### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = CUL7) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "CUL7" "cullin 7" "6" "p21.1" "unknown" "NC_000006.11" "UD_132085404607" "" "https://www.LOVD.nl/CUL7" "" "1" "21024" "9820" "609577" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "http://databases.lovd.nl/shared/refseq/CUL7_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2021-03-22 13:27:42" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00005898" "CUL7" "transcript variant 2" "002" "NM_014780.4" "" "NP_055595.2" "" "" "" "-332" "5168" "5097" "43021683" "43005355" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00276" "3M1" "3M syndrome, type 1 (3M1)" "AR" "273750" "" "" "" "00006" "2013-11-22 15:47:16" "00006" "2021-12-10 21:51:32" "02247" "MPS2" "mucopolysaccharidosis, type II (MPS-2, Hunter syndrome)" "XLR" "309900" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05489" "cancer, colon" "cancer, colon" "" "" "" "" "" "00006" "2018-10-26 16:33:57" "" "" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05896" "3MC" "3MC syndrome (3MC)" "" "" "" "" "" "00006" "2021-02-08 14:53:16" "00006" "2021-12-10 21:51:32" "05910" "3M" "3M syndrome (3M)" "" "" "" "" "" "00006" "2021-03-22 14:14:27" "00006" "2021-12-10 21:51:32" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "CUL7" "00276" ## Individuals ## Do not remove or alter this header ## ## Count = 48 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00004047" "" "" "" "1" "" "00549" "{PMID:Shaheen 2014:24389050}, {DOI:Shaheen 2014:10.1101/gr.160572.113}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "Arab" "" "00208599" "" "" "" "3" "" "03131" "" "" "" "" "" "" "0" "" "" "" "Fam301" "00208600" "" "" "" "2" "" "03131" "" "" "" "" "" "" "0" "" "" "" "Fam110" "00294111" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294112" "" "" "" "20" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294113" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294114" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294115" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294116" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00331391" "" "" "" "2" "" "00000" "{PMID:Maddirevula 2018:29620724}" "family, 2 affected (F, M)" "F;M" "yes" "" "" "0" "" "" "Arab" "08DG00138, 08DG00139" "00331392" "" "" "" "4" "" "00000" "{PMID:Maddirevula 2018:29620724}" "family, 4 affected (3F, M)" "F;M" "yes" "" "" "0" "" "" "Arab" "10DG1592, 10DG0199, 10DG1592, 10DG1593" "00331393" "" "" "" "2" "" "00000" "{PMID:Maddirevula 2018:29620724}" "family, 2 affected (2M)" "M" "yes" "" "" "0" "" "" "Arab" "11DG1211, 11DG1210" "00331394" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "F" "yes" "" "" "0" "" "" "Arab" "12DG1575" "00331395" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "F" "no" "" "" "0" "" "" "Arab" "17DG0787" "00359454" "" "" "" "1" "" "01709" "" "" "" "" "(Brazil)" "" "0" "" "" "" "" "00359455" "" "" "" "1" "" "01709" "{PMID:Silveira 2021:34529350}, {DOI:Silveira 2021:10.1002/ajmg.c.31937}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat2" "00359462" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Tunisia" "" "0" "" "" "" "Fam1" "00359463" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Tunisia" "" "0" "" "" "" "Fam2" "00359464" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Tunisia" "" "0" "" "" "" "Fam3" "00359465" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Tunisia" "" "0" "" "" "" "Fam4" "00359466" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Morocco" "" "0" "" "" "" "Fam5" "00359467" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Morocco" "" "0" "" "" "" "Fam6" "00359468" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "France" "" "0" "" "" "" "Fam7" "00359469" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "France" "" "0" "" "" "" "Fam8" "00359470" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "France" "" "0" "" "" "" "Fam9" "00359471" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Algeria" "" "0" "" "" "" "Fam10" "00359472" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Syria" "" "0" "" "" "" "Fam11" "00359473" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "Tunisia" "" "0" "" "" "" "Fam12" "00359474" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Portugal" "" "0" "" "" "" "Fam13" "00359475" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Sri Lanka" "" "0" "" "" "" "Fam14" "00359476" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Sri Lanka" "" "0" "" "" "" "Fam15" "00359477" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Sri Lanka" "" "0" "" "" "" "Fam16" "00359478" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Turkey" "" "0" "" "" "" "Fam17" "00359479" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Egypt" "" "0" "" "" "" "Fam18" "00359480" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Turkey" "" "0" "" "" "" "Fam19" "00359481" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Germany" "" "0" "" "" "" "Fam20" "00359482" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "Germany" "" "0" "" "" "" "Fam21" "00359483" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "Austria" "" "0" "" "" "" "Fam22" "00359484" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "Austria" "" "0" "" "" "" "Fam23" "00359485" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Italy" "" "0" "" "" "" "Fam24" "00359486" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Italy" "" "0" "" "" "" "Fam25" "00359487" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Italy" "" "0" "" "" "" "Fam26" "00359488" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "no" "Suriname" "" "0" "" "" "" "Fam27" "00359489" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "India" "" "0" "" "" "" "Fam28" "00359490" "" "" "" "1" "" "00006" "{PMID:Huber 2005:16142236}" "see paper" "" "yes" "Brazil" "" "0" "" "" "" "Fam29" "00375203" "" "" "" "1" "" "03894" "" "2-generation family, the proband has two disease phenotypes." "M" "no" "China" "" "" "" "" "Chinese" "" "00435457" "" "" "" "2" "" "04531" "" "" "F" "no" "Poland" "03y" "0" "" "" "white" "patient" "00465822" "" "" "" "2" "" "00006" "{PMID:Alazami 2016:27023906}" "family, 2 affected" "" "" "Saudi Arabia" "" "0" "" "" "" "Fam16" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 49 "{{individualid}}" "{{diseaseid}}" "00004047" "00276" "00208599" "05489" "00208600" "05489" "00294111" "00198" "00294112" "00198" "00294113" "00198" "00294114" "00198" "00294115" "00198" "00294116" "00198" "00331391" "05517" "00331392" "05517" "00331393" "05517" "00331394" "05517" "00331395" "05517" "00359454" "05896" "00359455" "05910" "00359462" "05910" "00359463" "05910" "00359464" "05910" "00359465" "05910" "00359466" "05910" "00359467" "05910" "00359468" "05910" "00359469" "05910" "00359470" "05910" "00359471" "05910" "00359472" "05910" "00359473" "05910" "00359474" "05910" "00359475" "05910" "00359476" "05910" "00359477" "05910" "00359478" "05910" "00359479" "05910" "00359480" "05910" "00359481" "05910" "00359482" "05910" "00359483" "05910" "00359484" "05910" "00359485" "05910" "00359486" "05910" "00359487" "05910" "00359488" "05910" "00359489" "05910" "00359490" "05910" "00375203" "02247" "00375203" "05910" "00435457" "00276" "00465822" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00276, 02247, 05489, 05517, 05896, 05910 ## Count = 42 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000002840" "00198" "00004047" "00549" "Familial, autosomal recessive" "" "small and mal-aligned teeth, skin and joint laxity, and normal motor and cognitive development" "" "" "" "" "" "" "" "" "" "" "" "0000249583" "05517" "00331391" "00000" "Familial, autosomal recessive" "" "Cutis laxa, Joint laxity, Global developmental delay, Failure to thrive, Proportionate short No" "" "" "" "" "" "" "" "" "Slender bone dysplasia group" "skeletal dysplasia" "" "0000249584" "05517" "00331392" "00000" "Familial, autosomal recessive" "" "Joint laxity, Midface retrusion, Depressed nasal bridge, Thick vermilion border, Prominent Yes" "" "" "" "" "" "" "" "" "Slender bone dysplasia group" "skeletal dysplasia" "" "0000249585" "05517" "00331393" "00000" "Familial, autosomal recessive" "" "Severe short stature, Feeding difficulties, Triangular face, Broad forehead, Wide nose, Mal Yes" "" "" "" "" "" "" "" "" "Slender bone dysplasia group" "skeletal dysplasia" "" "0000249586" "05517" "00331394" "00000" "Familial, autosomal recessive" "" "Short stature, Abnormal heart morphology, Osteopenia, Midface retrusion, Depressed nasno" "" "" "" "" "" "" "" "" "Slender bone dysplasia group" "skeletal dysplasia" "" "0000249587" "05517" "00331395" "00000" "Familial, autosomal recessive" "" "Short stature, Abnormal facial shape, Failure to thrive" "" "" "" "" "" "" "" "" "Slender bone dysplasia group" "skeletal dysplasia" "" "0000254695" "05896" "00359454" "01709" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "3M syndrome" "" "0000254696" "05896" "00359455" "01709" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "3M syndrome" "" "0000254704" "05910" "00359462" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254705" "05910" "00359463" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254706" "05910" "00359464" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254707" "05910" "00359465" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254708" "05910" "00359466" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254709" "05910" "00359467" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254710" "05910" "00359468" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254711" "05910" "00359469" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254712" "05910" "00359470" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254713" "05910" "00359471" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254714" "05910" "00359472" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254715" "05910" "00359473" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254716" "05910" "00359474" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254717" "05910" "00359475" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254718" "05910" "00359476" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254719" "05910" "00359477" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254720" "05910" "00359478" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254721" "05910" "00359479" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254722" "05910" "00359480" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254723" "05910" "00359481" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254724" "05910" "00359482" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254725" "05910" "00359483" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254726" "05910" "00359484" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254727" "05910" "00359485" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254728" "05910" "00359486" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254729" "05910" "00359487" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254730" "05910" "00359488" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254731" "05910" "00359489" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000254732" "05910" "00359490" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "3M1" "3-M syndrome" "" "0000270413" "05910" "00375203" "03894" "Familial, autosomal recessive" "" "Short stature" "" "" "" "" "" "" "" "" "3M Syndrome" "Short stature" "" "0000270414" "02247" "00375203" "03894" "Familial, X-linked recessive" "" "Fleshy prominent heels, large head circumference, coarse face." "" "" "" "" "" "" "" "" "" "" "" "0000270415" "02247" "00375203" "03894" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000325647" "00276" "00435457" "04531" "Familial, autosomal recessive" "01y" "short stature (HP:0004322)" "" "01y" "" "" "" "" "" "" "" "" "" "0000351269" "00198" "00465822" "00006" "Familial, autosomal recessive" "" "see paper; ..., Significant skin and joint laxity, developmental delay, failure to thrive, severe proportionate short stature with relative macrocephaly, dysmorphic features (prominent forehead, hypoplastic midface, depressed nasal root, anteverted nares and full lips), hyperlordosis, thin slender long tubular bones, small pelvises with winged iliac bones, prominent heels" "" "" "" "" "" "" "" "" "3M1" "joint laxity" "" ## Screenings ## Do not remove or alter this header ## ## Count = 48 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000003969" "00004047" "1" "00549" "00549" "2013-11-21 13:08:40" "" "" "PCR" "DNA" "" "" "0000209648" "00208599" "1" "03131" "03131" "2018-12-11 17:20:48" "" "" "SEQ-NG-I" "DNA" "Blood" "gene panel" "0000209649" "00208600" "1" "03131" "03131" "2018-12-11 20:17:35" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000295279" "00294111" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295280" "00294112" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295281" "00294113" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295282" "00294114" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295283" "00294115" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295284" "00294116" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000332610" "00331391" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332611" "00331392" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332612" "00331393" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332613" "00331394" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332614" "00331395" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000360684" "00359454" "1" "01709" "00006" "2021-03-22 12:01:49" "" "" "SEQ" "DNA" "" "" "0000360685" "00359455" "1" "01709" "00006" "2021-03-22 12:01:49" "" "" "SEQ" "DNA" "" "" "0000360692" "00359462" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360693" "00359463" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360694" "00359464" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360695" "00359465" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360696" "00359466" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360697" "00359467" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360698" "00359468" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360699" "00359469" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360700" "00359470" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360701" "00359471" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360702" "00359472" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360703" "00359473" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360704" "00359474" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360705" "00359475" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360706" "00359476" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360707" "00359477" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360708" "00359478" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360709" "00359479" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360710" "00359480" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360711" "00359481" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360712" "00359482" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360713" "00359483" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360714" "00359484" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360715" "00359485" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360716" "00359486" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360717" "00359487" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360718" "00359488" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360719" "00359489" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000360720" "00359490" "1" "00006" "00006" "2021-03-22 14:23:02" "" "" "SEQ" "DNA" "" "" "0000376397" "00375203" "1" "03894" "03894" "2021-05-30 09:17:19" "" "" "SEQ-NG" "DNA" "Peripheral blood" "" "0000436936" "00435457" "1" "04531" "04531" "2023-07-27 12:29:06" "" "" "SEQ-NG-I" "DNA" "" "WES, mtDNA" "0000467473" "00465822" "1" "00006" "00006" "2025-06-07 12:17:17" "" "" "arraySNP;SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 37 "{{screeningid}}" "{{geneid}}" "0000003969" "CUL7" "0000332610" "CUL7" "0000332611" "CUL7" "0000332612" "CUL7" "0000332613" "CUL7" "0000332614" "CUL7" "0000360692" "CUL7" "0000360693" "CUL7" "0000360694" "CUL7" "0000360695" "CUL7" "0000360696" "CUL7" "0000360697" "CUL7" "0000360698" "CUL7" "0000360699" "CUL7" "0000360700" "CUL7" "0000360701" "CUL7" "0000360702" "CUL7" "0000360703" "CUL7" "0000360704" "CUL7" "0000360705" "CUL7" "0000360706" "CUL7" "0000360707" "CUL7" "0000360708" "CUL7" "0000360709" "CUL7" "0000360710" "CUL7" "0000360711" "CUL7" "0000360712" "CUL7" "0000360713" "CUL7" "0000360714" "CUL7" "0000360715" "CUL7" "0000360716" "CUL7" "0000360717" "CUL7" "0000360718" "CUL7" "0000360719" "CUL7" "0000360720" "CUL7" "0000376397" "CUL7" "0000376397" "IDS" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 141 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000022846" "3" "95" "6" "43014042" "43014042" "subst" "0" "00549" "CUL7_000001" "g.43014042A>C" "" "{PMID:Shaheen 2014:24389050}, {DOI:Shaheen 2014:10.1101/gr.160572.113}" "" "" "" "Germline" "yes" "" "0" "" "" "g.43046304A>C" "" "pathogenic" "" "0000274638" "0" "30" "6" "43017883" "43017883" "subst" "6.49989E-5" "01943" "CUL7_000005" "g.43017883G>A" "" "" "" "CUL7(NM_001168370.1):c.1639C>T (p.R547C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43050145G>A" "" "likely benign" "" "0000274639" "0" "30" "6" "43014814" "43014814" "subst" "6.51232E-5" "01943" "CUL7_000004" "g.43014814C>T" "" "" "" "CUL7(NM_001168370.1):c.2453G>A (p.R818H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43047076C>T" "" "likely benign" "" "0000274640" "0" "50" "6" "43014614" "43014614" "subst" "0" "01943" "CUL7_000003" "g.43014614T>G" "" "" "" "CUL7(NM_001168370.1):c.2649+4A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43046876T>G" "" "VUS" "" "0000274641" "0" "30" "6" "43013767" "43013767" "subst" "0" "01943" "CUL7_000002" "g.43013767C>T" "" "" "" "CUL7(NM_001168370.1):c.2975G>A (p.C992Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43046029C>T" "" "likely benign" "" "0000274642" "0" "30" "6" "43021548" "43021548" "subst" "0" "01943" "CUL7_000008" "g.43021548G>A" "" "" "" "CUL7(NM_001168370.1):c.49C>T (p.H17Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43053810G>A" "" "likely benign" "" "0000331027" "0" "30" "6" "43018849" "43018849" "subst" "1.21864E-5" "01804" "CUL7_000006" "g.43018849C>T" "" "" "" "CUL7(NM_001168370.1):c.1342G>A (p.(Ala448Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43051111C>T" "" "likely benign" "" "0000331028" "0" "50" "6" "43020388" "43020388" "subst" "0.00010158" "01804" "CUL7_000007" "g.43020388G>A" "" "" "" "CUL7(NM_001168370.1):c.295C>T (p.(Arg99Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43052650G>A" "" "VUS" "" "0000331029" "0" "50" "6" "43022080" "43022080" "subst" "4.06659E-6" "01804" "MRPL2_000001" "g.43022080G>C" "" "" "" "MRPL2(NM_015950.3):c.850C>G (p.(Arg284Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43054342G>C" "" "VUS" "" "0000331030" "0" "50" "6" "43024060" "43024060" "subst" "0.000816257" "01804" "MRPL2_000002" "g.43024060C>T" "" "" "" "MRPL2(NM_015950.3):c.389G>A (p.(Arg130His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43056322C>T" "" "VUS" "" "0000338080" "0" "10" "6" "43006739" "43006739" "subst" "0.015346" "02327" "CUL7_000009" "g.43006739G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43039001G>T" "" "benign" "" "0000340069" "0" "10" "6" "43008298" "43008298" "subst" "0.192116" "02327" "CUL7_000010" "g.43008298C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43040560C>T" "" "benign" "" "0000340070" "0" "10" "6" "43014298" "43014298" "subst" "0.976318" "02327" "CUL7_000015" "g.43014298T>C" "" "" "" "CUL7(NM_001168370.2):c.2535A>G (p.Q845=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43046560T>C" "" "benign" "" "0000340071" "0" "10" "6" "43020188" "43020188" "subst" "0.156477" "02327" "CUL7_000018" "g.43020188G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43052450G>A" "" "benign" "" "0000340869" "0" "30" "6" "43020344" "43020344" "subst" "0.000166511" "02327" "CUL7_000019" "g.43020344C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43052606C>T" "" "likely benign" "" "0000341674" "0" "50" "6" "43013335" "43013335" "subst" "1.62438E-5" "02327" "CUL7_000014" "g.43013335C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43045597C>T" "" "VUS" "" "0000344547" "0" "90" "6" "43008384" "43008384" "subst" "4.06332E-6" "02327" "CUL7_000011" "g.43008384G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43040646G>A" "" "pathogenic" "" "0000345002" "0" "10" "6" "43014299" "43014299" "subst" "0.976269" "02327" "CUL7_000016" "g.43014299T>C" "" "" "" "CUL7(NM_001168370.2):c.2534A>G (p.Q845R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43046561T>C" "" "benign" "" "0000346848" "0" "90" "6" "43012621" "43012621" "subst" "0.000158471" "02327" "CUL7_000013" "g.43012621A>C" "" "" "" "CUL7(NM_001168370.2):c.3137T>G (p.L1046R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43044883A>C" "" "pathogenic" "" "0000351190" "0" "70" "6" "43011369" "43011369" "subst" "0" "02327" "CUL7_000012" "g.43011369C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.43043631C>G" "" "likely pathogenic" "" "0000439818" "0" "50" "6" "43014022" "43014022" "subst" "0.021336" "03131" "CUL7_000021" "g.43014022G>A" "" "" "" "" "" "Germline" "yes" "rs61732148" "0" "" "" "g.43046284G>A" "" "VUS" "" "0000439829" "0" "50" "6" "43013368" "43013368" "subst" "0.000113699" "03131" "CUL7_000020" "g.43013368C>T" "" "" "" "" "" "Germline" "yes" "rs201130952" "0" "" "" "g.43045630C>T" "" "VUS" "" "0000528896" "0" "30" "6" "43006408" "43006408" "subst" "0.00793012" "01804" "CUL7_000023" "g.43006408A>G" "" "" "" "CUL7(NM_001168370.1):c.4715T>C (p.(Leu1572Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43038670A>G" "" "likely benign" "" "0000528898" "0" "30" "6" "43011257" "43011257" "subst" "4.07266E-5" "01804" "CUL7_000025" "g.43011257C>T" "" "" "" "CUL7(NM_001168370.1):c.3536G>A (p.(Arg1179His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43043519C>T" "" "likely benign" "" "0000528900" "0" "10" "6" "43014022" "43014022" "subst" "0.021336" "01804" "CUL7_000021" "g.43014022G>A" "" "" "" "CUL7(NM_001168370.1):c.2864C>T (p.(Ala955Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43046284G>A" "" "benign" "" "0000528902" "0" "10" "6" "43014298" "43014298" "subst" "0.976318" "02325" "CUL7_000015" "g.43014298T>C" "" "" "" "CUL7(NM_001168370.2):c.2535A>G (p.Q845=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43046560T>C" "" "benign" "" "0000528903" "0" "10" "6" "43014299" "43014299" "subst" "0.976269" "02325" "CUL7_000016" "g.43014299T>C" "" "" "" "CUL7(NM_001168370.2):c.2534A>G (p.Q845R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43046561T>C" "" "benign" "" "0000528904" "0" "90" "6" "43015891" "43015891" "subst" "2.0474E-5" "02327" "CUL7_000027" "g.43015891G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43048153G>A" "" "pathogenic" "" "0000528905" "0" "30" "6" "43017190" "43017190" "subst" "0.0063672" "01804" "CUL7_000028" "g.43017190C>T" "" "" "" "CUL7(NM_001168370.1):c.2032G>A (p.(Ala678Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43049452C>T" "" "likely benign" "" "0000528906" "0" "50" "6" "43017858" "43017858" "subst" "0.000142228" "01804" "CUL7_000029" "g.43017858T>C" "" "" "" "CUL7(NM_001168370.1):c.1664A>G (p.(Tyr555Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43050120T>C" "" "VUS" "" "0000528907" "0" "30" "6" "43018769" "43018771" "del" "0" "01804" "CUL7_000030" "g.43018769_43018771del" "" "" "" "CUL7(NM_001168370.1):c.1423_1425del (p.(Glu475del)), CUL7(NM_001168370.1):c.1423_1425delGAG (p.E475del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43051031_43051033del" "" "likely benign" "" "0000528909" "0" "30" "6" "43019395" "43019395" "subst" "0.000190846" "02327" "CUL7_000032" "g.43019395C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43051657C>T" "" "likely benign" "" "0000610357" "0" "30" "6" "43005635" "43005635" "subst" "8.15461E-6" "01804" "CUL7_000035" "g.43005635C>T" "" "" "" "CUL7(NM_001168370.1):c.5140G>A (p.(Gly1714Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43037897C>T" "" "likely benign" "" "0000610358" "0" "30" "6" "43006016" "43006016" "subst" "0.00797944" "01804" "CUL7_000036" "g.43006016G>T" "" "" "" "CUL7(NM_001168370.1):c.5014C>A (p.(Leu1672Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43038278G>T" "" "likely benign" "" "0000610359" "0" "30" "6" "43011268" "43011268" "subst" "0.000101899" "01943" "CUL7_000037" "g.43011268C>T" "" "" "" "CUL7(NM_001168370.1):c.3525G>A (p.S1175=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43043530C>T" "" "likely benign" "" "0000610360" "0" "50" "6" "43013046" "43013046" "subst" "0.000215227" "01804" "CUL7_000038" "g.43013046C>T" "" "" "" "CUL7(NM_001168370.1):c.3209G>A (p.(Arg1070His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43045308C>T" "" "VUS" "" "0000610361" "0" "30" "6" "43022138" "43022138" "subst" "0.000410196" "01943" "CUL7_000039" "g.43022138G>C" "" "" "" "MRPL2(NM_015950.5):c.792C>G (p.R264=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.43054400G>C" "" "likely benign" "" "0000651968" "1" "50" "6" "43006016" "43006016" "subst" "0.00797944" "03575" "CUL7_000036" "g.43006016G>T" "3/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs147493246}" "Germline" "" "rs147493246" "0" "" "" "g.43038278G>T" "" "VUS" "" "0000651969" "1" "50" "6" "43006408" "43006408" "subst" "0.00793012" "03575" "CUL7_000023" "g.43006408A>G" "20/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "20 heterozygous, no homozygous; {DB:CLININrs41274912}" "Germline" "" "rs41274912" "0" "" "" "g.43038670A>G" "" "VUS" "" "0000651970" "1" "50" "6" "43010695" "43010695" "subst" "0.00192136" "03575" "CUL7_000040" "g.43010695G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs201135654}" "Germline" "" "rs201135654" "0" "" "" "g.43042957G>A" "" "VUS" "" "0000651971" "1" "50" "6" "43017728" "43017728" "subst" "0.00108124" "03575" "CUL7_000041" "g.43017728C>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 2 heterozygous, no homozygous; {DB:CLININrs146808129}" "Germline" "" "rs146808129" "0" "" "" "g.43049990C>A" "" "VUS" "" "0000651972" "1" "50" "6" "43019994" "43019994" "subst" "0.0013327" "03575" "CUL7_000042" "g.43019994C>A" "8/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 8 heterozygous, no homozygous; {DB:CLININrs183865568}" "Germline" "" "rs183865568" "0" "" "" "g.43052256C>A" "" "VUS" "" "0000651973" "1" "50" "6" "43020391" "43020391" "subst" "0.000353515" "03575" "CUL7_000043" "g.43020391G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs141692693}" "Germline" "" "rs141692693" "0" "" "" "g.43052653G>A" "" "VUS" "" "0000677782" "0" "30" "6" "43014079" "43014079" "subst" "0.00553489" "01804" "CUL7_000044" "g.43014079C>T" "" "" "" "CUL7(NM_001168370.1):c.2807G>A (p.(Arg936Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689741" "0" "30" "6" "43005451" "43005451" "subst" "9.2707E-5" "01943" "CUL7_000045" "g.43005451G>A" "" "" "" "CUL7(NM_001168370.1):c.5324C>T (p.T1775I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689742" "0" "30" "6" "43008398" "43008398" "subst" "0" "01804" "CUL7_000046" "g.43008398T>G" "" "" "" "CUL7(NM_001168370.1):c.4145A>C (p.(Asn1382Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689743" "0" "50" "6" "43019942" "43019942" "subst" "0" "01804" "CUL7_000047" "g.43019942C>G" "" "" "" "CUL7(NM_001168370.1):c.741G>C (p.(Glu247Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720946" "0" "50" "6" "43005469" "43005469" "subst" "0" "02329" "CUL7_000022" "g.43005469T>C" "" "" "" "CUL7(NM_001168370.1):c.5306A>G (p.Y1769C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720947" "0" "50" "6" "43006193" "43006193" "subst" "0" "01804" "CUL7_000048" "g.43006193C>G" "" "" "" "CUL7(NM_001168370.1):c.4837G>C (p.(Asp1613His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720948" "0" "50" "6" "43006309" "43006309" "subst" "8.1275E-6" "01804" "CUL7_000049" "g.43006309G>C" "" "" "" "CUL7(NM_001168370.1):c.4814C>G (p.(Pro1605Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720949" "0" "50" "6" "43008085" "43008085" "subst" "2.03663E-5" "01804" "CUL7_000050" "g.43008085G>A" "" "" "" "CUL7(NM_001168370.1):c.4355C>T (p.(Ala1452Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720950" "0" "90" "6" "43012528" "43012528" "del" "0" "01943" "CUL7_000051" "g.43012528del" "" "" "" "CUL7(NM_001168370.1):c.3388delC (p.L1130Wfs*95)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000720951" "0" "70" "6" "43012621" "43012621" "subst" "0.000158471" "02329" "CUL7_000013" "g.43012621A>C" "" "" "" "CUL7(NM_001168370.2):c.3137T>G (p.L1046R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000720952" "0" "30" "6" "43014755" "43014755" "subst" "6.09142E-5" "01804" "CUL7_000054" "g.43014755C>T" "" "" "" "CUL7(NM_001168370.1):c.2512G>A (p.(Ala838Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720953" "0" "30" "6" "43018769" "43018771" "del" "0" "01943" "CUL7_000030" "g.43018769_43018771del" "" "" "" "CUL7(NM_001168370.1):c.1423_1425del (p.(Glu475del)), CUL7(NM_001168370.1):c.1423_1425delGAG (p.E475del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000729892" "3" "90" "6" "43018795" "43018795" "subst" "0" "00000" "CUL7_000055" "g.43018795G>A" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_014780.4:c.1144C>T:p.(Arg382*)" "" "Germline" "" "" "0" "" "" "g.43051057G>A" "" "pathogenic (recessive)" "" "0000729893" "3" "90" "6" "43013141" "43013141" "subst" "0" "00000" "CUL7_000053" "g.43013141C>G" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_014780.4:c.2863-1G>C" "" "Germline" "" "" "0" "" "" "g.43045403C>G" "" "pathogenic (recessive)" "" "0000729894" "3" "90" "6" "43013015" "43013015" "subst" "0" "00000" "CUL7_000052" "g.43013015C>T" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_014780.4:c.2988G>A:p.(Trp996*)" "" "Germline" "" "" "0" "" "" "g.43045277C>T" "" "pathogenic (recessive)" "" "0000729895" "3" "90" "6" "43020264" "43020264" "del" "0" "00000" "CUL7_000056" "g.43020264del" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_014780.4:c.263del:p.(Val88Alafs*27)" "" "Germline" "" "" "0" "" "" "g.43052526del" "" "likely pathogenic (recessive)" "" "0000729896" "3" "90" "6" "43013141" "43013141" "subst" "0" "00000" "CUL7_000053" "g.43013141C>G" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_014780.4:c.2863-1G>C" "" "Germline" "" "" "0" "" "" "g.43045403C>G" "" "pathogenic (recessive)" "" "0000760758" "3" "70" "6" "43018096" "43018096" "subst" "0" "01709" "CUL7_000057" "g.43018096C>T" "" "" "" "NM_001168370:c.1526G>A p.Trp509*" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000760759" "3" "70" "6" "43012528" "43012528" "del" "0" "01709" "CUL7_000051" "g.43012528del" "" "{PMID:Silveira 2021:34529350}, {DOI:Silveira 2021:10.1002/ajmg.c.31937}" "" "3184-2A>C" "ACMG PVS1, PP4, PM3, PM2" "Germline" "" "" "0" "" "" "g.43044790del" "" "pathogenic (recessive)" "ACMG" "0000760766" "3" "90" "6" "43006421" "43006422" "del" "0" "00006" "CUL7_000060" "g.43006421_43006422del" "" "{PMID:Huber 2005:16142236}" "" "4449_4450delTG" "" "Germline" "" "" "0" "" "" "g.43038683_43038684del" "" "pathogenic (recessive)" "" "0000760767" "3" "90" "6" "43006421" "43006422" "del" "0" "00006" "CUL7_000060" "g.43006421_43006422del" "" "{PMID:Huber 2005:16142236}" "" "4449_4450delTG" "" "Germline" "" "" "0" "" "" "g.43038683_43038684del" "" "pathogenic (recessive)" "" "0000760768" "3" "90" "6" "43006421" "43006422" "del" "0" "00006" "CUL7_000060" "g.43006421_43006422del" "" "{PMID:Huber 2005:16142236}" "" "4449_4450delTG" "" "Germline" "" "" "0" "" "" "g.43038683_43038684del" "" "pathogenic (recessive)" "" "0000760769" "3" "90" "6" "43006421" "43006422" "del" "0" "00006" "CUL7_000060" "g.43006421_43006422del" "" "{PMID:Huber 2005:16142236}" "" "4449_4450delTG" "" "Germline" "" "" "0" "" "" "g.43038683_43038684del" "" "pathogenic (recessive)" "" "0000760770" "3" "90" "6" "43012528" "43012528" "del" "0" "00006" "CUL7_000051" "g.43012528del" "" "{PMID:Huber 2005:16142236}" "" "3136delC" "" "Germline" "" "" "0" "" "" "g.43044790del" "" "pathogenic (recessive)" "" "0000760771" "3" "90" "6" "43018136" "43018141" "del" "0" "00006" "CUL7_000076" "g.43018136_43018141del" "" "{PMID:Huber 2005:16142236}" "" "IVS4-4_–1delCCAG, 1234_1235delCG" "" "Germline" "" "" "0" "" "" "g.43050398_43050403del" "" "pathogenic (recessive)" "" "0000760772" "3" "90" "6" "43008321" "43008321" "subst" "0" "00006" "CUL7_000065" "g.43008321G>A" "" "{PMID:Huber 2005:16142236}" "" "3970C>T" "" "Germline" "" "" "0" "" "" "g.43040583G>A" "" "pathogenic (recessive)" "" "0000760773" "1" "90" "6" "43012494" "43012495" "delins" "0" "00006" "CUL7_000069" "g.43012494_43012495delinsTC" "" "{PMID:Huber 2005:16142236}" "" "3167_3168CC>GA" "" "Germline" "" "" "0" "" "" "g.43044756_43044757delinsTC" "" "pathogenic (recessive)" "" "0000760774" "1" "90" "6" "43013765" "43013765" "subst" "0" "00006" "CUL7_000070" "g.43013765C>T" "" "{PMID:Huber 2005:16142236}" "" "2725G>A" "" "Germline" "" "" "0" "" "" "g.43046027C>T" "" "pathogenic (recessive)" "" "0000760775" "3" "90" "6" "43006421" "43006422" "del" "0" "00006" "CUL7_000060" "g.43006421_43006422del" "" "{PMID:Huber 2005:16142236}" "" "4449_4450delTG" "" "Germline" "" "" "0" "" "" "g.43038683_43038684del" "" "pathogenic (recessive)" "" "0000760776" "3" "90" "6" "43014781" "43014803" "del" "0" "00006" "CUL7_000073" "g.43014781_43014803del" "" "{PMID:Huber 2005:16142236}" "" "2212_2235delTGAGCAGGGACTATGCCGTGGTG" "" "Germline" "" "" "0" "" "" "g.43047043_43047065del" "" "pathogenic (recessive)" "" "0000760777" "1" "90" "6" "43019016" "43019016" "subst" "4.08137E-6" "00006" "CUL7_000077" "g.43019016A>C" "" "{PMID:Huber 2005:16142236}" "" "923T>G" "" "Germline" "" "" "0" "" "" "g.43051278A>C" "" "pathogenic (recessive)" "" "0000760778" "3" "90" "6" "43005744" "43005744" "dup" "0" "00006" "CUL7_000058" "g.43005744dup" "" "{PMID:Huber 2005:16142236}" "" "4781insG" "" "Germline" "" "" "0" "" "" "g.43038006dup" "" "pathogenic (recessive)" "" "0000760779" "3" "90" "6" "43006687" "43006687" "subst" "4.87733E-5" "00006" "CUL7_000063" "g.43006687G>A" "" "{PMID:Huber 2005:16142236}" "" "4333C>T" "" "Germline" "" "" "0" "" "" "g.43038949G>A" "" "pathogenic (recessive)" "" "0000760780" "3" "90" "6" "43006687" "43006687" "subst" "4.87733E-5" "00006" "CUL7_000063" "g.43006687G>A" "" "{PMID:Huber 2005:16142236}" "" "4333C>T" "" "Germline" "" "" "0" "" "" "g.43038949G>A" "" "pathogenic (recessive)" "" "0000760781" "3" "90" "6" "43006687" "43006687" "subst" "4.87733E-5" "00006" "CUL7_000063" "g.43006687G>A" "" "{PMID:Huber 2005:16142236}" "" "4333C>T" "" "Germline" "" "" "0" "" "" "g.43038949G>A" "" "pathogenic (recessive)" "" "0000760782" "3" "90" "6" "43013783" "43013784" "dup" "0" "00006" "CUL7_000072" "g.43013783_43013784dup" "" "{PMID:Huber 2005:16142236}" "" "2706insGG" "" "Germline" "" "" "0" "" "" "g.43046045_43046046dup" "" "pathogenic (recessive)" "" "0000760783" "3" "90" "6" "43008454" "43008727" "del" "0" "00006" "CUL7_000066" "g.43008454_43008727del" "" "{PMID:Huber 2005:16142236}" "" "3733_3838del96bp (Q1246G)" "" "Germline" "" "" "0" "" "" "g.43040716_43040989del" "" "pathogenic (recessive)" "" "0000760784" "3" "90" "6" "43016198" "43016198" "dup" "0" "00006" "CUL7_000075" "g.43016198dup" "" "{PMID:Huber 2005:16142236}" "" "1939insG" "" "Germline" "" "" "0" "" "" "g.43048460dup" "" "pathogenic (recessive)" "" "0000760785" "3" "90" "6" "43012621" "43012621" "subst" "0.000158471" "00006" "CUL7_000013" "g.43012621A>C" "" "{PMID:Huber 2005:16142236}" "" "3041T>G" "" "Germline" "" "" "0" "" "" "g.43044883A>C" "" "pathogenic (recessive)" "" "0000760786" "3" "90" "6" "43012621" "43012621" "subst" "0.000158471" "00006" "CUL7_000013" "g.43012621A>C" "" "{PMID:Huber 2005:16142236}" "" "3041T>G" "" "Germline" "" "" "0" "" "" "g.43044883A>C" "" "pathogenic (recessive)" "" "0000760787" "1" "90" "6" "43019013" "43019022" "del" "0" "00006" "CUL7_000017" "g.43019013_43019022del" "" "{PMID:Huber 2005:16142236}" "" "920_929delTGGTGCAAGC" "" "Germline" "" "" "0" "" "" "g.43051275_43051284del" "" "pathogenic (recessive)" "" "0000760788" "3" "90" "6" "43015944" "43015944" "subst" "0" "00006" "CUL7_000074" "g.43015944C>T" "" "{PMID:Huber 2005:16142236}" "" "2111G>A" "" "Germline" "" "" "0" "" "" "g.43048206C>T" "" "pathogenic (recessive)" "" "0000760789" "3" "90" "6" "43006629" "43006629" "subst" "8.12203E-6" "00006" "CUL7_000061" "g.43006629T>G" "" "{PMID:Huber 2005:16142236}" "" "4391A>C" "" "Germline" "" "" "0" "" "" "g.43038891T>G" "" "pathogenic (recessive)" "" "0000760790" "3" "90" "6" "43006629" "43006629" "subst" "8.12203E-6" "00006" "CUL7_000061" "g.43006629T>G" "" "{PMID:Huber 2005:16142236}" "" "4391A>C" "" "Germline" "" "" "0" "" "" "g.43038891T>G" "" "pathogenic (recessive)" "" "0000760791" "3" "90" "6" "43020065" "43020065" "del" "0" "00006" "CUL7_000078" "g.43020065del" "" "{PMID:Huber 2005:16142236}" "" "462delT" "" "Germline" "" "" "0" "" "" "g.43052327del" "" "pathogenic (recessive)" "" "0000760792" "1" "90" "6" "43010579" "43010579" "dup" "0" "00006" "CUL7_000068" "g.43010579dup" "" "{PMID:Huber 2005:16142236}" "" "3608insG" "" "Germline" "" "" "0" "" "" "g.43042841dup" "" "pathogenic (recessive)" "" "0000760793" "3" "90" "6" "43013780" "43013780" "subst" "8.12236E-6" "00006" "CUL7_000071" "g.43013780G>A" "" "{PMID:Huber 2005:16142236}" "" "2710C>T" "" "Germline" "" "" "0" "" "" "g.43046042G>A" "" "pathogenic (recessive)" "" "0000760794" "3" "90" "6" "43006061" "43006061" "subst" "4.06693E-6" "00006" "CUL7_000059" "g.43006061G>A" "" "{PMID:Huber 2005:16142236}" "" "4717C>T" "" "Germline" "" "" "0" "" "" "g.43038323G>A" "" "pathogenic (recessive)" "" "0000760795" "2" "90" "6" "43006678" "43006678" "subst" "0" "00006" "CUL7_000062" "g.43006678A>G" "" "{PMID:Huber 2005:16142236}" "" "4343C>T" "" "Germline" "" "" "0" "" "" "g.43038940A>G" "" "pathogenic (recessive)" "" "0000760796" "2" "90" "6" "43006702" "43006702" "subst" "1.21948E-5" "00006" "CUL7_000064" "g.43006702G>A" "" "{PMID:Huber 2005:16142236}" "" "2725G>A;4318C>T" "" "Germline" "" "" "0" "" "" "g.43038964G>A" "" "pathogenic (recessive)" "" "0000760797" "2" "90" "6" "43010551" "43010566" "del" "0" "00006" "CUL7_000067" "g.43010551_43010566del" "" "{PMID:Huber 2005:16142236}" "" "3624_3639delCCCTTTTCTCAAAGCT" "" "Germline" "" "" "0" "" "" "g.43042813_43042828del" "" "pathogenic (recessive)" "" "0000760798" "2" "90" "6" "43012621" "43012621" "subst" "0.000158471" "00006" "CUL7_000013" "g.43012621A>C" "" "{PMID:Huber 2005:16142236}" "" "3041T>G" "" "Germline" "" "" "0" "" "" "g.43044883A>C" "" "pathogenic (recessive)" "" "0000760799" "2" "90" "6" "43008384" "43008384" "subst" "4.06332E-6" "00006" "CUL7_000011" "g.43008384G>A" "" "{PMID:Huber 2005:16142236}" "" "3907C>T" "" "Germline" "" "" "0" "" "" "g.43040646G>A" "" "pathogenic (recessive)" "" "0000787994" "21" "90" "6" "43013725" "43013725" "subst" "0" "03894" "CUL7_000080" "g.43013725G>T" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "pathogenic (recessive)" "" "0000787995" "11" "70" "6" "43012609" "43012609" "subst" "0" "03894" "CUL7_000079" "g.43012609A>G" "" "" "" "" "" "Germline" "yes" "" "" "" "" "" "" "likely pathogenic (recessive)" "" "0000802601" "0" "30" "6" "43012504" "43012504" "subst" "0" "01804" "CUL7_000081" "g.43012504T>C" "" "" "" "CUL7(NM_001168370.1):c.3410A>G (p.(Asn1137Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802602" "0" "30" "6" "43012613" "43012613" "subst" "0.000320971" "01804" "CUL7_000082" "g.43012613C>T" "" "" "" "CUL7(NM_001168370.1):c.3301G>A (p.(Ala1101Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851237" "0" "30" "6" "43017813" "43017813" "subst" "0.000686891" "01804" "CUL7_000083" "g.43017813C>T" "" "" "" "CUL7(NM_001168370.1):c.1709G>A (p.(Cys570Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851238" "0" "50" "6" "43019400" "43019400" "subst" "0" "01804" "CUL7_000084" "g.43019400C>G" "" "" "" "CUL7(NM_001168370.1):c.934G>C (p.(Ala312Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860357" "0" "30" "6" "43019994" "43019994" "subst" "0.0013327" "01804" "CUL7_000042" "g.43019994C>A" "" "" "" "CUL7(NM_001168370.1):c.689G>T (p.(Arg230Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000877161" "0" "90" "6" "43020445" "43020445" "subst" "0" "03779" "CUL7_000086" "g.43020445G>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000877162" "0" "90" "6" "43010723" "43010723" "subst" "0" "03779" "CUL7_000085" "g.43010723C>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000880520" "0" "90" "6" "43006421" "43006422" "del" "0" "03779" "CUL7_000060" "g.43006421_43006422del" "" "" "" "" "" "Unknown" "" "rs730880261" "0" "" "" "" "" "pathogenic" "" "0000887260" "0" "50" "6" "43011255" "43011255" "subst" "0" "02327" "CUL7_000087" "g.43011255G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887261" "0" "50" "6" "43011287" "43011287" "subst" "4.08804E-5" "02327" "CUL7_000088" "g.43011287C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887262" "0" "50" "6" "43020391" "43020391" "subst" "0.000353515" "01804" "CUL7_000043" "g.43020391G>A" "" "" "" "CUL7(NM_001168370.1):c.292C>T (p.(Arg98Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924512" "0" "90" "6" "43006702" "43006702" "subst" "1.21948E-5" "02327" "CUL7_000064" "g.43006702G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000924513" "0" "50" "6" "43010835" "43010835" "subst" "8.12612E-6" "02327" "CUL7_000089" "g.43010835A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924514" "0" "50" "6" "43020213" "43020213" "subst" "2.4374E-5" "01804" "CUL7_000090" "g.43020213G>A" "" "" "" "CUL7(NM_001168370.1):c.470C>T (p.(Ser157Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924515" "0" "30" "6" "43023701" "43023701" "subst" "0" "01804" "CUL7_000091" "g.43023701C>A" "" "" "" "MRPL2(NM_001300848.1):c.565G>T (p.(Val189Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929195" "0" "50" "6" "43015923" "43015923" "subst" "0" "01804" "CUL7_000092" "g.43015923C>A" "" "" "" "CUL7(NM_001168370.1):c.2384G>T (p.(Cys795Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931619" "0" "70" "6" "43010662" "43010662" "subst" "0" "04531" "CUL7_000093" "g.43010662G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.43042924G>A" "" "likely pathogenic" "" "0000964152" "0" "50" "6" "43018866" "43018866" "subst" "2.03128E-5" "01804" "CUL7_000094" "g.43018866C>T" "" "" "" "CUL7(NM_001168370.1):c.1325G>A (p.(Arg442His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977256" "0" "50" "6" "43005551" "43005551" "subst" "4.63287E-5" "01804" "CUL7_000095" "g.43005551C>T" "" "" "" "CUL7(NM_014780.5):c.4972G>A (p.(Glu1658Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977257" "0" "30" "6" "43013736" "43013736" "subst" "0.000463049" "01804" "CUL7_000096" "g.43013736C>T" "" "" "" "CUL7(NM_014780.5):c.2754G>A (p.(Thr918=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000977258" "0" "30" "6" "43014020" "43014020" "subst" "0.00152279" "01804" "CUL7_000097" "g.43014020C>T" "" "" "" "CUL7(NM_014780.5):c.2614G>A (p.(Gly872Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000977259" "0" "50" "6" "43014697" "43014697" "subst" "0.000215216" "01804" "CUL7_000098" "g.43014697C>T" "" "" "" "CUL7(NM_014780.5):c.2318G>A (p.(Arg773Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977260" "0" "50" "6" "43019947" "43019947" "subst" "0" "01804" "CUL7_000099" "g.43019947C>T" "" "" "" "CUL7(NM_014780.5):c.580G>A (p.(Gly194Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977261" "0" "30" "6" "43019979" "43019979" "subst" "5.69402E-5" "01804" "CUL7_000100" "g.43019979C>T" "" "" "" "CUL7(NM_014780.5):c.548G>A (p.(Arg183Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995775" "0" "50" "6" "43011210" "43011210" "subst" "0" "01804" "CUL7_000102" "g.43011210G>A" "" "" "" "CUL7(NM_014780.4):c.3331C>T (p.(Arg1111Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035783" "0" "50" "6" "43005617" "43005617" "subst" "1.22269E-5" "01804" "CUL7_000104" "g.43005617G>A" "" "" "" "CUL7(NM_014780.5):c.4906C>T (p.(Arg1636Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035784" "0" "50" "6" "43006428" "43006428" "subst" "8.53187E-5" "01804" "CUL7_000105" "g.43006428C>T" "" "" "" "CUL7(NM_014780.5):c.4443G>A (p.(Ala1481=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035785" "0" "50" "6" "43006674" "43006674" "subst" "0.000117838" "01804" "CUL7_000106" "g.43006674G>A" "" "" "" "CUL7(NM_014780.5):c.4346C>T (p.(Thr1449Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035786" "0" "50" "6" "43008369" "43008369" "subst" "0" "01804" "CUL7_000107" "g.43008369G>C" "" "" "" "CUL7(NM_014780.5):c.3922C>G (p.(Leu1308Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035787" "0" "50" "6" "43012565" "43012565" "subst" "5.27962E-5" "01804" "CUL7_000108" "g.43012565C>T" "" "" "" "CUL7(NM_014780.5):c.3097G>A (p.(Glu1033Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035788" "0" "50" "6" "43014142" "43014142" "subst" "0.000231463" "01804" "CUL7_000109" "g.43014142G>A" "" "" "" "CUL7(NM_014780.5):c.2492C>T (p.(Ser831Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035789" "0" "30" "6" "43014321" "43014321" "subst" "0.000414257" "01804" "CUL7_000110" "g.43014321C>T" "" "" "" "CUL7(NM_014780.5):c.2416G>A (p.(Glu806Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035790" "0" "30" "6" "43014345" "43014345" "subst" "2.84398E-5" "01804" "CUL7_000111" "g.43014345G>C" "" "" "" "CUL7(NM_014780.5):c.2398-6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035791" "0" "50" "6" "43018756" "43018756" "subst" "3.65518E-5" "01804" "CUL7_000112" "g.43018756C>T" "" "" "" "CUL7(NM_014780.5):c.1183G>A (p.(Gly395Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035792" "0" "50" "6" "43019001" "43019001" "subst" "4.07289E-6" "01804" "CUL7_000113" "g.43019001C>A" "" "" "" "CUL7(NM_014780.5):c.938G>T (p.(Trp313Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035793" "0" "50" "6" "43019004" "43019004" "subst" "8.14983E-5" "01804" "CUL7_000114" "g.43019004C>T" "" "" "" "CUL7(NM_014780.5):c.935G>A (p.(Arg312His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035794" "0" "30" "6" "43019508" "43019508" "subst" "0" "01804" "CUL7_000115" "g.43019508C>T" "" "" "" "CUL7(NM_014780.5):c.581-7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035795" "0" "50" "6" "43020322" "43020322" "subst" "1.62446E-5" "01804" "CUL7_000116" "g.43020322T>C" "" "" "" "CUL7(NM_014780.5):c.205A>G (p.(Met69Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045285" "3" "90" "6" "43018795" "43018795" "subst" "0" "00006" "CUL7_000055" "g.43018795G>A" "" "{PMID:Alazami 2016:27023906}" "" "" "" "Germline" "" "" "0" "" "" "g.43051057G>A" "" "pathogenic (recessive)" "" "0001052358" "0" "50" "6" "43010898" "43010898" "subst" "0" "01804" "CUL7_000117" "g.43010898C>T" "" "" "" "CUL7(NM_014780.5):c.3376G>A (p.(Asp1126Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052359" "0" "30" "6" "43015878" "43015878" "del" "0" "01804" "CUL7_000118" "g.43015878del" "" "" "" "CUL7(NM_014780.5):c.2169+8del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001052360" "0" "50" "6" "43020385" "43020385" "subst" "0" "01804" "CUL7_000119" "g.43020385C>G" "" "" "" "CUL7(NM_014780.5):c.142G>C (p.(Gly48Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052361" "0" "50" "6" "43021516" "43021516" "subst" "0" "01804" "CUL7_000120" "g.43021516C>T" "" "" "" "CUL7(NM_001168370.2):c.-76G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes CUL7 ## Count = 141 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000022846" "00005898" "95" "2592" "0" "2592" "0" "c.2592T>G" "r.(?)" "p.(Tyr864*)" "12" "0000274638" "00005898" "30" "1387" "0" "1387" "0" "c.1387C>T" "r.(?)" "p.(Arg463Cys)" "" "0000274639" "00005898" "30" "2201" "0" "2201" "0" "c.2201G>A" "r.(?)" "p.(Arg734His)" "" "0000274640" "00005898" "50" "2397" "4" "2397" "4" "c.2397+4A>C" "r.spl?" "p.?" "" "0000274641" "00005898" "30" "2723" "0" "2723" "0" "c.2723G>A" "r.(?)" "p.(Cys908Tyr)" "" "0000274642" "00005898" "30" "-197" "0" "-197" "0" "c.-197C>T" "r.(?)" "p.(=)" "" "0000331027" "00005898" "30" "1090" "0" "1090" "0" "c.1090G>A" "r.(?)" "p.(Ala364Thr)" "" "0000331028" "00005898" "50" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Arg47Cys)" "" "0000331029" "00005898" "50" "-729" "0" "-729" "0" "c.-729C>G" "r.(?)" "p.(=)" "" "0000331030" "00005898" "50" "-2709" "0" "-2709" "0" "c.-2709G>A" "r.(?)" "p.(=)" "" "0000338080" "00005898" "10" "4295" "-14" "4295" "-14" "c.4295-14C>A" "r.(=)" "p.(=)" "" "0000340069" "00005898" "10" "3993" "0" "3993" "0" "c.3993G>A" "r.(?)" "p.(Leu1331=)" "" "0000340070" "00005898" "10" "2439" "0" "2439" "0" "c.2439A>G" "r.(?)" "p.(Gln813=)" "" "0000340071" "00005898" "10" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Asp113=)" "" "0000340869" "00005898" "30" "183" "0" "183" "0" "c.183G>A" "r.(?)" "p.(Lys61=)" "" "0000341674" "00005898" "50" "2852" "0" "2852" "0" "c.2852G>A" "r.(?)" "p.(Arg951His)" "" "0000344547" "00005898" "90" "3907" "0" "3907" "0" "c.3907C>T" "r.(?)" "p.(Gln1303Ter)" "" "0000345002" "00005898" "10" "2438" "0" "2438" "0" "c.2438A>G" "r.(?)" "p.(Gln813Arg)" "" "0000346848" "00005898" "90" "3041" "0" "3041" "0" "c.3041T>G" "r.(?)" "p.(Leu1014Arg)" "" "0000351190" "00005898" "70" "3173" "-1" "3173" "-1" "c.3173-1G>C" "r.spl?" "p.?" "" "0000439818" "00005898" "50" "2612" "0" "2612" "0" "c.2612C>T" "r.(?)" "p.(Ala871Val)" "" "0000439829" "00005898" "50" "2819" "0" "2819" "0" "c.2819G>A" "r.(?)" "p.(Arg940His)" "" "0000528896" "00005898" "30" "4463" "0" "4463" "0" "c.4463T>C" "r.(?)" "p.(Leu1488Pro)" "" "0000528898" "00005898" "30" "3284" "0" "3284" "0" "c.3284G>A" "r.(?)" "p.(Arg1095His)" "" "0000528900" "00005898" "10" "2612" "0" "2612" "0" "c.2612C>T" "r.(?)" "p.(Ala871Val)" "" "0000528902" "00005898" "10" "2439" "0" "2439" "0" "c.2439A>G" "r.(?)" "p.(Gln813=)" "" "0000528903" "00005898" "10" "2438" "0" "2438" "0" "c.2438A>G" "r.(?)" "p.(Gln813Arg)" "" "0000528904" "00005898" "90" "2164" "0" "2164" "0" "c.2164C>T" "r.(?)" "p.(Arg722Ter)" "" "0000528905" "00005898" "30" "1780" "0" "1780" "0" "c.1780G>A" "r.(?)" "p.(Ala594Thr)" "" "0000528906" "00005898" "50" "1412" "0" "1412" "0" "c.1412A>G" "r.(?)" "p.(Tyr471Cys)" "" "0000528907" "00005898" "30" "1171" "0" "1173" "0" "c.1171_1173del" "r.(?)" "p.(Glu391del)" "" "0000528909" "00005898" "30" "687" "0" "687" "0" "c.687G>A" "r.(?)" "p.(Thr229=)" "" "0000610357" "00005898" "30" "4888" "0" "4888" "0" "c.4888G>A" "r.(?)" "p.(Gly1630Ser)" "" "0000610358" "00005898" "30" "4762" "0" "4762" "0" "c.4762C>A" "r.(?)" "p.(Leu1588Ile)" "" "0000610359" "00005898" "30" "3273" "0" "3273" "0" "c.3273G>A" "r.(?)" "p.(Ser1091=)" "" "0000610360" "00005898" "50" "2957" "0" "2957" "0" "c.2957G>A" "r.(?)" "p.(Arg986His)" "" "0000610361" "00005898" "30" "-787" "0" "-787" "0" "c.-787C>G" "r.(?)" "p.(=)" "" "0000651968" "00005898" "50" "4762" "0" "4762" "0" "c.4762C>A" "r.(?)" "p.(Leu1588Ile)" "" "0000651969" "00005898" "50" "4463" "0" "4463" "0" "c.4463T>C" "r.(?)" "p.(Leu1488Pro)" "" "0000651970" "00005898" "50" "3490" "0" "3490" "0" "c.3490C>T" "r.(?)" "p.(Arg1164Trp)" "" "0000651971" "00005898" "50" "1542" "0" "1542" "0" "c.1542G>T" "r.(?)" "p.(Gln514His)" "" "0000651972" "00005898" "50" "533" "0" "533" "0" "c.533G>T" "r.(?)" "p.(Arg178Leu)" "" "0000651973" "00005898" "50" "136" "0" "136" "0" "c.136C>T" "r.(?)" "p.(Arg46Trp)" "" "0000677782" "00005898" "30" "2555" "0" "2555" "0" "c.2555G>A" "r.(?)" "p.(Arg852Gln)" "" "0000689741" "00005898" "30" "5072" "0" "5072" "0" "c.5072C>T" "r.(?)" "p.(Thr1691Ile)" "" "0000689742" "00005898" "30" "3893" "0" "3893" "0" "c.3893A>C" "r.(?)" "p.(Asn1298Thr)" "" "0000689743" "00005898" "50" "580" "5" "580" "5" "c.580+5G>C" "r.spl?" "p.?" "" "0000720946" "00005898" "50" "5054" "0" "5054" "0" "c.5054A>G" "r.(?)" "p.(Tyr1685Cys)" "" "0000720947" "00005898" "50" "4585" "0" "4585" "0" "c.4585G>C" "r.(?)" "p.(Asp1529His)" "" "0000720948" "00005898" "50" "4562" "0" "4562" "0" "c.4562C>G" "r.(?)" "p.(Pro1521Arg)" "" "0000720949" "00005898" "50" "4103" "0" "4103" "0" "c.4103C>T" "r.(?)" "p.(Ala1368Val)" "" "0000720950" "00005898" "90" "3136" "0" "3136" "0" "c.3136del" "r.(?)" "p.(Leu1046Trpfs*95)" "" "0000720951" "00005898" "70" "3041" "0" "3041" "0" "c.3041T>G" "r.(?)" "p.(Leu1014Arg)" "" "0000720952" "00005898" "30" "2260" "0" "2260" "0" "c.2260G>A" "r.(?)" "p.(Ala754Thr)" "" "0000720953" "00005898" "30" "1171" "0" "1173" "0" "c.1171_1173del" "r.(?)" "p.(Glu391del)" "" "0000729892" "00005898" "90" "1144" "0" "1144" "0" "c.1144C>T" "r.(?)" "p.(Arg382*)" "" "0000729893" "00005898" "90" "2863" "-1" "2863" "-1" "c.2863-1G>C" "r.spl?" "p.?" "" "0000729894" "00005898" "90" "2988" "0" "2988" "0" "c.2988G>A" "r.(?)" "p.(Trp996*)" "" "0000729895" "00005898" "90" "263" "0" "263" "0" "c.263del" "r.(?)" "p.(Val88Alafs*27)" "" "0000729896" "00005898" "90" "2863" "-1" "2863" "-1" "c.2863-1G>C" "r.spl?" "p.?" "" "0000760758" "00005898" "70" "1274" "0" "1274" "0" "c.1274G>A" "r.(?)" "p.(Trp425*)" "" "0000760759" "00005898" "70" "3136" "0" "3136" "0" "c.3136del" "r.(?)" "p.(Leu1046Trpfs*95)" "" "0000760766" "00005898" "90" "4451" "0" "4452" "0" "c.4451_4452del" "r.(?)" "p.(Val1484GlyfsTer69)" "24" "0000760767" "00005898" "90" "4451" "0" "4452" "0" "c.4451_4452del" "r.(?)" "p.(Val1484GlyfsTer69)" "24" "0000760768" "00005898" "90" "4451" "0" "4452" "0" "c.4451_4452del" "r.(?)" "p.(Val1484GlyfsTer69)" "24" "0000760769" "00005898" "90" "4451" "0" "4452" "0" "c.4451_4452del" "r.(?)" "p.(Val1484GlyfsTer69)" "24" "0000760770" "00005898" "90" "3136" "0" "3136" "0" "c.3136del" "r.(?)" "p.(Leu1046TrpfsTer95)" "16" "0000760771" "00005898" "90" "1234" "-4" "1235" "0" "c.1234-4_1235del" "r.spl" "p.?" "4i" "0000760772" "00005898" "90" "3970" "0" "3970" "0" "c.3970C>T" "r.(?)" "p.(Gln1324Ter)" "21" "0000760773" "00005898" "90" "3167" "0" "3168" "0" "c.3167_3168delinsGA" "r.(?)" "p.(Ser1056Ter)" "16" "0000760774" "00005898" "90" "2725" "0" "2725" "0" "c.2725G>A" "r.(?)" "p.(Gly909Arg)" "13" "0000760775" "00005898" "90" "4451" "0" "4452" "0" "c.4451_4452del" "r.(?)" "p.(Val1484GlyfsTer69)" "24" "0000760776" "00005898" "90" "2212" "0" "2234" "0" "c.2212_2234del" "r.(?)" "p.(Val738AlafsTer35)" "10" "0000760777" "00005898" "90" "923" "0" "923" "0" "c.923T>G" "r.(?)" "p.(Val308Gly)" "4" "0000760778" "00005898" "90" "4780" "0" "4780" "0" "c.4780dup" "r.(?)" "p.(Glu1594GlyfsTer19)" "26" "0000760779" "00005898" "90" "4333" "0" "4333" "0" "c.4333C>T" "r.(?)" "p.(Arg1445Ter)" "23" "0000760780" "00005898" "90" "4333" "0" "4333" "0" "c.4333C>T" "r.(?)" "p.(Arg1445Ter)" "23" "0000760781" "00005898" "90" "4333" "0" "4333" "0" "c.4333C>T" "r.(?)" "p.(Arg1445Ter)" "23" "0000760782" "00005898" "90" "2706" "0" "2707" "0" "c.2706_2707dup" "r.(?)" "p.(Ala903GlyfsTer22)" "13" "0000760783" "00005898" "90" "3733" "0" "3838" "0" "c.3733_3838del" "r.(?)" "p.(Leu1245SerfsTer29)" "20" "0000760784" "00005898" "90" "1938" "0" "1938" "0" "c.1938dup" "r.(?)" "p.(Thr647AspfsTer33)" "19" "0000760785" "00005898" "90" "3041" "0" "3041" "0" "c.3041T>G" "r.(?)" "p.(Leu1014Arg)" "16" "0000760786" "00005898" "90" "3041" "0" "3041" "0" "c.3041T>G" "r.(?)" "p.(Leu1014Arg)" "16" "0000760787" "00005898" "90" "920" "0" "929" "0" "c.920_929del" "r.(?)" "p.(Leu307ProfsTer29)" "4" "0000760788" "00005898" "90" "2111" "0" "2111" "0" "c.2111G>A" "r.(?)" "p.(Trp704Ter)" "9" "0000760789" "00005898" "90" "4391" "0" "4391" "0" "c.4391A>C" "r.(?)" "p.(His1464Pro)" "23" "0000760790" "00005898" "90" "4391" "0" "4391" "0" "c.4391A>C" "r.(?)" "p.(His1464Pro)" "23" "0000760791" "00005898" "90" "462" "0" "462" "0" "c.462del" "r.(?)" "p.(Gly155GlufsTer16)" "2" "0000760792" "00005898" "90" "3608" "0" "3608" "0" "c.3608dup" "r.(?)" "p.(Ala1204SerfsTer15)" "19" "0000760793" "00005898" "90" "2710" "0" "2710" "0" "c.2710C>T" "r.(?)" "p.(Arg904Ter)" "13" "0000760794" "00005898" "90" "4717" "0" "4717" "0" "c.4717C>T" "r.(?)" "p.(Arg1573Ter)" "25" "0000760795" "00005898" "90" "4342" "0" "4342" "0" "c.4342T>C" "r.(?)" "p.(Trp1448Arg)" "23" "0000760796" "00005898" "90" "4318" "0" "4318" "0" "c.4318C>T" "r.(?)" "p.(Arg1440Ter)" "23" "0000760797" "00005898" "90" "3624" "0" "3639" "0" "c.3624_3639del" "r.(?)" "p.(Phe1210ThrfsTer2)" "19" "0000760798" "00005898" "90" "3041" "0" "3041" "0" "c.3041T>G" "r.(?)" "p.(Leu1014Arg)" "16" "0000760799" "00005898" "90" "3907" "0" "3907" "0" "c.3907C>T" "r.(?)" "p.(Gln1303Ter)" "21" "0000787994" "00005898" "90" "2765" "0" "2765" "0" "c.2765C>A" "r.(?)" "p.(Ser922*)" "" "0000787995" "00005898" "70" "3053" "0" "3053" "0" "c.3053T>C" "r.(?)" "p.(Leu1018Pro)" "" "0000802601" "00005898" "30" "3158" "0" "3158" "0" "c.3158A>G" "r.(?)" "p.(Asn1053Ser)" "" "0000802602" "00005898" "30" "3049" "0" "3049" "0" "c.3049G>A" "r.(?)" "p.(Ala1017Thr)" "" "0000851237" "00005898" "30" "1457" "0" "1457" "0" "c.1457G>A" "r.(?)" "p.(Cys486Tyr)" "" "0000851238" "00005898" "50" "682" "0" "682" "0" "c.682G>C" "r.(?)" "p.(Ala228Pro)" "" "0000860357" "00005898" "30" "533" "0" "533" "0" "c.533G>T" "r.(?)" "p.(Arg178Leu)" "" "0000877161" "00005898" "90" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28Ter)" "" "0000877162" "00005898" "90" "3463" "-1" "3463" "-1" "c.3463-1G>T" "r.(?)" "p.(?)" "" "0000880520" "00005898" "90" "4451" "0" "4452" "0" "c.4451_4452del" "r.(?)" "p.(Val1484GlyfsTer69)" "" "0000887260" "00005898" "50" "3286" "0" "3286" "0" "c.3286C>G" "r.(?)" "p.(Leu1096Val)" "" "0000887261" "00005898" "50" "3254" "0" "3254" "0" "c.3254G>A" "r.(?)" "p.(Arg1085His)" "" "0000887262" "00005898" "50" "136" "0" "136" "0" "c.136C>T" "r.(?)" "p.(Arg46Trp)" "" "0000924512" "00005898" "90" "4318" "0" "4318" "0" "c.4318C>T" "r.(?)" "p.(Arg1440*)" "" "0000924513" "00005898" "50" "3439" "0" "3439" "0" "c.3439T>C" "r.(?)" "p.(Trp1147Arg)" "" "0000924514" "00005898" "50" "314" "0" "314" "0" "c.314C>T" "r.(?)" "p.(Ser105Phe)" "" "0000924515" "00005898" "30" "-2350" "0" "-2350" "0" "c.-2350G>T" "r.(?)" "p.(=)" "" "0000929195" "00005898" "50" "2132" "0" "2132" "0" "c.2132G>T" "r.(?)" "p.(Cys711Phe)" "" "0000931619" "00005898" "70" "3523" "0" "3523" "0" "c.3523C>T" "r.(?)" "p.(His1175Tyr)" "19" "0000964152" "00005898" "50" "1073" "0" "1073" "0" "c.1073G>A" "r.(?)" "p.(Arg358His)" "" "0000977256" "00005898" "50" "4972" "0" "4972" "0" "c.4972G>A" "r.(?)" "p.(Glu1658Lys)" "" "0000977257" "00005898" "30" "2754" "0" "2754" "0" "c.2754G>A" "r.(?)" "p.(=)" "" "0000977258" "00005898" "30" "2614" "0" "2614" "0" "c.2614G>A" "r.(?)" "p.(Gly872Ser)" "" "0000977259" "00005898" "50" "2318" "0" "2318" "0" "c.2318G>A" "r.(?)" "p.(Arg773Gln)" "" "0000977260" "00005898" "50" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Gly194Arg)" "" "0000977261" "00005898" "30" "548" "0" "548" "0" "c.548G>A" "r.(?)" "p.(Arg183Gln)" "" "0000995775" "00005898" "50" "3331" "0" "3331" "0" "c.3331C>T" "r.(?)" "p.(Pro1111Ser)" "" "0001035783" "00005898" "50" "4906" "0" "4906" "0" "c.4906C>T" "r.(?)" "p.(Arg1636Cys)" "" "0001035784" "00005898" "50" "4443" "0" "4443" "0" "c.4443G>A" "r.(?)" "p.(=)" "" "0001035785" "00005898" "50" "4346" "0" "4346" "0" "c.4346C>T" "r.(?)" "p.(Thr1449Met)" "" "0001035786" "00005898" "50" "3922" "0" "3922" "0" "c.3922C>G" "r.(?)" "p.(Leu1308Val)" "" "0001035787" "00005898" "50" "3097" "0" "3097" "0" "c.3097G>A" "r.(?)" "p.(Glu1033Lys)" "" "0001035788" "00005898" "50" "2492" "0" "2492" "0" "c.2492C>T" "r.(?)" "p.(Ser831Phe)" "" "0001035789" "00005898" "30" "2416" "0" "2416" "0" "c.2416G>A" "r.(?)" "p.(Glu806Lys)" "" "0001035790" "00005898" "30" "2398" "-6" "2398" "-6" "c.2398-6C>G" "r.(=)" "p.(=)" "" "0001035791" "00005898" "50" "1183" "0" "1183" "0" "c.1183G>A" "r.(?)" "p.(Gly395Arg)" "" "0001035792" "00005898" "50" "938" "0" "938" "0" "c.938G>T" "r.(?)" "p.(Trp313Leu)" "" "0001035793" "00005898" "50" "935" "0" "935" "0" "c.935G>A" "r.(?)" "p.(Arg312His)" "" "0001035794" "00005898" "30" "581" "-7" "581" "-7" "c.581-7G>A" "r.(=)" "p.(=)" "" "0001035795" "00005898" "50" "205" "0" "205" "0" "c.205A>G" "r.(?)" "p.(Met69Val)" "" "0001045285" "00005898" "90" "1144" "0" "1144" "0" "c.1144C>T" "r.(?)" "p.(Arg382Ter)" "" "0001052358" "00005898" "50" "3376" "0" "3376" "0" "c.3376G>A" "r.(?)" "p.(Asp1126Asn)" "" "0001052359" "00005898" "30" "2169" "8" "2169" "8" "c.2169+8del" "r.(=)" "p.(=)" "" "0001052360" "00005898" "50" "142" "0" "142" "0" "c.142G>C" "r.(?)" "p.(Gly48Arg)" "" "0001052361" "00005898" "50" "-165" "0" "-165" "0" "c.-165G>A" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 54 "{{screeningid}}" "{{variantid}}" "0000003969" "0000022846" "0000209648" "0000439818" "0000209649" "0000439829" "0000295279" "0000651968" "0000295280" "0000651969" "0000295281" "0000651970" "0000295282" "0000651971" "0000295283" "0000651972" "0000295284" "0000651973" "0000332610" "0000729892" "0000332611" "0000729893" "0000332612" "0000729894" "0000332613" "0000729895" "0000332614" "0000729896" "0000360684" "0000760758" "0000360685" "0000760759" "0000360692" "0000760766" "0000360693" "0000760767" "0000360694" "0000760768" "0000360695" "0000760769" "0000360696" "0000760770" "0000360697" "0000760771" "0000360698" "0000760772" "0000360699" "0000760773" "0000360699" "0000760795" "0000360700" "0000760774" "0000360700" "0000760796" "0000360701" "0000760775" "0000360702" "0000760776" "0000360703" "0000760777" "0000360703" "0000760797" "0000360704" "0000760778" "0000360705" "0000760779" "0000360706" "0000760780" "0000360707" "0000760781" "0000360708" "0000760782" "0000360709" "0000760783" "0000360710" "0000760784" "0000360711" "0000760785" "0000360712" "0000760786" "0000360713" "0000760787" "0000360713" "0000760798" "0000360714" "0000760788" "0000360715" "0000760789" "0000360716" "0000760790" "0000360717" "0000760791" "0000360718" "0000760792" "0000360718" "0000760799" "0000360719" "0000760793" "0000360720" "0000760794" "0000376397" "0000787994" "0000376397" "0000787995" "0000436936" "0000931619" "0000467473" "0001045285"