"	"00006"	"Isolated (sporadic)"	""	"Focal epilepsy, Rolandic; age onset childhood"	""	""	""	""	""	""	""	""	""	"seizures"	""
"0000232041"	"00714"	"00306193"	"03695"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000233061"	"01544"	"00307257"	"03753"	"Unknown"	""	"Unilateral"	""	"00y22m"	"HP:0000486"	""	""	""	""	""	""	""	""
"0000233063"	"01544"	"00307259"	"03753"	"Unknown"	""	"Unilateral"	""	"00y07m"	"HP:0000486"	""	""	""	""	""	""	""	""
"0000233361"	"00139"	"00307938"	"00006"	"Isolated (sporadic)"	"2y2m"	"see paper; ..., Global developmental delay; Cleft palate, Recurrent aspiration pneumonia, Hypertelorism, Triphalangeal thumb, Prominent fingertip pads"	""	""	""	""	""	""	""	""	""	"intellectual diability"	""
"0000233362"	"00139"	"00307939"	"00006"	"Isolated (sporadic)"	"5y"	"see paper; ..., Global developmental delay, Hirsutism, Abnormality of the Pinna, Overlapping toes, Abnormality of the columella, Brain atrophy"	""	""	""	""	""	""	""	""	""	"intellectual diability"	""
"0000238743"	"00198"	"00314991"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	"chromatinopathy"	""
"0000238744"	"00198"	"00314992"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	"chromatinopathy"	""
"0000238745"	"00198"	"00314993"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	"chromatinopathy"	""
"0000238746"	"00198"	"00314994"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	"chromatinopathy"	""
"0000238747"	"00198"	"00314995"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	"chromatinopathy"	""
"0000238748"	"00198"	"00314996"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"chromatinopathy"	""
"0000238749"	"00198"	"00314997"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	"chromatinopathy"	""
"0000249576"	"05517"	"00331384"	"00000"	"Familial, autosomal dominant"	""	"Cryptorchidism, Elbow flexion contracture, Global developmental delay, Hirsutism, Under No"	""	""	""	""	""	""	""	""	"Rachydactylies (with extraskeletal manifestations)"	"skeletal dysplasia"	""
"0000249577"	"05517"	"00331385"	"00000"	"Familial, autosomal dominant"	""	"Intellectual disability, Severe short stature"	""	""	""	""	""	""	""	""	"Rachydactylies (with extraskeletal manifestations)"	"skeletal dysplasia"	""
"0000249578"	"05517"	"00331386"	"00000"	"Familial, autosomal dominant"	""	"Intellectual disability, Severe short stature, Abnormal facial shape"	""	""	""	""	""	""	""	""	"Rachydactylies (with extraskeletal manifestations)"	"skeletal dysplasia"	""
"0000256903"	"00139"	"00361498"	"00006"	"Isolated (sporadic)"	"8y"	"syndromic; intellectual disability with dysmorphism"	""	""	""	""	""	""	""	""	""	"intellectual disability"	""
"0000257066"	"00139"	"00361661"	"00006"	"Unknown"	"13y"	"syndromic; intellectual disability, short stature, dysmorphism"	""	""	""	""	""	""	""	""	""	"intellectual disability"	""
"0000257068"	"00139"	"00361663"	"00006"	"Isolated (sporadic)"	"6y2m"	"syndromic; intellectual disability and dysmorphism"	""	""	""	""	""	""	""	""	""	"intellectual disability"	""
"0000269340"	"00198"	"00374129"	"00006"	"Unknown"	"<0d"	"30w-fetus, ultrasound intrauterine growth retardation, diaphragmatic hernia, bilateral pyelectasis, corpus callosum hypoplasia; autopsy intrauterine growth retardation, diaphragmatic hernia, facial dysmorphism, superior short oral frenula, bilateral clino/camptodactyly fingers II and V, bilateral simian crease, diaphragmatic hernia, glabber agenesis, four accessory spleens, short corpus callosum"	""	""	""	""	""	""	""	""	""	"multiple congenital abnormalities"	""
"0000290779"	"05621"	"00397652"	"01164"	"Unknown"	"08y"	"Mild global developmental delay, Specific learning disability, Protruding ea"	""	""	""	""	""	""	""	""	""	""	""
"0000318983"	"00198"	"00428037"	"00006"	"Familial, autosomal dominant"	"4m"	""	""	""	""	""	""	""	""	""	""	""	""
"0000319106"	"00714"	"00428194"	"01164"	"Unknown"	"02y"	"Global developmental delay, Autistic behavior, Unilateral renal agenesis, Esophageal atresia, Sleep disturbance, Impaired social interactions, Constipation, Hyperactivity, Delayed speech and language development, high forehead, backward rotated ears, corners of the mouth turned downwards"	""	""	""	""	""	""	""	""	""	""	""
"0000322431"	"05621"	"00431863"	"01164"	"Unknown"	"02y"	"Delayed speech and language development, Global developmental delay, Motor delay, Delayed social development, Hypotonia"	""	""	""	""	""	""	""	""	""	""	""
"0000324099"	"05621"	"00433676"	"03544"	"Familial, autosomal dominant"	""	"autism, hyperactivity, motor delay, aggressive behaviour, facial abnormality"	""	""	""	""	""	""	""	""	""	""	""
"0000324589"	"00198"	"00434231"	"00006"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"RSTS1"	"microphthalmia, anophthalmia, coloboma"	""
"0000325451"	"00103"	"00435255"	"01164"	"Unknown"	"13y"	"Intellectual disability, Autistic behavior, Motor tics, Short stature, Neurodevelopmental delay, Tip-toe gait, 2-3 toe syndactyly, Abnormality of the face, Pes planus; mother and 3 brothers with syndactyly II and III bilateral"	""	""	""	""	""	""	""	""	""	""	""
"0000326327"	"00714"	"00436143"	"01164"	"Isolated (sporadic)"	"07y"	"Premature birth, Small for gestational age, Bilateral sensorineural hearing impairment, Microcephaly, Neurodevelopmental delay, Intellectual disability, Delayed speech and language development, Generalized-onset seizure"	""	""	""	""	""	""	""	""	""	""	""
"0000326549"	"04281"	"00436370"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	"CDLS3"	"xeroderma pigmentosa"	""
"0000330306"	"00198"	"00440396"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome-1 (MIM #180849)"	""	""
"0000337546"	"00714"	"00448355"	"01164"	"Unknown"	"23+3"	"Abnormality of prenatal development or birth, Short fetal femur length, Short fetal humerus length, Polyhydramnios, Single umbilical artery, Malposition of the stomach, Dextrocardia"	""	""	""	""	""	""	""	""	""	""	""
"0000338971"	"00139"	"00449824"	"03544"	"Isolated (sporadic)"	""	"HP:0001249, HP:0007018, HP:0000252, HP:0000098, HP:0011098"	""	""	""	""	""	""	""	""	"MKHK1"	"intellectual disability"	""
"0000340339"	"05619"	"00451679"	"00006"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"RSTS"	"Rubinstein-Taybi syndrome"	""
"0000346195"	"05619"	"00457746"	"03544"	"Isolated (sporadic)"	""	"HP:0001249, HP:0000271, HP:0011304"	""	""	""	""	""	""	""	""	"RSTS1"	""	""
"0000346196"	"00198"	"00457747"	"03544"	"Isolated (sporadic)"	""	"HP:0001627, HP:0002650, HP:0001763, HP:0001250, HP:0010864, HP:0001344, HP:0004322, HP:0000252, HP:0000271"	""	""	""	""	""	""	""	""	"MKHK1"	"complex neurodevelopmental disorder"	""
"0000346360"	"05611"	"00457910"	"03544"	"Isolated (sporadic)"	""	"HP:0001249, HP:0000750, HP:0001252, HP:0031936, HP:0001999, HP:0007687, HP:0000286, HP:0000494, HP:0000319, HP:0000414"	""	""	""	""	""	""	""	""	"RSTS1"	"complex neurodevelopmental disorder"	""
"0000350136"	"05619"	"00464074"	"00006"	"Unknown"	"0y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350137"	"05619"	"00464075"	"00006"	"Unknown"	"1y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350138"	"05619"	"00464076"	"00006"	"Unknown"	"5.4y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350139"	"05619"	"00464077"	"00006"	"Unknown"	"0y"	"microcephaly, columella below alae nasi, broad thumbs/halluces; prominent forehead, low-set ears, microstomia, short neck, gastroesophageal reflux, diaphragmatic hernia"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350140"	"05619"	"00464078"	"00006"	"Unknown"	"3.5y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350141"	"05619"	"00464079"	"00006"	"Unknown"	"1.4y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350142"	"05619"	"00464080"	"00006"	"Unknown"	"6.6y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350143"	"05619"	"00464081"	"00006"	"Unknown"	"1y"	"microcephaly, downslanted palpebral fissures, convex nasal ridge, highly arched palate, broad thumbs/halluces, mild intellectual disability; facial hemangioma, microstomia, brachydactyly, thin lips"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350144"	"05619"	"00464082"	"00006"	"Unknown"	"3.4y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350145"	"05619"	"00464083"	"00006"	"Unknown"	"4.8y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350146"	"05619"	"00464084"	"00006"	"Unknown"	"1.3y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350147"	"05619"	"00464085"	"00006"	"Unknown"	"2.8y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350148"	"05619"	"00464086"	"00006"	"Unknown"	"11.3y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350149"	"05619"	"00464087"	"00006"	"Unknown"	"1.2y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350150"	"05619"	"00464088"	"00006"	"Unknown"	"1.5y"	"columella below alae nasi, highly arched palate, broad distal phalanx fingers/toes, intellectual disability; hypertrichosis; strabismus, low-set displastic ears, short neck, urinary tract anomalies (congenital megaureter, renal diverticulum)"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350151"	"05619"	"00464089"	"00006"	"Unknown"	"4.1y"	"downslanted palpebral fissures, broad thumbs/halluces, intellectual disability, postnatal growth retardation; ptosis, brachidactyly, deformed thorax, urinary tract anomalies (congenital megaureter, non-functional right kidney)"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350152"	"05619"	"00464090"	"00006"	"Unknown"	"12.3y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350153"	"05619"	"00464091"	"00006"	"Unknown"	"1.6y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350154"	"05619"	"00464092"	"00006"	"Unknown"	"2.3y"	"downslanted palpebral fissures, convex nasal ridge; strabismus, low-set ears"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350155"	"05619"	"00464093"	"00006"	"Isolated (sporadic)"	"1.9y"	"downslanted palpebral fissures, broad thumbs/halluces, intellectual disability, postnatal growth retardation"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350156"	"05619"	"00464094"	"00006"	"Unknown"	"0.8y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350157"	"05619"	"00464095"	"00006"	"Unknown"	"1.4y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350158"	"05619"	"00464096"	"00006"	"Unknown"	"1.7y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350159"	"05619"	"00464097"	"00006"	"Unknown"	"0.9y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350160"	"05619"	"00464098"	"00006"	"Unknown"	"4.3y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350161"	"05619"	"00464099"	"00006"	"Unknown"	"1.8y"	"columella below alae nasi, highly arched palate, broad thumbs/halluces, intellectual disability, postnatal growth retardation; hypertrichosis; flat forehead, short neck"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350162"	"05619"	"00464100"	"00006"	"Unknown"	"6.7y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350163"	"05619"	"00464101"	"00006"	"Unknown"	"1.5y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350164"	"05619"	"00464102"	"00006"	"Unknown"	"7.4y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, convex nasal ridge, columella below alae nasi, highly arched palate, broad thumbs/halluces, intellectual disability, postnatal growth retardation; strabismus, long eyelashes, supernumerary tooth, low anterior hairline"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350165"	"05619"	"00464103"	"00006"	"Unknown"	"1.2y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350166"	"05619"	"00464104"	"00006"	"Unknown"	"4.7y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350167"	"05619"	"00464105"	"00006"	"Isolated (sporadic)"	"0.9y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, convex nasal ridge, columella below alae nasi, highly arched palate, broad thumbs/halluces, intellectual disability, postnatal growth retardation; dacryocystitis, facial hemangioma, brachidactyly"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350168"	"05619"	"00464106"	"00006"	"Unknown"	"10.1y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350169"	"05619"	"00464107"	"00006"	"Unknown"	"4.2y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, convex nasal ridge, highly arched palate, typical smile, broad angulated thumbs, broad halluces, intellectual disability, postnatal growth retardation; strabismis, cryptorchidism"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350170"	"05619"	"00464108"	"00006"	"Isolated (sporadic)"	"1.1y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350171"	"05619"	"00464109"	"00006"	"Unknown"	""	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350172"	"05619"	"00464110"	"00006"	"Unknown"	"0.9y"	"microcephaly, highly arched eyebrow, columella below alae nasi, broad thumbs, halluces and distal phalanx of other fingers, intellectual disability, postnatal growth retardation; strabismus, hypermetropia, epicanthal folds thin lips, long philtrum, low-set ears, 2-3-4-5 finger cutaneous syndactyly, 1-2-3 toe syndactyly, short thorax, cardiovascular anomalies (bicuspid aortic valve, mild aortic valve stenosis)"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350173"	"05619"	"00464111"	"00006"	"Unknown"	"6.2y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, columella below alae nasi, highly arched palate, broad thumbs/halluces/distal phalanx other fingers, intellectual disability, postnatal growth retardation; synophrys, overhanging nasal tip, long eyelashes, strabismus, epicanthal folds, dysplastic ears, auricular pit, short neck, scoliosis, cryptorchidism"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350174"	"05619"	"00464112"	"00006"	"Unknown"	"0.2y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350175"	"05619"	"00464113"	"00006"	"Unknown"	""	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350176"	"05619"	"00464114"	"00006"	"Unknown"	"0.2y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350177"	"05619"	"00464115"	"00006"	"Unknown"	"0.7y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350178"	"05619"	"00464116"	"00006"	"Unknown"	"12.5y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350179"	"05619"	"00464117"	"00006"	"Unknown"	"2y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350180"	"05619"	"00464118"	"00006"	"Unknown"	"0.1y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350181"	"05619"	"00464119"	"00006"	"Unknown"	"0.1y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350182"	"05619"	"00464120"	"00006"	"Unknown"	"10.1y"	"microcephaly, highly arched eyebrow, columella below alae nasi, mild intellectual disability, postnatal growth retardation; hypertrichosis; obesity, absent speech, strabismus, epicanthal folds, low anterior hairline, overhanging nasal tip, cryptorchidism"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350183"	"05619"	"00464121"	"00006"	"Unknown"	"1.2y"	"downslanted palpebral fissures, highly arched eyebrow, broad thumbs/halluces/distal phalanx other fingers, intellectual disability, postnatal growth retardation; hypertrichosis shoulders; long philtrum, low- set dysplastic ears, short neck, low anterior hairline"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350184"	"05619"	"00464122"	"00006"	"Unknown"	"0.5y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, convex nasal ridge, columella below alae nasi, highly arched palate, broad thumbs/halluces, intellectual disability, postnatal growth retardation; hypertrichosis; cryptorchidism, caliectasis, low anterior hairline, strabismus, epicanthal folds"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350185"	"05619"	"00464123"	"00006"	"Unknown"	"1.2y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, broad thumbs/halluces, intellectual disability, postnatal growth retardation; low-set ears, short nose with overhanging nasal tip, duplicated tongue tip, inguinal hernia"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350186"	"05619"	"00464124"	"00006"	"Unknown"	"2y"	"downslanted palpebral fissures, highly arched palate, broad thumbs, duplicated halluces, intellectual disability, postnatal growth retardation; neck pterygium, hypoplastic teeth"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350187"	"05619"	"00464125"	"00006"	"Unknown"	"3.6y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350188"	"05619"	"00464126"	"00006"	"Unknown"	"4.4y"	"downslanted palpebral fissures, convex nasal ridge, columella below alae nasi, broad thumbs/halluces, intellectual disability, postnatal growth retardation; hypertrichosis; epicanthal folds, cryptorchidism"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350189"	"05619"	"00464127"	"00006"	"Unknown"	""	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350190"	"05619"	"00464128"	"00006"	"Unknown"	"1.2y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, columella below alae nasi, broad thumbs/halluces, intellectual disability, postnatal growth retardation; obesity, hypotonia"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350191"	"05619"	"00464129"	"00006"	"Unknown"	"9.6y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350192"	"05619"	"00464130"	"00006"	"Isolated (sporadic)"	"6.6y"	"highly arched palate, broad thumbs/halluces, intellectual disability; hypertrichosis; hypotonia, conductive deafness, left ear canal atresia, narrow forehead, gastroesophageal reflux, diaphragmatic hernia, constipation"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350193"	"05619"	"00464131"	"00006"	"Unknown"	"2.8y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350194"	"05619"	"00464132"	"00006"	"Unknown"	"14y"	"microcephaly, downslanted palpebral fissures, highly arched eyebrow, columella below alae nasi, broad thumbs/halluces, intellectual disability, postnatal growth retardation; hypertrichosis; obesity, scoliosis, strabismus, epicanthal folds, hypermetropia, low anterior hairline"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350195"	"05619"	"00464133"	"00006"	"Unknown"	"7y"	"microcephaly, convex nasal ridge, downslanted palpebral fissures, intellectual disability, postnatal growth retardation; hypertrichosis; normal thumbs and halluces, brachydactyly, cutaneous syndactyly of the 2nd and 3rd toes"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350196"	"05619"	"00464134"	"00006"	"Unknown"	"4y"	"broad thumbs/halluces, narrow palate, convex nasal ridge; intellectual disability, postnatal growth retardation; hypertrichosis; mild upslanted palpebral fissures, long eyelashes, ptosis, micrognathia, 2-3 toes cutaneous syndactyly, postaxial polydactyly of the left hand, atresia of the nasolacrimal duct, inguinal and umbilical hernia"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350197"	"05619"	"00464135"	"00006"	"Unknown"	"3.2y"	"syndromic neurodevelopmental disorder, query rubinstein-taybi syndrome"	""	""	""	""	""	""	""	""	"RSTS1"	"Rubinstein-Taybi syndrome"	""
"0000350203"	"05619"	"00464141"	"00006"	"Unknown"	"0.8y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	""
"0000350204"	"05619"	"00464142"	"00006"	"Unknown"	"5.5y"	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	""
"0000350205"	"05619"	"00464143"	"00006"	"Unknown"	""	"Rubinstein-Taybi syndrome"	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	""
"0000350206"	"05619"	"00464144"	"00006"	"Unknown"	"6.5y"	"gait abnormality, phenotype of rsts"	""	""	""	""	""	""	""	""	""	"Rubinstein-Taybi syndrome"	""
"0000351462"	"00714"	"00466078"	"01164"	"Isolated (sporadic)"	"12y"	"Global developmental delay, Atypical behavior, Abnormality of the face, Clinodactyly, Sensorineural hearing impairment, Intellectual disability, Bicuspid aortic valve, Cryptorchidism"	""	""	""	""	""	""	""	""	""	""	""
"0000352914"	"05619"	"00467762"	"01164"	"Unknown"	"07y"	"Intellectual disability, Hypoplastic fifth toenail, Clinodactyly, Shortening of all distal phalanges of the fingers, Obesity, Neurodevelopmental abnormality, Arrhythmia, Abnormality of the face"	""	""	""	""	""	""	""	""	""	""	""
"0000353933"	"00198"	"00468780"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"multiple congenital anomalies"	""
"0000353934"	"00198"	"00468781"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"multiple congenital anomalies"	""
"0000353935"	"00198"	"00468782"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"multiple congenital anomalies"	""
"0000353936"	"00198"	"00468783"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"multiple congenital anomalies"	""
"0000353937"	"00198"	"00468784"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"abnormality of the nervous system"	""
"0000353938"	"00198"	"00468785"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"abnormality of the nervous system"	""


## Screenings ## Do not remove or alter this header ##
## Count = 347
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000000210"	"00000209"	"1"	"00037"	"00001"	"2012-09-13 12:09:36"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000050368"	"00050423"	"1"	"00006"	"00006"	"2015-09-27 16:16:40"	""	""	"SEQ;SEQ-NG-I"	"DNA"	""	""
"0000050611"	"00050666"	"1"	"00006"	"00006"	"2015-09-27 16:16:40"	""	""	"SEQ;SEQ-NG-I"	"DNA"	""	""
"0000080940"	"00080828"	"1"	"01758"	"00006"	"2016-09-07 13:24:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""
"0000081560"	"00081430"	"1"	"01783"	"01783"	"2016-10-13 16:42:00"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000081569"	"00081433"	"1"	"01783"	"01783"	"2016-10-14 03:42:49"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000081586"	"00081440"	"1"	"01783"	"01783"	"2016-10-14 04:25:37"	""	""	"SEQ-NG"	"DNA"	"blood"	""
"0000101837"	"00101390"	"1"	"01864"	"01864"	"2017-03-29 08:30:45"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000102533"	"00102082"	"1"	"01864"	"01864"	"2017-03-30 08:42:37"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000111197"	"00110731"	"1"	"01353"	"01353"	"2010-03-30 13:55:30"	"01353"	"2011-03-18 11:17:00"	"SEQ"	"DNA"	""	""
"0000111198"	"00110732"	"1"	"01353"	"01353"	"2010-03-30 13:49:49"	"01353"	"2011-03-18 11:17:22"	"SEQ"	"DNA"	""	""
"0000111199"	"00110733"	"1"	"01353"	"01353"	"2010-03-30 13:52:43"	"01353"	"2011-03-18 11:17:40"	"SEQ"	"DNA"	""	""
"0000111200"	"00110734"	"1"	"01353"	"01353"	"2010-04-14 16:01:21"	"01353"	"2011-03-18 10:48:30"	"SEQ"	"DNA"	""	""
"0000111201"	"00110735"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111202"	"00110736"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111203"	"00110737"	"1"	"01353"	"01353"	"2011-03-17 11:03:53"	""	""	"SEQ"	"DNA"	""	""
"0000111204"	"00110738"	"1"	"01353"	"01353"	"2010-03-30 14:07:02"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111205"	"00110739"	"1"	"01353"	"01353"	"2011-03-18 11:19:36"	""	""	"SEQ"	"DNA"	""	""
"0000111206"	"00110740"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111207"	"00110741"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111208"	"00110742"	"1"	"01353"	"01353"	"2011-03-17 11:09:17"	""	""	"SEQ"	"DNA"	""	""
"0000111209"	"00110743"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111210"	"00110744"	"1"	"01353"	"01353"	"2009-01-26 17:24:09"	"01353"	"2011-03-18 10:48:55"	"SEQ"	"DNA"	""	""
"0000111211"	"00110745"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111212"	"00110746"	"1"	"01353"	"01353"	"2011-03-17 11:30:16"	""	""	"SEQ"	"DNA"	""	""
"0000111213"	"00110747"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111214"	"00110748"	"1"	"01353"	"01353"	"2011-03-17 11:35:04"	""	""	"SEQ"	"DNA"	""	""
"0000111215"	"00110749"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111216"	"00110750"	"1"	"01353"	"01353"	"2011-03-17 11:41:43"	""	""	"SEQ"	"DNA"	""	""
"0000111217"	"00110751"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111218"	"00110752"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111219"	"00110753"	"1"	"01353"	"01353"	"2010-05-03 15:51:36"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111220"	"00110754"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111221"	"00110755"	"1"	"01353"	"01353"	"2008-10-21 15:09:01"	"01353"	"2011-03-18 10:50:29"	"SEQ"	"DNA"	""	""
"0000111222"	"00110756"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111223"	"00110757"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111224"	"00110758"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111225"	"00110759"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111226"	"00110760"	"1"	"01353"	"01353"	"2010-05-03 15:49:47"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111227"	"00110761"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111228"	"00110762"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111229"	"00110763"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111230"	"00110764"	"1"	"01353"	"01353"	"2008-10-21 15:19:05"	"01353"	"2011-03-18 10:50:54"	"SEQ"	"DNA"	""	""
"0000111231"	"00110765"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111232"	"00110766"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111233"	"00110767"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111234"	"00110768"	"1"	"01353"	"01353"	"2010-02-18 11:18:16"	"01353"	"2011-03-18 10:51:18"	"SEQ"	"DNA"	""	""
"0000111235"	"00110769"	"1"	"01353"	"01353"	"2008-10-21 16:40:20"	"01353"	"2011-03-18 10:51:50"	"SEQ"	"DNA"	""	""
"0000111236"	"00110770"	"1"	"01353"	"01353"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111237"	"00110771"	"1"	"01353"	"01353"	"2010-05-12 17:48:03"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111238"	"00110772"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111239"	"00110773"	"1"	"01353"	"01353"	"2011-03-17 11:44:57"	""	""	"SEQ"	"DNA"	""	""
"0000111240"	"00110774"	"1"	"01353"	"01353"	"2011-03-17 11:49:22"	""	""	"SEQ"	"DNA"	""	""
"0000111241"	"00110775"	"1"	"01353"	"01353"	"2010-09-10 11:22:30"	"01353"	"2011-03-18 10:52:31"	"SEQ"	"DNA"	""	""
"0000111242"	"00110776"	"1"	"01353"	"01353"	"2008-10-21 16:54:53"	"01353"	"2011-03-18 10:52:58"	"SEQ"	"DNA"	""	""
"0000111243"	"00110777"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111244"	"00110778"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111245"	"00110779"	"1"	"01353"	"01353"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111246"	"00110780"	"1"	"02170"	"02170"	"2017-03-25 08:36:53"	""	""	"SEQ"	"DNA"	""	""
"0000111247"	"00110781"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111248"	"00110782"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111249"	"00110783"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111250"	"00110784"	"1"	"01353"	"01353"	"2010-04-12 15:41:33"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111251"	"00110785"	"1"	"01353"	"01353"	"2011-03-17 11:53:17"	""	""	"SEQ"	"DNA"	""	""
"0000111252"	"00110786"	"1"	"01353"	"01353"	"2011-10-12 11:39:58"	""	""	"SEQ"	"DNA"	""	""
"0000111253"	"00110787"	"1"	"01353"	"01353"	"2010-04-13 10:30:24"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111254"	"00110788"	"1"	"01353"	"01353"	"2010-04-12 17:41:10"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111255"	"00110789"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111256"	"00110790"	"1"	"01353"	"01353"	"2010-04-12 17:38:16"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111257"	"00110791"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111258"	"00110792"	"1"	"01353"	"01353"	"2010-03-25 16:37:26"	"01353"	"2011-03-18 10:54:39"	"SEQ"	"DNA"	""	""
"0000111259"	"00110793"	"1"	"01353"	"01353"	"2011-03-18 10:56:22"	""	""	"SEQ"	"DNA"	""	""
"0000111260"	"00110794"	"1"	"01353"	"01353"	"2009-01-26 17:22:07"	"01353"	"2011-03-18 10:57:03"	"SEQ"	"DNA"	""	""
"0000111261"	"00110795"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111262"	"00110796"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111263"	"00110797"	"1"	"01353"	"01353"	"2010-03-30 14:09:54"	"01353"	"2011-03-18 11:27:24"	"SEQ"	"DNA"	""	""
"0000111264"	"00110798"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111265"	"00110799"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111266"	"00110800"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111267"	"00110801"	"1"	"01353"	"01353"	"2008-10-21 17:01:14"	"01353"	"2011-03-18 10:57:33"	"SEQ"	"DNA"	""	""
"0000111268"	"00110802"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111269"	"00110803"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111270"	"00110804"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111271"	"00110805"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111272"	"00110806"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111273"	"00110807"	"1"	"01353"	"01353"	"2011-03-17 12:01:29"	"01353"	"2011-03-17 15:02:09"	"SEQ"	"DNA"	""	""
"0000111274"	"00110808"	"1"	"01353"	"01353"	"2011-03-18 11:35:42"	""	""	"SEQ"	"DNA"	""	""
"0000111275"	"00110809"	"1"	"01353"	"01353"	"2011-03-17 11:58:03"	""	""	"SEQ"	"DNA"	""	""
"0000111276"	"00110810"	"1"	"01353"	"01353"	"2008-10-21 17:07:33"	"01353"	"2011-03-18 10:57:59"	"SEQ"	"DNA"	""	""
"0000111277"	"00110811"	"1"	"01353"	"01353"	"2008-10-21 17:03:25"	"01353"	"2011-03-18 10:58:19"	"SEQ"	"DNA"	""	""
"0000111278"	"00110812"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111279"	"00110813"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111280"	"00110814"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111281"	"00110815"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111282"	"00110816"	"1"	"01353"	"01353"	"2011-03-17 12:08:42"	""	""	"SEQ"	"DNA"	""	""
"0000111283"	"00110817"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111284"	"00110818"	"1"	"01353"	"01353"	"2016-02-12 16:24:23"	""	""	"SEQ"	"DNA"	""	""
"0000111285"	"00110819"	"1"	"01353"	"01353"	"2009-11-03 16:36:17"	"01353"	"2011-03-18 10:58:56"	"SEQ"	"DNA"	""	""
"0000111286"	"00110820"	"1"	"01353"	"01353"	"2008-10-21 17:13:55"	"01353"	"2011-03-18 10:59:15"	"SEQ"	"DNA"	""	""
"0000111287"	"00110821"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"01353"	"2016-02-12 16:25:53"	"SEQ"	"DNA"	""	""
"0000111288"	"00110822"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111289"	"00110823"	"1"	"01353"	"01353"	"2008-10-21 17:24:23"	"01353"	"2011-03-18 10:59:47"	"SEQ"	"DNA"	""	""
"0000111290"	"00110824"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111291"	"00110825"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111292"	"00110826"	"1"	"01353"	"01353"	"2008-10-21 17:30:24"	"01353"	"2011-03-18 11:02:25"	"SEQ"	"DNA"	""	""
"0000111293"	"00110827"	"1"	"01353"	"01353"	"2008-11-04 14:08:11"	"01353"	"2011-03-18 11:04:07"	"SEQ"	"DNA"	""	""
"0000111294"	"00110828"	"1"	"01353"	"01353"	"2011-03-17 13:53:12"	""	""	"SEQ"	"DNA"	""	""
"0000111295"	"00110829"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111296"	"00110830"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111297"	"00110831"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111298"	"00110832"	"1"	"01353"	"01353"	"2010-03-30 14:12:21"	"01353"	"2011-03-18 11:27:50"	"SEQ"	"DNA"	""	""
"0000111299"	"00110833"	"1"	"01353"	"01353"	"2010-03-30 14:25:57"	"01353"	"2011-03-18 11:32:27"	"SEQ"	"DNA"	""	""
"0000111300"	"00110834"	"1"	"01353"	"01353"	"2011-10-12 11:41:36"	""	""	"SEQ"	"DNA"	""	""
"0000111301"	"00110835"	"1"	"01353"	"01353"	"2010-09-10 12:25:50"	"01353"	"2011-03-18 11:06:11"	"SEQ"	"DNA"	""	""
"0000111302"	"00110836"	"1"	"01353"	"01353"	"2009-11-03 13:32:22"	"01353"	"2011-03-18 11:06:32"	"SEQ"	"DNA"	""	""
"0000111303"	"00110837"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111304"	"00110838"	"1"	"01353"	"01353"	"2010-03-30 14:27:53"	"01353"	"2011-03-18 11:33:17"	"SEQ"	"DNA"	""	""
"0000111305"	"00110839"	"1"	"01353"	"01353"	"2011-03-17 13:56:45"	"01353"	"2011-03-17 15:02:36"	"SEQ"	"DNA"	""	""
"0000111306"	"00110840"	"1"	"01353"	"01353"	"2011-03-17 14:06:15"	""	""	"SEQ"	"DNA"	""	""
"0000111307"	"00110841"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111308"	"00110842"	"1"	"01353"	"01353"	"2011-03-17 14:11:04"	""	""	"SEQ"	"DNA"	""	""
"0000111309"	"00110843"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111310"	"00110844"	"1"	"01353"	"01353"	"2008-10-21 17:33:20"	"01353"	"2011-03-18 11:07:04"	"SEQ"	"DNA"	""	""
"0000111311"	"00110845"	"1"	"01353"	"01353"	"2008-10-21 17:36:27"	"01353"	"2011-03-18 11:08:08"	"SEQ"	"DNA"	""	""
"0000111312"	"00110846"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111313"	"00110847"	"1"	"01353"	"01353"	"2011-03-18 10:43:15"	"01353"	"2011-03-18 10:43:39"	"SEQ"	"DNA"	""	""
"0000111314"	"00110848"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111315"	"00110849"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111316"	"00110850"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111317"	"00110851"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111318"	"00110852"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111319"	"00110853"	"1"	"01353"	"01353"	"2008-10-21 17:38:40"	"01353"	"2011-03-18 11:09:19"	"SEQ"	"DNA"	""	""
"0000111320"	"00110854"	"1"	"01353"	"01353"	"2011-03-17 14:20:40"	""	""	"SEQ"	"DNA"	""	""
"0000111321"	"00110855"	"1"	"01353"	"01353"	"2010-02-26 10:43:47"	"01353"	"2011-03-18 11:10:10"	"SEQ"	"DNA"	""	""
"0000111322"	"00110856"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111323"	"00110857"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111324"	"00110858"	"1"	"01353"	"01353"	"2011-03-17 14:30:06"	""	""	"SEQ"	"DNA"	""	""
"0000111325"	"00110859"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111326"	"00110860"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111327"	"00110861"	"1"	"01353"	"01353"	"2015-09-30 15:01:11"	""	""	"SEQ"	"DNA"	""	""
"0000111328"	"00110862"	"1"	"01353"	"01353"	"2011-03-17 14:32:12"	""	""	"SEQ"	"DNA"	""	""
"0000111329"	"00110863"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111330"	"00110864"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111331"	"00110865"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111332"	"00110866"	"1"	"01353"	"01353"	"2011-03-17 10:31:16"	""	""	"SEQ"	"DNA"	""	""
"0000111333"	"00110867"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111334"	"00110868"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111335"	"00110869"	"1"	"01353"	"01353"	"2010-05-05 11:31:23"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111336"	"00110870"	"1"	"01353"	"01353"	"2008-10-22 11:05:38"	"01353"	"2011-03-18 11:10:43"	"SEQ"	"DNA"	""	""
"0000111337"	"00110871"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111338"	"00110872"	"1"	"01353"	"01353"	"2011-10-12 13:09:35"	""	""	"SEQ"	"DNA"	""	""
"0000111339"	"00110873"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111340"	"00110874"	"1"	"01353"	"01353"	"2011-03-17 14:37:26"	"01353"	"2011-03-17 14:37:39"	"SEQ"	"DNA"	""	""
"0000111341"	"00110875"	"1"	"01353"	"01353"	"2011-10-12 14:06:29"	""	""	"SEQ"	"DNA"	""	""
"0000111342"	"00110876"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111343"	"00110877"	"1"	"01353"	"01353"	"2008-10-22 11:07:41"	"01353"	"2011-03-18 11:11:13"	"SEQ"	"DNA"	""	""
"0000111344"	"00110878"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111345"	"00110879"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111346"	"00110880"	"1"	"01353"	"01353"	"2010-04-13 15:21:32"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111347"	"00110881"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111348"	"00110882"	"1"	"01353"	"01353"	"2008-11-04 15:02:57"	"01353"	"2011-03-18 11:12:37"	"SEQ"	"DNA"	""	""
"0000111349"	"00110883"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111350"	"00110884"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111351"	"00110885"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111352"	"00110886"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111353"	"00110887"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111354"	"00110888"	"1"	"01353"	"01353"	"2015-09-30 10:25:24"	""	""	"SEQ"	"DNA"	""	""
"0000111355"	"00110889"	"1"	"01353"	"01353"	"2011-03-17 14:41:40"	""	""	"SEQ"	"DNA"	""	""
"0000111356"	"00110890"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111357"	"00110891"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111358"	"00110892"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111359"	"00110893"	"1"	"01353"	"01353"	"2010-02-18 11:15:30"	"01353"	"2011-03-18 11:13:48"	"SEQ"	"DNA"	""	""
"0000111360"	"00110894"	"1"	"01353"	"01353"	"2010-05-12 17:55:10"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111361"	"00110895"	"1"	"01353"	"01353"	"2011-03-17 14:47:37"	""	""	"SEQ"	"DNA"	""	""
"0000111362"	"00110896"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111363"	"00110897"	"1"	"01353"	"01353"	"2008-10-22 11:11:47"	"01353"	"2011-03-18 11:14:09"	"SEQ"	"DNA"	""	""
"0000111364"	"00110898"	"1"	"01353"	"01353"	"2011-03-17 14:54:59"	""	""	"SEQ"	"DNA"	""	""
"0000111365"	"00110899"	"1"	"00006"	"01353"	"2008-10-21 14:25:38"	"01353"	"2011-03-18 11:15:00"	"SEQ"	"DNA"	""	""
"0000111366"	"00110900"	"1"	"01353"	"01353"	"2011-03-17 10:44:19"	""	""	"SEQ"	"DNA"	""	""
"0000111367"	"00110901"	"1"	"01353"	"01353"	"2011-03-17 15:01:28"	""	""	"SEQ"	"DNA"	""	""
"0000111368"	"00110902"	"1"	"01540"	"01540"	"2014-08-22 09:52:06"	""	""	"SEQ"	"DNA"	""	""
"0000111369"	"00110903"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111370"	"00110904"	"1"	"01353"	"01353"	"2009-11-03 16:38:26"	"01353"	"2011-03-18 11:15:26"	"SEQ"	"DNA"	""	""
"0000111371"	"00110905"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111372"	"00110906"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111373"	"00110907"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111374"	"00110908"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111375"	"00110909"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111376"	"00110910"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111377"	"00110911"	"1"	"01353"	"01353"	"2008-10-22 11:14:01"	"01353"	"2011-03-18 11:15:51"	"SEQ"	"DNA"	""	""
"0000111378"	"00110912"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111379"	"00110913"	"1"	"01353"	"01353"	"2008-10-22 11:15:55"	"01353"	"2011-03-18 10:47:34"	"SEQ"	"DNA"	""	""
"0000111380"	"00110914"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000111381"	"00110915"	"1"	"00006"	"00006"	"2007-06-22 15:00:00"	"00006"	"2011-01-24 22:22:34"	"SEQ"	"DNA"	""	""
"0000145172"	"00144312"	"1"	"02342"	"02342"	"2017-12-08 15:53:43"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145179"	"00144319"	"1"	"02342"	"02342"	"2017-12-09 09:57:48"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145180"	"00144320"	"1"	"02342"	"02342"	"2017-12-09 10:09:48"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145181"	"00144321"	"1"	"02342"	"02342"	"2017-12-09 10:15:20"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145182"	"00144322"	"1"	"02342"	"02342"	"2017-12-09 10:27:31"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145183"	"00144323"	"1"	"02342"	"02342"	"2017-12-09 10:34:25"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145184"	"00144324"	"1"	"02342"	"02342"	"2017-12-09 10:39:49"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145185"	"00144325"	"1"	"02342"	"02342"	"2017-12-09 10:45:46"	""	""	"SEQ"	"DNA"	""	""
"0000145186"	"00144326"	"1"	"02342"	"02342"	"2017-12-09 10:50:27"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145187"	"00144327"	"1"	"02342"	"02342"	"2017-12-09 10:54:47"	""	""	"SEQ-NG"	"DNA"	""	""
"0000145188"	"00144328"	"1"	"02342"	"02342"	"2017-12-09 10:59:30"	""	""	"SEQ-NG"	"DNA"	""	""
"0000232638"	"00231539"	"1"	"00006"	"00006"	"2019-05-03 12:21:09"	""	""	"SEQ-NG"	"DNA"	""	"1031 gene panel"
"0000246760"	"00245648"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246761"	"00245649"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246762"	"00245650"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246763"	"00245651"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246764"	"00245652"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246765"	"00245653"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246766"	"00245654"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246767"	"00245655"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246768"	"00245656"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246769"	"00245657"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246770"	"00245658"	"1"	"00006"	"00006"	"2019-07-05 15:49:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246773"	"00245661"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246774"	"00245662"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246775"	"00245663"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246776"	"00245664"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246777"	"00245665"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246778"	"00245666"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246779"	"00245667"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246780"	"00245668"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246781"	"00245669"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246782"	"00245670"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000246783"	"00245671"	"1"	"00006"	"00006"	"2019-07-05 16:39:31"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000292623"	"00291455"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292624"	"00291456"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292625"	"00291457"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292626"	"00291458"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292627"	"00291459"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292628"	"00291460"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000292629"	"00291461"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296815"	"00295643"	"1"	"01164"	"01164"	"2020-03-22 12:43:10"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000304106"	"00302981"	"1"	"00006"	"00006"	"2020-06-05 14:08:27"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000307327"	"00306193"	"1"	"03695"	"03695"	"2020-07-11 07:24:00"	""	""	"SEQ-NG"	"DNA"	""	""
"0000308399"	"00307257"	"1"	"03753"	"03753"	"2020-08-06 23:25:39"	""	""	"SEQ-NG-I"	"DNA"	"blood/FFPE tumor"	"160 genes"
"0000308401"	"00307259"	"1"	"03753"	"03753"	"2020-08-07 03:41:08"	""	""	"SEQ-NG-I"	"DNA"	"blood/FFPE tumor"	"160 genes"
"0000309082"	"00307938"	"1"	"00006"	"00006"	"2020-08-23 13:31:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000309083"	"00307939"	"1"	"00006"	"00006"	"2020-08-23 13:31:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"sanger"
"0000316167"	"00314991"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000316168"	"00314992"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000316169"	"00314993"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000316170"	"00314994"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000316171"	"00314995"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000316172"	"00314996"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000316173"	"00314997"	"1"	"00006"	"00006"	"2020-10-24 17:31:22"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"68-gene panel"
"0000332603"	"00331384"	"1"	"00000"	"00006"	"2021-02-11 15:29:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000332604"	"00331385"	"1"	"00000"	"00006"	"2021-02-11 15:29:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000332605"	"00331386"	"1"	"00000"	"00006"	"2021-02-11 15:29:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000362726"	"00361498"	"1"	"00006"	"00006"	"2021-04-07 19:07:03"	""	""	"SEQ-NG"	"DNA"	""	"758-gene panel"
"0000362889"	"00361661"	"1"	"00006"	"00006"	"2021-04-07 19:07:03"	""	""	"SEQ-NG"	"DNA"	""	"758-gene panel"
"0000362891"	"00361663"	"1"	"00006"	"00006"	"2021-04-07 19:07:03"	""	""	"SEQ-NG"	"DNA"	""	"758-gene panel"
"0000375322"	"00374129"	"1"	"00006"	"00006"	"2021-05-23 14:33:57"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000398890"	"00397652"	"1"	"01164"	"01164"	"2021-12-27 16:13:19"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000402884"	"00401641"	"1"	"02494"	"02494"	"2022-02-01 11:03:49"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000429450"	"00428037"	"1"	"00006"	"00006"	"2022-12-19 13:11:26"	""	""	"RT-PCR;SEQ;SEQ-NG-RNA"	"DNA;RNA"	"whole blood"	"trio WES"
"0000429605"	"00428194"	"1"	"01164"	"01164"	"2022-12-23 15:01:16"	""	""	"SEQ-NG-H"	"DNA"	""	""
"0000433301"	"00431863"	"1"	"01164"	"01164"	"2023-02-17 10:24:57"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000435134"	"00433676"	"1"	"03544"	"03544"	"2023-03-13 08:19:14"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000435699"	"00434231"	"1"	"00006"	"00006"	"2023-03-22 17:30:10"	""	""	"SEQ-NG"	"DNA"	""	"WGS"
"0000436735"	"00435255"	"1"	"01164"	"01164"	"2023-06-23 13:44:22"	""	""	"SEQ-NG-I"	"DNA"	""	""
"0000437625"	"00436143"	"1"	"01164"	"01164"	"2023-08-21 15:01:26"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000437852"	"00436370"	"1"	"00006"	"00006"	"2023-09-04 09:51:16"	""	""	"SEQ-NG"	"DNA"	""	"clinical WES"
"0000441881"	"00440396"	"1"	"00006"	"00006"	"2023-11-02 14:36:08"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000449931"	"00448355"	"1"	"01164"	"01164"	"2024-02-29 11:24:36"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000451420"	"00449824"	"1"	"03544"	"03544"	"2024-05-16 12:20:37"	""	""	"SEQ-NG-I"	"DNA"	"peripheral blood"	"WES"
"0000453283"	"00451679"	"1"	"00006"	"00006"	"2024-06-28 11:20:59"	""	""	"SEQ"	"DNA"	""	""
"0000459366"	"00457746"	"1"	"03544"	"03544"	"2024-11-18 09:59:39"	""	""	"SEQ-NG-I"	"DNA"	"peripheral blood"	"CES"
"0000459367"	"00457747"	"1"	"03544"	"03544"	"2024-11-18 10:37:47"	""	""	"SEQ-NG-I"	"DNA"	"peripheral blood"	"CES"
"0000459530"	"00457910"	"1"	"03544"	"03544"	"2024-11-21 07:49:11"	""	""	"SEQ-NG-I"	"DNA"	"peripheral blood"	"CES"
"0000465705"	"00464074"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465706"	"00464075"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465707"	"00464076"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465708"	"00464077"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465709"	"00464078"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465710"	"00464079"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465711"	"00464080"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465712"	"00464081"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465713"	"00464082"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465714"	"00464083"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465715"	"00464084"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465716"	"00464085"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465717"	"00464086"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465718"	"00464087"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465719"	"00464088"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465720"	"00464089"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465721"	"00464090"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465722"	"00464091"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465723"	"00464092"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465724"	"00464093"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465725"	"00464094"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465726"	"00464095"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465727"	"00464096"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465728"	"00464097"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465729"	"00464098"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465730"	"00464099"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465731"	"00464100"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465732"	"00464101"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465733"	"00464102"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465734"	"00464103"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465735"	"00464104"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465736"	"00464105"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465737"	"00464106"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465738"	"00464107"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465739"	"00464108"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465740"	"00464109"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465741"	"00464110"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465742"	"00464111"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465743"	"00464112"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465744"	"00464113"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465745"	"00464114"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465746"	"00464115"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465747"	"00464116"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465748"	"00464117"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465749"	"00464118"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465750"	"00464119"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465751"	"00464120"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465752"	"00464121"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465753"	"00464122"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465754"	"00464123"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465755"	"00464124"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465756"	"00464125"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465757"	"00464126"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465758"	"00464127"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465759"	"00464128"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465760"	"00464129"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465761"	"00464130"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465762"	"00464131"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465763"	"00464132"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465764"	"00464133"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465765"	"00464134"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465766"	"00464135"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465772"	"00464141"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465773"	"00464142"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465774"	"00464143"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000465775"	"00464144"	"1"	"00006"	"00006"	"2025-02-22 11:39:16"	""	""	"MLPA;SEQ"	"DNA"	""	""
"0000467735"	"00466078"	"1"	"01164"	"01164"	"2025-07-31 14:57:16"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000469428"	"00467762"	"1"	"01164"	"01164"	"2025-10-29 13:25:23"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	""
"0000470448"	"00468780"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000470449"	"00468781"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000470450"	"00468782"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000470451"	"00468783"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000470452"	"00468784"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000470453"	"00468785"	"1"	"00006"	"00006"	"2025-11-13 13:02:43"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 311
"{{screeningid}}"	"{{geneid}}"
"0000050368"	"CREBBP"
"0000050611"	"CREBBP"
"0000080940"	"CREBBP"
"0000081560"	"CREBBP"
"0000081569"	"CREBBP"
"0000081586"	"CREBBP"
"0000101837"	"CREBBP"
"0000102533"	"CREBBP"
"0000111197"	"CREBBP"
"0000111198"	"CREBBP"
"0000111199"	"CREBBP"
"0000111200"	"CREBBP"
"0000111201"	"CREBBP"
"0000111202"	"CREBBP"
"0000111203"	"CREBBP"
"0000111204"	"CREBBP"
"0000111205"	"CREBBP"
"0000111206"	"CREBBP"
"0000111207"	"CREBBP"
"0000111208"	"CREBBP"
"0000111209"	"CREBBP"
"0000111210"	"CREBBP"
"0000111211"	"CREBBP"
"0000111212"	"CREBBP"
"0000111213"	"CREBBP"
"0000111214"	"CREBBP"
"0000111215"	"CREBBP"
"0000111216"	"CREBBP"
"0000111217"	"CREBBP"
"0000111218"	"CREBBP"
"0000111219"	"CREBBP"
"0000111220"	"CREBBP"
"0000111221"	"CREBBP"
"0000111222"	"CREBBP"
"0000111223"	"CREBBP"
"0000111224"	"CREBBP"
"0000111225"	"CREBBP"
"0000111226"	"CREBBP"
"0000111227"	"CREBBP"
"0000111228"	"CREBBP"
"0000111229"	"CREBBP"
"0000111230"	"CREBBP"
"0000111231"	"CREBBP"
"0000111232"	"CREBBP"
"0000111233"	"CREBBP"
"0000111234"	"CREBBP"
"0000111235"	"CREBBP"
"0000111236"	"CREBBP"
"0000111237"	"CREBBP"
"0000111238"	"CREBBP"
"0000111239"	"CREBBP"
"0000111240"	"CREBBP"
"0000111241"	"CREBBP"
"0000111242"	"CREBBP"
"0000111243"	"CREBBP"
"0000111244"	"CREBBP"
"0000111245"	"CREBBP"
"0000111246"	"CREBBP"
"0000111247"	"CREBBP"
"0000111248"	"CREBBP"
"0000111249"	"CREBBP"
"0000111250"	"CREBBP"
"0000111251"	"CREBBP"
"0000111252"	"CREBBP"
"0000111253"	"CREBBP"
"0000111254"	"CREBBP"
"0000111255"	"CREBBP"
"0000111256"	"CREBBP"
"0000111257"	"CREBBP"
"0000111258"	"CREBBP"
"0000111259"	"CREBBP"
"0000111260"	"CREBBP"
"0000111261"	"CREBBP"
"0000111262"	"CREBBP"
"0000111263"	"CREBBP"
"0000111264"	"CREBBP"
"0000111265"	"CREBBP"
"0000111266"	"CREBBP"
"0000111267"	"CREBBP"
"0000111268"	"CREBBP"
"0000111269"	"CREBBP"
"0000111270"	"CREBBP"
"0000111271"	"CREBBP"
"0000111272"	"CREBBP"
"0000111273"	"CREBBP"
"0000111274"	"CREBBP"
"0000111275"	"CREBBP"
"0000111276"	"CREBBP"
"0000111277"	"CREBBP"
"0000111278"	"CREBBP"
"0000111279"	"CREBBP"
"0000111280"	"CREBBP"
"0000111281"	"CREBBP"
"0000111282"	"CREBBP"
"0000111283"	"CREBBP"
"0000111284"	"CREBBP"
"0000111285"	"CREBBP"
"0000111286"	"CREBBP"
"0000111287"	"CREBBP"
"0000111288"	"CREBBP"
"0000111289"	"CREBBP"
"0000111290"	"CREBBP"
"0000111291"	"CREBBP"
"0000111292"	"CREBBP"
"0000111293"	"CREBBP"
"0000111294"	"CREBBP"
"0000111295"	"CREBBP"
"0000111296"	"CREBBP"
"0000111297"	"CREBBP"
"0000111298"	"CREBBP"
"0000111299"	"CREBBP"
"0000111300"	"CREBBP"
"0000111301"	"CREBBP"
"0000111302"	"CREBBP"
"0000111303"	"CREBBP"
"0000111304"	"CREBBP"
"0000111305"	"CREBBP"
"0000111306"	"CREBBP"
"0000111307"	"CREBBP"
"0000111308"	"CREBBP"
"0000111309"	"CREBBP"
"0000111310"	"CREBBP"
"0000111311"	"CREBBP"
"0000111312"	"CREBBP"
"0000111313"	"CREBBP"
"0000111314"	"CREBBP"
"0000111315"	"CREBBP"
"0000111316"	"CREBBP"
"0000111317"	"CREBBP"
"0000111318"	"CREBBP"
"0000111319"	"CREBBP"
"0000111320"	"CREBBP"
"0000111321"	"CREBBP"
"0000111322"	"CREBBP"
"0000111323"	"CREBBP"
"0000111324"	"CREBBP"
"0000111325"	"CREBBP"
"0000111326"	"CREBBP"
"0000111327"	"CREBBP"
"0000111328"	"CREBBP"
"0000111329"	"CREBBP"
"0000111330"	"CREBBP"
"0000111331"	"CREBBP"
"0000111332"	"CREBBP"
"0000111333"	"CREBBP"
"0000111334"	"CREBBP"
"0000111335"	"CREBBP"
"0000111336"	"CREBBP"
"0000111337"	"CREBBP"
"0000111338"	"CREBBP"
"0000111339"	"CREBBP"
"0000111340"	"CREBBP"
"0000111341"	"CREBBP"
"0000111342"	"CREBBP"
"0000111343"	"CREBBP"
"0000111344"	"CREBBP"
"0000111345"	"CREBBP"
"0000111346"	"CREBBP"
"0000111347"	"CREBBP"
"0000111348"	"CREBBP"
"0000111349"	"CREBBP"
"0000111350"	"CREBBP"
"0000111351"	"CREBBP"
"0000111352"	"CREBBP"
"0000111353"	"CREBBP"
"0000111354"	"CREBBP"
"0000111355"	"CREBBP"
"0000111356"	"CREBBP"
"0000111357"	"CREBBP"
"0000111358"	"CREBBP"
"0000111359"	"CREBBP"
"0000111360"	"CREBBP"
"0000111361"	"CREBBP"
"0000111362"	"CREBBP"
"0000111363"	"CREBBP"
"0000111364"	"CREBBP"
"0000111365"	"CREBBP"
"0000111366"	"CREBBP"
"0000111367"	"CREBBP"
"0000111368"	"CREBBP"
"0000111369"	"CREBBP"
"0000111370"	"CREBBP"
"0000111371"	"CREBBP"
"0000111372"	"CREBBP"
"0000111373"	"CREBBP"
"0000111374"	"CREBBP"
"0000111375"	"CREBBP"
"0000111376"	"CREBBP"
"0000111377"	"CREBBP"
"0000111378"	"CREBBP"
"0000111379"	"CREBBP"
"0000111380"	"CREBBP"
"0000111381"	"CREBBP"
"0000145185"	"CREBBP"
"0000232638"	"CREBBP"
"0000246760"	"CREBBP"
"0000246761"	"CREBBP"
"0000246762"	"CREBBP"
"0000246763"	"CREBBP"
"0000246764"	"CREBBP"
"0000246765"	"CREBBP"
"0000246766"	"CREBBP"
"0000246767"	"CREBBP"
"0000246768"	"CREBBP"
"0000246769"	"CREBBP"
"0000246770"	"CREBBP"
"0000246773"	"CREBBP"
"0000246774"	"CREBBP"
"0000246775"	"CREBBP"
"0000246776"	"CREBBP"
"0000246777"	"CREBBP"
"0000246778"	"CREBBP"
"0000246779"	"CREBBP"
"0000246780"	"CREBBP"
"0000246781"	"CREBBP"
"0000246782"	"CREBBP"
"0000246783"	"CREBBP"
"0000304106"	"CREBBP"
"0000307327"	"CREBBP"
"0000309082"	"CREBBP"
"0000309083"	"CREBBP"
"0000316167"	"CREBBP"
"0000316168"	"CREBBP"
"0000316169"	"CREBBP"
"0000316170"	"CREBBP"
"0000316171"	"CREBBP"
"0000316172"	"CREBBP"
"0000316173"	"CREBBP"
"0000332603"	"CREBBP"
"0000332604"	"CREBBP"
"0000332605"	"CREBBP"
"0000362726"	"CREBBP"
"0000362889"	"CREBBP"
"0000362891"	"CREBBP"
"0000375322"	"CREBBP"
"0000398890"	"CREBBP"
"0000429605"	"CREBBP"
"0000433301"	"CREBBP"
"0000436735"	"CREBBP"
"0000436735"	"FOXP1"
"0000437625"	"CREBBP"
"0000449931"	"CREBBP"
"0000453283"	"CREBBP"
"0000465705"	"CREBBP"
"0000465706"	"CREBBP"
"0000465707"	"CREBBP"
"0000465708"	"CREBBP"
"0000465709"	"CREBBP"
"0000465710"	"CREBBP"
"0000465711"	"CREBBP"
"0000465712"	"CREBBP"
"0000465713"	"CREBBP"
"0000465714"	"CREBBP"
"0000465715"	"CREBBP"
"0000465716"	"CREBBP"
"0000465717"	"CREBBP"
"0000465718"	"CREBBP"
"0000465719"	"CREBBP"
"0000465720"	"CREBBP"
"0000465721"	"CREBBP"
"0000465722"	"CREBBP"
"0000465723"	"CREBBP"
"0000465724"	"CREBBP"
"0000465725"	"CREBBP"
"0000465726"	"CREBBP"
"0000465727"	"CREBBP"
"0000465728"	"CREBBP"
"0000465729"	"CREBBP"
"0000465730"	"CREBBP"
"0000465731"	"CREBBP"
"0000465732"	"CREBBP"
"0000465733"	"CREBBP"
"0000465734"	"CREBBP"
"0000465735"	"CREBBP"
"0000465736"	"CREBBP"
"0000465737"	"CREBBP"
"0000465738"	"CREBBP"
"0000465739"	"CREBBP"
"0000465740"	"CREBBP"
"0000465741"	"CREBBP"
"0000465742"	"CREBBP"
"0000465743"	"CREBBP"
"0000465744"	"CREBBP"
"0000465745"	"CREBBP"
"0000465746"	"CREBBP"
"0000465747"	"CREBBP"
"0000465748"	"CREBBP"
"0000465749"	"CREBBP"
"0000465750"	"CREBBP"
"0000465751"	"CREBBP"
"0000465752"	"CREBBP"
"0000465753"	"CREBBP"
"0000465754"	"CREBBP"
"0000465755"	"CREBBP"
"0000465756"	"CREBBP"
"0000465757"	"CREBBP"
"0000465758"	"CREBBP"
"0000465759"	"CREBBP"
"0000465760"	"CREBBP"
"0000465761"	"CREBBP"
"0000465762"	"CREBBP"
"0000465763"	"CREBBP"
"0000465764"	"CREBBP"
"0000465765"	"CREBBP"
"0000465766"	"CREBBP"
"0000465772"	"CREBBP"
"0000465773"	"CREBBP"
"0000465774"	"CREBBP"
"0000465775"	"CREBBP"
"0000467735"	"CREBBP"
"0000469428"	"CREBBP"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 711
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000013516"	"0"	"30"	"16"	"3890293"	"3890293"	"subst"	"0"	"00037"	"CREBBP_000171"	"g.3890293A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3840292A>G"	""	"likely benign"	""
"0000079348"	"0"	"90"	"16"	"3779563"	"3779563"	"subst"	"0"	"00006"	"CREBBP_000173"	"g.3779563G>C"	""	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729562G>C"	""	"pathogenic"	""
"0000079591"	"0"	"90"	"16"	"3779449"	"3779449"	"subst"	"0"	"00006"	"CREBBP_000174"	"g.3779449G>A"	""	"{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729448G>A"	""	"pathogenic"	""
"0000130026"	"1"	"70"	"16"	"3827613"	"3827613"	"subst"	"0"	"01758"	"CREBBP_000172"	"g.3827613C>T"	""	"{PMID:Trujillano 2017:27848944}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.3777612C>T"	""	"likely pathogenic"	"ACMG"
"0000132223"	"0"	"50"	"16"	"3786691"	"3786691"	"subst"	"0"	"01783"	"CREBBP_000176"	"g.3786691A>T"	""	""	""	"4820T>A (L1907Q)"	""	"De novo"	""	""	"0"	""	""	"g.3736690A>T"	""	"VUS"	""
"0000132232"	"0"	"50"	"16"	"3779205"	"3779205"	"subst"	"0"	"01783"	"CREBBP_000177"	"g.3779205G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729204G>A"	""	"VUS"	""
"0000132250"	"0"	"50"	"16"	"3807954"	"3807954"	"subst"	"0"	"01783"	"CREBBP_000175"	"g.3807954G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3757953G>A"	""	"VUS"	""
"0000164579"	"0"	"70"	"16"	"3779446"	"3779446"	"subst"	"0"	"01864"	"CREBBP_000178"	"g.3779446G>A"	""	""	""	""	""	"De novo"	"yes"	""	"0"	""	""	"g.3729445G>A"	""	"likely pathogenic"	""
"0000165275"	"0"	"70"	"16"	"3779451"	"3779453"	"del"	"0"	"01864"	"CREBBP_000179"	"g.3779451_3779453del"	""	""	""	""	""	"De novo"	"yes"	""	"0"	"blood"	""	"g.3729450_3729452del"	""	"likely pathogenic"	""
"0000178258"	"0"	"99"	"16"	"3777718"	"3929918"	""	"0"	"01353"	"CREBBP_000117"	"g.(?_3777718)_(3929918_?)del"	""	""	""	""	"deletion exon 1 to 31 (entire gene)"	"Germline/De novo (untested)"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178259"	"0"	"99"	"16"	"3860779"	"3900299"	""	"0"	"01353"	"CREBBP_000116"	"g.(3860779_3900299)_(393012_?)del"	""	""	""	""	"deletion exon 1 to 2"	"De novo"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178260"	"0"	"99"	"16"	"3860779"	"3900299"	""	"0"	"01353"	"CREBBP_000116"	"g.(3860779_3900299)_(393012_?)del"	""	""	""	""	"deletion exon 1 to 2"	"De novo"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178261"	"0"	"99"	"16"	"3929881"	"3929881"	"subst"	"0"	"01353"	"CREBBP_000127"	"g.3929881T>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3879880T>C"	""	"pathogenic"	""
"0000178262"	"0"	"97"	"16"	"3929878"	"3929878"	"subst"	"0"	"00006"	"CREBBP_000071"	"g.3929878T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3879877T>C"	""	"pathogenic"	""
"0000178263"	"0"	"99"	"16"	"3929850"	"3929850"	"subst"	"0"	"00006"	"CREBBP_000025"	"g.3929850G>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3879849G>T"	""	"pathogenic"	""
"0000178264"	"0"	"99"	"16"	"3929832"	"3929832"	"subst"	"0"	"01353"	"CREBBP_000135"	"g.3929832C>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3879831C>A"	""	"pathogenic"	""
"0000178265"	"0"	"99"	"16"	"3900297"	"3901011"	""	"0"	"01353"	"CREBBP_000118"	"g.(3860781_3900297)_(3901011_3929832)del"	""	""	""	""	"deletion exon 2"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178266"	"0"	"99"	"16"	"3900297"	"3901011"	""	"0"	"01353"	"CREBBP_000118"	"g.(3860781_3900297)_(3901011_3929832)del"	""	""	""	""	"deletion exon 2"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178267"	"0"	"99"	"16"	"3900865"	"3901012"	"del"	"0"	"00006"	"CREBBP_000031"	"g.3900865_3901012del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850864_3851011del"	""	"pathogenic"	""
"0000178268"	"0"	"99"	"16"	"3900957"	"3900957"	"delins"	"0"	"00006"	"CREBBP_000018"	"g.3900957delinsCAGCTCATGATGA"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850956delinsCAGCTCATGATGA"	""	"pathogenic"	""
"0000178269"	"0"	"99"	"16"	"3900873"	"3900873"	"subst"	"0"	"01353"	"CREBBP_000136"	"g.3900873G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3850872G>A"	""	"pathogenic"	""
"0000178270"	"0"	"99"	"16"	"3900861"	"3900861"	"del"	"0"	"00006"	"CREBBP_000047"	"g.3900861del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850860del"	""	"pathogenic"	""
"0000178271"	"0"	"99"	"16"	"3900819"	"3900819"	"dup"	"0"	"01353"	"CREBBP_000110"	"g.3900819dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850818dup"	""	"pathogenic"	""
"0000178272"	"0"	"99"	"16"	"3900792"	"3900792"	"subst"	"0"	"00006"	"CREBBP_000052"	"g.3900792G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850791G>A"	""	"pathogenic"	""
"0000178273"	"0"	"99"	"16"	"3900779"	"3900779"	"dup"	"0"	"01353"	"CREBBP_000137"	"g.3900779dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3850778dup"	""	"pathogenic"	""
"0000178274"	"0"	"99"	"16"	"3900690"	"3900690"	"subst"	"0"	"00006"	"CREBBP_000001"	"g.3900690G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850689G>A"	""	"pathogenic"	""
"0000178275"	"0"	"99"	"16"	"3900624"	"3900624"	"subst"	"0"	"01353"	"CREBBP_000138"	"g.3900624G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3850623G>A"	""	"pathogenic"	""
"0000178276"	"0"	"99"	"16"	"3900607"	"3900626"	"del"	"0"	"00006"	"CREBBP_000067"	"g.3900607_3900626del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3850606_3850625del"	""	"pathogenic"	""
"0000178277"	"0"	"99"	"16"	"3860768"	"3860769"	"del"	"0"	"01353"	"CREBBP_000139"	"g.3860768_3860769del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3810767_3810768del"	""	"pathogenic"	""
"0000178278"	"0"	"99"	"16"	"3860741"	"3860741"	"dup"	"0"	"00006"	"CREBBP_000026"	"g.3860741dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3810740dup"	""	"pathogenic"	""
"0000178279"	"0"	"99"	"16"	"3860676"	"3860677"	"del"	"0"	"00006"	"CREBBP_000057"	"g.3860676_3860677del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3810675_3810676del"	""	"pathogenic"	""
"0000178280"	"0"	"99"	"16"	"3843592"	"3843592"	"dup"	"0"	"01353"	"CREBBP_000129"	"g.3843592dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3793591dup"	""	"pathogenic"	""
"0000178281"	"0"	"99"	"16"	"3843537"	"3843537"	"subst"	"0"	"00006"	"CREBBP_000002"	"g.3843537G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793536G>A"	""	"pathogenic"	""
"0000178282"	"0"	"99"	"16"	"3843534"	"3843534"	"subst"	"0"	"01353"	"CREBBP_000092"	"g.3843534G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793533G>A"	""	"pathogenic"	""
"0000178283"	"0"	"99"	"16"	"3843495"	"3843495"	"subst"	"0"	"00006"	"CREBBP_000023"	"g.3843495G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793494G>A"	""	"pathogenic"	""
"0000178284"	"0"	"99"	"16"	"3843495"	"3843495"	"subst"	"0"	"00006"	"CREBBP_000023"	"g.3843495G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793494G>A"	""	"pathogenic"	""
"0000178285"	"0"	"99"	"16"	"3843495"	"3843495"	"subst"	"0"	"00006"	"CREBBP_000023"	"g.3843495G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793494G>A"	""	"pathogenic"	""
"0000178286"	"0"	"99"	"16"	"3843495"	"3843495"	"subst"	"0"	"00006"	"CREBBP_000023"	"g.3843495G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793494G>A"	""	"pathogenic"	""
"0000178287"	"0"	"99"	"16"	"3843489"	"3843489"	"subst"	"0"	"01353"	"CREBBP_000128"	"g.3843489G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3793488G>A"	""	"pathogenic"	""
"0000178288"	"0"	"99"	"16"	"3843386"	"3843386"	"subst"	"0"	"00006"	"CREBBP_000029"	"g.3843386C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3793385C>T"	""	"pathogenic"	""
"0000178289"	"0"	"99"	"16"	"3842075"	"3842075"	"subst"	"0"	"00006"	"CREBBP_000024"	"g.3842075G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792074G>A"	""	"pathogenic"	""
"0000178290"	"0"	"99"	"16"	"3842075"	"3842075"	"subst"	"0"	"00006"	"CREBBP_000024"	"g.3842075G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792074G>A"	""	"pathogenic"	""
"0000178291"	"0"	"99"	"16"	"3842075"	"3842075"	"subst"	"0"	"01353"	"CREBBP_000024"	"g.3842075G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792074G>A"	""	"pathogenic"	""
"0000178292"	"0"	"99"	"16"	"3842042"	"3842042"	"subst"	"0"	"00006"	"CREBBP_000072"	"g.3842042G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792041G>A"	""	"pathogenic"	""
"0000178293"	"0"	"99"	"16"	"3842042"	"3842042"	"subst"	"0"	"00006"	"CREBBP_000072"	"g.3842042G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792041G>A"	""	"pathogenic"	""
"0000178294"	"0"	"99"	"16"	"3842042"	"3842042"	"subst"	"0"	"00006"	"CREBBP_000072"	"g.3842042G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792041G>A"	""	"pathogenic"	""
"0000178295"	"0"	"99"	"16"	"3842042"	"3842042"	"subst"	"0"	"01353"	"CREBBP_000072"	"g.3842042G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3792041G>A"	""	"pathogenic"	""
"0000178296"	"0"	"99"	"16"	"3841994"	"3841994"	"subst"	"0"	"01353"	"CREBBP_000093"	"g.3841994G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3791993G>A"	""	"pathogenic"	""
"0000178297"	"0"	"99"	"16"	"3832867"	"3832874"	"del"	"0"	"01353"	"CREBBP_000046"	"g.3832867_3832874del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3782866_3782873del"	""	"pathogenic"	""
"0000178298"	"0"	"99"	"16"	"3832846"	"3832849"	"del"	"0"	"01353"	"CREBBP_000131"	"g.3832846_3832849del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3782845_3782848del"	""	"pathogenic"	""
"0000178299"	"0"	"99"	"16"	"3832778"	"3832778"	"dup"	"0"	"00006"	"CREBBP_000050"	"g.3832778dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3782777dup"	""	"pathogenic"	""
"0000178300"	"0"	"99"	"16"	"3832775"	"3832775"	"subst"	"0"	"01353"	"CREBBP_000140"	"g.3832775G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3782774G>A"	""	"pathogenic"	""
"0000178301"	"0"	"99"	"16"	"3832737"	"3832743"	"del"	"0"	"01353"	"CREBBP_000141"	"g.3832737_3832743del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3782736_3782742del"	""	"pathogenic"	""
"0000178302"	"0"	"99"	"16"	"3832736"	"3832736"	"subst"	"0"	"01353"	"CREBBP_000133"	"g.3832736G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3782735G>A"	""	"pathogenic"	""
"0000178303"	"0"	"99"	"16"	"3831227"	"3831227"	"del"	"0"	"01353"	"CREBBP_000094"	"g.3831227del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3781226del"	""	"pathogenic"	""
"0000178304"	"0"	"99"	"16"	"3831204"	"3831204"	"subst"	"0"	"00006"	"CREBBP_000030"	"g.3831204C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3781203C>T"	""	"pathogenic"	""
"0000178305"	"0"	"99"	"16"	"3830824"	"3830824"	"del"	"0"	"00006"	"CREBBP_000081"	"g.3830824del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3780823del"	""	"pathogenic"	""
"0000178306"	"0"	"99"	"16"	"3830822"	"3830822"	"dup"	"0"	"01353"	"CREBBP_000044"	"g.3830822dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3780821dup"	""	"pathogenic"	""
"0000178307"	"0"	"90"	"16"	"3830754"	"3830754"	"subst"	"0"	"02170"	"CREBBP_000167"	"g.3830754C>T"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3780753C>T"	""	"pathogenic"	""
"0000178308"	"0"	"99"	"16"	"3828749"	"3828753"	"del"	"0"	"00006"	"CREBBP_000062"	"g.3828749_3828753del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3778748_3778752del"	""	"pathogenic"	""
"0000178309"	"0"	"99"	"16"	"3828141"	"3828141"	"subst"	"0"	"00006"	"CREBBP_000083"	"g.3828141G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3778140G>A"	""	"pathogenic"	""
"0000178310"	"0"	"99"	"16"	"3828080"	"3828080"	"dup"	"0"	"00006"	"CREBBP_000019"	"g.3828080dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3778079dup"	""	"pathogenic"	""
"0000178311"	"0"	"99"	"16"	"3824599"	"3824599"	"subst"	"0"	"01353"	"CREBBP_000122"	"g.3824599G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3774598G>A"	""	"pathogenic"	""
"0000178312"	"0"	"99"	"16"	"3823861"	"3823861"	"del"	"0"	"01353"	"CREBBP_000142"	"g.3823861del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3773860del"	""	"pathogenic"	""
"0000178313"	"0"	"99"	"16"	"3823754"	"3823754"	"subst"	"0"	"01353"	"CREBBP_000160"	"g.3823754G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3773753G>A"	""	"pathogenic"	""
"0000178314"	"0"	"99"	"16"	"3820773"	"3820773"	"subst"	"0"	"01353"	"CREBBP_000125"	"g.3820773G>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3770772G>T"	""	"pathogenic"	""
"0000178315"	"0"	"99"	"16"	"3820727"	"3820727"	"del"	"0"	"01353"	"CREBBP_000124"	"g.3820727del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3770726del"	""	"pathogenic"	""
"0000178316"	"0"	"99"	"16"	"3820702"	"3820702"	"dup"	"0"	"00006"	"CREBBP_000085"	"g.3820702dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3770701dup"	""	"pathogenic"	""
"0000178317"	"0"	"99"	"16"	"3820645"	"3820645"	"dup"	"0"	"01353"	"CREBBP_000123"	"g.3820645dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3770644dup"	""	"pathogenic"	""
"0000178318"	"0"	"99"	"16"	"3820624"	"3820624"	"del"	"0"	"00006"	"CREBBP_000021"	"g.3820624del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3770623del"	""	"pathogenic"	""
"0000178319"	"0"	"99"	"16"	"3820609"	"3820609"	"subst"	"0"	"01353"	"CREBBP_000115"	"g.3820609G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3770608G>A"	""	"pathogenic"	""
"0000178320"	"0"	"99"	"16"	"3820609"	"3820609"	"subst"	"0"	"01353"	"CREBBP_000115"	"g.3820609G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3770608G>A"	""	"pathogenic"	""
"0000178321"	"0"	"99"	"16"	"3820573"	"3820573"	"del"	"0"	"01353"	"CREBBP_000109"	"g.3820573del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3770572del"	""	"pathogenic"	""
"0000178322"	"0"	"95"	"16"	"3819294"	"3819294"	"subst"	"0.00345374"	"00006"	"CREBBP_000013"	"g.3819294C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3769293C>T"	""	"pathogenic"	""
"0000178323"	"0"	"99"	"16"	"3819249"	"3819249"	"subst"	"0"	"00006"	"CREBBP_000065"	"g.3819249C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3769248C>A"	""	"pathogenic"	""
"0000178324"	"0"	"99"	"16"	"3807288"	"3817911"	""	"0"	"01353"	"CREBBP_000119"	"g.(3801808_3807288)_(3817911_3819174)del"	""	""	""	""	"deletion exon 16 to 19"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178325"	"0"	"99"	"16"	"3817876"	"3817876"	"dup"	"0"	"00006"	"CREBBP_000015"	"g.3817876dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3767875dup"	""	"pathogenic"	""
"0000178326"	"0"	"99"	"16"	"3808874"	"3808875"	"dup"	"0"	"00006"	"CREBBP_000056"	"g.3808874_3808875dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3758873_3758874dup"	""	"pathogenic"	""
"0000178327"	"0"	"99"	"16"	"3808849"	"3808855"	"delins"	"0"	"00006"	"CREBBP_000028"	"g.3808849_3808855delinsTG"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3758848_3758854delinsTG"	""	"pathogenic"	""
"0000178328"	"0"	"99"	"16"	"3808044"	"3808044"	"subst"	"0"	"01353"	"CREBBP_000095"	"g.3808044A>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3758043A>C"	""	"pathogenic"	""
"0000178329"	"0"	"99"	"16"	"3808019"	"3808023"	"del"	"0"	"00006"	"CREBBP_000051"	"g.3808019_3808023del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3758018_3758022del"	""	"pathogenic"	""
"0000178330"	"0"	"99"	"16"	"3807986"	"3807987"	"del"	"0"	"00006"	"CREBBP_000058"	"g.3807986_3807987del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757985_3757986del"	""	"pathogenic"	""
"0000178331"	"0"	"99"	"16"	"3807902"	"3807902"	"subst"	"0"	"00006"	"CREBBP_000084"	"g.3807902G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757901G>A"	""	"pathogenic"	""
"0000178332"	"0"	"97"	"16"	"3807895"	"3807895"	"subst"	"0"	"00006"	"CREBBP_000034"	"g.3807895T>C"	""	"{PMID:Bartsch 2002:12114483}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3757894T>C"	""	"pathogenic"	""
"0000178333"	"0"	"99"	"16"	"3807874"	"3807874"	"dup"	"0"	"00006"	"CREBBP_000077"	"g.3807874dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757873dup"	""	"pathogenic"	""
"0000178334"	"0"	"99"	"16"	"3807873"	"3807873"	"del"	"0"	"01353"	"CREBBP_000144"	"g.3807873del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3757872del"	""	"pathogenic"	""
"0000178335"	"0"	"99"	"16"	"3807872"	"3807872"	"subst"	"0"	"01353"	"CREBBP_000159"	"g.3807872C>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3757871C>A"	""	"pathogenic"	""
"0000178336"	"0"	"99"	"16"	"3807807"	"3807813"	"del"	"0"	"01353"	"CREBBP_000143"	"g.3807807_3807813del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3757806_3757812del"	""	"pathogenic"	""
"0000178337"	"0"	"99"	"16"	"3807379"	"3807379"	"subst"	"0"	"01353"	"CREBBP_000097"	"g.3807379T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757378T>C"	""	"pathogenic"	""
"0000178338"	"0"	"99"	"16"	"3807378"	"3807378"	"subst"	"0"	"01353"	"CREBBP_000096"	"g.3807378C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757377C>T"	""	"pathogenic"	""
"0000178339"	"0"	"99"	"16"	"3807348"	"3807348"	"subst"	"0"	"00006"	"CREBBP_000063"	"g.3807348G>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757347G>T"	""	"pathogenic"	""
"0000178340"	"0"	"99"	"16"	"3807288"	"3807288"	"subst"	"0"	"00006"	"CREBBP_000074"	"g.3807288C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757287C>T"	""	"pathogenic"	""
"0000178341"	"0"	"95"	"16"	"3807286"	"3807286"	"subst"	"0"	"00006"	"CREBBP_000008"	"g.3807286T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3757285T>A"	""	"pathogenic"	""
"0000178342"	"0"	"99"	"16"	"3801790"	"3801791"	"del"	"0"	"00006"	"CREBBP_000089"	"g.3801790_3801791del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3751789_3751790del"	""	"pathogenic"	""
"0000178343"	"0"	"99"	"16"	"3801757"	"3801757"	"del"	"0"	"01353"	"CREBBP_000145"	"g.3801757del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3751756del"	""	"pathogenic"	""
"0000178344"	"0"	"99"	"16"	"3801737"	"3801739"	"del"	"0"	"00006"	"CREBBP_000073"	"g.3801737_3801739del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3751736_3751738del"	""	"pathogenic"	""
"0000178345"	"0"	"99"	"16"	"3801726"	"3801726"	"subst"	"0"	"01353"	"CREBBP_000166"	"g.3801726C>T"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3751725C>T"	""	"pathogenic"	""
"0000178346"	"0"	"99"	"16"	"3801725"	"3801725"	"subst"	"0"	"01353"	"CREBBP_000112"	"g.3801725A>G"	""	""	""	""	"Not present in mother, father unavailable"	"Germline"	""	""	"0"	""	""	"g.3751724A>G"	""	"pathogenic"	""
"0000178347"	"0"	"77"	"16"	"3801724"	"3801724"	"subst"	"0"	"01353"	"CREBBP_000098"	"g.3801724T>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3751723T>A"	""	"likely pathogenic"	""
"0000178348"	"0"	"99"	"16"	"3801722"	"3801722"	"subst"	"0"	"00006"	"CREBBP_000035"	"g.3801722C>G"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3751721C>G"	""	"pathogenic"	""
"0000178349"	"0"	"99"	"16"	"3799659"	"3799659"	"subst"	"0"	"00006"	"CREBBP_000016"	"g.3799659T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3749658T>A"	""	"pathogenic"	""
"0000178350"	"0"	"99"	"16"	"3799643"	"3799647"	"dup"	"0"	"01353"	"CREBBP_000099"	"g.3799643_3799647dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3749642_3749646dup"	""	"pathogenic"	""
"0000178351"	"0"	"99"	"16"	"3799641"	"3799641"	"dup"	"0"	"00006"	"CREBBP_000045"	"g.3799641dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3749640dup"	""	"pathogenic"	""
"0000178352"	"0"	"97"	"16"	"3799632"	"3799632"	"subst"	"0"	"00006"	"CREBBP_000038"	"g.3799632C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3749631C>T"	""	"pathogenic"	""
"0000178353"	"0"	"77"	"16"	"3799632"	"3799632"	"subst"	"0"	"01353"	"CREBBP_000038"	"g.3799632C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3749631C>T"	""	"likely pathogenic"	""
"0000178354"	"0"	"77"	"16"	"3799632"	"3799632"	"subst"	"0"	"01353"	"CREBBP_000038"	"g.3799632C>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3749631C>T"	""	"likely pathogenic"	""
"0000178355"	"0"	"97"	"16"	"3799631"	"3799631"	"subst"	"0"	"01353"	"CREBBP_000146"	"g.3799631T>G"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3749630T>G"	""	"pathogenic"	""
"0000178356"	"0"	"97"	"16"	"3799631"	"3799631"	"subst"	"0"	"00006"	"CREBBP_000078"	"g.3799631T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3749630T>C"	""	"pathogenic"	""
"0000178357"	"0"	"99"	"16"	"3799627"	"3799627"	"subst"	"0"	"00006"	"CREBBP_000075"	"g.3799627C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3749626C>T"	""	"pathogenic"	""
"0000178358"	"0"	"99"	"16"	"3795357"	"3795357"	"subst"	"0"	"00006"	"CREBBP_000036"	"g.3795357T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3745356T>A"	""	"pathogenic"	""
"0000178359"	"0"	"99"	"16"	"3794894"	"3795356"	""	"0"	"01353"	"CREBBP_000120"	"g.(3790551_3794894)_(3795356_3799629)del"	""	""	""	""	"deletion exon 22 to 23"	"De novo"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178360"	"0"	"99"	"16"	"3794894"	"3795356"	""	"0"	"01353"	"CREBBP_000120"	"g.(3790551_3794894)_(3795356_3799629)del"	""	""	""	""	"deletion exon 22 to 23"	"De novo"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178361"	"0"	"99"	"16"	"3795336"	"3795337"	"del"	"0"	"01353"	"CREBBP_000161"	"g.3795336_3795337del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3745335_3745336del"	""	"pathogenic"	""
"0000178362"	"0"	"99"	"16"	"3795323"	"3795332"	"del"	"0"	"01353"	"CREBBP_000134"	"g.3795323_3795332del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3745322_3745331del"	""	"pathogenic"	""
"0000178363"	"0"	"99"	"16"	"3795277"	"3795277"	"subst"	"0"	"01353"	"CREBBP_000111"	"g.3795277C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3745276C>A"	""	"pathogenic"	""
"0000178364"	"0"	"99"	"16"	"3794963"	"3794963"	"subst"	"0"	"00006"	"CREBBP_000043"	"g.3794963C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3744962C>T"	""	"pathogenic"	""
"0000178365"	"0"	"99"	"16"	"3775055"	"3790551"	""	"0"	"01353"	"CREBBP_000121"	"g.(?_3775055)_(3790551_3794894)del"	""	""	""	""	"deletion exon 24 to 31"	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000178366"	"0"	"97"	"16"	"3790519"	"3790519"	"subst"	"0"	"01353"	"CREBBP_000147"	"g.3790519C>G"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3740518C>G"	""	"pathogenic"	""
"0000178367"	"0"	"77"	"16"	"3790400"	"3790400"	"subst"	"0"	"01353"	"CREBBP_000148"	"g.3790400C>G"	""	""	""	""	"last position of the exon"	"Unknown"	""	""	"0"	""	""	"g.3740399C>G"	""	"likely pathogenic"	""
"0000178368"	"0"	"99"	"16"	"3790399"	"3790399"	"subst"	"0"	"00006"	"CREBBP_000037"	"g.3790399C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3740398C>T"	""	"pathogenic"	""
"0000178369"	"0"	"97"	"16"	"3789643"	"3789643"	"subst"	"0"	"01353"	"CREBBP_000149"	"g.3789643C>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3739642C>A"	""	"pathogenic"	""
"0000178370"	"0"	"97"	"16"	"3789621"	"3789621"	"subst"	"0"	"00006"	"CREBBP_000079"	"g.3789621T>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3739620T>G"	""	"pathogenic"	""
"0000178371"	"0"	"99"	"16"	"3789604"	"3789605"	"del"	"0"	"01353"	"CREBBP_000100"	"g.3789604_3789605del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3739603_3739604del"	""	"pathogenic"	""
"0000178372"	"0"	"99"	"16"	"3789596"	"3789596"	"dup"	"0"	"01353"	"CREBBP_000101"	"g.3789596dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3739595dup"	""	"pathogenic"	""
"0000178373"	"0"	"99"	"16"	"3789577"	"3789577"	"subst"	"0"	"00006"	"CREBBP_000009"	"g.3789577A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3739576A>G"	""	"pathogenic"	""
"0000178374"	"0"	"97"	"16"	"3788680"	"3788680"	"subst"	"0"	"01353"	"CREBBP_000158"	"g.3788680G>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3738679G>C"	""	"pathogenic"	""
"0000178375"	"0"	"97"	"16"	"3788650"	"3788650"	"subst"	"0"	"00006"	"CREBBP_000064"	"g.3788650T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3738649T>A"	""	"pathogenic"	""
"0000178376"	"0"	"99"	"16"	"3788634"	"3788635"	"del"	"0"	"00006"	"CREBBP_000004"	"g.3788634_3788635del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3738633_3738634del"	""	"pathogenic"	""
"0000178377"	"0"	"99"	"16"	"3788634"	"3788634"	"dup"	"0"	"00006"	"CREBBP_000070"	"g.3788634dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3738633dup"	""	"pathogenic"	""
"0000178378"	"0"	"97"	"16"	"3788614"	"3788614"	"subst"	"0"	"00006"	"CREBBP_000059"	"g.3788614G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3738613G>A"	""	"pathogenic"	""
"0000178379"	"0"	"97"	"16"	"3788606"	"3788606"	"subst"	"0"	"00006"	"CREBBP_000061"	"g.3788606A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3738605A>G"	""	"pathogenic"	""
"0000178380"	"0"	"77"	"16"	"3788556"	"3788556"	"subst"	"0"	"01353"	"CREBBP_000102"	"g.3788556T>G"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3738555T>G"	""	"likely pathogenic"	""
"0000178381"	"0"	"55"	"16"	"3788555"	"3788555"	"subst"	"0"	"01353"	"CREBBP_000150"	"g.3788555C>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3738554C>A"	""	"VUS"	""
"0000178382"	"0"	"99"	"16"	"3786809"	"3786819"	"del"	"0"	"01353"	"CREBBP_000114"	"g.3786809_3786819del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736808_3736818del"	""	"pathogenic"	""
"0000178383"	"0"	"99"	"16"	"3786813"	"3786813"	"dup"	"0"	"00006"	"CREBBP_000060"	"g.3786813dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736812dup"	""	"pathogenic"	""
"0000178384"	"0"	"99"	"16"	"3786813"	"3786813"	"subst"	"0"	"00006"	"CREBBP_000027"	"g.3786813A>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736812A>T"	""	"pathogenic"	""
"0000178385"	"0"	"99"	"16"	"3786811"	"3786811"	"del"	"0"	"01353"	"CREBBP_000151"	"g.3786811del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3736810del"	""	"pathogenic"	""
"0000178386"	"0"	"97"	"16"	"3786802"	"3786802"	"subst"	"0"	"00006"	"CREBBP_000048"	"g.3786802T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736801T>C"	""	"pathogenic"	""
"0000178387"	"0"	"99"	"16"	"3786776"	"3786776"	"subst"	"0"	"00006"	"CREBBP_000088"	"g.3786776C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736775C>A"	""	"pathogenic"	""
"0000178388"	"0"	"77"	"16"	"3786775"	"3786777"	"del"	"0"	"01353"	"CREBBP_000165"	"g.3786775_3786777del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736774_3736776del"	""	"likely pathogenic"	""
"0000178389"	"0"	"97"	"16"	"3786767"	"3786767"	"subst"	"0"	"01353"	"CREBBP_000152"	"g.3786767A>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736766A>C"	""	"pathogenic"	""
"0000178390"	"0"	"97"	"16"	"3786766"	"3786766"	"subst"	"0"	"00006"	"CREBBP_000033"	"g.3786766T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736765T>C"	""	"pathogenic"	""
"0000178391"	"0"	"99"	"16"	"3786719"	"3786719"	"subst"	"0"	"00006"	"CREBBP_000022"	"g.3786719G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736718G>A"	""	"pathogenic"	""
"0000178392"	"0"	"99"	"16"	"3786719"	"3786719"	"subst"	"0"	"00006"	"CREBBP_000022"	"g.3786719G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736718G>A"	""	"pathogenic"	""
"0000178393"	"0"	"99"	"16"	"3786719"	"3786719"	"subst"	"0"	"01353"	"CREBBP_000022"	"g.3786719G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3736718G>A"	""	"pathogenic"	""
"0000178394"	"0"	"97"	"16"	"3786652"	"3786652"	"subst"	"0"	"00006"	"CREBBP_000011"	"g.3786652T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736651T>C"	""	"pathogenic"	""
"0000178395"	"0"	"95"	"16"	"3786209"	"3786209"	"subst"	"0"	"00006"	"CREBBP_000010"	"g.3786209G>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736208G>C"	""	"pathogenic"	""
"0000178396"	"0"	"99"	"16"	"3786206"	"3786206"	"subst"	"0"	"01353"	"CREBBP_000130"	"g.3786206T>C"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3736205T>C"	""	"pathogenic"	""
"0000178397"	"0"	"99"	"16"	"3786199"	"3786200"	"del"	"0"	"01353"	"CREBBP_000103"	"g.3786199_3786200del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736198_3736199del"	""	"pathogenic"	""
"0000178398"	"0"	"99"	"16"	"3786154"	"3786154"	"del"	"0"	"00006"	"CREBBP_000080"	"g.3786154del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736153del"	""	"pathogenic"	""
"0000178399"	"0"	"99"	"16"	"3786138"	"3786138"	"subst"	"0"	"01353"	"CREBBP_000162"	"g.3786138C>T"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736137C>T"	""	"pathogenic"	""
"0000178400"	"0"	"97"	"16"	"3786138"	"3786138"	"subst"	"0"	"00006"	"CREBBP_000087"	"g.3786138C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736137C>A"	""	"pathogenic"	""
"0000178401"	"0"	"99"	"16"	"3786114"	"3786118"	"del"	"0"	"01353"	"CREBBP_000153"	"g.3786114_3786118del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736113_3736117del"	""	"pathogenic"	""
"0000178402"	"0"	"99"	"16"	"3786114"	"3786118"	"del"	"0"	"01353"	"CREBBP_000153"	"g.3786114_3786118del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736113_3736117del"	""	"pathogenic"	""
"0000178403"	"0"	"99"	"16"	"3786096"	"3786096"	"subst"	"0"	"00006"	"CREBBP_000039"	"g.3786096G>A"	""	""	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.3736095G>A"	""	"pathogenic"	""
"0000178404"	"0"	"77"	"16"	"3786057"	"3786057"	"subst"	"0"	"01353"	"CREBBP_000104"	"g.3786057C>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736056C>A"	""	"likely pathogenic"	""
"0000178405"	"0"	"99"	"16"	"3786036"	"3786036"	"subst"	"0"	"00006"	"CREBBP_000086"	"g.3786036C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3736035C>T"	""	"pathogenic"	""
"0000178406"	"0"	"99"	"16"	"3781830"	"3781830"	"del"	"0"	"00006"	"CREBBP_000042"	"g.3781830del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731829del"	""	"pathogenic"	""
"0000178407"	"0"	"99"	"16"	"3781796"	"3781796"	"dup"	"0"	"01353"	"CREBBP_000126"	"g.3781796dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3731795dup"	""	"pathogenic"	""
"0000178408"	"0"	"99"	"16"	"3781788"	"3781788"	"subst"	"0"	"00006"	"CREBBP_000049"	"g.3781788T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731787T>A"	""	"pathogenic"	""
"0000178409"	"0"	"77"	"16"	"3781780"	"3781782"	"del"	"0"	"01353"	"CREBBP_000108"	"g.3781780_3781782del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3731779_3731781del"	""	"likely pathogenic"	""
"0000178410"	"0"	"99"	"16"	"3781457"	"3781467"	"del"	"0"	"00006"	"CREBBP_000005"	"g.3781457_3781467del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731456_3731466del"	""	"pathogenic"	""
"0000178411"	"0"	"99"	"16"	"3781420"	"3781420"	"del"	"0"	"00006"	"CREBBP_000014"	"g.3781420del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731419del"	""	"pathogenic"	""
"0000178412"	"0"	"99"	"16"	"3781406"	"3781406"	"del"	"0"	"00006"	"CREBBP_000090"	"g.3781406del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731405del"	""	"pathogenic"	""
"0000178413"	"0"	"97"	"16"	"3781374"	"3781374"	"subst"	"0"	"00006"	"CREBBP_000040"	"g.3781374C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731373C>T"	""	"pathogenic"	""
"0000178414"	"0"	"97"	"16"	"3781374"	"3781374"	"subst"	"0"	"00006"	"CREBBP_000040"	"g.3781374C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3731373C>T"	""	"pathogenic"	""
"0000178415"	"0"	"77"	"16"	"3781329"	"3781331"	"del"	"0"	"01353"	"CREBBP_000164"	"g.3781329_3781331del"	""	""	""	""	"Low mosaicism in buccal cells, undetectable in blood; de novo, somatic mosaicism"	"De novo"	""	""	"0"	""	""	"g.3731328_3731330del"	""	"likely pathogenic"	""
"0000178416"	"0"	"97"	"16"	"3781305"	"3781305"	"subst"	"0"	"01353"	"CREBBP_000154"	"g.3781305G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3731304G>A"	""	"pathogenic"	""
"0000178417"	"0"	"99"	"16"	"3779836"	"3779837"	"ins"	"0"	"00006"	"CREBBP_000006"	"g.3779836_3779837insTGCAGGACCGAGGG"	""	"{PMID:Murata 2001:11331617}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3729835_3729836insTGCAGGACCGAGGG"	""	"pathogenic"	""
"0000178418"	"0"	"99"	"16"	"3779825"	"3779826"	"del"	"0"	"00006"	"CREBBP_000007"	"g.3779825_3779826del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729824_3729825del"	""	"pathogenic"	""
"0000178419"	"0"	"99"	"16"	"3779413"	"3779413"	"subst"	"0"	"00006"	"CREBBP_000068"	"g.3779413G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729412G>A"	""	"pathogenic"	""
"0000178420"	"0"	"99"	"16"	"3779408"	"3779409"	"del"	"0"	"01353"	"CREBBP_000113"	"g.3779408_3779409del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729407_3729408del"	""	"pathogenic"	""
"0000178421"	"0"	"99"	"16"	"3779338"	"3779338"	"subst"	"0"	"01353"	"CREBBP_000132"	"g.3779338G>A"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3729337G>A"	""	"pathogenic"	""
"0000178422"	"0"	"99"	"16"	"3779263"	"3779263"	"del"	"0"	"01353"	"CREBBP_000155"	"g.3779263del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729262del"	""	"pathogenic"	""
"0000178423"	"0"	"99"	"16"	"3779256"	"3779256"	"dup"	"0"	"00006"	"CREBBP_000076"	"g.3779256dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729255dup"	""	"pathogenic"	""
"0000178424"	"0"	"99"	"16"	"3779227"	"3779227"	"subst"	"0"	"01353"	"CREBBP_000105"	"g.3779227G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729226G>A"	""	"pathogenic"	""
"0000178425"	"0"	"99"	"16"	"3779217"	"3779217"	"del"	"0"	"01353"	"CREBBP_000156"	"g.3779217del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3729216del"	""	"pathogenic"	""
"0000178426"	"0"	"99"	"16"	"3779217"	"3779217"	"dup"	"0"	"00006"	"CREBBP_000091"	"g.3779217dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729216dup"	""	"pathogenic"	""
"0000178427"	"0"	"99"	"16"	"3779217"	"3779217"	"dup"	"0"	"01353"	"CREBBP_000091"	"g.3779217dup"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	"g.3729216dup"	""	"pathogenic"	""
"0000178428"	"0"	"99"	"16"	"3779191"	"3779210"	"dup"	"0"	"01353"	"CREBBP_000157"	"g.3779191_3779210dup20"	""	""	""	""	"Variant Error [ESYNTAX]: This genomic variant has an error (char 33: expected EOF). Please fix this entry and then remove this message."	"Unknown"	""	""	"0"	""	""	"g.3729190_3729209dup20"	""	"pathogenic"	""
"0000178429"	"3"	"33"	"16"	"3779103"	"3779103"	"subst"	"0"	"01540"	"CREBBP_000163"	"g.3779103G>C"	""	""	""	""	"also homozygously detected in healthy sibling; familial"	"Germline"	""	""	"0"	""	""	"g.3729102G>C"	""	"likely benign"	""
"0000178430"	"0"	"99"	"16"	"3779038"	"3779038"	"subst"	"0"	"00006"	"CREBBP_000055"	"g.3779038G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729037G>A"	""	"pathogenic"	""
"0000178431"	"0"	"99"	"16"	"3779038"	"3779038"	"subst"	"0"	"01353"	"CREBBP_000055"	"g.3779038G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729037G>A"	""	"pathogenic"	""
"0000178432"	"0"	"99"	"16"	"3779029"	"3779029"	"subst"	"0"	"00006"	"CREBBP_000069"	"g.3779029G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729028G>A"	""	"pathogenic"	""
"0000178433"	"0"	"99"	"16"	"3779005"	"3779005"	"del"	"0"	"00006"	"CREBBP_000032"	"g.3779005del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3729004del"	""	"pathogenic"	""
"0000178434"	"0"	"99"	"16"	"3778998"	"3779004"	"dup"	"0"	"00006"	"CREBBP_000066"	"g.3778998_3779004dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728997_3729003dup"	""	"pathogenic"	""
"0000178435"	"0"	"99"	"16"	"3778980"	"3778986"	"del"	"0"	"00006"	"CREBBP_000082"	"g.3778980_3778986del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728979_3728985del"	""	"pathogenic"	""
"0000178436"	"0"	"99"	"16"	"3778921"	"3778921"	"subst"	"0"	"00006"	"CREBBP_000020"	"g.3778921G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728920G>A"	""	"pathogenic"	""
"0000178437"	"0"	"99"	"16"	"3778915"	"3778915"	"subst"	"0"	"00006"	"CREBBP_000053"	"g.3778915G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728914G>A"	""	"pathogenic"	""
"0000178438"	"0"	"99"	"16"	"3778835"	"3778835"	"del"	"0"	"01353"	"CREBBP_000106"	"g.3778835del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728834del"	""	"pathogenic"	""
"0000178439"	"0"	"99"	"16"	"3778765"	"3778765"	"subst"	"0"	"00006"	"CREBBP_000054"	"g.3778765G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728764G>A"	""	"pathogenic"	""
"0000178440"	"0"	"99"	"16"	"3778612"	"3778612"	"subst"	"0"	"01353"	"CREBBP_000107"	"g.3778612G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728611G>A"	""	"pathogenic"	""
"0000178441"	"0"	"93"	"16"	"3778387"	"3778387"	"subst"	"0.000174343"	"00006"	"CREBBP_000017"	"g.3778387T>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728386T>G"	""	"pathogenic"	""
"0000178442"	"0"	"95"	"16"	"3778320"	"3778320"	"subst"	"2.50977E-5"	"00006"	"CREBBP_000012"	"g.3778320G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.3728319G>A"	""	"pathogenic"	""
"0000236244"	"0"	"70"	"16"	"3781210"	"3781210"	"subst"	"0"	"02342"	"CREBBP_000185"	"g.3781210G>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3731209G>C"	""	"likely pathogenic"	""
"0000236256"	"0"	"70"	"16"	"3779703"	"3779703"	"subst"	"0"	"02342"	"CREBBP_000184"	"g.3779703G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729702G>A"	""	"likely pathogenic"	""
"0000236257"	"0"	"70"	"16"	"3779563"	"3779563"	"subst"	"0"	"02342"	"CREBBP_000173"	"g.3779563G>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729562G>C"	""	"likely pathogenic"	""
"0000236258"	"0"	"70"	"16"	"3779451"	"3779453"	"del"	"0"	"02342"	"CREBBP_000179"	"g.3779451_3779453del"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729450_3729452del"	""	"likely pathogenic"	""
"0000236259"	"0"	"70"	"16"	"3779448"	"3779448"	"subst"	"0"	"02342"	"CREBBP_000183"	"g.3779448C>T"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729447C>T"	""	"likely pathogenic"	""
"0000236260"	"0"	"70"	"16"	"3779446"	"3779446"	"subst"	"0"	"02342"	"CREBBP_000178"	"g.3779446G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"likely pathogenic"	""
"0000236261"	"0"	"70"	"16"	"3779446"	"3779446"	"subst"	"0"	"02342"	"CREBBP_000178"	"g.3779446G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"likely pathogenic"	""
"0000236262"	"0"	"70"	"16"	"3779446"	"3779446"	"subst"	"0"	"02342"	"CREBBP_000178"	"g.3779446G>A"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"likely pathogenic"	""
"0000236263"	"0"	"70"	"16"	"3779445"	"3779445"	"subst"	"0"	"02342"	"CREBBP_000182"	"g.3779445C>T"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729444C>T"	""	"likely pathogenic"	""
"0000236265"	"0"	"70"	"16"	"3779440"	"3779440"	"subst"	"0"	"02342"	"CREBBP_000181"	"g.3779440C>G"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729439C>G"	""	"likely pathogenic"	""
"0000236266"	"0"	"70"	"16"	"3779434"	"3779434"	"subst"	"0"	"02342"	"CREBBP_000180"	"g.3779434T>C"	""	""	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729433T>C"	""	"likely pathogenic"	""
"0000252279"	"0"	"30"	"16"	"3789571"	"3789571"	"subst"	"0.000162439"	"02326"	"CREBBP_000210"	"g.3789571A>G"	""	""	""	"CREBBP(NM_004380.2):c.4280+8T>C, CREBBP(NM_004380.3):c.4280+8T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3739570A>G"	""	"likely benign"	""
"0000255648"	"0"	"90"	"16"	"3786704"	"3786704"	"subst"	"0"	"01943"	"CREBBP_000209"	"g.3786704A>G"	""	""	""	"CREBBP(NM_004380.2):c.4507T>C (p.Y1503H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3736703A>G"	""	"pathogenic"	""
"0000267125"	"0"	"10"	"16"	"3820723"	"3820723"	"subst"	"0.00248178"	"02325"	"CREBBP_000220"	"g.3820723T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2614A>G (p.(Thr872Ala)), CREBBP(NM_004380.2):c.2728A>G (p.T910A), CREBBP(NM_004380.3):c.2728A>G (p.T910A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3770722T>C"	""	"benign"	""
"0000267126"	"0"	"50"	"16"	"3777897"	"3777897"	"subst"	"0"	"02325"	"CREBBP_000187"	"g.3777897T>G"	""	""	""	"CREBBP(NM_001079846.1):c.7037A>C (p.(His2346Pro)), CREBBP(NM_004380.3):c.7151A>C (p.H2384P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3727896T>G"	""	"VUS"	""
"0000270582"	"0"	"30"	"16"	"3820773"	"3820773"	"subst"	"0.000978935"	"02326"	"CREBBP_000221"	"g.3820773G>A"	""	""	""	"CREBBP(NM_001079846.1):c.2564C>T (p.(Ser855Leu)), CREBBP(NM_004380.2):c.2678C>T (p.S893L), CREBBP(NM_004380.3):c.2678C>T (p.S893L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3770772G>A"	""	"likely benign"	""
"0000270583"	"0"	"30"	"16"	"3819294"	"3819294"	"subst"	"0.00345374"	"02326"	"CREBBP_000013"	"g.3819294C>T"	""	""	""	"CREBBP(NM_001079846.1):c.2827G>A (p.(Ala943Thr)), CREBBP(NM_004380.2):c.2941G>A (p.A981T), CREBBP(NM_004380.3):c.2941G>A (p.A981T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3769293C>T"	""	"likely benign"	""
"0000274411"	"0"	"30"	"16"	"3843454"	"3843454"	"subst"	"0.00187196"	"01943"	"CREBBP_000226"	"g.3843454C>T"	""	""	""	"CREBBP(NM_004380.2):c.1149G>A (p.P383=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3793453C>T"	""	"likely benign"	""
"0000274412"	"0"	"10"	"16"	"3831230"	"3831230"	"subst"	"0.0102912"	"01943"	"CREBBP_000225"	"g.3831230G>T"	""	""	""	"CREBBP(NM_001079846.1):c.1537C>A (p.(Leu513Ile)), CREBBP(NM_004380.2):c.1651C>A (p.L551I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3781229G>T"	""	"benign"	""
"0000274413"	"0"	"30"	"16"	"3823935"	"3823935"	"subst"	"5.68731E-5"	"01943"	"CREBBP_000223"	"g.3823935C>G"	""	""	""	"CREBBP(NM_004380.2):c.2284-4G>C (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3773934C>G"	""	"likely benign"	""
"0000274414"	"0"	"30"	"16"	"3819294"	"3819294"	"subst"	"0.00345374"	"01943"	"CREBBP_000013"	"g.3819294C>T"	""	""	""	"CREBBP(NM_001079846.1):c.2827G>A (p.(Ala943Thr)), CREBBP(NM_004380.2):c.2941G>A (p.A981T), CREBBP(NM_004380.3):c.2941G>A (p.A981T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3769293C>T"	""	"likely benign"	""
"0000274415"	"0"	"30"	"16"	"3819262"	"3819262"	"subst"	"0.00219708"	"01943"	"CREBBP_000217"	"g.3819262G>A"	""	""	""	"CREBBP(NM_004380.2):c.2973C>T (p.D991=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3769261G>A"	""	"likely benign"	""
"0000274416"	"0"	"90"	"16"	"3799632"	"3799632"	"subst"	"0"	"01943"	"CREBBP_000038"	"g.3799632C>T"	""	""	""	"CREBBP(NM_004380.2):c.3832G>A (p.E1278K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3749631C>T"	""	"pathogenic"	""
"0000274417"	"0"	"30"	"16"	"3900713"	"3900713"	"subst"	"0.000727222"	"01943"	"CREBBP_000229"	"g.3900713G>C"	""	""	""	"CREBBP(NM_004380.2):c.383C>G (p.S128C), CREBBP(NM_004380.3):c.383C>G (p.S128C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3850712G>C"	""	"likely benign"	""
"0000274418"	"0"	"50"	"16"	"3795291"	"3795291"	"subst"	"0"	"01943"	"CREBBP_000214"	"g.3795291T>C"	""	""	""	"CREBBP(NM_004380.2):c.3901A>G (p.I1301V, p.(Ile1301Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3745290T>C"	""	"VUS"	""
"0000274419"	"0"	"50"	"16"	"3790449"	"3790449"	"subst"	"0"	"01943"	"CREBBP_000212"	"g.3790449C>G"	""	""	""	"CREBBP(NM_004380.2):c.4084G>C (p.V1362L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3740448C>G"	""	"VUS"	""
"0000274420"	"0"	"30"	"16"	"3786029"	"3786029"	"subst"	"0.000268258"	"01943"	"CREBBP_000208"	"g.3786029G>A"	""	""	""	"CREBBP(NM_004380.2):c.4728+8C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3736028G>A"	""	"likely benign"	""
"0000274421"	"0"	"30"	"16"	"3779879"	"3779879"	"subst"	"0"	"01943"	"CREBBP_000206"	"g.3779879C>T"	""	""	""	"CREBBP(NM_004380.2):c.5173-4G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729878C>T"	""	"likely benign"	""
"0000274422"	"0"	"50"	"16"	"3929866"	"3929866"	"subst"	"0"	"01943"	"CREBBP_000231"	"g.3929866T>A"	""	""	""	"CREBBP(NM_004380.2):c.52A>T (p.S18C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3879865T>A"	""	"VUS"	""
"0000274423"	"0"	"50"	"16"	"3900527"	"3900527"	"subst"	"1.21821E-5"	"01943"	"CREBBP_000228"	"g.3900527T>C"	""	""	""	"CREBBP(NM_004380.2):c.569A>G (p.N190S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3850526T>C"	""	"VUS"	""
"0000274424"	"0"	"30"	"16"	"3779278"	"3779278"	"subst"	"0.000315519"	"01943"	"CREBBP_000202"	"g.3779278C>T"	""	""	""	"CREBBP(NM_001079846.1):c.5656G>A (p.(Val1886Met)), CREBBP(NM_004380.2):c.5770G>A (p.V1924M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729277C>T"	""	"likely benign"	""
"0000274425"	"0"	"50"	"16"	"3779158"	"3779158"	"subst"	"0"	"01943"	"CREBBP_000199"	"g.3779158G>A"	""	""	""	"CREBBP(NM_004380.2):c.5890C>T (p.R1964C), CREBBP(NM_004380.3):c.5890C>T (p.R1964C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729157G>A"	""	"VUS"	""
"0000274426"	"0"	"30"	"16"	"3778998"	"3778998"	"subst"	"0"	"01943"	"CREBBP_000197"	"g.3778998G>A"	""	""	""	"CREBBP(NM_004380.2):c.6050C>T (p.P2017L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728997G>A"	""	"likely benign"	""
"0000274427"	"0"	"30"	"16"	"3778811"	"3778811"	"subst"	"2.44437E-5"	"01943"	"CREBBP_000195"	"g.3778811G>T"	""	""	""	"CREBBP(NM_004380.2):c.6237C>A (p.S2079=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728810G>T"	""	"likely benign"	""
"0000274428"	"0"	"30"	"16"	"3778697"	"3778697"	"subst"	"7.3613E-5"	"01943"	"CREBBP_000194"	"g.3778697G>A"	""	""	""	"CREBBP(NM_004380.2):c.6351C>T (p.P2117=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728696G>A"	""	"likely benign"	""
"0000274429"	"0"	"30"	"16"	"3778672"	"3778672"	"subst"	"4.09742E-6"	"01943"	"CREBBP_000193"	"g.3778672C>G"	""	""	""	"CREBBP(NM_004380.2):c.6376G>C (p.G2126R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728671C>G"	""	"likely benign"	""
"0000274430"	"0"	"30"	"16"	"3778392"	"3778392"	"subst"	"0.000153923"	"01943"	"CREBBP_000190"	"g.3778392G>A"	""	""	""	"CREBBP(NM_004380.2):c.6656C>T (p.A2219V), CREBBP(NM_004380.3):c.6656C>T (p.(Ala2219Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728391G>A"	""	"likely benign"	""
"0000274431"	"0"	"10"	"16"	"3778363"	"3778363"	"subst"	"0.00189558"	"01943"	"CREBBP_000189"	"g.3778363C>T"	""	""	""	"CREBBP(NM_001079846.1):c.6571G>A (p.(Gly2191Ser)), CREBBP(NM_004380.2):c.6685G>A (p.G2229S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728362C>T"	""	"benign"	""
"0000274432"	"0"	"30"	"16"	"3777746"	"3777746"	"subst"	"0.000698466"	"01943"	"CREBBP_000186"	"g.3777746C>T"	""	""	""	"CREBBP(NM_004380.2):c.7302G>A (p.T2434=), CREBBP(NM_004380.3):c.7302G>A (p.(Thr2434=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3727745C>T"	""	"likely benign"	""
"0000274433"	"0"	"50"	"16"	"3860714"	"3860714"	"subst"	"8.12301E-6"	"01943"	"CREBBP_000227"	"g.3860714C>T"	""	""	""	"CREBBP(NM_004380.2):c.865G>A (p.G289R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3810713C>T"	""	"VUS"	""
"0000324528"	"0"	"50"	"16"	"3778285"	"3778285"	"subst"	"3.72159E-5"	"01804"	"CREBBP_000188"	"g.3778285G>A"	""	""	""	"CREBBP(NM_001079846.1):c.6649C>T (p.(Pro2217Ser)), CREBBP(NM_004380.2):c.6763C>T (p.P2255S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728284G>A"	""	"VUS"	""
"0000324529"	"0"	"50"	"16"	"3778484"	"3778484"	"subst"	"0"	"01804"	"CREBBP_000191"	"g.3778484C>G"	""	""	""	"CREBBP(NM_001079846.1):c.6450G>C (p.(Gln2150His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728483C>G"	""	"VUS"	""
"0000324531"	"0"	"30"	"16"	"3778933"	"3778933"	"subst"	"2.20632E-5"	"01804"	"CREBBP_000196"	"g.3778933C>T"	""	""	""	"CREBBP(NM_001079846.1):c.6001G>A (p.(Val2001Met)), CREBBP(NM_004380.3):c.6115G>A (p.V2039M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3728932C>T"	""	"likely benign"	""
"0000324532"	"0"	"30"	"16"	"3779115"	"3779115"	"subst"	"0.00506791"	"01804"	"CREBBP_000198"	"g.3779115T>C"	""	""	""	"CREBBP(NM_001079846.1):c.5819A>G (p.(Asn1940Ser)), CREBBP(NM_004380.2):c.5933A>G (p.N1978S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729114T>C"	""	"likely benign"	""
"0000324534"	"0"	"50"	"16"	"3779248"	"3779248"	"subst"	"0.000358886"	"01804"	"CREBBP_000201"	"g.3779248A>G"	""	""	""	"CREBBP(NM_001079846.1):c.5686T>C (p.(Ser1896Pro)), CREBBP(NM_004380.3):c.5800T>C (p.S1934P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729247A>G"	""	"VUS"	""
"0000324535"	"0"	"30"	"16"	"3779329"	"3779329"	"subst"	"0.00157656"	"01804"	"CREBBP_000203"	"g.3779329C>T"	""	""	""	"CREBBP(NM_001079846.1):c.5605G>A (p.(Ala1869Thr)), CREBBP(NM_004380.2):c.5719G>A (p.A1907T), CREBBP(NM_004380.3):c.5719G>A (p.A1907T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729328C>T"	""	"likely benign"	""
"0000324536"	"0"	"50"	"16"	"3779434"	"3779434"	"subst"	"0"	"01804"	"CREBBP_000180"	"g.3779434T>C"	""	""	""	"CREBBP(NM_001079846.1):c.5500A>G (p.(Met1834Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729433T>C"	""	"VUS"	""
"0000324537"	"0"	"50"	"16"	"3779448"	"3779448"	"subst"	"0"	"01804"	"CREBBP_000183"	"g.3779448C>T"	""	""	""	"CREBBP(NM_004380.2):c.5600G>A (p.(Arg1867Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729447C>T"	""	"VUS"	""
"0000324539"	"0"	"50"	"16"	"3781910"	"3781910"	"subst"	"0"	"01804"	"CREBBP_000207"	"g.3781910T>C"	""	""	""	"CREBBP(NM_004380.2):c.4757A>G (p.(Lys1586Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3731909T>C"	""	"VUS"	""
"0000324541"	"0"	"30"	"16"	"3790548"	"3790548"	"subst"	"0.000158395"	"01804"	"CREBBP_000213"	"g.3790548G>A"	""	""	""	"CREBBP(NM_001079846.1):c.3871C>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3740547G>A"	""	"likely benign"	""
"0000324543"	"0"	"70"	"16"	"3807325"	"3807325"	"subst"	"0"	"01804"	"CREBBP_000216"	"g.3807325A>G"	""	""	""	"CREBBP(NM_004380.2):c.3662T>C (p.(Ile1221Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3757324A>G"	""	"likely pathogenic"	""
"0000324544"	"0"	"30"	"16"	"3819294"	"3819294"	"subst"	"0.00345374"	"01804"	"CREBBP_000013"	"g.3819294C>T"	""	""	""	"CREBBP(NM_001079846.1):c.2827G>A (p.(Ala943Thr)), CREBBP(NM_004380.2):c.2941G>A (p.A981T), CREBBP(NM_004380.3):c.2941G>A (p.A981T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3769293C>T"	""	"likely benign"	""
"0000324545"	"0"	"50"	"16"	"3820692"	"3820692"	"subst"	"0"	"01804"	"CREBBP_000219"	"g.3820692G>A"	""	""	""	"CREBBP(NM_001079846.1):c.2645C>T (p.(Ala882Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3770691G>A"	""	"VUS"	""
"0000324546"	"0"	"50"	"16"	"3820853"	"3820853"	"subst"	"1.21909E-5"	"01804"	"CREBBP_000222"	"g.3820853C>A"	""	""	""	"CREBBP(NM_001079846.1):c.2484G>T (p.(Met828Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3770852C>A"	""	"VUS"	""
"0000324547"	"0"	"50"	"16"	"3827623"	"3827623"	"subst"	"0"	"01804"	"CREBBP_000224"	"g.3827623C>T"	""	""	""	"CREBBP(NM_004380.2):c.2149G>A (p.(Val717Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3777622C>T"	""	"VUS"	""
"0000324548"	"0"	"50"	"16"	"3900991"	"3900991"	"subst"	"4.06832E-6"	"01804"	"CREBBP_000230"	"g.3900991G>C"	""	""	""	"CREBBP(NM_004380.2):c.105C>G (p.D35E, p.(Asp35Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3850990G>C"	""	"VUS"	""
"0000341215"	"0"	"70"	"16"	"3779703"	"3779703"	"subst"	"0"	"02327"	"CREBBP_000184"	"g.3779703G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729702G>A"	""	"likely pathogenic"	""
"0000343611"	"0"	"50"	"16"	"3786125"	"3786125"	"subst"	"0"	"02327"	"CREBBP_000235"	"g.3786125T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3736124T>G"	""	"VUS"	""
"0000345822"	"0"	"50"	"16"	"3779242"	"3779242"	"subst"	"0"	"02327"	"CREBBP_000233"	"g.3779242C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729241C>G"	""	"VUS"	""
"0000346387"	"0"	"70"	"16"	"3781210"	"3781210"	"subst"	"0"	"02327"	"CREBBP_000185"	"g.3781210G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3731209G>C"	""	"likely pathogenic"	""
"0000346937"	"0"	"90"	"16"	"3781299"	"3781299"	"subst"	"0"	"02327"	"CREBBP_000234"	"g.3781299A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3731298A>G"	""	"pathogenic"	""
"0000347208"	"0"	"50"	"16"	"3832687"	"3832687"	"subst"	"0"	"02327"	"CREBBP_000240"	"g.3832687A>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3782686A>T"	""	"VUS"	""
"0000347322"	"0"	"50"	"16"	"3820924"	"3820924"	"subst"	"1.22151E-5"	"02327"	"CREBBP_000238"	"g.3820924G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3770923G>C"	""	"VUS"	""
"0000349655"	"0"	"10"	"16"	"3820723"	"3820723"	"subst"	"0.00248178"	"02327"	"CREBBP_000220"	"g.3820723T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2614A>G (p.(Thr872Ala)), CREBBP(NM_004380.2):c.2728A>G (p.T910A), CREBBP(NM_004380.3):c.2728A>G (p.T910A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3770722T>C"	""	"benign"	""
"0000350266"	"0"	"30"	"16"	"3795351"	"3795351"	"subst"	"0.00013018"	"02327"	"CREBBP_000237"	"g.3795351C>T"	""	""	""	"CREBBP(NM_004380.3):c.3841G>A (p.(Val1281Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3745350C>T"	""	"likely benign"	""
"0000350372"	"0"	"30"	"16"	"3779278"	"3779278"	"subst"	"0.000315519"	"02327"	"CREBBP_000202"	"g.3779278C>T"	""	""	""	"CREBBP(NM_001079846.1):c.5656G>A (p.(Val1886Met)), CREBBP(NM_004380.2):c.5770G>A (p.V1924M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3729277C>T"	""	"likely benign"	""
"0000351148"	"0"	"90"	"16"	"3789726"	"3789726"	"subst"	"0"	"02327"	"CREBBP_000236"	"g.3789726C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3739725C>A"	""	"pathogenic"	""
"0000351150"	"0"	"90"	"16"	"3824569"	"3824569"	"subst"	"0"	"02327"	"CREBBP_000239"	"g.3824569C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.3774568C>T"	""	"pathogenic"	""
"0000474973"	"1"	"70"	"16"	"3779499"	"3779499"	"subst"	"0"	"00006"	"CREBBP_000241"	"g.3779499A>G"	""	"{PMID:Eggers 2016:27899157}"	""	""	""	"Germline"	""	""	"0"	""	"46,XY"	"g.3729498A>G"	""	"likely pathogenic"	""
"0000499546"	"0"	"90"	"16"	"3781210"	"3781210"	"subst"	"0"	"00006"	"CREBBP_000185"	"g.3781210G>C"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3731209G>C"	""	"pathogenic (dominant)"	""
"0000499547"	"0"	"90"	"16"	"3779703"	"3779703"	"subst"	"0"	"00006"	"CREBBP_000184"	"g.3779703G>A"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729702G>A"	""	"pathogenic (dominant)"	""
"0000499548"	"0"	"90"	"16"	"3779563"	"3779563"	"subst"	"0"	"00006"	"CREBBP_000173"	"g.3779563G>C"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729562G>C"	""	"pathogenic (dominant)"	""
"0000499549"	"0"	"90"	"16"	"3779451"	"3779453"	"del"	"0"	"00006"	"CREBBP_000179"	"g.3779451_3779453del"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729450_3729452del"	""	"pathogenic (dominant)"	""
"0000499550"	"0"	"90"	"16"	"3779448"	"3779448"	"subst"	"0"	"00006"	"CREBBP_000183"	"g.3779448C>T"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3729447C>T"	""	"pathogenic (dominant)"	""
"0000499551"	"0"	"90"	"16"	"3779446"	"3779446"	"subst"	"0"	"00006"	"CREBBP_000178"	"g.3779446G>A"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"pathogenic (dominant)"	""
"0000499552"	"0"	"90"	"16"	"3779446"	"3779446"	"subst"	"0"	"00006"	"CREBBP_000178"	"g.3779446G>A"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"pathogenic (dominant)"	""
"0000499553"	"0"	"90"	"16"	"3779446"	"3779446"	"subst"	"0"	"00006"	"CREBBP_000178"	"g.3779446G>A"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"pathogenic (dominant)"	""
"0000499554"	"0"	"90"	"16"	"3779445"	"3779445"	"subst"	"0"	"00006"	"CREBBP_000182"	"g.3779445C>T"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729444C>T"	""	"pathogenic (dominant)"	""
"0000499555"	"0"	"90"	"16"	"3779440"	"3779440"	"subst"	"0"	"00006"	"CREBBP_000181"	"g.3779440C>G"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729439C>G"	""	"pathogenic (dominant)"	""
"0000499556"	"0"	"90"	"16"	"3779434"	"3779434"	"subst"	"0"	"00006"	"CREBBP_000180"	"g.3779434T>C"	""	"{PMID:Menke 2018:29460469}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729433T>C"	""	"pathogenic (dominant)"	""
"0000499559"	"0"	"90"	"16"	"3781237"	"3781237"	"subst"	"0"	"00006"	"CREBBP_000246"	"g.3781237A>G"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3731236A>G"	""	"pathogenic (dominant)"	""
"0000499560"	"0"	"90"	"16"	"3779808"	"3779808"	"subst"	"0"	"00006"	"CREBBP_000245"	"g.3779808A>C"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729807A>C"	""	"pathogenic (dominant)"	""
"0000499561"	"0"	"90"	"16"	"3779691"	"3779691"	"subst"	"0"	"00006"	"CREBBP_000244"	"g.3779691C>G"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729690C>G"	""	"pathogenic (dominant)"	""
"0000499562"	"0"	"90"	"16"	"3779592"	"3779592"	"subst"	"0"	"00006"	"CREBBP_000205"	"g.3779592C>A"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729591C>A"	""	"pathogenic (dominant)"	""
"0000499563"	"0"	"90"	"16"	"3779570"	"3779570"	"subst"	"0"	"00006"	"CREBBP_000243"	"g.3779570G>C"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729569G>C"	""	"pathogenic (dominant)"	""
"0000499564"	"0"	"90"	"16"	"3779535"	"3779535"	"subst"	"0"	"00006"	"CREBBP_000242"	"g.3779535C>T"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729534C>T"	""	"pathogenic (dominant)"	""
"0000499565"	"0"	"90"	"16"	"3779449"	"3779449"	"subst"	"0"	"00006"	"CREBBP_000174"	"g.3779449G>A"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729448G>A"	""	"pathogenic (dominant)"	""
"0000499566"	"0"	"90"	"16"	"3779448"	"3779448"	"subst"	"0"	"00006"	"CREBBP_000183"	"g.3779448C>T"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729447C>T"	""	"pathogenic (dominant)"	""
"0000499567"	"0"	"90"	"16"	"3779446"	"3779446"	"subst"	"0"	"00006"	"CREBBP_000178"	"g.3779446G>A"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"pathogenic (dominant)"	""
"0000499568"	"0"	"90"	"16"	"3779446"	"3779446"	"subst"	"0"	"00006"	"CREBBP_000178"	"g.3779446G>A"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729445G>A"	""	"pathogenic (dominant)"	""
"0000499569"	"0"	"90"	"16"	"3779434"	"3779434"	"subst"	"0"	"00006"	"CREBBP_000180"	"g.3779434T>C"	""	"{PMID:Menke 2016:27311832}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729433T>C"	""	"pathogenic (dominant)"	""
"0000558136"	"0"	"30"	"16"	"3777897"	"3777897"	"subst"	"0"	"01804"	"CREBBP_000187"	"g.3777897T>G"	""	""	""	"CREBBP(NM_001079846.1):c.7037A>C (p.(His2346Pro)), CREBBP(NM_004380.3):c.7151A>C (p.H2384P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3727896T>G"	""	"likely benign"	""
"0000558137"	"0"	"50"	"16"	"3778087"	"3778087"	"subst"	"0"	"02327"	"CREBBP_000249"	"g.3778087G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728086G>A"	""	"VUS"	""
"0000558138"	"0"	"30"	"16"	"3778325"	"3778325"	"subst"	"5.87539E-5"	"01943"	"CREBBP_000250"	"g.3778325T>C"	""	""	""	"CREBBP(NM_004380.2):c.6723A>G (p.P2241=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728324T>C"	""	"likely benign"	""
"0000558139"	"0"	"30"	"16"	"3778387"	"3778387"	"subst"	"0.000174343"	"01943"	"CREBBP_000017"	"g.3778387T>G"	""	""	""	"CREBBP(NM_004380.2):c.6661A>C (p.M2221L), CREBBP(NM_004380.3):c.6661A>C (p.M2221L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728386T>G"	""	"likely benign"	""
"0000558140"	"0"	"30"	"16"	"3778387"	"3778387"	"subst"	"0.000174343"	"02325"	"CREBBP_000017"	"g.3778387T>G"	""	""	""	"CREBBP(NM_004380.2):c.6661A>C (p.M2221L), CREBBP(NM_004380.3):c.6661A>C (p.M2221L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728386T>G"	""	"likely benign"	""
"0000558141"	"0"	"30"	"16"	"3778424"	"3778424"	"subst"	"0"	"01804"	"CREBBP_000251"	"g.3778424T>G"	""	""	""	"CREBBP(NM_001079846.1):c.6510A>C (p.(Gln2170His)), CREBBP(NM_004380.3):c.6624A>C (p.Q2208H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728423T>G"	""	"likely benign"	""
"0000558142"	"0"	"30"	"16"	"3778424"	"3778424"	"subst"	"0"	"02326"	"CREBBP_000251"	"g.3778424T>G"	""	""	""	"CREBBP(NM_001079846.1):c.6510A>C (p.(Gln2170His)), CREBBP(NM_004380.3):c.6624A>C (p.Q2208H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728423T>G"	""	"likely benign"	""
"0000558144"	"0"	"30"	"16"	"3778811"	"3778811"	"subst"	"0"	"01943"	"CREBBP_000253"	"g.3778811G>C"	""	""	""	"CREBBP(NM_004380.2):c.6237C>G (p.S2079=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728810G>C"	""	"likely benign"	""
"0000558146"	"0"	"30"	"16"	"3779045"	"3779045"	"subst"	"0.00360281"	"01943"	"CREBBP_000255"	"g.3779045A>G"	""	""	""	"CREBBP(NM_004380.2):c.6003T>C (p.N2001=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729044A>G"	""	"likely benign"	""
"0000558147"	"0"	"30"	"16"	"3779115"	"3779115"	"subst"	"0.00506791"	"01943"	"CREBBP_000198"	"g.3779115T>C"	""	""	""	"CREBBP(NM_001079846.1):c.5819A>G (p.(Asn1940Ser)), CREBBP(NM_004380.2):c.5933A>G (p.N1978S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729114T>C"	""	"likely benign"	""
"0000558148"	"0"	"50"	"16"	"3779170"	"3779170"	"subst"	"0"	"01804"	"CREBBP_000256"	"g.3779170G>A"	""	""	""	"CREBBP(NM_001079846.1):c.5764C>T (p.(Arg1922Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729169G>A"	""	"VUS"	""
"0000558149"	"0"	"50"	"16"	"3779203"	"3779203"	"subst"	"7.96407E-6"	"01943"	"CREBBP_000257"	"g.3779203C>T"	""	""	""	"CREBBP(NM_004380.2):c.5845G>A (p.A1949T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729202C>T"	""	"VUS"	""
"0000558150"	"0"	"30"	"16"	"3779219"	"3779219"	"subst"	"0.00147054"	"01943"	"CREBBP_000258"	"g.3779219C>T"	""	""	""	"CREBBP(NM_004380.2):c.5829G>A (p.P1943=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729218C>T"	""	"likely benign"	""
"0000558151"	"0"	"50"	"16"	"3779241"	"3779241"	"subst"	"0"	"01804"	"CREBBP_000259"	"g.3779241C>T"	""	""	""	"CREBBP(NM_004380.2):c.5807G>A (p.(Gly1936Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729240C>T"	""	"VUS"	""
"0000558152"	"0"	"30"	"16"	"3779278"	"3779278"	"subst"	"0.000315519"	"01804"	"CREBBP_000202"	"g.3779278C>T"	""	""	""	"CREBBP(NM_001079846.1):c.5656G>A (p.(Val1886Met)), CREBBP(NM_004380.2):c.5770G>A (p.V1924M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729277C>T"	""	"likely benign"	""
"0000558153"	"0"	"30"	"16"	"3779329"	"3779329"	"subst"	"0.00157656"	"01943"	"CREBBP_000203"	"g.3779329C>T"	""	""	""	"CREBBP(NM_001079846.1):c.5605G>A (p.(Ala1869Thr)), CREBBP(NM_004380.2):c.5719G>A (p.A1907T), CREBBP(NM_004380.3):c.5719G>A (p.A1907T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729328C>T"	""	"likely benign"	""
"0000558154"	"0"	"30"	"16"	"3779329"	"3779329"	"subst"	"0.00157656"	"02325"	"CREBBP_000203"	"g.3779329C>T"	""	""	""	"CREBBP(NM_001079846.1):c.5605G>A (p.(Ala1869Thr)), CREBBP(NM_004380.2):c.5719G>A (p.A1907T), CREBBP(NM_004380.3):c.5719G>A (p.A1907T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729328C>T"	""	"likely benign"	""
"0000558155"	"0"	"90"	"16"	"3779338"	"3779338"	"subst"	"0"	"02325"	"CREBBP_000132"	"g.3779338G>A"	""	""	""	"CREBBP(NM_004380.3):c.5710C>T (p.Q1904*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729337G>A"	""	"pathogenic"	""
"0000558156"	"0"	"50"	"16"	"3779440"	"3779440"	"subst"	"0"	"02325"	"CREBBP_000260"	"g.3779440C>T"	""	""	""	"CREBBP(NM_004380.3):c.5608G>A (p.A1870T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729439C>T"	""	"VUS"	""
"0000558157"	"0"	"90"	"16"	"3779448"	"3779448"	"subst"	"0"	"02327"	"CREBBP_000183"	"g.3779448C>T"	""	""	""	"CREBBP(NM_004380.2):c.5600G>A (p.(Arg1867Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729447C>T"	""	"pathogenic"	""
"0000558158"	"0"	"70"	"16"	"3779449"	"3779449"	"subst"	"0"	"02327"	"CREBBP_000174"	"g.3779449G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729448G>A"	""	"likely pathogenic"	""
"0000558160"	"0"	"30"	"16"	"3779612"	"3779612"	"subst"	"0.00216473"	"01943"	"CREBBP_000262"	"g.3779612G>C"	""	""	""	"CREBBP(NM_004380.2):c.5436C>G (p.T1812=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729611G>C"	""	"likely benign"	""
"0000558161"	"0"	"70"	"16"	"3779838"	"3779838"	"subst"	"1.26701E-5"	"02327"	"CREBBP_000263"	"g.3779838C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729837C>T"	""	"likely pathogenic"	""
"0000558162"	"0"	"50"	"16"	"3781330"	"3781330"	"subst"	"0"	"01804"	"CREBBP_000264"	"g.3781330A>C"	""	""	""	"CREBBP(NM_004380.2):c.5035T>G (p.(Ser1679Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3731329A>C"	""	"VUS"	""
"0000558163"	"0"	"30"	"16"	"3781361"	"3781361"	"subst"	"0"	"01943"	"CREBBP_000265"	"g.3781361G>A"	""	""	""	"CREBBP(NM_004380.2):c.5004C>T (p.L1668=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3731360G>A"	""	"likely benign"	""
"0000558166"	"0"	"70"	"16"	"3781900"	"3781900"	"del"	"0"	"02327"	"CREBBP_000267"	"g.3781900del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3731899del"	""	"likely pathogenic"	""
"0000558168"	"0"	"30"	"16"	"3789571"	"3789571"	"subst"	"0.000162439"	"01943"	"CREBBP_000210"	"g.3789571A>G"	""	""	""	"CREBBP(NM_004380.2):c.4280+8T>C, CREBBP(NM_004380.3):c.4280+8T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3739570A>G"	""	"likely benign"	""
"0000558169"	"0"	"50"	"16"	"3789682"	"3789682"	"subst"	"4.06062E-6"	"02327"	"CREBBP_000269"	"g.3789682T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3739681T>C"	""	"VUS"	""
"0000558170"	"0"	"30"	"16"	"3790396"	"3790396"	"subst"	"0.000296953"	"01943"	"CREBBP_000211"	"g.3790396T>C"	""	""	""	"CREBBP(NM_004380.2):c.4133+4A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3740395T>C"	""	"likely benign"	""
"0000558171"	"0"	"50"	"16"	"3794912"	"3794912"	"subst"	"0"	"01804"	"CREBBP_000270"	"g.3794912T>C"	""	""	""	"CREBBP(NM_001079846.1):c.3851A>G (p.(Asn1284Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3744911T>C"	""	"VUS"	""
"0000558172"	"0"	"70"	"16"	"3799632"	"3799632"	"subst"	"0"	"02327"	"CREBBP_000038"	"g.3799632C>T"	""	""	""	"CREBBP(NM_004380.2):c.3832G>A (p.E1278K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3749631C>T"	""	"likely pathogenic"	""
"0000558173"	"0"	"30"	"16"	"3799633"	"3799633"	"subst"	"0.000278691"	"01943"	"CREBBP_000271"	"g.3799633G>A"	""	""	""	"CREBBP(NM_004380.2):c.3831C>T (p.P1277=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3749632G>A"	""	"likely benign"	""
"0000558174"	"0"	"70"	"16"	"3799668"	"3799668"	"subst"	"0"	"02327"	"CREBBP_000272"	"g.3799668G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3749667G>A"	""	"likely pathogenic"	""
"0000558175"	"0"	"30"	"16"	"3807387"	"3807387"	"subst"	"1.24873E-5"	"01943"	"CREBBP_000273"	"g.3807387T>C"	""	""	""	"CREBBP(NM_004380.2):c.3610-10A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3757386T>C"	""	"likely benign"	""
"0000558176"	"0"	"50"	"16"	"3808000"	"3808000"	"subst"	"0"	"02327"	"CREBBP_000274"	"g.3808000C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3757999C>T"	""	"VUS"	""
"0000558177"	"0"	"30"	"16"	"3808065"	"3808065"	"del"	"0"	"01804"	"CREBBP_000275"	"g.3808065del"	""	""	""	"CREBBP(NM_001079846.1):c.3256-4del (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3758064del"	""	"likely benign"	""
"0000558178"	"0"	"30"	"16"	"3808065"	"3808065"	"dup"	"0"	"02326"	"CREBBP_000276"	"g.3808065dup"	""	""	""	"CREBBP(NM_004380.3):c.3370-4dupT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3758064dup"	""	"likely benign"	""
"0000558179"	"0"	"30"	"16"	"3808972"	"3808972"	"subst"	"8.12315E-6"	"01943"	"CREBBP_000277"	"g.3808972G>A"	""	""	""	"CREBBP(NM_004380.2):c.3252C>T (p.I1084=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3758971G>A"	""	"likely benign"	""
"0000558180"	"0"	"30"	"16"	"3819206"	"3819206"	"subst"	"0.000178708"	"01943"	"CREBBP_000278"	"g.3819206G>A"	""	""	""	"CREBBP(NM_004380.2):c.3029C>T (p.P1010L), CREBBP(NM_004380.3):c.3029C>T (p.P1010L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3769205G>A"	""	"likely benign"	""
"0000558182"	"0"	"30"	"16"	"3819284"	"3819284"	"subst"	"3.24944E-5"	"01943"	"CREBBP_000280"	"g.3819284T>C"	""	""	""	"CREBBP(NM_004380.2):c.2951A>G (p.N984S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3769283T>C"	""	"likely benign"	""
"0000558183"	"0"	"30"	"16"	"3820640"	"3820640"	"subst"	"0.000394229"	"02325"	"CREBBP_000281"	"g.3820640C>T"	""	""	""	"CREBBP(NM_004380.2):c.2811G>A (p.P937=), CREBBP(NM_004380.3):c.2811G>A (p.P937=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770639C>T"	""	"likely benign"	""
"0000558185"	"0"	"30"	"16"	"3820723"	"3820723"	"subst"	"0.00248178"	"01943"	"CREBBP_000220"	"g.3820723T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2614A>G (p.(Thr872Ala)), CREBBP(NM_004380.2):c.2728A>G (p.T910A), CREBBP(NM_004380.3):c.2728A>G (p.T910A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770722T>C"	""	"likely benign"	""
"0000558186"	"0"	"50"	"16"	"3820762"	"3820762"	"subst"	"0"	"02327"	"CREBBP_000282"	"g.3820762G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770761G>T"	""	"VUS"	""
"0000558187"	"0"	"30"	"16"	"3820773"	"3820773"	"subst"	"0.000978935"	"01943"	"CREBBP_000221"	"g.3820773G>A"	""	""	""	"CREBBP(NM_001079846.1):c.2564C>T (p.(Ser855Leu)), CREBBP(NM_004380.2):c.2678C>T (p.S893L), CREBBP(NM_004380.3):c.2678C>T (p.S893L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770772G>A"	""	"likely benign"	""
"0000558188"	"0"	"30"	"16"	"3820773"	"3820773"	"subst"	"0.000978935"	"01804"	"CREBBP_000221"	"g.3820773G>A"	""	""	""	"CREBBP(NM_001079846.1):c.2564C>T (p.(Ser855Leu)), CREBBP(NM_004380.2):c.2678C>T (p.S893L), CREBBP(NM_004380.3):c.2678C>T (p.S893L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770772G>A"	""	"likely benign"	""
"0000558190"	"0"	"50"	"16"	"3823871"	"3823871"	"subst"	"0"	"01943"	"CREBBP_000284"	"g.3823871T>C"	""	""	""	"CREBBP(NM_004380.2):c.2344A>G (p.N782D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3773870T>C"	""	"VUS"	""
"0000558191"	"0"	"50"	"16"	"3823889"	"3823889"	"subst"	"0"	"02327"	"CREBBP_000285"	"g.3823889T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3773888T>C"	""	"VUS"	""
"0000558192"	"0"	"30"	"16"	"3828073"	"3828073"	"subst"	"0"	"01943"	"CREBBP_000286"	"g.3828073G>A"	""	""	""	"CREBBP(NM_004380.2):c.2052C>T (p.A684=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3778072G>A"	""	"likely benign"	""
"0000558193"	"0"	"30"	"16"	"3828172"	"3828172"	"subst"	"0.0147921"	"01804"	"CREBBP_000287"	"g.3828172A>G"	""	""	""	"CREBBP(NM_001079846.1):c.1839T>C (p.(Tyr613=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3778171A>G"	""	"likely benign"	""
"0000558194"	"0"	"70"	"16"	"3830757"	"3830757"	"subst"	"0"	"02327"	"CREBBP_000288"	"g.3830757A>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3780756A>G"	""	"likely pathogenic"	""
"0000558195"	"0"	"30"	"16"	"3831230"	"3831230"	"subst"	"0.0102912"	"01804"	"CREBBP_000225"	"g.3831230G>T"	""	""	""	"CREBBP(NM_001079846.1):c.1537C>A (p.(Leu513Ile)), CREBBP(NM_004380.2):c.1651C>A (p.L551I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3781229G>T"	""	"likely benign"	""
"0000558197"	"0"	"30"	"16"	"3860700"	"3860700"	"subst"	"0.000564554"	"01943"	"CREBBP_000290"	"g.3860700C>T"	""	""	""	"CREBBP(NM_004380.2):c.879G>A (p.V293=), CREBBP(NM_004380.3):c.879G>A (p.(Val293=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3810699C>T"	""	"likely benign"	""
"0000558198"	"0"	"30"	"16"	"3900384"	"3900384"	"subst"	"0.000434648"	"01804"	"CREBBP_000291"	"g.3900384C>G"	""	""	""	"CREBBP(NM_004380.3):c.712G>C (p.(Val238Leu), p.V238L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850383C>G"	""	"likely benign"	""
"0000558199"	"0"	"30"	"16"	"3900510"	"3900510"	"subst"	"4.06068E-6"	"01943"	"CREBBP_000292"	"g.3900510T>C"	""	""	""	"CREBBP(NM_004380.2):c.586A>G (p.S196G, p.(Ser196Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850509T>C"	""	"likely benign"	""
"0000558200"	"0"	"30"	"16"	"3900661"	"3900661"	"subst"	"3.25113E-5"	"02326"	"CREBBP_000293"	"g.3900661G>A"	""	""	""	"CREBBP(NM_004380.3):c.435C>T (p.P145=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850660G>A"	""	"likely benign"	""
"0000558201"	"0"	"70"	"16"	"3900710"	"3900710"	"subst"	"0"	"02327"	"CREBBP_000294"	"g.3900710G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850709G>C"	""	"likely pathogenic"	""
"0000558202"	"0"	"50"	"16"	"3900956"	"3900956"	"subst"	"1.62566E-5"	"01943"	"CREBBP_000295"	"g.3900956T>C"	""	""	""	"CREBBP(NM_001079846.1):c.140A>G (p.(Asn47Ser)), CREBBP(NM_004380.2):c.140A>G (p.N47S), CREBBP(NM_004380.3):c.140A>G (p.N47S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850955T>C"	""	"VUS"	""
"0000558203"	"0"	"30"	"16"	"3929882"	"3929882"	"subst"	"0"	"01943"	"CREBBP_000296"	"g.3929882G>C"	""	""	""	"CREBBP(NM_004380.2):c.36C>G (p.P12=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3879881G>C"	""	"likely benign"	""
"0000615980"	"0"	"50"	"16"	"3777766"	"3777766"	"subst"	"0"	"01943"	"CREBBP_000247"	"g.3777766C>G"	""	""	""	"CREBBP(NM_004380.2):c.7282G>C (p.G2428R, p.(Gly2428Arg)), CREBBP(NM_004380.3):c.7282G>C (p.G2428R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3727765C>G"	""	"VUS"	""
"0000615982"	"0"	"30"	"16"	"3778958"	"3778958"	"subst"	"0.000255675"	"01943"	"CREBBP_000301"	"g.3778958C>T"	""	""	""	"CREBBP(NM_004380.2):c.6090G>A (p.Q2030=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728957C>T"	""	"likely benign"	""
"0000615984"	"0"	"10"	"16"	"3779115"	"3779115"	"subst"	"0.00506791"	"02327"	"CREBBP_000198"	"g.3779115T>C"	""	""	""	"CREBBP(NM_001079846.1):c.5819A>G (p.(Asn1940Ser)), CREBBP(NM_004380.2):c.5933A>G (p.N1978S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729114T>C"	""	"benign"	""
"0000615985"	"0"	"30"	"16"	"3779183"	"3779183"	"subst"	"0.00047112"	"01943"	"CREBBP_000302"	"g.3779183C>T"	""	""	""	"CREBBP(NM_004380.2):c.5865G>A (p.A1955=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729182C>T"	""	"likely benign"	""
"0000615986"	"0"	"50"	"16"	"3779490"	"3779490"	"subst"	"0"	"02327"	"CREBBP_000303"	"g.3779490T>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729489T>G"	""	"VUS"	""
"0000615987"	"0"	"50"	"16"	"3779793"	"3779793"	"subst"	"0"	"02327"	"CREBBP_000304"	"g.3779793T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3729792T>C"	""	"VUS"	""
"0000615988"	"0"	"30"	"16"	"3781372"	"3781372"	"subst"	"0"	"02327"	"CREBBP_000305"	"g.3781372C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3731371C>T"	""	"likely benign"	""
"0000615989"	"0"	"50"	"16"	"3788663"	"3788663"	"subst"	"0"	"02325"	"CREBBP_000306"	"g.3788663T>C"	""	""	""	"CREBBP(NM_004380.3):c.4291A>G (p.I1431V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3738662T>C"	""	"VUS"	""
"0000615991"	"0"	"30"	"16"	"3817733"	"3817733"	"subst"	"8.1217E-6"	"01804"	"CREBBP_000310"	"g.3817733G>C"	""	""	""	"CREBBP(NM_001079846.1):c.3124C>G (p.(Pro1042Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3767732G>C"	""	"likely benign"	""
"0000615992"	"0"	"50"	"16"	"3817739"	"3817739"	"subst"	"3.24857E-5"	"01943"	"CREBBP_000311"	"g.3817739A>G"	""	""	""	"CREBBP(NM_004380.2):c.3232T>C (p.S1078P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3767738A>G"	""	"VUS"	""
"0000615993"	"0"	"50"	"16"	"3817832"	"3817832"	"subst"	"4.06081E-6"	"01943"	"CREBBP_000312"	"g.3817832C>T"	""	""	""	"CREBBP(NM_004380.2):c.3139G>A (p.E1047K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3767831C>T"	""	"VUS"	""
"0000615994"	"0"	"50"	"16"	"3820807"	"3820807"	"subst"	"0"	"02327"	"CREBBP_000314"	"g.3820807G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770806G>C"	""	"VUS"	""
"0000615995"	"0"	"90"	"16"	"3900388"	"3900388"	"dup"	"0"	"02327"	"CREBBP_000315"	"g.3900388dup"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850387dup"	""	"pathogenic"	""
"0000615996"	"0"	"50"	"16"	"3900437"	"3900437"	"subst"	"0"	"02329"	"CREBBP_000316"	"g.3900437C>G"	""	""	""	"CREBBP(NM_004380.3):c.659G>C (p.R220T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850436C>G"	""	"VUS"	""
"0000615997"	"0"	"30"	"16"	"3900713"	"3900713"	"subst"	"0.000727222"	"02325"	"CREBBP_000229"	"g.3900713G>C"	""	""	""	"CREBBP(NM_004380.2):c.383C>G (p.S128C), CREBBP(NM_004380.3):c.383C>G (p.S128C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850712G>C"	""	"likely benign"	""
"0000615998"	"0"	"50"	"16"	"3900951"	"3900951"	"subst"	"0"	"01943"	"CREBBP_000319"	"g.3900951C>G"	""	""	""	"CREBBP(NM_004380.2):c.145G>C (p.G49R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850950C>G"	""	"VUS"	""
"0000615999"	"0"	"30"	"16"	"3900956"	"3900956"	"subst"	"1.62566E-5"	"01804"	"CREBBP_000295"	"g.3900956T>C"	""	""	""	"CREBBP(NM_001079846.1):c.140A>G (p.(Asn47Ser)), CREBBP(NM_004380.2):c.140A>G (p.N47S), CREBBP(NM_004380.3):c.140A>G (p.N47S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850955T>C"	""	"likely benign"	""
"0000616000"	"0"	"50"	"16"	"3900991"	"3900991"	"subst"	"4.06832E-6"	"01943"	"CREBBP_000230"	"g.3900991G>C"	""	""	""	"CREBBP(NM_004380.2):c.105C>G (p.D35E, p.(Asp35Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850990G>C"	""	"VUS"	""
"0000616001"	"0"	"70"	"16"	"3929881"	"3929881"	"subst"	"0"	"02327"	"CREBBP_000127"	"g.3929881T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3879880T>C"	""	"likely pathogenic"	""
"0000623457"	"0"	"50"	"16"	"3777742"	"3777742"	"subst"	"0"	"01943"	"CREBBP_000297"	"g.3777742C>T"	""	""	""	"CREBBP(NM_004380.2):c.7306G>A (p.E2436K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3727741C>T"	""	"VUS"	""
"0000623459"	"0"	"30"	"16"	"3778716"	"3778716"	"subst"	"0.00015525"	"02326"	"CREBBP_000300"	"g.3778716T>C"	""	""	""	"CREBBP(NM_004380.3):c.6332A>G (p.N2111S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3728715T>C"	""	"likely benign"	""
"0000623460"	"0"	"50"	"16"	"3789706"	"3789706"	"subst"	"0"	"01943"	"CREBBP_000308"	"g.3789706T>G"	""	""	""	"CREBBP(NM_004380.2):c.4153A>C (p.M1385L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3739705T>G"	""	"VUS"	""
"0000623461"	"0"	"30"	"16"	"3790430"	"3790430"	"subst"	"4.06243E-6"	"01943"	"CREBBP_000309"	"g.3790430G>A"	""	""	""	"CREBBP(NM_004380.2):c.4103C>T (p.T1368M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3740429G>A"	""	"likely benign"	""
"0000623462"	"0"	"10"	"16"	"3808065"	"3808065"	"dup"	"0"	"02325"	"CREBBP_000276"	"g.3808065dup"	""	""	""	"CREBBP(NM_004380.3):c.3370-4dupT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3758064dup"	""	"benign"	""
"0000623463"	"0"	"30"	"16"	"3819244"	"3819244"	"subst"	"2.03034E-5"	"01943"	"CREBBP_000313"	"g.3819244C>A"	""	""	""	"CREBBP(NM_004380.2):c.2991G>T (p.M997I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3769243C>A"	""	"likely benign"	""
"0000623464"	"0"	"30"	"16"	"3820640"	"3820640"	"subst"	"0.000394229"	"01943"	"CREBBP_000281"	"g.3820640C>T"	""	""	""	"CREBBP(NM_004380.2):c.2811G>A (p.P937=), CREBBP(NM_004380.3):c.2811G>A (p.P937=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3770639C>T"	""	"likely benign"	""
"0000623465"	"0"	"90"	"16"	"3900914"	"3900915"	"ins"	"0"	"02329"	"CREBBP_000317"	"g.3900914_3900915insTTAAACCTT"	""	""	""	"CREBBP(NM_004380.3):c.181_182insAAGGTTTAA (p.P61delinsQGLT)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850913_3850914insTTAAACCTT"	""	"pathogenic"	""
"0000623466"	"0"	"90"	"16"	"3900915"	"3900916"	"ins"	"0"	"02329"	"CREBBP_000318"	"g.3900915_3900916insTTTA"	""	""	""	"CREBBP(NM_004380.3):c.180_181insTAAA (p.P61*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3850914_3850915insTTTA"	""	"pathogenic"	""
"0000649312"	"1"	"10"	"16"	"3777836"	"3777836"	"subst"	"0.016413"	"03575"	"CREBBP_000320"	"g.3777836T>C"	"38/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"38 heterozygous, no homozygous; {DB:CLININrs55916120}"	"Germline"	""	"rs55916120"	"0"	""	""	"g.3727835T>C"	""	"benign"	""
"0000649313"	"1"	"70"	"16"	"3786766"	"3786766"	"subst"	"0"	"03575"	"CREBBP_000033"	"g.3786766T>C"	"1/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs587783496}"	"Germline"	""	"rs587783496"	"0"	""	""	"g.3736765T>C"	""	"likely pathogenic"	""
"0000649314"	"1"	"90"	"16"	"3790541"	"3790541"	"del"	"0"	"03575"	"CREBBP_000321"	"g.3790541del"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs794727391}"	"Germline"	""	"rs794727391"	"0"	""	""	"g.3740540del"	""	"pathogenic"	""
"0000649315"	"1"	"30"	"16"	"3820723"	"3820723"	"subst"	"0.00248178"	"03575"	"CREBBP_000220"	"g.3820723T>C"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs143247685}"	"Germline"	""	"rs143247685"	"0"	""	""	"g.3770722T>C"	""	"likely benign"	""
"0000649316"	"1"	"10"	"16"	"3828172"	"3828172"	"subst"	"0.0147921"	"03575"	"CREBBP_000287"	"g.3828172A>G"	"20/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"20 heterozygous, no homozygous; {DB:CLININrs130003}"	"Germline"	""	"rs130003"	"0"	""	""	"g.3778171A>G"	""	"benign"	""
"0000649317"	"1"	"90"	"16"	"3842055"	"3842055"	"subst"	"0"	"03575"	"CREBBP_000322"	"g.3842055C>T"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs587783463}"	"Germline"	""	"rs587783463"	"0"	""	""	"g.3792054C>T"	""	"pathogenic"	""
"0000649318"	"1"	"90"	"16"	"3900799"	"3900799"	"del"	"0"	"03575"	"CREBBP_000323"	"g.3900799del"	"8/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"8 heterozygous, no homozygous; {DB:CLININrs587783477}"	"Germline"	""	"rs587783477"	"0"	""	""	"g.3850798del"	""	"pathogenic"	""
"0000653528"	"0"	"70"	"16"	"3779104"	"3779104"	"del"	"0"	"01164"	"CREBBP_000324"	"g.3779104del"	""	""	""	""	"ACMG: PVS1,PM2; Lee et al. 2015. Brain 4: 402"	"Germline"	""	""	"0"	""	""	"g.3729103del"	""	"likely pathogenic"	"ACMG"
"0000657843"	"0"	"50"	"16"	"3781420"	"3781420"	"subst"	"8.92403E-6"	"01943"	"CREBBP_000325"	"g.3781420T>G"	""	""	""	"CREBBP(NM_004380.2):c.4945A>C (p.I1649L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3731419T>G"	""	"VUS"	""
"0000657844"	"0"	"70"	"16"	"3788618"	"3788618"	"subst"	"0"	"02325"	"CREBBP_000326"	"g.3788618G>A"	""	""	""	"CREBBP(NM_004380.3):c.4336C>T (p.R1446C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3738617G>A"	""	"likely pathogenic"	""
"0000657845"	"0"	"50"	"16"	"3790490"	"3790490"	"subst"	"0"	"02325"	"CREBBP_000327"	"g.3790490C>A"	""	""	""	"CREBBP(NM_004380.3):c.4043G>T (p.R1348L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3740489C>A"	""	"VUS"	""
"0000657846"	"0"	"90"	"16"	"3801726"	"3801726"	"subst"	"0"	"02327"	"CREBBP_000166"	"g.3801726C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3751725C>T"	""	"pathogenic"	""
"0000657847"	"0"	"30"	"16"	"3823806"	"3823806"	"subst"	"0.000682799"	"01943"	"CREBBP_000328"	"g.3823806G>A"	""	""	""	"CREBBP(NM_004380.2):c.2409C>T (p.S803=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3773805G>A"	""	"likely benign"	""
"0000657848"	"0"	"30"	"16"	"3860674"	"3860674"	"subst"	"0.000154327"	"01943"	"CREBBP_000329"	"g.3860674C>T"	""	""	""	"CREBBP(NM_001079846.1):c.905G>A (p.(Ser302Asn)), CREBBP(NM_004380.2):c.905G>A (p.S302N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.3810673C>T"	""	"likely benign"	""
"0000667504"	"0"	"90"	"16"	"3781236"	"3781236"	"subst"	"0"	"00006"	"CREBBP_000330"	"g.3781236C>T"	""	"{PMID:Helbig 2016:26795593}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3731235C>T"	""	"pathogenic (dominant)"	"ACMG"
"0000673945"	"0"	"70"	"16"	"3781375"	"3781375"	"subst"	"0"	"03695"	"CREBBP_000331"	"g.3781375G>A"	""	""	""	""	""	"De novo"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000680568"	"0"	"30"	"16"	"3778285"	"3778285"	"subst"	"3.72159E-5"	"01943"	"CREBBP_000188"	"g.3778285G>A"	""	""	""	"CREBBP(NM_001079846.1):c.6649C>T (p.(Pro2217Ser)), CREBBP(NM_004380.2):c.6763C>T (p.P2255S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000680569"	"0"	"30"	"16"	"3778412"	"3778414"	"dup"	"0"	"01804"	"CREBBP_000332"	"g.3778412_3778414dup"	""	""	""	"CREBBP(NM_001079846.1):c.6533_6534insGCA (p.(Gln2178dup))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000680570"	"0"	"30"	"16"	"3778568"	"3778568"	"subst"	"1.65482E-5"	"01943"	"CREBBP_000333"	"g.3778568C>T"	""	""	""	"CREBBP(NM_004380.2):c.6480G>A (p.A2160=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000680571"	"0"	"90"	"16"	"3778724"	"3778724"	"subst"	"0"	"02329"	"CREBBP_000334"	"g.3778724G>C"	""	""	""	"CREBBP(NM_004380.3):c.6324C>G (p.Y2108*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000680572"	"0"	"50"	"16"	"3781777"	"3781777"	"subst"	"0"	"02327"	"CREBBP_000337"	"g.3781777C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000680574"	"0"	"30"	"16"	"3828037"	"3828037"	"subst"	"0"	"01943"	"CREBBP_000339"	"g.3828037T>C"	""	""	""	"CREBBP(NM_004380.2):c.2088A>G (p.P696=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000680575"	"0"	"70"	"16"	"3843422"	"3843422"	"subst"	"0"	"01943"	"CREBBP_000340"	"g.3843422T>G"	""	""	""	"CREBBP(NM_004380.2):c.1181A>C (p.H394P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000682722"	"0"	"70"	"16"	"3781192"	"3781192"	"subst"	"0"	"03753"	"CREBBP_000336"	"g.3781192C>T"	"0.045"	"{PMID:Mendonca 2021:34478740}"	""	""	""	"Somatic"	""	""	""	""	""	""	""	"pathogenic"	"ACMG"
"0000682723"	"0"	"70"	"16"	"3779200"	"3779200"	"subst"	"0"	"03753"	"CREBBP_000335"	"g.3779200G>A"	"0.197"	"{PMID:Mendonca 2021:34478740}"	""	""	""	"Somatic"	""	""	""	""	""	""	""	"pathogenic"	"ACMG"
"0000682760"	"0"	"70"	"16"	"3843624"	"3843624"	"subst"	"0"	"03753"	"CREBBP_000341"	"g.3843624G>A"	"0.05"	"{PMID:Mendonca 2021:34478740}"	""	""	""	"Somatic"	""	""	""	""	""	""	""	"pathogenic"	"ACMG"
"0000683545"	"0"	"90"	"16"	"3786719"	"3786719"	"subst"	"0"	"00006"	"CREBBP_000022"	"g.3786719G>A"	""	"{PMID:Anazi 2017:28940097}"	""	"NM_001079846.1:c.4378C>T"	"ACMG PVS1,PS2"	"De novo"	""	""	"0"	""	""	"g.3736718G>A"	""	"pathogenic (dominant)"	"ACMG"
"0000683546"	"0"	"90"	"16"	"3860698"	"3860698"	"dup"	"0"	"00006"	"CREBBP_000342"	"g.3860698dup"	""	"{PMID:Anazi 2017:28940097}"	""	""	"ACMG PVS1,PS2"	"De novo"	""	""	"0"	""	""	"g.3810697dup"	""	"pathogenic (dominant)"	"ACMG"
"0000692070"	"0"	"50"	"16"	"3779184"	"3779184"	"subst"	"0"	"01943"	"CREBBP_000343"	"g.3779184G>A"	""	""	""	"CREBBP(NM_004380.2):c.5864C>T (p.A1955V), CREBBP(NM_004380.3):c.5864C>T (p.A1955V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000698317"	"0"	"90"	"16"	"3843495"	"3843495"	"subst"	"0"	"00006"	"CREBBP_000023"	"g.3843495G>A"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3793494G>A"	""	"pathogenic"	"ACMG"
"0000698318"	"0"	"90"	"16"	"3820788"	"3820801"	"dup"	"0"	"00006"	"CREBBP_000346"	"g.3820788_3820801dup"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3770787_3770800dup"	""	"pathogenic (dominant)"	"ACMG"
"0000698319"	"0"	"90"	"16"	"3820835"	"3820835"	"dup"	"0"	"00006"	"CREBBP_000347"	"g.3820835dup"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3770834dup"	""	"pathogenic"	"ACMG"
"0000698320"	"0"	"70"	"16"	"3786138"	"3786138"	"subst"	"0"	"00006"	"CREBBP_000345"	"g.3786138C>G"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3736137C>G"	""	"likely pathogenic (dominant)"	"ACMG"
"0000698321"	"0"	"70"	"16"	"3786138"	"3786138"	"subst"	"0"	"00006"	"CREBBP_000345"	"g.3786138C>G"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3736137C>G"	""	"likely pathogenic"	"ACMG"
"0000698322"	"0"	"90"	"16"	"3781237"	"3781237"	"subst"	"0"	"00006"	"CREBBP_000246"	"g.3781237A>G"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3731236A>G"	""	"pathogenic"	"ACMG"
"0000698323"	"0"	"90"	"16"	"3778380"	"3778381"	"dup"	"0"	"00006"	"CREBBP_000344"	"g.3778380_3778381dup"	""	"{PMID:Squeo 2020:32170002}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3728379_3728380dup"	""	"pathogenic (dominant)"	"ACMG"
"0000725772"	"0"	"50"	"16"	"3777766"	"3777766"	"subst"	"0"	"02329"	"CREBBP_000247"	"g.3777766C>G"	""	""	""	"CREBBP(NM_004380.2):c.7282G>C (p.G2428R, p.(Gly2428Arg)), CREBBP(NM_004380.3):c.7282G>C (p.G2428R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725773"	"0"	"30"	"16"	"3777792"	"3777792"	"subst"	"0.00019499"	"02327"	"CREBBP_000348"	"g.3777792G>A"	""	""	""	"CREBBP(NM_004380.3):c.7256C>T (p.A2419V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725774"	"0"	"50"	"16"	"3777886"	"3777886"	"subst"	"2.03557E-5"	"02329"	"CREBBP_000248"	"g.3777886C>T"	""	""	""	"CREBBP(NM_004380.3):c.7162G>A (p.A2388T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725775"	"0"	"30"	"16"	"3778591"	"3778591"	"subst"	"2.07051E-5"	"01943"	"CREBBP_000349"	"g.3778591C>T"	""	""	""	"CREBBP(NM_004380.2):c.6457G>A (p.G2153S, p.(Gly2153Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725776"	"0"	"50"	"16"	"3778613"	"3778613"	"subst"	"1.65134E-5"	"02329"	"CREBBP_000299"	"g.3778613C>A"	""	""	""	"CREBBP(NM_004380.3):c.6435G>T (p.M2145I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725777"	"0"	"70"	"16"	"3779592"	"3779592"	"subst"	"0"	"02329"	"CREBBP_000205"	"g.3779592C>A"	""	""	""	"CREBBP(NM_004380.3):c.5456G>T (p.C1819F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000725778"	"0"	"30"	"16"	"3779621"	"3779621"	"subst"	"0"	"01943"	"CREBBP_000350"	"g.3779621T>C"	""	""	""	"CREBBP(NM_004380.2):c.5427A>G (p.K1809=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725779"	"0"	"70"	"16"	"3781471"	"3781471"	"subst"	"0"	"02329"	"CREBBP_000266"	"g.3781471A>G"	""	""	""	"CREBBP(NM_004380.3):c.4894T>C (p.F1632L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000725780"	"0"	"30"	"16"	"3786717"	"3786717"	"subst"	"0.000714657"	"01943"	"CREBBP_000352"	"g.3786717T>C"	""	""	""	"CREBBP(NM_004380.2):c.4494A>G (p.R1498=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725781"	"0"	"50"	"16"	"3786772"	"3786772"	"subst"	"0"	"02325"	"CREBBP_000353"	"g.3786772T>C"	""	""	""	"CREBBP(NM_004380.3):c.4439A>G (p.D1480G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725782"	"0"	"50"	"16"	"3788671"	"3788671"	"subst"	"0"	"02329"	"CREBBP_000307"	"g.3788671C>T"	""	""	""	"CREBBP(NM_004380.3):c.4283G>A (p.R1428H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725783"	"0"	"50"	"16"	"3788685"	"3788685"	"subst"	"0"	"02329"	"CREBBP_000268"	"g.3788685A>C"	""	""	""	"CREBBP(NM_004380.3):c.4281-12T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725784"	"0"	"50"	"16"	"3820605"	"3820605"	"subst"	"5.28761E-5"	"02329"	"CREBBP_000218"	"g.3820605G>A"	""	""	""	"CREBBP(NM_004380.2):c.2846C>T (p.P949L), CREBBP(NM_004380.3):c.2846C>T (p.P949L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725785"	"0"	"30"	"16"	"3820723"	"3820723"	"subst"	"0.000219339"	"01804"	"CREBBP_000354"	"g.3820723T>A"	""	""	""	"CREBBP(NM_001079846.1):c.2614A>T (p.(Thr872Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725786"	"0"	"30"	"16"	"3820723"	"3820723"	"subst"	"0.00248178"	"02326"	"CREBBP_000220"	"g.3820723T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2614A>G (p.(Thr872Ala)), CREBBP(NM_004380.2):c.2728A>G (p.T910A), CREBBP(NM_004380.3):c.2728A>G (p.T910A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725787"	"0"	"50"	"16"	"3823795"	"3823795"	"subst"	"0"	"01943"	"CREBBP_000355"	"g.3823795C>G"	""	""	""	"CREBBP(NM_004380.2):c.2420G>C (p.S807T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725788"	"0"	"50"	"16"	"3823805"	"3823805"	"subst"	"2.84444E-5"	"01943"	"CREBBP_000356"	"g.3823805C>T"	""	""	""	"CREBBP(NM_004380.2):c.2410G>A (p.G804R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725789"	"0"	"50"	"16"	"3827631"	"3827631"	"subst"	"0"	"02325"	"CREBBP_000358"	"g.3827631C>T"	""	""	""	"CREBBP(NM_004380.3):c.2141G>A (p.R714H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725790"	"0"	"30"	"16"	"3828818"	"3828818"	"subst"	"8.12222E-6"	"01943"	"CREBBP_000359"	"g.3828818G>A"	""	""	""	"CREBBP(NM_004380.2):c.1824C>T (p.L608=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725791"	"0"	"50"	"16"	"3831241"	"3831241"	"subst"	"4.06078E-6"	"01943"	"CREBBP_000360"	"g.3831241G>A"	""	""	""	"CREBBP(NM_004380.2):c.1640C>T (p.S547L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000725792"	"0"	"30"	"16"	"3900763"	"3900763"	"subst"	"0.000625828"	"01943"	"CREBBP_000362"	"g.3900763G>A"	""	""	""	"CREBBP(NM_004380.2):c.333C>T (p.N111=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000725793"	"0"	"10"	"16"	"3900803"	"3900803"	"subst"	"0.000508047"	"02325"	"CREBBP_000363"	"g.3900803C>A"	""	""	""	"CREBBP(NM_004380.3):c.293G>T (p.G98V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000729885"	"0"	"90"	"16"	"3860699"	"3860699"	"dup"	"0"	"00000"	"CREBBP_000361"	"g.3860699dup"	""	"{PMID:Maddirevula 2018:29620724}"	""	"NM_004380.2:c.881dup:p.(Asn294Lysfs*56)"	""	"De novo"	""	""	"0"	""	""	"g.3810698dup"	""	"likely pathogenic (dominant)"	""
"0000729886"	"0"	"90"	"16"	"3781775"	"3781775"	"subst"	"0"	"00000"	"CREBBP_000351"	"g.3781775A>G"	""	"{PMID:Maddirevula 2018:29620724}"	""	"NM_004380.2:c.4890+2T>C"	""	"De novo"	""	""	"0"	""	""	"g.3731774A>G"	""	"likely pathogenic (dominant)"	""
"0000729887"	"0"	"90"	"16"	"3824650"	"3824650"	"del"	"0"	"00000"	"CREBBP_000357"	"g.3824650del"	""	"{PMID:Maddirevula 2018:29620724}"	""	"NM_004380.2:c.2204del:p.(Pro735Hisfs*13)"	""	"De novo"	""	""	"0"	""	""	"g.3774649del"	""	"likely pathogenic (dominant)"	""
"0000763100"	"1"	"90"	"16"	"3781775"	"3781775"	"subst"	"0"	"00006"	"CREBBP_000351"	"g.3781775A>G"	""	"{PMID:Anazi 2017:27431290}"	""	"c.4892+2T>C"	"ACMG PVS1, PS2"	"De novo"	""	""	"0"	""	""	"g.3731774A>G"	""	"pathogenic"	"ACMG"
"0000763263"	"1"	"90"	"16"	"3824650"	"3824650"	"del"	"0"	"00006"	"CREBBP_000357"	"g.3824650del"	""	"{PMID:Anazi 2017:27431290}"	""	"NM_001079846.1:c.2090del"	"ACMG PVS1, PM2, PM6"	"Germline"	""	""	"0"	""	""	"g.3774649del"	""	"pathogenic"	"ACMG"
"0000763265"	"1"	"70"	"16"	"3779434"	"3779434"	"subst"	"0"	"00006"	"CREBBP_000180"	"g.3779434T>C"	""	"{PMID:Anazi 2017:27431290}"	""	"NM_001079846.1:c.5500A>G"	"ACMG PS2, PM2, PP3"	"De novo"	""	""	"0"	""	""	"g.3729433T>C"	""	"likely pathogenic"	"ACMG"
"0000786663"	"0"	"50"	"16"	"3779464"	"3779464"	"subst"	"0"	"00006"	"CREBBP_000364"	"g.3779464C>G"	""	"{PMID:Lefebvre 2021:32732226}"	""	"NM_001079846.1:c.5470G>C"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3729463C>G"	""	"VUS"	""
"0000807390"	"0"	"50"	"16"	"3778439"	"3778450"	"del"	"0"	"02325"	"CREBBP_000365"	"g.3778439_3778450del"	""	""	""	"CREBBP(NM_004380.3):c.6612_6623delGCAGCAGCAACA (p.Q2213_Q2216del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000807391"	"0"	"30"	"16"	"3778853"	"3778853"	"subst"	"0.000179702"	"01943"	"CREBBP_000366"	"g.3778853G>A"	""	""	""	"CREBBP(NM_004380.2):c.6195C>T (p.S2065=), CREBBP(NM_004380.3):c.6195C>T (p.S2065=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807392"	"0"	"70"	"16"	"3779445"	"3779445"	"subst"	"0"	"01804"	"CREBBP_000182"	"g.3779445C>T"	""	""	""	"CREBBP(NM_004380.2):c.5603G>A (p.(Arg1868Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000807393"	"0"	"30"	"16"	"3781175"	"3781175"	"subst"	"0"	"02326"	"CREBBP_000367"	"g.3781175G>A"	""	""	""	"CREBBP(NM_004380.3):c.5172+18C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807394"	"0"	"30"	"16"	"3781770"	"3781770"	"subst"	"1.23058E-5"	"01943"	"CREBBP_000368"	"g.3781770C>G"	""	""	""	"CREBBP(NM_004380.2):c.4890+7G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807395"	"0"	"30"	"16"	"3807376"	"3807376"	"subst"	"0.000126682"	"02325"	"CREBBP_000369"	"g.3807376T>A"	""	""	""	"CREBBP(NM_001079846.1):c.3497A>T (p.(Tyr1166Phe)), CREBBP(NM_004380.3):c.3611A>T (p.Y1204F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807396"	"0"	"30"	"16"	"3817843"	"3817843"	"subst"	"0.00255456"	"01804"	"CREBBP_000370"	"g.3817843G>A"	""	""	""	"CREBBP(NM_001079846.1):c.3014C>T (p.(Ser1005Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807397"	"0"	"30"	"16"	"3824553"	"3824553"	"subst"	"2.43645E-5"	"02326"	"CREBBP_000371"	"g.3824553C>A"	""	""	""	"CREBBP(NM_004380.3):c.2283+17G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807398"	"0"	"30"	"16"	"3824559"	"3824559"	"subst"	"3.65456E-5"	"02326"	"CREBBP_000372"	"g.3824559A>G"	""	""	""	"CREBBP(NM_004380.3):c.2283+11T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807399"	"0"	"50"	"16"	"3824634"	"3824634"	"subst"	"0"	"01943"	"CREBBP_000373"	"g.3824634C>T"	""	""	""	"CREBBP(NM_004380.2):c.2219G>A (p.G740E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000807400"	"0"	"30"	"16"	"3860674"	"3860674"	"subst"	"0.000154327"	"01804"	"CREBBP_000329"	"g.3860674C>T"	""	""	""	"CREBBP(NM_001079846.1):c.905G>A (p.(Ser302Asn)), CREBBP(NM_004380.2):c.905G>A (p.S302N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807401"	"0"	"30"	"16"	"3900336"	"3900336"	"subst"	"0.00068361"	"01943"	"CREBBP_000374"	"g.3900336C>T"	""	""	""	"CREBBP(NM_004380.2):c.760G>A (p.A254T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807402"	"0"	"30"	"16"	"3900384"	"3900384"	"subst"	"0.000434648"	"02325"	"CREBBP_000291"	"g.3900384C>G"	""	""	""	"CREBBP(NM_004380.3):c.712G>C (p.(Val238Leu), p.V238L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000807403"	"0"	"50"	"16"	"3900872"	"3900872"	"subst"	"0"	"01943"	"CREBBP_000375"	"g.3900872C>T"	""	""	""	"CREBBP(NM_004380.2):c.224G>A (p.R75Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000807404"	"0"	"30"	"16"	"3900880"	"3900880"	"subst"	"0.000129965"	"01804"	"CREBBP_000376"	"g.3900880C>A"	""	""	""	"CREBBP(NM_001079846.1):c.216G>T (p.(Glu72Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000831178"	"0"	"50"	"16"	"3779035"	"3779035"	"subst"	"0"	"01164"	"CREBBP_000377"	"g.3779035G>A"	""	""	""	""	"ACMG: PM2_SUP, PP2"	"Germline"	"?"	""	""	""	""	""	""	"VUS"	"ACMG"
"0000837163"	"0"	"70"	"16"	"3779682"	"3779682"	"subst"	"0"	"02494"	"CREBBP_000378"	"g.3779682T>C"	""	""	""	""	""	"De novo"	""	""	""	""	""	""	""	"likely pathogenic (dominant)"	""
"0000854506"	"0"	"30"	"16"	"3779162"	"3779162"	"subst"	"0.000100185"	"01943"	"CREBBP_000381"	"g.3779162G>A"	""	""	""	"CREBBP(NM_004380.2):c.5886C>T (p.I1962=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854507"	"0"	"30"	"16"	"3779248"	"3779248"	"subst"	"0.000358886"	"02325"	"CREBBP_000201"	"g.3779248A>G"	""	""	""	"CREBBP(NM_001079846.1):c.5686T>C (p.(Ser1896Pro)), CREBBP(NM_004380.3):c.5800T>C (p.S1934P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854508"	"0"	"70"	"16"	"3779530"	"3779530"	"subst"	"0"	"02327"	"CREBBP_000382"	"g.3779530C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000854509"	"0"	"30"	"16"	"3789635"	"3789635"	"subst"	"0"	"02326"	"CREBBP_000386"	"g.3789635G>A"	""	""	""	"CREBBP(NM_004380.3):c.4224C>T (p.C1408=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000854510"	"0"	"90"	"16"	"3794931"	"3794931"	"del"	"0"	"02327"	"CREBBP_000387"	"g.3794931del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000854511"	"0"	"50"	"16"	"3808937"	"3808937"	"subst"	"0"	"01804"	"CREBBP_000388"	"g.3808937G>A"	""	""	""	"CREBBP(NM_001079846.1):c.3173C>T (p.(Pro1058Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000854512"	"0"	"50"	"16"	"3823760"	"3823760"	"subst"	"4.47865E-5"	"01943"	"CREBBP_000390"	"g.3823760C>T"	""	""	""	"CREBBP(NM_004380.2):c.2455G>A (p.V819M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864795"	"0"	"10"	"16"	"3777836"	"3777836"	"subst"	"0.016413"	"01804"	"CREBBP_000320"	"g.3777836T>C"	""	""	""	"CREBBP(NM_001079846.1):c.7098A>G (p.(Glu2366=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000864796"	"0"	"30"	"16"	"3778199"	"3778199"	"subst"	"0.000749698"	"01943"	"CREBBP_000379"	"g.3778199G>A"	""	""	""	"CREBBP(NM_004380.2):c.6849C>T (p.S2283=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864797"	"0"	"30"	"16"	"3778424"	"3778424"	"subst"	"0"	"01943"	"CREBBP_000380"	"g.3778424T>C"	""	""	""	"CREBBP(NM_004380.2):c.6624A>G (p.Q2208=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864798"	"0"	"30"	"16"	"3778933"	"3778933"	"subst"	"2.20632E-5"	"02325"	"CREBBP_000196"	"g.3778933C>T"	""	""	""	"CREBBP(NM_001079846.1):c.6001G>A (p.(Val2001Met)), CREBBP(NM_004380.3):c.6115G>A (p.V2039M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864799"	"0"	"50"	"16"	"3781218"	"3781218"	"subst"	"0"	"02327"	"CREBBP_000383"	"g.3781218G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864800"	"0"	"50"	"16"	"3786721"	"3786721"	"subst"	"0"	"01943"	"CREBBP_000384"	"g.3786721T>G"	""	""	""	"CREBBP(NM_004380.2):c.4490A>C (p.K1497T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864801"	"0"	"30"	"16"	"3788552"	"3788552"	"subst"	"1.22344E-5"	"01943"	"CREBBP_000385"	"g.3788552A>G"	""	""	""	"CREBBP(NM_004380.2):c.4394+8T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864802"	"0"	"50"	"16"	"3820605"	"3820605"	"subst"	"5.28761E-5"	"01943"	"CREBBP_000218"	"g.3820605G>A"	""	""	""	"CREBBP(NM_004380.2):c.2846C>T (p.P949L), CREBBP(NM_004380.3):c.2846C>T (p.P949L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864803"	"0"	"30"	"16"	"3820855"	"3820855"	"subst"	"2.03171E-5"	"01804"	"CREBBP_000389"	"g.3820855T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2482A>G (p.(Met828Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864804"	"0"	"30"	"16"	"3828818"	"3828818"	"subst"	"0"	"01804"	"CREBBP_000391"	"g.3828818G>C"	""	""	""	"CREBBP(NM_001079846.1):c.1710C>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000864805"	"0"	"50"	"16"	"3900407"	"3900407"	"subst"	"4.06088E-6"	"02325"	"CREBBP_000392"	"g.3900407G>A"	""	""	""	"CREBBP(NM_004380.3):c.689C>T (p.A230V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864806"	"0"	"50"	"16"	"3900452"	"3900452"	"subst"	"0"	"02325"	"CREBBP_000393"	"g.3900452G>T"	""	""	""	"CREBBP(NM_004380.3):c.644C>A (p.A215D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000864807"	"0"	"10"	"16"	"3900637"	"3900637"	"subst"	"0.0109062"	"01804"	"CREBBP_000394"	"g.3900637C>T"	""	""	""	"CREBBP(NM_001079846.1):c.459G>A (p.(Pro153=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000864808"	"0"	"30"	"16"	"3900919"	"3900919"	"subst"	"0.000402089"	"01943"	"CREBBP_000395"	"g.3900919A>T"	""	""	""	"CREBBP(NM_004380.2):c.177T>A (p.L59=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000874759"	"0"	"30"	"16"	"3807302"	"3807302"	"subst"	"0"	"03779"	"CREBBP_000396"	"g.3807302T>C"	""	""	""	""	""	"CLASSIFICATION record"	""	""	"0"	""	""	""	""	"likely benign"	""
"0000892974"	"0"	"30"	"16"	"3778363"	"3778363"	"subst"	"0.00189558"	"01804"	"CREBBP_000189"	"g.3778363C>T"	""	""	""	"CREBBP(NM_001079846.1):c.6571G>A (p.(Gly2191Ser)), CREBBP(NM_004380.2):c.6685G>A (p.G2229S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892975"	"0"	"50"	"16"	"3778708"	"3778708"	"subst"	"8.99626E-5"	"02325"	"CREBBP_000397"	"g.3778708C>T"	""	""	""	"CREBBP(NM_004380.3):c.6340G>A (p.G2114S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000892976"	"0"	"30"	"16"	"3778853"	"3778853"	"subst"	"0.000179702"	"02326"	"CREBBP_000366"	"g.3778853G>A"	""	""	""	"CREBBP(NM_004380.2):c.6195C>T (p.S2065=), CREBBP(NM_004380.3):c.6195C>T (p.S2065=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892977"	"0"	"30"	"16"	"3778976"	"3778976"	"subst"	"7.9443E-5"	"02325"	"CREBBP_000398"	"g.3778976C>T"	""	""	""	"CREBBP(NM_004380.3):c.6072G>A (p.A2024=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892978"	"0"	"30"	"16"	"3779211"	"3779211"	"subst"	"4.81726E-5"	"02326"	"CREBBP_000200"	"g.3779211G>T"	""	""	""	"CREBBP(NM_004380.3):c.5837C>A (p.P1946Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892979"	"0"	"30"	"16"	"3779248"	"3779248"	"subst"	"0.000358886"	"02326"	"CREBBP_000201"	"g.3779248A>G"	""	""	""	"CREBBP(NM_001079846.1):c.5686T>C (p.(Ser1896Pro)), CREBBP(NM_004380.3):c.5800T>C (p.S1934P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892980"	"0"	"50"	"16"	"3788632"	"3788632"	"subst"	"2.43817E-5"	"01804"	"CREBBP_000399"	"g.3788632C>T"	""	""	""	"CREBBP(NM_001079846.1):c.4208G>A (p.(Arg1403Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000892981"	"0"	"90"	"16"	"3789614"	"3789627"	"del"	"0"	"02327"	"CREBBP_000400"	"g.3789614_3789627del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000892982"	"0"	"30"	"16"	"3790554"	"3790554"	"subst"	"4.0619E-6"	"02325"	"CREBBP_000401"	"g.3790554G>A"	""	""	""	"CREBBP(NM_004380.3):c.3983-4C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892983"	"0"	"30"	"16"	"3807282"	"3807282"	"subst"	"0.000651999"	"01804"	"CREBBP_000402"	"g.3807282C>T"	""	""	""	"CREBBP(NM_001079846.1):c.3584+7G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892984"	"0"	"50"	"16"	"3808928"	"3808928"	"subst"	"0"	"01804"	"CREBBP_000403"	"g.3808928T>G"	""	""	""	"CREBBP(NM_004380.2):c.3296A>C (p.(Glu1099Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000892985"	"0"	"30"	"16"	"3824614"	"3824614"	"subst"	"0.000190846"	"01804"	"CREBBP_000404"	"g.3824614T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2125A>G (p.(Met709Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892986"	"0"	"90"	"16"	"3828099"	"3828099"	"subst"	"0"	"02327"	"CREBBP_000405"	"g.3828099G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000892988"	"0"	"50"	"16"	"3830774"	"3830774"	"subst"	"0"	"02329"	"CREBBP_000407"	"g.3830774T>G"	""	""	""	"CREBBP(NM_004380.3):c.1782A>C (p.E594D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000892989"	"0"	"30"	"16"	"3900384"	"3900384"	"subst"	"0.000434648"	"02326"	"CREBBP_000291"	"g.3900384C>G"	""	""	""	"CREBBP(NM_004380.3):c.712G>C (p.(Val238Leu), p.V238L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000892990"	"0"	"90"	"16"	"3900624"	"3900624"	"subst"	"0"	"02327"	"CREBBP_000138"	"g.3900624G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000892991"	"0"	"50"	"16"	"3900956"	"3900956"	"subst"	"1.62566E-5"	"02325"	"CREBBP_000295"	"g.3900956T>C"	""	""	""	"CREBBP(NM_001079846.1):c.140A>G (p.(Asn47Ser)), CREBBP(NM_004380.2):c.140A>G (p.N47S), CREBBP(NM_004380.3):c.140A>G (p.N47S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000892992"	"0"	"70"	"16"	"3930655"	"3930655"	"subst"	"0"	"02329"	"CREBBP_000408"	"g.3930655G>C"	""	""	""	"CREBBP(NM_004380.3):c.-738C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000908923"	"0"	"90"	"16"	"3789725"	"3789725"	"subst"	"0"	"00006"	"CREBBP_000409"	"g.3789725C>A"	""	"{PMID:Bournazos 2022:34906502}"	""	""	"exon skipping, intron retention"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3739724C>A"	""	"pathogenic (dominant)"	""
"0000909190"	"0"	"50"	"16"	"3828062"	"3828062"	"subst"	"8.1215E-6"	"01164"	"CREBBP_000410"	"g.3828062G>A"	""	""	""	""	"ACMG: PM2_SUP, PP2"	"Germline"	"?"	""	""	""	""	""	"VCV000588969.4"	"VUS"	"ACMG"
"0000914626"	"0"	"50"	"16"	"3778314"	"3778316"	"dup"	"0"	"02325"	"CREBBP_000411"	"g.3778314_3778316dup"	""	""	""	"CREBBP(NM_004380.3):c.6743_6745dupAGC (p.Q2248dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000914627"	"0"	"30"	"16"	"3778359"	"3778359"	"subst"	"0"	"01804"	"CREBBP_000412"	"g.3778359T>C"	""	""	""	"CREBBP(NM_004380.2):c.6689A>G (p.(Gln2230Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000914628"	"0"	"50"	"16"	"3779158"	"3779158"	"subst"	"0"	"02325"	"CREBBP_000199"	"g.3779158G>A"	""	""	""	"CREBBP(NM_004380.2):c.5890C>T (p.R1964C), CREBBP(NM_004380.3):c.5890C>T (p.R1964C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000914629"	"0"	"30"	"16"	"3827627"	"3827627"	"subst"	"0"	"02326"	"CREBBP_000413"	"g.3827627C>G"	""	""	""	"CREBBP(NM_004380.3):c.2145G>C (p.M715I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000918945"	"0"	"50"	"16"	"3778328"	"3778328"	"subst"	"0"	"01164"	"CREBBP_000414"	"g.3778328G>C"	""	""	""	""	"PVS1_MOD, PM2_SUP"	"Germline"	"?"	""	""	""	""	""	""	"VUS"	"ACMG"
"0000921075"	"11"	"50"	"16"	"3781234"	"3781234"	"subst"	"0"	"03544"	"CREBBP_000415"	"g.3781234T>C"	""	""	""	""	"inherited from unaffected father, borderline classification of pathogenicity VUS-LP, possible incomplete penetrance"	"Germline"	"?"	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000921872"	"0"	"90"	"16"	"3823900"	"3823907"	"dup"	"0"	"00006"	"CREBBP_000416"	"g.3823900_3823907dup"	""	"{PMID:Jackson 2020:32830442}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.3773899_3773906dup"	""	"pathogenic (dominant)"	""
"0000926282"	"0"	"30"	"16"	"3777792"	"3777792"	"subst"	"0.00019499"	"02325"	"CREBBP_000348"	"g.3777792G>A"	""	""	""	"CREBBP(NM_004380.3):c.7256C>T (p.A2419V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000926283"	"0"	"50"	"16"	"3778476"	"3778476"	"subst"	"0"	"02329"	"CREBBP_000417"	"g.3778476T>C"	""	""	""	"CREBBP(NM_004380.3):c.6572A>G (p.E2191G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926284"	"0"	"70"	"16"	"3779478"	"3779498"	"del"	"0"	"02325"	"CREBBP_000418"	"g.3779478_3779498del"	""	""	""	"CREBBP(NM_004380.3):c.5555_5575delAGCAGCAGATCCAGCACCGCC (p.Q1852_R1858del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000926285"	"0"	"30"	"16"	"3820723"	"3820723"	"subst"	"0.00248178"	"01804"	"CREBBP_000220"	"g.3820723T>C"	""	""	""	"CREBBP(NM_001079846.1):c.2614A>G (p.(Thr872Ala)), CREBBP(NM_004380.2):c.2728A>G (p.T910A), CREBBP(NM_004380.3):c.2728A>G (p.T910A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000926286"	"0"	"90"	"16"	"3823756"	"3823756"	"subst"	"0"	"02327"	"CREBBP_000419"	"g.3823756G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000926287"	"0"	"50"	"16"	"3832832"	"3832832"	"subst"	"8.12137E-6"	"02325"	"CREBBP_000420"	"g.3832832T>C"	""	""	""	"CREBBP(NM_004380.3):c.1426A>G (p.I476V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000927864"	"0"	"50"	"16"	"3807935"	"3807935"	"subst"	"0"	"01164"	"CREBBP_000421"	"g.3807935T>C"	""	""	""	""	"ACMG: PM1, PM2_SUP, PP2"	"Germline"	"?"	""	"0"	""	""	"g.3757934T>C"	""	"VUS (!)"	"ACMG"
"0000930602"	"0"	"50"	"16"	"3778992"	"3778992"	"subst"	"1.85365E-5"	"02325"	"CREBBP_000422"	"g.3778992C>A"	""	""	""	"CREBBP(NM_004380.3):c.6056G>T (p.(Gly2019Val), p.G2019V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000930603"	"0"	"30"	"16"	"3779309"	"3779309"	"subst"	"4.45321E-5"	"02326"	"CREBBP_000423"	"g.3779309G>A"	""	""	""	"CREBBP(NM_004380.3):c.5739C>T (p.P1913=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000930604"	"0"	"30"	"16"	"3807376"	"3807376"	"subst"	"0.000126682"	"01804"	"CREBBP_000369"	"g.3807376T>A"	""	""	""	"CREBBP(NM_001079846.1):c.3497A>T (p.(Tyr1166Phe)), CREBBP(NM_004380.3):c.3611A>T (p.Y1204F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000930605"	"0"	"30"	"16"	"3830823"	"3830823"	"subst"	"0"	"02327"	"CREBBP_000424"	"g.3830823G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000932950"	"0"	"50"	"16"	"3819231"	"3819231"	"subst"	"0"	"01164"	"CREBBP_000426"	"g.3819231G>T"	""	""	""	""	"ACMG: PS2_MOD, PM2_SUP, PP2, BP4"	"De novo"	"-"	""	"0"	""	""	"g.3769230G>T"	""	"VUS (!)"	"ACMG"
"0000933285"	"0"	"70"	"16"	"3778911"	"3778911"	"subst"	"1.72184E-5"	"00006"	"CREBBP_000427"	"g.3778911G>A"	""	"{PMID:Yuan 2019:30158690}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3728910G>A"	""	"likely pathogenic"	""
"0000939823"	"0"	"70"	"16"	"3779565"	"3779567"	"del"	"0"	"00006"	"CREBBP_000428"	"g.3779565_3779567del"	""	"{PMID:Nambot 2018:29095811}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.3729564_3729566del"	""	"likely pathogenic (dominant)"	""
"0000950657"	"0"	"50"	"16"	"3778206"	"3778206"	"subst"	"0"	"02325"	"CREBBP_000429"	"g.3778206G>A"	""	""	""	"CREBBP(NM_004380.3):c.6842C>T (p.A2281V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000950658"	"0"	"50"	"16"	"3778449"	"3778454"	"del"	"0"	"02325"	"CREBBP_000430"	"g.3778449_3778454del"	""	""	""	"CREBBP(NM_004380.3):c.6603_6608delGCAGCA (p.Q2215_Q2216del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000950659"	"0"	"30"	"16"	"3817766"	"3817766"	"subst"	"7.71517E-5"	"02325"	"CREBBP_000431"	"g.3817766C>A"	""	""	""	"CREBBP(NM_004380.3):c.3205G>T (p.G1069C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968357"	"0"	"30"	"16"	"3777746"	"3777746"	"subst"	"0.000698466"	"02327"	"CREBBP_000186"	"g.3777746C>T"	""	""	""	"CREBBP(NM_004380.2):c.7302G>A (p.T2434=), CREBBP(NM_004380.3):c.7302G>A (p.(Thr2434=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968358"	"0"	"30"	"16"	"3777886"	"3777886"	"subst"	"2.03557E-5"	"02325"	"CREBBP_000248"	"g.3777886C>T"	""	""	""	"CREBBP(NM_004380.3):c.7162G>A (p.A2388T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968364"	"0"	"30"	"16"	"3779309"	"3779309"	"subst"	"4.45321E-5"	"02325"	"CREBBP_000423"	"g.3779309G>A"	""	""	""	"CREBBP(NM_004380.3):c.5739C>T (p.P1913=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000968370"	"0"	"70"	"16"	"3823841"	"3823841"	"subst"	"0"	"02326"	"CREBBP_000433"	"g.3823841G>A"	""	""	""	"CREBBP(NM_004380.3):c.2374C>T (p.Q792*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000968371"	"0"	"30"	"16"	"3860700"	"3860700"	"subst"	"0.000564554"	"02327"	"CREBBP_000290"	"g.3860700C>T"	""	""	""	"CREBBP(NM_004380.2):c.879G>A (p.V293=), CREBBP(NM_004380.3):c.879G>A (p.(Val293=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000971519"	"0"	"70"	"16"	"3795280"	"3795280"	"dup"	"0"	"01164"	"CREBBP_000432"	"g.3795280dup"	""	""	""	""	"ACMG: PVS1, PS2_SUP, PM2_SUP"	"De novo"	"-"	""	"0"	""	""	"g.3745279dup"	""	"pathogenic (dominant)"	"ACMG"
"0000981886"	"0"	"30"	"16"	"3777864"	"3777864"	"subst"	"1.21915E-5"	"01804"	"CREBBP_000434"	"g.3777864A>G"	""	""	""	"CREBBP(NM_004380.3):c.7184T>C (p.(Ile2395Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981887"	"0"	"30"	"16"	"3778196"	"3778196"	"subst"	"0.000134393"	"01804"	"CREBBP_000435"	"g.3778196G>C"	""	""	""	"CREBBP(NM_004380.3):c.6852C>G (p.(Thr2284=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981888"	"0"	"30"	"16"	"3778392"	"3778392"	"subst"	"0.000153923"	"01804"	"CREBBP_000190"	"g.3778392G>A"	""	""	""	"CREBBP(NM_004380.2):c.6656C>T (p.A2219V), CREBBP(NM_004380.3):c.6656C>T (p.(Ala2219Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981889"	"0"	"50"	"16"	"3778484"	"3778484"	"subst"	"0"	"02325"	"CREBBP_000436"	"g.3778484C>A"	""	""	""	"CREBBP(NM_004380.3):c.6564G>T (p.Q2188H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981890"	"0"	"50"	"16"	"3778596"	"3778596"	"subst"	"4.14202E-6"	"01804"	"CREBBP_000437"	"g.3778596C>A"	""	""	""	"CREBBP(NM_004380.3):c.6452G>T (p.(Arg2151Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981891"	"0"	"30"	"16"	"3778604"	"3778604"	"subst"	"0.000107655"	"01804"	"CREBBP_000252"	"g.3778604G>A"	""	""	""	"CREBBP(NM_004380.3):c.6444C>T (p.(Gly2148=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981892"	"0"	"50"	"16"	"3778867"	"3778867"	"subst"	"0"	"01804"	"CREBBP_000438"	"g.3778867T>A"	""	""	""	"CREBBP(NM_004380.3):c.6181A>T (p.(Ser2061Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981893"	"0"	"50"	"16"	"3778974"	"3778974"	"subst"	"0"	"01804"	"CREBBP_000439"	"g.3778974G>A"	""	""	""	"CREBBP(NM_004380.3):c.6074C>T (p.(Pro2025Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981894"	"0"	"30"	"16"	"3778992"	"3778992"	"subst"	"1.85365E-5"	"01804"	"CREBBP_000422"	"g.3778992C>A"	""	""	""	"CREBBP(NM_004380.3):c.6056G>T (p.(Gly2019Val), p.G2019V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981895"	"0"	"90"	"16"	"3779408"	"3779409"	"del"	"0"	"01804"	"CREBBP_000113"	"g.3779408_3779409del"	""	""	""	"CREBBP(NM_004380.3):c.5641_5642del (p.(Leu1882Alafs*83))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000981896"	"0"	"30"	"16"	"3780901"	"3780901"	"subst"	"0"	"01804"	"CREBBP_000440"	"g.3780901G>A"	""	""	""	"CREBBP(NM_004380.3):c.5172+292C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981897"	"0"	"30"	"16"	"3807282"	"3807282"	"subst"	"5.814E-5"	"01804"	"CREBBP_000441"	"g.3807282C>G"	""	""	""	"CREBBP(NM_004380.3):c.3698+7G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981898"	"0"	"30"	"16"	"3817813"	"3817813"	"subst"	"0.000641598"	"01804"	"CREBBP_000442"	"g.3817813G>A"	""	""	""	"CREBBP(NM_004380.3):c.3158C>T (p.(Pro1053Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981899"	"0"	"30"	"16"	"3819111"	"3819111"	"subst"	"0"	"01804"	"CREBBP_000443"	"g.3819111G>A"	""	""	""	"CREBBP(NM_004380.3):c.3060+64C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000981900"	"0"	"50"	"16"	"3820939"	"3820939"	"subst"	"0"	"01804"	"CREBBP_000444"	"g.3820939G>T"	""	""	""	"CREBBP(NM_004380.3):c.2512C>A (p.(Pro838Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981901"	"0"	"50"	"16"	"3820946"	"3820946"	"subst"	"0"	"02325"	"CREBBP_000445"	"g.3820946C>A"	""	""	""	"CREBBP(NM_004380.3):c.2505G>T (p.M835I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981902"	"0"	"50"	"16"	"3823801"	"3823801"	"subst"	"4.06524E-6"	"01804"	"CREBBP_000446"	"g.3823801G>A"	""	""	""	"CREBBP(NM_004380.3):c.2414C>T (p.(Ala805Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981903"	"0"	"50"	"16"	"3828048"	"3828048"	"subst"	"0"	"01804"	"CREBBP_000447"	"g.3828048G>C"	""	""	""	"CREBBP(NM_004380.3):c.2077C>G (p.(Pro693Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981904"	"0"	"50"	"16"	"3860717"	"3860717"	"subst"	"1.21851E-5"	"01804"	"CREBBP_000448"	"g.3860717T>C"	""	""	""	"CREBBP(NM_004380.3):c.862A>G (p.(Met288Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000981905"	"0"	"50"	"16"	"3893915"	"3893915"	"subst"	"0"	"01804"	"CREBBP_000449"	"g.3893915C>T"	""	""	""	"CREBBP(NM_004380.3):c.798+6383G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000985296"	"0"	"70"	"16"	"3779821"	"3779823"	"del"	"0"	"03544"	"CREBBP_000450"	"g.3779821_3779823del"	""	""	""	""	""	"De novo"	"-"	""	"0"	""	""	"g.3729820_3729822del"	"{CV:3895541}"	"likely pathogenic"	"ACMG"
"0000987861"	"0"	"90"	"16"	"3778969"	"3778969"	"del"	"0"	"00006"	"CREBBP_000451"	"g.3778969del"	""	"{PMID:Verma 2024:38820863}, {DOI:Verma 2024:10.1016/j.scr.2024.103456}"	""	"6876delC"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3728968del"	""	"pathogenic (dominant)"	""
"0001002326"	"0"	"50"	"16"	"3777766"	"3777766"	"subst"	"0"	"01804"	"CREBBP_000247"	"g.3777766C>G"	""	""	""	"CREBBP(NM_004380.2):c.7282G>C (p.G2428R, p.(Gly2428Arg)), CREBBP(NM_004380.3):c.7282G>C (p.G2428R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002327"	"0"	"50"	"16"	"3778088"	"3778088"	"subst"	"1.21862E-5"	"01804"	"CREBBP_000452"	"g.3778088C>A"	""	""	""	"CREBBP(NM_004380.2):c.6960G>T (p.(Met2320Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002328"	"0"	"50"	"16"	"3778266"	"3778266"	"subst"	"0"	"01804"	"CREBBP_000453"	"g.3778266A>G"	""	""	""	"CREBBP(NM_004380.2):c.6782T>C (p.(Met2261Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002329"	"0"	"50"	"16"	"3778327"	"3778327"	"subst"	"0"	"01804"	"CREBBP_000454"	"g.3778327G>A"	""	""	""	"CREBBP(NM_004380.2):c.6721C>T (p.(Pro2241Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002330"	"0"	"30"	"16"	"3778390"	"3778390"	"subst"	"2.07829E-5"	"01804"	"CREBBP_000455"	"g.3778390C>T"	""	""	""	"CREBBP(NM_004380.2):c.6658G>A (p.(Gly2220Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002331"	"0"	"50"	"16"	"3778399"	"3778399"	"subst"	"0"	"01804"	"CREBBP_000456"	"g.3778399C>A"	""	""	""	"CREBBP(NM_004380.2):c.6649G>T (p.(Gly2217Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002332"	"0"	"30"	"16"	"3778591"	"3778591"	"subst"	"2.07051E-5"	"01804"	"CREBBP_000349"	"g.3778591C>T"	""	""	""	"CREBBP(NM_004380.2):c.6457G>A (p.G2153S, p.(Gly2153Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002333"	"0"	"30"	"16"	"3778687"	"3778687"	"subst"	"8.18257E-6"	"01804"	"CREBBP_000457"	"g.3778687G>A"	""	""	""	"CREBBP(NM_004380.2):c.6361C>T (p.(Leu2121Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002334"	"0"	"50"	"16"	"3778893"	"3778893"	"subst"	"0"	"01804"	"CREBBP_000458"	"g.3778893C>T"	""	""	""	"CREBBP(NM_004380.2):c.6155G>A (p.(Arg2052Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002335"	"0"	"30"	"16"	"3778911"	"3778911"	"subst"	"1.72184E-5"	"01804"	"CREBBP_000427"	"g.3778911G>A"	""	""	""	"CREBBP(NM_004380.2):c.6137C>T (p.(Ala2046Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002336"	"0"	"50"	"16"	"3779242"	"3779242"	"subst"	"0"	"01804"	"CREBBP_000459"	"g.3779242C>T"	""	""	""	"CREBBP(NM_004380.2):c.5806G>A (p.(Gly1936Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002337"	"0"	"30"	"16"	"3781932"	"3781932"	"subst"	"8.20439E-6"	"01804"	"CREBBP_000460"	"g.3781932G>C"	""	""	""	"CREBBP(NM_004380.2):c.4735C>G (p.(Gln1579Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002338"	"0"	"30"	"16"	"3789607"	"3789607"	"subst"	"3.65458E-5"	"01804"	"CREBBP_000461"	"g.3789607C>T"	""	""	""	"CREBBP(NM_004380.2):c.4252G>A (p.(Gly1418Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002339"	"0"	"70"	"16"	"3789627"	"3789627"	"subst"	"0"	"01804"	"CREBBP_000462"	"g.3789627C>A"	""	""	""	"CREBBP(NM_004380.2):c.4232G>T (p.(Gly1411Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001002340"	"0"	"70"	"16"	"3789644"	"3789652"	"del"	"0"	"01804"	"CREBBP_000463"	"g.3789644_3789652del"	""	""	""	"CREBBP(NM_004380.2):c.4209_4217delCGGCGTGGA (p.(Gly1404_Asp1406del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001002341"	"0"	"30"	"16"	"3795291"	"3795291"	"subst"	"0"	"01804"	"CREBBP_000214"	"g.3795291T>C"	""	""	""	"CREBBP(NM_004380.2):c.3901A>G (p.I1301V, p.(Ile1301Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002342"	"0"	"50"	"16"	"3795299"	"3795299"	"subst"	"4.06782E-6"	"01804"	"CREBBP_000464"	"g.3795299T>C"	""	""	""	"CREBBP(NM_004380.2):c.3893A>G (p.(Tyr1298Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002343"	"0"	"30"	"16"	"3817859"	"3817859"	"subst"	"0"	"01804"	"CREBBP_000465"	"g.3817859T>A"	""	""	""	"CREBBP(NM_004380.2):c.3112A>T (p.(Ile1038Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002344"	"0"	"30"	"16"	"3819206"	"3819206"	"subst"	"0.000178708"	"02325"	"CREBBP_000278"	"g.3819206G>A"	""	""	""	"CREBBP(NM_004380.2):c.3029C>T (p.P1010L), CREBBP(NM_004380.3):c.3029C>T (p.P1010L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002345"	"0"	"30"	"16"	"3819311"	"3819311"	"subst"	"0"	"01804"	"CREBBP_000466"	"g.3819311G>T"	""	""	""	"CREBBP(NM_004380.2):c.2924C>A (p.(Pro975His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002346"	"0"	"50"	"16"	"3820579"	"3820579"	"subst"	"0"	"01804"	"CREBBP_000467"	"g.3820579C>T"	""	""	""	"CREBBP(NM_004380.2):c.2872G>A (p.(Gly958Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002347"	"0"	"50"	"16"	"3820584"	"3820584"	"subst"	"0"	"01804"	"CREBBP_000468"	"g.3820584G>A"	""	""	""	"CREBBP(NM_004380.2):c.2867C>T (p.(Pro956Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002348"	"0"	"30"	"16"	"3823877"	"3823877"	"subst"	"0"	"01804"	"CREBBP_000469"	"g.3823877T>C"	""	""	""	"CREBBP(NM_004380.2):c.2338A>G (p.(Thr780Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002349"	"0"	"30"	"16"	"3823890"	"3823890"	"subst"	"8.12249E-6"	"01804"	"CREBBP_000470"	"g.3823890C>T"	""	""	""	"CREBBP(NM_004380.2):c.2325G>A (p.(Met775Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002350"	"0"	"30"	"16"	"3823935"	"3823935"	"subst"	"5.68731E-5"	"01804"	"CREBBP_000223"	"g.3823935C>G"	""	""	""	"CREBBP(NM_004380.2):c.2284-4G>C (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002351"	"0"	"30"	"16"	"3828009"	"3828009"	"subst"	"1.21839E-5"	"01804"	"CREBBP_000471"	"g.3828009T>C"	""	""	""	"CREBBP(NM_004380.2):c.2113+3A>G (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002352"	"0"	"50"	"16"	"3830776"	"3830776"	"subst"	"0"	"01804"	"CREBBP_000472"	"g.3830776C>T"	""	""	""	"CREBBP(NM_004380.2):c.1780G>A (p.(Glu594Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002353"	"0"	"30"	"16"	"3832765"	"3832765"	"subst"	"2.43647E-5"	"01804"	"CREBBP_000473"	"g.3832765G>A"	""	""	""	"CREBBP(NM_004380.2):c.1493C>T (p.(Thr498Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002354"	"0"	"50"	"16"	"3900510"	"3900510"	"subst"	"4.06068E-6"	"01804"	"CREBBP_000292"	"g.3900510T>C"	""	""	""	"CREBBP(NM_004380.2):c.586A>G (p.S196G, p.(Ser196Gly))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001002355"	"0"	"30"	"16"	"3900713"	"3900713"	"subst"	"0.000727222"	"02327"	"CREBBP_000229"	"g.3900713G>C"	""	""	""	"CREBBP(NM_004380.2):c.383C>G (p.S128C), CREBBP(NM_004380.3):c.383C>G (p.S128C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002356"	"0"	"30"	"16"	"3900713"	"3900713"	"subst"	"0.000727222"	"02326"	"CREBBP_000229"	"g.3900713G>C"	""	""	""	"CREBBP(NM_004380.2):c.383C>G (p.S128C), CREBBP(NM_004380.3):c.383C>G (p.S128C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002357"	"0"	"30"	"16"	"3900813"	"3900813"	"subst"	"4.06398E-6"	"01804"	"CREBBP_000474"	"g.3900813C>T"	""	""	""	"CREBBP(NM_004380.2):c.283G>A (p.(Val95Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002358"	"0"	"30"	"16"	"3900825"	"3900825"	"subst"	"2.84442E-5"	"01804"	"CREBBP_000475"	"g.3900825C>A"	""	""	""	"CREBBP(NM_004380.2):c.271G>T (p.(Ala91Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001002359"	"0"	"50"	"16"	"3929856"	"3929856"	"subst"	"0"	"01804"	"CREBBP_000476"	"g.3929856C>T"	""	""	""	"CREBBP(NM_004380.2):c.62G>A (p.(Gly21Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001015389"	"0"	"90"	"16"	"3779219"	"3779219"	"dup"	"0"	"02325"	"CREBBP_000477"	"g.3779219dup"	""	""	""	"CREBBP(NM_004380.3):c.5830dupG (p.A1944Gfs*22)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001017381"	"0"	"90"	"16"	"3830805"	"3830805"	"dup"	"0"	"03544"	"CREBBP_000478"	"g.3830805dup"	""	""	""	""	""	"De novo"	"-"	""	"0"	""	""	"g.3780804dup"	"{CV:4083511}"	"pathogenic (dominant)"	"ACMG"
"0001017382"	"0"	"90"	"16"	"3778804"	"3778804"	"subst"	"0"	"03544"	"CREBBP_000479"	"g.3778804G>A"	""	""	""	""	""	"De novo"	"-"	"rs1057518789"	"0"	""	""	"g.3728803G>A"	"{CV:373943}"	"pathogenic (dominant)"	"ACMG"
"0001017578"	"0"	"70"	"16"	"3842011"	"3842011"	"subst"	"0"	"03544"	"CREBBP_000480"	"g.3842011T>A"	""	""	""	""	""	"De novo"	"-"	""	"0"	""	""	"g.3792010T>A"	"{CV:3381760}"	"likely pathogenic"	"ACMG"
"0001026708"	"0"	"50"	"16"	"3779184"	"3779184"	"subst"	"0"	"02325"	"CREBBP_000343"	"g.3779184G>A"	""	""	""	"CREBBP(NM_004380.2):c.5864C>T (p.A1955V), CREBBP(NM_004380.3):c.5864C>T (p.A1955V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001026709"	"0"	"50"	"16"	"3786050"	"3786050"	"subst"	"0"	"02325"	"CREBBP_000481"	"g.3786050C>T"	""	""	""	"CREBBP(NM_004380.3):c.4715G>A (p.S1572N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001026710"	"0"	"30"	"16"	"3820773"	"3820773"	"subst"	"0.000978935"	"02327"	"CREBBP_000221"	"g.3820773G>A"	""	""	""	"CREBBP(NM_001079846.1):c.2564C>T (p.(Ser855Leu)), CREBBP(NM_004380.2):c.2678C>T (p.S893L), CREBBP(NM_004380.3):c.2678C>T (p.S893L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001029403"	"0"	"90"	"16"	"3929832"	"3929918"	"del"	"0"	"00006"	"CREBBP_000532"	"g.(3901011_3929832)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3851010_3879831)_(3879917_?)del"	""	"pathogenic (dominant)"	""
"0001029404"	"0"	"90"	"16"	"3929832"	"3929918"	"del"	"0"	"00006"	"CREBBP_000532"	"g.(3901011_3929832)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3851010_3879831)_(3879917_?)del"	""	"pathogenic (dominant)"	""
"0001029405"	"0"	"90"	"16"	"3808854"	"3929918"	"del"	"0"	"00006"	"CREBBP_000507"	"g.(3808050_3808854)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1-17"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3758049_3758853)_(3879917_?)del"	""	"pathogenic (dominant)"	""
"0001029406"	"0"	"90"	"16"	"3817720"	"3817911"	"del"	"0"	"00006"	"CREBBP_000509"	"g.(3808974_3817720)_(3817911_3819174)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex16"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3758973_3767719)_(3767910_3769173)del"	""	"pathogenic (dominant)"	""
"0001029407"	"0"	"90"	"16"	"3786036"	"3795356"	"del"	"0"	"00006"	"CREBBP_000490"	"g.(3781939_3786036)_(3795356_3799627)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex22-28"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3731938_3736035)_(3745355_3749626)del"	""	"pathogenic (dominant)"	""
"0001029408"	"0"	"90"	"16"	"3777718"	"3860781"	"del"	"0"	"00006"	"CREBBP_000485"	"g.(?_3777718)_(3860781_3900297)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex3-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3810780_3850296)del"	""	"pathogenic (dominant)"	""
"0001029409"	"0"	"90"	"16"	"3777718"	"3843628"	"del"	"0"	"00006"	"CREBBP_000484"	"g.(?_3777718)_(3843628_3860603)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex4-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3793627_3810602)del"	""	"pathogenic (dominant)"	""
"0001029410"	"0"	"90"	"16"	"3777718"	"3843628"	"del"	"0"	"00006"	"CREBBP_000484"	"g.(?_3777718)_(3843628_3860603)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex4-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3793627_3810602)del"	""	"pathogenic (dominant)"	""
"0001029411"	"0"	"90"	"16"	"3777718"	"3843628"	"del"	"0"	"00006"	"CREBBP_000484"	"g.(?_3777718)_(3843628_3860603)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex4-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3793627_3810602)del"	""	"pathogenic (dominant)"	""
"0001029412"	"0"	"90"	"16"	"3777718"	"3781475"	"del"	"0"	"00006"	"CREBBP_000482"	"g.(?_3777718)_(3781475_3781776)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex30-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3731474_3731775)del"	""	"pathogenic (dominant)"	""
"0001029413"	"0"	"90"	"16"	"3777718"	"3786817"	"del"	"0"	"00006"	"CREBBP_000483"	"g.(?_3777718)_(3786817_3788559)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex27-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3736816_3738558)del"	""	"pathogenic (recessive)"	""
"0001029414"	"0"	"90"	"16"	"3777718"	"3929918"	"del"	"0"	"00006"	"CREBBP_000117"	"g.(?_3777718)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3879917_?)del"	""	"pathogenic (recessive)"	""
"0001029415"	"0"	"90"	"16"	"3777718"	"3929918"	"del"	"0"	"00006"	"CREBBP_000117"	"g.(?_3777718)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3879917_?)del"	""	"pathogenic (recessive)"	""
"0001029416"	"0"	"90"	"16"	"3777718"	"3929918"	"del"	"0"	"00006"	"CREBBP_000117"	"g.(?_3777718)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3879917_?)del"	""	"pathogenic (recessive)"	""
"0001029417"	"0"	"90"	"16"	"3777718"	"3929918"	"del"	"0"	"00006"	"CREBBP_000117"	"g.(?_3777718)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3879917_?)del"	""	"pathogenic (recessive)"	""
"0001029418"	"0"	"90"	"16"	"3777718"	"3929918"	"del"	"0"	"00006"	"CREBBP_000117"	"g.(?_3777718)_(3929918_?)del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"del ex1-31"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(?_3727717)_(3879917_?)del"	""	"pathogenic (recessive)"	""
"0001029419"	"0"	"90"	"16"	"3819174"	"3824695"	"dup"	"0"	"00006"	"CREBBP_000510"	"g.(3817911_3819174)_(3824695_3827613)dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"dup ex12-15"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3767910_3769173)_(3774694_3777612)dup"	""	"pathogenic (recessive)"	""
"0001029420"	"0"	"90"	"16"	"3786036"	"3842096"	"dup"	"0"	"00006"	"CREBBP_000491"	"g.(3781939_3786036)_(3842096_3843386)dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"dup ex5-28"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3731938_3736035)_(3792095_3793385)dup"	""	"pathogenic (recessive)"	""
"0001029421"	"0"	"90"	"16"	"3781192"	"3799685"	"dup"	"0"	"00006"	"CREBBP_000488"	"g.(3779876_3781192)_(3799685_3801726)dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	"dup ex21-30"	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.(3729875_3731191)_(3749684_3751725)dup"	""	"pathogenic (recessive)"	""
"0001029422"	"0"	"90"	"16"	"3900972"	"3900972"	"del"	"0"	"00006"	"CREBBP_000531"	"g.3900972del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PS2, PM2"	"De novo"	""	""	"0"	""	""	"g.3850971del"	""	"pathogenic (recessive)"	""
"0001029423"	"0"	"90"	"16"	"3900733"	"3900733"	"del"	"0"	"00006"	"CREBBP_000529"	"g.3900733del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3850732del"	""	"pathogenic (recessive)"	""
"0001029424"	"0"	"90"	"16"	"3842019"	"3842022"	"del"	"0"	"00006"	"CREBBP_000525"	"g.3842019_3842022del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3792018_3792021del"	""	"pathogenic (recessive)"	""
"0001029425"	"0"	"90"	"16"	"3831216"	"3831216"	"dup"	"0"	"00006"	"CREBBP_000522"	"g.3831216dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3781215dup"	""	"pathogenic (recessive)"	""
"0001029426"	"0"	"90"	"16"	"3830840"	"3830840"	"del"	"0"	"00006"	"CREBBP_000521"	"g.3830840del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3780839del"	""	"pathogenic (recessive)"	""
"0001029427"	"0"	"90"	"16"	"3828752"	"3828752"	"del"	"0"	"00006"	"CREBBP_000519"	"g.3828752del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3778751del"	""	"pathogenic (recessive)"	""
"0001029428"	"0"	"90"	"16"	"3828748"	"3828748"	"dup"	"0"	"00006"	"CREBBP_000518"	"g.3828748dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3778747dup"	""	"pathogenic (recessive)"	""
"0001029429"	"0"	"90"	"16"	"3828732"	"3828732"	"del"	"0"	"00006"	"CREBBP_000517"	"g.3828732del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3778731del"	""	"pathogenic (recessive)"	""
"0001029430"	"0"	"90"	"16"	"3828071"	"3828072"	"dup"	"0"	"00006"	"CREBBP_000515"	"g.3828071_3828072dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3778070_3778071dup"	""	"pathogenic (recessive)"	""
"0001029431"	"0"	"90"	"16"	"3823786"	"3823786"	"dup"	"0"	"00006"	"CREBBP_000513"	"g.3823786dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3773785dup"	""	"pathogenic (recessive)"	""
"0001029432"	"0"	"90"	"16"	"3820789"	"3820789"	"del"	"0"	"00006"	"CREBBP_000512"	"g.3820789del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3770788del"	""	"pathogenic (recessive)"	""
"0001029433"	"0"	"90"	"16"	"3819338"	"3819338"	"del"	"0"	"00006"	"CREBBP_000511"	"g.3819338del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3769337del"	""	"pathogenic (recessive)"	""
"0001029434"	"0"	"90"	"16"	"3808028"	"3808028"	"dup"	"0"	"00006"	"CREBBP_000506"	"g.3808028dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PS2, PM2"	"De novo"	""	""	"0"	""	""	"g.3758027dup"	""	"pathogenic (recessive)"	""
"0001029435"	"0"	"90"	"16"	"3807868"	"3807878"	"del"	"0"	"00006"	"CREBBP_000504"	"g.3807868_3807878del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3757867_3757877del"	""	"pathogenic (recessive)"	""
"0001029436"	"0"	"90"	"16"	"3790463"	"3790463"	"del"	"0"	"00006"	"CREBBP_000497"	"g.3790463del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3740462del"	""	"pathogenic (recessive)"	""
"0001029437"	"0"	"90"	"16"	"3790401"	"3790404"	"dup"	"0"	"00006"	"CREBBP_000496"	"g.3790401_3790404dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PS2, PM2"	"De novo"	""	""	"0"	""	""	"g.3740400_3740403dup"	""	"pathogenic (recessive)"	""
"0001029438"	"0"	"90"	"16"	"3781938"	"3781942"	"del"	"0"	"00006"	"CREBBP_000489"	"g.3781938_3781942del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3731937_3731941del"	""	"pathogenic (recessive)"	""
"0001029439"	"0"	"90"	"16"	"3779284"	"3779296"	"dup"	"0"	"00006"	"CREBBP_000486"	"g.3779284_3779296dup"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3729283_3729295dup"	""	"pathogenic (recessive)"	""
"0001029440"	"0"	"90"	"16"	"3900780"	"3900780"	"subst"	"0"	"00006"	"CREBBP_000530"	"g.3900780G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3850779G>A"	""	"pathogenic (recessive)"	""
"0001029441"	"0"	"90"	"16"	"3900651"	"3900651"	"subst"	"0"	"00006"	"CREBBP_000528"	"g.3900651G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3850650G>A"	""	"pathogenic (recessive)"	""
"0001029442"	"0"	"90"	"16"	"3900363"	"3900363"	"subst"	"0"	"00006"	"CREBBP_000527"	"g.3900363G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3850362G>A"	""	"pathogenic (recessive)"	""
"0001029443"	"0"	"90"	"16"	"3843540"	"3843540"	"subst"	"0"	"00006"	"CREBBP_000526"	"g.3843540G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3793539G>A"	""	"pathogenic (recessive)"	""
"0001029444"	"0"	"90"	"16"	"3843489"	"3843489"	"subst"	"0"	"00006"	"CREBBP_000128"	"g.3843489G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3793488G>A"	""	"pathogenic (recessive)"	""
"0001029445"	"0"	"90"	"16"	"3842042"	"3842042"	"subst"	"0"	"00006"	"CREBBP_000072"	"g.3842042G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3792041G>A"	""	"pathogenic (recessive)"	""
"0001029446"	"0"	"90"	"16"	"3832811"	"3832811"	"subst"	"0"	"00006"	"CREBBP_000524"	"g.3832811G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3782810G>A"	""	"pathogenic (recessive)"	""
"0001029447"	"0"	"90"	"16"	"3832811"	"3832811"	"subst"	"0"	"00006"	"CREBBP_000524"	"g.3832811G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3782810G>A"	""	"pathogenic (recessive)"	""
"0001029448"	"0"	"90"	"16"	"3832736"	"3832736"	"subst"	"0"	"00006"	"CREBBP_000133"	"g.3832736G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3782735G>A"	""	"pathogenic (recessive)"	""
"0001029449"	"0"	"90"	"16"	"3824635"	"3824635"	"subst"	"0"	"00006"	"CREBBP_000514"	"g.3824635C>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3774634C>A"	""	"pathogenic (recessive)"	""
"0001029450"	"0"	"90"	"16"	"3807978"	"3807978"	"subst"	"0"	"00006"	"CREBBP_000505"	"g.3807978G>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3757977G>T"	""	"pathogenic (recessive)"	""
"0001029451"	"0"	"90"	"16"	"3807297"	"3807297"	"subst"	"0"	"00006"	"CREBBP_000501"	"g.3807297A>C"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3757296A>C"	""	"pathogenic (recessive)"	""
"0001029452"	"0"	"90"	"16"	"3795281"	"3795281"	"subst"	"0"	"00006"	"CREBBP_000498"	"g.3795281G>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3745280G>T"	""	"pathogenic (recessive)"	""
"0001029453"	"0"	"90"	"16"	"3788574"	"3788574"	"subst"	"0"	"00006"	"CREBBP_000493"	"g.3788574A>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3738573A>T"	""	"pathogenic (recessive)"	""
"0001029454"	"0"	"90"	"16"	"3831309"	"3831309"	"subst"	"0"	"00006"	"CREBBP_000523"	"g.3831309T>C"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3781308T>C"	""	"pathogenic (recessive)"	""
"0001029455"	"0"	"90"	"16"	"3828819"	"3828819"	"subst"	"0"	"00006"	"CREBBP_000520"	"g.3828819C>G"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3778818C>G"	""	"pathogenic (recessive)"	""
"0001029456"	"0"	"90"	"16"	"3817717"	"3817731"	"del"	"0"	"00006"	"CREBBP_000508"	"g.3817717_3817731del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3767716_3767730del"	""	"pathogenic (recessive)"	""
"0001029457"	"0"	"90"	"16"	"3807809"	"3807809"	"subst"	"0"	"00006"	"CREBBP_000503"	"g.3807809C>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3757808C>T"	""	"pathogenic (recessive)"	""
"0001029458"	"0"	"90"	"16"	"3807378"	"3807378"	"subst"	"0"	"00006"	"CREBBP_000502"	"g.3807378C>G"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3757377C>G"	""	"pathogenic (recessive)"	""
"0001029459"	"0"	"90"	"16"	"3807284"	"3807284"	"subst"	"0"	"00006"	"CREBBP_000499"	"g.3807284C>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PS1, PS2, PM2"	"De novo"	""	""	"0"	""	""	"g.3757283C>T"	""	"pathogenic (recessive)"	""
"0001029460"	"0"	"90"	"16"	"3789579"	"3789581"	"del"	"0"	"00006"	"CREBBP_000494"	"g.3789579_3789581del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3739578_3739580del"	""	"pathogenic (recessive)"	""
"0001029461"	"0"	"90"	"16"	"3786650"	"3786650"	"subst"	"0"	"00006"	"CREBBP_000492"	"g.3786650C>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PVS1, PM2"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3736649C>T"	""	"pathogenic (recessive)"	""
"0001029462"	"0"	"90"	"16"	"3788614"	"3788614"	"subst"	"0"	"00006"	"CREBBP_000059"	"g.3788614G>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3738613G>A"	""	"pathogenic (recessive)"	""
"0001029463"	"0"	"90"	"16"	"3786772"	"3786772"	"subst"	"0"	"00006"	"CREBBP_000353"	"g.3786772T>C"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3736771T>C"	""	"pathogenic (recessive)"	""
"0001029464"	"0"	"90"	"16"	"3786772"	"3786772"	"subst"	"0"	"00006"	"CREBBP_000353"	"g.3786772T>C"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3736771T>C"	""	"pathogenic (recessive)"	""
"0001029470"	"0"	"90"	"16"	"3828696"	"3828696"	"subst"	"0"	"00006"	"CREBBP_000516"	"g.3828696C>T"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PM2, PP3"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3778695C>T"	""	"pathogenic (recessive)"	""
"0001029471"	"0"	"90"	"16"	"3807289"	"3807289"	"subst"	"0"	"00006"	"CREBBP_000500"	"g.3807289C>G"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PM2, PP3"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3757288C>G"	""	"pathogenic (recessive)"	""
"0001029472"	"0"	"90"	"16"	"3779562"	"3779562"	"subst"	"0"	"00006"	"CREBBP_000487"	"g.3779562T>A"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PM2, PP3"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3729561T>A"	""	"pathogenic (recessive)"	""
"0001029473"	"0"	"90"	"16"	"3789606"	"3789620"	"del"	"0"	"00006"	"CREBBP_000495"	"g.3789606_3789620del"	""	"{PMID:Ismagilova 2025:39958159}, {DOI:Ismagilova 2025:10.3389/fgene.2025.1516565}"	""	""	"ACMG PM2, PP3"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.3739605_3739619del"	""	"pathogenic (recessive)"	""
"0001041104"	"0"	"30"	"16"	"3777746"	"3777746"	"subst"	"0.000698466"	"01804"	"CREBBP_000186"	"g.3777746C>T"	""	""	""	"CREBBP(NM_004380.2):c.7302G>A (p.T2434=), CREBBP(NM_004380.3):c.7302G>A (p.(Thr2434=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041105"	"0"	"50"	"16"	"3777857"	"3777857"	"subst"	"0"	"01804"	"CREBBP_000533"	"g.3777857C>A"	""	""	""	"CREBBP(NM_004380.3):c.7191G>T (p.(Gln2397His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041106"	"0"	"50"	"16"	"3777976"	"3777996"	"del"	"0"	"01804"	"CREBBP_000534"	"g.3777976_3777996del"	""	""	""	"CREBBP(NM_004380.3):c.7058_7078del (p.(Arg2353_Pro2359del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041107"	"0"	"30"	"16"	"3778427"	"3778427"	"subst"	"0"	"01804"	"CREBBP_000535"	"g.3778427T>C"	""	""	""	"CREBBP(NM_004380.3):c.6621A>G (p.(Gln2207=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041108"	"0"	"50"	"16"	"3778438"	"3778439"	"ins"	"0"	"01804"	"CREBBP_000536"	"g.3778438_3778439insC"	""	""	""	"CREBBP(NM_004380.3):c.6609_6610insG (p.(Gln2204AlafsTer137))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041109"	"0"	"50"	"16"	"3778439"	"3778440"	"ins"	"0"	"01804"	"CREBBP_000537"	"g.3778439_3778440insGC"	""	""	""	"CREBBP(NM_004380.3):c.6608_6609insGC (p.(Gln2204Hisfs*99))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041110"	"0"	"30"	"16"	"3778500"	"3778500"	"subst"	"2.89618E-5"	"01804"	"CREBBP_000538"	"g.3778500G>A"	""	""	""	"CREBBP(NM_004380.3):c.6548C>T (p.(Ala2183Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041111"	"0"	"50"	"16"	"3778685"	"3778702"	"del"	"0"	"01804"	"CREBBP_000539"	"g.3778685_3778702del"	""	""	""	"CREBBP(NM_004380.3):c.6349_6366del (p.(Pro2117_Gln2122del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041112"	"0"	"50"	"16"	"3778993"	"3778993"	"subst"	"9.27635E-6"	"01804"	"CREBBP_000540"	"g.3778993C>G"	""	""	""	"CREBBP(NM_004380.3):c.6055G>C (p.(Gly2019Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041113"	"0"	"30"	"16"	"3779042"	"3779042"	"subst"	"4.93389E-6"	"01804"	"CREBBP_000541"	"g.3779042C>A"	""	""	""	"CREBBP(NM_004380.3):c.6006G>T (p.(Val2002=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041114"	"0"	"30"	"16"	"3779060"	"3779060"	"subst"	"0.0152012"	"01804"	"CREBBP_000542"	"g.3779060G>A"	""	""	""	"CREBBP(NM_004380.3):c.5988C>T (p.(Ala1996=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041115"	"0"	"50"	"16"	"3779220"	"3779220"	"subst"	"0"	"01804"	"CREBBP_000543"	"g.3779220G>T"	""	""	""	"CREBBP(NM_004380.3):c.5828C>A (p.(Pro1943Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041116"	"0"	"30"	"16"	"3779594"	"3779594"	"subst"	"0.00692358"	"01804"	"CREBBP_000544"	"g.3779594C>T"	""	""	""	"CREBBP(NM_004380.3):c.5454G>A (p.(Val1818=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041117"	"0"	"30"	"16"	"3789255"	"3789255"	"subst"	"0"	"01804"	"CREBBP_000545"	"g.3789255C>T"	""	""	""	"CREBBP(NM_004380.3):c.4280+324G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041118"	"0"	"30"	"16"	"3790391"	"3790391"	"subst"	"0.000134321"	"01804"	"CREBBP_000546"	"g.3790391C>T"	""	""	""	"CREBBP(NM_004380.3):c.4133+9G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041119"	"0"	"30"	"16"	"3790755"	"3790755"	"subst"	"0"	"01804"	"CREBBP_000547"	"g.3790755T>C"	""	""	""	"CREBBP(NM_004380.3):c.3983-205A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041120"	"0"	"30"	"16"	"3794886"	"3794886"	"subst"	"7.71793E-5"	"01804"	"CREBBP_000548"	"g.3794886G>A"	""	""	""	"CREBBP(NM_004380.3):c.3982+9C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041121"	"0"	"10"	"16"	"3795292"	"3795292"	"subst"	"0.0344079"	"01804"	"CREBBP_000549"	"g.3795292G>T"	""	""	""	"CREBBP(NM_004380.3):c.3900C>A (p.(Ile1300=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001041122"	"0"	"30"	"16"	"3814493"	"3814493"	"del"	"0"	"01804"	"CREBBP_000550"	"g.3814493del"	""	""	""	"CREBBP(NM_004380.3):c.3250+3228del"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041123"	"0"	"30"	"16"	"3814501"	"3814501"	"subst"	"0"	"01804"	"CREBBP_000551"	"g.3814501G>T"	""	""	""	"CREBBP(NM_004380.3):c.3250+3220C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041124"	"0"	"10"	"16"	"3819294"	"3819294"	"subst"	"0.00345374"	"02327"	"CREBBP_000013"	"g.3819294C>T"	""	""	""	"CREBBP(NM_001079846.1):c.2827G>A (p.(Ala943Thr)), CREBBP(NM_004380.2):c.2941G>A (p.A981T), CREBBP(NM_004380.3):c.2941G>A (p.A981T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001041125"	"0"	"50"	"16"	"3819311"	"3819311"	"subst"	"0"	"01804"	"CREBBP_000552"	"g.3819311G>A"	""	""	""	"CREBBP(NM_004380.3):c.2924C>T (p.(Pro975Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041126"	"0"	"10"	"16"	"3820667"	"3820667"	"subst"	"0.0341373"	"01804"	"CREBBP_000553"	"g.3820667C>T"	""	""	""	"CREBBP(NM_004380.3):c.2784G>A (p.(Pro928=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001041127"	"0"	"30"	"16"	"3823851"	"3823862"	"del"	"0"	"01804"	"CREBBP_000554"	"g.3823851_3823862del"	""	""	""	"CREBBP(NM_004380.3):c.2355_2366del (p.(Ala787_Gln790del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041128"	"0"	"50"	"16"	"3824571"	"3824571"	"subst"	"0"	"01804"	"CREBBP_000555"	"g.3824571C>A"	""	""	""	"CREBBP(NM_004380.3):c.2282G>T (p.(Gly761Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041129"	"0"	"70"	"16"	"3828723"	"3828723"	"subst"	"0"	"01804"	"CREBBP_000556"	"g.3828723A>C"	""	""	""	"CREBBP(NM_004380.3):c.1919T>G (p.(Met640Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001041130"	"0"	"50"	"16"	"3830818"	"3830818"	"subst"	"0"	"01804"	"CREBBP_000557"	"g.3830818C>T"	""	""	""	"CREBBP(NM_004380.3):c.1738G>A (p.(Ala580Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001041131"	"0"	"30"	"16"	"3843581"	"3843581"	"subst"	"1.6243E-5"	"01804"	"CREBBP_000558"	"g.3843581G>A"	""	""	""	"CREBBP(NM_004380.3):c.1022C>T (p.(Ala341Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041132"	"0"	"30"	"16"	"3860640"	"3860640"	"subst"	"0.0292527"	"01804"	"CREBBP_000559"	"g.3860640A>G"	""	""	""	"CREBBP(NM_004380.3):c.939T>C (p.(Asp313=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041133"	"0"	"30"	"16"	"3860700"	"3860700"	"subst"	"0.000564554"	"01804"	"CREBBP_000290"	"g.3860700C>T"	""	""	""	"CREBBP(NM_004380.2):c.879G>A (p.V293=), CREBBP(NM_004380.3):c.879G>A (p.(Val293=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041134"	"0"	"30"	"16"	"3900343"	"3900343"	"subst"	"0.000252074"	"01804"	"CREBBP_000560"	"g.3900343A>C"	""	""	""	"CREBBP(NM_004380.3):c.753T>G (p.(Thr251=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041135"	"0"	"30"	"16"	"3900392"	"3900392"	"subst"	"8.12315E-6"	"01804"	"CREBBP_000561"	"g.3900392G>A"	""	""	""	"CREBBP(NM_004380.3):c.704C>T (p.(Ser235Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041137"	"0"	"30"	"16"	"3901320"	"3901321"	"ins"	"0"	"01804"	"CREBBP_000562"	"g.3901320_3901321insG"	""	""	""	"CREBBP(NM_004380.3):c.86-311_86-310insC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001041138"	"0"	"30"	"16"	"3903428"	"3903428"	"subst"	"0"	"01804"	"CREBBP_000563"	"g.3903428G>A"	""	""	""	"CREBBP(NM_004380.3):c.86-2418C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001047045"	"0"	"70"	"16"	"3842075"	"3842075"	"subst"	"0"	"01164"	"CREBBP_000024"	"g.3842075G>A"	""	"PMID: 12070251, 18792986, 31566936,"	""	""	"ACMG: PVS1, PS2, PM2_SUP, confirmed de novo"	"De novo"	"-"	""	""	""	""	"g.3792074G>A"	""	"pathogenic (dominant)"	"ACMG"
"0001048360"	"0"	"70"	"16"	"3824685"	"3824685"	"subst"	"0"	"03779"	"CREBBP_000564"	"g.3824685G>T"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0001049722"	"0"	"50"	"16"	"3807899"	"3807899"	"subst"	"0"	"01164"	"CREBBP_000565"	"g.3807899C>A"	""	""	""	""	"ACMG: PM1, PM2_SUP"	"Germline"	"?"	""	""	""	""	"g.3757898C>A"	""	"VUS"	"ACMG"
"0001055408"	"0"	"50"	"16"	"3777990"	"3777990"	"subst"	"1.23067E-5"	"01804"	"CREBBP_000566"	"g.3777990C>T"	""	""	""	"CREBBP(NM_004380.3):c.7058G>A (p.(Arg2353Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055409"	"0"	"50"	"16"	"3778051"	"3778051"	"subst"	"4.06719E-6"	"01804"	"CREBBP_000567"	"g.3778051G>T"	""	""	""	"CREBBP(NM_004380.3):c.6997C>A (p.(Gln2333Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055410"	"0"	"50"	"16"	"3778837"	"3778837"	"subst"	"4.0781E-6"	"01804"	"CREBBP_000568"	"g.3778837G>T"	""	""	""	"CREBBP(NM_004380.3):c.6211C>A (p.(Leu2071Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055411"	"0"	"50"	"16"	"3779329"	"3779329"	"subst"	"0"	"01804"	"CREBBP_000569"	"g.3779329C>A"	""	""	""	"CREBBP(NM_004380.3):c.5719G>T (p.(Ala1907Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055412"	"0"	"30"	"16"	"3786645"	"3786645"	"subst"	"0.000105594"	"01804"	"CREBBP_000570"	"g.3786645G>A"	""	""	""	"CREBBP(NM_004380.3):c.4560+6C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055413"	"0"	"30"	"16"	"3795351"	"3795351"	"subst"	"0.00013018"	"01804"	"CREBBP_000237"	"g.3795351C>T"	""	""	""	"CREBBP(NM_004380.3):c.3841G>A (p.(Val1281Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055414"	"0"	"50"	"16"	"3817905"	"3817905"	"subst"	"0"	"01804"	"CREBBP_000571"	"g.3817905C>G"	""	""	""	"CREBBP(NM_004380.3):c.3066G>C (p.(Met1022Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055415"	"0"	"50"	"16"	"3820894"	"3820894"	"subst"	"4.06832E-6"	"01804"	"CREBBP_000572"	"g.3820894G>T"	""	""	""	"CREBBP(NM_004380.3):c.2557C>A (p.(Leu853Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055416"	"0"	"30"	"16"	"3824921"	"3824921"	"subst"	"0"	"01804"	"CREBBP_000573"	"g.3824921C>T"	""	""	""	"CREBBP(NM_004380.3):c.2159-227G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055417"	"0"	"50"	"16"	"3828784"	"3828784"	"subst"	"0"	"01804"	"CREBBP_000574"	"g.3828784C>G"	""	""	""	"CREBBP(NM_004380.3):c.1858G>C (p.(Ala620Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055418"	"0"	"50"	"16"	"3843455"	"3843455"	"subst"	"0"	"01804"	"CREBBP_000575"	"g.3843455G>A"	""	""	""	"CREBBP(NM_004380.3):c.1148C>T (p.(Pro383Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001055419"	"0"	"30"	"16"	"3900288"	"3900288"	"subst"	"0"	"01804"	"CREBBP_000576"	"g.3900288G>A"	""	""	""	"CREBBP(NM_004380.3):c.798+10C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055420"	"0"	"30"	"16"	"3900344"	"3900344"	"subst"	"4.06524E-6"	"01804"	"CREBBP_000577"	"g.3900344G>C"	""	""	""	"CREBBP(NM_004380.3):c.752C>G (p.(Thr251Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001055421"	"0"	"50"	"16"	"3900378"	"3900378"	"subst"	"0"	"01804"	"CREBBP_000578"	"g.3900378C>T"	""	""	""	"CREBBP(NM_004380.3):c.718G>A (p.(Ala240Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001058570"	"0"	"90"	"16"	"3801726"	"3801726"	"subst"	"0"	"00006"	"CREBBP_000166"	"g.3801726C>T"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.3751725C>T"	""	"pathogenic"	""
"0001058571"	"0"	"90"	"16"	"3779434"	"3779434"	"subst"	"0"	"00006"	"CREBBP_000180"	"g.3779434T>C"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.3729433T>C"	""	"pathogenic"	""
"0001058572"	"0"	"90"	"16"	"3799632"	"3799632"	"subst"	"0"	"00006"	"CREBBP_000038"	"g.3799632C>T"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.3749631C>T"	""	"pathogenic"	""
"0001058573"	"0"	"90"	"16"	"3799632"	"3799632"	"subst"	"0"	"00006"	"CREBBP_000038"	"g.3799632C>T"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.3749631C>T"	""	"pathogenic"	""
"0001058574"	"0"	"70"	"16"	"3824670"	"3824670"	"subst"	"0"	"00006"	"CREBBP_000580"	"g.3824670G>C"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.3774669G>C"	""	"likely pathogenic"	""
"0001058575"	"0"	"70"	"16"	"3779681"	"3779681"	"subst"	"0"	"00006"	"CREBBP_000579"	"g.3779681G>C"	""	"{PMID:Retterer 2016:26633542}"	""	""	"variants reported seperately, unknown if mono-allelic or bi-allelic"	"Unknown"	""	""	"0"	""	""	"g.3729680G>C"	""	"likely pathogenic"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes CREBBP
## Count = 711
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000013516"	"00001113"	"30"	"798"	"10005"	"798"	"10005"	"c.798+10005T>C"	"r.(?)"	"p.(=)"	"2i"
"0000079348"	"00001113"	"90"	"5485"	"0"	"5485"	"0"	"c.5485C>G"	"r.(?)"	"p.(His1829Asp)"	"31"
"0000079591"	"00001113"	"90"	"5599"	"0"	"5599"	"0"	"c.5599C>T"	"r.(?)"	"p.(Arg1867Trp)"	"31"
"0000130026"	"00001113"	"70"	"2158"	"1"	"2158"	"1"	"c.2158+1G>A"	"r.spl"	"p.?"	"11i"
"0000132223"	"00001113"	"50"	"4520"	"0"	"4520"	"0"	"c.4520T>A"	"r.(4520u>a)"	"p.(Leu1507Gln)"	"27"
"0000132232"	"00001113"	"50"	"5843"	"0"	"5843"	"0"	"c.5843C>T"	"r.(5843c>u)"	"p.(Pro1948Leu)"	"31"
"0000132250"	"00001113"	"50"	"3465"	"0"	"3465"	"0"	"c.3465C>T"	"r.(3465c>u)"	"p.(Asp1155=)"	"18"
"0000164579"	"00001113"	"70"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	"31"
"0000165275"	"00001113"	"70"	"5595"	"0"	"5597"	"0"	"c.5595_5597del"	"r.(?)"	"p.(Met1865_Arg1866delinsIle)"	"31"
"0000178258"	"00001113"	"99"	"-204"	"0"	"9993"	"0"	"c.(?_-204)_(*2664_?)del"	"r.0"	"p.0"	"_1_31_"
"0000178259"	"00001113"	"99"	"-204"	"0"	"798"	"-1"	"c.(?_-204)_(798-1_799+1)del"	"r.0?"	"p.0?"	"_1_2i"
"0000178260"	"00001113"	"99"	"-204"	"0"	"798"	"-1"	"c.(?_-204)_(798-1_799+1)del"	"r.0?"	"p.0?"	"_1_2i"
"0000178261"	"00001113"	"99"	"37"	"0"	"37"	"0"	"c.37A>G"	"r.(?)"	"p.(Lys13Glu)"	"1"
"0000178262"	"00001113"	"97"	"40"	"0"	"40"	"0"	"c.40A>G"	"r.(?)"	"p.(Arg14Gly)"	"1"
"0000178263"	"00001113"	"99"	"68"	"0"	"68"	"0"	"c.68C>A"	"r.(?)"	"p.(Ser23*)"	"1"
"0000178264"	"00001113"	"99"	"85"	"1"	"85"	"1"	"c.85+1G>T"	"r.spl?"	"p.(?)"	"1i"
"0000178265"	"00001113"	"99"	"86"	"-1"	"798"	"1"	"c.(85+1_86-1)_(798+1_799-1)del"	"r.(del)"	"p.(del)"	"1i_2i"
"0000178266"	"00001113"	"99"	"86"	"-1"	"798"	"1"	"c.(85+1_86-1)_(798+1_799-1)del"	"r.(del)"	"p.(del)"	"1i_2i"
"0000178267"	"00001113"	"99"	"86"	"0"	"233"	"0"	"c.86_233del"	"r.(?)"	"p.(Asp29fs)"	"2"
"0000178268"	"00001113"	"99"	"139"	"0"	"139"	"0"	"c.139delinsTCATCATGAGCTG"	"r.(?)"	"p.(Asn47delinsSerSer*)"	"2"
"0000178269"	"00001113"	"99"	"223"	"0"	"223"	"0"	"c.223C>T"	"r.(?)"	"p.(Arg75*)"	"2"
"0000178270"	"00001113"	"99"	"236"	"0"	"236"	"0"	"c.236del"	"r.(?)"	"p.(Gly79AlafsTer8)"	"2"
"0000178271"	"00001113"	"99"	"277"	"0"	"277"	"0"	"c.277dup"	"r.(?)"	"p.(Ser93LysfsTer19)"	"2"
"0000178272"	"00001113"	"99"	"304"	"0"	"304"	"0"	"c.304C>T"	"r.(?)"	"p.(Gln102*)"	"2"
"0000178273"	"00001113"	"99"	"317"	"0"	"317"	"0"	"c.317dup"	"r.(?)"	"p.(Pro107AlafsTer5)"	"2"
"0000178274"	"00001113"	"99"	"406"	"0"	"406"	"0"	"c.406C>T"	"r.(?)"	"p.(Gln136*)"	"2"
"0000178275"	"00001113"	"99"	"472"	"0"	"472"	"0"	"c.472C>T"	"r.(?)"	"p.(Gln158*)"	"2"
"0000178276"	"00001113"	"99"	"474"	"0"	"493"	"0"	"c.474_493del"	"r.(?)"	"p.(Val159fs)"	"2"
"0000178277"	"00001113"	"99"	"810"	"0"	"811"	"0"	"c.810_811del"	"r.(?)"	"p.(Gly271GlufsTer10)"	"3"
"0000178278"	"00001113"	"99"	"840"	"0"	"840"	"0"	"c.840dup"	"r.(?)"	"p.(Ser281*)"	"3"
"0000178279"	"00001113"	"99"	"904"	"0"	"905"	"0"	"c.904_905del"	"r.(?)"	"p.(Ser302HisfsTer47)"	"3"
"0000178280"	"00001113"	"99"	"1011"	"0"	"1011"	"0"	"c.1011dup"	"r.(?)"	"p.(Gln338ThrfsTer12)"	"4"
"0000178281"	"00001113"	"99"	"1066"	"0"	"1066"	"0"	"c.1066C>T"	"r.(?)"	"p.(Gln356*)"	"4"
"0000178282"	"00001113"	"99"	"1069"	"0"	"1069"	"0"	"c.1069C>T"	"r.(?)"	"p.(Gln357*)"	"4"
"0000178283"	"00001113"	"99"	"1108"	"0"	"1108"	"0"	"c.1108C>T"	"r.(?)"	"p.(Arg370*)"	"4"
"0000178284"	"00001113"	"99"	"1108"	"0"	"1108"	"0"	"c.1108C>T"	"r.(?)"	"p.(Arg370*)"	"4"
"0000178285"	"00001113"	"99"	"1108"	"0"	"1108"	"0"	"c.1108C>T"	"r.(?)"	"p.(Arg370*)"	"4"
"0000178286"	"00001113"	"99"	"1108"	"0"	"1108"	"0"	"c.1108C>T"	"r.(?)"	"p.(Arg370*)"	"4"
"0000178287"	"00001113"	"99"	"1114"	"0"	"1114"	"0"	"c.1114C>T"	"r.(?)"	"p.(Gln372*)"	"4"
"0000178288"	"00001113"	"99"	"1216"	"1"	"1216"	"1"	"c.1216+1G>A"	"r.spl?"	"p.(?)"	"4i"
"0000178289"	"00001113"	"99"	"1237"	"0"	"1237"	"0"	"c.1237C>T"	"r.(?)"	"p.(Arg413*)"	"5"
"0000178290"	"00001113"	"99"	"1237"	"0"	"1237"	"0"	"c.1237C>T"	"r.(?)"	"p.(Arg413*)"	"5"
"0000178291"	"00001113"	"99"	"1237"	"0"	"1237"	"0"	"c.1237C>T"	"r.(?)"	"p.(Arg413*)"	"5"
"0000178292"	"00001113"	"99"	"1270"	"0"	"1270"	"0"	"c.1270C>T"	"r.(?)"	"p.(Arg424*)"	"5"
"0000178293"	"00001113"	"99"	"1270"	"0"	"1270"	"0"	"c.1270C>T"	"r.(?)"	"p.(Arg424*)"	"5"
"0000178294"	"00001113"	"99"	"1270"	"0"	"1270"	"0"	"c.1270C>T"	"r.(?)"	"p.(Arg424*)"	"5"
"0000178295"	"00001113"	"99"	"1270"	"0"	"1270"	"0"	"c.1270C>T"	"r.(?)"	"p.(Arg424*)"	"5"
"0000178296"	"00001113"	"99"	"1318"	"0"	"1318"	"0"	"c.1318C>T"	"r.(?)"	"p.(Arg440*)"	"5"
"0000178297"	"00001113"	"99"	"1388"	"0"	"1395"	"0"	"c.1388_1395del"	"r.(?)"	"p.(Gly463GlufsTer7)"	"6"
"0000178298"	"00001113"	"99"	"1412"	"0"	"1415"	"0"	"c.1412_1415del"	"r.(?)"	"p.(Ser471ThrfsTer5)"	"6"
"0000178299"	"00001113"	"99"	"1481"	"0"	"1481"	"0"	"c.1481dup"	"r.(?)"	"p.(Asn494LysfsTer34)"	"6"
"0000178300"	"00001113"	"99"	"1483"	"0"	"1483"	"0"	"c.1483C>T"	"r.(?)"	"p.(Gln495*)"	"6"
"0000178301"	"00001113"	"99"	"1515"	"0"	"1521"	"0"	"c.1515_1521del"	"r.(?)"	"p.(Gly506AsnfsTer11)"	"6"
"0000178302"	"00001113"	"99"	"1522"	"0"	"1522"	"0"	"c.1522C>T"	"r.(?)"	"p.(Gln508*)"	"6"
"0000178303"	"00001113"	"99"	"1655"	"0"	"1655"	"0"	"c.1655del"	"r.(?)"	"p.(Pro552ArgfsTer10)"	"7"
"0000178304"	"00001113"	"99"	"1676"	"1"	"1676"	"1"	"c.1676+1G>A"	"r.spl?"	"p.(?)"	"7i"
"0000178305"	"00001113"	"99"	"1733"	"0"	"1733"	"0"	"c.1733del"	"r.(?)"	"p.(Pro578GlnfsTer11)"	"8"
"0000178306"	"00001113"	"99"	"1735"	"0"	"1735"	"0"	"c.1735dup"	"r.(?)"	"p.(Thr579AsnfsTer7)"	"8"
"0000178307"	"00001113"	"90"	"1802"	"0"	"1802"	"0"	"c.1802G>A"	"r.(?)"	"p.(Arg601Gln)"	"8"
"0000178308"	"00001113"	"99"	"1891"	"0"	"1895"	"0"	"c.1891_1895del"	"r.(?)"	"p.(Ala631CysfsTer2)"	"9"
"0000178309"	"00001113"	"99"	"1984"	"0"	"1984"	"0"	"c.1984C>T"	"r.(?)"	"p.(Gln662*)"	"10"
"0000178310"	"00001113"	"99"	"2045"	"0"	"2045"	"0"	"c.2045dup"	"r.(?)"	"p.(Pro683AlafsTer43)"	"10"
"0000178311"	"00001113"	"99"	"2254"	"0"	"2254"	"0"	"c.2254C>T"	"r.(?)"	"p.(Gln752*)"	"12"
"0000178312"	"00001113"	"99"	"2356"	"0"	"2356"	"0"	"c.2356del"	"r.(?)"	"p.(Gln786ArgfsTer21)"	"13"
"0000178313"	"00001113"	"99"	"2461"	"0"	"2461"	"0"	"c.2461C>T"	"r.(?)"	"p.(Gln821*)"	"13"
"0000178314"	"00001113"	"99"	"2678"	"0"	"2678"	"0"	"c.2678C>A"	"r.(?)"	"p.(Ser893*)"	"14"
"0000178315"	"00001113"	"99"	"2724"	"0"	"2724"	"0"	"c.2724del"	"r.(?)"	"p.(Ser908ArgfsTer19)"	"14"
"0000178316"	"00001113"	"99"	"2749"	"0"	"2749"	"0"	"c.2749dup"	"r.(?)"	"p.(Thr917AsnfsTer53)"	"14"
"0000178317"	"00001113"	"99"	"2810"	"0"	"2810"	"0"	"c.2810dup"	"r.(?)"	"p.(Ser938ValfsTer32)"	"14"
"0000178318"	"00001113"	"99"	"2827"	"0"	"2827"	"0"	"c.2827del"	"r.(?)"	"p.(Gln943SerfsTer55)"	"14"
"0000178319"	"00001113"	"99"	"2842"	"0"	"2842"	"0"	"c.2842C>T"	"r.(?)"	"p.(Gln948*)"	"14"
"0000178320"	"00001113"	"99"	"2842"	"0"	"2842"	"0"	"c.2842C>T"	"r.(?)"	"p.(Gln948*)"	"14"
"0000178321"	"00001113"	"99"	"2879"	"0"	"2879"	"0"	"c.2879del"	"r.(?)"	"p.(Pro960ArgfsTer38)"	"14"
"0000178322"	"00001113"	"95"	"2941"	"0"	"2941"	"0"	"c.2941G>A"	"r.(?)"	"p.(Ala981Thr)"	"15"
"0000178323"	"00001113"	"99"	"2986"	"0"	"2986"	"0"	"c.2986G>T"	"r.(?)"	"p.(Glu996*)"	"15"
"0000178324"	"00001113"	"99"	"3061"	"-1"	"3698"	"1"	"c.(3060+1_3061-1)_(3698+1_3699-1)del"	"r.(del)"	"p.(del)"	"15i_19i"
"0000178325"	"00001113"	"99"	"3096"	"0"	"3096"	"0"	"c.3096dup"	"r.(?)"	"p.(Lys1033*)"	"16"
"0000178326"	"00001113"	"99"	"3351"	"0"	"3352"	"0"	"c.3351_3352dup"	"r.(?)"	"p.(Gln1118ProfsTer13)"	"17"
"0000178327"	"00001113"	"99"	"3369"	"0"	"3369"	"6"	"c.3369_3369+6delinsCA"	"r.spl?"	"p.(?)"	"17"
"0000178328"	"00001113"	"99"	"3375"	"0"	"3375"	"0"	"c.3375T>G"	"r.(?)"	"p.(Tyr1125*)"	"18"
"0000178329"	"00001113"	"99"	"3396"	"0"	"3400"	"0"	"c.3396_3400del"	"r.(?)"	"p.(Met1133ProfsTer34)"	"18"
"0000178330"	"00001113"	"99"	"3432"	"0"	"3433"	"0"	"c.3432_3433del"	"r.(?)"	"p.(Gly1145AlafsTer23)"	"18"
"0000178331"	"00001113"	"99"	"3517"	"0"	"3517"	"0"	"c.3517C>T"	"r.(?)"	"p.(Arg1173*)"	"18"
"0000178332"	"00001113"	"97"	"3524"	"0"	"3524"	"0"	"c.3524A>G"	"r.(?)"	"p.(Tyr1175Cys)"	"18"
"0000178333"	"00001113"	"99"	"3545"	"0"	"3545"	"0"	"c.3545dup"	"r.(?)"	"p.(Glu1183ArgfsTer4)"	"18"
"0000178334"	"00001113"	"99"	"3546"	"0"	"3546"	"0"	"c.3546del"	"r.(?)"	"p.(Glu1183ArgfsTer67)"	"18"
"0000178335"	"00001113"	"99"	"3547"	"0"	"3547"	"0"	"c.3547G>T"	"r.(?)"	"p.(Glu1183*)"	"18"
"0000178336"	"00001113"	"99"	"3608"	"0"	"3609"	"5"	"c.3608_3609+5del"	"r.spl?"	"p.(?)"	"18"
"0000178337"	"00001113"	"99"	"3610"	"-2"	"3610"	"-2"	"c.3610-2A>G"	"r.spl?"	"p.(?)"	"18i"
"0000178338"	"00001113"	"99"	"3610"	"-1"	"3610"	"-1"	"c.3610-1G>A"	"r.spl?"	"p.(?)"	"18i"
"0000178339"	"00001113"	"99"	"3639"	"0"	"3639"	"0"	"c.3639C>A"	"r.(?)"	"p.(Cys1213*)"	"19"
"0000178340"	"00001113"	"99"	"3698"	"1"	"3698"	"1"	"c.3698+1G>A"	"r.spl?"	"p.(?)"	"19i"
"0000178341"	"00001113"	"95"	"3698"	"3"	"3698"	"3"	"c.3698+3A>T"	"r.(spl?)"	"p.(?)"	"19i"
"0000178342"	"00001113"	"99"	"3715"	"0"	"3716"	"0"	"c.3715_3716del"	"r.(?)"	"p.(Lys1239ValfsTer14)"	"20"
"0000178343"	"00001113"	"99"	"3751"	"0"	"3751"	"0"	"c.3751del"	"r.(?)"	"p.(Leu1251TrpfsTer25)"	"20"
"0000178344"	"00001113"	"99"	"3767"	"0"	"3769"	"0"	"c.3767_3769del"	"r.(?)"	"p.(Ser1256*)"	"20"
"0000178345"	"00001113"	"99"	"3779"	"1"	"3779"	"1"	"c.3779+1G>A"	"r.spl"	"p.(?)"	"20i"
"0000178346"	"00001113"	"99"	"3779"	"2"	"3779"	"2"	"c.3779+2T>C"	"r.spl"	"p.(?)"	"20i"
"0000178347"	"00001113"	"77"	"3779"	"3"	"3779"	"3"	"c.3779+3A>T"	"r.spl"	"p.(?)"	"20i"
"0000178348"	"00001113"	"99"	"3779"	"5"	"3779"	"5"	"c.3779+5G>C"	"r.spl"	"p.(?)"	"20i"
"0000178349"	"00001113"	"99"	"3805"	"0"	"3805"	"0"	"c.3805A>T"	"r.(?)"	"p.(Lys1269*)"	"21"
"0000178350"	"00001113"	"99"	"3817"	"0"	"3821"	"0"	"c.3817_3821dup"	"r.(?)"	"p.(Leu1275IlefsTer3)"	"21"
"0000178351"	"00001113"	"99"	"3824"	"0"	"3824"	"0"	"c.3824dup"	"r.(?)"	"p.(Leu1275PhefsTer8)"	"21"
"0000178352"	"00001113"	"97"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	"21"
"0000178353"	"00001113"	"77"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	"21"
"0000178354"	"00001113"	"77"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	"21"
"0000178355"	"00001113"	"97"	"3833"	"0"	"3833"	"0"	"c.3833A>C"	"r.(?)"	"p.(Glu1278Ala)"	"21"
"0000178356"	"00001113"	"97"	"3833"	"0"	"3833"	"0"	"c.3833A>G"	"r.(?)"	"p.(Glu1278Gly)"	"21"
"0000178357"	"00001113"	"99"	"3836"	"1"	"3836"	"1"	"c.3836+1G>A"	"r.spl?"	"p.(?)"	"21i"
"0000178358"	"00001113"	"99"	"3837"	"-2"	"3837"	"-2"	"c.3837-2A>T"	"r.spl?"	"p.(?)"	"21i"
"0000178359"	"00001113"	"99"	"3837"	"-1"	"3982"	"1"	"c.(3836-1_3837-1)_(3982+1_3983-1)del"	"r.(del)"	"p.(del)"	"21i_23i"
"0000178360"	"00001113"	"99"	"3837"	"-1"	"3982"	"1"	"c.(3836-1_3837-1)_(3982+1_3983-1)del"	"r.(del)"	"p.(del)"	"21i_23i"
"0000178361"	"00001113"	"99"	"3858"	"0"	"3859"	"0"	"c.3858_3859del"	"r.(?)"	"p.(Cys1286TrpfsTer13)"	"22"
"0000178362"	"00001113"	"99"	"3862"	"0"	"3871"	"0"	"c.3862_3871del"	"r.(?)"	"p.(Arg1288fs)"	"22"
"0000178363"	"00001113"	"99"	"3914"	"1"	"3914"	"1"	"c.3914+1G>T"	"r.spl?"	"p.(?)"	"22i"
"0000178364"	"00001113"	"99"	"3915"	"-1"	"3915"	"-1"	"c.3915-1G>A"	"r.spl?"	"p.(?)"	"22i"
"0000178365"	"00001113"	"99"	"3983"	"-1"	"9993"	"0"	"c.(3982+1_3983-1)_(*2664_?)del"	"r.?"	"p.?"	"23i_31_"
"0000178366"	"00001113"	"97"	"4014"	"0"	"4014"	"0"	"c.4014G>C"	"r.(?)"	"p.(Leu1338Phe)"	"24"
"0000178367"	"00001113"	"77"	"4133"	"0"	"4133"	"0"	"c.4133G>C"	"r.spl?"	"p.(Arg1378Cys)"	"24"
"0000178368"	"00001113"	"99"	"4133"	"1"	"4133"	"1"	"c.4133+1G>A"	"r.spl?"	"p.(?)"	"24i"
"0000178369"	"00001113"	"97"	"4216"	"0"	"4216"	"0"	"c.4216G>T"	"r.(?)"	"p.(Asp1406Tyr)"	"25"
"0000178370"	"00001113"	"97"	"4238"	"0"	"4238"	"0"	"c.4238A>C"	"r.(?)"	"p.(His1413Pro)"	"25"
"0000178371"	"00001113"	"99"	"4256"	"0"	"4257"	"0"	"c.4256_4257del"	"r.(?)"	"p.(Ser1419*)"	"25"
"0000178372"	"00001113"	"99"	"4268"	"0"	"4268"	"0"	"c.4268dup"	"r.(?)"	"p.(Pro1424SerfsTer13)"	"25"
"0000178373"	"00001113"	"99"	"4280"	"2"	"4280"	"2"	"c.4280+2T>C"	"r.spl?"	"p.(?)"	"25i"
"0000178374"	"00001113"	"97"	"4281"	"-7"	"4281"	"-7"	"c.4281-7C>G"	"r.(?)"	"p.(?)"	"25i"
"0000178375"	"00001113"	"97"	"4304"	"0"	"4304"	"0"	"c.4304A>T"	"r.(?)"	"p.(Asp1435Val)"	"26"
"0000178376"	"00001113"	"99"	"4319"	"0"	"4320"	"0"	"c.4319_4320del"	"r.(?)"	"p.(Phe1440SerfsTer12)"	"26"
"0000178377"	"00001113"	"99"	"4321"	"0"	"4321"	"0"	"c.4321dup"	"r.(?)"	"p.(Arg1441ProfsTer12)"	"26"
"0000178378"	"00001113"	"97"	"4340"	"0"	"4340"	"0"	"c.4340C>T"	"r.(?)"	"p.(Thr1447Ile)"	"26"
"0000178379"	"00001113"	"97"	"4348"	"0"	"4348"	"0"	"c.4348T>C"	"r.(?)"	"p.(Tyr1450His)"	"26"
"0000178380"	"00001113"	"77"	"4394"	"4"	"4394"	"4"	"c.4394+4A>C"	"r.(spl?)"	"p.(?)"	"26i"
"0000178381"	"00001113"	"55"	"4394"	"5"	"4394"	"5"	"c.4394+5G>T"	"r.(spl?)"	"p.(?)"	"26i"
"0000178382"	"00001113"	"99"	"4396"	"0"	"4406"	"0"	"c.4396_4406del"	"r.(?)"	"p.(Tyr1466fs)"	"27"
"0000178383"	"00001113"	"99"	"4398"	"0"	"4398"	"0"	"c.4398dup"	"r.(?)"	"p.(Val1467CysfsTer12)"	"27"
"0000178384"	"00001113"	"99"	"4398"	"0"	"4398"	"0"	"c.4398T>A"	"r.(?)"	"p.(Tyr1466*)"	"27"
"0000178385"	"00001113"	"99"	"4400"	"0"	"4400"	"0"	"c.4400del"	"r.(?)"	"p.(Val1467GlyfsTer83)"	"27"
"0000178386"	"00001113"	"97"	"4409"	"0"	"4409"	"0"	"c.4409A>G"	"r.(?)"	"p.(His1470Arg)"	"27"
"0000178387"	"00001113"	"99"	"4435"	"0"	"4435"	"0"	"c.4435G>T"	"r.(?)"	"p.(Gly1479*)"	"27"
"0000178388"	"00001113"	"77"	"4436"	"0"	"4438"	"0"	"c.4436_4438del"	"r.(?)"	"p.(Gly1479del)"	"27"
"0000178389"	"00001113"	"97"	"4444"	"0"	"4444"	"0"	"c.4444T>G"	"r.(?)"	"p.(Tyr1482Asp)"	"27"
"0000178390"	"00001113"	"97"	"4445"	"0"	"4445"	"0"	"c.4445A>G"	"r.(?)"	"p.(Tyr1482Cys)"	"27"
"0000178391"	"00001113"	"99"	"4492"	"0"	"4492"	"0"	"c.4492C>T"	"r.(?)"	"p.(Arg1498*)"	"27"
"0000178392"	"00001113"	"99"	"4492"	"0"	"4492"	"0"	"c.4492C>T"	"r.(?)"	"p.(Arg1498*)"	"27"
"0000178393"	"00001113"	"99"	"4492"	"0"	"4492"	"0"	"c.4492C>T"	"r.(?)"	"p.(Arg1498*)"	"27"
"0000178394"	"00001113"	"97"	"4559"	"0"	"4559"	"0"	"c.4559A>G"	"r.(spl?)"	"p.(Lys1520Arg)"	"27"
"0000178395"	"00001113"	"95"	"4561"	"-5"	"4561"	"-5"	"c.4561-5C>G"	"r.(spl?)"	"p.(?)"	"27i"
"0000178396"	"00001113"	"99"	"4561"	"-2"	"4561"	"-2"	"c.4561-2A>G"	"r.spl?"	"p.(?)"	"27i"
"0000178397"	"00001113"	"99"	"4567"	"0"	"4568"	"0"	"c.4567_4568del"	"r.(?)"	"p.(Phe1523GlnfsTer5)"	"28"
"0000178398"	"00001113"	"99"	"4611"	"0"	"4611"	"0"	"c.4611del"	"r.(?)"	"p.(Tyr1539IlefsTer11)"	"28"
"0000178399"	"00001113"	"99"	"4627"	"0"	"4627"	"0"	"c.4627G>A"	"r.(?)"	"p.(Asp1543Asn)"	"28"
"0000178400"	"00001113"	"97"	"4627"	"0"	"4627"	"0"	"c.4627G>T"	"r.(?)"	"p.(Asp1543Tyr)"	"28"
"0000178401"	"00001113"	"99"	"4650"	"0"	"4654"	"0"	"c.4650_4654del"	"r.(?)"	"p.(Glu1551HisfsTer2)"	"28"
"0000178402"	"00001113"	"99"	"4650"	"0"	"4654"	"0"	"c.4650_4654del"	"r.(?)"	"p.(Glu1551HisfsTer2)"	"28"
"0000178403"	"00001113"	"99"	"4669"	"0"	"4669"	"0"	"c.4669C>T"	"r.(?)"	"p.(Glu1557*)"	"28"
"0000178404"	"00001113"	"77"	"4708"	"0"	"4708"	"0"	"c.4708G>T"	"r.(?)"	"p.(Ala1570Ser)"	"28"
"0000178405"	"00001113"	"99"	"4728"	"1"	"4728"	"1"	"c.4728+1G>A"	"r.spl?"	"p.(?)"	"28i"
"0000178406"	"00001113"	"99"	"4837"	"0"	"4837"	"0"	"c.4837del"	"r.(?)"	"p.(Val1613CysfsTer22)"	"29"
"0000178407"	"00001113"	"99"	"4872"	"0"	"4872"	"0"	"c.4872dup"	"r.(?)"	"p.(Met1625HisfsTer35)"	"29"
"0000178408"	"00001113"	"99"	"4879"	"0"	"4879"	"0"	"c.4879A>T"	"r.(?)"	"p.(Lys1627*)"	"29"
"0000178409"	"00001113"	"77"	"4885"	"0"	"4887"	"0"	"c.4885_4887del"	"r.(?)"	"p.(Lys1629del)"	"29"
"0000178410"	"00001113"	"99"	"4898"	"0"	"4908"	"0"	"c.4898_4908del"	"r.(?)"	"p.(Phe1633fs)"	"30"
"0000178411"	"00001113"	"99"	"4945"	"0"	"4945"	"0"	"c.4945del"	"r.(?)"	"p.(Ile1649SerfsTer95)"	"30"
"0000178412"	"00001113"	"99"	"4963"	"0"	"4963"	"0"	"c.4963del"	"r.(?)"	"p.(Leu1655CysfsTer89)"	"30"
"0000178413"	"00001113"	"97"	"4991"	"0"	"4991"	"0"	"c.4991G>A"	"r.(?)"	"p.(Arg1664His)"	"30"
"0000178414"	"00001113"	"97"	"4991"	"0"	"4991"	"0"	"c.4991G>A"	"r.(?)"	"p.(Arg1664His)"	"30"
"0000178415"	"00001113"	"77"	"5039"	"0"	"5041"	"0"	"c.5039_5041del"	"r.(?)"	"p.(Ser1680del)"	"30"
"0000178416"	"00001113"	"97"	"5060"	"0"	"5060"	"0"	"c.5060C>T"	"r.(?)"	"p.(Ser1687Phe)"	"30"
"0000178417"	"00001113"	"99"	"5212"	"0"	"5213"	"0"	"c.5212_5213insCCTCGGTCCTGCAC"	"r.(?)"	"p.(His1738Profs*11)"	"31"
"0000178418"	"00001113"	"99"	"5223"	"0"	"5224"	"0"	"c.5223_5224del"	"r.(?)"	"p.(Lys1741AsnfsTer10)"	"31"
"0000178419"	"00001113"	"99"	"5635"	"0"	"5635"	"0"	"c.5635C>T"	"r.(?)"	"p.(Gln1879*)"	"31"
"0000178420"	"00001113"	"99"	"5641"	"0"	"5642"	"0"	"c.5641_5642del"	"r.(?)"	"p.(Leu1882AlafsTer83)"	"31"
"0000178421"	"00001113"	"99"	"5710"	"0"	"5710"	"0"	"c.5710C>T"	"r.(?)"	"p.(Gln1904*)"	"31"
"0000178422"	"00001113"	"99"	"5790"	"0"	"5790"	"0"	"c.5790del"	"r.(?)"	"p.(Thr1931ProfsTer45)"	"31"
"0000178423"	"00001113"	"99"	"5793"	"0"	"5793"	"0"	"c.5793dup"	"r.(?)"	"p.(Thr1932HisfsTer34)"	"31"
"0000178424"	"00001113"	"99"	"5821"	"0"	"5821"	"0"	"c.5821C>T"	"r.(?)"	"p.(Gln1941*)"	"31"
"0000178425"	"00001113"	"99"	"5837"	"0"	"5837"	"0"	"c.5837del"	"r.(?)"	"p.(Pro1946HisfsTer30)"	"31"
"0000178426"	"00001113"	"99"	"5837"	"0"	"5837"	"0"	"c.5837dup"	"r.(?)"	"p.(Pro1947ThrfsTer19)"	"31"
"0000178427"	"00001113"	"99"	"5837"	"0"	"5837"	"0"	"c.5837dup"	"r.(?)"	"p.(Pro1947ThrfsTer19)"	"31"
"0000178428"	"00001113"	"99"	"5838"	"0"	"5857"	"0"	"c.5838_5857dup20"	"r.(?)"	"p.(Pro1953fs)"	"31"
"0000178429"	"00001113"	"33"	"5945"	"0"	"5945"	"0"	"c.5945C>G"	"r.(?)"	"p.(Pro1982Arg)"	"31"
"0000178430"	"00001113"	"99"	"6010"	"0"	"6010"	"0"	"c.6010C>T"	"r.(?)"	"p.(Arg2004*)"	"31"
"0000178431"	"00001113"	"99"	"6010"	"0"	"6010"	"0"	"c.6010C>T"	"r.(?)"	"p.(Arg2004*)"	"31"
"0000178432"	"00001113"	"99"	"6019"	"0"	"6019"	"0"	"c.6019C>T"	"r.(?)"	"p.(Gln2007*)"	"31"
"0000178433"	"00001113"	"99"	"6043"	"0"	"6043"	"0"	"c.6043del"	"r.(?)"	"p.(Ser2015AlafsTer25)"	"31"
"0000178434"	"00001113"	"99"	"6044"	"0"	"6050"	"0"	"c.6044_6050dup"	"r.(?)"	"p.(Pro2018HisfsTer325)"	"31"
"0000178435"	"00001113"	"99"	"6065"	"0"	"6071"	"0"	"c.6065_6071del"	"r.(?)"	"p.(Gln2022ArgfsTer16)"	"31"
"0000178436"	"00001113"	"99"	"6127"	"0"	"6127"	"0"	"c.6127C>T"	"r.(?)"	"p.(Gln2043*)"	"31"
"0000178437"	"00001113"	"99"	"6133"	"0"	"6133"	"0"	"c.6133C>T"	"r.(?)"	"p.(Gln2045*)"	"31"
"0000178438"	"00001113"	"99"	"6213"	"0"	"6213"	"0"	"c.6213del"	"r.(?)"	"p.(Arg2072GlyfsTer3)"	"31"
"0000178439"	"00001113"	"99"	"6283"	"0"	"6283"	"0"	"c.6283C>T"	"r.(?)"	"p.(Gln2095*)"	"31"
"0000178440"	"00001113"	"99"	"6436"	"0"	"6436"	"0"	"c.6436C>T"	"r.(?)"	"p.(Gln2146*)"	"31"
"0000178441"	"00001113"	"93"	"6661"	"0"	"6661"	"0"	"c.6661A>C"	"r.(?)"	"p.(Met2221Leu)"	"31"
"0000178442"	"00001113"	"95"	"6728"	"0"	"6728"	"0"	"c.6728C>T"	"r.(?)"	"p.(Ala2243Val)"	"31"
"0000236244"	"00001113"	"70"	"5155"	"0"	"5155"	"0"	"c.5155C>G"	"r.(?)"	"p.(His1719Asp)"	"30"
"0000236256"	"00001113"	"70"	"5345"	"0"	"5345"	"0"	"c.5345C>T"	"r.(?)"	"p.(Ala1782Val)"	"31"
"0000236257"	"00001113"	"70"	"5485"	"0"	"5485"	"0"	"c.5485C>G"	"r.(?)"	"p.(His1829Asp)"	"31"
"0000236258"	"00001113"	"70"	"5595"	"0"	"5597"	"0"	"c.5595_5597del"	"r.(?)"	"p.(Met1865_Arg1866delinsIle)"	"31"
"0000236259"	"00001113"	"70"	"5600"	"0"	"5600"	"0"	"c.5600G>A"	"r.(?)"	"p.(Arg1867Gln)"	"31"
"0000236260"	"00001113"	"70"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	"31"
"0000236261"	"00001113"	"70"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	"31"
"0000236262"	"00001113"	"70"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	"31"
"0000236263"	"00001113"	"70"	"5603"	"0"	"5603"	"0"	"c.5603G>A"	"r.(?)"	"p.(Arg1868Gln)"	"31"
"0000236265"	"00001113"	"70"	"5608"	"0"	"5608"	"0"	"c.5608G>C"	"r.(?)"	"p.(Ala1870Pro)"	"31"
"0000236266"	"00001113"	"70"	"5614"	"0"	"5614"	"0"	"c.5614A>G"	"r.(?)"	"p.(Met1872Val)"	"31"
"0000252279"	"00001113"	"30"	"4280"	"8"	"4280"	"8"	"c.4280+8T>C"	"r.(=)"	"p.(=)"	""
"0000255648"	"00001113"	"90"	"4507"	"0"	"4507"	"0"	"c.4507T>C"	"r.(?)"	"p.(Tyr1503His)"	""
"0000267125"	"00001113"	"10"	"2728"	"0"	"2728"	"0"	"c.2728A>G"	"r.(?)"	"p.(Thr910Ala)"	""
"0000267126"	"00001113"	"50"	"7151"	"0"	"7151"	"0"	"c.7151A>C"	"r.(?)"	"p.(His2384Pro)"	""
"0000270582"	"00001113"	"30"	"2678"	"0"	"2678"	"0"	"c.2678C>T"	"r.(?)"	"p.(Ser893Leu)"	""
"0000270583"	"00001113"	"30"	"2941"	"0"	"2941"	"0"	"c.2941G>A"	"r.(?)"	"p.(Ala981Thr)"	""
"0000274411"	"00001113"	"30"	"1149"	"0"	"1149"	"0"	"c.1149G>A"	"r.(?)"	"p.(Pro383=)"	""
"0000274412"	"00001113"	"10"	"1651"	"0"	"1651"	"0"	"c.1651C>A"	"r.(?)"	"p.(Leu551Ile)"	""
"0000274413"	"00001113"	"30"	"2284"	"-4"	"2284"	"-4"	"c.2284-4G>C"	"r.spl?"	"p.?"	""
"0000274414"	"00001113"	"30"	"2941"	"0"	"2941"	"0"	"c.2941G>A"	"r.(?)"	"p.(Ala981Thr)"	""
"0000274415"	"00001113"	"30"	"2973"	"0"	"2973"	"0"	"c.2973C>T"	"r.(?)"	"p.(Asp991=)"	""
"0000274416"	"00001113"	"90"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	""
"0000274417"	"00001113"	"30"	"383"	"0"	"383"	"0"	"c.383C>G"	"r.(?)"	"p.(Ser128Cys)"	""
"0000274418"	"00001113"	"50"	"3901"	"0"	"3901"	"0"	"c.3901A>G"	"r.(?)"	"p.(Ile1301Val)"	""
"0000274419"	"00001113"	"50"	"4084"	"0"	"4084"	"0"	"c.4084G>C"	"r.(?)"	"p.(Val1362Leu)"	""
"0000274420"	"00001113"	"30"	"4728"	"8"	"4728"	"8"	"c.4728+8C>T"	"r.(=)"	"p.(=)"	""
"0000274421"	"00001113"	"30"	"5173"	"-4"	"5173"	"-4"	"c.5173-4G>A"	"r.spl?"	"p.?"	""
"0000274422"	"00001113"	"50"	"52"	"0"	"52"	"0"	"c.52A>T"	"r.(?)"	"p.(Ser18Cys)"	""
"0000274423"	"00001113"	"50"	"569"	"0"	"569"	"0"	"c.569A>G"	"r.(?)"	"p.(Asn190Ser)"	""
"0000274424"	"00001113"	"30"	"5770"	"0"	"5770"	"0"	"c.5770G>A"	"r.(?)"	"p.(Val1924Met)"	""
"0000274425"	"00001113"	"50"	"5890"	"0"	"5890"	"0"	"c.5890C>T"	"r.(?)"	"p.(Arg1964Cys)"	""
"0000274426"	"00001113"	"30"	"6050"	"0"	"6050"	"0"	"c.6050C>T"	"r.(?)"	"p.(Pro2017Leu)"	""
"0000274427"	"00001113"	"30"	"6237"	"0"	"6237"	"0"	"c.6237C>A"	"r.(?)"	"p.(Ser2079=)"	""
"0000274428"	"00001113"	"30"	"6351"	"0"	"6351"	"0"	"c.6351C>T"	"r.(?)"	"p.(Pro2117=)"	""
"0000274429"	"00001113"	"30"	"6376"	"0"	"6376"	"0"	"c.6376G>C"	"r.(?)"	"p.(Gly2126Arg)"	""
"0000274430"	"00001113"	"30"	"6656"	"0"	"6656"	"0"	"c.6656C>T"	"r.(?)"	"p.(Ala2219Val)"	""
"0000274431"	"00001113"	"10"	"6685"	"0"	"6685"	"0"	"c.6685G>A"	"r.(?)"	"p.(Gly2229Ser)"	""
"0000274432"	"00001113"	"30"	"7302"	"0"	"7302"	"0"	"c.7302G>A"	"r.(?)"	"p.(Thr2434=)"	""
"0000274433"	"00001113"	"50"	"865"	"0"	"865"	"0"	"c.865G>A"	"r.(?)"	"p.(Gly289Arg)"	""
"0000324528"	"00001113"	"50"	"6763"	"0"	"6763"	"0"	"c.6763C>T"	"r.(?)"	"p.(Pro2255Ser)"	""
"0000324529"	"00001113"	"50"	"6564"	"0"	"6564"	"0"	"c.6564G>C"	"r.(?)"	"p.(Gln2188His)"	""
"0000324531"	"00001113"	"30"	"6115"	"0"	"6115"	"0"	"c.6115G>A"	"r.(?)"	"p.(Val2039Met)"	""
"0000324532"	"00001113"	"30"	"5933"	"0"	"5933"	"0"	"c.5933A>G"	"r.(?)"	"p.(Asn1978Ser)"	""
"0000324534"	"00001113"	"50"	"5800"	"0"	"5800"	"0"	"c.5800T>C"	"r.(?)"	"p.(Ser1934Pro)"	""
"0000324535"	"00001113"	"30"	"5719"	"0"	"5719"	"0"	"c.5719G>A"	"r.(?)"	"p.(Ala1907Thr)"	""
"0000324536"	"00001113"	"50"	"5614"	"0"	"5614"	"0"	"c.5614A>G"	"r.(?)"	"p.(Met1872Val)"	""
"0000324537"	"00001113"	"50"	"5600"	"0"	"5600"	"0"	"c.5600G>A"	"r.(?)"	"p.(Arg1867Gln)"	""
"0000324539"	"00001113"	"50"	"4757"	"0"	"4757"	"0"	"c.4757A>G"	"r.(?)"	"p.(Lys1586Arg)"	""
"0000324541"	"00001113"	"30"	"3985"	"0"	"3985"	"0"	"c.3985C>T"	"r.(?)"	"p.(Leu1329=)"	""
"0000324543"	"00001113"	"70"	"3662"	"0"	"3662"	"0"	"c.3662T>C"	"r.(?)"	"p.(Ile1221Thr)"	""
"0000324544"	"00001113"	"30"	"2941"	"0"	"2941"	"0"	"c.2941G>A"	"r.(?)"	"p.(Ala981Thr)"	""
"0000324545"	"00001113"	"50"	"2759"	"0"	"2759"	"0"	"c.2759C>T"	"r.(?)"	"p.(Ala920Val)"	""
"0000324546"	"00001113"	"50"	"2598"	"0"	"2598"	"0"	"c.2598G>T"	"r.(?)"	"p.(Met866Ile)"	""
"0000324547"	"00001113"	"50"	"2149"	"0"	"2149"	"0"	"c.2149G>A"	"r.(?)"	"p.(Val717Ile)"	""
"0000324548"	"00001113"	"50"	"105"	"0"	"105"	"0"	"c.105C>G"	"r.(?)"	"p.(Asp35Glu)"	""
"0000341215"	"00001113"	"70"	"5345"	"0"	"5345"	"0"	"c.5345C>T"	"r.(?)"	"p.(Ala1782Val)"	""
"0000343611"	"00001113"	"50"	"4640"	"0"	"4640"	"0"	"c.4640A>C"	"r.(?)"	"p.(Asn1547Thr)"	""
"0000345822"	"00001113"	"50"	"5806"	"0"	"5806"	"0"	"c.5806G>C"	"r.(?)"	"p.(Gly1936Arg)"	""
"0000346387"	"00001113"	"70"	"5155"	"0"	"5155"	"0"	"c.5155C>G"	"r.(?)"	"p.(His1719Asp)"	""
"0000346937"	"00001113"	"90"	"5066"	"0"	"5066"	"0"	"c.5066T>C"	"r.(?)"	"p.(Leu1689Pro)"	""
"0000347208"	"00001113"	"50"	"1571"	"0"	"1571"	"0"	"c.1571T>A"	"r.(?)"	"p.(Leu524Gln)"	""
"0000347322"	"00001113"	"50"	"2527"	"0"	"2527"	"0"	"c.2527C>G"	"r.(?)"	"p.(Leu843Val)"	""
"0000349655"	"00001113"	"10"	"2728"	"0"	"2728"	"0"	"c.2728A>G"	"r.(?)"	"p.(Thr910Ala)"	""
"0000350266"	"00001113"	"30"	"3841"	"0"	"3841"	"0"	"c.3841G>A"	"r.(?)"	"p.(Val1281Ile)"	""
"0000350372"	"00001113"	"30"	"5770"	"0"	"5770"	"0"	"c.5770G>A"	"r.(?)"	"p.(Val1924Met)"	""
"0000351148"	"00001113"	"90"	"4134"	"-1"	"4134"	"-1"	"c.4134-1G>T"	"r.spl?"	"p.?"	""
"0000351150"	"00001113"	"90"	"2283"	"1"	"2283"	"1"	"c.2283+1G>A"	"r.spl?"	"p.?"	""
"0000474973"	"00001113"	"70"	"5549"	"0"	"5549"	"0"	"c.5549T>C"	"r.(?)"	"p.(Leu1850Pro)"	""
"0000499546"	"00001113"	"90"	"5155"	"0"	"5155"	"0"	"c.5155C>G"	"r.(?)"	"p.(His1719Asp)"	""
"0000499547"	"00001113"	"90"	"5345"	"0"	"5345"	"0"	"c.5345C>T"	"r.(?)"	"p.(Ala1782Val)"	""
"0000499548"	"00001113"	"90"	"5485"	"0"	"5485"	"0"	"c.5485C>G"	"r.(?)"	"p.(His1829Asp)"	""
"0000499549"	"00001113"	"90"	"5595"	"0"	"5597"	"0"	"c.5595_5597del"	"r.(?)"	"p.(Met1865_Arg1866delinsIle)"	""
"0000499550"	"00001113"	"90"	"5600"	"0"	"5600"	"0"	"c.5600G>A"	"r.(?)"	"p.(Arg1867Gln)"	""
"0000499551"	"00001113"	"90"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	""
"0000499552"	"00001113"	"90"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	""
"0000499553"	"00001113"	"90"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	""
"0000499554"	"00001113"	"90"	"5603"	"0"	"5603"	"0"	"c.5603G>A"	"r.(?)"	"p.(Arg1868Gln)"	""
"0000499555"	"00001113"	"90"	"5608"	"0"	"5608"	"0"	"c.5608G>C"	"r.(?)"	"p.(Ala1870Pro)"	""
"0000499556"	"00001113"	"90"	"5614"	"0"	"5614"	"0"	"c.5614A>G"	"r.(?)"	"p.(Met1872Val)"	""
"0000499559"	"00001113"	"90"	"5128"	"0"	"5128"	"0"	"c.5128T>C"	"r.(?)"	"p.(Cys1710Arg)"	""
"0000499560"	"00001113"	"90"	"5240"	"0"	"5240"	"0"	"c.5240T>G"	"r.(?)"	"p.(Leu1747Arg)"	""
"0000499561"	"00001113"	"90"	"5357"	"0"	"5357"	"0"	"c.5357G>C"	"r.(?)"	"p.(Arg1786Pro)"	""
"0000499562"	"00001113"	"90"	"5456"	"0"	"5456"	"0"	"c.5456G>T"	"r.(?)"	"p.(Cys1819Phe)"	""
"0000499563"	"00001113"	"90"	"5478"	"0"	"5478"	"0"	"c.5478C>G"	"r.(?)"	"p.(Cys1826Trp)"	""
"0000499564"	"00001113"	"90"	"5513"	"0"	"5513"	"0"	"c.5513G>A"	"r.(?)"	"p.(Cys1838Tyr)"	""
"0000499565"	"00001113"	"90"	"5599"	"0"	"5599"	"0"	"c.5599C>T"	"r.(?)"	"p.(Arg1867Trp)"	""
"0000499566"	"00001113"	"90"	"5600"	"0"	"5600"	"0"	"c.5600G>A"	"r.(?)"	"p.(Arg1867Gln)"	""
"0000499567"	"00001113"	"90"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	""
"0000499568"	"00001113"	"90"	"5602"	"0"	"5602"	"0"	"c.5602C>T"	"r.(?)"	"p.(Arg1868Trp)"	""
"0000499569"	"00001113"	"90"	"5614"	"0"	"5614"	"0"	"c.5614A>G"	"r.(?)"	"p.(Met1872Val)"	""
"0000558136"	"00001113"	"30"	"7151"	"0"	"7151"	"0"	"c.7151A>C"	"r.(?)"	"p.(His2384Pro)"	""
"0000558137"	"00001113"	"50"	"6961"	"0"	"6961"	"0"	"c.6961C>T"	"r.(?)"	"p.(Leu2321Phe)"	""
"0000558138"	"00001113"	"30"	"6723"	"0"	"6723"	"0"	"c.6723A>G"	"r.(?)"	"p.(Pro2241=)"	""
"0000558139"	"00001113"	"30"	"6661"	"0"	"6661"	"0"	"c.6661A>C"	"r.(?)"	"p.(Met2221Leu)"	""
"0000558140"	"00001113"	"30"	"6661"	"0"	"6661"	"0"	"c.6661A>C"	"r.(?)"	"p.(Met2221Leu)"	""
"0000558141"	"00001113"	"30"	"6624"	"0"	"6624"	"0"	"c.6624A>C"	"r.(?)"	"p.(Gln2208His)"	""
"0000558142"	"00001113"	"30"	"6624"	"0"	"6624"	"0"	"c.6624A>C"	"r.(?)"	"p.(Gln2208His)"	""
"0000558144"	"00001113"	"30"	"6237"	"0"	"6237"	"0"	"c.6237C>G"	"r.(?)"	"p.(Ser2079=)"	""
"0000558146"	"00001113"	"30"	"6003"	"0"	"6003"	"0"	"c.6003T>C"	"r.(?)"	"p.(Asn2001=)"	""
"0000558147"	"00001113"	"30"	"5933"	"0"	"5933"	"0"	"c.5933A>G"	"r.(?)"	"p.(Asn1978Ser)"	""
"0000558148"	"00001113"	"50"	"5878"	"0"	"5878"	"0"	"c.5878C>T"	"r.(?)"	"p.(Arg1960Trp)"	""
"0000558149"	"00001113"	"50"	"5845"	"0"	"5845"	"0"	"c.5845G>A"	"r.(?)"	"p.(Ala1949Thr)"	""
"0000558150"	"00001113"	"30"	"5829"	"0"	"5829"	"0"	"c.5829G>A"	"r.(?)"	"p.(Pro1943=)"	""
"0000558151"	"00001113"	"50"	"5807"	"0"	"5807"	"0"	"c.5807G>A"	"r.(?)"	"p.(Gly1936Glu)"	""
"0000558152"	"00001113"	"30"	"5770"	"0"	"5770"	"0"	"c.5770G>A"	"r.(?)"	"p.(Val1924Met)"	""
"0000558153"	"00001113"	"30"	"5719"	"0"	"5719"	"0"	"c.5719G>A"	"r.(?)"	"p.(Ala1907Thr)"	""
"0000558154"	"00001113"	"30"	"5719"	"0"	"5719"	"0"	"c.5719G>A"	"r.(?)"	"p.(Ala1907Thr)"	""
"0000558155"	"00001113"	"90"	"5710"	"0"	"5710"	"0"	"c.5710C>T"	"r.(?)"	"p.(Gln1904Ter)"	""
"0000558156"	"00001113"	"50"	"5608"	"0"	"5608"	"0"	"c.5608G>A"	"r.(?)"	"p.(Ala1870Thr)"	""
"0000558157"	"00001113"	"90"	"5600"	"0"	"5600"	"0"	"c.5600G>A"	"r.(?)"	"p.(Arg1867Gln)"	""
"0000558158"	"00001113"	"70"	"5599"	"0"	"5599"	"0"	"c.5599C>T"	"r.(?)"	"p.(Arg1867Trp)"	""
"0000558160"	"00001113"	"30"	"5436"	"0"	"5436"	"0"	"c.5436C>G"	"r.(?)"	"p.(Thr1812=)"	""
"0000558161"	"00001113"	"70"	"5210"	"0"	"5210"	"0"	"c.5210G>A"	"r.(?)"	"p.(Ser1737Asn)"	""
"0000558162"	"00001113"	"50"	"5035"	"0"	"5035"	"0"	"c.5035T>G"	"r.(?)"	"p.(Ser1679Ala)"	""
"0000558163"	"00001113"	"30"	"5004"	"0"	"5004"	"0"	"c.5004C>T"	"r.(?)"	"p.(Leu1668=)"	""
"0000558166"	"00001113"	"70"	"4767"	"0"	"4767"	"0"	"c.4767del"	"r.(?)"	"p.(Asn1589LysfsTer46)"	""
"0000558168"	"00001113"	"30"	"4280"	"8"	"4280"	"8"	"c.4280+8T>C"	"r.(=)"	"p.(=)"	""
"0000558169"	"00001113"	"50"	"4177"	"0"	"4177"	"0"	"c.4177A>G"	"r.(?)"	"p.(Thr1393Ala)"	""
"0000558170"	"00001113"	"30"	"4133"	"4"	"4133"	"4"	"c.4133+4A>G"	"r.spl?"	"p.?"	""
"0000558171"	"00001113"	"50"	"3965"	"0"	"3965"	"0"	"c.3965A>G"	"r.(?)"	"p.(Asn1322Ser)"	""
"0000558172"	"00001113"	"70"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	""
"0000558173"	"00001113"	"30"	"3831"	"0"	"3831"	"0"	"c.3831C>T"	"r.(?)"	"p.(Pro1277=)"	""
"0000558174"	"00001113"	"70"	"3796"	"0"	"3796"	"0"	"c.3796C>T"	"r.(?)"	"p.(Gln1266Ter)"	""
"0000558175"	"00001113"	"30"	"3610"	"-10"	"3610"	"-10"	"c.3610-10A>G"	"r.(=)"	"p.(=)"	""
"0000558176"	"00001113"	"50"	"3419"	"0"	"3419"	"0"	"c.3419G>A"	"r.(?)"	"p.(Arg1140Gln)"	""
"0000558177"	"00001113"	"30"	"3370"	"-4"	"3370"	"-4"	"c.3370-4del"	"r.spl?"	"p.?"	""
"0000558178"	"00001113"	"30"	"3370"	"-4"	"3370"	"-4"	"c.3370-4dup"	"r.spl?"	"p.?"	""
"0000558179"	"00001113"	"30"	"3252"	"0"	"3252"	"0"	"c.3252C>T"	"r.(?)"	"p.(Ile1084=)"	""
"0000558180"	"00001113"	"30"	"3029"	"0"	"3029"	"0"	"c.3029C>T"	"r.(?)"	"p.(Pro1010Leu)"	""
"0000558182"	"00001113"	"30"	"2951"	"0"	"2951"	"0"	"c.2951A>G"	"r.(?)"	"p.(Asn984Ser)"	""
"0000558183"	"00001113"	"30"	"2811"	"0"	"2811"	"0"	"c.2811G>A"	"r.(?)"	"p.(Pro937=)"	""
"0000558185"	"00001113"	"30"	"2728"	"0"	"2728"	"0"	"c.2728A>G"	"r.(?)"	"p.(Thr910Ala)"	""
"0000558186"	"00001113"	"50"	"2689"	"0"	"2689"	"0"	"c.2689C>A"	"r.(?)"	"p.(Gln897Lys)"	""
"0000558187"	"00001113"	"30"	"2678"	"0"	"2678"	"0"	"c.2678C>T"	"r.(?)"	"p.(Ser893Leu)"	""
"0000558188"	"00001113"	"30"	"2678"	"0"	"2678"	"0"	"c.2678C>T"	"r.(?)"	"p.(Ser893Leu)"	""
"0000558190"	"00001113"	"50"	"2344"	"0"	"2344"	"0"	"c.2344A>G"	"r.(?)"	"p.(Asn782Asp)"	""
"0000558191"	"00001113"	"50"	"2326"	"0"	"2326"	"0"	"c.2326A>G"	"r.(?)"	"p.(Met776Val)"	""
"0000558192"	"00001113"	"30"	"2052"	"0"	"2052"	"0"	"c.2052C>T"	"r.(?)"	"p.(Ala684=)"	""
"0000558193"	"00001113"	"30"	"1953"	"0"	"1953"	"0"	"c.1953T>C"	"r.(?)"	"p.(Tyr651=)"	""
"0000558194"	"00001113"	"70"	"1799"	"0"	"1799"	"0"	"c.1799T>C"	"r.(?)"	"p.(Leu600Pro)"	""
"0000558195"	"00001113"	"30"	"1651"	"0"	"1651"	"0"	"c.1651C>A"	"r.(?)"	"p.(Leu551Ile)"	""
"0000558197"	"00001113"	"30"	"879"	"0"	"879"	"0"	"c.879G>A"	"r.(?)"	"p.(Val293=)"	""
"0000558198"	"00001113"	"30"	"712"	"0"	"712"	"0"	"c.712G>C"	"r.(?)"	"p.(Val238Leu)"	""
"0000558199"	"00001113"	"30"	"586"	"0"	"586"	"0"	"c.586A>G"	"r.(?)"	"p.(Ser196Gly)"	""
"0000558200"	"00001113"	"30"	"435"	"0"	"435"	"0"	"c.435C>T"	"r.(?)"	"p.(Pro145=)"	""
"0000558201"	"00001113"	"70"	"386"	"0"	"386"	"0"	"c.386C>G"	"r.(?)"	"p.(Ser129Ter)"	""
"0000558202"	"00001113"	"50"	"140"	"0"	"140"	"0"	"c.140A>G"	"r.(?)"	"p.(Asn47Ser)"	""
"0000558203"	"00001113"	"30"	"36"	"0"	"36"	"0"	"c.36C>G"	"r.(?)"	"p.(Pro12=)"	""
"0000615980"	"00001113"	"50"	"7282"	"0"	"7282"	"0"	"c.7282G>C"	"r.(?)"	"p.(Gly2428Arg)"	""
"0000615982"	"00001113"	"30"	"6090"	"0"	"6090"	"0"	"c.6090G>A"	"r.(?)"	"p.(Gln2030=)"	""
"0000615984"	"00001113"	"10"	"5933"	"0"	"5933"	"0"	"c.5933A>G"	"r.(?)"	"p.(Asn1978Ser)"	""
"0000615985"	"00001113"	"30"	"5865"	"0"	"5865"	"0"	"c.5865G>A"	"r.(?)"	"p.(Ala1955=)"	""
"0000615986"	"00001113"	"50"	"5558"	"0"	"5558"	"0"	"c.5558A>C"	"r.(?)"	"p.(Gln1853Pro)"	""
"0000615987"	"00001113"	"50"	"5255"	"0"	"5255"	"0"	"c.5255A>G"	"r.(?)"	"p.(Glu1752Gly)"	""
"0000615988"	"00001113"	"30"	"4993"	"0"	"4993"	"0"	"c.4993G>A"	"r.(?)"	"p.(Asp1665Asn)"	""
"0000615989"	"00001113"	"50"	"4291"	"0"	"4291"	"0"	"c.4291A>G"	"r.(?)"	"p.(Ile1431Val)"	""
"0000615991"	"00001113"	"30"	"3238"	"0"	"3238"	"0"	"c.3238C>G"	"r.(?)"	"p.(Pro1080Ala)"	""
"0000615992"	"00001113"	"50"	"3232"	"0"	"3232"	"0"	"c.3232T>C"	"r.(?)"	"p.(Ser1078Pro)"	""
"0000615993"	"00001113"	"50"	"3139"	"0"	"3139"	"0"	"c.3139G>A"	"r.(?)"	"p.(Glu1047Lys)"	""
"0000615994"	"00001113"	"50"	"2644"	"0"	"2644"	"0"	"c.2644C>G"	"r.(?)"	"p.(Pro882Ala)"	""
"0000615995"	"00001113"	"90"	"708"	"0"	"708"	"0"	"c.708dup"	"r.(?)"	"p.(Ser237GlnfsTer5)"	""
"0000615996"	"00001113"	"50"	"659"	"0"	"659"	"0"	"c.659G>C"	"r.(?)"	"p.(Arg220Thr)"	""
"0000615997"	"00001113"	"30"	"383"	"0"	"383"	"0"	"c.383C>G"	"r.(?)"	"p.(Ser128Cys)"	""
"0000615998"	"00001113"	"50"	"145"	"0"	"145"	"0"	"c.145G>C"	"r.(?)"	"p.(Gly49Arg)"	""
"0000615999"	"00001113"	"30"	"140"	"0"	"140"	"0"	"c.140A>G"	"r.(?)"	"p.(Asn47Ser)"	""
"0000616000"	"00001113"	"50"	"105"	"0"	"105"	"0"	"c.105C>G"	"r.(?)"	"p.(Asp35Glu)"	""
"0000616001"	"00001113"	"70"	"37"	"0"	"37"	"0"	"c.37A>G"	"r.(?)"	"p.(Lys13Glu)"	""
"0000623457"	"00001113"	"50"	"7306"	"0"	"7306"	"0"	"c.7306G>A"	"r.(?)"	"p.(Glu2436Lys)"	""
"0000623459"	"00001113"	"30"	"6332"	"0"	"6332"	"0"	"c.6332A>G"	"r.(?)"	"p.(Asn2111Ser)"	""
"0000623460"	"00001113"	"50"	"4153"	"0"	"4153"	"0"	"c.4153A>C"	"r.(?)"	"p.(Met1385Leu)"	""
"0000623461"	"00001113"	"30"	"4103"	"0"	"4103"	"0"	"c.4103C>T"	"r.(?)"	"p.(Thr1368Met)"	""
"0000623462"	"00001113"	"10"	"3370"	"-4"	"3370"	"-4"	"c.3370-4dup"	"r.spl?"	"p.?"	""
"0000623463"	"00001113"	"30"	"2991"	"0"	"2991"	"0"	"c.2991G>T"	"r.(?)"	"p.(Met997Ile)"	""
"0000623464"	"00001113"	"30"	"2811"	"0"	"2811"	"0"	"c.2811G>A"	"r.(?)"	"p.(Pro937=)"	""
"0000623465"	"00001113"	"90"	"181"	"0"	"182"	"0"	"c.181_182insAAGGTTTAA"	"r.(?)"	"p.(Pro61delinsGlnGlyLeuThr)"	""
"0000623466"	"00001113"	"90"	"180"	"0"	"181"	"0"	"c.180_181insTAAA"	"r.(?)"	"p.(Pro61Ter)"	""
"0000649312"	"00001113"	"10"	"7212"	"0"	"7212"	"0"	"c.7212A>G"	"r.(=)"	"p.(=)"	""
"0000649313"	"00001113"	"70"	"4445"	"0"	"4445"	"0"	"c.4445A>G"	"r.(?)"	"p.(Tyr1482Cys)"	""
"0000649314"	"00001113"	"90"	"3993"	"0"	"3993"	"0"	"c.3993del"	"r.(?)"	"p.(Thr1332Glnfs*11)"	""
"0000649315"	"00001113"	"30"	"2728"	"0"	"2728"	"0"	"c.2728A>G"	"r.(?)"	"p.(Thr910Ala)"	""
"0000649316"	"00001113"	"10"	"1953"	"0"	"1953"	"0"	"c.1953T>C"	"r.(=)"	"p.(=)"	""
"0000649317"	"00001113"	"90"	"1257"	"0"	"1257"	"0"	"c.1257G>A"	"r.(?)"	"p.(Trp419*)"	""
"0000649318"	"00001113"	"90"	"299"	"0"	"299"	"0"	"c.299del"	"r.(?)"	"p.(Gly100Valfs*24)"	""
"0000653528"	"00001113"	"70"	"5948"	"0"	"5948"	"0"	"c.5948del"	"r.(?)"	"p.(Pro1983Glnfs*16)"	""
"0000657843"	"00001113"	"50"	"4945"	"0"	"4945"	"0"	"c.4945A>C"	"r.(?)"	"p.(Ile1649Leu)"	""
"0000657844"	"00001113"	"70"	"4336"	"0"	"4336"	"0"	"c.4336C>T"	"r.(?)"	"p.(Arg1446Cys)"	""
"0000657845"	"00001113"	"50"	"4043"	"0"	"4043"	"0"	"c.4043G>T"	"r.(?)"	"p.(Arg1348Leu)"	""
"0000657846"	"00001113"	"90"	"3779"	"1"	"3779"	"1"	"c.3779+1G>A"	"r.spl?"	"p.?"	""
"0000657847"	"00001113"	"30"	"2409"	"0"	"2409"	"0"	"c.2409C>T"	"r.(?)"	"p.(Ser803=)"	""
"0000657848"	"00001113"	"30"	"905"	"0"	"905"	"0"	"c.905G>A"	"r.(?)"	"p.(Ser302Asn)"	""
"0000667504"	"00001113"	"90"	"5129"	"0"	"5129"	"0"	"c.5129G>A"	"r.(?)"	"p.(Cys1710Tyr)"	""
"0000673945"	"00001113"	"70"	"4990"	"0"	"4990"	"0"	"c.4990C>T"	"r.(?)"	"p.(Arg1664Cys)"	""
"0000680568"	"00001113"	"30"	"6763"	"0"	"6763"	"0"	"c.6763C>T"	"r.(?)"	"p.(Pro2255Ser)"	""
"0000680569"	"00001113"	"30"	"6645"	"0"	"6647"	"0"	"c.6645_6647dup"	"r.(?)"	"p.(Gln2216dup)"	""
"0000680570"	"00001113"	"30"	"6480"	"0"	"6480"	"0"	"c.6480G>A"	"r.(?)"	"p.(Ala2160=)"	""
"0000680571"	"00001113"	"90"	"6324"	"0"	"6324"	"0"	"c.6324C>G"	"r.(?)"	"p.(Tyr2108Ter)"	""
"0000680572"	"00001113"	"50"	"4890"	"0"	"4890"	"0"	"c.4890G>A"	"r.(?)"	"p.(Glu1630=)"	""
"0000680574"	"00001113"	"30"	"2088"	"0"	"2088"	"0"	"c.2088A>G"	"r.(?)"	"p.(Pro696=)"	""
"0000680575"	"00001113"	"70"	"1181"	"0"	"1181"	"0"	"c.1181A>C"	"r.(?)"	"p.(His394Pro)"	""
"0000682722"	"00001113"	"70"	"5172"	"1"	"5172"	"1"	"c.5172+1G>A"	"r.spl?"	"p.?"	""
"0000682723"	"00001113"	"70"	"5848"	"0"	"5848"	"0"	"c.5848C>T"	"r.(?)"	"p.(Gln1950*)"	""
"0000682760"	"00001113"	"70"	"979"	"0"	"979"	"0"	"c.979C>T"	"r.(?)"	"p.(Gln327*)"	""
"0000683545"	"00001113"	"90"	"4492"	"0"	"4492"	"0"	"c.4492C>T"	"r.(?)"	"p.(Arg1498*)"	""
"0000683546"	"00001113"	"90"	"881"	"0"	"881"	"0"	"c.881dup"	"r.(?)"	"p.(Asn294Lysfs*56)"	""
"0000692070"	"00001113"	"50"	"5864"	"0"	"5864"	"0"	"c.5864C>T"	"r.(?)"	"p.(Ala1955Val)"	""
"0000698317"	"00001113"	"90"	"1108"	"0"	"1108"	"0"	"c.1108C>T"	"r.(?)"	"p.(Arg370* )"	"4"
"0000698318"	"00001113"	"90"	"2650"	"0"	"2663"	"0"	"c.2650_2663dup"	"r.(?)"	"p.(Ser889Leufs* 43)"	"14"
"0000698319"	"00001113"	"90"	"2616"	"0"	"2616"	"0"	"c.2616dup"	"r.(?)"	"p.(Thr873Aspfs* 97)"	"14"
"0000698320"	"00001113"	"70"	"4627"	"0"	"4627"	"0"	"c.4627G>C"	"r.(?)"	"p.(Asp1543His)"	"21"
"0000698321"	"00001113"	"70"	"4627"	"0"	"4627"	"0"	"c.4627G>C"	"r.(?)"	"p.(Asp1543His)"	"21"
"0000698322"	"00001113"	"90"	"5128"	"0"	"5128"	"0"	"c.5128T>C"	"r.(?)"	"p.(Cys1710Arg)"	"30"
"0000698323"	"00001113"	"90"	"6670"	"0"	"6671"	"0"	"c.6670_6671dup"	"r.(?)"	"p.(Met2225Alafs* 78)"	"31"
"0000725772"	"00001113"	"50"	"7282"	"0"	"7282"	"0"	"c.7282G>C"	"r.(?)"	"p.(Gly2428Arg)"	""
"0000725773"	"00001113"	"30"	"7256"	"0"	"7256"	"0"	"c.7256C>T"	"r.(?)"	"p.(Ala2419Val)"	""
"0000725774"	"00001113"	"50"	"7162"	"0"	"7162"	"0"	"c.7162G>A"	"r.(?)"	"p.(Ala2388Thr)"	""
"0000725775"	"00001113"	"30"	"6457"	"0"	"6457"	"0"	"c.6457G>A"	"r.(?)"	"p.(Gly2153Ser)"	""
"0000725776"	"00001113"	"50"	"6435"	"0"	"6435"	"0"	"c.6435G>T"	"r.(?)"	"p.(Met2145Ile)"	""
"0000725777"	"00001113"	"70"	"5456"	"0"	"5456"	"0"	"c.5456G>T"	"r.(?)"	"p.(Cys1819Phe)"	""
"0000725778"	"00001113"	"30"	"5427"	"0"	"5427"	"0"	"c.5427A>G"	"r.(?)"	"p.(Lys1809=)"	""
"0000725779"	"00001113"	"70"	"4894"	"0"	"4894"	"0"	"c.4894T>C"	"r.(?)"	"p.(Phe1632Leu)"	""
"0000725780"	"00001113"	"30"	"4494"	"0"	"4494"	"0"	"c.4494A>G"	"r.(?)"	"p.(Arg1498=)"	""
"0000725781"	"00001113"	"50"	"4439"	"0"	"4439"	"0"	"c.4439A>G"	"r.(?)"	"p.(Asp1480Gly)"	""
"0000725782"	"00001113"	"50"	"4283"	"0"	"4283"	"0"	"c.4283G>A"	"r.(?)"	"p.(Arg1428His)"	""
"0000725783"	"00001113"	"50"	"4281"	"-12"	"4281"	"-12"	"c.4281-12T>G"	"r.(=)"	"p.(=)"	""
"0000725784"	"00001113"	"50"	"2846"	"0"	"2846"	"0"	"c.2846C>T"	"r.(?)"	"p.(Pro949Leu)"	""
"0000725785"	"00001113"	"30"	"2728"	"0"	"2728"	"0"	"c.2728A>T"	"r.(?)"	"p.(Thr910Ser)"	""
"0000725786"	"00001113"	"30"	"2728"	"0"	"2728"	"0"	"c.2728A>G"	"r.(?)"	"p.(Thr910Ala)"	""
"0000725787"	"00001113"	"50"	"2420"	"0"	"2420"	"0"	"c.2420G>C"	"r.(?)"	"p.(Ser807Thr)"	""
"0000725788"	"00001113"	"50"	"2410"	"0"	"2410"	"0"	"c.2410G>A"	"r.(?)"	"p.(Gly804Arg)"	""
"0000725789"	"00001113"	"50"	"2141"	"0"	"2141"	"0"	"c.2141G>A"	"r.(?)"	"p.(Arg714His)"	""
"0000725790"	"00001113"	"30"	"1824"	"0"	"1824"	"0"	"c.1824C>T"	"r.(?)"	"p.(Leu608=)"	""
"0000725791"	"00001113"	"50"	"1640"	"0"	"1640"	"0"	"c.1640C>T"	"r.(?)"	"p.(Ser547Leu)"	""
"0000725792"	"00001113"	"30"	"333"	"0"	"333"	"0"	"c.333C>T"	"r.(?)"	"p.(Asn111=)"	""
"0000725793"	"00001113"	"10"	"293"	"0"	"293"	"0"	"c.293G>T"	"r.(?)"	"p.(Gly98Val)"	""
"0000729885"	"00001113"	"90"	"880"	"0"	"880"	"0"	"c.880dup"	"r.(?)"	"p.(Asn294Lysfs*56)"	""
"0000729886"	"00001113"	"90"	"4890"	"2"	"4890"	"2"	"c.4890+2T>C"	"r.spl?"	"p.?"	""
"0000729887"	"00001113"	"90"	"2203"	"0"	"2203"	"0"	"c.2203del"	"r.(?)"	"p.(Pro735Hisfs*13)"	""
"0000763100"	"00001113"	"90"	"4890"	"2"	"4890"	"2"	"c.4890+2T>C"	"r.spl"	"p.?"	""
"0000763263"	"00001113"	"90"	"2203"	"0"	"2203"	"0"	"c.2203del"	"r.(?)"	"p.(Pro735Hisfs*13)"	""
"0000763265"	"00001113"	"70"	"5614"	"0"	"5614"	"0"	"c.5614A>G"	"r.(?)"	"p.(Met1872Val)"	""
"0000786663"	"00001113"	"50"	"5584"	"0"	"5584"	"0"	"c.5584G>C"	"r.(?)"	"p.(Ala1862Pro)"	""
"0000807390"	"00001113"	"50"	"6612"	"0"	"6623"	"0"	"c.6612_6623del"	"r.(?)"	"p.(Gln2213_Gln2216del)"	""
"0000807391"	"00001113"	"30"	"6195"	"0"	"6195"	"0"	"c.6195C>T"	"r.(?)"	"p.(Ser2065=)"	""
"0000807392"	"00001113"	"70"	"5603"	"0"	"5603"	"0"	"c.5603G>A"	"r.(?)"	"p.(Arg1868Gln)"	""
"0000807393"	"00001113"	"30"	"5172"	"18"	"5172"	"18"	"c.5172+18C>T"	"r.(=)"	"p.(=)"	""
"0000807394"	"00001113"	"30"	"4890"	"7"	"4890"	"7"	"c.4890+7G>C"	"r.(=)"	"p.(=)"	""
"0000807395"	"00001113"	"30"	"3611"	"0"	"3611"	"0"	"c.3611A>T"	"r.(?)"	"p.(Tyr1204Phe)"	""
"0000807396"	"00001113"	"30"	"3128"	"0"	"3128"	"0"	"c.3128C>T"	"r.(?)"	"p.(Ser1043Leu)"	""
"0000807397"	"00001113"	"30"	"2283"	"17"	"2283"	"17"	"c.2283+17G>T"	"r.(=)"	"p.(=)"	""
"0000807398"	"00001113"	"30"	"2283"	"11"	"2283"	"11"	"c.2283+11T>C"	"r.(=)"	"p.(=)"	""
"0000807399"	"00001113"	"50"	"2219"	"0"	"2219"	"0"	"c.2219G>A"	"r.(?)"	"p.(Gly740Glu)"	""
"0000807400"	"00001113"	"30"	"905"	"0"	"905"	"0"	"c.905G>A"	"r.(?)"	"p.(Ser302Asn)"	""
"0000807401"	"00001113"	"30"	"760"	"0"	"760"	"0"	"c.760G>A"	"r.(?)"	"p.(Ala254Thr)"	""
"0000807402"	"00001113"	"30"	"712"	"0"	"712"	"0"	"c.712G>C"	"r.(?)"	"p.(Val238Leu)"	""
"0000807403"	"00001113"	"50"	"224"	"0"	"224"	"0"	"c.224G>A"	"r.(?)"	"p.(Arg75Gln)"	""
"0000807404"	"00001113"	"30"	"216"	"0"	"216"	"0"	"c.216G>T"	"r.(?)"	"p.(Glu72Asp)"	""
"0000831178"	"00001113"	"50"	"6013"	"0"	"6013"	"0"	"c.6013C>T"	"r.(?)"	"p.(Pro2005Ser)"	""
"0000837163"	"00001113"	"70"	"5366"	"0"	"5366"	"0"	"c.5366A>G"	"r.(?)"	"p.(Asn1789Ser)"	""
"0000854506"	"00001113"	"30"	"5886"	"0"	"5886"	"0"	"c.5886C>T"	"r.(?)"	"p.(Ile1962=)"	""
"0000854507"	"00001113"	"30"	"5800"	"0"	"5800"	"0"	"c.5800T>C"	"r.(?)"	"p.(Ser1934Pro)"	""
"0000854508"	"00001113"	"70"	"5518"	"0"	"5518"	"0"	"c.5518G>A"	"r.(?)"	"p.(Val1840Met)"	""
"0000854509"	"00001113"	"30"	"4224"	"0"	"4224"	"0"	"c.4224C>T"	"r.(?)"	"p.(Cys1408=)"	""
"0000854510"	"00001113"	"90"	"3947"	"0"	"3947"	"0"	"c.3947del"	"r.(?)"	"p.(Gly1316Alafs*27)"	""
"0000854511"	"00001113"	"50"	"3287"	"0"	"3287"	"0"	"c.3287C>T"	"r.(?)"	"p.(Pro1096Leu)"	""
"0000854512"	"00001113"	"50"	"2455"	"0"	"2455"	"0"	"c.2455G>A"	"r.(?)"	"p.(Val819Met)"	""
"0000864795"	"00001113"	"10"	"7212"	"0"	"7212"	"0"	"c.7212A>G"	"r.(?)"	"p.(Glu2404=)"	""
"0000864796"	"00001113"	"30"	"6849"	"0"	"6849"	"0"	"c.6849C>T"	"r.(?)"	"p.(Ser2283=)"	""
"0000864797"	"00001113"	"30"	"6624"	"0"	"6624"	"0"	"c.6624A>G"	"r.(?)"	"p.(Gln2208=)"	""
"0000864798"	"00001113"	"30"	"6115"	"0"	"6115"	"0"	"c.6115G>A"	"r.(?)"	"p.(Val2039Met)"	""
"0000864799"	"00001113"	"50"	"5147"	"0"	"5147"	"0"	"c.5147C>T"	"r.(?)"	"p.(Thr1716Met)"	""
"0000864800"	"00001113"	"50"	"4490"	"0"	"4490"	"0"	"c.4490A>C"	"r.(?)"	"p.(Lys1497Thr)"	""
"0000864801"	"00001113"	"30"	"4394"	"8"	"4394"	"8"	"c.4394+8T>C"	"r.(=)"	"p.(=)"	""
"0000864802"	"00001113"	"50"	"2846"	"0"	"2846"	"0"	"c.2846C>T"	"r.(?)"	"p.(Pro949Leu)"	""
"0000864803"	"00001113"	"30"	"2596"	"0"	"2596"	"0"	"c.2596A>G"	"r.(?)"	"p.(Met866Val)"	""
"0000864804"	"00001113"	"30"	"1824"	"0"	"1824"	"0"	"c.1824C>G"	"r.(?)"	"p.(Leu608=)"	""
"0000864805"	"00001113"	"50"	"689"	"0"	"689"	"0"	"c.689C>T"	"r.(?)"	"p.(Ala230Val)"	""
"0000864806"	"00001113"	"50"	"644"	"0"	"644"	"0"	"c.644C>A"	"r.(?)"	"p.(Ala215Asp)"	""
"0000864807"	"00001113"	"10"	"459"	"0"	"459"	"0"	"c.459G>A"	"r.(?)"	"p.(Pro153=)"	""
"0000864808"	"00001113"	"30"	"177"	"0"	"177"	"0"	"c.177T>A"	"r.(?)"	"p.(Leu59=)"	""
"0000874759"	"00001113"	"30"	"3685"	"0"	"3685"	"0"	"c.3685A>G"	"r.(?)"	"p.(Ser1229Gly)"	""
"0000892974"	"00001113"	"30"	"6685"	"0"	"6685"	"0"	"c.6685G>A"	"r.(?)"	"p.(Gly2229Ser)"	""
"0000892975"	"00001113"	"50"	"6340"	"0"	"6340"	"0"	"c.6340G>A"	"r.(?)"	"p.(Gly2114Ser)"	""
"0000892976"	"00001113"	"30"	"6195"	"0"	"6195"	"0"	"c.6195C>T"	"r.(?)"	"p.(Ser2065=)"	""
"0000892977"	"00001113"	"30"	"6072"	"0"	"6072"	"0"	"c.6072G>A"	"r.(?)"	"p.(Ala2024=)"	""
"0000892978"	"00001113"	"30"	"5837"	"0"	"5837"	"0"	"c.5837C>A"	"r.(?)"	"p.(Pro1946Gln)"	""
"0000892979"	"00001113"	"30"	"5800"	"0"	"5800"	"0"	"c.5800T>C"	"r.(?)"	"p.(Ser1934Pro)"	""
"0000892980"	"00001113"	"50"	"4322"	"0"	"4322"	"0"	"c.4322G>A"	"r.(?)"	"p.(Arg1441Gln)"	""
"0000892981"	"00001113"	"90"	"4236"	"0"	"4249"	"0"	"c.4236_4249del"	"r.(?)"	"p.(Met1412Ilefs*4)"	""
"0000892982"	"00001113"	"30"	"3983"	"-4"	"3983"	"-4"	"c.3983-4C>T"	"r.spl?"	"p.?"	""
"0000892983"	"00001113"	"30"	"3698"	"7"	"3698"	"7"	"c.3698+7G>A"	"r.(=)"	"p.(=)"	""
"0000892984"	"00001113"	"50"	"3296"	"0"	"3296"	"0"	"c.3296A>C"	"r.(?)"	"p.(Glu1099Ala)"	""
"0000892985"	"00001113"	"30"	"2239"	"0"	"2239"	"0"	"c.2239A>G"	"r.(?)"	"p.(Met747Val)"	""
"0000892986"	"00001113"	"90"	"2026"	"0"	"2026"	"0"	"c.2026C>T"	"r.(?)"	"p.(Gln676*)"	""
"0000892988"	"00001113"	"50"	"1782"	"0"	"1782"	"0"	"c.1782A>C"	"r.(?)"	"p.(Glu594Asp)"	""
"0000892989"	"00001113"	"30"	"712"	"0"	"712"	"0"	"c.712G>C"	"r.(?)"	"p.(Val238Leu)"	""
"0000892990"	"00001113"	"90"	"472"	"0"	"472"	"0"	"c.472C>T"	"r.(?)"	"p.(Gln158*)"	""
"0000892991"	"00001113"	"50"	"140"	"0"	"140"	"0"	"c.140A>G"	"r.(?)"	"p.(Asn47Ser)"	""
"0000892992"	"00001113"	"70"	"-738"	"0"	"-738"	"0"	"c.-738C>G"	"r.(?)"	"p.(=)"	""
"0000908923"	"00001113"	"90"	"4134"	"0"	"4134"	"0"	"c.4134G>T"	"r.[4134_4280del,4134delins[4133+1_4134-1;u]]"	"p.[Phe1379_Arg1427del,Phe1379Serfs*27]"	""
"0000909190"	"00001113"	"50"	"2063"	"0"	"2063"	"0"	"c.2063C>T"	"r.(?)"	"p.(Pro688Leu)"	""
"0000914626"	"00001113"	"50"	"6743"	"0"	"6745"	"0"	"c.6743_6745dup"	"r.(?)"	"p.(Gln2248dup)"	""
"0000914627"	"00001113"	"30"	"6689"	"0"	"6689"	"0"	"c.6689A>G"	"r.(?)"	"p.(Gln2230Arg)"	""
"0000914628"	"00001113"	"50"	"5890"	"0"	"5890"	"0"	"c.5890C>T"	"r.(?)"	"p.(Arg1964Cys)"	""
"0000914629"	"00001113"	"30"	"2145"	"0"	"2145"	"0"	"c.2145G>C"	"r.(?)"	"p.(Met715Ile)"	""
"0000918945"	"00001113"	"50"	"6720"	"0"	"6720"	"0"	"c.6720C>G"	"r.(?)"	"p.(Tyr2240*)"	"31"
"0000921075"	"00001113"	"50"	"5131"	"0"	"5131"	"0"	"c.5131A>G"	"r.(?)"	"p.(Lys1711Glu)"	""
"0000921872"	"00001113"	"90"	"2308"	"0"	"2315"	"0"	"c.2308_2315dup"	"r.(?)"	"p.(Pro773LeufsTer6)"	""
"0000926282"	"00001113"	"30"	"7256"	"0"	"7256"	"0"	"c.7256C>T"	"r.(?)"	"p.(Ala2419Val)"	""
"0000926283"	"00001113"	"50"	"6572"	"0"	"6572"	"0"	"c.6572A>G"	"r.(?)"	"p.(Glu2191Gly)"	""
"0000926284"	"00001113"	"70"	"5555"	"0"	"5575"	"0"	"c.5555_5575del"	"r.(?)"	"p.(Gln1852_Arg1858del)"	""
"0000926285"	"00001113"	"30"	"2728"	"0"	"2728"	"0"	"c.2728A>G"	"r.(?)"	"p.(Thr910Ala)"	""
"0000926286"	"00001113"	"90"	"2459"	"0"	"2459"	"0"	"c.2459C>A"	"r.(?)"	"p.(Ser820*)"	""
"0000926287"	"00001113"	"50"	"1426"	"0"	"1426"	"0"	"c.1426A>G"	"r.(?)"	"p.(Ile476Val)"	""
"0000927864"	"00001113"	"50"	"3484"	"0"	"3484"	"0"	"c.3484A>G"	"r.(?)"	"p.(Asn1162Asp)"	""
"0000930602"	"00001113"	"50"	"6056"	"0"	"6056"	"0"	"c.6056G>T"	"r.(?)"	"p.(Gly2019Val)"	""
"0000930603"	"00001113"	"30"	"5739"	"0"	"5739"	"0"	"c.5739C>T"	"r.(?)"	"p.(=)"	""
"0000930604"	"00001113"	"30"	"3611"	"0"	"3611"	"0"	"c.3611A>T"	"r.(?)"	"p.(Tyr1204Phe)"	""
"0000930605"	"00001113"	"30"	"1733"	"0"	"1733"	"0"	"c.1733C>T"	"r.(?)"	"p.(Pro578Leu)"	""
"0000932950"	"00001113"	"50"	"3004"	"0"	"3004"	"0"	"c.3004C>A"	"r.(?)"	"p.(Gln1002Lys)"	""
"0000933285"	"00001113"	"70"	"6137"	"0"	"6137"	"0"	"c.6137C>T"	"r.(?)"	"p.(Ala2046Val)"	""
"0000939823"	"00001113"	"70"	"5482"	"0"	"5484"	"0"	"c.5482_5484del"	"r.(?)"	"p.(Tyr1828del)"	"31"
"0000950657"	"00001113"	"50"	"6842"	"0"	"6842"	"0"	"c.6842C>T"	"r.(?)"	"p.(Ala2281Val)"	""
"0000950658"	"00001113"	"50"	"6603"	"0"	"6608"	"0"	"c.6603_6608del"	"r.(?)"	"p.(Gln2215_Gln2216del)"	""
"0000950659"	"00001113"	"30"	"3205"	"0"	"3205"	"0"	"c.3205G>T"	"r.(?)"	"p.(Gly1069Cys)"	""
"0000968357"	"00001113"	"30"	"7302"	"0"	"7302"	"0"	"c.7302G>A"	"r.(?)"	"p.(Thr2434=)"	""
"0000968358"	"00001113"	"30"	"7162"	"0"	"7162"	"0"	"c.7162G>A"	"r.(?)"	"p.(Ala2388Thr)"	""
"0000968364"	"00001113"	"30"	"5739"	"0"	"5739"	"0"	"c.5739C>T"	"r.(?)"	"p.(=)"	""
"0000968370"	"00001113"	"70"	"2374"	"0"	"2374"	"0"	"c.2374C>T"	"r.(?)"	"p.(Gln792*)"	""
"0000968371"	"00001113"	"30"	"879"	"0"	"879"	"0"	"c.879G>A"	"r.(?)"	"p.(Val293=)"	""
"0000971519"	"00001113"	"70"	"3912"	"0"	"3912"	"0"	"c.3912dup"	"r.(?)"	"p.(Gly1305Argfs*23)"	"22"
"0000981886"	"00001113"	"30"	"7184"	"0"	"7184"	"0"	"c.7184T>C"	"r.(?)"	"p.(Ile2395Thr)"	""
"0000981887"	"00001113"	"30"	"6852"	"0"	"6852"	"0"	"c.6852C>G"	"r.(?)"	"p.(=)"	""
"0000981888"	"00001113"	"30"	"6656"	"0"	"6656"	"0"	"c.6656C>T"	"r.(?)"	"p.(Ala2219Val)"	""
"0000981889"	"00001113"	"50"	"6564"	"0"	"6564"	"0"	"c.6564G>T"	"r.(?)"	"p.(Gln2188His)"	""
"0000981890"	"00001113"	"50"	"6452"	"0"	"6452"	"0"	"c.6452G>T"	"r.(?)"	"p.(Arg2151Leu)"	""
"0000981891"	"00001113"	"30"	"6444"	"0"	"6444"	"0"	"c.6444C>T"	"r.(?)"	"p.(Gly2148=)"	""
"0000981892"	"00001113"	"50"	"6181"	"0"	"6181"	"0"	"c.6181A>T"	"r.(?)"	"p.(Ser2061Cys)"	""
"0000981893"	"00001113"	"50"	"6074"	"0"	"6074"	"0"	"c.6074C>T"	"r.(?)"	"p.(Pro2025Leu)"	""
"0000981894"	"00001113"	"30"	"6056"	"0"	"6056"	"0"	"c.6056G>T"	"r.(?)"	"p.(Gly2019Val)"	""
"0000981895"	"00001113"	"90"	"5641"	"0"	"5642"	"0"	"c.5641_5642del"	"r.(?)"	"p.(Leu1882Alafs*83)"	""
"0000981896"	"00001113"	"30"	"5172"	"292"	"5172"	"292"	"c.5172+292C>T"	"r.(=)"	"p.(=)"	""
"0000981897"	"00001113"	"30"	"3698"	"7"	"3698"	"7"	"c.3698+7G>C"	"r.(=)"	"p.(=)"	""
"0000981898"	"00001113"	"30"	"3158"	"0"	"3158"	"0"	"c.3158C>T"	"r.(?)"	"p.(Pro1053Leu)"	""
"0000981899"	"00001113"	"30"	"3060"	"64"	"3060"	"64"	"c.3060+64C>T"	"r.(=)"	"p.(=)"	""
"0000981900"	"00001113"	"50"	"2512"	"0"	"2512"	"0"	"c.2512C>A"	"r.(?)"	"p.(Pro838Thr)"	""
"0000981901"	"00001113"	"50"	"2505"	"0"	"2505"	"0"	"c.2505G>T"	"r.(?)"	"p.(Met835Ile)"	""
"0000981902"	"00001113"	"50"	"2414"	"0"	"2414"	"0"	"c.2414C>T"	"r.(?)"	"p.(Ala805Val)"	""
"0000981903"	"00001113"	"50"	"2077"	"0"	"2077"	"0"	"c.2077C>G"	"r.(?)"	"p.(Pro693Ala)"	""
"0000981904"	"00001113"	"50"	"862"	"0"	"862"	"0"	"c.862A>G"	"r.(?)"	"p.(Met288Val)"	""
"0000981905"	"00001113"	"50"	"798"	"6383"	"798"	"6383"	"c.798+6383G>A"	"r.(=)"	"p.(=)"	""
"0000985296"	"00001113"	"70"	"5227"	"0"	"5229"	"0"	"c.5227_5229del"	"r.(?)"	"p.(Val1743del)"	"31"
"0000987861"	"00001113"	"90"	"6082"	"0"	"6082"	"0"	"c.6082del"	"r.(?)"	"p.(Gln2028Serfs*12)"	"31"
"0001002326"	"00001113"	"50"	"7282"	"0"	"7282"	"0"	"c.7282G>C"	"r.(?)"	"p.(Gly2428Arg)"	""
"0001002327"	"00001113"	"50"	"6960"	"0"	"6960"	"0"	"c.6960G>T"	"r.(?)"	"p.(Met2320Ile)"	""
"0001002328"	"00001113"	"50"	"6782"	"0"	"6782"	"0"	"c.6782T>C"	"r.(?)"	"p.(Met2261Thr)"	""
"0001002329"	"00001113"	"50"	"6721"	"0"	"6721"	"0"	"c.6721C>T"	"r.(?)"	"p.(Pro2241Ser)"	""
"0001002330"	"00001113"	"30"	"6658"	"0"	"6658"	"0"	"c.6658G>A"	"r.(?)"	"p.(Gly2220Ser)"	""
"0001002331"	"00001113"	"50"	"6649"	"0"	"6649"	"0"	"c.6649G>T"	"r.(?)"	"p.(Gly2217Trp)"	""
"0001002332"	"00001113"	"30"	"6457"	"0"	"6457"	"0"	"c.6457G>A"	"r.(?)"	"p.(Gly2153Ser)"	""
"0001002333"	"00001113"	"30"	"6361"	"0"	"6361"	"0"	"c.6361C>T"	"r.(?)"	"p.(Leu2121Phe)"	""
"0001002334"	"00001113"	"50"	"6155"	"0"	"6155"	"0"	"c.6155G>A"	"r.(?)"	"p.(Arg2052Gln)"	""
"0001002335"	"00001113"	"30"	"6137"	"0"	"6137"	"0"	"c.6137C>T"	"r.(?)"	"p.(Ala2046Val)"	""
"0001002336"	"00001113"	"50"	"5806"	"0"	"5806"	"0"	"c.5806G>A"	"r.(?)"	"p.(Gly1936Arg)"	""
"0001002337"	"00001113"	"30"	"4735"	"0"	"4735"	"0"	"c.4735C>G"	"r.(?)"	"p.(Gln1579Glu)"	""
"0001002338"	"00001113"	"30"	"4252"	"0"	"4252"	"0"	"c.4252G>A"	"r.(?)"	"p.(Gly1418Ser)"	""
"0001002339"	"00001113"	"70"	"4232"	"0"	"4232"	"0"	"c.4232G>T"	"r.(?)"	"p.(Gly1411Val)"	""
"0001002340"	"00001113"	"70"	"4209"	"0"	"4217"	"0"	"c.4209_4217del"	"r.(?)"	"p.(Gly1404_Asp1406del)"	""
"0001002341"	"00001113"	"30"	"3901"	"0"	"3901"	"0"	"c.3901A>G"	"r.(?)"	"p.(Ile1301Val)"	""
"0001002342"	"00001113"	"50"	"3893"	"0"	"3893"	"0"	"c.3893A>G"	"r.(?)"	"p.(Tyr1298Cys)"	""
"0001002343"	"00001113"	"30"	"3112"	"0"	"3112"	"0"	"c.3112A>T"	"r.(?)"	"p.(Ile1038Leu)"	""
"0001002344"	"00001113"	"30"	"3029"	"0"	"3029"	"0"	"c.3029C>T"	"r.(?)"	"p.(Pro1010Leu)"	""
"0001002345"	"00001113"	"30"	"2924"	"0"	"2924"	"0"	"c.2924C>A"	"r.(?)"	"p.(Pro975His)"	""
"0001002346"	"00001113"	"50"	"2872"	"0"	"2872"	"0"	"c.2872G>A"	"r.(?)"	"p.(Gly958Ser)"	""
"0001002347"	"00001113"	"50"	"2867"	"0"	"2867"	"0"	"c.2867C>T"	"r.(?)"	"p.(Pro956Leu)"	""
"0001002348"	"00001113"	"30"	"2338"	"0"	"2338"	"0"	"c.2338A>G"	"r.(?)"	"p.(Thr780Ala)"	""
"0001002349"	"00001113"	"30"	"2325"	"0"	"2325"	"0"	"c.2325G>A"	"r.(?)"	"p.(Met775Ile)"	""
"0001002350"	"00001113"	"30"	"2284"	"-4"	"2284"	"-4"	"c.2284-4G>C"	"r.spl?"	"p.?"	""
"0001002351"	"00001113"	"30"	"2113"	"3"	"2113"	"3"	"c.2113+3A>G"	"r.spl?"	"p.?"	""
"0001002352"	"00001113"	"50"	"1780"	"0"	"1780"	"0"	"c.1780G>A"	"r.(?)"	"p.(Glu594Lys)"	""
"0001002353"	"00001113"	"30"	"1493"	"0"	"1493"	"0"	"c.1493C>T"	"r.(?)"	"p.(Thr498Met)"	""
"0001002354"	"00001113"	"50"	"586"	"0"	"586"	"0"	"c.586A>G"	"r.(?)"	"p.(Ser196Gly)"	""
"0001002355"	"00001113"	"30"	"383"	"0"	"383"	"0"	"c.383C>G"	"r.(?)"	"p.(Ser128Cys)"	""
"0001002356"	"00001113"	"30"	"383"	"0"	"383"	"0"	"c.383C>G"	"r.(?)"	"p.(Ser128Cys)"	""
"0001002357"	"00001113"	"30"	"283"	"0"	"283"	"0"	"c.283G>A"	"r.(?)"	"p.(Val95Met)"	""
"0001002358"	"00001113"	"30"	"271"	"0"	"271"	"0"	"c.271G>T"	"r.(?)"	"p.(Ala91Ser)"	""
"0001002359"	"00001113"	"50"	"62"	"0"	"62"	"0"	"c.62G>A"	"r.(?)"	"p.(Gly21Asp)"	""
"0001015389"	"00001113"	"90"	"5830"	"0"	"5830"	"0"	"c.5830dup"	"r.(?)"	"p.(Ala1944Glyfs*22)"	""
"0001017381"	"00001113"	"90"	"1751"	"0"	"1751"	"0"	"c.1751dup"	"r.(?)"	"p.(Ser585*)"	"8"
"0001017382"	"00001113"	"90"	"6244"	"0"	"6244"	"0"	"c.6244C>T"	"r.(?)"	"p.(Gln2082*)"	"31"
"0001017578"	"00001113"	"70"	"1301"	"0"	"1301"	"0"	"c.1301A>T"	"r.(?)"	"p.(Lys434Ile)"	"5"
"0001026708"	"00001113"	"50"	"5864"	"0"	"5864"	"0"	"c.5864C>T"	"r.(?)"	"p.(Ala1955Val)"	""
"0001026709"	"00001113"	"50"	"4715"	"0"	"4715"	"0"	"c.4715G>A"	"r.(?)"	"p.(Ser1572Asn)"	""
"0001026710"	"00001113"	"30"	"2678"	"0"	"2678"	"0"	"c.2678C>T"	"r.(?)"	"p.(Ser893Leu)"	""
"0001029403"	"00001113"	"90"	"-1"	"0"	"85"	"1"	"c.(?_-1)_(85+1_86-1)del"	"r.0?"	"p.0?"	""
"0001029404"	"00001113"	"90"	"-1"	"0"	"85"	"1"	"c.(?_-1)_(85+1_86-1)del"	"r.0?"	"p.0?"	""
"0001029405"	"00001113"	"90"	"-1"	"0"	"3369"	"1"	"c.(?_-1)_(3369+1_3370-1)del"	"r.0?"	"p.0?"	""
"0001029406"	"00001113"	"90"	"3061"	"-1"	"3250"	"1"	"c.(3060+1_3061-1)_(3250+1_3251-1)del"	"r.?"	"p.?"	""
"0001029407"	"00001113"	"90"	"3837"	"-1"	"4728"	"1"	"c.(3836+1_3837-1)_(4728+1_4729-1)del"	"r.?"	"p.?"	""
"0001029408"	"00001113"	"90"	""	"0"	""	"0"	"c.(798+1_799-1)_(*1_?)del"	"r.?"	"p.?"	""
"0001029409"	"00001113"	"90"	""	"0"	""	"0"	"c.(975+1_976-1)_(*1_?)del"	"r.?"	"p.?"	""
"0001029410"	"00001113"	"90"	""	"0"	""	"0"	"c.(975+1_976-1)_(*1_?)del"	"r.?"	"p.?"	""
"0001029411"	"00001113"	"90"	""	"0"	""	"0"	"c.(975+1_976-1)_(*1_?)del"	"r.?"	"p.?"	""
"0001029412"	"00001113"	"90"	""	"0"	""	"0"	"c.(4890+1_4891-1)_(*1_?)del"	"r.?"	"p.?"	""
"0001029413"	"00001113"	"90"	""	"0"	""	"0"	"c.(4394+1_4395-1)_(*1_?)del"	"r.?"	"p.?"	""
"0001029414"	"00001113"	"90"	""	"0"	""	"0"	"c.(?_-1)_(*1_?)del"	"r.0"	"p.0"	""
"0001029415"	"00001113"	"90"	""	"0"	""	"0"	"c.(?_-1)_(*1_?)del"	"r.0"	"p.0"	""
"0001029416"	"00001113"	"90"	""	"0"	""	"0"	"c.(?_-1)_(*1_?)del"	"r.0"	"p.0"	""
"0001029417"	"00001113"	"90"	""	"0"	""	"0"	"c.(?_-1)_(*1_?)del"	"r.0"	"p.0"	""
"0001029418"	"00001113"	"90"	""	"0"	""	"0"	"c.(?_-1)_(*1_?)del"	"r.0"	"p.0"	""
"0001029419"	"00001113"	"90"	"2159"	"-1"	"3060"	"1"	"c.(2158+1_2159-1)_(3060+1_3061-1)dup"	"r.?"	"p.?"	""
"0001029420"	"00001113"	"90"	"1217"	"-1"	"4728"	"1"	"c.(1216+1_1217-1)_(4728+1_4729-1)dup"	"r.?"	"p.?"	""
"0001029421"	"00001113"	"90"	"3780"	"-1"	"5172"	"1"	"c.(3779+1_3780-1)_(5172+1_5173-1)dup"	"r.?"	"p.?"	""
"0001029422"	"00001113"	"90"	"124"	"0"	"124"	"0"	"c.124del"	"r.(?)"	"p.(Asp42MetfsTer3)"	""
"0001029423"	"00001113"	"90"	"365"	"0"	"365"	"0"	"c.365del"	"r.(?)"	"p.(Pro122LeufsTer2)"	""
"0001029424"	"00001113"	"90"	"1293"	"0"	"1296"	"0"	"c.1293_1296del"	"r.(?)"	"p.(Pro432Ter)"	""
"0001029425"	"00001113"	"90"	"1669"	"0"	"1669"	"0"	"c.1669dup"	"r.(?)"	"p.(Ala557GlyfsTer14)"	""
"0001029426"	"00001113"	"90"	"1717"	"0"	"1717"	"0"	"c.1717del"	"r.(?)"	"p.(Thr573ProfsTer16)"	""
"0001029427"	"00001113"	"90"	"1890"	"0"	"1890"	"0"	"c.1890del"	"r.(?)"	"p.(Ala631ProfsTer24)"	""
"0001029428"	"00001113"	"90"	"1894"	"0"	"1894"	"0"	"c.1894dup"	"r.(?)"	"p.(Tyr632LeufsTer3)"	""
"0001029429"	"00001113"	"90"	"1911"	"0"	"1911"	"0"	"c.1911del"	"r.(?)"	"p.(Asp639ThrfsTer16)"	""
"0001029430"	"00001113"	"90"	"2053"	"0"	"2054"	"0"	"c.2053_2054dup"	"r.(?)"	"p.(Leu685PhefsTer11)"	""
"0001029431"	"00001113"	"90"	"2429"	"0"	"2429"	"0"	"c.2429dup"	"r.(?)"	"p.(Met810IlefsTer22)"	""
"0001029432"	"00001113"	"90"	"2663"	"0"	"2663"	"0"	"c.2663del"	"r.(?)"	"p.(Pro888HisfsTer39)"	""
"0001029433"	"00001113"	"90"	"2898"	"0"	"2898"	"0"	"c.2898del"	"r.(?)"	"p.(Ser967AlafsTer31)"	""
"0001029434"	"00001113"	"90"	"3392"	"0"	"3392"	"0"	"c.3392dup"	"r.(?)"	"p.(Asn1131LysfsTer38)"	""
"0001029435"	"00001113"	"90"	"3544"	"0"	"3554"	"0"	"c.3544_3554del"	"r.(?)"	"p.(Ala1182Ter)"	""
"0001029436"	"00001113"	"90"	"4074"	"0"	"4074"	"0"	"c.4074del"	"r.(?)"	"p.(Phe1358LeufsTer18)"	""
"0001029437"	"00001113"	"90"	"4129"	"0"	"4132"	"0"	"c.4129_4132dup"	"r.(?)"	"p.(Arg1378LeufsTer11)"	""
"0001029438"	"00001113"	"90"	"4729"	"0"	"4733"	"0"	"c.4729_4733del"	"r.(?)"	"p.(Gly1577SerfsTer38)"	""
"0001029439"	"00001113"	"90"	"5757"	"0"	"5769"	"0"	"c.5757_5769dup"	"r.(?)"	"p.(Val1924TrpfsTer46)"	""
"0001029440"	"00001113"	"90"	"316"	"0"	"316"	"0"	"c.316C>T"	"r.(?)"	"p.(Gln106Ter)"	""
"0001029441"	"00001113"	"90"	"445"	"0"	"445"	"0"	"c.445C>T"	"r.(?)"	"p.(Gln149Ter)"	""
"0001029442"	"00001113"	"90"	"733"	"0"	"733"	"0"	"c.733C>T"	"r.(?)"	"p.(Gln245Ter)"	""
"0001029443"	"00001113"	"90"	"1063"	"0"	"1063"	"0"	"c.1063C>T"	"r.(?)"	"p.(Gln355Ter)"	""
"0001029444"	"00001113"	"90"	"1114"	"0"	"1114"	"0"	"c.1114C>T"	"r.(?)"	"p.(Gln372Ter)"	""
"0001029445"	"00001113"	"90"	"1270"	"0"	"1270"	"0"	"c.1270C>T"	"r.(?)"	"p.(Arg424Ter)"	""
"0001029446"	"00001113"	"90"	"1447"	"0"	"1447"	"0"	"c.1447C>T"	"r.(?)"	"p.(Arg483Ter)"	""
"0001029447"	"00001113"	"90"	"1447"	"0"	"1447"	"0"	"c.1447C>T"	"r.(?)"	"p.(Arg483Ter)"	""
"0001029448"	"00001113"	"90"	"1522"	"0"	"1522"	"0"	"c.1522C>T"	"r.(?)"	"p.(Gln508Ter)"	""
"0001029449"	"00001113"	"90"	"2218"	"0"	"2218"	"0"	"c.2218G>T"	"r.(?)"	"p.(Gly740Ter)"	""
"0001029450"	"00001113"	"90"	"3441"	"0"	"3441"	"0"	"c.3441C>A"	"r.(?)"	"p.(Tyr1147Ter)"	""
"0001029451"	"00001113"	"90"	"3690"	"0"	"3690"	"0"	"c.3690T>G"	"r.(?)"	"p.(Tyr1230Ter)"	""
"0001029452"	"00001113"	"90"	"3911"	"0"	"3911"	"0"	"c.3911C>A"	"r.(?)"	"p.(Ser1304Ter)"	""
"0001029453"	"00001113"	"90"	"4380"	"0"	"4380"	"0"	"c.4380T>A"	"r.(?)"	"p.(Tyr1460Ter)"	""
"0001029454"	"00001113"	"90"	"1574"	"-2"	"1574"	"-2"	"c.1574-2A>G"	"r.spl"	"p.?"	""
"0001029455"	"00001113"	"90"	"1824"	"-1"	"1824"	"-1"	"c.1824-1G>C"	"r.spl"	"p.?"	""
"0001029456"	"00001113"	"90"	"3242"	"0"	"3250"	"6"	"c.3242_3250+6del"	"r.spl"	"p.?"	""
"0001029457"	"00001113"	"90"	"3609"	"1"	"3609"	"1"	"c.3609+1G>A"	"r.spl"	"p.?"	""
"0001029458"	"00001113"	"90"	"3610"	"-1"	"3610"	"-1"	"c.3610-1G>C"	"r.spl"	"p.?"	""
"0001029459"	"00001113"	"90"	"3698"	"5"	"3698"	"5"	"c.3698+5G>A"	"r.spl"	"p.?"	""
"0001029460"	"00001113"	"90"	"4279"	"0"	"4280"	"1"	"c.4279_4280+1del"	"r.spl"	"p.?"	""
"0001029461"	"00001113"	"90"	"4560"	"1"	"4560"	"1"	"c.4560+1G>A"	"r.spl"	"p.?"	""
"0001029462"	"00001113"	"90"	"4340"	"0"	"4340"	"0"	"c.4340C>T"	"r.(?)"	"p.(Thr1447Ile)"	""
"0001029463"	"00001113"	"90"	"4439"	"0"	"4439"	"0"	"c.4439A>G"	"r.(?)"	"p.(Asp1480Gly)"	""
"0001029464"	"00001113"	"90"	"4439"	"0"	"4439"	"0"	"c.4439A>G"	"r.(?)"	"p.(Asp1480Gly)"	""
"0001029470"	"00001113"	"90"	"1941"	"5"	"1941"	"5"	"c.1941+5G>A"	"r.spl?"	"p.?"	""
"0001029471"	"00001113"	"90"	"3698"	"0"	"3698"	"0"	"c.3698G>C"	"r.(?)"	"p.(Arg1233Thr)"	""
"0001029472"	"00001113"	"90"	"5486"	"0"	"5486"	"0"	"c.5486A>T"	"r.(?)"	"p.(His1829Leu)"	""
"0001029473"	"00001113"	"90"	"4240"	"0"	"4254"	"0"	"c.4240_4254del"	"r.(?)"	"p.(Val1414_Gly1418del)"	""
"0001041104"	"00001113"	"30"	"7302"	"0"	"7302"	"0"	"c.7302G>A"	"r.(?)"	"p.(Thr2434=)"	""
"0001041105"	"00001113"	"50"	"7191"	"0"	"7191"	"0"	"c.7191G>T"	"r.(?)"	"p.(Gln2397His)"	""
"0001041106"	"00001113"	"50"	"7058"	"0"	"7078"	"0"	"c.7058_7078del"	"r.(?)"	"p.(Arg2353_Pro2359del)"	""
"0001041107"	"00001113"	"30"	"6621"	"0"	"6621"	"0"	"c.6621A>G"	"r.(?)"	"p.(=)"	""
"0001041108"	"00001113"	"50"	"6609"	"0"	"6610"	"0"	"c.6609_6610insG"	"r.(?)"	"p.(Gln2204Alafs*137)"	""
"0001041109"	"00001113"	"50"	"6608"	"0"	"6609"	"0"	"c.6608_6609insGC"	"r.(?)"	"p.(Gln2204Hisfs*99)"	""
"0001041110"	"00001113"	"30"	"6548"	"0"	"6548"	"0"	"c.6548C>T"	"r.(?)"	"p.(Ala2183Val)"	""
"0001041111"	"00001113"	"50"	"6349"	"0"	"6366"	"0"	"c.6349_6366del"	"r.(?)"	"p.(Pro2117_Gln2122del)"	""
"0001041112"	"00001113"	"50"	"6055"	"0"	"6055"	"0"	"c.6055G>C"	"r.(?)"	"p.(Gly2019Arg)"	""
"0001041113"	"00001113"	"30"	"6006"	"0"	"6006"	"0"	"c.6006G>T"	"r.(?)"	"p.(=)"	""
"0001041114"	"00001113"	"30"	"5988"	"0"	"5988"	"0"	"c.5988C>T"	"r.(?)"	"p.(=)"	""
"0001041115"	"00001113"	"50"	"5828"	"0"	"5828"	"0"	"c.5828C>A"	"r.(?)"	"p.(Pro1943Gln)"	""
"0001041116"	"00001113"	"30"	"5454"	"0"	"5454"	"0"	"c.5454G>A"	"r.(?)"	"p.(=)"	""
"0001041117"	"00001113"	"30"	"4280"	"324"	"4280"	"324"	"c.4280+324G>A"	"r.(=)"	"p.(=)"	""
"0001041118"	"00001113"	"30"	"4133"	"9"	"4133"	"9"	"c.4133+9G>A"	"r.(=)"	"p.(=)"	""
"0001041119"	"00001113"	"30"	"3983"	"-205"	"3983"	"-205"	"c.3983-205A>G"	"r.(=)"	"p.(=)"	""
"0001041120"	"00001113"	"30"	"3982"	"9"	"3982"	"9"	"c.3982+9C>T"	"r.(=)"	"p.(=)"	""
"0001041121"	"00001113"	"10"	"3900"	"0"	"3900"	"0"	"c.3900C>A"	"r.(?)"	"p.(=)"	""
"0001041122"	"00001113"	"30"	"3250"	"3228"	"3250"	"3228"	"c.3250+3228del"	"r.(=)"	"p.(=)"	""
"0001041123"	"00001113"	"30"	"3250"	"3220"	"3250"	"3220"	"c.3250+3220C>A"	"r.(=)"	"p.(=)"	""
"0001041124"	"00001113"	"10"	"2941"	"0"	"2941"	"0"	"c.2941G>A"	"r.(?)"	"p.(Ala981Thr)"	""
"0001041125"	"00001113"	"50"	"2924"	"0"	"2924"	"0"	"c.2924C>T"	"r.(?)"	"p.(Pro975Leu)"	""
"0001041126"	"00001113"	"10"	"2784"	"0"	"2784"	"0"	"c.2784G>A"	"r.(?)"	"p.(=)"	""
"0001041127"	"00001113"	"30"	"2355"	"0"	"2366"	"0"	"c.2355_2366del"	"r.(?)"	"p.(Ala787_Gln790del)"	""
"0001041128"	"00001113"	"50"	"2282"	"0"	"2282"	"0"	"c.2282G>T"	"r.(?)"	"p.(Gly761Val)"	""
"0001041129"	"00001113"	"70"	"1919"	"0"	"1919"	"0"	"c.1919T>G"	"r.(?)"	"p.(Met640Arg)"	""
"0001041130"	"00001113"	"50"	"1738"	"0"	"1738"	"0"	"c.1738G>A"	"r.(?)"	"p.(Ala580Thr)"	""
"0001041131"	"00001113"	"30"	"1022"	"0"	"1022"	"0"	"c.1022C>T"	"r.(?)"	"p.(Ala341Val)"	""
"0001041132"	"00001113"	"30"	"939"	"0"	"939"	"0"	"c.939T>C"	"r.(?)"	"p.(=)"	""
"0001041133"	"00001113"	"30"	"879"	"0"	"879"	"0"	"c.879G>A"	"r.(?)"	"p.(Val293=)"	""
"0001041134"	"00001113"	"30"	"753"	"0"	"753"	"0"	"c.753T>G"	"r.(?)"	"p.(=)"	""
"0001041135"	"00001113"	"30"	"704"	"0"	"704"	"0"	"c.704C>T"	"r.(?)"	"p.(Ser235Leu)"	""
"0001041137"	"00001113"	"30"	"86"	"-311"	"86"	"-310"	"c.86-311_86-310insC"	"r.(=)"	"p.(=)"	""
"0001041138"	"00001113"	"30"	"86"	"-2418"	"86"	"-2418"	"c.86-2418C>T"	"r.(=)"	"p.(=)"	""
"0001047045"	"00001113"	"70"	"1237"	"0"	"1237"	"0"	"c.1237C>T"	"r.(?)"	"p.(Arg413*)"	"5"
"0001048360"	"00001113"	"70"	"2168"	"0"	"2168"	"0"	"c.2168C>A"	"r.(?)"	"p.(Ser723Ter)"	""
"0001049722"	"00001113"	"50"	"3520"	"0"	"3520"	"0"	"c.3520G>T"	"r.(?)"	"p.(Val1174Phe)"	"18"
"0001055408"	"00001113"	"50"	"7058"	"0"	"7058"	"0"	"c.7058G>A"	"r.(?)"	"p.(Arg2353Gln)"	""
"0001055409"	"00001113"	"50"	"6997"	"0"	"6997"	"0"	"c.6997C>A"	"r.(?)"	"p.(Gln2333Lys)"	""
"0001055410"	"00001113"	"50"	"6211"	"0"	"6211"	"0"	"c.6211C>A"	"r.(?)"	"p.(Leu2071Met)"	""
"0001055411"	"00001113"	"50"	"5719"	"0"	"5719"	"0"	"c.5719G>T"	"r.(?)"	"p.(Ala1907Ser)"	""
"0001055412"	"00001113"	"30"	"4560"	"6"	"4560"	"6"	"c.4560+6C>T"	"r.(=)"	"p.(=)"	""
"0001055413"	"00001113"	"30"	"3841"	"0"	"3841"	"0"	"c.3841G>A"	"r.(?)"	"p.(Val1281Ile)"	""
"0001055414"	"00001113"	"50"	"3066"	"0"	"3066"	"0"	"c.3066G>C"	"r.(?)"	"p.(Met1022Ile)"	""
"0001055415"	"00001113"	"50"	"2557"	"0"	"2557"	"0"	"c.2557C>A"	"r.(?)"	"p.(Leu853Met)"	""
"0001055416"	"00001113"	"30"	"2159"	"-227"	"2159"	"-227"	"c.2159-227G>A"	"r.(=)"	"p.(=)"	""
"0001055417"	"00001113"	"50"	"1858"	"0"	"1858"	"0"	"c.1858G>C"	"r.(?)"	"p.(Ala620Pro)"	""
"0001055418"	"00001113"	"50"	"1148"	"0"	"1148"	"0"	"c.1148C>T"	"r.(?)"	"p.(Pro383Leu)"	""
"0001055419"	"00001113"	"30"	"798"	"10"	"798"	"10"	"c.798+10C>T"	"r.(=)"	"p.(=)"	""
"0001055420"	"00001113"	"30"	"752"	"0"	"752"	"0"	"c.752C>G"	"r.(?)"	"p.(Thr251Ser)"	""
"0001055421"	"00001113"	"50"	"718"	"0"	"718"	"0"	"c.718G>A"	"r.(?)"	"p.(Ala240Thr)"	""
"0001058570"	"00001113"	"90"	"3779"	"1"	"3779"	"1"	"c.3779+1G>A"	"r.spl"	"p.?"	""
"0001058571"	"00001113"	"90"	"5614"	"0"	"5614"	"0"	"c.5614A>G"	"r.(?)"	"p.(Met1872Val)"	""
"0001058572"	"00001113"	"90"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	""
"0001058573"	"00001113"	"90"	"3832"	"0"	"3832"	"0"	"c.3832G>A"	"r.(?)"	"p.(Glu1278Lys)"	""
"0001058574"	"00001113"	"70"	"2183"	"0"	"2183"	"0"	"c.2183C>G"	"r.(?)"	"p.(Ser728Cys)"	""
"0001058575"	"00001113"	"70"	"5367"	"0"	"5367"	"0"	"c.5367C>G"	"r.(?)"	"p.(Asn1789Lys)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 348
"{{screeningid}}"	"{{variantid}}"
"0000000210"	"0000013516"
"0000050368"	"0000079348"
"0000050611"	"0000079591"
"0000080940"	"0000130026"
"0000081560"	"0000132223"
"0000081569"	"0000132232"
"0000081586"	"0000132250"
"0000101837"	"0000164579"
"0000102533"	"0000165275"
"0000111197"	"0000178258"
"0000111198"	"0000178259"
"0000111199"	"0000178260"
"0000111200"	"0000178261"
"0000111201"	"0000178262"
"0000111202"	"0000178263"
"0000111203"	"0000178264"
"0000111204"	"0000178265"
"0000111205"	"0000178266"
"0000111206"	"0000178267"
"0000111207"	"0000178268"
"0000111208"	"0000178269"
"0000111209"	"0000178270"
"0000111210"	"0000178271"
"0000111211"	"0000178272"
"0000111212"	"0000178273"
"0000111213"	"0000178274"
"0000111214"	"0000178275"
"0000111215"	"0000178276"
"0000111216"	"0000178277"
"0000111217"	"0000178278"
"0000111218"	"0000178279"
"0000111219"	"0000178280"
"0000111220"	"0000178281"
"0000111221"	"0000178282"
"0000111222"	"0000178283"
"0000111223"	"0000178284"
"0000111224"	"0000178285"
"0000111225"	"0000178286"
"0000111226"	"0000178287"
"0000111227"	"0000178288"
"0000111228"	"0000178289"
"0000111229"	"0000178290"
"0000111230"	"0000178291"
"0000111231"	"0000178292"
"0000111232"	"0000178293"
"0000111233"	"0000178294"
"0000111234"	"0000178295"
"0000111235"	"0000178296"
"0000111236"	"0000178297"
"0000111237"	"0000178298"
"0000111238"	"0000178299"
"0000111239"	"0000178300"
"0000111240"	"0000178301"
"0000111241"	"0000178302"
"0000111242"	"0000178303"
"0000111243"	"0000178304"
"0000111244"	"0000178305"
"0000111245"	"0000178306"
"0000111246"	"0000178307"
"0000111247"	"0000178308"
"0000111248"	"0000178309"
"0000111249"	"0000178310"
"0000111250"	"0000178311"
"0000111251"	"0000178312"
"0000111252"	"0000178313"
"0000111253"	"0000178314"
"0000111254"	"0000178315"
"0000111255"	"0000178316"
"0000111256"	"0000178317"
"0000111257"	"0000178318"
"0000111258"	"0000178319"
"0000111259"	"0000178320"
"0000111260"	"0000178321"
"0000111261"	"0000178322"
"0000111262"	"0000178323"
"0000111263"	"0000178324"
"0000111264"	"0000178325"
"0000111265"	"0000178326"
"0000111266"	"0000178327"
"0000111267"	"0000178328"
"0000111268"	"0000178329"
"0000111269"	"0000178330"
"0000111270"	"0000178331"
"0000111271"	"0000178332"
"0000111272"	"0000178333"
"0000111273"	"0000178334"
"0000111274"	"0000178335"
"0000111275"	"0000178336"
"0000111276"	"0000178337"
"0000111277"	"0000178338"
"0000111278"	"0000178339"
"0000111279"	"0000178340"
"0000111280"	"0000178341"
"0000111281"	"0000178342"
"0000111282"	"0000178343"
"0000111283"	"0000178344"
"0000111284"	"0000178345"
"0000111285"	"0000178346"
"0000111286"	"0000178347"
"0000111287"	"0000178348"
"0000111288"	"0000178349"
"0000111289"	"0000178350"
"0000111290"	"0000178351"
"0000111291"	"0000178352"
"0000111292"	"0000178353"
"0000111293"	"0000178354"
"0000111294"	"0000178355"
"0000111295"	"0000178356"
"0000111296"	"0000178357"
"0000111297"	"0000178358"
"0000111298"	"0000178359"
"0000111299"	"0000178360"
"0000111300"	"0000178361"
"0000111301"	"0000178362"
"0000111302"	"0000178363"
"0000111303"	"0000178364"
"0000111304"	"0000178365"
"0000111305"	"0000178366"
"0000111306"	"0000178367"
"0000111307"	"0000178368"
"0000111308"	"0000178369"
"0000111309"	"0000178370"
"0000111310"	"0000178371"
"0000111311"	"0000178372"
"0000111312"	"0000178373"
"0000111313"	"0000178374"
"0000111314"	"0000178375"
"0000111315"	"0000178376"
"0000111316"	"0000178377"
"0000111317"	"0000178378"
"0000111318"	"0000178379"
"0000111319"	"0000178380"
"0000111320"	"0000178381"
"0000111321"	"0000178382"
"0000111322"	"0000178383"
"0000111323"	"0000178384"
"0000111324"	"0000178385"
"0000111325"	"0000178386"
"0000111326"	"0000178387"
"0000111327"	"0000178388"
"0000111328"	"0000178389"
"0000111329"	"0000178390"
"0000111330"	"0000178391"
"0000111331"	"0000178392"
"0000111332"	"0000178393"
"0000111333"	"0000178394"
"0000111334"	"0000178395"
"0000111335"	"0000178396"
"0000111336"	"0000178397"
"0000111337"	"0000178398"
"0000111338"	"0000178399"
"0000111339"	"0000178400"
"0000111340"	"0000178401"
"0000111341"	"0000178402"
"0000111342"	"0000178403"
"0000111343"	"0000178404"
"0000111344"	"0000178405"
"0000111345"	"0000178406"
"0000111346"	"0000178407"
"0000111347"	"0000178408"
"0000111348"	"0000178409"
"0000111349"	"0000178410"
"0000111350"	"0000178411"
"0000111351"	"0000178412"
"0000111352"	"0000178413"
"0000111353"	"0000178414"
"0000111354"	"0000178415"
"0000111355"	"0000178416"
"0000111356"	"0000178417"
"0000111357"	"0000178418"
"0000111358"	"0000178419"
"0000111359"	"0000178420"
"0000111360"	"0000178421"
"0000111361"	"0000178422"
"0000111362"	"0000178423"
"0000111363"	"0000178424"
"0000111364"	"0000178425"
"0000111365"	"0000178426"
"0000111366"	"0000178427"
"0000111367"	"0000178428"
"0000111368"	"0000178429"
"0000111369"	"0000178430"
"0000111370"	"0000178431"
"0000111371"	"0000178432"
"0000111372"	"0000178433"
"0000111373"	"0000178434"
"0000111374"	"0000178435"
"0000111375"	"0000178436"
"0000111376"	"0000178437"
"0000111377"	"0000178438"
"0000111378"	"0000178439"
"0000111379"	"0000178440"
"0000111380"	"0000178441"
"0000111381"	"0000178442"
"0000145172"	"0000236244"
"0000145179"	"0000236256"
"0000145180"	"0000236257"
"0000145181"	"0000236258"
"0000145182"	"0000236259"
"0000145183"	"0000236260"
"0000145184"	"0000236261"
"0000145185"	"0000236262"
"0000145186"	"0000236263"
"0000145187"	"0000236265"
"0000145188"	"0000236266"
"0000232638"	"0000474973"
"0000246760"	"0000499546"
"0000246761"	"0000499547"
"0000246762"	"0000499548"
"0000246763"	"0000499549"
"0000246764"	"0000499550"
"0000246765"	"0000499551"
"0000246766"	"0000499552"
"0000246767"	"0000499553"
"0000246768"	"0000499554"
"0000246769"	"0000499555"
"0000246770"	"0000499556"
"0000246773"	"0000499559"
"0000246774"	"0000499560"
"0000246775"	"0000499561"
"0000246776"	"0000499562"
"0000246777"	"0000499563"
"0000246778"	"0000499564"
"0000246779"	"0000499565"
"0000246780"	"0000499566"
"0000246781"	"0000499567"
"0000246782"	"0000499568"
"0000246783"	"0000499569"
"0000292623"	"0000649312"
"0000292624"	"0000649313"
"0000292625"	"0000649314"
"0000292626"	"0000649315"
"0000292627"	"0000649316"
"0000292628"	"0000649317"
"0000292629"	"0000649318"
"0000296815"	"0000653528"
"0000304106"	"0000667504"
"0000307327"	"0000673945"
"0000308399"	"0000682722"
"0000308399"	"0000682723"
"0000308401"	"0000682760"
"0000309082"	"0000683545"
"0000309083"	"0000683546"
"0000316167"	"0000698317"
"0000316168"	"0000698318"
"0000316169"	"0000698319"
"0000316170"	"0000698320"
"0000316171"	"0000698321"
"0000316172"	"0000698322"
"0000316173"	"0000698323"
"0000332603"	"0000729885"
"0000332604"	"0000729886"
"0000332605"	"0000729887"
"0000362726"	"0000763100"
"0000362889"	"0000763263"
"0000362891"	"0000763265"
"0000375322"	"0000786663"
"0000398890"	"0000831178"
"0000402884"	"0000837163"
"0000429450"	"0000908923"
"0000429605"	"0000909190"
"0000433301"	"0000918945"
"0000435134"	"0000921075"
"0000435699"	"0000921872"
"0000436735"	"0000927864"
"0000437625"	"0000932950"
"0000437852"	"0000933285"
"0000441881"	"0000939823"
"0000449931"	"0000971519"
"0000451420"	"0000985296"
"0000453283"	"0000987861"
"0000459366"	"0001017381"
"0000459367"	"0001017382"
"0000459530"	"0001017578"
"0000465705"	"0001029403"
"0000465706"	"0001029404"
"0000465707"	"0001029405"
"0000465708"	"0001029406"
"0000465709"	"0001029407"
"0000465710"	"0001029408"
"0000465711"	"0001029409"
"0000465712"	"0001029410"
"0000465713"	"0001029411"
"0000465714"	"0001029412"
"0000465715"	"0001029413"
"0000465716"	"0001029414"
"0000465717"	"0001029415"
"0000465718"	"0001029416"
"0000465719"	"0001029417"
"0000465720"	"0001029418"
"0000465721"	"0001029419"
"0000465722"	"0001029420"
"0000465723"	"0001029421"
"0000465724"	"0001029422"
"0000465725"	"0001029423"
"0000465726"	"0001029424"
"0000465727"	"0001029425"
"0000465728"	"0001029426"
"0000465729"	"0001029427"
"0000465730"	"0001029428"
"0000465731"	"0001029429"
"0000465732"	"0001029430"
"0000465733"	"0001029431"
"0000465734"	"0001029432"
"0000465735"	"0001029433"
"0000465736"	"0001029434"
"0000465737"	"0001029435"
"0000465738"	"0001029436"
"0000465739"	"0001029437"
"0000465740"	"0001029438"
"0000465741"	"0001029439"
"0000465742"	"0001029440"
"0000465743"	"0001029441"
"0000465744"	"0001029442"
"0000465745"	"0001029443"
"0000465746"	"0001029444"
"0000465747"	"0001029445"
"0000465748"	"0001029446"
"0000465749"	"0001029447"
"0000465750"	"0001029448"
"0000465751"	"0001029449"
"0000465752"	"0001029450"
"0000465753"	"0001029451"
"0000465754"	"0001029452"
"0000465755"	"0001029453"
"0000465756"	"0001029454"
"0000465757"	"0001029455"
"0000465758"	"0001029456"
"0000465759"	"0001029457"
"0000465760"	"0001029458"
"0000465761"	"0001029459"
"0000465762"	"0001029460"
"0000465763"	"0001029461"
"0000465764"	"0001029462"
"0000465765"	"0001029463"
"0000465766"	"0001029464"
"0000465772"	"0001029470"
"0000465773"	"0001029471"
"0000465774"	"0001029472"
"0000465775"	"0001029473"
"0000467735"	"0001047045"
"0000469428"	"0001049722"
"0000470448"	"0001058570"
"0000470449"	"0001058571"
"0000470450"	"0001058572"
"0000470451"	"0001058573"
"0000470452"	"0001058574"
"0000470453"	"0001058575"