### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = DEAF1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "DEAF1" "DEAF1 transcription factor" "11" "p15.5" "unknown" "NC_000011.9" "UD_132319403192" "" "http://www.LOVD.nl/DEAF1" "" "1" "14677" "10522" "602635" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/DEAF1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2016-06-18 21:02:52" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00006257" "DEAF1" "deformed epidermal autoregulatory factor 1 (Drosophila)" "001" "NM_021008.2" "" "NP_066288.2" "" "" "" "-693" "2023" "1698" "695740" "644225" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00841" "EIEE" "encephalopathy, epileptic, early infantile (EIEE)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2015-02-20 16:58:56" "04442" "VSVS;MRD24" "Vulto-van Silfout-de Vries syndrome (MRD-24)" "AD" "615828" "" "" "" "00000" "2015-09-23 10:25:22" "00006" "2024-02-02 17:37:34" "05342" "CAKUT" "kidney and urinary tract, anomalies, congenital (CAKUT)" "" "" "" "" "" "00006" "2017-11-10 19:49:59" "00006" "2017-11-10 19:51:20" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06116" "NEDHELS;DYSEIDD" "neurodevelopmental disorder with hypotonia, impaired expressive language, and with or without seizures (DYSEIDD)" "AR" "617171" "" "" "" "00006" "2021-12-10 23:20:41" "00006" "2024-02-02 17:36:56" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "DEAF1" "04442" "DEAF1" "06116" ## Individuals ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00016656" "" "" "" "1" "" "00705" "{PMID:Vissers 2010:21076407}, {PMID:Vulto van Silfhout 2014:24726472}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "?" "(Netherlands)" "" "0" "" "" "" "MRtrio5/Pat1" "00016662" "" "" "" "1" "" "00705" "{PMID:Vulto van Silfhout 2014:24726472}" "" "F" "?" "" "" "0" "" "" "Unknown" "" "00081049" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected parents" "" "" "" "" "0" "" "" "" "" "00296791" "" "" "" "1" "" "00006" "{PMID:Redin 2014:25167861}" "2-generation family, affected male, unaffected heterozygous carrier mother" "M" "" "France" "" "0" "" "" "" "APN-109" "00302986" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat31" "00316134" "" "" "" "2" "" "00006" "{PMID:Heidet 2017:28566479}" "affected patient and 1st degree relative (deafness)" "" "" "France" "" "0" "" "" "" "K190" "00359461" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00374710" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1593" "00426118" "" "" "" "1" "" "00006" "{PMID:Al-Kasbi 2022:36344539}" "patient, other affecteds in family" "M" "" "Oman" "" "0" "" "" "" "10DK7400" "00447941" "" "" "" "1" "" "00006" "{PMID:Ostrander 2018:30109124}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "United States" "" "0" "" "" "" "Pat9" "00457922" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 11 "{{individualid}}" "{{diseaseid}}" "00016656" "00139" "00016662" "00139" "00081049" "04442" "00296791" "00139" "00302986" "05521" "00316134" "05342" "00359461" "00198" "00374710" "00198" "00426118" "00139" "00447941" "00841" "00457922" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00841, 04442, 05342, 05521, 05611, 06116 ## Count = 10 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000015219" "00139" "00016656" "00705" "Unknown" "09y" "mild motor delay, no speech, severe ID, poor eyecontact, behavioral problems, autism, mood swings, fascinations, high pain threshold, abnormal walking pattern, thin and fair hair, straight eyebrows, full nasal tip, full lower lip, prominent chin, upslant, epicantic folds, fetal finger pads, Skin syndactyly in toes 2 and 3, Hyperlaxity, Recurrent infections in childhood, scrotal raphe, flat feet" "" "" "" "" "" "" "" "" "" "" "" "" "0000060618" "04442" "00081049" "01758" "Familial, autosomal recessive" "" "Mental retardation, autosomal dominant 24 (OMIM:615828)" "" "" "" "" "" "" "" "" "" "" "" "" "0000224190" "00139" "00296791" "00006" "Unknown" "" "severe intellectual disability, developmental delay, poor speech, pain resistance, dysmorphic features, aggressive behaviour" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000230069" "05521" "00302986" "00006" "Familial, autosomal recessive" "" "Focal epilepsy, unclassified; age onset adolescent" "" "" "" "" "" "" "" "" "" "MRD24" "seizures" "" "0000239881" "05342" "00316134" "00006" "Unknown" "" "renal hypoplasia; renal dysplasia; cysts" "" "" "" "" "" "" "" "" "" "" "renal hypoplasia" "" "0000254703" "00198" "00359461" "01807" "Unknown" "" "Microcephaly (HP:0000252); Hearing abnormality (HP:0000364); Hearing impairment (HP:0000365); Strabismus (HP:0000486); Behavioral abnormality (HP:0000708); Intellectual disability (HP:0001249); Absent speech (HP:0001344); Ventricular septal defect (HP:0001629); Sleep disturbance (HP:0002360); Intellectual disability, severe (HP:0010864); Cerebral palsy (HP:0100021); Talipes (HP:0001883)" "" "" "" "" "" "" "" "" "" "" "" "" "0000269920" "00198" "00374710" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000317268" "00139" "00426118" "00006" "Familial, autosomal recessive" "5y" "" "" "" "" "" "" "" "" "" "" "Neurodevelopmental disorder with hypotonia, impaired expressive language, and with or without seizures" "intellectual disability" "" "0000337134" "00841" "00447941" "00006" "Isolated (sporadic)" "" "see paper; ..., postnatal microcephaly, hypotonia, global developmental delay, polymyoclonus; seizure types myoclonic, atonic, myoclonic, partial seizures, generalized tonic clonic, atypical absence; EEG 1-2hz delta, generalized spike wave; MRI brain delayed myelination" "6m" "" "" "" "" "" "" "" "" "VSVS" "early infantile epileptic encephalopathy" "" "0000346372" "05611" "00457922" "03544" "Isolated (sporadic)" "" "HP:0001263, HP:0001250" "" "" "" "" "" "" "" "" "" "VSVS" "complex neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000016619" "00016656" "1" "00705" "00705" "2014-05-26 14:45:06" "00705" "2014-05-26 16:29:46" "SEQ" "DNA" "" "" "0000016623" "00016662" "1" "00705" "00705" "2014-05-26 16:48:32" "" "" "SEQ" "DNA" "" "" "0000081161" "00081049" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000297901" "00296791" "1" "00006" "00006" "2020-04-13 16:02:07" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000304111" "00302986" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000317316" "00316134" "1" "00006" "00006" "2020-11-02 19:29:22" "" "" "SEQ;SEQ-NG" "DNA" "" "330-gene panel" "0000360691" "00359461" "1" "01807" "01807" "2021-03-22 12:34:01" "" "" "SEQ" "DNA" "" "" "0000375904" "00374710" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000427438" "00426118" "1" "00006" "00006" "2022-11-28 11:02:11" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000449512" "00447941" "1" "00006" "00006" "2024-02-02 18:50:24" "" "" "arrayCGH;SEQ;SEQ-NG" "DNA" "" "WGS" "0000459542" "00457922" "1" "03544" "03544" "2024-11-21 13:49:54" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "CES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 10 "{{screeningid}}" "{{geneid}}" "0000016619" "DEAF1" "0000016623" "DEAF1" "0000081161" "DEAF1" "0000297901" "DEAF1" "0000304111" "DEAF1" "0000317316" "DEAF1" "0000317316" "GRHL2" "0000317316" "NOTCH2" "0000317316" "PAXIP1" "0000375904" "DEAF1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 144 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000036487" "0" "77" "11" "686979" "686979" "subst" "0" "00705" "DEAF1_000001" "g.686979A>C" "" "{PMID:Vissers 2010:21076407}, {PMID:Vulto-van Silfhout 2014:24726472}" "" "" "" "De novo" "?" "" "0" "" "" "g.686979A>C" "" "likely pathogenic (dominant)" "" "0000036493" "0" "75" "11" "686900" "686900" "subst" "0" "00705" "DEAF1_000004" "g.686900T>G" "1/2300 cases" "{PMID:Vulto-van Silfhout 2014:24726472}" "" "" "" "De novo" "?" "" "0" "" "" "g.686900T>G" "" "likely pathogenic" "" "0000130247" "3" "90" "11" "680959" "680959" "del" "0" "01758" "DEAF1_000005" "g.680959T>G" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.680959T>G" "" "pathogenic" "ACMG" "0000253665" "0" "10" "11" "640109" "640109" "subst" "0.00175458" "01943" "DRD4_000029" "g.640109A>C" "" "" "" "DRD4(NM_000797.3):c.860A>C (p.Q287P), DRD4(NM_000797.3):c.860delinsC (p.(Gln287Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640109A>C" "" "benign" "" "0000270691" "0" "90" "11" "686992" "686992" "subst" "0" "02326" "DEAF1_000012" "g.686992G>A" "" "" "" "DEAF1(NM_021008.3):c.670C>T (p.R224W), DEAF1(NM_021008.4):c.670C>T (p.R224W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.686992G>A" "" "pathogenic" "" "0000274928" "0" "30" "11" "678763" "678763" "subst" "0.000747172" "01943" "DEAF1_000010" "g.678763C>T" "" "" "" "DEAF1(NM_021008.3):c.1186G>A (p.G396S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.678763C>T" "" "likely benign" "" "0000274929" "0" "10" "11" "644614" "644614" "subst" "0.00653977" "01943" "DEAF1_000008" "g.644614G>C" "" "" "" "DEAF1(NM_021008.2):c.1634C>G (p.(Ala545Gly)), DEAF1(NM_021008.3):c.1634C>G (p.A545G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.644614G>C" "" "benign" "" "0000275514" "0" "50" "11" "640265" "640265" "subst" "0.00150339" "01943" "DRD4_000034" "g.640265G>A" "" "" "" "DRD4(NM_000797.3):c.1016G>A (p.G339D, p.(Gly339Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640265G>A" "" "VUS" "" "0000275519" "0" "30" "11" "640051" "640051" "subst" "0.0316973" "01943" "DRD4_000021" "g.640051G>T" "" "" "" "DRD4(NM_000797.3):c.802G>T (p.G268C, p.(Gly268Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640051G>T" "" "likely benign" "" "0000275520" "0" "30" "11" "640065" "640065" "subst" "0.00694444" "01943" "DRD4_000023" "g.640065T>C" "" "" "" "DRD4(NM_000797.3):c.816T>C (p.G272=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640065T>C" "" "likely benign" "" "0000275521" "0" "30" "11" "640071" "640071" "subst" "0.00296736" "01943" "DRD4_000024" "g.640071C>T" "" "" "" "DRD4(NM_000797.3):c.822C>T (p.C274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640071C>T" "" "likely benign" "" "0000275522" "0" "30" "11" "640138" "640138" "subst" "0.000782838" "01943" "DRD4_000031" "g.640138C>G" "" "" "" "DRD4(NM_000797.3):c.889C>G (p.P297A, p.(Pro297Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640138C>G" "" "likely benign" "" "0000321853" "0" "50" "11" "639661" "639666" "dup" "0" "01804" "DRD4_000015" "g.639661_639666dup" "" "" "" "DRD4(NM_000797.3):c.401_402insCGTGGC (p.(Phe134_Val135insValAla))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.639661_639666dup" "" "VUS" "" "0000321854" "0" "50" "11" "639661" "639666" "del" "0" "01804" "DRD4_000016" "g.639661_639666del" "" "" "" "DRD4(NM_000797.3):c.402_407del (p.(Ala136_Val137del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.639661_639666del" "" "VUS" "" "0000321856" "0" "30" "11" "639943" "639943" "subst" "0.000112554" "01804" "DRD4_000018" "g.639943G>A" "" "" "" "DRD4(NM_000797.3):c.694G>A (p.(Gly232Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.639943G>A" "" "likely benign" "" "0000321857" "0" "50" "11" "640003" "640003" "subst" "0.000199203" "01804" "DRD4_000019" "g.640003C>T" "" "" "" "DRD4(NM_000797.3):c.754C>T (p.(Arg252Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640003C>T" "" "VUS" "" "0000321858" "0" "30" "11" "640056" "640151" "del" "0" "01804" "DRD4_000020" "g.640056_640151del" "" "" "" "DRD4(NM_000797.3):c.755_850del (p.(Pro254_Leu285del)), DRD4(NM_000797.3):c.807_902del (p.R271_P302del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640056_640151del" "" "likely benign" "" "0000321859" "0" "50" "11" "640061" "640108" "del" "0" "01804" "DRD4_000022" "g.640061_640108del" "" "" "" "DRD4(NM_000797.3):c.808_855del (p.(Arg271_Pro286del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640061_640108del" "" "VUS" "" "0000321860" "0" "50" "11" "640071" "640080" "del" "0.023338" "01804" "DRD4_000025" "g.640071_640080del" "" "" "" "DRD4(NM_000797.3):c.822_831del (p.(Gly275ValfsTer68))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640071_640080del" "" "VUS" "" "0000321861" "0" "50" "11" "640083" "640120" "del" "0" "01804" "DRD4_000026" "g.640083_640120del" "" "" "" "DRD4(NM_000797.3):c.833_870del (p.(Cys278TrpfsTer159))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640083_640120del" "" "VUS" "" "0000321862" "0" "50" "11" "640090" "640090" "subst" "0.034127" "01804" "DRD4_000027" "g.640090G>C" "" "" "" "DRD4(NM_000797.3):c.841G>C (p.(Ala281Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640090G>C" "" "VUS" "" "0000321863" "0" "30" "11" "640099" "640146" "del" "0" "01804" "DRD4_000028" "g.640099_640146del" "" "" "" "DRD4(NM_000797.3):c.850_897del (p.(Ser284_Pro299del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640099_640146del" "" "likely benign" "" "0000321864" "0" "30" "11" "640109" "640109" "subst" "0.00175458" "01804" "DRD4_000029" "g.640109A>C" "" "" "" "DRD4(NM_000797.3):c.860A>C (p.Q287P), DRD4(NM_000797.3):c.860delinsC (p.(Gln287Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640109A>C" "" "likely benign" "" "0000321865" "0" "50" "11" "640134" "640181" "del" "0" "01804" "DRD4_000030" "g.640134_640181del" "" "" "" "DRD4(NM_000797.3):c.878_925del (p.(Ala295_Cys310del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640134_640181del" "" "VUS" "" "0000321866" "0" "30" "11" "640138" "640138" "subst" "0.000782838" "01804" "DRD4_000031" "g.640138C>G" "" "" "" "DRD4(NM_000797.3):c.889C>G (p.P297A, p.(Pro297Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640138C>G" "" "likely benign" "" "0000321867" "0" "50" "11" "640157" "640157" "subst" "0.000940318" "01804" "DRD4_000032" "g.640157C>A" "" "" "" "DRD4(NM_000797.3):c.908C>A (p.(Pro303Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640157C>A" "" "VUS" "" "0000321868" "0" "50" "11" "640187" "640187" "subst" "0.00412474" "01804" "DRD4_000033" "g.640187C>G" "" "" "" "DRD4(NM_000797.3):c.938C>G (p.(Pro313Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640187C>G" "" "VUS" "" "0000321870" "0" "30" "11" "640265" "640265" "subst" "0.00150339" "01804" "DRD4_000034" "g.640265G>A" "" "" "" "DRD4(NM_000797.3):c.1016G>A (p.G339D, p.(Gly339Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640265G>A" "" "likely benign" "" "0000321871" "0" "50" "11" "640502" "640502" "subst" "0.00104061" "01804" "DRD4_000035" "g.640502T>G" "" "" "" "DRD4(NM_000797.3):c.1159T>G (p.(Trp387Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.640502T>G" "" "VUS" "" "0000321874" "0" "50" "11" "644590" "644590" "subst" "0" "01804" "DEAF1_000007" "g.644590A>C" "" "" "" "DEAF1(NM_021008.2):c.1658T>G (p.(Val553Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.644590A>C" "" "VUS" "" "0000321875" "0" "30" "11" "644614" "644614" "subst" "0.00653977" "01804" "DEAF1_000008" "g.644614G>C" "" "" "" "DEAF1(NM_021008.2):c.1634C>G (p.(Ala545Gly)), DEAF1(NM_021008.3):c.1634C>G (p.A545G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.644614G>C" "" "likely benign" "" "0000321877" "0" "50" "11" "678798" "678798" "subst" "0.000109647" "01804" "DEAF1_000011" "g.678798G>A" "" "" "" "DEAF1(NM_021008.2):c.1151C>T (p.(Pro384Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.678798G>A" "" "VUS" "" "0000321878" "0" "50" "11" "687977" "687977" "subst" "1.62497E-5" "01804" "DEAF1_000013" "g.687977C>T" "" "" "" "DEAF1(NM_021008.2):c.598G>A (p.(Asp200Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.687977C>T" "" "VUS" "" "0000321880" "0" "50" "11" "694961" "694966" "del" "0" "01804" "DEAF1_000015" "g.694961_694966del" "" "" "" "DEAF1(NM_021008.2):c.93_98del (p.(Ala32_Ala33del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.694961_694966del" "" "VUS" "" "0000321882" "0" "50" "11" "695681" "695681" "subst" "0" "01804" "DEAF1_000017" "g.695681G>A" "" "" "" "TMEM80(NM_001042463.1):c.-72G>A (p.(Ala25Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.695681G>A" "" "VUS" "" "0000321884" "0" "50" "11" "695835" "695835" "subst" "0.00393701" "01804" "TMEM80_000002" "g.695835C>T" "" "" "" "TMEM80(NM_001042463.1):c.83C>T (p.(Ala76Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.695835C>T" "" "VUS" "" "0000321887" "0" "50" "11" "695853" "695853" "subst" "0" "01804" "TMEM80_000003" "g.695853T>C" "" "" "" "TMEM80(NM_001042463.1):c.94+7T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.695853T>C" "" "VUS" "" "0000342306" "0" "90" "11" "686992" "686992" "subst" "0" "02327" "DEAF1_000012" "g.686992G>A" "" "" "" "DEAF1(NM_021008.3):c.670C>T (p.R224W), DEAF1(NM_021008.4):c.670C>T (p.R224W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.686992G>A" "" "pathogenic" "" "0000345879" "0" "30" "11" "686995" "686995" "subst" "8.12883E-6" "02327" "DEAF1_000018" "g.686995C>T" "" "" "" "DEAF1(NM_021008.4):c.667G>A (p.(Gly223Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.686995C>T" "" "likely benign" "" "0000544820" "0" "30" "11" "640051" "640051" "subst" "0.0316973" "01804" "DRD4_000021" "g.640051G>T" "" "" "" "DRD4(NM_000797.3):c.802G>T (p.G268C, p.(Gly268Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640051G>T" "" "likely benign" "" "0000544821" "0" "30" "11" "640061" "640061" "subst" "0.00608273" "01804" "DEAF1_000023" "g.640061G>A" "" "" "" "DRD4(NM_000797.3):c.812G>A (p.(Arg271Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640061G>A" "" "likely benign" "" "0000544822" "0" "50" "11" "640061" "640061" "subst" "0" "01804" "DEAF1_000024" "g.640061G>C" "" "" "" "DRD4(NM_000797.3):c.812G>C (p.(Arg271Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640061G>C" "" "VUS" "" "0000544823" "0" "30" "11" "640064" "640064" "subst" "0.00659631" "01804" "DEAF1_000025" "g.640064G>A" "" "" "" "DRD4(NM_000797.3):c.815G>A (p.(Gly272Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640064G>A" "" "likely benign" "" "0000544824" "0" "50" "11" "640090" "640137" "del" "0.0152778" "01804" "DEAF1_000026" "g.640090_640137del" "" "" "" "DRD4(NM_000797.3):c.817_864del (p.(Cys274_Pro289del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640090_640137del" "" "VUS" "" "0000544825" "0" "30" "11" "640099" "640099" "subst" "0" "01804" "DEAF1_000027" "g.640099A>C" "" "" "" "DRD4(NM_000797.3):c.850A>C (p.(Ser284Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640099A>C" "" "likely benign" "" "0000544830" "0" "30" "11" "640174" "640174" "subst" "0.00060594" "01804" "DEAF1_000032" "g.640174A>G" "" "" "" "DRD4(NM_000797.3):c.925A>G (p.(Asn309Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640174A>G" "" "likely benign" "" "0000544832" "0" "10" "11" "640253" "640253" "subst" "0.00260333" "01943" "DEAF1_000034" "g.640253C>G" "" "" "" "DRD4(NM_000797.3):c.1004C>G (p.A335G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640253C>G" "" "benign" "" "0000545396" "0" "50" "11" "674682" "674682" "subst" "4.06197E-6" "01943" "DEAF1_000036" "g.674682A>C" "" "" "" "DEAF1(NM_021008.3):c.1357T>G (p.W453G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.674682A>C" "" "VUS" "" "0000545538" "0" "70" "11" "686866" "686866" "subst" "0" "02327" "DEAF1_000038" "g.686866G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.686866G>A" "" "likely pathogenic" "" "0000545539" "0" "70" "11" "686895" "686895" "subst" "0" "01804" "DEAF1_000039" "g.686895A>C" "" "" "" "DEAF1(NM_021008.2):c.767T>G (p.(Ile256Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.686895A>C" "" "likely pathogenic" "" "0000545540" "0" "30" "11" "686935" "686935" "subst" "0.00279559" "01943" "DEAF1_000040" "g.686935T>C" "" "" "" "DEAF1(NM_001367390.1):c.1A>G (p.M1?), DEAF1(NM_021008.3):c.727A>G (p.M243V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.686935T>C" "" "likely benign" "" "0000545544" "0" "70" "11" "686982" "686982" "subst" "0" "02327" "DEAF1_000041" "g.686982C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.686982C>T" "" "likely pathogenic" "" "0000545566" "0" "50" "11" "688052" "688052" "subst" "8.12962E-6" "01943" "DEAF1_000043" "g.688052G>C" "" "" "" "DEAF1(NM_021008.3):c.523C>G (p.Q175E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.688052G>C" "" "VUS" "" "0000545567" "0" "30" "11" "688324" "688324" "subst" "5.30391E-5" "01943" "DEAF1_000044" "g.688324G>A" "" "" "" "DEAF1(NM_021008.3):c.517+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.688324G>A" "" "likely benign" "" "0000545569" "0" "50" "11" "694759" "694759" "subst" "0" "01943" "DEAF1_000045" "g.694759C>T" "" "" "" "DEAF1(NM_021008.3):c.289G>A (p.E97K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694759C>T" "" "VUS" "" "0000545570" "0" "50" "11" "694771" "694771" "subst" "0" "01804" "DEAF1_000046" "g.694771C>T" "" "" "" "DEAF1(NM_021008.2):c.277G>A (p.(Ala93Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694771C>T" "" "VUS" "" "0000545571" "0" "50" "11" "694797" "694797" "subst" "1.99045E-5" "01943" "DEAF1_000047" "g.694797G>C" "" "" "" "DEAF1(NM_021008.2):c.251C>G (p.(Pro84Arg)), DEAF1(NM_021008.3):c.251C>G (p.P84R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694797G>C" "" "VUS" "" "0000545572" "0" "30" "11" "694961" "694999" "del" "0" "01804" "DEAF1_000048" "g.694961_694999del" "" "" "" "DEAF1(NM_021008.2):c.54_92del (p.(Val19_Ala31del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694961_694999del" "" "likely benign" "" "0000545573" "0" "30" "11" "694968" "694991" "del" "0" "01804" "DEAF1_000049" "g.694968_694991del" "" "" "" "DEAF1(NM_021008.2):c.72_95del (p.(Val25_Ala32del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694968_694991del" "" "likely benign" "" "0000545613" "0" "30" "11" "709463" "709463" "dup" "0" "01943" "DEAF1_000054" "g.709463dup" "" "" "" "EPS8L2(NM_022772.3):c.44+12dupC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.709463dup" "" "likely benign" "" "0000545614" "0" "30" "11" "709549" "709549" "subst" "8.21099E-6" "01943" "DEAF1_000055" "g.709549G>T" "" "" "" "EPS8L2(NM_022772.3):c.45-4G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.709549G>T" "" "likely benign" "" "0000613510" "0" "30" "11" "640044" "640044" "subst" "0" "01943" "DEAF1_000056" "g.640044C>T" "" "" "" "DRD4(NM_000797.3):c.795C>T (p.P265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640044C>T" "" "likely benign" "" "0000613511" "0" "30" "11" "640075" "640075" "subst" "0" "01943" "DRD4_000038" "g.640075C>T" "" "" "" "DRD4(NM_000797.3):c.826C>T (p.P276S, p.(Pro276Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640075C>T" "" "likely benign" "" "0000613512" "0" "50" "11" "640075" "640075" "subst" "0" "01804" "DRD4_000038" "g.640075C>T" "" "" "" "DRD4(NM_000797.3):c.826C>T (p.P276S, p.(Pro276Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640075C>T" "" "VUS" "" "0000613513" "0" "30" "11" "640078" "640078" "subst" "0" "01943" "DRD4_000037" "g.640078G>A" "" "" "" "DRD4(NM_000797.3):c.829G>A (p.D277N, p.(Asp277Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640078G>A" "" "likely benign" "" "0000613514" "0" "50" "11" "640078" "640078" "subst" "0" "01804" "DRD4_000037" "g.640078G>A" "" "" "" "DRD4(NM_000797.3):c.829G>A (p.D277N, p.(Asp277Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.640078G>A" "" "VUS" "" "0000613557" "0" "50" "11" "654008" "654008" "subst" "0" "02327" "DEAF1_000057" "g.654008G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.654008G>T" "" "VUS" "" "0000613637" "0" "50" "11" "679706" "679706" "subst" "8.16167E-5" "01943" "DEAF1_000058" "g.679706C>T" "" "" "" "DEAF1(NM_021008.3):c.1108G>A (p.V370I), DEAF1(NM_021008.4):c.1108G>A (p.(Val370Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.679706C>T" "" "VUS" "" "0000613671" "0" "90" "11" "687929" "687929" "subst" "0" "02327" "DEAF1_000060" "g.687929T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.687929T>C" "" "pathogenic" "" "0000613672" "0" "30" "11" "694961" "694990" "del" "0" "02325" "DEAF1_000062" "g.694961_694990del" "" "" "" "DEAF1(NM_021008.4):c.69_98delCGCTGTGGCGGCGGCGGCCGCGGCCGCGGC (p.A24_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694961_694990del" "" "likely benign" "" "0000613673" "0" "50" "11" "695724" "695724" "subst" "0" "02325" "DEAF1_000063" "g.695724G>C" "" "" "" "DEAF1(NM_021008.4):c.-677C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.695724G>C" "" "VUS" "" "0000622707" "0" "50" "11" "679807" "679807" "subst" "0" "01943" "DEAF1_000059" "g.679807G>T" "" "" "" "DEAF1(NM_021008.3):c.1007C>A (p.T336N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.679807G>T" "" "VUS" "" "0000622714" "0" "50" "11" "688376" "688376" "subst" "0.000166774" "02325" "DEAF1_000061" "g.688376C>T" "" "" "" "DEAF1(NM_021008.4):c.472G>A (p.V158M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.688376C>T" "" "VUS" "" "0000656897" "0" "70" "11" "686881" "686881" "subst" "4.06501E-6" "02327" "DEAF1_000064" "g.686881G>A" "" "" "" "DEAF1(NM_021008.2):c.781C>T (p.(Arg261*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.686881G>A" "" "likely pathogenic" "" "0000656904" "0" "70" "11" "709610" "709610" "subst" "0" "02327" "DEAF1_000065" "g.709610T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.709610T>G" "" "likely pathogenic" "" "0000660604" "21" "70" "11" "691601" "691601" "subst" "0" "00006" "DEAF1_000066" "g.691601G>C" "" "{PMID:Redin 2014:25167861}" "" "" "rna effect from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.691601G>C" "" "VUS" "" "0000667509" "3" "70" "11" "686986" "686986" "subst" "4.06395E-6" "00006" "DEAF1_000067" "g.686986G>A" "" "{PMID:Helbig 2016:26795593}" "" "" "" "Germline" "" "" "0" "" "" "g.686986G>A" "" "likely pathogenic (recessive)" "ACMG" "0000679318" "0" "30" "11" "694961" "695002" "del" "0" "02325" "DEAF1_000068" "g.694961_695002del" "" "" "" "DEAF1(NM_021008.4):c.51_92del (p.V19_A32del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679319" "0" "50" "11" "694965" "694991" "del" "0" "02325" "DEAF1_000016" "g.694965_694991del" "" "" "" "DEAF1(NM_021008.4):c.60_86delGGCCGCGGCCGCTGTGGCGGCGGCGGC (p.V25_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691167" "0" "50" "11" "686873" "686873" "subst" "0" "02327" "DEAF1_000069" "g.686873C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691168" "0" "90" "11" "686900" "686900" "subst" "0" "02327" "DEAF1_000004" "g.686900T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000691175" "0" "30" "11" "694959" "695003" "del" "0" "02325" "DEAF1_000070" "g.694959_695003del" "" "" "" "DEAF1(NM_021008.4):c.48_92del (p.V19_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000699934" "0" "70" "11" "0" "0" "" "0" "00006" "DRD4_000002" "g.?" "" "{PMID:Heidet 2017:28566479}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000723680" "0" "50" "11" "686935" "686935" "subst" "0.00279559" "02329" "DEAF1_000040" "g.686935T>C" "" "" "" "DEAF1(NM_001367390.1):c.1A>G (p.M1?), DEAF1(NM_021008.3):c.727A>G (p.M243V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000723681" "0" "70" "11" "686960" "686960" "subst" "0" "02329" "DEAF1_000071" "g.686960C>T" "" "" "" "DEAF1(NM_021008.4):c.702G>A (p.W234*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000723688" "0" "30" "11" "694949" "694978" "del" "0" "02325" "DEAF1_000072" "g.694949_694978del" "" "" "" "DEAF1(NM_021008.4):c.71_100delCTGTGGCGGCGGCGGCCGCGGCCGCGGCAG (p.A24_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000760765" "3" "90" "11" "687996" "687997" "ins" "0" "01807" "DEAF1_000073" "g.687996_687997insTTTT" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000787255" "0" "50" "11" "678762" "678762" "subst" "0" "00006" "DEAF1_000074" "g.678762C>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.678762C>A" "" "VUS" "" "0000805242" "0" "10" "11" "640056" "640151" "del" "0" "01943" "DRD4_000001" "g.640056_640151del" "" "" "" "DRD4(NM_000797.3):c.755_850del (p.(Pro254_Leu285del)), DRD4(NM_000797.3):c.807_902del (p.R271_P302del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000805350" "0" "70" "11" "679687" "679687" "subst" "0" "01943" "DEAF1_000075" "g.679687C>T" "" "" "" "DEAF1(NM_021008.3):c.1126+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000805368" "0" "70" "11" "684913" "684913" "subst" "0.00081159" "01943" "DEAF1_000076" "g.684913G>A" "" "" "" "DEAF1(NM_001293634.1):c.715C>T (p.R239*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000805374" "0" "50" "11" "694974" "694974" "subst" "0" "02326" "DEAF1_000077" "g.694974A>C" "" "" "" "DEAF1(NM_021008.3):c.74T>G (p.V25G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853070" "0" "30" "11" "640098" "640098" "subst" "0" "01943" "DEAF1_000079" "g.640098C>A" "" "" "" "DRD4(NM_000797.3):c.849C>A (p.P283=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862619" "0" "90" "11" "640059" "640072" "del" "0" "01943" "DEAF1_000078" "g.640059_640072del" "" "" "" "DRD4(NM_000797.3):c.810_823delCCGGGGTCCCTGCG (p.R271Pfs*174)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000862667" "0" "50" "11" "679763" "679763" "subst" "1.22097E-5" "02327" "DEAF1_000080" "g.679763G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890043" "0" "50" "11" "644597" "644597" "subst" "0" "02325" "DEAF1_000081" "g.644597C>G" "" "" "" "DEAF1(NM_021008.4):c.1651G>C (p.D551H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890075" "0" "50" "11" "654020" "654020" "subst" "4.06686E-6" "02327" "DEAF1_000082" "g.654020A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890127" "0" "50" "11" "680974" "680974" "subst" "8.12203E-6" "02327" "DEAF1_000083" "g.680974G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890153" "0" "90" "11" "686992" "686992" "subst" "0" "02325" "DEAF1_000012" "g.686992G>A" "" "" "" "DEAF1(NM_021008.3):c.670C>T (p.R224W), DEAF1(NM_021008.4):c.670C>T (p.R224W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000904798" "3" "70" "11" "680959" "680959" "subst" "0" "00006" "DEAF1_000005" "g.680959T>G" "" "{PMID:Al-Kasbi 2022:36344539}" "" "" "" "Germline" "" "rs886040972" "0" "" "" "g.680959T>G" "VCV000267316.3" "likely pathogenic (recessive)" "" "0000925458" "0" "50" "11" "639460" "639460" "subst" "4.52919E-6" "02325" "DEAF1_000084" "g.639460C>A" "" "" "" "DRD4(NM_000797.4):c.313C>A (p.P105T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000959730" "0" "90" "11" "687941" "687941" "subst" "0" "00006" "DEAF1_000085" "g.687941C>T" "" "{PMID:Ostrander 2018:30109124}" "" "" "ACMG PS1, PS2, PS3, PM2, PP3, PP2" "De novo" "" "" "0" "" "" "g.687941C>T" "" "pathogenic (dominant)" "ACMG" "0000966552" "0" "30" "11" "694961" "695002" "del" "0" "02329" "DEAF1_000068" "g.694961_695002del" "" "" "" "DEAF1(NM_021008.4):c.51_92del (p.V19_A32del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979752" "0" "30" "11" "654605" "654605" "subst" "0" "01804" "DEAF1_000086" "g.654605C>T" "" "" "" "DEAF1(NM_001293634.1):c.1278+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979787" "0" "30" "11" "666892" "666892" "subst" "0" "01804" "DEAF1_000087" "g.666892A>G" "" "" "" "DEAF1(NM_021008.4):c.1503+7644T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979804" "0" "50" "11" "679706" "679706" "subst" "8.16167E-5" "01804" "DEAF1_000058" "g.679706C>T" "" "" "" "DEAF1(NM_021008.3):c.1108G>A (p.V370I), DEAF1(NM_021008.4):c.1108G>A (p.(Val370Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979805" "0" "50" "11" "679727" "679728" "del" "0" "01804" "DEAF1_000088" "g.679727_679728del" "" "" "" "DEAF1(NM_021008.2):c.1090_1091delAG (p.(Pro365fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979808" "0" "50" "11" "680981" "680981" "subst" "9.33987E-5" "01804" "DEAF1_000089" "g.680981C>T" "" "" "" "DEAF1(NM_021008.4):c.979G>A (p.(Ala327Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979836" "0" "50" "11" "687958" "687958" "subst" "8.12585E-6" "01804" "DEAF1_000090" "g.687958C>T" "" "" "" "DEAF1(NM_021008.4):c.617G>A (p.(Arg206Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979837" "0" "30" "11" "694886" "694886" "subst" "0.00172952" "02326" "DEAF1_000091" "g.694886C>G" "" "" "" "DEAF1(NM_021008.3):c.162G>C (p.S54=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979839" "0" "50" "11" "696721" "696721" "subst" "0" "01804" "DEAF1_000093" "g.696721G>A" "" "" "" "DEAF1(NM_001367390.1):c.-437-5123C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999398" "0" "50" "11" "678754" "678754" "subst" "0" "01804" "DEAF1_000094" "g.678754C>G" "" "" "" "DEAF1(NM_021008.2):c.1195G>C (p.(Asp399His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999402" "0" "50" "11" "681053" "681053" "subst" "0" "01804" "DEAF1_000095" "g.681053G>A" "" "" "" "DEAF1(NM_021008.2):c.907C>T (p.(Arg303Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999420" "0" "70" "11" "684927" "684927" "subst" "0" "01804" "DEAF1_000096" "g.684927A>G" "" "" "" "DEAF1(NM_021008.2):c.841T>C (p.(Cys281Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000999421" "0" "50" "11" "684947" "684947" "subst" "0" "01804" "DEAF1_000097" "g.684947G>A" "" "" "" "DEAF1(NM_021008.2):c.821C>T (p.(Pro274Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999424" "0" "70" "11" "686881" "686881" "subst" "4.06501E-6" "01804" "DEAF1_000064" "g.686881G>A" "" "" "" "DEAF1(NM_021008.2):c.781C>T (p.(Arg261*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000999429" "0" "50" "11" "688450" "688450" "subst" "0" "01804" "DEAF1_000098" "g.688450G>A" "" "" "" "DEAF1(NM_021008.2):c.398C>T (p.(Thr133Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999430" "0" "50" "11" "694797" "694797" "subst" "1.99045E-5" "01804" "DEAF1_000047" "g.694797G>C" "" "" "" "DEAF1(NM_021008.2):c.251C>G (p.(Pro84Arg)), DEAF1(NM_021008.3):c.251C>G (p.P84R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999431" "0" "30" "11" "694895" "694895" "subst" "0" "01804" "DEAF1_000099" "g.694895G>C" "" "" "" "DEAF1(NM_021008.2):c.153C>G (p.(Asp51Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999432" "0" "50" "11" "694914" "694914" "subst" "0" "01804" "DEAF1_000100" "g.694914T>C" "" "" "" "DEAF1(NM_021008.2):c.134A>G (p.(Asp45Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999433" "0" "30" "11" "694992" "694992" "subst" "0" "02326" "DEAF1_000101" "g.694992A>G" "" "" "" "DEAF1(NM_021008.3):c.56T>C (p.V19A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014878" "0" "90" "11" "687941" "687941" "subst" "0" "02329" "DEAF1_000102" "g.687941C>A" "" "" "" "DEAF1(NM_001293634.1):c.634G>T (p.G212C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001017597" "0" "90" "11" "686925" "686925" "subst" "0" "03544" "DEAF1_000103" "g.686925C>G" "" "" "" "" "" "Germline" "yes" "rs1554944271" "0" "" "" "g.686925C>G" "{CV:437396}" "pathogenic" "ACMG" "0001026075" "0" "50" "11" "686956" "686956" "subst" "0" "01943" "DEAF1_000104" "g.686956T>C" "" "" "" "DEAF1(NM_021008.3):c.706A>G (p.S236G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038565" "0" "50" "11" "639519" "639520" "del" "0" "01804" "DEAF1_000105" "g.639519_639520del" "" "" "" "DRD4(NM_000797.4):c.372_373del (p.(Phe124Leufs*325))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038568" "0" "30" "11" "639830" "639830" "subst" "0.00351921" "01804" "DEAF1_000106" "g.639830T>G" "" "" "" "DRD4(NM_000797.4):c.581T>G (p.(Val194Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038571" "0" "30" "11" "640305" "640305" "subst" "0.0034538" "01804" "DEAF1_000107" "g.640305C>G" "" "" "" "DRD4(NM_000797.4):c.1056C>G (p.(Val352=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038670" "0" "30" "11" "674526" "674526" "subst" "4.47125E-5" "01804" "DEAF1_000108" "g.674526C>T" "" "" "" "DEAF1(NM_021008.4):c.1503+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038671" "0" "50" "11" "674588" "674588" "subst" "0" "01804" "DEAF1_000109" "g.674588C>A" "" "" "" "DEAF1(NM_021008.4):c.1451G>T (p.(Arg484Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038684" "0" "30" "11" "680541" "680541" "subst" "0" "01804" "DEAF1_000110" "g.680541C>A" "" "" "" "DEAF1(NM_021008.4):c.997+422G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038715" "0" "90" "11" "686991" "686991" "subst" "4.06468E-6" "02327" "DEAF1_000111" "g.686991C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001038716" "0" "50" "11" "686995" "686995" "subst" "8.12883E-6" "01804" "DEAF1_000018" "g.686995C>T" "" "" "" "DEAF1(NM_021008.4):c.667G>A (p.(Gly223Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038719" "0" "30" "11" "692166" "692166" "subst" "0" "01804" "DEAF1_000112" "g.692166C>T" "" "" "" "DEAF1(NM_021008.4):c.290-568G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038720" "0" "50" "11" "694759" "694762" "del" "0" "01804" "DEAF1_000113" "g.694759_694762del" "" "" "" "DEAF1(NM_021008.4):c.289_289+3del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038721" "0" "50" "11" "694976" "694993" "del" "0" "01804" "DEAF1_000114" "g.694976_694993del" "" "" "" "DEAF1(NM_021008.4):c.63_80del (p.(Val25_Ala30del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046329" "0" "50" "11" "678691" "678691" "subst" "0" "02325" "DEAF1_000115" "g.678691T>C" "" "" "" "DEAF1(NM_021008.4):c.1255+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046331" "0" "30" "11" "686935" "686935" "subst" "0.00279559" "02326" "DEAF1_000040" "g.686935T>C" "" "" "" "DEAF1(NM_001367390.1):c.1A>G (p.M1?), DEAF1(NM_021008.3):c.727A>G (p.M243V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053751" "0" "50" "11" "640003" "640003" "subst" "0.000199203" "01804" "DEAF1_000116" "g.640003C>G" "" "" "" "DRD4(NM_000797.4):c.754C>G (p.(Arg252Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053752" "0" "50" "11" "640109" "640109" "del" "0" "01804" "DRD4_000039" "g.640109del" "" "" "" "DRD4(NM_000797.4):c.860del (p.(Gln287Argfs*59))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053753" "0" "50" "11" "644633" "644633" "subst" "4.11191E-6" "01804" "DEAF1_000117" "g.644633T>C" "" "" "" "DEAF1(NM_021008.4):c.1615A>G (p.(Ile539Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053754" "0" "30" "11" "696692" "696697" "del" "0" "01804" "DEAF1_000118" "g.696692_696697del" "" "" "" "DEAF1(NM_001367390.1):c.-437-5099_-437-5094del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053755" "0" "30" "11" "696698" "696698" "subst" "0" "01804" "DEAF1_000119" "g.696698C>A" "" "" "" "DEAF1(NM_001367390.1):c.-437-5100G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001065377" "0" "10" "11" "640090" "640090" "del" "0" "02325" "DEAF1_000120" "g.640090del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001065378" "0" "50" "11" "654641" "654641" "subst" "0" "01804" "DEAF1_000121" "g.654641G>A" "" "" "" "DEAF1(NM_001293634.1):c.1252C>T (p.(Arg418Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes DEAF1 ## Count = 144 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000036487" "00006257" "70" "683" "0" "683" "0" "c.683T>G" "r.(?)" "p.(Ile228Ser)" "" "0000036493" "00006257" "70" "762" "0" "762" "0" "c.762A>C" "r.(?)" "p.(Arg254Ser)" "" "0000130247" "00006257" "90" "997" "4" "997" "4" "c.997+4A>C" "r.spl" "p.?" "" "0000253665" "00006257" "10" "6139" "0" "6139" "0" "c.*4441T>G" "r.(=)" "p.(=)" "" "0000270691" "00006257" "90" "670" "0" "670" "0" "c.670C>T" "r.(?)" "p.(Arg224Trp)" "" "0000274928" "00006257" "30" "1186" "0" "1186" "0" "c.1186G>A" "r.(?)" "p.(Gly396Ser)" "" "0000274929" "00006257" "10" "1634" "0" "1634" "0" "c.1634C>G" "r.(?)" "p.(Ala545Gly)" "" "0000275514" "00006257" "50" "5983" "0" "5983" "0" "c.*4285C>T" "r.(=)" "p.(=)" "" "0000275519" "00006257" "30" "6197" "0" "6197" "0" "c.*4499C>A" "r.(=)" "p.(=)" "" "0000275520" "00006257" "30" "6183" "0" "6183" "0" "c.*4485A>G" "r.(=)" "p.(=)" "" "0000275521" "00006257" "30" "6177" "0" "6177" "0" "c.*4479G>A" "r.(=)" "p.(=)" "" "0000275522" "00006257" "30" "6110" "0" "6110" "0" "c.*4412G>C" "r.(=)" "p.(=)" "" "0000321853" "00006257" "50" "6592" "0" "6597" "0" "c.*4894_*4899dup" "r.(=)" "p.(=)" "" "0000321854" "00006257" "50" "6592" "0" "6597" "0" "c.*4894_*4899del" "r.(=)" "p.(=)" "" "0000321856" "00006257" "30" "6305" "0" "6305" "0" "c.*4607C>T" "r.(=)" "p.(=)" "" "0000321857" "00006257" "50" "6245" "0" "6245" "0" "c.*4547G>A" "r.(=)" "p.(=)" "" "0000321858" "00006257" "30" "6149" "0" "6244" "0" "c.*4451_*4546del" "r.(=)" "p.(=)" "" "0000321859" "00006257" "50" "6144" "0" "6191" "0" "c.*4446_*4493del" "r.(=)" "p.(=)" "" "0000321860" "00006257" "50" "6168" "0" "6177" "0" "c.*4470_*4479del" "r.(=)" "p.(=)" "" "0000321861" "00006257" "50" "6129" "0" "6166" "0" "c.*4431_*4468del" "r.(=)" "p.(=)" "" "0000321862" "00006257" "50" "6158" "0" "6158" "0" "c.*4460C>G" "r.(=)" "p.(=)" "" "0000321863" "00006257" "30" "6110" "0" "6157" "0" "c.*4412_*4459del" "r.(=)" "p.(=)" "" "0000321864" "00006257" "30" "6139" "0" "6139" "0" "c.*4441T>G" "r.(=)" "p.(=)" "" "0000321865" "00006257" "50" "6074" "0" "6121" "0" "c.*4376_*4423del" "r.(=)" "p.(=)" "" "0000321866" "00006257" "30" "6110" "0" "6110" "0" "c.*4412G>C" "r.(=)" "p.(=)" "" "0000321867" "00006257" "50" "6091" "0" "6091" "0" "c.*4393G>T" "r.(=)" "p.(=)" "" "0000321868" "00006257" "50" "6061" "0" "6061" "0" "c.*4363G>C" "r.(=)" "p.(=)" "" "0000321870" "00006257" "30" "5983" "0" "5983" "0" "c.*4285C>T" "r.(=)" "p.(=)" "" "0000321871" "00006257" "50" "5746" "0" "5746" "0" "c.*4048A>C" "r.(=)" "p.(=)" "" "0000321874" "00006257" "50" "1658" "0" "1658" "0" "c.1658T>G" "r.(?)" "p.(Val553Gly)" "" "0000321875" "00006257" "30" "1634" "0" "1634" "0" "c.1634C>G" "r.(?)" "p.(Ala545Gly)" "" "0000321877" "00006257" "50" "1151" "0" "1151" "0" "c.1151C>T" "r.(?)" "p.(Pro384Leu)" "" "0000321878" "00006257" "50" "598" "0" "598" "0" "c.598G>A" "r.(?)" "p.(Asp200Asn)" "" "0000321880" "00006257" "50" "93" "0" "98" "0" "c.93_98del" "r.(?)" "p.(Ala32_Ala33del)" "" "0000321882" "00006257" "50" "-634" "0" "-634" "0" "c.-634C>T" "r.(?)" "p.(=)" "" "0000321884" "00006257" "50" "-788" "0" "-788" "0" "c.-788G>A" "r.(?)" "p.(=)" "" "0000321887" "00006257" "50" "-806" "0" "-806" "0" "c.-806A>G" "r.(?)" "p.(=)" "" "0000342306" "00006257" "90" "670" "0" "670" "0" "c.670C>T" "r.(?)" "p.(Arg224Trp)" "" "0000345879" "00006257" "30" "667" "0" "667" "0" "c.667G>A" "r.(?)" "p.(Gly223Ser)" "" "0000544820" "00006257" "30" "6197" "0" "6197" "0" "c.*4499C>A" "r.(=)" "p.(=)" "" "0000544821" "00006257" "30" "6187" "0" "6187" "0" "c.*4489C>T" "r.(=)" "p.(=)" "" "0000544822" "00006257" "50" "6187" "0" "6187" "0" "c.*4489C>G" "r.(=)" "p.(=)" "" "0000544823" "00006257" "30" "6184" "0" "6184" "0" "c.*4486C>T" "r.(=)" "p.(=)" "" "0000544824" "00006257" "50" "6135" "0" "6182" "0" "c.*4437_*4484del" "r.(=)" "p.(=)" "" "0000544825" "00006257" "30" "6149" "0" "6149" "0" "c.*4451T>G" "r.(=)" "p.(=)" "" "0000544830" "00006257" "30" "6074" "0" "6074" "0" "c.*4376T>C" "r.(=)" "p.(=)" "" "0000544832" "00006257" "10" "5995" "0" "5995" "0" "c.*4297G>C" "r.(=)" "p.(=)" "" "0000545396" "00006257" "50" "1357" "0" "1357" "0" "c.1357T>G" "r.(?)" "p.(Trp453Gly)" "" "0000545538" "00006257" "70" "796" "0" "796" "0" "c.796C>T" "r.(?)" "p.(Leu266Phe)" "" "0000545539" "00006257" "70" "767" "0" "767" "0" "c.767T>G" "r.(?)" "p.(Ile256Ser)" "" "0000545540" "00006257" "30" "727" "0" "727" "0" "c.727A>G" "r.(?)" "p.(Met243Val)" "" "0000545544" "00006257" "70" "680" "0" "680" "0" "c.680G>A" "r.(?)" "p.(Cys227Tyr)" "" "0000545566" "00006257" "50" "523" "0" "523" "0" "c.523C>G" "r.(?)" "p.(Gln175Glu)" "" "0000545567" "00006257" "30" "517" "7" "517" "7" "c.517+7C>T" "r.(=)" "p.(=)" "" "0000545569" "00006257" "50" "289" "0" "289" "0" "c.289G>A" "r.(?)" "p.(Glu97Lys)" "" "0000545570" "00006257" "50" "277" "0" "277" "0" "c.277G>A" "r.(?)" "p.(Ala93Thr)" "" "0000545571" "00006257" "50" "251" "0" "251" "0" "c.251C>G" "r.(?)" "p.(Pro84Arg)" "" "0000545572" "00006257" "30" "54" "0" "92" "0" "c.54_92del" "r.(?)" "p.(Val19_Ala31del)" "" "0000545573" "00006257" "30" "72" "0" "95" "0" "c.72_95del" "r.(?)" "p.(Val25_Ala32del)" "" "0000545613" "00006257" "30" "-14414" "0" "-14414" "0" "c.-14414dup" "r.(?)" "p.(=)" "" "0000545614" "00006257" "30" "-14502" "0" "-14502" "0" "c.-14502C>A" "r.(?)" "p.(=)" "" "0000613510" "00006257" "30" "6204" "0" "6204" "0" "c.*4506G>A" "r.(=)" "p.(=)" "" "0000613511" "00006257" "30" "6173" "0" "6173" "0" "c.*4475G>A" "r.(=)" "p.(=)" "" "0000613512" "00006257" "50" "6173" "0" "6173" "0" "c.*4475G>A" "r.(=)" "p.(=)" "" "0000613513" "00006257" "30" "6170" "0" "6170" "0" "c.*4472C>T" "r.(=)" "p.(=)" "" "0000613514" "00006257" "50" "6170" "0" "6170" "0" "c.*4472C>T" "r.(=)" "p.(=)" "" "0000613557" "00006257" "50" "1547" "0" "1547" "0" "c.1547C>A" "r.(?)" "p.(Thr516Asn)" "" "0000613637" "00006257" "50" "1108" "0" "1108" "0" "c.1108G>A" "r.(?)" "p.(Val370Ile)" "" "0000613671" "00006257" "90" "646" "0" "646" "0" "c.646A>G" "r.(?)" "p.(Lys216Glu)" "" "0000613672" "00006257" "30" "69" "0" "98" "0" "c.69_98del" "r.(?)" "p.(Ala24_Ala33del)" "" "0000613673" "00006257" "50" "-677" "0" "-677" "0" "c.-677C>G" "r.(?)" "p.(=)" "" "0000622707" "00006257" "50" "1007" "0" "1007" "0" "c.1007C>A" "r.(?)" "p.(Thr336Asn)" "" "0000622714" "00006257" "50" "472" "0" "472" "0" "c.472G>A" "r.(?)" "p.(Val158Met)" "" "0000656897" "00006257" "70" "781" "0" "781" "0" "c.781C>T" "r.(?)" "p.(Arg261Ter)" "" "0000656904" "00006257" "70" "-14563" "0" "-14563" "0" "c.-14563A>C" "r.(?)" "p.(=)" "" "0000660604" "00006257" "70" "290" "-3" "290" "-3" "c.290-3C>G" "r.[(290_387del|0.8,289_290ins[gcuccuucuguug;gag]|0.1,=|0.1)]" "p.?" "" "0000667509" "00006257" "70" "676" "0" "676" "0" "c.676C>T" "r.(?)" "p.(Arg226Trp)" "" "0000679318" "00006257" "30" "51" "0" "92" "0" "c.51_92del" "r.(?)" "p.(Val19_Ala32del)" "" "0000679319" "00006257" "50" "60" "0" "86" "0" "c.60_86del" "r.(?)" "p.(Val25_Ala33del)" "" "0000691167" "00006257" "50" "789" "0" "789" "0" "c.789G>T" "r.(?)" "p.(Leu263Phe)" "" "0000691168" "00006257" "90" "762" "0" "762" "0" "c.762A>C" "r.(?)" "p.(Arg254Ser)" "" "0000691175" "00006257" "30" "48" "0" "92" "0" "c.48_92del" "r.(?)" "p.(Val19_Ala33del)" "" "0000699934" "00006257" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Glu232Glyfs*10)" "" "0000723680" "00006257" "50" "727" "0" "727" "0" "c.727A>G" "r.(?)" "p.(Met243Val)" "" "0000723681" "00006257" "70" "702" "0" "702" "0" "c.702G>A" "r.(?)" "p.(Trp234*)" "" "0000723688" "00006257" "30" "71" "0" "100" "0" "c.71_100del" "r.(?)" "p.(Ala24_Ala33del)" "" "0000760765" "00006257" "90" "578" "0" "579" "0" "c.578_579insAAAA" "r.(?)" "p.(Asn193LysfsTer11)" "" "0000787255" "00006257" "50" "1187" "0" "1187" "0" "c.1187G>T" "r.(?)" "p.(Gly396Val)" "9" "0000805242" "00006257" "10" "6149" "0" "6244" "0" "c.*4451_*4546del" "r.(=)" "p.(=)" "" "0000805350" "00006257" "70" "1126" "1" "1126" "1" "c.1126+1G>A" "r.spl?" "p.?" "" "0000805368" "00006257" "70" "855" "0" "855" "0" "c.855C>T" "r.(?)" "p.(Cys285=)" "" "0000805374" "00006257" "50" "74" "0" "74" "0" "c.74T>G" "r.(?)" "p.(Val25Gly)" "" "0000853070" "00006257" "30" "6150" "0" "6150" "0" "c.*4452G>T" "r.(=)" "p.(=)" "" "0000862619" "00006257" "90" "6176" "0" "6189" "0" "c.*4478_*4491del" "r.(=)" "p.(=)" "" "0000862667" "00006257" "50" "1051" "0" "1051" "0" "c.1051C>T" "r.(?)" "p.(Arg351*)" "" "0000890043" "00006257" "50" "1651" "0" "1651" "0" "c.1651G>C" "r.(?)" "p.(Asp551His)" "" "0000890075" "00006257" "50" "1535" "0" "1535" "0" "c.1535T>C" "r.(?)" "p.(Met512Thr)" "" "0000890127" "00006257" "50" "986" "0" "986" "0" "c.986C>T" "r.(?)" "p.(Ala329Val)" "" "0000890153" "00006257" "90" "670" "0" "670" "0" "c.670C>T" "r.(?)" "p.(Arg224Trp)" "" "0000904798" "00006257" "70" "997" "4" "997" "4" "c.997+4A>C" "r.spl?" "p.?" "" "0000925458" "00006257" "50" "6788" "0" "6788" "0" "c.*5090G>T" "r.(=)" "p.(=)" "" "0000959730" "00006257" "90" "634" "0" "634" "0" "c.634G>A" "r.(?)" "p.(Gly212Ser)" "" "0000966552" "00006257" "30" "51" "0" "92" "0" "c.51_92del" "r.(?)" "p.(Val19_Ala32del)" "" "0000979752" "00006257" "30" "1504" "-554" "1504" "-554" "c.1504-554G>A" "r.(=)" "p.(=)" "" "0000979787" "00006257" "30" "1503" "7644" "1503" "7644" "c.1503+7644T>C" "r.(=)" "p.(=)" "" "0000979804" "00006257" "50" "1108" "0" "1108" "0" "c.1108G>A" "r.(?)" "p.(Val370Ile)" "" "0000979805" "00006257" "50" "1090" "0" "1091" "0" "c.1090_1091del" "r.(?)" "p.(Pro365Glyfs*26)" "" "0000979808" "00006257" "50" "979" "0" "979" "0" "c.979G>A" "r.(?)" "p.(Ala327Thr)" "" "0000979836" "00006257" "50" "617" "0" "617" "0" "c.617G>A" "r.(?)" "p.(Arg206Gln)" "" "0000979837" "00006257" "30" "162" "0" "162" "0" "c.162G>C" "r.(?)" "p.(=)" "" "0000979839" "00006257" "50" "-1674" "0" "-1674" "0" "c.-1674C>T" "r.(?)" "p.(=)" "" "0000999398" "00006257" "50" "1195" "0" "1195" "0" "c.1195G>C" "r.(?)" "p.(Asp399His)" "" "0000999402" "00006257" "50" "907" "0" "907" "0" "c.907C>T" "r.(?)" "p.(Arg303Cys)" "" "0000999420" "00006257" "70" "841" "0" "841" "0" "c.841T>C" "r.(?)" "p.(Cys281Arg)" "" "0000999421" "00006257" "50" "821" "0" "821" "0" "c.821C>T" "r.(?)" "p.(Pro274Leu)" "" "0000999424" "00006257" "70" "781" "0" "781" "0" "c.781C>T" "r.(?)" "p.(Arg261Ter)" "" "0000999429" "00006257" "50" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Thr133Met)" "" "0000999430" "00006257" "50" "251" "0" "251" "0" "c.251C>G" "r.(?)" "p.(Pro84Arg)" "" "0000999431" "00006257" "30" "153" "0" "153" "0" "c.153C>G" "r.(?)" "p.(Asp51Glu)" "" "0000999432" "00006257" "50" "134" "0" "134" "0" "c.134A>G" "r.(?)" "p.(Asp45Gly)" "" "0000999433" "00006257" "30" "56" "0" "56" "0" "c.56T>C" "r.(?)" "p.(Val19Ala)" "" "0001014878" "00006257" "90" "634" "0" "634" "0" "c.634G>T" "r.(?)" "p.(Gly212Cys)" "" "0001017597" "00006257" "90" "737" "0" "737" "0" "c.737G>C" "r.(?)" "p.(Arg246Thr)" "5" "0001026075" "00006257" "50" "706" "0" "706" "0" "c.706A>G" "r.(?)" "p.(Ser236Gly)" "" "0001038565" "00006257" "50" "6728" "0" "6729" "0" "c.*5030_*5031del" "r.(=)" "p.(=)" "" "0001038568" "00006257" "30" "6418" "0" "6418" "0" "c.*4720A>C" "r.(=)" "p.(=)" "" "0001038571" "00006257" "30" "5943" "0" "5943" "0" "c.*4245G>C" "r.(=)" "p.(=)" "" "0001038670" "00006257" "30" "1503" "10" "1503" "10" "c.1503+10G>A" "r.(=)" "p.(=)" "" "0001038671" "00006257" "50" "1451" "0" "1451" "0" "c.1451G>T" "r.(?)" "p.(Arg484Leu)" "" "0001038684" "00006257" "30" "997" "422" "997" "422" "c.997+422G>T" "r.(=)" "p.(=)" "" "0001038715" "00006257" "90" "671" "0" "671" "0" "c.671G>A" "r.(?)" "p.(Arg224Gln)" "" "0001038716" "00006257" "50" "667" "0" "667" "0" "c.667G>A" "r.(?)" "p.(Gly223Ser)" "" "0001038719" "00006257" "30" "290" "-568" "290" "-568" "c.290-568G>A" "r.(=)" "p.(=)" "" "0001038720" "00006257" "50" "289" "0" "289" "3" "c.289_289+3del" "r.(?)" "p.(Ala96Argfs*2)" "" "0001038721" "00006257" "50" "63" "0" "80" "0" "c.63_80del" "r.(?)" "p.(Val25_Ala30del)" "" "0001046329" "00006257" "50" "1255" "3" "1255" "3" "c.1255+3A>G" "r.spl?" "p.?" "" "0001046331" "00006257" "30" "727" "0" "727" "0" "c.727A>G" "r.(?)" "p.(Met243Val)" "" "0001053751" "00006257" "50" "6245" "0" "6245" "0" "c.*4547G>C" "r.(=)" "p.(=)" "" "0001053752" "00006257" "50" "6139" "0" "6139" "0" "c.*4441del" "r.(?)" "p.(=)" "" "0001053753" "00006257" "50" "1615" "0" "1615" "0" "c.1615A>G" "r.(?)" "p.(Ile539Val)" "" "0001053754" "00006257" "30" "-1650" "0" "-1645" "0" "c.-1650_-1645del" "r.(?)" "p.(=)" "" "0001053755" "00006257" "30" "-1651" "0" "-1651" "0" "c.-1651G>T" "r.(?)" "p.(=)" "" "0001065377" "00006257" "10" "6158" "0" "6158" "0" "c.*4460del" "r.(?)" "p.(=)" "" "0001065378" "00006257" "50" "1504" "-590" "1504" "-590" "c.1504-590C>T" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 11 "{{screeningid}}" "{{variantid}}" "0000016619" "0000036487" "0000016623" "0000036493" "0000081161" "0000130247" "0000297901" "0000660604" "0000304111" "0000667509" "0000317316" "0000699934" "0000360691" "0000760765" "0000375904" "0000787255" "0000427438" "0000904798" "0000449512" "0000959730" "0000459542" "0001017597"