### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CTNND1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CTNND1" "catenin (cadherin-associated protein), delta 1" "11" "q12.1" "unknown" "NG_029078.1" "UD_132085291106" "" "https://www.LOVD.nl/CTNND1" "" "1" "2515" "1500" "601045" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/CTNND1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-07-30 14:01:44" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024303" "CTNND1" "transcript variant 1" "007" "NM_001085458.1" "" "NP_001078927.1" "" "" "" "-571" "5779" "2907" "57529234" "57586652" "00006" "2017-07-30 13:57:15" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "05303" "BCDS" "blepharocheilodontic syndrome (BCDS)" "" "" "" "" "" "00006" "2017-07-13 16:37:55" "00006" "2021-12-10 21:51:32" "05637" "BCDS2" "blepharocheilodontic syndrome, type 2 (BCDS-2)" "AD" "617681" "" "autosomal dominant" "" "00006" "2019-07-29 19:23:01" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "CTNND1" "05303" "CTNND1" "05637" ## Individuals ## Do not remove or alter this header ## ## Count = 24 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00110511" "" "" "" "1" "" "01188" "" "" "F" "" "Brazil" "" "0" "" "" "" "S3" "00110516" "" "" "" "1" "" "01188" "" "" "M" "" "Netherlands" "" "0" "" "" "Dutch" "R1a" "00110517" "" "" "" "1" "" "01188" "" "" "F" "" "Netherlands" "" "0" "" "" "Dutch" "R1b" "00110518" "" "" "" "1" "" "01188" "" "" "F" "" "Netherlands" "" "0" "" "" "Dutch" "R1c" "00110519" "" "" "" "1" "" "01188" "" "" "F" "" "Netherlands" "" "0" "" "" "Dutch" "R1d" "00110520" "" "" "" "1" "" "01188" "" "" "F" "" "Netherlands" "" "0" "" "" "Dutch" "R1e" "00110521" "" "" "" "1" "" "01188" "" "" "F" "" "Netherlands" "" "0" "" "" "Dutch" "U3a" "00110522" "" "" "" "1" "" "01188" "" "" "M" "" "Netherlands" "" "0" "" "" "Dutch" "U3b" "00248857" "" "" "" "2" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, affected mother/daugther" "F" "" "" "" "0" "" "" "" "Fam1Pat1" "00248858" "" "" "00248857" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "daughter" "F" "" "" "" "0" "" "" "" "Fam1Pat2" "00248859" "" "" "" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Fam2Pat3" "00248860" "" "" "" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Fam3Pat4" "00248861" "" "" "" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "" "" "0" "" "" "" "Fam4Pat5" "00248862" "" "" "" "2" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, affected mother/son" "M" "" "" "" "0" "" "" "" "Fam5Pat6" "00248863" "" "" "00248862" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "son" "F" "" "" "" "0" "" "" "" "Fam5Pat7" "00248864" "" "" "" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Fam6Pat8" "00248865" "" "" "" "2" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 2 affected brothers, unaffected carrier father" "M" "" "" "" "0" "" "" "" "Fam7Pat9" "00248866" "" "" "00248865" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "brother" "M" "" "" "" "0" "" "" "" "Fam7Pat10" "00248867" "" "" "" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Fam8Pat11" "00248868" "" "" "" "2" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "2-generation family, 2 affected twin brothers, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Fam9Pat12" "00248869" "" "" "00248868" "1" "" "00006" "{DOI:Alharatani 2019:10.1101/711184}" "brother" "M" "" "" "" "0" "" "" "" "Fam9Pat13" "00248870" "" "" "" "1" "" "00006" "{PMID:Ghoumid 2017:28301459}" "2-generation family, 1 affected, unaffected carrier father" "M" "" "" "" "0" "" "" "" "Fam6" "00248871" "" "" "" "1" "" "00006" "{PMID:Ghoumid 2017:28301459}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "" "" "0" "" "" "" "Fam7" "00248872" "" "" "" "2" "" "00006" "{PMID:Ghoumid 2017:28301459}" "2-generation family, affected mother/son" "F;M" "" "" "" "0" "" "" "" "Fam8" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 24 "{{individualid}}" "{{diseaseid}}" "00110511" "05303" "00110516" "05303" "00110517" "05303" "00110518" "05303" "00110519" "05303" "00110520" "05303" "00110521" "05303" "00110522" "05303" "00248857" "00198" "00248858" "00198" "00248859" "00198" "00248860" "00198" "00248861" "00198" "00248862" "00198" "00248863" "00198" "00248864" "00198" "00248865" "00198" "00248866" "00198" "00248867" "00198" "00248868" "00198" "00248869" "00198" "00248870" "05303" "00248871" "05303" "00248872" "05303" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 05303, 05637 ## Count = 24 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000087148" "05303" "00110516" "01188" "Familial, autosomal dominant" "" "-HP:0002342; HP:0000337; HP:0009890; HP:0000316; HP:0012905; HP:0030001; -HP:0000656; -HP:0000579; HP:0009743; HP:0009755; HP:0000202; HP:0000668; HP:0000696; -HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; -HP:0012385; HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; HP:0000834; HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087149" "05303" "00110517" "01188" "Familial, autosomal dominant" "" "-HP:0002342; -HP:0000337; -HP:0009890; HP:0000316; HP:0012905; HP:0030001; HP:0000656; -HP:0000579; HP:0009743; -HP:0009755; -HP:0000202; -HP:0000668; -HP:0000696; HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; HP:0012385; -HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; -HP:0000834; ?HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087150" "05303" "00110518" "01188" "Familial, autosomal dominant" "" "-HP:0002342; -HP:0000337; HP:0009890; HP:0000316; HP:0012905; HP:0030001; HP:0000656; -HP:0000579; HP:0009743; HP:0009755; -HP:0000202; HP:0000668; HP:0000696; -HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; -HP:0012385; HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; HP:0000834; HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087151" "05303" "00110519" "01188" "Familial, autosomal dominant" "" "-HP:0002342; -HP:0000337; -HP:0009890; HP:0000316; HP:0012905; HP:0030001; HP:0000656; -HP:0000579; HP:0009743; -HP:0009755; -HP:0000202; HP:0000668; HP:0000696; HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; HP:0012385; -HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; HP:0000834; HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087152" "05303" "00110520" "01188" "Unknown" "" "-HP:0002342; -HP:0000337; -HP:0009890; HP:0000316; HP:0012905; HP:0030001; HP:0000656; -HP:0000579; HP:0009743; HP:0009755; -HP:0000202; HP:0000668; HP:0000696; HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; -HP:0012385; HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; HP:0000834; HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087153" "05303" "00110521" "01188" "Familial, autosomal dominant" "" "-HP:0002342; -HP:0000337; -HP:0009890; HP:0000316; -HP:0012905; -HP:0030001; HP:0000656; -HP:0000579; HP:0009743; -HP:0009755; HP:0000202; HP:0000668; ?HP:0000696; HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; -HP:0012385; -HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; -HP:0000834; -HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087154" "05303" "00110522" "01188" "Isolated (sporadic)" "" "-HP:0002342; HP:0000337; -HP:0009890; -HP:0000316; -HP:0012905; -HP:0030001; -HP:0000656; -HP:0000579; -HP:0009743; -HP:0009755; -HP:0000202; -HP:0000668; -HP:0000696; -HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; -HP:0000377; -HP:0001537/HP:0000023; -HP:0030084; -HP:0001159; -HP:0012385; -HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; -HP:0000834; -HP:0000107/HP:0000126; -HP:0002023; -HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126;" "" "" "" "" "" "" "" "" "" "" "" "0000087155" "05303" "00110511" "01188" "Isolated (sporadic)" "" "-HP:0002342; -HP:0000337; -HP:0009890; -HP:0000316; HP:0012905; -HP:0030001; -HP:0000656; -HP:0000579; -HP:0009743; HP:0009755; HP:0000202; HP:0000668; ?HP:0000696; HP:0011077; -HP:0010296; -HP:0000232; -HP:0002710; -HP:0000303; HP:0000377; -HP:0001537/HP:0000023; HP:0030084; -HP:0001159; -HP:0012385; -HP:0008070; -HP:0001792; -HP:0000951; -HP:0000078; ?HP:0000834; -HP:0002023; ?HP:0000821; -HP:0000453/HP:0000452; -HP:0045005; -HP:0012126; HP:0010116" "" "" "" "" "" "" "" "" "" "" "" "0000187824" "00198" "00248857" "00006" "Familial, autosomal dominant" "" "no cleft lip/palate; high-arched palate; thin upper lip; choanal atresia; no ear anomaly; wide nasal bridge; broad nasal tip; mid-facial hypoplasia; mandibular prognathism; no brachycephaly; no narrow, upslanted palpebral fissures; no hooded eyelids; no telecanthus; high arched eyebrows; thin lateral eyebrows; mild ectropion; distichiasis; no ankyloblepahron; hypodontia; delayed dentition; abnormal crown form; ventricular septal defect; no tetralogy of Fallot; atrial septal defect or patent foramen ovale; mitral valve stenosis; no PS or coarctation aorta; no patent ductus arteriosus; hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; no aggressive behaviour; no anomalies hands; no anomalies feet; no voice anomalies; skeletal anomalies, scoliosis; no short stature; no cancer; restrictive lung disease" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187825" "00198" "00248858" "00006" "Familial, autosomal dominant" "" "no cleft lip/palate; high-arched palate; thin upper lip; choanal atresia; ear anomaly; wide nasal bridge; no broad nasal tip; mid-facial hypoplasia; no mandibular prognathism; brachycephaly; no narrow, upslanted palpebral fissures; no hooded eyelids; no telecanthus; high arched eyebrows; no thin lateral eyebrows; no mild ectropion; distichiasis; ankyloblepahron; hypodontia; delayed dentition; abnormal crown form; ventricular septal defect; no tetralogy of Fallot; atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; patent ductus arteriosus; no hypoplastic aortic arch;; attention deficit hyperactivity disorder; developmental delay/learning difficulty; no speech delay/no language delay; aggressive behaviour; no anomalies hands; anomalies feet; voice anomalies; no skeletal anomalies; no short stature; no cancer; partial agenesis corpus callosum" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187826" "00198" "00248859" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; high-arched palate; no thin upper lip; no choanal atresia; ear anomaly; wide nasal bridge; broad nasal tip; mid-facial hypoplasia; mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; no high arched eyebrows; no thin lateral eyebrows; no mild ectropion; no distichiasis; no ankyloblepahron; hypodontia; no delayed dentition; abnormal crown form; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; autism spectrum disorder; attention deficit hyperactivity disorder; developmental delay/learning difficulty; speech delay/language delay; aggressive behaviour; anomalies hands; anomalies feet; no voice anomalies; skeletal anomalies; no short stature; no cancer; velo-pharyngeal insufficiency, early onset puberty, bowel problems" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187827" "00198" "00248860" "00006" "Familial, autosomal dominant" "" "no cleft lip/palate; no high-arched palate; no thin upper lip; no choanal atresia; ear anomaly; no wide nasal bridge; no broad nasal tip; no mid-facial hypoplasia; no mandibular prognathism; brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; no high arched eyebrows; no thin lateral eyebrows; mild ectropion; no distichiasis; no ankyloblepahron; hypodontia; delayed dentition; no abnormal crown form; ventricular septal defect; no tetralogy of Fallot; atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; autism spectrum disorder; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; no aggressive behaviour; no anomalies hands; anomalies feet; no voice anomalies; skeletal anomalies; no short stature; no cancer; joint laxity" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187828" "00198" "00248861" "00006" "Familial, autosomal dominant" "" "no cleft lip/palate; no high-arched palate; no thin upper lip; no choanal atresia; no ear anomaly; no wide nasal bridge; no broad nasal tip; no mid-facial hypoplasia; no mandibular prognathism; no brachycephaly; no narrow, upslanted palpebral fissures; no hooded eyelids; no telecanthus; no high arched eyebrows; thin lateral eyebrows; mild ectropion; distichiasis; no ankyloblepahron; hypodontia; delayed dentition; abnormal crown form; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; no aggressive behaviour; no anomalies hands; no anomalies feet;; no skeletal anomalies; no short stature; no cancer;" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187829" "00198" "00248862" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; no high-arched palate; no thin upper lip; no choanal atresia; ear anomaly; wide nasal bridge; no broad nasal tip; mid-facial hypoplasia; no mandibular prognathism; no brachycephaly; no narrow, upslanted palpebral fissures; no hooded eyelids; no telecanthus; high arched eyebrows; thin lateral eyebrows; mild ectropion; no distichiasis; no ankyloblepahron; no hypodontia; no delayed dentition; no abnormal crown form; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; no aggressive behaviour; anomalies hands; anomalies feet; voice anomalies; skeletal anomalies, scoliosis; short stature; no cancer; hypothyroid" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187830" "00198" "00248863" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; high-arched palate; thin upper lip; no choanal atresia; ear anomaly; wide nasal bridge; broad nasal tip; mid-facial hypoplasia; no mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; no hooded eyelids; no telecanthus; high arched eyebrows; thin lateral eyebrows; no mild ectropion; distichiasis; ankyloblepahron; no hypodontia; no delayed dentition; abnormal crown form; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; no aggressive behaviour; anomalies hands; anomalies feet; no voice anomalies; no skeletal anomalies; no short stature; no cancer;" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187831" "00198" "00248864" "00006" "Familial, autosomal dominant" "" "no cleft lip/palate; high-arched palate; thin upper lip; choanal atresia; ear anomaly; wide nasal bridge; broad nasal tip; mid-facial hypoplasia; mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; no telecanthus; high arched eyebrows; thin lateral eyebrows; no mild ectropion; no distichiasis; no ankyloblepahron; hypodontia; abnormal crown form; no ventricular septal defect; tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; no aggressive behaviour; anomalies hands; no anomalies feet; no voice anomalies; no skeletal anomalies; no short stature; ovarian dysgerminoma; macroglossia" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187832" "00198" "00248865" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; no high-arched palate; thin upper lip; no choanal atresia; ear anomaly; wide nasal bridge; broad nasal tip; no mid-facial hypoplasia; no mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; no high arched eyebrows; thin lateral eyebrows; no mild ectropion; no distichiasis; ankyloblepahron; abnormal crown form; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch;; no attention deficit hyperactivity disorder; no developmental delay/no learning difficulty; no speech delay/no language delay; aggressive behaviour; no anomalies hands; no anomalies feet; no voice anomalies; no skeletal anomalies; no short stature; no cancer;" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187833" "00198" "00248866" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; no thin upper lip; no choanal atresia; ear anomaly; wide nasal bridge; broad nasal tip; no mid-facial hypoplasia; no mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; no high arched eyebrows; thin lateral eyebrows; no mild ectropion; no distichiasis; no ankyloblepahron; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; developmental delay/learning difficulty; speech delay/language delay; aggressive behaviour; no anomalies hands; no anomalies feet; no voice anomalies; no skeletal anomalies; no short stature; no cancer;" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187834" "00198" "00248867" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; no high-arched palate; thin upper lip; choanal atresia; ear anomaly; wide nasal bridge; broad nasal tip; mid-facial hypoplasia; mandibular prognathism; brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; high arched eyebrows; thin lateral eyebrows; no mild ectropion; no distichiasis; no ankyloblepahron; hypodontia; delayed dentition; abnormal crown form; ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; PS or coarctation aorta; no patent ductus arteriosus; hypoplastic aortic arch; autism spectrum disorder; attention deficit hyperactivity disorder; developmental delay/learning difficulty; speech delay/language delay; no aggressive behaviour; anomalies hands; no anomalies feet; voice anomalies; skeletal anomalies; short stature; no cancer; cryptorchidism" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187835" "00198" "00248868" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; high-arched palate; thin upper lip; no choanal atresia; no ear anomaly; wide nasal bridge; no broad nasal tip; mid-facial hypoplasia; no mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; high arched eyebrows; no thin lateral eyebrows; no mild ectropion; no distichiasis; no ankyloblepahron; no hypodontia; no delayed dentition; abnormal crown form; ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; developmental delay/learning difficulty; no speech delay/no language delay; no aggressive behaviour; anomalies hands; anomalies feet; no voice anomalies; no skeletal anomalies; no short stature; no cancer; coronal hypospadias" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187836" "00198" "00248869" "00006" "Familial, autosomal dominant" "" "cleft lip/palate; high-arched palate; no thin upper lip; no choanal atresia; no ear anomaly; wide nasal bridge; no broad nasal tip; mid-facial hypoplasia; mandibular prognathism; no brachycephaly; narrow, upslanted palpebral fissures; hooded eyelids; telecanthus; high arched eyebrows; no thin lateral eyebrows; no mild ectropion; no distichiasis; no ankyloblepahron; hypodontia; delayed dentition; no abnormal crown form; no ventricular septal defect; no tetralogy of Fallot; no atrial septal defect or patent foramen ovale; no no atrial septal defect or patent foramen ovale; no PS or coarctation aorta; no patent ductus arteriosus; no hypoplastic aortic arch; no autism spectrum disorder; no attention deficit hyperactivity disorder; developmental delay/learning difficulty; no speech delay/no language delay; no aggressive behaviour; anomalies hands; anomalies feet; no voice anomalies; no skeletal anomalies; no short stature; no cancer;" "" "" "" "" "" "" "" "" "" "craniofacial and cardiac syndrome" "" "0000187837" "05303" "00248870" "00006" "Unknown" "" "cleft lip/palate; eyelid anomalies ectropion, euryblepharon, lagophthalmy, distichiasis; hair anomalies; conical teeth; tooth agenesis; no nail dysplasia; no vertex aplasia; no choanal atresia; syndactyly (1/2); no anal atresia; no neural tube defect; no hypothyroidism" "" "" "" "" "" "" "" "" "BCDS-2" "blepharocheilodontic syndrome" "" "0000187838" "05303" "00248871" "00006" "Isolated (sporadic)" "" "cleft lip/palate; eyelid anomalies ectropion, euryblepharon, lagophthalmy, distichiasis; hair anomalies; conical teeth; tooth agenesis; no nail dysplasia; no vertex aplasia; no choanal atresia; no syndactyly; no anal atresia; no neural tube defect; hypothyroidism" "" "" "" "" "" "" "" "" "BCDS-2" "blepharocheilodontic syndrome" "" "0000187839" "05303" "00248872" "00006" "Familial, autosomal dominant" "" "cleft lip/palate (1/2); eyelid anomalies ectropion (2/2), euryblepharon (1/2), lagophthalmy (1/2), distichiasis (1/2); hair anomalies (1/2); conical teeth (2/2); tooth agenesis (2/2); no nail dysplasia; no vertex aplasia; no choanal atresia; no syndactyly; no anal atresia; no neural tube defect; no hypothyroidism" "" "" "" "" "" "" "" "" "BCDS-2" "blepharocheilodontic syndrome" "" ## Screenings ## Do not remove or alter this header ## ## Count = 24 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000110991" "00110516" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000110992" "00110517" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000110993" "00110518" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000110994" "00110519" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000110995" "00110520" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000110996" "00110521" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ-NG-I" "DNA" "blood" "WES" "0000110997" "00110522" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000110998" "00110511" "1" "01188" "01188" "2017-07-18 11:15:29" "" "" "SEQ" "DNA" "" "" "0000249960" "00248857" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249961" "00248858" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249962" "00248859" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249963" "00248860" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249964" "00248861" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249965" "00248862" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249966" "00248863" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249967" "00248864" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249968" "00248865" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249969" "00248866" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249970" "00248867" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249971" "00248868" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249972" "00248869" "1" "00006" "00006" "2019-07-29 19:36:23" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249973" "00248870" "1" "00006" "00006" "2019-07-29 19:43:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249974" "00248871" "1" "00006" "00006" "2019-07-29 19:43:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000249975" "00248872" "1" "00006" "00006" "2019-07-29 19:43:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 24 "{{screeningid}}" "{{geneid}}" "0000110991" "CTNND1" "0000110992" "CTNND1" "0000110993" "CTNND1" "0000110994" "CTNND1" "0000110995" "CTNND1" "0000110996" "CTNND1" "0000110997" "CTNND1" "0000110998" "CTNND1" "0000249960" "CTNND1" "0000249961" "CTNND1" "0000249962" "CTNND1" "0000249963" "CTNND1" "0000249964" "CTNND1" "0000249965" "CTNND1" "0000249966" "CTNND1" "0000249967" "CTNND1" "0000249968" "CTNND1" "0000249969" "CTNND1" "0000249970" "CTNND1" "0000249971" "CTNND1" "0000249972" "CTNND1" "0000249973" "CTNND1" "0000249974" "CTNND1" "0000249975" "CTNND1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 102 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000177975" "21" "90" "11" "57569620" "57569620" "subst" "0" "01188" "CTNND1_000001" "g.57569620C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000177976" "11" "90" "11" "57569620" "57569620" "subst" "0" "01188" "CTNND1_000001" "g.57569620C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000177977" "21" "90" "11" "57569620" "57569620" "subst" "0" "01188" "CTNND1_000001" "g.57569620C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000177978" "21" "90" "11" "57569620" "57569620" "subst" "0" "01188" "CTNND1_000001" "g.57569620C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000177979" "1" "90" "11" "57569620" "57569620" "subst" "0" "01188" "CTNND1_000001" "g.57569620C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000177980" "1" "90" "11" "57571267" "57571267" "subst" "0" "01188" "CTNND1_000002" "g.57571267G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.57803795G>A" "" "pathogenic" "" "0000177981" "1" "90" "11" "57571267" "57571267" "subst" "0" "01188" "CTNND1_000002" "g.57571267G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.57803795G>A" "" "pathogenic" "" "0000177982" "1" "90" "11" "57577634" "57577634" "subst" "0" "01188" "CTNND1_000003" "g.57577634G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.57810162G>A" "" "pathogenic" "" "0000255892" "0" "90" "11" "57480254" "57480254" "subst" "8.13286E-6" "01943" "TMX2_000002" "g.57480254A>C" "" "" "" "TMX2(NM_015959.4):c.164A>C (p.D55A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57712782A>C" "" "pathogenic" "" "0000267192" "0" "50" "11" "57574441" "57574441" "subst" "0.000309862" "02325" "TMX2-CTNND1_000004" "g.57574441C>T" "" "" "" "CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57806969C>T" "" "VUS" "" "0000267193" "0" "50" "11" "57575877" "57575877" "subst" "0.000119003" "02325" "TMX2-CTNND1_000005" "g.57575877C>T" "" "" "" "CTNND1(NM_001085458.2):c.2107C>T (p.R703C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57808405C>T" "" "VUS" "" "0000274585" "0" "90" "11" "57569620" "57569620" "subst" "0" "01943" "CTNND1_000001" "g.57569620C>T" "" "" "" "CTNND1(NM_001085458.1):c.1372C>T (p.R458*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57802148C>T" "" "pathogenic" "" "0000274586" "0" "50" "11" "57577619" "57577619" "subst" "4.48537E-5" "01943" "TMX2-CTNND1_000007" "g.57577619T>C" "" "" "" "CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57810147T>C" "" "VUS" "" "0000322248" "0" "50" "11" "57505879" "57505879" "subst" "0" "01804" "TMX2-CTNND1_000003" "g.57505879T>C" "" "" "" "TMX2(NM_001144012.2):c.304T>C (p.(Tyr102His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.57738407T>C" "" "VUS" "" "0000544635" "0" "30" "11" "57480232" "57480232" "subst" "0.00302759" "01943" "C11orf31_000002" "g.57480232G>C" "" "" "" "TMX2(NM_015959.4):c.142G>C (p.G48R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57712760G>C" "" "likely benign" "" "0000544636" "0" "50" "11" "57480270" "57480270" "subst" "0.00107137" "01943" "C11orf31_000003" "g.57480270C>G" "" "" "" "TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57712798C>G" "" "VUS" "" "0000544637" "0" "90" "11" "57505852" "57505852" "dup" "0" "01943" "C11orf31_000004" "g.57505852dup" "" "" "" "TMX2(NM_015959.4):c.391dupC (p.L131Pfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57738380dup" "" "pathogenic" "" "0000544638" "0" "30" "11" "57558849" "57558849" "subst" "0" "01943" "C11orf31_000005" "g.57558849C>G" "" "" "" "CTNND1(NM_001085458.1):c.-94-8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791377C>G" "" "likely benign" "" "0000544639" "0" "30" "11" "57558992" "57558992" "subst" "0.000116607" "01943" "C11orf31_000006" "g.57558992C>T" "" "" "" "CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791520C>T" "" "likely benign" "" "0000544640" "0" "30" "11" "57559050" "57559050" "subst" "0.00014041" "01943" "C11orf31_000007" "g.57559050C>G" "" "" "" "CTNND1(NM_001085458.1):c.100C>G (p.R34G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791578C>G" "" "likely benign" "" "0000544641" "0" "30" "11" "57563080" "57563080" "subst" "0" "01804" "C11orf31_000008" "g.57563080C>T" "" "" "" "CTNND1(NM_001085458.1):c.299C>T (p.(Pro100Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57795608C>T" "" "likely benign" "" "0000544642" "0" "50" "11" "57564380" "57564380" "subst" "1.27185E-5" "01943" "C11orf31_000009" "g.57564380A>G" "" "" "" "CTNND1(NM_001085458.1):c.872A>G (p.Y291C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57796908A>G" "" "VUS" "" "0000544643" "0" "30" "11" "57571209" "57571209" "subst" "0.000451873" "01943" "C11orf31_000010" "g.57571209A>G" "" "" "" "CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57803737A>G" "" "likely benign" "" "0000544644" "0" "30" "11" "57573960" "57573961" "ins" "0" "01943" "C11orf31_000011" "g.57573960_57573961insA" "" "" "" "CTNND1(NM_001085458.1):c.1894+10_1894+11insA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57806488_57806489insA" "" "likely benign" "" "0000544645" "0" "30" "11" "57576944" "57576944" "subst" "0.000539919" "01943" "C11orf31_000012" "g.57576944C>G" "" "" "" "CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57809472C>G" "" "likely benign" "" "0000544646" "0" "30" "11" "57578951" "57578951" "subst" "3.67209E-5" "01943" "C11orf31_000013" "g.57578951A>G" "" "" "" "CTNND1(NM_001085458.1):c.2631A>G (p.Q877=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57811479A>G" "" "likely benign" "" "0000579041" "0" "90" "11" "57563951" "57563952" "del" "0" "00006" "CTNND1_000007" "g.57563951_57563952del" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "443_444delTG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57796479_57796480del" "" "pathogenic (dominant)" "" "0000579042" "21" "90" "11" "57563951" "57563952" "del" "0" "00006" "CTNND1_000007" "g.57563951_57563952del" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "443_444delTG" "" "Germline" "yes" "" "0" "" "" "g.57796479_57796480del" "" "pathogenic (dominant)" "" "0000579043" "0" "90" "11" "57569629" "57569629" "subst" "0" "00006" "CTNND1_000014" "g.57569629C>T" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "De novo" "" "" "0" "" "" "g.57802157C>T" "" "pathogenic (dominant)" "" "0000579044" "0" "90" "11" "57569629" "57569629" "subst" "0" "00006" "CTNND1_000014" "g.57569629C>T" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "De novo" "" "" "0" "" "" "g.57802157C>T" "" "pathogenic (dominant)" "" "0000579045" "21" "90" "11" "57576892" "57576892" "subst" "0" "00006" "CTNND1_000013" "g.57576892C>T" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "Germline" "" "" "0" "" "" "g.57809420C>T" "" "pathogenic (dominant)" "" "0000579046" "0" "90" "11" "57571153" "57571157" "del" "0" "00006" "CTNND1_000012" "g.57571153_57571157del" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.57803681_57803685del" "" "pathogenic (dominant)" "" "0000579047" "21" "90" "11" "57571153" "57571157" "del" "0" "00006" "CTNND1_000012" "g.57571153_57571157del" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "De novo" "" "" "0" "" "" "g.57803681_57803685del" "" "pathogenic (dominant)" "" "0000579048" "0" "90" "11" "57571267" "57571267" "del" "0" "00006" "CTNND1_000011" "g.57571267del" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "De novo" "" "" "0" "" "" "g.57803795del" "" "pathogenic (dominant)" "" "0000579049" "11" "90" "11" "57578918" "57578921" "dup" "0" "00006" "CTNND1_000010" "g.57578918_57578921dup" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "2598_2601dupTGAT" "" "Germline" "" "" "0" "" "" "g.57811446_57811449dup" "" "pathogenic (dominant)" "" "0000579050" "11" "90" "11" "57578918" "57578921" "dup" "0" "00006" "CTNND1_000010" "g.57578918_57578921dup" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "2598_2601dupTGAT" "" "Germline" "" "" "0" "" "" "g.57811446_57811449dup" "" "pathogenic (dominant)" "" "0000579051" "0" "90" "11" "57582861" "57582861" "subst" "0" "00006" "CTNND1_000009" "g.57582861A>G" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "De novo" "" "" "0" "" "" "g.57815389A>G" "" "pathogenic (dominant)" "" "0000579052" "0" "90" "11" "57582901" "57582901" "dup" "0" "00006" "CTNND1_000008" "g.57582901dup" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "2737dupC" "" "De novo" "" "" "0" "" "" "g.57815429dup" "" "pathogenic (dominant)" "" "0000579053" "0" "90" "11" "57582901" "57582901" "dup" "0" "00006" "CTNND1_000008" "g.57582901dup" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "2737dupC" "" "De novo" "" "" "0" "" "" "g.57815429dup" "" "pathogenic (dominant)" "" "0000579054" "11" "90" "11" "57564114" "57564135" "del" "0" "00006" "CTNND1_000004" "g.57564114_57564135del" "" "{PMID:Ghoumid 2017:28301459}" "" "Pro203Leufs*25" "" "Germline" "" "" "0" "" "" "g.57796642_57796663del" "" "pathogenic (dominant)" "" "0000579055" "0" "90" "11" "57569341" "57569341" "subst" "0" "00006" "CTNND1_000005" "g.57569341C>T" "" "{PMID:Ghoumid 2017:28301459}" "" "" "" "De novo" "" "" "0" "" "" "g.57801869C>T" "" "pathogenic (dominant)" "" "0000579056" "21" "90" "11" "57575868" "57575868" "subst" "0" "00006" "CTNND1_000006" "g.57575868C>T" "" "{PMID:Ghoumid 2017:28301459}" "" "" "" "Germline" "yes" "" "0" "" "" "g.57808396C>T" "" "pathogenic (dominant)" "" "0000579066" "11" "50" "11" "57564451" "57564451" "subst" "0.000216192" "00006" "CTNND1_000015" "g.57564451C>T" "" "{DOI:Alharatani 2019:10.1101/711184}" "" "" "" "Germline" "" "" "0" "" "" "g.57796979C>T" "" "VUS" "" "0000613458" "0" "30" "11" "57506518" "57506518" "subst" "3.24915E-5" "01943" "C11orf31_000014" "g.57506518A>G" "" "" "" "TMX2(NM_015959.4):c.614+7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57739046A>G" "" "likely benign" "" "0000613459" "0" "50" "11" "57571096" "57571096" "subst" "8.30558E-6" "01943" "C11orf31_000017" "g.57571096C>T" "" "" "" "CTNND1(NM_001085458.1):c.1424C>T (p.T475I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57803624C>T" "" "VUS" "" "0000622642" "0" "30" "11" "57558974" "57558974" "subst" "0.000308933" "01943" "C11orf31_000015" "g.57558974G>C" "" "" "" "CTNND1(NM_001085458.1):c.24G>C (p.S8=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57791502G>C" "" "likely benign" "" "0000622643" "0" "10" "11" "57561543" "57561543" "subst" "0.00121429" "01943" "C11orf31_000016" "g.57561543A>G" "" "" "" "CTNND1(NM_001085458.1):c.257A>G (p.N86S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57794071A>G" "" "benign" "" "0000656819" "0" "30" "11" "57561544" "57561544" "subst" "0" "01943" "C11orf31_000018" "g.57561544C>T" "" "" "" "CTNND1(NM_001085458.1):c.258C>T (p.N86=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.57794072C>T" "" "likely benign" "" "0000679229" "0" "30" "11" "57573454" "57573454" "subst" "0" "01943" "C11orf31_000019" "g.57573454C>G" "" "" "" "CTNND1(NM_001085458.1):c.1823C>G (p.A608G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679230" "0" "30" "11" "57576792" "57576792" "subst" "4.06438E-6" "01943" "C11orf31_000020" "g.57576792G>A" "" "" "" "CTNND1(NM_001085458.1):c.2289G>A (p.Q763=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723498" "0" "50" "11" "57480270" "57480270" "subst" "0.00107137" "02329" "C11orf31_000003" "g.57480270C>G" "" "" "" "TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723499" "0" "30" "11" "57506500" "57506500" "subst" "4.06108E-5" "01943" "C11orf31_000021" "g.57506500T>C" "" "" "" "TMX2(NM_001347895.1):c.321T>C (p.D107=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723500" "0" "30" "11" "57569457" "57569457" "subst" "0.000121852" "01943" "C11orf31_000022" "g.57569457C>T" "" "" "" "CTNND1(NM_001085458.1):c.1209C>T (p.D403=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723501" "0" "30" "11" "57572259" "57572259" "subst" "0" "01943" "C11orf31_000023" "g.57572259G>T" "" "" "" "CTNND1(NM_001085458.1):c.1722+7G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723502" "0" "50" "11" "57574441" "57574441" "subst" "0.000309862" "01943" "TMX2-CTNND1_000004" "g.57574441C>T" "" "" "" "CTNND1(NM_001085458.1):c.1949C>T (p.T650M), CTNND1(NM_001085458.2):c.1949C>T (p.T650M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723503" "0" "30" "11" "57576852" "57576852" "subst" "0.00058538" "01943" "C11orf31_000024" "g.57576852C>T" "" "" "" "CTNND1(NM_001085458.1):c.2349C>T (p.N783=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723504" "0" "30" "11" "57582878" "57582878" "subst" "0.000340536" "01943" "C11orf31_000025" "g.57582878C>A" "" "" "" "CTNND1(NM_001085458.1):c.2714C>A (p.S905Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000805197" "0" "30" "11" "57563967" "57563967" "subst" "4.06832E-6" "01943" "C11orf31_000026" "g.57563967A>G" "" "" "" "CTNND1(NM_001085458.1):c.459A>G (p.V153=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853033" "0" "50" "11" "57492041" "57492041" "subst" "0" "01943" "C11orf31_000027" "g.57492041C>T" "" "" "" "TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853034" "0" "30" "11" "57561488" "57561488" "subst" "0.000393833" "01943" "C11orf31_000028" "g.57561488C>T" "" "" "" "CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853035" "0" "50" "11" "57569438" "57569438" "subst" "8.12447E-6" "02325" "C11orf31_000029" "g.57569438A>G" "" "" "" "CTNND1(NM_001085458.2):c.1190A>G (p.N397S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853036" "0" "30" "11" "57569667" "57569667" "subst" "2.07691E-5" "01943" "C11orf31_000030" "g.57569667C>T" "" "" "" "CTNND1(NM_001085458.1):c.1419C>T (p.T473=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853037" "0" "30" "11" "57578943" "57578943" "subst" "0.000693283" "01943" "C11orf31_000032" "g.57578943C>T" "" "" "" "CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862588" "0" "50" "11" "57575929" "57575929" "subst" "8.14266E-6" "01943" "C11orf31_000031" "g.57575929C>A" "" "" "" "CTNND1(NM_001085458.1):c.2159C>A (p.T720N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000889992" "0" "50" "11" "57563136" "57563136" "subst" "0" "02325" "C11orf31_000033" "g.57563136G>C" "" "" "" "CTNND1(NM_001085458.2):c.355G>C (p.G119R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000889993" "0" "30" "11" "57578974" "57578974" "subst" "0.00039487" "02326" "C11orf31_000034" "g.57578974G>A" "" "" "" "CTNND1(NM_001085458.2):c.2638+16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000889994" "0" "30" "11" "57581818" "57581818" "subst" "0.000387434" "02326" "C11orf31_000035" "g.57581818A>G" "" "" "" "CTNND1(NM_001085458.2):c.2674A>G (p.N892D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913627" "0" "30" "11" "57558992" "57558992" "subst" "0.000116607" "02326" "C11orf31_000006" "g.57558992C>T" "" "" "" "CTNND1(NM_001085458.1):c.42C>T (p.A14=), CTNND1(NM_001085458.2):c.42C>T (p.A14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925439" "0" "30" "11" "57575943" "57575943" "subst" "0.000933102" "02325" "C11orf31_000036" "g.57575943C>T" "" "" "" "CTNND1(NM_001085458.2):c.2173C>T (p.R725W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929920" "0" "50" "11" "57571246" "57571246" "subst" "0" "02325" "C11orf31_000037" "g.57571246C>T" "" "" "" "CTNND1(NM_001085458.2):c.1574C>T (p.S525L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979654" "0" "30" "11" "57492041" "57492041" "subst" "0" "01804" "C11orf31_000027" "g.57492041C>T" "" "" "" "TMX2(NM_001347891.1):c.196C>T (p.R66C), TMX2(NM_001347891.2):c.196C>T (p.(Arg66Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979655" "0" "50" "11" "57561488" "57561488" "subst" "0.000393833" "02325" "C11orf31_000028" "g.57561488C>T" "" "" "" "CTNND1(NM_001085458.1):c.202C>T (p.R68W), CTNND1(NM_001085458.2):c.202C>T (p.R68W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979656" "0" "30" "11" "57563118" "57563118" "subst" "0.000167381" "01804" "C11orf31_000038" "g.57563118A>C" "" "" "" "CTNND1(NM_001085458.2):c.337A>C (p.(Thr113Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979657" "0" "50" "11" "57564328" "57564328" "subst" "2.04322E-5" "01804" "C11orf31_000039" "g.57564328C>T" "" "" "" "CTNND1(NM_001085458.2):c.820C>T (p.(Arg274Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979658" "0" "50" "11" "57564457" "57564457" "subst" "4.01662E-5" "02325" "C11orf31_000040" "g.57564457C>T" "" "" "" "CTNND1(NM_001085458.2):c.949C>T (p.R317C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979659" "0" "30" "11" "57571209" "57571209" "subst" "0.000451873" "02326" "C11orf31_000010" "g.57571209A>G" "" "" "" "CTNND1(NM_001085458.1):c.1537A>G (p.N513D), CTNND1(NM_001085458.2):c.1537A>G (p.N513D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979660" "0" "30" "11" "57573468" "57573468" "subst" "7.44503E-5" "02325" "C11orf31_000041" "g.57573468C>T" "" "" "" "CTNND1(NM_001085458.2):c.1837C>T (p.P613S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999148" "0" "50" "11" "57506506" "57506526" "del" "0" "01804" "TMX2_000010" "g.57506506_57506526del" "" "" "" "TMX2(NM_015959.3):c.609_614+15delTACGCGGTATGTAAAGACCTG (p.(Ser203_Thr204del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999149" "0" "50" "11" "57507701" "57507701" "dup" "0" "01804" "C11orf31_000042" "g.57507701dup" "" "" "" "TMX2(NM_015959.3):c.875dupA (p.(Asn292fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999150" "0" "50" "11" "57507702" "57507702" "subst" "3.41775E-5" "01804" "C11orf31_000043" "g.57507702C>G" "" "" "" "TMX2(NM_015959.3):c.876C>G (p.(Asn292Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999151" "0" "50" "11" "57564126" "57564126" "subst" "0" "01804" "C11orf31_000044" "g.57564126C>G" "" "" "" "CTNND1(NM_001085458.1):c.618C>G (p.(Phe206Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999152" "0" "30" "11" "57564142" "57564142" "subst" "0" "01804" "C11orf31_000045" "g.57564142G>A" "" "" "" "CTNND1(NM_001085458.1):c.634G>A (p.(Gly212Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999153" "0" "70" "11" "57564292" "57564292" "subst" "0" "01804" "C11orf31_000046" "g.57564292C>T" "" "" "" "CTNND1(NM_001085458.1):c.784C>T (p.(Gln262*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000999154" "0" "30" "11" "57564326" "57564326" "subst" "0" "01804" "C11orf31_000047" "g.57564326A>G" "" "" "" "CTNND1(NM_001085458.1):c.818A>G (p.(His273Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999155" "0" "30" "11" "57564365" "57564365" "subst" "1.24281E-5" "01804" "C11orf31_000048" "g.57564365A>G" "" "" "" "CTNND1(NM_001085458.1):c.857A>G (p.(Gln286Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999156" "0" "30" "11" "57564439" "57564439" "subst" "0" "01804" "C11orf31_000049" "g.57564439C>T" "" "" "" "CTNND1(NM_001085458.1):c.931C>T (p.(Pro311Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999157" "0" "50" "11" "57573381" "57573381" "subst" "0" "01804" "C11orf31_000050" "g.57573381C>T" "" "" "" "CTNND1(NM_001085458.1):c.1750C>T (p.(Arg584Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999158" "0" "70" "11" "57575686" "57575686" "dup" "0" "01804" "C11orf31_000051" "g.57575686dup" "" "" "" "CTNND1(NM_001085458.1):c.2013dupT (p.(Leu672fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000999159" "0" "30" "11" "57577619" "57577619" "subst" "4.48537E-5" "01804" "TMX2-CTNND1_000007" "g.57577619T>C" "" "" "" "CTNND1(NM_001085458.1):c.2474T>C (p.V825A, p.(Val825Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999160" "0" "30" "11" "57578943" "57578943" "subst" "0.000693283" "02325" "C11orf31_000032" "g.57578943C>T" "" "" "" "CTNND1(NM_001085458.1):c.2623C>T (p.R875W), CTNND1(NM_001085458.2):c.2623C>T (p.R875W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038522" "0" "50" "11" "57505378" "57505379" "del" "0" "01804" "C11orf31_000052" "g.57505378_57505379del" "" "" "" "TMX2(NM_015959.4):c.251-7_251-6del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038523" "0" "30" "11" "57564167" "57564167" "subst" "2.43667E-5" "02325" "C11orf31_000053" "g.57564167G>A" "" "" "" "CTNND1(NM_001085458.2):c.659G>A (p.G220D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038524" "0" "30" "11" "57571227" "57571227" "subst" "4.08627E-5" "01804" "C11orf31_000054" "g.57571227C>T" "" "" "" "CTNND1(NM_001085458.2):c.1555C>T (p.(Arg519Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038525" "0" "30" "11" "57571243" "57571243" "subst" "2.05081E-5" "01804" "C11orf31_000055" "g.57571243A>T" "" "" "" "CTNND1(NM_001085458.2):c.1571A>T (p.(Glu524Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038526" "0" "50" "11" "57575754" "57575754" "subst" "0" "01804" "C11orf31_000056" "g.57575754G>C" "" "" "" "CTNND1(NM_001085458.2):c.2081G>C (p.(Gly694Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038527" "0" "30" "11" "57576944" "57576944" "subst" "0.000539919" "01804" "C11orf31_000012" "g.57576944C>G" "" "" "" "CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038528" "0" "30" "11" "57576944" "57576944" "subst" "0.000539919" "02325" "C11orf31_000012" "g.57576944C>G" "" "" "" "CTNND1(NM_001085458.1):c.2435+6C>G, CTNND1(NM_001085458.2):c.2435+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038529" "0" "30" "11" "57578864" "57578864" "subst" "2.44884E-5" "01804" "C11orf31_000057" "g.57578864C>T" "" "" "" "CTNND1(NM_001085458.2):c.2551-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038530" "0" "30" "11" "57582859" "57582859" "dup" "0" "01804" "C11orf31_000058" "g.57582859dup" "" "" "" "CTNND1(NM_001085458.2):c.2702-7dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046318" "0" "90" "11" "57573393" "57573397" "del" "0" "02325" "C11orf31_000059" "g.57573393_57573397del" "" "" "" "CTNND1(NM_001085458.2):c.1762_1766delTATCA (p.Y588Sfs*38)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001053892" "0" "30" "11" "57480270" "57480270" "subst" "0.00107137" "01804" "C11orf31_000003" "g.57480270C>G" "" "" "" "TMX2(NM_001347890.1):c.180C>G (p.D60E), TMX2(NM_015959.4):c.180C>G (p.D60E, p.(Asp60Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001065472" "0" "50" "11" "57564073" "57564073" "subst" "0" "02325" "C11orf31_000060" "g.57564073G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CTNND1 ## Count = 102 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000177975" "00024303" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458*)" "7" "0000177976" "00024303" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458*)" "7" "0000177977" "00024303" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458*)" "7" "0000177978" "00024303" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458*)" "7" "0000177979" "00024303" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458*)" "7" "0000177980" "00024303" "90" "1595" "0" "1595" "0" "c.1595G>A" "r.(?)" "p.(Gly532Asp)" "8" "0000177981" "00024303" "90" "1595" "0" "1595" "0" "c.1595G>A" "r.(?)" "p.(Gly532Asp)" "8" "0000177982" "00024303" "90" "2489" "0" "2489" "0" "c.2489G>A" "r.(?)" "p.(Trp830*)" "16" "0000255892" "00024303" "90" "-49551" "0" "-49551" "0" "c.-49551A>C" "r.(?)" "p.(=)" "" "0000267192" "00024303" "50" "1949" "0" "1949" "0" "c.1949C>T" "r.(?)" "p.(Thr650Met)" "" "0000267193" "00024303" "50" "2107" "0" "2107" "0" "c.2107C>T" "r.(?)" "p.(Arg703Cys)" "" "0000274585" "00024303" "90" "1372" "0" "1372" "0" "c.1372C>T" "r.(?)" "p.(Arg458Ter)" "" "0000274586" "00024303" "50" "2474" "0" "2474" "0" "c.2474T>C" "r.(?)" "p.(Val825Ala)" "" "0000322248" "00024303" "50" "-23926" "0" "-23926" "0" "c.-23926T>C" "r.(?)" "p.(=)" "" "0000544635" "00024303" "30" "-49573" "0" "-49573" "0" "c.-49573G>C" "r.(?)" "p.(=)" "" "0000544636" "00024303" "50" "-49535" "0" "-49535" "0" "c.-49535C>G" "r.(?)" "p.(=)" "" "0000544637" "00024303" "90" "-23953" "0" "-23953" "0" "c.-23953dup" "r.(?)" "p.(=)" "" "0000544638" "00024303" "30" "-94" "-8" "-94" "-8" "c.-94-8C>G" "r.(=)" "p.(=)" "" "0000544639" "00024303" "30" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Ala14=)" "" "0000544640" "00024303" "30" "100" "0" "100" "0" "c.100C>G" "r.(?)" "p.(Arg34Gly)" "" "0000544641" "00024303" "30" "299" "0" "299" "0" "c.299C>T" "r.(?)" "p.(Pro100Leu)" "" "0000544642" "00024303" "50" "872" "0" "872" "0" "c.872A>G" "r.(?)" "p.(Tyr291Cys)" "" "0000544643" "00024303" "30" "1537" "0" "1537" "0" "c.1537A>G" "r.(?)" "p.(Asn513Asp)" "" "0000544644" "00024303" "30" "1894" "10" "1894" "11" "c.1894+10_1894+11insA" "r.(=)" "p.(=)" "" "0000544645" "00024303" "30" "2435" "6" "2435" "6" "c.2435+6C>G" "r.(=)" "p.(=)" "" "0000544646" "00024303" "30" "2631" "0" "2631" "0" "c.2631A>G" "r.(?)" "p.(Gln877=)" "" "0000579041" "00024303" "90" "443" "0" "444" "0" "c.443_444del" "r.(?)" "p.(Val148Aspfs*24)" "" "0000579042" "00024303" "90" "443" "0" "444" "0" "c.443_444del" "r.(?)" "p.(Val148Aspfs*24)" "" "0000579043" "00024303" "90" "1381" "0" "1381" "0" "c.1381C>T" "r.(?)" "p.(Arg461*)" "" "0000579044" "00024303" "90" "1381" "0" "1381" "0" "c.1381C>T" "r.(?)" "p.(Arg461*)" "" "0000579045" "00024303" "90" "2389" "0" "2389" "0" "c.2389C>T" "r.(?)" "p.(Arg797*)" "" "0000579046" "00024303" "90" "1481" "0" "1485" "0" "c.1481_1485del" "r.(?)" "p.(Leu494Argfs*5)" "" "0000579047" "00024303" "90" "1481" "0" "1485" "0" "c.1481_1485del" "r.(?)" "p.(Leu494Argfs*5)" "" "0000579048" "00024303" "90" "1595" "0" "1595" "0" "c.1595del" "r.(?)" "p.(Gly532Alafs*6)" "" "0000579049" "00024303" "90" "2598" "0" "2601" "0" "c.2598_2601dup" "r.(?)" "p.(Ser868*)" "" "0000579050" "00024303" "90" "2598" "0" "2601" "0" "c.2598_2601dup" "r.(?)" "p.(Ser868*)" "" "0000579051" "00024303" "90" "2702" "-5" "2702" "-5" "c.2702-5A>G" "r.spl" "p.?" "" "0000579052" "00024303" "90" "2737" "0" "2737" "0" "c.2737dup" "r.(?)" "p.(His913Profs*3)" "" "0000579053" "00024303" "90" "2737" "0" "2737" "0" "c.2737dup" "r.(?)" "p.(His913Profs*3)" "" "0000579054" "00024303" "90" "606" "0" "627" "0" "c.606_627del" "r.(?)" "p.(Pro203Leufs*25)" "" "0000579055" "00024303" "90" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Gln365*)" "" "0000579056" "00024303" "90" "2098" "0" "2098" "0" "c.2098C>T" "r.(?)" "p.(Arg700*)" "" "0000579066" "00024303" "50" "943" "0" "943" "0" "c.943C>T" "r.(?)" "p.(Arg315Cys)" "" "0000613458" "00024303" "30" "-23287" "0" "-23287" "0" "c.-23287A>G" "r.(?)" "p.(=)" "" "0000613459" "00024303" "50" "1424" "0" "1424" "0" "c.1424C>T" "r.(?)" "p.(Thr475Ile)" "" "0000622642" "00024303" "30" "24" "0" "24" "0" "c.24G>C" "r.(?)" "p.(Ser8=)" "" "0000622643" "00024303" "10" "257" "0" "257" "0" "c.257A>G" "r.(?)" "p.(Asn86Ser)" "" "0000656819" "00024303" "30" "258" "0" "258" "0" "c.258C>T" "r.(?)" "p.(Asn86=)" "" "0000679229" "00024303" "30" "1823" "0" "1823" "0" "c.1823C>G" "r.(?)" "p.(Ala608Gly)" "" "0000679230" "00024303" "30" "2289" "0" "2289" "0" "c.2289G>A" "r.(?)" "p.(Gln763=)" "" "0000723498" "00024303" "50" "-49535" "0" "-49535" "0" "c.-49535C>G" "r.(?)" "p.(=)" "" "0000723499" "00024303" "30" "-23305" "0" "-23305" "0" "c.-23305T>C" "r.(?)" "p.(=)" "" "0000723500" "00024303" "30" "1209" "0" "1209" "0" "c.1209C>T" "r.(?)" "p.(Asp403=)" "" "0000723501" "00024303" "30" "1722" "7" "1722" "7" "c.1722+7G>T" "r.(=)" "p.(=)" "" "0000723502" "00024303" "50" "1949" "0" "1949" "0" "c.1949C>T" "r.(?)" "p.(Thr650Met)" "" "0000723503" "00024303" "30" "2349" "0" "2349" "0" "c.2349C>T" "r.(?)" "p.(Asn783=)" "" "0000723504" "00024303" "30" "2714" "0" "2714" "0" "c.2714C>A" "r.(?)" "p.(Ser905Tyr)" "" "0000805197" "00024303" "30" "459" "0" "459" "0" "c.459A>G" "r.(?)" "p.(Val153=)" "" "0000853033" "00024303" "50" "-37764" "0" "-37764" "0" "c.-37764C>T" "r.(?)" "p.(=)" "" "0000853034" "00024303" "30" "202" "0" "202" "0" "c.202C>T" "r.(?)" "p.(Arg68Trp)" "" "0000853035" "00024303" "50" "1190" "0" "1190" "0" "c.1190A>G" "r.(?)" "p.(Asn397Ser)" "" "0000853036" "00024303" "30" "1419" "0" "1419" "0" "c.1419C>T" "r.(?)" "p.(Thr473=)" "" "0000853037" "00024303" "30" "2623" "0" "2623" "0" "c.2623C>T" "r.(?)" "p.(Arg875Trp)" "" "0000862588" "00024303" "50" "2159" "0" "2159" "0" "c.2159C>A" "r.(?)" "p.(Thr720Asn)" "" "0000889992" "00024303" "50" "355" "0" "355" "0" "c.355G>C" "r.(?)" "p.(Gly119Arg)" "" "0000889993" "00024303" "30" "2638" "16" "2638" "16" "c.2638+16G>A" "r.(=)" "p.(=)" "" "0000889994" "00024303" "30" "2674" "0" "2674" "0" "c.2674A>G" "r.(?)" "p.(Asn892Asp)" "" "0000913627" "00024303" "30" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Ala14=)" "" "0000925439" "00024303" "30" "2173" "0" "2173" "0" "c.2173C>T" "r.(?)" "p.(Arg725Trp)" "" "0000929920" "00024303" "50" "1574" "0" "1574" "0" "c.1574C>T" "r.(?)" "p.(Ser525Leu)" "" "0000979654" "00024303" "30" "-37764" "0" "-37764" "0" "c.-37764C>T" "r.(?)" "p.(=)" "" "0000979655" "00024303" "50" "202" "0" "202" "0" "c.202C>T" "r.(?)" "p.(Arg68Trp)" "" "0000979656" "00024303" "30" "337" "0" "337" "0" "c.337A>C" "r.(?)" "p.(Thr113Pro)" "" "0000979657" "00024303" "50" "820" "0" "820" "0" "c.820C>T" "r.(?)" "p.(Arg274Cys)" "" "0000979658" "00024303" "50" "949" "0" "949" "0" "c.949C>T" "r.(?)" "p.(Arg317Cys)" "" "0000979659" "00024303" "30" "1537" "0" "1537" "0" "c.1537A>G" "r.(?)" "p.(Asn513Asp)" "" "0000979660" "00024303" "30" "1837" "0" "1837" "0" "c.1837C>T" "r.(?)" "p.(Pro613Ser)" "" "0000999148" "00024303" "50" "-23299" "0" "-23279" "0" "c.-23299_-23279del" "r.(?)" "p.(=)" "" "0000999149" "00024303" "50" "-22104" "0" "-22104" "0" "c.-22104dup" "r.(?)" "p.(=)" "" "0000999150" "00024303" "50" "-22103" "0" "-22103" "0" "c.-22103C>G" "r.(?)" "p.(=)" "" "0000999151" "00024303" "50" "618" "0" "618" "0" "c.618C>G" "r.(?)" "p.(Phe206Leu)" "" "0000999152" "00024303" "30" "634" "0" "634" "0" "c.634G>A" "r.(?)" "p.(Gly212Ser)" "" "0000999153" "00024303" "70" "784" "0" "784" "0" "c.784C>T" "r.(?)" "p.(Gln262*)" "" "0000999154" "00024303" "30" "818" "0" "818" "0" "c.818A>G" "r.(?)" "p.(His273Arg)" "" "0000999155" "00024303" "30" "857" "0" "857" "0" "c.857A>G" "r.(?)" "p.(Gln286Arg)" "" "0000999156" "00024303" "30" "931" "0" "931" "0" "c.931C>T" "r.(?)" "p.(Pro311Ser)" "" "0000999157" "00024303" "50" "1750" "0" "1750" "0" "c.1750C>T" "r.(?)" "p.(Arg584Trp)" "" "0000999158" "00024303" "70" "2013" "0" "2013" "0" "c.2013dup" "r.(?)" "p.(Leu672Serfs*2)" "" "0000999159" "00024303" "30" "2474" "0" "2474" "0" "c.2474T>C" "r.(?)" "p.(Val825Ala)" "" "0000999160" "00024303" "30" "2623" "0" "2623" "0" "c.2623C>T" "r.(?)" "p.(Arg875Trp)" "" "0001038522" "00024303" "50" "-24427" "0" "-24426" "0" "c.-24427_-24426del" "r.(?)" "p.(=)" "" "0001038523" "00024303" "30" "659" "0" "659" "0" "c.659G>A" "r.(?)" "p.(Gly220Asp)" "" "0001038524" "00024303" "30" "1555" "0" "1555" "0" "c.1555C>T" "r.(?)" "p.(Arg519Cys)" "" "0001038525" "00024303" "30" "1571" "0" "1571" "0" "c.1571A>T" "r.(?)" "p.(Glu524Val)" "" "0001038526" "00024303" "50" "2081" "0" "2081" "0" "c.2081G>C" "r.(?)" "p.(Gly694Ala)" "" "0001038527" "00024303" "30" "2435" "6" "2435" "6" "c.2435+6C>G" "r.(=)" "p.(=)" "" "0001038528" "00024303" "30" "2435" "6" "2435" "6" "c.2435+6C>G" "r.(=)" "p.(=)" "" "0001038529" "00024303" "30" "2551" "-7" "2551" "-7" "c.2551-7C>T" "r.(=)" "p.(=)" "" "0001038530" "00024303" "30" "2702" "-7" "2702" "-7" "c.2702-7dup" "r.(=)" "p.(=)" "" "0001046318" "00024303" "90" "1762" "0" "1766" "0" "c.1762_1766del" "r.(?)" "p.(Tyr588Serfs*38)" "" "0001053892" "00024303" "30" "-49535" "0" "-49535" "0" "c.-49535C>G" "r.(?)" "p.(=)" "" "0001065472" "00024303" "50" "565" "0" "565" "0" "c.565G>A" "r.(?)" "p.(Gly189Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 25 "{{screeningid}}" "{{variantid}}" "0000110991" "0000177975" "0000110992" "0000177976" "0000110993" "0000177977" "0000110994" "0000177978" "0000110995" "0000177979" "0000110996" "0000177980" "0000110997" "0000177981" "0000110998" "0000177982" "0000249960" "0000579041" "0000249961" "0000579042" "0000249962" "0000579043" "0000249962" "0000579066" "0000249963" "0000579044" "0000249964" "0000579045" "0000249965" "0000579046" "0000249966" "0000579047" "0000249967" "0000579048" "0000249968" "0000579049" "0000249969" "0000579050" "0000249970" "0000579051" "0000249971" "0000579052" "0000249972" "0000579053" "0000249973" "0000579054" "0000249974" "0000579055" "0000249975" "0000579056"