### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = DOCK8) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "DOCK8" "dedicator of cytokinesis 8" "9" "p24.3" "unknown" "LRG_196" "UD_132084537461" "" "https://www.LOVD.nl/DOCK8" "" "1" "19191" "81704" "611432" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/DOCK8_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-11-05 19:00:32" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025575" "DOCK8" "transcript variant 1" "001" "NM_203447.3" "" "NP_982272.2" "" "" "" "-112" "7340" "6300" "214865" "465259" "00006" "2020-11-05 18:58:04" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 9 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00663" "MRD2" "mental retardation, autosomal dominant, type 2 (MRD-2)" "" "614113" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "00664" "HIES2" "hyper-IgE recurrent infection syndrome, autosomal recessive (HIES2)" "AR" "243700" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-11-05 19:02:37" "03381" "cancer, gastric" "cancer, gastric (Neoplasm of stomach)" "" "613659" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2017-07-14 15:28:09" "05292" "IMD" "immunodeficiency (IMD)" "" "" "" "" "" "00006" "2017-06-24 18:16:32" "00006" "2017-10-24 17:01:05" "05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54" "05515" "ATOD" "dermatitis, atopic (ATOD)" "" "" "" "" "" "00006" "2018-11-16 12:02:42" "" "" "05793" "IMD74" "immunodeficiency, type 74, COVID19-related, X-linked" "XLR" "301051" "" "" "" "00006" "2020-07-24 22:16:50" "00006" "2025-08-26 15:50:59" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "DOCK8" "00139" "DOCK8" "00663" "DOCK8" "00664" ## Individuals ## Do not remove or alter this header ## ## Count = 34 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00050559" "" "" "" "2" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, affected mother/child" "F" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00104019" "" "" "" "1" "" "00587" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer" "" "" "" "" "0" "" "" "" "Vogelaar-530A" "00104030" "" "" "" "1" "" "00587" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer" "" "" "" "" "0" "" "" "" "Vogelaar-731A" "00294841" "" "" "" "231" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294845" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294858" "" "" "" "79" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294864" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294865" "" "" "" "50" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294870" "" "" "" "8" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00296783" "" "" "" "1" "" "00006" "{PMID:Redin 2014:25167861}" "analysis 106 patients; 2-generation family, 1 affected, unaffected PHF8 carrier mother" "M" "" "France" "" "0" "" "" "" "APN-105" "00305248" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305249" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00318000" "" "" "" "1" "" "00006" "{PMID:Riazuddin 2017:27457812}" "" "" "yes" "Pakistan" "" "0" "" "" "" "PKMR133" "00324380" "" "" "" "1" "" "00006" "contact me for details" "" "" "" "Malaysia" "" "0" "" "" "" "private email" "00334361" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334533" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334546" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334850" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00335014" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00335029" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00388000" "" "" "" "1" "" "04135" "{PMID:Alsum 2013:22968740}, {DOI:Alsum 2013:10.1007/s10875-012-9769-x}" "" "M" "?" "Saudi Arabia" "" "0" "" "" "" "Fam1Pat1" "00388002" "" "" "" "3" "" "04135" "{PMID:Alsum 2013:22968740}" "family, 3 affected (2F, M)" "F" "?" "Saudi Arabia" "" "0" "" "" "" "Fam2Pat1" "00388006" "" "" "00388002" "1" "" "04135" "{PMID:Alsum 2013:22968740}, {DOI:Alsum 2013:10.1007/s10875-012-9769-x}" "girl" "F" "?" "Saudi Arabia" "" "0" "" "" "" "Fam2P2" "00425644" "" "" "" "1" "" "04425" "{DOI:Perälä 2023:10.1016/j.xjidi.2023.100203}" "" "?" "?" "Finland" "" "0" "" "" "" "" "00425645" "" "" "" "1" "" "04425" "{DOI:Perälä:10.1016/j.xjidi.2023.100203}" "" "?" "?" "Finland" "" "" "" "" "" "" "00425646" "" "" "" "1" "" "04425" "{DOI:Perälä:10.1016/j.xjidi.2023.100203}" "" "?" "?" "Finland" "" "" "" "" "" "" "00425647" "" "" "" "1" "" "04425" "{DOI:Perälä:10.1016/j.xjidi.2023.100203}" "" "?" "?" "Finland" "" "" "" "" "" "" "00425648" "" "" "" "1" "" "04425" "{DOI:Perälä:10.1016/j.xjidi.2023.100203}" "" "?" "?" "Finland" "" "" "" "" "" "" "00425649" "" "" "" "1" "" "04425" "{DOI:Perälä:10.1016/j.xjidi.2023.100203}" "" "?" "?" "Finland" "" "" "" "" "" "" "00433059" "" "" "" "2" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "2-generation family, 2 affected brothers, unaffected heterozygous carrier parents" "M" "" "Turkey" "" "0" "" "" "" "Pat30,1" "00433065" "" "" "" "1" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "" "F" "" "United States" "" "0" "" "" "Europe" "Pat36,1" "00433097" "" "" "" "1" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "" "F" "" "Germany" "" "0" "" "" "" "Pat73,1" "00433104" "" "" "" "2" "" "00006" "{PMID:Stray-Pedersen 2017:27577878}" "family, 2 affected" "F" "" "" "" "0" "" "" "Middle East" "Pat81,1" "00437764" "" "" "" "1" "" "00006" "{PMID:Kekou 2023:37754746}" "" "M" "" "Greece" "" "0" "" "" "" "D688" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 34 "{{individualid}}" "{{diseaseid}}" "00050559" "00198" "00104019" "03381" "00104030" "03381" "00294841" "00198" "00294845" "00198" "00294858" "00198" "00294864" "00198" "00294865" "00198" "00294870" "00198" "00296783" "00139" "00305248" "00198" "00305249" "00198" "00318000" "00139" "00324380" "00198" "00334361" "05793" "00334533" "05793" "00334546" "05793" "00334850" "05793" "00335014" "05793" "00335029" "05793" "00388000" "00664" "00388002" "00664" "00388006" "00664" "00425644" "05515" "00425645" "05515" "00425646" "05515" "00425647" "05515" "00425648" "05515" "00425649" "05515" "00433059" "05292" "00433065" "05292" "00433097" "05292" "00433104" "05292" "00437764" "05378" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00663, 00664, 03381, 05292, 05378, 05515, 05793 ## Count = 18 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037171" "00198" "00050559" "00006" "Unknown" "" "global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "" "0000081953" "03381" "00104019" "00587" "Unknown" "" "diffuse-type or intestinal-type gastric cancer" "" "" "" "" "" "" "" "" "" "" "" "" "0000081964" "03381" "00104030" "00587" "Unknown" "" "diffuse-type or intestinal-type gastric cancer" "" "" "" "" "" "" "" "" "" "" "" "" "0000224182" "00139" "00296783" "00006" "Familial, X-linked" "" "mild intellectual disability" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000241784" "00139" "00318000" "00006" "Familial, autosomal recessive" "" "Not available" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000253156" "05793" "00334361" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253224" "05793" "00334533" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253236" "05793" "00334546" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253247" "05793" "00334850" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253296" "05793" "00335014" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000253311" "05793" "00335029" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "" "COVID-19" "" "0000281593" "00664" "00388000" "04135" "Familial, autosomal recessive" "" "reccurent sinopulmonary infections (HP:0005425); eczema (HP:0000964); skin abscesses (HP:0031292); asthma (HP:0002099)" "" "" "" "" "" "" "" "" "" "" "" "" "0000281595" "00664" "00388002" "04135" "Familial, autosomal recessive" "?" "Recurrent pneumonia, bronchiectasis, sepsis, candidemia, EBV infection, cryptosporidial infections with sclerosing cholangitis, warts, hypothyroidism, adrenal gland leiomyoma, asthma, food allergy, recurrent abscesses, FTT." "?" "" "" "" "" "" "" "" "" "" "" "" "0000281599" "00664" "00388006" "04135" "Unknown" "?" "Recurrent sinopulmonary infections, EBV infection, viral cutaneous infections (warts and HSV), mucocutaneous candidiasis, asthma, drug allergy\r\nand food allergy, recurrent abscesses." "?" "" "?" "" "" "" "" "" "" "" "Autosomal recessive Hyper-IgE syndrome" "" "0000323585" "05292" "00433059" "00006" "Familial, autosomal recessive" "" "combined immunodeficiency (not SCID), selective T cell deficiency" "" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" "0000323591" "05292" "00433065" "00006" "Familial, autosomal recessive" "3y" "combined immunodeficiency (not SCID), selective T cell deficiency" "" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" "0000323623" "05292" "00433097" "00006" "Familial, autosomal recessive" "" "defect in innate immunity including mucocutaneous candidiasis, hyper IgE syndrome, mendelian susceptibility to mycobacterial disease, and complement deficiency" "" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" "0000323630" "05292" "00433104" "00006" "Familial, autosomal recessive" "5y" "defect in innate immunity including mucocutaneous candidiasis, hyper IgE syndrome, mendelian susceptibility to mycobacterial disease, and complement deficiency" "" "" "" "" "" "" "" "" "" "" "primary immunodeficiency disease" "" ## Screenings ## Do not remove or alter this header ## ## Count = 34 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000050504" "00050559" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000104490" "00104019" "1" "00587" "00006" "2017-04-28 08:15:46" "" "" "SEQ-NG" "DNA" "" "" "0000104501" "00104030" "1" "00587" "00006" "2017-04-28 08:15:46" "" "" "SEQ-NG" "DNA" "" "" "0000296009" "00294841" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296013" "00294845" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296026" "00294858" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296032" "00294864" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296033" "00294865" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296038" "00294870" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000297893" "00296783" "1" "00006" "00006" "2020-04-13 12:27:32" "" "" "SEQ;SEQ-NG" "DNA" "" "238-gene ID panel" "0000306377" "00305248" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306378" "00305249" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000319182" "00318000" "1" "00006" "00006" "2020-11-05 17:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000325570" "00324380" "1" "00006" "00006" "2020-12-08 10:13:42" "" "" "SEQ" "DNA" "" "" "0000335589" "00334361" "1" "04011" "04011" "2021-02-28 05:19:20" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335762" "00334533" "1" "04011" "04011" "2021-03-01 12:17:42" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335775" "00334546" "1" "04011" "04011" "2021-03-01 14:30:48" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336078" "00334850" "1" "04011" "04011" "2021-03-02 03:15:23" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336243" "00335014" "1" "04011" "04011" "2021-03-03 02:07:39" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000336258" "00335029" "1" "04011" "04011" "2021-03-03 04:37:42" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000389235" "00388000" "1" "04135" "04135" "2021-11-01 16:59:15" "00006" "2021-11-01 18:41:49" "?" "DNA" "" "gene panel (DOCK8, STAT3, TYK2)" "0000389238" "00388002" "1" "04135" "04135" "2021-11-01 17:27:18" "" "" "?" "DNA" "" "Gene panel (STAT3,TYK2, DOCK8)" "0000389244" "00388006" "1" "04135" "04135" "2021-11-01 18:38:51" "" "" "?" "DNA" "" "Gene panel (STAT3, TYK2, DOCK8)" "0000426964" "00425644" "1" "04425" "04425" "2022-11-24 21:29:40" "" "" "SEQ-NG" "DNA" "" "candidate gene sequencing" "0000426965" "00425645" "1" "04425" "04425" "2022-11-24 21:38:36" "" "" "SEQ-NG" "DNA" "" "Candidate gene seq" "0000426966" "00425646" "1" "04425" "04425" "2022-11-24 21:44:36" "" "" "SEQ-NG" "DNA" "" "Candidate gene seq" "0000426967" "00425647" "1" "04425" "04425" "2022-11-24 21:50:39" "" "" "SEQ-NG" "DNA" "" "" "0000426968" "00425648" "1" "04425" "04425" "2022-11-24 21:54:11" "" "" "SEQ-NG" "DNA" "" "Candidate gene seq" "0000426969" "00425649" "1" "04425" "04425" "2022-11-24 21:58:01" "" "" "SEQ-NG" "DNA" "" "Candidate gene seq" "0000434490" "00433059" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "arrayCGH;SEQ;SEQ-NG" "DNA" "" "" "0000434496" "00433065" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "SEQ-NG" "DNA" "" "" "0000434528" "00433097" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "SEQ-NG" "DNA" "" "" "0000434535" "00433104" "1" "00006" "00006" "2023-02-28 15:41:53" "" "" "arrayCGH;SEQ;SEQ-NG" "DNA" "" "" "0000439248" "00437764" "1" "00006" "00006" "2023-10-13 10:29:24" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 8 "{{screeningid}}" "{{geneid}}" "0000297893" "DOCK8" "0000297893" "PHF8" "0000319182" "DOCK8" "0000325570" "DOCK8" "0000389235" "DOCK8" "0000389238" "DOCK8" "0000389244" "DOCK8" "0000439248" "DMD" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 295 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000079484" "0" "90" "9" "204104" "8198999" "del" "0" "00006" "GLDC_000111" "g.204104_8198999del" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "decreased gene dosage" "De novo" "" "" "0" "" "" "g.204104_8198999del" "" "pathogenic" "" "0000169359" "0" "70" "9" "304628" "304628" "subst" "0.00138116" "00587" "DOCK8_000001" "g.304628G>A" "" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "" "NM_203447.3(DOCK8):c.452G>A p.(Arg151Gln)" "variant could not be associated with disease phenotype" "Germline" "" "" "0" "" "" "g.304628G>A" "" "likely pathogenic" "" "0000169399" "0" "70" "9" "463655" "463655" "subst" "0" "00587" "DOCK8_000002" "g.463655C>A" "" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "" "NM_203447.3(DOCK8):c.6207C>A p.(Tyr2069*)" "variant could not be associated with disease phenotype" "Germline" "" "" "0" "" "" "g.463655C>A" "" "likely pathogenic" "" "0000248195" "0" "10" "9" "370244" "370244" "subst" "0.216925" "02325" "DOCK8_000032" "g.370244A>G" "" "" "" "DOCK8(NM_203447.3):c.1812A>G (p.K604=), DOCK8(NM_203447.4):c.1812A>G (p.K604=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.370244A>G" "" "benign" "" "0000248231" "0" "10" "9" "433978" "433978" "subst" "0.766491" "02325" "DOCK8_000102" "g.433978A>G" "" "" "" "DOCK8(NM_203447.3):c.4886+3A>G, DOCK8(NM_203447.4):c.4886+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.433978A>G" "" "benign" "" "0000249437" "0" "30" "9" "441328" "441328" "subst" "0.00010152" "02325" "DOCK8_000083" "g.441328A>C" "" "" "" "DOCK8(NM_203447.4):c.5266A>C (p.I1756L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.441328A>C" "" "likely benign" "" "0000249478" "0" "30" "9" "418091" "418091" "subst" "8.12315E-6" "02325" "DOCK8_000063" "g.418091A>T" "" "" "" "DOCK8(NM_203447.4):c.3724A>T (p.T1242S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.418091A>T" "" "likely benign" "" "0000249948" "0" "30" "9" "463649" "463649" "subst" "0.00107421" "02329" "DOCK8_000103" "g.463649A>G" "" "" "" "DOCK8(NM_203447.3):c.6201A>G (p.E2067=), DOCK8(NM_203447.4):c.6201A>G (p.E2067=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.463649A>G" "" "likely benign" "" "0000249995" "0" "50" "9" "420579" "420579" "subst" "0.00274531" "02329" "DOCK8_000068" "g.420579A>G" "" "" "" "DOCK8(NM_203447.3):c.4019A>G (p.Y1340C), DOCK8(NM_203447.4):c.4019A>G (p.Y1340C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420579A>G" "" "VUS" "" "0000250763" "0" "30" "9" "463649" "463649" "subst" "0.00107421" "02326" "DOCK8_000103" "g.463649A>G" "" "" "" "DOCK8(NM_203447.3):c.6201A>G (p.E2067=), DOCK8(NM_203447.4):c.6201A>G (p.E2067=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.463649A>G" "" "likely benign" "" "0000250864" "0" "10" "9" "414816" "414816" "subst" "0.00553512" "02326" "DOCK8_000061" "g.414816A>G" "" "" "" "DOCK8(NM_203447.3):c.3565A>G (p.I1189V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.414816A>G" "" "benign" "" "0000250898" "0" "10" "9" "370244" "370244" "subst" "0.216925" "02326" "DOCK8_000032" "g.370244A>G" "" "" "" "DOCK8(NM_203447.3):c.1812A>G (p.K604=), DOCK8(NM_203447.4):c.1812A>G (p.K604=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.370244A>G" "" "benign" "" "0000250934" "0" "10" "9" "433978" "433978" "subst" "0.766491" "02326" "DOCK8_000102" "g.433978A>G" "" "" "" "DOCK8(NM_203447.3):c.4886+3A>G, DOCK8(NM_203447.4):c.4886+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.433978A>G" "" "benign" "" "0000251138" "0" "10" "9" "334337" "334337" "subst" "0.24542" "02326" "DOCK8_000024" "g.334337A>G" "" "" "" "DOCK8(NM_203447.3):c.1238A>G (p.N413S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.334337A>G" "" "benign" "" "0000252566" "0" "90" "9" "405072" "405072" "subst" "0" "02326" "DOCK8_000056" "g.405072A>G" "" "" "" "DOCK8(NM_203447.3):c.3389A>G (p.Q1130R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.405072A>G" "" "pathogenic" "" "0000253982" "0" "30" "9" "463649" "463649" "subst" "0.00107421" "01943" "DOCK8_000103" "g.463649A>G" "" "" "" "DOCK8(NM_203447.3):c.6201A>G (p.E2067=), DOCK8(NM_203447.4):c.6201A>G (p.E2067=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.463649A>G" "" "likely benign" "" "0000254570" "0" "30" "9" "377040" "377040" "subst" "4.06835E-6" "01943" "DOCK8_000039" "g.377040A>G" "" "" "" "DOCK8(NM_203447.3):c.2269A>G (p.I757V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.377040A>G" "" "likely benign" "" "0000255015" "0" "30" "9" "215387" "215387" "subst" "3.32358E-5" "01943" "C9orf66_000002" "g.215387A>G" "" "" "" "C9orf66(NM_152569.2):c.10T>C (p.S4P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.215387A>G" "" "likely benign" "" "0000255260" "0" "30" "9" "376203" "376203" "subst" "0" "01943" "DOCK8_000038" "g.376203A>T" "" "" "" "DOCK8(NM_203447.3):c.2110-7A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.376203A>T" "" "likely benign" "" "0000255261" "0" "30" "9" "432160" "432160" "subst" "2.45134E-5" "01943" "DOCK8_000077" "g.432160A>T" "" "" "" "DOCK8(NM_203447.3):c.4627-6A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.432160A>T" "" "likely benign" "" "0000255793" "0" "50" "9" "420579" "420579" "subst" "0.00274531" "01943" "DOCK8_000068" "g.420579A>G" "" "" "" "DOCK8(NM_203447.3):c.4019A>G (p.Y1340C), DOCK8(NM_203447.4):c.4019A>G (p.Y1340C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420579A>G" "" "VUS" "" "0000255794" "0" "50" "9" "446401" "446401" "subst" "0.000410192" "01943" "DOCK8_000089" "g.446401A>G" "" "" "" "DOCK8(NM_203447.3):c.5612A>G (p.Y1871C), DOCK8(NM_203447.4):c.5612A>G (p.Y1871C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.446401A>G" "" "VUS" "" "0000267494" "0" "10" "9" "368128" "368128" "subst" "0.0772103" "02325" "DOCK8_000031" "g.368128C>T" "" "" "" "DOCK8(NM_203447.4):c.1790C>T (p.A597V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.368128C>T" "" "benign" "" "0000267495" "0" "10" "9" "377111" "377111" "subst" "0.22566" "02325" "DOCK8_000041" "g.377111G>C" "" "" "" "DOCK8(NM_203447.3):c.2340G>C (p.L780=), DOCK8(NM_203447.4):c.2340G>C (p.L780=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.377111G>C" "" "benign" "" "0000267496" "0" "10" "9" "286593" "286593" "subst" "0.525054" "02325" "DOCK8_000005" "g.286593C>A" "" "" "" "DOCK8(NM_203447.3):c.289C>A (p.P97T), DOCK8(NM_203447.4):c.289C>A (p.P97T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.286593C>A" "" "benign" "" "0000267497" "0" "10" "9" "390512" "390512" "subst" "0.228129" "02325" "DOCK8_000047" "g.390512C>T" "" "" "" "DOCK8(NM_203447.3):c.2916C>T (p.T972=), DOCK8(NM_203447.4):c.2916C>T (p.T972=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.390512C>T" "" "benign" "" "0000267498" "0" "10" "9" "421032" "421032" "subst" "0.508603" "02325" "DOCK8_000071" "g.421032C>G" "" "" "" "DOCK8(NM_203447.3):c.4107C>G (p.L1369=), DOCK8(NM_203447.4):c.4107C>G (p.L1369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.421032C>G" "" "benign" "" "0000267499" "0" "10" "9" "429719" "429719" "subst" "0.997693" "02325" "DOCK8_000075" "g.429719T>C" "" "" "" "DOCK8(NM_203447.4):c.4491T>C (p.F1497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.429719T>C" "" "benign" "" "0000267500" "0" "10" "9" "432330" "432330" "subst" "0.766001" "02325" "DOCK8_000078" "g.432330C>G" "" "" "" "DOCK8(NM_203447.3):c.4785+6C>G, DOCK8(NM_203447.4):c.4785+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.432330C>G" "" "benign" "" "0000267501" "0" "30" "9" "441358" "441358" "subst" "0.00015837" "02325" "DOCK8_000084" "g.441358C>T" "" "" "" "DOCK8(NM_203447.3):c.5296C>T (p.R1766W), DOCK8(NM_203447.4):c.5296C>T (p.R1766W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.441358C>T" "" "likely benign" "" "0000267502" "0" "10" "9" "441952" "441952" "subst" "0.825245" "02325" "DOCK8_000086" "g.441952G>A" "" "" "" "DOCK8(NM_203447.3):c.5433G>A (p.E1811=), DOCK8(NM_203447.4):c.5433G>A (p.E1811=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.441952G>A" "" "benign" "" "0000267503" "0" "10" "9" "446352" "446352" "subst" "0.699253" "02325" "DOCK8_000088" "g.446352G>C" "" "" "" "DOCK8(NM_203447.3):c.5581-18G>C, DOCK8(NM_203447.4):c.5581-18G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.446352G>C" "" "benign" "" "0000267504" "0" "10" "9" "271638" "271638" "subst" "0.328049" "02325" "DOCK8_000004" "g.271638C>T" "" "" "" "DOCK8(NM_203447.3):c.65C>T (p.A22V), DOCK8(NM_203447.4):c.65C>T (p.A22V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.271638C>T" "" "benign" "" "0000267505" "0" "10" "9" "312124" "312124" "subst" "0.165023" "02325" "DOCK8_000014" "g.312124T>C" "" "" "" "DOCK8(NM_203447.4):c.699T>C (p.N233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.312124T>C" "" "benign" "" "0000267506" "0" "10" "9" "328006" "328006" "subst" "0.687378" "02325" "DOCK8_000017" "g.328006T>C" "" "" "" "DOCK8(NM_203447.3):c.895-16T>C, DOCK8(NM_203447.4):c.895-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.328006T>C" "" "benign" "" "0000270843" "0" "70" "9" "328143" "328143" "subst" "0.000130126" "02326" "DOCK8_000020" "g.328143C>T" "" "" "" "DOCK8(NM_203447.3):c.1016C>T (p.P339L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.328143C>T" "" "likely pathogenic" "" "0000270844" "0" "90" "9" "334385" "334385" "subst" "0" "02326" "DOCK8_000025" "g.334385G>A" "" "" "" "DOCK8(NM_203447.3):c.1285+1G>A, DOCK8(NM_203447.4):c.1285+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.334385G>A" "" "pathogenic" "" "0000270845" "0" "10" "9" "336819" "336819" "subst" "0" "02326" "DOCK8_000026" "g.336819G>T" "" "" "" "DOCK8(NM_203447.3):c.1422+101G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.336819G>T" "" "benign" "" "0000270846" "0" "10" "9" "340339" "340339" "subst" "0.00295463" "02326" "DOCK8_000029" "g.340339G>A" "" "" "" "DOCK8(NM_203447.3):c.1679+18G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.340339G>A" "" "benign" "" "0000270847" "0" "10" "9" "365587" "365587" "del" "0" "02326" "DOCK8_000030" "g.365587del" "" "" "" "DOCK8(NM_203447.3):c.1680-2431delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.365587del" "" "benign" "" "0000270848" "0" "90" "9" "370292" "370292" "subst" "0" "02326" "DOCK8_000034" "g.370292C>A" "" "" "" "DOCK8(NM_203447.3):c.1860C>A (p.Y620*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.370292C>A" "" "pathogenic" "" "0000270849" "0" "10" "9" "377066" "377066" "subst" "0.0144748" "02326" "DOCK8_000040" "g.377066C>T" "" "" "" "DOCK8(NM_203447.3):c.2295C>T (p.S765=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.377066C>T" "" "benign" "" "0000270850" "0" "10" "9" "377111" "377111" "subst" "0.22566" "02326" "DOCK8_000041" "g.377111G>C" "" "" "" "DOCK8(NM_203447.3):c.2340G>C (p.L780=), DOCK8(NM_203447.4):c.2340G>C (p.L780=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.377111G>C" "" "benign" "" "0000270851" "0" "90" "9" "390495" "390495" "subst" "0" "02326" "DOCK8_000046" "g.390495C>T" "" "" "" "DOCK8(NM_203447.3):c.2899C>T (p.Q967*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.390495C>T" "" "pathogenic" "" "0000270852" "0" "10" "9" "286593" "286593" "subst" "0.525054" "02326" "DOCK8_000005" "g.286593C>A" "" "" "" "DOCK8(NM_203447.3):c.289C>A (p.P97T), DOCK8(NM_203447.4):c.289C>A (p.P97T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.286593C>A" "" "benign" "" "0000270853" "0" "10" "9" "390512" "390512" "subst" "0.228129" "02326" "DOCK8_000047" "g.390512C>T" "" "" "" "DOCK8(NM_203447.3):c.2916C>T (p.T972=), DOCK8(NM_203447.4):c.2916C>T (p.T972=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.390512C>T" "" "benign" "" "0000270854" "0" "10" "9" "399361" "399361" "subst" "0" "02326" "DOCK8_000053" "g.399361T>A" "" "" "" "DOCK8(NM_203447.3):c.3234+102T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.399361T>A" "" "benign" "" "0000270855" "0" "30" "9" "399274" "399274" "del" "0" "02326" "DOCK8_000052" "g.399274del" "" "" "" "DOCK8(NM_203447.3):c.3234+15delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.399274del" "" "likely benign" "" "0000270857" "0" "30" "9" "420945" "420945" "subst" "0.00214041" "02326" "DOCK8_000069" "g.420945C>T" "" "" "" "DOCK8(NM_001190458.1):c.3724-4C>T (p.?), DOCK8(NM_203447.3):c.4024-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420945C>T" "" "likely benign" "" "0000270858" "0" "10" "9" "289597" "289597" "del" "0" "02326" "DOCK8_000007" "g.289597del" "" "" "" "DOCK8(NM_203447.3):c.404+16delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.289597del" "" "benign" "" "0000270859" "0" "50" "9" "421012" "421012" "subst" "0.000162441" "02326" "DOCK8_000070" "g.421012C>T" "" "" "" "DOCK8(NM_203447.3):c.4087C>T (p.R1363W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.421012C>T" "" "VUS" "" "0000270860" "0" "10" "9" "421032" "421032" "subst" "0.508603" "02326" "DOCK8_000071" "g.421032C>G" "" "" "" "DOCK8(NM_203447.3):c.4107C>G (p.L1369=), DOCK8(NM_203447.4):c.4107C>G (p.L1369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.421032C>G" "" "benign" "" "0000270861" "0" "30" "9" "422052" "422052" "subst" "0.000548736" "02326" "DOCK8_000073" "g.422052C>T" "" "" "" "DOCK8(NM_203447.3):c.4158C>T (p.N1386=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.422052C>T" "" "likely benign" "" "0000270862" "0" "10" "9" "429617" "429617" "subst" "0" "02326" "DOCK8_000074" "g.429617C>T" "" "" "" "DOCK8(NM_203447.3):c.4474-85C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.429617C>T" "" "benign" "" "0000270863" "0" "10" "9" "432152" "432154" "del" "0" "02326" "DOCK8_000076" "g.432152_432154del" "" "" "" "DOCK8(NM_203447.3):c.4627-14_4627-12delTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.432152_432154del" "" "benign" "" "0000270864" "0" "10" "9" "432330" "432330" "subst" "0.766001" "02326" "DOCK8_000078" "g.432330C>G" "" "" "" "DOCK8(NM_203447.3):c.4785+6C>G, DOCK8(NM_203447.4):c.4785+6C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.432330C>G" "" "benign" "" "0000270865" "0" "10" "9" "439376" "439376" "subst" "0.00445035" "02326" "DOCK8_000082" "g.439376G>A" "" "" "" "DOCK8(NM_203447.3):c.5211G>A (p.E1737=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.439376G>A" "" "benign" "" "0000270866" "0" "10" "9" "311814" "311814" "subst" "0" "02326" "DOCK8_000010" "g.311814C>G" "" "" "" "DOCK8(NM_203447.3):c.529-140C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.311814C>G" "" "benign" "" "0000270867" "0" "30" "9" "441737" "441737" "subst" "0" "02326" "DOCK8_000085" "g.441737T>A" "" "" "" "DOCK8(NM_203447.3):c.5356-138T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.441737T>A" "" "likely benign" "" "0000270868" "0" "90" "9" "271626" "271626" "subst" "0.000265763" "02326" "DOCK8_000003" "g.271626G>T" "" "" "" "DOCK8(NM_203447.3):c.54-1G>T, DOCK8(NM_203447.4):c.54-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.271626G>T" "" "pathogenic" "" "0000270869" "0" "10" "9" "441952" "441952" "subst" "0.825245" "02326" "DOCK8_000086" "g.441952G>A" "" "" "" "DOCK8(NM_203447.3):c.5433G>A (p.E1811=), DOCK8(NM_203447.4):c.5433G>A (p.E1811=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.441952G>A" "" "benign" "" "0000270870" "0" "10" "9" "442722" "442722" "subst" "0" "02326" "DOCK8_000087" "g.442722T>C" "" "" "" "DOCK8(NM_203447.3):c.5491-705T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.442722T>C" "" "benign" "" "0000270871" "0" "10" "9" "446352" "446352" "subst" "0.699253" "02326" "DOCK8_000088" "g.446352G>C" "" "" "" "DOCK8(NM_203447.3):c.5581-18G>C, DOCK8(NM_203447.4):c.5581-18G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.446352G>C" "" "benign" "" "0000270872" "0" "10" "9" "449770" "449770" "subst" "0.00774876" "02326" "DOCK8_000092" "g.449770C>T" "" "" "" "DOCK8(NM_203447.3):c.5818-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.449770C>T" "" "benign" "" "0000270873" "0" "30" "9" "449768" "449768" "subst" "0.000893916" "02326" "DOCK8_000091" "g.449768T>C" "" "" "" "DOCK8(NM_203447.3):c.5818-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.449768T>C" "" "likely benign" "" "0000270874" "0" "30" "9" "452003" "452003" "subst" "0.00060203" "02326" "DOCK8_000095" "g.452003C>T" "" "" "" "DOCK8(NM_203447.3):c.5962-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.452003C>T" "" "likely benign" "" "0000270875" "0" "10" "9" "271638" "271638" "subst" "0.328049" "02326" "DOCK8_000004" "g.271638C>T" "" "" "" "DOCK8(NM_203447.3):c.65C>T (p.A22V), DOCK8(NM_203447.4):c.65C>T (p.A22V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.271638C>T" "" "benign" "" "0000270876" "0" "10" "9" "312134" "312134" "subst" "0.0283043" "02326" "DOCK8_000015" "g.312134G>A" "" "" "" "DOCK8(NM_001190458.1):c.505G>A (p.(Glu169Lys)), DOCK8(NM_203447.3):c.709G>A (p.E237K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.312134G>A" "" "benign" "" "0000270878" "0" "10" "9" "328006" "328006" "subst" "0.687378" "02326" "DOCK8_000017" "g.328006T>C" "" "" "" "DOCK8(NM_203447.3):c.895-16T>C, DOCK8(NM_203447.4):c.895-16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.328006T>C" "" "benign" "" "0000275468" "0" "50" "9" "386382" "386382" "subst" "0" "01943" "DOCK8_000044" "g.386382G>T" "" "" "" "DOCK8(NM_203447.3):c.2830G>T (p.D944Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.386382G>T" "" "VUS" "" "0000275469" "0" "50" "9" "396837" "396837" "subst" "0.000727051" "01943" "DOCK8_000049" "g.396837G>A" "" "" "" "DOCK8(NM_203447.3):c.3023G>A (p.R1008Q), DOCK8(NM_203447.4):c.3023G>A (p.R1008Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.396837G>A" "" "VUS" "" "0000275470" "0" "30" "9" "399245" "399245" "subst" "0.000719483" "01943" "DOCK8_000051" "g.399245C>A" "" "" "" "DOCK8(NM_001190458.1):c.2920C>A (p.(His974Asn)), DOCK8(NM_203447.3):c.3220C>A (p.H1074N), DOCK8(NM_203447.4):c.3220C>A (p.H1074N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.399245C>A" "" "likely benign" "" "0000275471" "0" "50" "9" "404995" "404995" "subst" "0.000698795" "01943" "DOCK8_000054" "g.404995G>C" "" "" "" "DOCK8(NM_203447.3):c.3312G>C (p.E1104D), DOCK8(NM_203447.4):c.3312G>C (p.E1104D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.404995G>C" "" "VUS" "" "0000275472" "0" "10" "9" "414824" "414824" "subst" "0.00557979" "01943" "DOCK8_000062" "g.414824C>T" "" "" "" "DOCK8(NM_203447.3):c.3573C>T (p.S1191=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.414824C>T" "" "benign" "" "0000275473" "0" "50" "9" "289556" "289556" "subst" "0.000101603" "01943" "DOCK8_000006" "g.289556C>T" "" "" "" "DOCK8(NM_203447.3):c.379C>T (p.R127C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.289556C>T" "" "VUS" "" "0000275474" "0" "30" "9" "420548" "420548" "subst" "0.000292414" "01943" "DOCK8_000066" "g.420548C>G" "" "" "" "DOCK8(NM_203447.3):c.3988C>G (p.L1330V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420548C>G" "" "likely benign" "" "0000275475" "0" "30" "9" "420563" "420563" "subst" "7.3103E-5" "01943" "DOCK8_000067" "g.420563G>T" "" "" "" "DOCK8(NM_203447.3):c.4003G>T (p.V1335L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420563G>T" "" "likely benign" "" "0000275476" "0" "30" "9" "420945" "420945" "subst" "0.00214041" "01943" "DOCK8_000069" "g.420945C>T" "" "" "" "DOCK8(NM_001190458.1):c.3724-4C>T (p.?), DOCK8(NM_203447.3):c.4024-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420945C>T" "" "likely benign" "" "0000275477" "0" "30" "9" "434894" "434894" "subst" "9.75999E-5" "01943" "DOCK8_000080" "g.434894G>C" "" "" "" "DOCK8(NM_203447.3):c.4998G>C (p.V1666=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.434894G>C" "" "likely benign" "" "0000275478" "0" "10" "9" "439376" "439376" "subst" "0.00445035" "01943" "DOCK8_000082" "g.439376G>A" "" "" "" "DOCK8(NM_203447.3):c.5211G>A (p.E1737=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.439376G>A" "" "benign" "" "0000275479" "0" "50" "9" "446441" "446441" "subst" "0" "01943" "DOCK8_000090" "g.446441T>A" "" "" "" "DOCK8(NM_203447.3):c.5652T>A (p.F1884L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.446441T>A" "" "VUS" "" "0000275480" "0" "30" "9" "312005" "312005" "subst" "0.000495883" "01943" "DOCK8_000011" "g.312005G>A" "" "" "" "DOCK8(NM_203447.3):c.580G>A (p.V194I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.312005G>A" "" "likely benign" "" "0000275481" "0" "10" "9" "452003" "452003" "subst" "0.00060203" "01943" "DOCK8_000095" "g.452003C>T" "" "" "" "DOCK8(NM_203447.3):c.5962-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.452003C>T" "" "benign" "" "0000275482" "0" "50" "9" "463595" "463595" "subst" "0" "01943" "DOCK8_000098" "g.463595C>G" "" "" "" "DOCK8(NM_203447.3):c.6147C>G (p.N2049K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.463595C>G" "" "VUS" "" "0000275483" "0" "30" "9" "312088" "312088" "subst" "0.00174266" "01943" "DOCK8_000012" "g.312088C>A" "" "" "" "DOCK8(NM_203447.3):c.663C>A (p.D221E), DOCK8(NM_203447.4):c.663C>A (p.D221E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.312088C>A" "" "likely benign" "" "0000332500" "0" "50" "9" "214679" "214679" "subst" "0.0028666" "01804" "C9orf66_000003" "g.214679G>A" "" "" "" "C9orf66(NM_152569.2):c.718C>T (p.(Pro240Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.214679G>A" "" "VUS" "" "0000332502" "0" "50" "9" "304652" "304652" "subst" "6.09187E-5" "01804" "DOCK8_000008" "g.304652C>T" "" "" "" "DOCK8(NM_001190458.1):c.272C>T (p.(Pro91Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.304652C>T" "" "VUS" "" "0000332503" "0" "50" "9" "312104" "312104" "subst" "0.00181208" "01804" "DOCK8_000013" "g.312104G>A" "" "" "" "DOCK8(NM_001190458.1):c.475G>A (p.(Glu159Lys)), DOCK8(NM_203447.3):c.679G>A (p.E227K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.312104G>A" "" "VUS" "" "0000332505" "0" "50" "9" "332425" "332425" "subst" "8.12407E-6" "01804" "DOCK8_000021" "g.332425A>G" "" "" "" "DOCK8(NM_001190458.1):c.868A>G (p.(Ile290Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.332425A>G" "" "VUS" "" "0000332506" "0" "50" "9" "332443" "332443" "subst" "0.000329022" "01804" "DOCK8_000022" "g.332443C>T" "" "" "" "DOCK8(NM_001190458.1):c.886C>T (p.(Pro296Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.332443C>T" "" "VUS" "" "0000332507" "0" "50" "9" "370261" "370261" "subst" "0" "01804" "DOCK8_000033" "g.370261T>G" "" "" "" "DOCK8(NM_001190458.1):c.1625T>G (p.(Phe542Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.370261T>G" "" "VUS" "" "0000332508" "0" "50" "9" "399245" "399245" "subst" "0.000719483" "01804" "DOCK8_000051" "g.399245C>A" "" "" "" "DOCK8(NM_001190458.1):c.2920C>A (p.(His974Asn)), DOCK8(NM_203447.3):c.3220C>A (p.H1074N), DOCK8(NM_203447.4):c.3220C>A (p.H1074N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.399245C>A" "" "VUS" "" "0000332509" "0" "30" "9" "406953" "406953" "subst" "5.68995E-5" "01804" "DOCK8_000058" "g.406953C>A" "" "" "" "DOCK8(NM_001190458.1):c.3114C>A (p.(Phe1038Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.406953C>A" "" "likely benign" "" "0000332510" "0" "50" "9" "420393" "420393" "subst" "0" "01804" "DOCK8_000064" "g.420393C>G" "" "" "" "DOCK8(NM_001190458.1):c.3541-8C>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420393C>G" "" "VUS" "" "0000332511" "0" "50" "9" "420404" "420404" "subst" "8.12348E-6" "01804" "DOCK8_000065" "g.420404T>C" "" "" "" "DOCK8(NM_001190458.1):c.3544T>C (p.(Tyr1182His)), DOCK8(NM_203447.3):c.3844T>C (p.Y1282H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.420404T>C" "" "VUS" "" "0000332512" "0" "50" "9" "422043" "422043" "subst" "0" "01804" "DOCK8_000072" "g.422043C>G" "" "" "" "DOCK8(NM_001190458.1):c.3854-5C>G (p.?), DOCK8(NM_203447.3):c.4154-5C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.422043C>G" "" "VUS" "" "0000332515" "0" "50" "9" "463535" "463535" "subst" "9.34382E-5" "01804" "DOCK8_000096" "g.463535G>C" "" "" "" "DOCK8(NM_001190458.1):c.5787G>C (p.(Glu1929Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.463535G>C" "" "VUS" "" "0000332516" "0" "50" "9" "463555" "463555" "subst" "9.34488E-5" "01804" "DOCK8_000097" "g.463555C>T" "" "" "" "DOCK8(NM_001190458.1):c.5807C>T (p.(Thr1936Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.463555C>T" "" "VUS" "" "0000349307" "0" "50" "9" "304661" "304661" "subst" "2.43663E-5" "02327" "DOCK8_000100" "g.304661C>T" "" "" "" "DOCK8(NM_203447.3):c.485C>T (p.T162M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.304661C>T" "" "VUS" "" "0000350154" "0" "50" "9" "371442" "371442" "subst" "0" "02327" "DOCK8_000101" "g.371442A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.371442A>T" "" "VUS" "" "0000537808" "0" "50" "9" "215028" "215028" "subst" "0.000188681" "01943" "C9orf66_000005" "g.215028A>G" "" "" "" "DOCK8(NM_203447.3):c.52A>G (p.R18G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.215028A>G" "" "VUS" "" "0000537809" "0" "50" "9" "215192" "215192" "subst" "0" "01943" "C9orf66_000006" "g.215192C>G" "" "" "" "C9orf66(NM_152569.2):c.205G>C (p.A69P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.215192C>G" "" "VUS" "" "0000537810" "0" "50" "9" "215199" "215221" "del" "0" "01943" "C9orf66_000007" "g.215199_215221del" "" "" "" "C9orf66(NM_152569.2):c.182_204delCAGGAGCCGCCGCGCGTCCAGCG (p.A61Gfs*57)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.215199_215221del" "" "VUS" "" "0000537898" "0" "30" "9" "289555" "289555" "subst" "0.00017882" "01943" "C9orf66_000008" "g.289555C>G" "" "" "" "DOCK8(NM_203447.3):c.378C>G (p.I126M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.289555C>G" "" "likely benign" "" "0000537899" "0" "30" "9" "289557" "289557" "subst" "0.00198347" "01943" "C9orf66_000009" "g.289557G>A" "" "" "" "DOCK8(NM_203447.3):c.380G>A (p.R127H), DOCK8(NM_203447.4):c.380G>A (p.R127H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.289557G>A" "" "likely benign" "" "0000537901" "0" "30" "9" "304670" "304670" "subst" "0.000601045" "01943" "DOCK8_000009" "g.304670C>T" "" "" "" "DOCK8(NM_203447.3):c.494C>T (p.S165L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.304670C>T" "" "likely benign" "" "0000537902" "0" "30" "9" "304670" "304670" "subst" "0.000601045" "02326" "DOCK8_000009" "g.304670C>T" "" "" "" "DOCK8(NM_203447.3):c.494C>T (p.S165L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.304670C>T" "" "likely benign" "" "0000537903" "0" "30" "9" "312003" "312003" "subst" "1.21918E-5" "01943" "C9orf66_000010" "g.312003C>G" "" "" "" "DOCK8(NM_203447.3):c.578C>G (p.P193R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.312003C>G" "" "likely benign" "" "0000537904" "0" "10" "9" "312104" "312104" "subst" "0.00181208" "01943" "DOCK8_000013" "g.312104G>A" "" "" "" "DOCK8(NM_001190458.1):c.475G>A (p.(Glu159Lys)), DOCK8(NM_203447.3):c.679G>A (p.E227K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.312104G>A" "" "benign" "" "0000537905" "0" "30" "9" "312134" "312134" "subst" "0.0283043" "01804" "DOCK8_000015" "g.312134G>A" "" "" "" "DOCK8(NM_001190458.1):c.505G>A (p.(Glu169Lys)), DOCK8(NM_203447.3):c.709G>A (p.E237K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.312134G>A" "" "likely benign" "" "0000537947" "0" "10" "9" "325811" "325812" "ins" "0" "02326" "C9orf66_000011" "g.325811_325812insC" "" "" "" "DOCK8(NM_203447.3):c.894+74_894+75insC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.325811_325812insC" "" "benign" "" "0000538008" "0" "30" "9" "340168" "340168" "subst" "0" "02326" "C9orf66_000014" "g.340168G>C" "" "" "" "DOCK8(NM_203447.3):c.1526G>C (p.R509T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.340168G>C" "" "likely benign" "" "0000538009" "0" "10" "9" "340229" "340229" "subst" "0.000727459" "01943" "C9orf66_000015" "g.340229C>G" "" "" "" "DOCK8(NM_203447.3):c.1587C>G (p.P529=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.340229C>G" "" "benign" "" "0000538178" "0" "30" "9" "368021" "368021" "subst" "0.000113791" "01804" "C9orf66_000016" "g.368021C>A" "" "" "" "DOCK8(NM_001190458.1):c.1479C>A (p.(Asn493Lys)), DOCK8(NM_203447.3):c.1683C>A (p.N561K), DOCK8(NM_203447.4):c.1683C>A (p.N561K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.368021C>A" "" "likely benign" "" "0000538186" "0" "50" "9" "376211" "376211" "subst" "2.03123E-5" "01943" "C9orf66_000018" "g.376211A>G" "" "" "" "DOCK8(NM_203447.3):c.2111A>G (p.K704R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.376211A>G" "" "VUS" "" "0000538191" "0" "50" "9" "379774" "379774" "subst" "0.000134023" "01943" "C9orf66_000019" "g.379774A>C" "" "" "" "DOCK8(NM_203447.3):c.2444A>C (p.N815T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.379774A>C" "" "VUS" "" "0000538211" "0" "10" "9" "396836" "396836" "subst" "0.00101547" "01943" "C9orf66_000020" "g.396836C>T" "" "" "" "DOCK8(NM_203447.3):c.3022C>T (p.R1008W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.396836C>T" "" "benign" "" "0000538213" "0" "10" "9" "399255" "399255" "subst" "0.0477765" "02326" "C9orf66_000022" "g.399255G>A" "" "" "" "DOCK8(NM_001190458.1):c.2930G>A (p.(Ser977Asn)), DOCK8(NM_203447.3):c.3230G>A (p.S1077N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.399255G>A" "" "benign" "" "0000538214" "0" "90" "9" "399261" "399261" "subst" "2.85274E-5" "02325" "C9orf66_000023" "g.399261T>C" "" "" "" "DOCK8(NM_203447.4):c.3234+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.399261T>C" "" "pathogenic" "" "0000538216" "0" "50" "9" "404946" "404946" "subst" "0.000105628" "01943" "C9orf66_000025" "g.404946C>T" "" "" "" "DOCK8(NM_203447.3):c.3263C>T (p.T1088M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.404946C>T" "" "VUS" "" "0000538217" "0" "50" "9" "406806" "406807" "ins" "0" "02326" "C9orf66_000026" "g.406806_406807insC" "" "" "" "DOCK8(NM_203447.3):c.3391-124_3391-123insC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.406806_406807insC" "" "VUS" "" "0000538218" "0" "30" "9" "406999" "406999" "subst" "0.00288609" "01943" "C9orf66_000027" "g.406999C>T" "" "" "" "DOCK8(NM_203447.3):c.3460C>T (p.R1154C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.406999C>T" "" "likely benign" "" "0000538220" "0" "50" "9" "407024" "407024" "subst" "4.0655E-6" "01804" "C9orf66_000028" "g.407024T>C" "" "" "" "DOCK8(NM_001190458.1):c.3185T>C (p.(Leu1062Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.407024T>C" "" "VUS" "" "0000538257" "0" "30" "9" "414863" "414863" "subst" "0.00012589" "01943" "C9orf66_000030" "g.414863A>T" "" "" "" "DOCK8(NM_203447.3):c.3612A>T (p.K1204N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.414863A>T" "" "likely benign" "" "0000538259" "0" "30" "9" "418101" "418101" "subst" "2.84669E-5" "01943" "C9orf66_000032" "g.418101C>T" "" "" "" "DOCK8(NM_203447.3):c.3734C>T (p.S1245L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.418101C>T" "" "likely benign" "" "0000538260" "0" "30" "9" "418193" "418193" "subst" "0.000316754" "01943" "C9orf66_000033" "g.418193G>T" "" "" "" "DOCK8(NM_203447.3):c.3826G>T (p.V1276L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.418193G>T" "" "likely benign" "" "0000538261" "0" "30" "9" "420413" "420413" "subst" "0" "01943" "C9orf66_000034" "g.420413T>G" "" "" "" "DOCK8(NM_203447.3):c.3853T>G (p.Y1285D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.420413T>G" "" "likely benign" "" "0000538262" "0" "30" "9" "420945" "420945" "subst" "0.00214041" "01804" "DOCK8_000069" "g.420945C>T" "" "" "" "DOCK8(NM_001190458.1):c.3724-4C>T (p.?), DOCK8(NM_203447.3):c.4024-4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.420945C>T" "" "likely benign" "" "0000538263" "0" "50" "9" "420966" "420966" "subst" "4.06114E-5" "01943" "C9orf66_000035" "g.420966C>A" "" "" "" "DOCK8(NM_203447.3):c.4041C>A (p.D1347E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.420966C>A" "" "VUS" "" "0000538271" "0" "30" "9" "429816" "429816" "subst" "0.000861256" "01943" "C9orf66_000036" "g.429816C>G" "" "" "" "DOCK8(NM_203447.3):c.4588C>G (p.L1530V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.429816C>G" "" "likely benign" "" "0000538272" "0" "10" "9" "432153" "432154" "del" "0" "02326" "C9orf66_000037" "g.432153_432154del" "" "" "" "DOCK8(NM_203447.3):c.4627-13_4627-12delTT, DOCK8(NM_203447.4):c.4627-13_4627-12delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.432153_432154del" "" "benign" "" "0000538274" "0" "50" "9" "432263" "432263" "subst" "0.000292431" "01943" "C9orf66_000039" "g.432263G>A" "" "" "" "DOCK8(NM_203447.3):c.4724G>A (p.R1575K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.432263G>A" "" "VUS" "" "0000538291" "0" "30" "9" "441392" "441392" "subst" "0" "01943" "C9orf66_000040" "g.441392G>C" "" "" "" "DOCK8(NM_203447.3):c.5330G>C (p.R1777T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.441392G>C" "" "likely benign" "" "0000538292" "0" "50" "9" "446455" "446455" "subst" "0" "01943" "C9orf66_000041" "g.446455A>C" "" "" "" "DOCK8(NM_203447.3):c.5666A>C (p.N1889T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.446455A>C" "" "VUS" "" "0000538293" "0" "30" "9" "446588" "446588" "subst" "1.63341E-5" "01943" "C9orf66_000042" "g.446588C>T" "" "" "" "DOCK8(NM_203447.3):c.5799C>T (p.S1933=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.446588C>T" "" "likely benign" "" "0000538294" "0" "30" "9" "451995" "452003" "del" "0" "02326" "C9orf66_000043" "g.451995_452003del" "" "" "" "DOCK8(NM_203447.3):c.5962-16_5962-8delTTTTTTTTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.451995_452003del" "" "likely benign" "" "0000538295" "0" "30" "9" "463510" "463510" "subst" "2.84391E-5" "02326" "C9orf66_000044" "g.463510A>G" "" "" "" "DOCK8(NM_203447.3):c.6069-7A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.463510A>G" "" "likely benign" "" "0000612073" "0" "30" "9" "312110" "312110" "subst" "0.00010159" "01943" "C9orf66_000046" "g.312110G>C" "" "" "" "DOCK8(NM_203447.3):c.685G>C (p.A229P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.312110G>C" "" "likely benign" "" "0000612125" "0" "50" "9" "370245" "370245" "subst" "2.43736E-5" "01943" "C9orf66_000048" "g.370245T>C" "" "" "" "DOCK8(NM_203447.3):c.1813T>C (p.S605P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.370245T>C" "" "VUS" "" "0000612126" "0" "50" "9" "377043" "377043" "subst" "3.25616E-5" "02327" "C9orf66_000049" "g.377043C>T" "" "" "" "DOCK8(NM_203447.4):c.2272C>T (p.(Arg758Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.377043C>T" "" "VUS" "" "0000612127" "0" "50" "9" "377067" "377067" "subst" "4.89349E-5" "01943" "C9orf66_000050" "g.377067G>A" "" "" "" "DOCK8(NM_203447.3):c.2296G>A (p.E766K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.377067G>A" "" "VUS" "" "0000612128" "0" "50" "9" "377143" "377143" "subst" "4.16576E-6" "02327" "C9orf66_000051" "g.377143T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.377143T>C" "" "VUS" "" "0000612130" "0" "30" "9" "379924" "379924" "subst" "0.000215851" "01943" "C9orf66_000052" "g.379924T>C" "" "" "" "DOCK8(NM_203447.3):c.2594T>C (p.V865A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.379924T>C" "" "likely benign" "" "0000612133" "0" "70" "9" "386427" "386427" "subst" "0" "02327" "C9orf66_000053" "g.386427G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.386427G>T" "" "likely pathogenic" "" "0000612134" "0" "50" "9" "399204" "399204" "subst" "4.06237E-6" "01943" "C9orf66_000055" "g.399204T>C" "" "" "" "DOCK8(NM_203447.3):c.3179T>C (p.L1060P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.399204T>C" "" "VUS" "" "0000612144" "0" "50" "9" "439392" "439392" "subst" "0.000641744" "01943" "C9orf66_000056" "g.439392A>G" "" "" "" "DOCK8(NM_203447.3):c.5223+4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.439392A>G" "" "VUS" "" "0000622250" "0" "30" "9" "289557" "289557" "subst" "0.00198347" "02326" "C9orf66_000009" "g.289557G>A" "" "" "" "DOCK8(NM_203447.3):c.380G>A (p.R127H), DOCK8(NM_203447.4):c.380G>A (p.R127H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.289557G>A" "" "likely benign" "" "0000622254" "0" "30" "9" "328041" "328041" "subst" "4.06339E-6" "01943" "C9orf66_000047" "g.328041G>T" "" "" "" "DOCK8(NM_203447.3):c.914G>T (p.C305F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.328041G>T" "" "likely benign" "" "0000622273" "0" "30" "9" "396872" "396872" "subst" "0.000471146" "01943" "C9orf66_000054" "g.396872A>G" "" "" "" "DOCK8(NM_203447.3):c.3058A>G (p.I1020V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.396872A>G" "" "likely benign" "" "0000622277" "0" "30" "9" "446570" "446570" "subst" "0.000268791" "02326" "C9orf66_000057" "g.446570C>T" "" "" "" "DOCK8(NM_203447.3):c.5781C>T (p.Y1927=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.446570C>T" "" "likely benign" "" "0000652698" "1" "30" "9" "312134" "312134" "subst" "0.0283043" "03575" "DOCK8_000015" "g.312134G>A" "231/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "231 heterozygous; {DB:CLININrs11789099}" "Germline" "" "rs11789099" "0" "" "" "g.312134G>A" "" "likely benign" "" "0000652702" "1" "50" "9" "328113" "328113" "subst" "0.000971189" "03575" "DOCK8_000104" "g.328113C>T" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 3 heterozygous, no homozygous; {DB:CLININrs75352090}" "Germline" "" "rs75352090" "0" "" "" "g.328113C>T" "" "VUS" "" "0000652715" "1" "30" "9" "368128" "368128" "subst" "0.0772103" "03575" "DOCK8_000031" "g.368128C>T" "79/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "79 heterozygous; {DB:CLININrs17673268}" "Germline" "" "rs17673268" "0" "" "" "g.368128C>T" "" "likely benign" "" "0000652721" "1" "50" "9" "396836" "396836" "subst" "0.00101547" "03575" "C9orf66_000020" "g.396836C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs16937932}" "Germline" "" "rs16937932" "0" "" "" "g.396836C>T" "" "VUS" "" "0000652722" "1" "50" "9" "406999" "406999" "subst" "0.00288609" "03575" "C9orf66_000027" "g.406999C>T" "50/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 50 heterozygous, no homozygous; {DB:CLININrs34390308}" "Germline" "" "rs34390308" "0" "" "" "g.406999C>T" "" "VUS" "" "0000652727" "1" "50" "9" "420579" "420579" "subst" "0.00274531" "03575" "DOCK8_000068" "g.420579A>G" "8/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 8 heterozygous, no homozygous; {DB:CLININrs116920018}" "Germline" "" "rs116920018" "0" "" "" "g.420579A>G" "" "VUS" "" "0000656338" "0" "50" "9" "304628" "304628" "subst" "0.00138116" "01943" "DOCK8_000001" "g.304628G>A" "" "" "" "DOCK8(NM_203447.3):c.452G>A (p.R151Q), DOCK8(NM_203447.4):c.452G>A (p.R151Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.304628G>A" "" "VUS" "" "0000656339" "0" "30" "9" "304646" "304646" "subst" "0.000515828" "01943" "C9orf66_000058" "g.304646C>T" "" "" "" "DOCK8(NM_203447.3):c.470C>T (p.T157M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.304646C>T" "" "likely benign" "" "0000656340" "0" "30" "9" "312048" "312048" "subst" "2.43736E-5" "01943" "C9orf66_000059" "g.312048A>G" "" "" "" "DOCK8(NM_203447.3):c.623A>G (p.K208R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.312048A>G" "" "likely benign" "" "0000656344" "0" "30" "9" "332451" "332451" "subst" "3.65643E-5" "01943" "C9orf66_000060" "g.332451G>A" "" "" "" "DOCK8(NM_203447.3):c.1098G>A (p.T366=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.332451G>A" "" "likely benign" "" "0000656360" "0" "50" "9" "399148" "399148" "subst" "3.25251E-5" "02325" "C9orf66_000061" "g.399148A>C" "" "" "" "DOCK8(NM_203447.4):c.3123A>C (p.E1041D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.399148A>C" "" "VUS" "" "0000656361" "0" "30" "9" "399267" "399268" "ins" "0" "01943" "C9orf66_000062" "g.399267_399268insGC" "" "" "" "DOCK8(NM_203447.3):c.3234+8_3234+9insGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.399267_399268insGC" "" "likely benign" "" "0000656362" "0" "30" "9" "426926" "426926" "subst" "0.000199054" "02326" "C9orf66_000063" "g.426926A>G" "" "" "" "DOCK8(NM_203447.3):c.4283A>G (p.N1428S), DOCK8(NM_203447.4):c.4283A>G (p.N1428S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.426926A>G" "" "likely benign" "" "0000656364" "0" "50" "9" "443437" "443437" "subst" "0" "02325" "C9orf66_000064" "g.443437G>A" "" "" "" "DOCK8(NM_203447.4):c.5501G>A (p.G1834D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.443437G>A" "" "VUS" "" "0000656365" "0" "10" "9" "449874" "449874" "subst" "0.0617069" "02326" "C9orf66_000065" "g.449874G>C" "" "" "" "DOCK8(NM_203447.3):c.5908G>C (p.A1970P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.449874G>C" "" "benign" "" "0000656366" "0" "30" "9" "451994" "452003" "del" "0" "01943" "C9orf66_000066" "g.451994_452003del" "" "" "" "DOCK8(NM_203447.3):c.5962-17_5962-8delTTTTTTTTTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.451994_452003del" "" "likely benign" "" "0000660601" "0" "50" "9" "407035" "407035" "subst" "0" "00006" "DOCK8_000105" "g.407035G>T" "" "{PMID:Redin 2014:25167861}" "" "Gln735His" "phenotype fits better with PHF8 variant" "De novo" "" "" "0" "" "" "g.407035G>T" "" "VUS" "" "0000670065" "3" "30" "9" "312134" "312134" "subst" "0.0283043" "03575" "DOCK8_000015" "g.312134G>A" "9/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "9 homozygous; {DB:CLININrs11789099}" "Germline" "" "rs11789099" "0" "" "" "g.312134G>A" "" "likely benign" "" "0000670066" "3" "30" "9" "368128" "368128" "subst" "0.0772103" "03575" "DOCK8_000031" "g.368128C>T" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 homozygous; {DB:CLININrs17673268}" "Germline" "" "rs17673268" "0" "" "" "g.368128C>T" "" "likely benign" "" "0000678655" "0" "30" "9" "312005" "312005" "subst" "0.000495883" "02326" "DOCK8_000011" "g.312005G>A" "" "" "" "DOCK8(NM_203447.3):c.580G>A (p.V194I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678681" "0" "30" "9" "377075" "377075" "subst" "8.16787E-6" "01943" "C9orf66_000067" "g.377075G>A" "" "" "" "DOCK8(NM_203447.3):c.2304G>A (p.A768=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678682" "0" "50" "9" "407019" "407019" "subst" "0" "01943" "C9orf66_000068" "g.407019C>A" "" "" "" "DOCK8(NM_203447.3):c.3480C>A (p.T1160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000678686" "0" "50" "9" "418074" "418074" "subst" "0" "01943" "C9orf66_000069" "g.418074A>G" "" "" "" "DOCK8(NM_203447.3):c.3707A>G (p.D1236G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000678687" "0" "30" "9" "420579" "420579" "subst" "0.00274531" "02325" "DOCK8_000068" "g.420579A>G" "" "" "" "DOCK8(NM_203447.3):c.4019A>G (p.Y1340C), DOCK8(NM_203447.4):c.4019A>G (p.Y1340C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690515" "0" "70" "9" "271626" "271626" "subst" "0.000265763" "01943" "DOCK8_000003" "g.271626G>T" "" "" "" "DOCK8(NM_203447.3):c.54-1G>T, DOCK8(NM_203447.4):c.54-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000690516" "0" "50" "9" "312113" "312113" "subst" "1.62562E-5" "02325" "C9orf66_000070" "g.312113C>T" "" "" "" "DOCK8(NM_203447.4):c.688C>T (p.R230W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690521" "0" "50" "9" "328143" "328143" "subst" "0.000130126" "01943" "DOCK8_000020" "g.328143C>T" "" "" "" "DOCK8(NM_203447.3):c.1016C>T (p.P339L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690523" "0" "50" "9" "334277" "334277" "subst" "4.0653E-5" "01943" "C9orf66_000071" "g.334277G>A" "" "" "" "DOCK8(NM_203447.3):c.1178G>A (p.R393H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690552" "0" "30" "9" "372297" "372297" "del" "0" "02326" "C9orf66_000072" "g.372297del" "" "" "" "DOCK8(NM_203447.3):c.2109+11delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690555" "0" "30" "9" "377135" "377135" "subst" "0" "01943" "C9orf66_000073" "g.377135C>T" "" "" "" "DOCK8(NM_203447.3):c.2364C>T (p.L788=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690561" "0" "30" "9" "418051" "418051" "subst" "0.000999391" "02326" "C9orf66_000074" "g.418051C>T" "" "" "" "DOCK8(NM_203447.3):c.3701-17C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690562" "0" "50" "9" "439371" "439371" "subst" "4.07272E-6" "01943" "C9orf66_000075" "g.439371G>A" "" "" "" "DOCK8(NM_203447.3):c.5206G>A (p.A1736T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000690563" "0" "50" "9" "441407" "441407" "subst" "0" "01943" "C9orf66_000076" "g.441407T>C" "" "" "" "DOCK8(NM_203447.3):c.5345T>C (p.I1782T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000701846" "3" "50" "9" "286599" "286599" "subst" "0.000215321" "00006" "DOCK8_000106" "g.286599G>A" "" "{PMID:Riazuddin 2017:27457812}" "" "" "" "Germline" "" "" "0" "" "" "g.286599G>A" "" "VUS" "" "0000708585" "1" "90" "9" "214865" "465259" "del" "0" "00006" "DOCK8_000107" "g.(?_214865)_(465259_?)del" "" "" "" "del coding sequence" "" "Germline" "" "" "0" "" "" "g.(?_214865)_(465259_?)del" "" "pathogenic (recessive)" "" "0000708586" "2" "90" "9" "325672" "386427" "del" "0" "00006" "DOCK8_000108" "g.(317131_325672)_(386427_390470)del" "" "" "" "del ex8-23" "" "Germline" "" "" "0" "" "" "g.(317131_325672)_(386427_390470)del" "" "pathogenic (recessive)" "" "0000722479" "0" "50" "9" "312088" "312088" "subst" "0.00174266" "02329" "DOCK8_000012" "g.312088C>A" "" "" "" "DOCK8(NM_203447.3):c.663C>A (p.D221E), DOCK8(NM_203447.4):c.663C>A (p.D221E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722488" "0" "50" "9" "325717" "325717" "subst" "0.000170707" "01943" "C9orf66_000077" "g.325717G>A" "" "" "" "DOCK8(NM_203447.3):c.874G>A (p.D292N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722492" "0" "50" "9" "340265" "340265" "subst" "0.000349534" "02329" "DOCK8_000028" "g.340265C>G" "" "" "" "DOCK8(NM_203447.4):c.1623C>G (p.H541Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722531" "0" "50" "9" "370226" "370226" "subst" "8.12539E-6" "02329" "C9orf66_000017" "g.370226A>G" "" "" "" "DOCK8(NM_203447.4):c.1798-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722533" "0" "50" "9" "372251" "372251" "subst" "0" "01943" "C9orf66_000078" "g.372251A>G" "" "" "" "DOCK8(NM_203447.3):c.2074A>G (p.K692E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722536" "0" "50" "9" "379824" "379824" "subst" "0" "02329" "DOCK8_000043" "g.379824C>T" "" "" "" "DOCK8(NM_203447.4):c.2494C>T (p.H832Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722537" "0" "50" "9" "399245" "399245" "subst" "0.000719483" "02325" "DOCK8_000051" "g.399245C>A" "" "" "" "DOCK8(NM_001190458.1):c.2920C>A (p.(His974Asn)), DOCK8(NM_203447.3):c.3220C>A (p.H1074N), DOCK8(NM_203447.4):c.3220C>A (p.H1074N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722538" "0" "30" "9" "399274" "399274" "del" "0" "01943" "DOCK8_000052" "g.399274del" "" "" "" "DOCK8(NM_203447.3):c.3234+15delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722539" "0" "30" "9" "404957" "404957" "subst" "1.62504E-5" "01943" "C9orf66_000079" "g.404957A>G" "" "" "" "DOCK8(NM_203447.3):c.3274A>G (p.M1092V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722540" "0" "50" "9" "422043" "422043" "subst" "0" "01943" "DOCK8_000072" "g.422043C>G" "" "" "" "DOCK8(NM_001190458.1):c.3854-5C>G (p.?), DOCK8(NM_203447.3):c.4154-5C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722541" "0" "10" "9" "434767" "434767" "subst" "0.000951908" "02326" "C9orf66_000080" "g.434767C>T" "" "" "" "DOCK8(NM_203447.3):c.4887-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000722542" "0" "30" "9" "439370" "439370" "subst" "3.66429E-5" "01943" "C9orf66_000081" "g.439370C>T" "" "" "" "DOCK8(NM_203447.3):c.5205C>T (p.A1735=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000734175" "0" "70" "9" "328163" "328163" "subst" "0.000175456" "04011" "DOCK8_000109" "g.328163G>A" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734604" "0" "70" "9" "328113" "328113" "subst" "0.000971189" "04011" "DOCK8_000104" "g.328113C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734663" "0" "70" "9" "434872" "434872" "subst" "6.90821E-5" "04011" "DOCK8_000112" "g.434872C>T" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000735025" "0" "70" "9" "377207" "377207" "subst" "0" "04011" "DOCK8_000111" "g.377207G>C" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000735427" "0" "70" "9" "452069" "452069" "subst" "0" "04011" "DOCK8_000113" "g.452069A>G" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000735485" "0" "70" "9" "286460" "286460" "subst" "0" "04011" "DOCK8_000110" "g.286460G>C" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000804087" "0" "30" "9" "289557" "289557" "subst" "0.00198347" "02325" "C9orf66_000009" "g.289557G>A" "" "" "" "DOCK8(NM_203447.3):c.380G>A (p.R127H), DOCK8(NM_203447.4):c.380G>A (p.R127H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804088" "0" "30" "9" "304574" "304574" "subst" "1.22092E-5" "01943" "C9orf66_000082" "g.304574A>T" "" "" "" "DOCK8(NM_203447.3):c.405-7A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804089" "0" "50" "9" "317046" "317046" "subst" "9.75031E-5" "01943" "C9orf66_000083" "g.317046G>A" "" "" "" "DOCK8(NM_203447.3):c.745G>A (p.D249N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804130" "0" "50" "9" "368021" "368021" "subst" "0.000113791" "01943" "C9orf66_000016" "g.368021C>A" "" "" "" "DOCK8(NM_001190458.1):c.1479C>A (p.(Asn493Lys)), DOCK8(NM_203447.3):c.1683C>A (p.N561K), DOCK8(NM_203447.4):c.1683C>A (p.N561K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804131" "0" "50" "9" "368021" "368021" "subst" "0.000113791" "02325" "C9orf66_000016" "g.368021C>A" "" "" "" "DOCK8(NM_001190458.1):c.1479C>A (p.(Asn493Lys)), DOCK8(NM_203447.3):c.1683C>A (p.N561K), DOCK8(NM_203447.4):c.1683C>A (p.N561K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804136" "0" "50" "9" "370226" "370226" "subst" "8.12539E-6" "02325" "C9orf66_000017" "g.370226A>G" "" "" "" "DOCK8(NM_203447.4):c.1798-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804137" "0" "50" "9" "371428" "371428" "subst" "0" "02327" "C9orf66_000084" "g.371428G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804138" "0" "90" "9" "371522" "371522" "subst" "4.0625E-6" "02327" "C9orf66_000085" "g.371522C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000804143" "0" "30" "9" "382536" "382536" "subst" "0" "01943" "C9orf66_000086" "g.382536C>T" "" "" "" "DOCK8(NM_203447.3):c.2629C>T (p.P877S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804152" "0" "50" "9" "420404" "420404" "subst" "8.12348E-6" "01943" "DOCK8_000065" "g.420404T>C" "" "" "" "DOCK8(NM_001190458.1):c.3544T>C (p.(Tyr1182His)), DOCK8(NM_203447.3):c.3844T>C (p.Y1282H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804154" "0" "30" "9" "433981" "433981" "subst" "1.62595E-5" "01943" "DOCK8_000079" "g.433981C>T" "" "" "" "DOCK8(NM_203447.3):c.4886+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804157" "0" "30" "9" "446365" "446365" "subst" "4.06468E-6" "01943" "C9orf66_000089" "g.446365C>T" "" "" "" "DOCK8(NM_203447.3):c.5581-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000804158" "0" "50" "9" "446401" "446401" "subst" "0.000410192" "02325" "DOCK8_000089" "g.446401A>G" "" "" "" "DOCK8(NM_203447.3):c.5612A>G (p.Y1871C), DOCK8(NM_203447.4):c.5612A>G (p.Y1871C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000818155" "3" "90" "9" "446414" "446414" "subst" "0" "04135" "DOCK8_000114" "g.446414T>G" "" "{PMID:Alsum 2013:22968740}, {DOI:Alsum 2013:10.1007/s10875-012-9769-x}" "" "Y1875X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000818993" "3" "90" "9" "446414" "446414" "subst" "0" "04135" "DOCK8_000114" "g.446414T>G" "" "{PMID:Alsum 2013:22968740}" "" "Y1875X" "" "Germline" "yes" "" "0" "" "" "g.446414T>G" "" "pathogenic (recessive)" "" "0000818995" "3" "90" "9" "446414" "446414" "subst" "0" "04135" "DOCK8_000114" "g.446414T>G" "" "{PMID:Alsum 2013:22968740}, {DOI:Alsum 2013:10.1007/s10875-012-9769-x}" "" "Y1875X" "" "Germline" "yes" "" "0" "" "" "g.446414T>G" "" "pathogenic (recessive)" "" "0000852249" "0" "30" "9" "304711" "304711" "subst" "0.00052797" "02326" "C9orf66_000090" "g.304711C>A" "" "" "" "DOCK8(NM_203447.3):c.528+7C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852283" "0" "30" "9" "371440" "371440" "subst" "0.000243831" "02326" "C9orf66_000091" "g.371440T>C" "" "" "" "DOCK8(NM_203447.3):c.1881T>C (p.F627=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852293" "0" "50" "9" "420579" "420579" "subst" "0.00274531" "02326" "DOCK8_000068" "g.420579A>G" "" "" "" "DOCK8(NM_203447.3):c.4019A>G (p.Y1340C), DOCK8(NM_203447.4):c.4019A>G (p.Y1340C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852294" "0" "30" "9" "451977" "451990" "del" "0" "02326" "C9orf66_000094" "g.451977_451990del" "" "" "" "DOCK8(NM_203447.3):c.5962-34_5962-18delATTTTTTTTTTTTTTTTinsTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861702" "0" "50" "9" "386334" "386334" "subst" "1.2187E-5" "01943" "C9orf66_000092" "g.386334G>A" "" "" "" "DOCK8(NM_203447.3):c.2782G>A (p.A928T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861705" "0" "30" "9" "399255" "399255" "subst" "0.0477765" "01804" "C9orf66_000022" "g.399255G>A" "" "" "" "DOCK8(NM_001190458.1):c.2930G>A (p.(Ser977Asn)), DOCK8(NM_203447.3):c.3230G>A (p.S1077N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861707" "0" "50" "9" "426926" "426926" "subst" "0.000199054" "02325" "C9orf66_000063" "g.426926A>G" "" "" "" "DOCK8(NM_203447.3):c.4283A>G (p.N1428S), DOCK8(NM_203447.4):c.4283A>G (p.N1428S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861708" "0" "50" "9" "429714" "429714" "subst" "3.24897E-5" "01943" "C9orf66_000093" "g.429714C>T" "" "" "" "DOCK8(NM_203447.3):c.4486C>T (p.L1496F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888803" "0" "30" "9" "304661" "304661" "subst" "2.43663E-5" "02326" "DOCK8_000100" "g.304661C>T" "" "" "" "DOCK8(NM_203447.3):c.485C>T (p.T162M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888804" "0" "30" "9" "311984" "311984" "subst" "2.03409E-5" "02326" "C9orf66_000095" "g.311984G>A" "" "" "" "DOCK8(NM_203447.3):c.559G>A (p.D187N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888817" "0" "30" "9" "336582" "336582" "subst" "4.0623E-6" "02326" "C9orf66_000096" "g.336582G>A" "" "" "" "DOCK8(NM_203447.3):c.1286G>A (p.G429E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888859" "0" "50" "9" "372194" "372194" "subst" "0.000117832" "02325" "DOCK8_000037" "g.372194A>G" "" "" "" "DOCK8(NM_203447.4):c.2017A>G (p.I673V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888861" "0" "30" "9" "377046" "377046" "subst" "0.000256479" "02326" "C9orf66_000097" "g.377046G>A" "" "" "" "DOCK8(NM_203447.3):c.2275G>A (p.V759M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888864" "0" "30" "9" "396771" "396771" "subst" "0.00245008" "02326" "C9orf66_000087" "g.396771A>G" "" "" "" "DOCK8(NM_203447.3):c.2971-14A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888865" "0" "30" "9" "406999" "406999" "subst" "0.00288609" "02326" "C9orf66_000027" "g.406999C>T" "" "" "" "DOCK8(NM_203447.3):c.3460C>T (p.R1154C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888870" "0" "10" "9" "418210" "418210" "subst" "0.0020588" "02326" "C9orf66_000098" "g.418210A>G" "" "" "" "DOCK8(NM_203447.3):c.3840+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000888872" "0" "70" "9" "432165" "432165" "subst" "0" "02329" "C9orf66_000099" "g.432165G>T" "" "" "" "DOCK8(NM_203447.4):c.4627-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000888873" "0" "50" "9" "443482" "443482" "subst" "0" "02325" "C9orf66_000100" "g.443482C>A" "" "" "" "DOCK8(NM_203447.4):c.5546C>A (p.T1849N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888874" "0" "30" "9" "446351" "446351" "subst" "0" "02326" "C9orf66_000101" "g.446351C>G" "" "" "" "DOCK8(NM_203447.3):c.5581-19C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888875" "0" "30" "9" "452113" "452113" "subst" "9.40672E-5" "02326" "C9orf66_000102" "g.452113A>G" "" "" "" "DOCK8(NM_203447.3):c.6064A>G (p.M2022V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000904111" "0" "30" "9" "312047" "312047" "subst" "0" "04425" "DOCK8_000116" "g.312047A>G" "1/140 atopic dermatis patients" "{DOI:Perälä 2023:10.1016/j.xjidi.2023.100203}" "" "" "" "Germline" "?" "" "0" "" "" "" "" "VUS" "other" "0000904112" "0" "70" "9" "286609" "286609" "subst" "0" "04425" "DOCK8_000120" "g.286609C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "" "" "VUS" "ACMG" "0000904113" "0" "50" "9" "414786" "414786" "subst" "0" "04425" "DOCK8_000118" "g.414786A>T" "1/140 atopic dermatis patients" "" "" "" "" "Germline" "?" "" "0" "" "" "" "" "VUS" "other" "0000904114" "0" "30" "9" "334250" "334250" "subst" "0" "04425" "DOCK8_000117" "g.334250A>G" "1/140 atopic dermatis patients" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "other" "0000904115" "0" "50" "9" "449788" "449788" "subst" "0" "04425" "DOCK8_000119" "g.449788T>C" "1/140 atopic dermatis patients" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "other" "0000904116" "0" "50" "9" "271649" "271649" "subst" "0" "04425" "DOCK8_000115" "g.271649A>C" "1/140 atopic dermatis patients" "" "" "" "" "Germline" "?" "" "0" "" "" "" "" "VUS" "other" "0000913146" "0" "30" "9" "336577" "336577" "subst" "8.12499E-6" "02326" "C9orf66_000103" "g.336577T>A" "" "" "" "DOCK8(NM_203447.3):c.1286-5T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913147" "0" "30" "9" "336736" "336736" "subst" "5.29014E-5" "02326" "C9orf66_000104" "g.336736A>T" "" "" "" "DOCK8(NM_203447.3):c.1422+18A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913166" "0" "50" "9" "379890" "379890" "subst" "0" "02329" "C9orf66_000105" "g.379890T>C" "" "" "" "DOCK8(NM_203447.4):c.2560T>C (p.Y854H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913167" "0" "30" "9" "382567" "382567" "subst" "0" "02326" "C9orf66_000106" "g.382567C>T" "" "" "" "DOCK8(NM_203447.3):c.2660C>T (p.S887L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913168" "0" "50" "9" "396837" "396837" "subst" "0.000727051" "02325" "DOCK8_000049" "g.396837G>A" "" "" "" "DOCK8(NM_203447.3):c.3023G>A (p.R1008Q), DOCK8(NM_203447.4):c.3023G>A (p.R1008Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913169" "0" "50" "9" "404995" "404995" "subst" "0.000698795" "02325" "DOCK8_000054" "g.404995G>C" "" "" "" "DOCK8(NM_203447.3):c.3312G>C (p.E1104D), DOCK8(NM_203447.4):c.3312G>C (p.E1104D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913170" "0" "30" "9" "418222" "418222" "subst" "0" "02326" "C9orf66_000107" "g.418222A>T" "" "" "" "DOCK8(NM_203447.3):c.3840+15A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913171" "0" "30" "9" "441358" "441358" "subst" "0.00015837" "02326" "DOCK8_000084" "g.441358C>T" "" "" "" "DOCK8(NM_203447.3):c.5296C>T (p.R1766W), DOCK8(NM_203447.4):c.5296C>T (p.R1766W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000920249" "3" "90" "9" "24850" "379936" "del" "0" "00006" "DOCK8_000121" "g.(?_24850)_(379936_?)del" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "del ex1-19, hg19 (24850-379936)x0" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000920253" "3" "50" "9" "463585" "463585" "subst" "0" "00006" "DOCK8_000124" "g.463585T>G" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "" "Germline" "" "" "0" "" "" "g.463585T>G" "" "VUS" "ACMG" "0000920282" "3" "50" "9" "429930" "429930" "subst" "0" "00006" "DOCK8_000123" "g.429930A>G" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "" "" "Germline" "" "" "0" "" "" "g.429930A>G" "" "VUS" "ACMG" "0000920289" "3" "90" "9" "368128" "452113" "del" "0" "00006" "DOCK8_000122" "g.(?_368128)_(452113_?)del" "" "{PMID:Stray-Pedersen 2017:27577878}" "" "hg19 (368128-452113)x0" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000925055" "0" "30" "9" "377181" "377181" "subst" "4.74338E-5" "02326" "C9orf66_000108" "g.377181G>A" "" "" "" "DOCK8(NM_203447.3):c.2410G>A (p.V804M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925056" "0" "30" "9" "377224" "377233" "del" "0" "02326" "C9orf66_000109" "g.377224_377233del" "" "" "" "DOCK8(NM_203447.3):c.2440+13_2440+22delAGGGCTGGGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925057" "0" "30" "9" "396805" "396805" "subst" "1.62513E-5" "02326" "C9orf66_000110" "g.396805C>T" "" "" "" "DOCK8(NM_203447.3):c.2991C>T (p.H997=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925058" "0" "50" "9" "396837" "396837" "subst" "0.000727051" "02326" "DOCK8_000049" "g.396837G>A" "" "" "" "DOCK8(NM_203447.3):c.3023G>A (p.R1008Q), DOCK8(NM_203447.4):c.3023G>A (p.R1008Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929589" "0" "10" "9" "304717" "304717" "subst" "0.00287548" "02326" "C9orf66_000111" "g.304717A>G" "" "" "" "DOCK8(NM_203447.3):c.528+13A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000929594" "0" "30" "9" "332496" "332496" "subst" "4.06597E-6" "02326" "C9orf66_000112" "g.332496T>C" "" "" "" "DOCK8(NM_203447.3):c.1125+18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000934953" "0" "90" "9" "0" "0" "" "" "00006" "DOCK8_000125" "g.[NC_000023.10:g.(31366752_31462597)]ins(?_271627)_(328093_?)inv" "" "{PMID:Kekou 2023:37754746}" "" "" "DOCK8 insertion in the DMD gene, origin DOCK8 sequences unknown" "DUPLICATE record" "" "" "0" "" "" "g.[NC_000023.11:g.(31348635_31444480)]ins(?_271627)_(328093_?)inv" "" "VUS (!)" "" "0000949267" "0" "10" "9" "312104" "312104" "subst" "0.00181208" "02326" "DOCK8_000013" "g.312104G>A" "" "" "" "DOCK8(NM_001190458.1):c.475G>A (p.(Glu159Lys)), DOCK8(NM_203447.3):c.679G>A (p.E227K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000949268" "0" "50" "9" "312114" "312114" "subst" "4.87706E-5" "02329" "C9orf66_000113" "g.312114G>A" "" "" "" "DOCK8(NM_203447.4):c.689G>A (p.R230Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000949302" "0" "30" "9" "396780" "396780" "subst" "7.31345E-5" "02326" "C9orf66_000114" "g.396780C>T" "" "" "" "DOCK8(NM_203447.3):c.2971-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949304" "0" "30" "9" "420544" "420544" "subst" "0" "02326" "C9orf66_000115" "g.420544A>G" "" "" "" "DOCK8(NM_203447.3):c.3984A>G (p.L1328=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000965386" "0" "50" "9" "334385" "334385" "subst" "0" "02325" "DOCK8_000025" "g.334385G>A" "" "" "" "DOCK8(NM_203447.3):c.1285+1G>A, DOCK8(NM_203447.4):c.1285+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000965447" "0" "30" "9" "432153" "432154" "del" "0" "02329" "C9orf66_000037" "g.432153_432154del" "" "" "" "DOCK8(NM_203447.3):c.4627-13_4627-12delTT, DOCK8(NM_203447.4):c.4627-13_4627-12delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000965456" "0" "10" "9" "451977" "451985" "del" "0" "02329" "C9orf66_000116" "g.451977_451985del" "" "" "" "DOCK8(NM_203447.4):c.5962-34_5962-26delATTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000965457" "0" "30" "9" "451991" "452002" "del" "0" "02329" "C9orf66_000117" "g.451991_452002del" "" "" "" "DOCK8(NM_203447.4):c.5962-20_5962-9delTTTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978670" "0" "50" "9" "304628" "304628" "subst" "0.00138116" "02325" "DOCK8_000001" "g.304628G>A" "" "" "" "DOCK8(NM_203447.3):c.452G>A (p.R151Q), DOCK8(NM_203447.4):c.452G>A (p.R151Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978675" "0" "30" "9" "334222" "334222" "subst" "3.25219E-5" "01804" "C9orf66_000118" "g.334222C>T" "" "" "" "DOCK8(NM_203447.4):c.1126-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978713" "0" "50" "9" "370255" "370255" "subst" "1.21875E-5" "01804" "C9orf66_000119" "g.370255C>G" "" "" "" "DOCK8(NM_203447.4):c.1823C>G (p.(Pro608Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978716" "0" "50" "9" "376207" "376207" "subst" "0" "01804" "C9orf66_000120" "g.376207C>G" "" "" "" "DOCK8(NM_203447.4):c.2110-3C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978717" "0" "50" "9" "377043" "377043" "subst" "3.25616E-5" "01804" "C9orf66_000049" "g.377043C>T" "" "" "" "DOCK8(NM_203447.4):c.2272C>T (p.(Arg758Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978725" "0" "50" "9" "396845" "396845" "subst" "0.000129969" "01804" "C9orf66_000121" "g.396845C>T" "" "" "" "DOCK8(NM_203447.4):c.3031C>T (p.(Arg1011Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978726" "0" "30" "9" "399269" "399269" "subst" "0" "01804" "C9orf66_000122" "g.399269C>A" "" "" "" "DOCK8(NM_203447.4):c.3234+10C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978735" "0" "50" "9" "464206" "464206" "subst" "1.21824E-5" "01804" "C9orf66_000123" "g.464206C>G" "" "" "" "DOCK8(NM_203447.4):c.6287C>G (p.(Ser2096*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997829" "0" "30" "9" "286594" "286594" "subst" "4.06286E-6" "01804" "C9orf66_000124" "g.286594C>T" "" "" "" "DOCK8(NM_203447.3):c.290C>T (p.(Ser97Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997830" "0" "30" "9" "304636" "304636" "subst" "0" "01804" "C9orf66_000125" "g.304636T>A" "" "" "" "DOCK8(NM_203447.3):c.460T>A (p.(Phe154Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997836" "0" "50" "9" "328062" "328062" "subst" "0" "01804" "C9orf66_000126" "g.328062T>C" "" "" "" "DOCK8(NM_203447.3):c.935T>C (p.(Ile312Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997901" "0" "30" "9" "406969" "406969" "subst" "4.06458E-6" "01804" "C9orf66_000127" "g.406969G>A" "" "" "" "DOCK8(NM_203447.3):c.3430G>A (p.(Ala1144Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997904" "0" "30" "9" "418128" "418128" "subst" "0" "01804" "C9orf66_000128" "g.418128C>T" "" "" "" "DOCK8(NM_203447.3):c.3761C>T (p.(Thr1254Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997911" "0" "50" "9" "441362" "441362" "subst" "0" "01804" "C9orf66_000130" "g.441362A>C" "" "" "" "DOCK8(NM_203447.3):c.5300A>C (p.(Gln1767Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997912" "0" "30" "9" "451975" "451988" "del" "0" "02329" "C9orf66_000131" "g.451975_451988del" "" "" "" "DOCK8(NM_203447.4):c.5962-36_5962-23delATATTTTTTTTTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014558" "0" "50" "9" "426895" "426895" "subst" "2.84377E-5" "02325" "C9orf66_000132" "g.426895G>A" "" "" "" "DOCK8(NM_203447.4):c.4252G>A (p.E1418K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037477" "0" "70" "9" "271626" "271626" "subst" "0.000265763" "01804" "DOCK8_000003" "g.271626G>T" "" "" "" "DOCK8(NM_203447.3):c.54-1G>T, DOCK8(NM_203447.4):c.54-1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001037490" "0" "50" "9" "334291" "334291" "subst" "2.4394E-5" "01804" "C9orf66_000133" "g.334291C>T" "" "" "" "DOCK8(NM_203447.4):c.1192C>T (p.(Arg398Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037537" "0" "30" "9" "371420" "371420" "subst" "0" "01804" "C9orf66_000134" "g.371420T>G" "" "" "" "DOCK8(NM_203447.4):c.1869-8T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037549" "0" "10" "9" "432154" "432154" "del" "0" "02329" "C9orf66_000135" "g.432154del" "" "" "" "DOCK8(NM_203447.4):c.4627-12delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001037554" "0" "50" "9" "446434" "446434" "subst" "2.43671E-5" "01804" "C9orf66_000136" "g.446434C>A" "" "" "" "DOCK8(NM_203447.4):c.5645C>A (p.(Thr1882Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001037555" "0" "30" "9" "452002" "452002" "del" "0" "01804" "C9orf66_000137" "g.452002del" "" "" "" "DOCK8(NM_203447.4):c.5962-9del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes DOCK8 ## Count = 295 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000079484" "00025575" "90" "-10873" "0" "7741080" "0" "c.-10873_*7734780del" "r.0?" "p.0?" "" "0000169359" "00025575" "70" "452" "0" "452" "0" "c.452G>A" "r.(?)" "p.(Arg151Gln)" "" "0000169399" "00025575" "70" "6207" "0" "6207" "0" "c.6207C>A" "r.(?)" "p.(Tyr2069*)" "" "0000248195" "00025575" "10" "1812" "0" "1812" "0" "c.1812A>G" "r.(?)" "p.(Lys604=)" "" "0000248231" "00025575" "10" "4886" "3" "4886" "3" "c.4886+3A>G" "r.spl?" "p.?" "" "0000249437" "00025575" "30" "5266" "0" "5266" "0" "c.5266A>C" "r.(?)" "p.(Ile1756Leu)" "" "0000249478" "00025575" "30" "3724" "0" "3724" "0" "c.3724A>T" "r.(?)" "p.(Thr1242Ser)" "" "0000249948" "00025575" "30" "6201" "0" "6201" "0" "c.6201A>G" "r.(?)" "p.(Glu2067=)" "" "0000249995" "00025575" "50" "4019" "0" "4019" "0" "c.4019A>G" "r.(?)" "p.(Tyr1340Cys)" "" "0000250763" "00025575" "30" "6201" "0" "6201" "0" "c.6201A>G" "r.(?)" "p.(Glu2067=)" "" "0000250864" "00025575" "10" "3565" "0" "3565" "0" "c.3565A>G" "r.(?)" "p.(Ile1189Val)" "" "0000250898" "00025575" "10" "1812" "0" "1812" "0" "c.1812A>G" "r.(?)" "p.(Lys604=)" "" "0000250934" "00025575" "10" "4886" "3" "4886" "3" "c.4886+3A>G" "r.spl?" "p.?" "" "0000251138" "00025575" "10" "1238" "0" "1238" "0" "c.1238A>G" "r.(?)" "p.(Asn413Ser)" "" "0000252566" "00025575" "90" "3389" "0" "3389" "0" "c.3389A>G" "r.(?)" "p.(Gln1130Arg)" "" "0000253982" "00025575" "30" "6201" "0" "6201" "0" "c.6201A>G" "r.(?)" "p.(Glu2067=)" "" "0000254570" "00025575" "30" "2269" "0" "2269" "0" "c.2269A>G" "r.(?)" "p.(Ile757Val)" "" "0000255015" "00025575" "30" "53" "358" "53" "358" "c.53+358A>G" "r.(=)" "p.(=)" "" "0000255260" "00025575" "30" "2110" "-7" "2110" "-7" "c.2110-7A>T" "r.(=)" "p.(=)" "" "0000255261" "00025575" "30" "4627" "-6" "4627" "-6" "c.4627-6A>T" "r.(=)" "p.(=)" "" "0000255793" "00025575" "50" "4019" "0" "4019" "0" "c.4019A>G" "r.(?)" "p.(Tyr1340Cys)" "" "0000255794" "00025575" "50" "5612" "0" "5612" "0" "c.5612A>G" "r.(?)" "p.(Tyr1871Cys)" "" "0000267494" "00025575" "10" "1790" "0" "1790" "0" "c.1790C>T" "r.(?)" "p.(Ala597Val)" "" "0000267495" "00025575" "10" "2340" "0" "2340" "0" "c.2340G>C" "r.(?)" "p.(Leu780=)" "" "0000267496" "00025575" "10" "289" "0" "289" "0" "c.289C>A" "r.(?)" "p.(Pro97Thr)" "" "0000267497" "00025575" "10" "2916" "0" "2916" "0" "c.2916C>T" "r.(?)" "p.(Thr972=)" "" "0000267498" "00025575" "10" "4107" "0" "4107" "0" "c.4107C>G" "r.(?)" "p.(Leu1369=)" "" "0000267499" "00025575" "10" "4491" "0" "4491" "0" "c.4491=" "r.(=)" "p.(Phe1497=)" "" "0000267500" "00025575" "10" "4785" "6" "4785" "6" "c.4785+6C>G" "r.(=)" "p.(=)" "" "0000267501" "00025575" "30" "5296" "0" "5296" "0" "c.5296C>T" "r.(?)" "p.(Arg1766Trp)" "" "0000267502" "00025575" "10" "5433" "0" "5433" "0" "c.5433G>A" "r.(?)" "p.(Glu1811=)" "" "0000267503" "00025575" "10" "5581" "-18" "5581" "-18" "c.5581-18G>C" "r.(=)" "p.(=)" "" "0000267504" "00025575" "10" "65" "0" "65" "0" "c.65C>T" "r.(?)" "p.(Ala22Val)" "" "0000267505" "00025575" "10" "699" "0" "699" "0" "c.699T>C" "r.(?)" "p.(Asn233=)" "" "0000267506" "00025575" "10" "895" "-16" "895" "-16" "c.895-16T>C" "r.(=)" "p.(=)" "" "0000270843" "00025575" "70" "1016" "0" "1016" "0" "c.1016C>T" "r.(?)" "p.(Pro339Leu)" "" "0000270844" "00025575" "90" "1285" "1" "1285" "1" "c.1285+1G>A" "r.spl?" "p.?" "" "0000270845" "00025575" "10" "1422" "101" "1422" "101" "c.1422+101G>T" "r.(=)" "p.(=)" "" "0000270846" "00025575" "10" "1679" "18" "1679" "18" "c.1679+18G>A" "r.(=)" "p.(=)" "" "0000270847" "00025575" "10" "1680" "-2431" "1680" "-2431" "c.1680-2431del" "r.(=)" "p.(=)" "" "0000270848" "00025575" "90" "1860" "0" "1860" "0" "c.1860C>A" "r.(?)" "p.(Tyr620Ter)" "" "0000270849" "00025575" "10" "2295" "0" "2295" "0" "c.2295C>T" "r.(?)" "p.(Ser765=)" "" "0000270850" "00025575" "10" "2340" "0" "2340" "0" "c.2340G>C" "r.(?)" "p.(Leu780=)" "" "0000270851" "00025575" "90" "2899" "0" "2899" "0" "c.2899C>T" "r.(?)" "p.(Gln967Ter)" "" "0000270852" "00025575" "10" "289" "0" "289" "0" "c.289C>A" "r.(?)" "p.(Pro97Thr)" "" "0000270853" "00025575" "10" "2916" "0" "2916" "0" "c.2916C>T" "r.(?)" "p.(Thr972=)" "" "0000270854" "00025575" "10" "3234" "102" "3234" "102" "c.3234+102T>A" "r.(=)" "p.(=)" "" "0000270855" "00025575" "30" "3234" "15" "3234" "15" "c.3234+15del" "r.(=)" "p.(=)" "" "0000270857" "00025575" "30" "4024" "-4" "4024" "-4" "c.4024-4C>T" "r.spl?" "p.?" "" "0000270858" "00025575" "10" "404" "16" "404" "16" "c.404+16del" "r.(=)" "p.(=)" "" "0000270859" "00025575" "50" "4087" "0" "4087" "0" "c.4087C>T" "r.(?)" "p.(Arg1363Trp)" "" "0000270860" "00025575" "10" "4107" "0" "4107" "0" "c.4107C>G" "r.(?)" "p.(Leu1369=)" "" "0000270861" "00025575" "30" "4158" "0" "4158" "0" "c.4158C>T" "r.(?)" "p.(Asn1386=)" "" "0000270862" "00025575" "10" "4474" "-85" "4474" "-85" "c.4474-85C>T" "r.(=)" "p.(=)" "" "0000270863" "00025575" "10" "4627" "-14" "4627" "-12" "c.4627-14_4627-12del" "r.(=)" "p.(=)" "" "0000270864" "00025575" "10" "4785" "6" "4785" "6" "c.4785+6C>G" "r.(=)" "p.(=)" "" "0000270865" "00025575" "10" "5211" "0" "5211" "0" "c.5211G>A" "r.(?)" "p.(Glu1737=)" "" "0000270866" "00025575" "10" "529" "-140" "529" "-140" "c.529-140C>G" "r.(=)" "p.(=)" "" "0000270867" "00025575" "30" "5356" "-138" "5356" "-138" "c.5356-138T>A" "r.(=)" "p.(=)" "" "0000270868" "00025575" "90" "54" "-1" "54" "-1" "c.54-1G>T" "r.spl?" "p.?" "" "0000270869" "00025575" "10" "5433" "0" "5433" "0" "c.5433G>A" "r.(?)" "p.(Glu1811=)" "" "0000270870" "00025575" "10" "5491" "-705" "5491" "-705" "c.5491-705T>C" "r.(=)" "p.(=)" "" "0000270871" "00025575" "10" "5581" "-18" "5581" "-18" "c.5581-18G>C" "r.(=)" "p.(=)" "" "0000270872" "00025575" "10" "5818" "-14" "5818" "-14" "c.5818-14C>T" "r.(=)" "p.(=)" "" "0000270873" "00025575" "30" "5818" "-16" "5818" "-16" "c.5818-16T>C" "r.(=)" "p.(=)" "" "0000270874" "00025575" "30" "5962" "-8" "5962" "-8" "c.5962-8C>T" "r.(=)" "p.(=)" "" "0000270875" "00025575" "10" "65" "0" "65" "0" "c.65C>T" "r.(?)" "p.(Ala22Val)" "" "0000270876" "00025575" "10" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Glu237Lys)" "" "0000270878" "00025575" "10" "895" "-16" "895" "-16" "c.895-16T>C" "r.(=)" "p.(=)" "" "0000275468" "00025575" "50" "2830" "0" "2830" "0" "c.2830G>T" "r.(?)" "p.(Asp944Tyr)" "" "0000275469" "00025575" "50" "3023" "0" "3023" "0" "c.3023G>A" "r.(?)" "p.(Arg1008Gln)" "" "0000275470" "00025575" "30" "3220" "0" "3220" "0" "c.3220C>A" "r.(?)" "p.(His1074Asn)" "" "0000275471" "00025575" "50" "3312" "0" "3312" "0" "c.3312G>C" "r.(?)" "p.(Glu1104Asp)" "" "0000275472" "00025575" "10" "3573" "0" "3573" "0" "c.3573C>T" "r.(?)" "p.(Ser1191=)" "" "0000275473" "00025575" "50" "379" "0" "379" "0" "c.379C>T" "r.(?)" "p.(Arg127Cys)" "" "0000275474" "00025575" "30" "3988" "0" "3988" "0" "c.3988C>G" "r.(?)" "p.(Leu1330Val)" "" "0000275475" "00025575" "30" "4003" "0" "4003" "0" "c.4003G>T" "r.(?)" "p.(Val1335Leu)" "" "0000275476" "00025575" "30" "4024" "-4" "4024" "-4" "c.4024-4C>T" "r.spl?" "p.?" "" "0000275477" "00025575" "30" "4998" "0" "4998" "0" "c.4998G>C" "r.(?)" "p.(Val1666=)" "" "0000275478" "00025575" "10" "5211" "0" "5211" "0" "c.5211G>A" "r.(?)" "p.(Glu1737=)" "" "0000275479" "00025575" "50" "5652" "0" "5652" "0" "c.5652T>A" "r.(?)" "p.(Phe1884Leu)" "" "0000275480" "00025575" "30" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Val194Ile)" "" "0000275481" "00025575" "10" "5962" "-8" "5962" "-8" "c.5962-8C>T" "r.(=)" "p.(=)" "" "0000275482" "00025575" "50" "6147" "0" "6147" "0" "c.6147C>G" "r.(?)" "p.(Asn2049Lys)" "" "0000275483" "00025575" "30" "663" "0" "663" "0" "c.663C>A" "r.(?)" "p.(Asp221Glu)" "" "0000332500" "00025575" "50" "-298" "0" "-298" "0" "c.-298G>A" "r.(?)" "p.(=)" "" "0000332502" "00025575" "50" "476" "0" "476" "0" "c.476C>T" "r.(?)" "p.(Pro159Leu)" "" "0000332503" "00025575" "50" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Glu227Lys)" "" "0000332505" "00025575" "50" "1072" "0" "1072" "0" "c.1072A>G" "r.(?)" "p.(Ile358Val)" "" "0000332506" "00025575" "50" "1090" "0" "1090" "0" "c.1090C>T" "r.(?)" "p.(Pro364Ser)" "" "0000332507" "00025575" "50" "1829" "0" "1829" "0" "c.1829T>G" "r.(?)" "p.(Phe610Cys)" "" "0000332508" "00025575" "50" "3220" "0" "3220" "0" "c.3220C>A" "r.(?)" "p.(His1074Asn)" "" "0000332509" "00025575" "30" "3414" "0" "3414" "0" "c.3414C>A" "r.(?)" "p.(Phe1138Leu)" "" "0000332510" "00025575" "50" "3841" "-8" "3841" "-8" "c.3841-8C>G" "r.(=)" "p.(=)" "" "0000332511" "00025575" "50" "3844" "0" "3844" "0" "c.3844T>C" "r.(?)" "p.(Tyr1282His)" "" "0000332512" "00025575" "50" "4154" "-5" "4154" "-5" "c.4154-5C>G" "r.spl?" "p.?" "" "0000332515" "00025575" "50" "6087" "0" "6087" "0" "c.6087G>C" "r.(?)" "p.(Glu2029Asp)" "" "0000332516" "00025575" "50" "6107" "0" "6107" "0" "c.6107C>T" "r.(?)" "p.(Thr2036Met)" "" "0000349307" "00025575" "50" "485" "0" "485" "0" "c.485C>T" "r.(?)" "p.(Thr162Met)" "" "0000350154" "00025575" "50" "1883" "0" "1883" "0" "c.1883A>T" "r.(?)" "p.(Tyr628Phe)" "" "0000537808" "00025575" "50" "52" "0" "52" "0" "c.52A>G" "r.(?)" "p.(Arg18Gly)" "" "0000537809" "00025575" "50" "53" "163" "53" "163" "c.53+163C>G" "r.(=)" "p.(=)" "" "0000537810" "00025575" "50" "53" "170" "53" "192" "c.53+170_53+192del" "r.(=)" "p.(=)" "" "0000537898" "00025575" "30" "378" "0" "378" "0" "c.378C>G" "r.(?)" "p.(Ile126Met)" "" "0000537899" "00025575" "30" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "" "0000537901" "00025575" "30" "494" "0" "494" "0" "c.494C>T" "r.(?)" "p.(Ser165Leu)" "" "0000537902" "00025575" "30" "494" "0" "494" "0" "c.494C>T" "r.(?)" "p.(Ser165Leu)" "" "0000537903" "00025575" "30" "578" "0" "578" "0" "c.578C>G" "r.(?)" "p.(Pro193Arg)" "" "0000537904" "00025575" "10" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Glu227Lys)" "" "0000537905" "00025575" "30" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Glu237Lys)" "" "0000537947" "00025575" "10" "894" "74" "894" "75" "c.894+74_894+75insC" "r.(=)" "p.(=)" "" "0000538008" "00025575" "30" "1526" "0" "1526" "0" "c.1526G>C" "r.(?)" "p.(Arg509Thr)" "" "0000538009" "00025575" "10" "1587" "0" "1587" "0" "c.1587C>G" "r.(?)" "p.(Pro529=)" "" "0000538178" "00025575" "30" "1683" "0" "1683" "0" "c.1683C>A" "r.(?)" "p.(Asn561Lys)" "" "0000538186" "00025575" "50" "2111" "0" "2111" "0" "c.2111A>G" "r.(?)" "p.(Lys704Arg)" "" "0000538191" "00025575" "50" "2444" "0" "2444" "0" "c.2444A>C" "r.(?)" "p.(Asn815Thr)" "" "0000538211" "00025575" "10" "3022" "0" "3022" "0" "c.3022C>T" "r.(?)" "p.(Arg1008Trp)" "" "0000538213" "00025575" "10" "3230" "0" "3230" "0" "c.3230G>A" "r.(?)" "p.(Ser1077Asn)" "" "0000538214" "00025575" "90" "3234" "2" "3234" "2" "c.3234+2T>C" "r.spl?" "p.?" "" "0000538216" "00025575" "50" "3263" "0" "3263" "0" "c.3263C>T" "r.(?)" "p.(Thr1088Met)" "" "0000538217" "00025575" "50" "3391" "-124" "3391" "-123" "c.3391-124_3391-123insC" "r.(=)" "p.(=)" "" "0000538218" "00025575" "30" "3460" "0" "3460" "0" "c.3460C>T" "r.(?)" "p.(Arg1154Cys)" "" "0000538220" "00025575" "50" "3485" "0" "3485" "0" "c.3485T>C" "r.(?)" "p.(Leu1162Pro)" "" "0000538257" "00025575" "30" "3612" "0" "3612" "0" "c.3612A>T" "r.(?)" "p.(Lys1204Asn)" "" "0000538259" "00025575" "30" "3734" "0" "3734" "0" "c.3734C>T" "r.(?)" "p.(Ser1245Leu)" "" "0000538260" "00025575" "30" "3826" "0" "3826" "0" "c.3826G>T" "r.(?)" "p.(Val1276Leu)" "" "0000538261" "00025575" "30" "3853" "0" "3853" "0" "c.3853T>G" "r.(?)" "p.(Tyr1285Asp)" "" "0000538262" "00025575" "30" "4024" "-4" "4024" "-4" "c.4024-4C>T" "r.spl?" "p.?" "" "0000538263" "00025575" "50" "4041" "0" "4041" "0" "c.4041C>A" "r.(?)" "p.(Asp1347Glu)" "" "0000538271" "00025575" "30" "4588" "0" "4588" "0" "c.4588C>G" "r.(?)" "p.(Leu1530Val)" "" "0000538272" "00025575" "10" "4627" "-13" "4627" "-12" "c.4627-13_4627-12del" "r.(=)" "p.(=)" "" "0000538274" "00025575" "50" "4724" "0" "4724" "0" "c.4724G>A" "r.(?)" "p.(Arg1575Lys)" "" "0000538291" "00025575" "30" "5330" "0" "5330" "0" "c.5330G>C" "r.(?)" "p.(Arg1777Thr)" "" "0000538292" "00025575" "50" "5666" "0" "5666" "0" "c.5666A>C" "r.(?)" "p.(Asn1889Thr)" "" "0000538293" "00025575" "30" "5799" "0" "5799" "0" "c.5799C>T" "r.(?)" "p.(Ser1933=)" "" "0000538294" "00025575" "30" "5962" "-16" "5962" "-8" "c.5962-16_5962-8del" "r.(=)" "p.(=)" "" "0000538295" "00025575" "30" "6069" "-7" "6069" "-7" "c.6069-7A>G" "r.(=)" "p.(=)" "" "0000612073" "00025575" "30" "685" "0" "685" "0" "c.685G>C" "r.(?)" "p.(Ala229Pro)" "" "0000612125" "00025575" "50" "1813" "0" "1813" "0" "c.1813T>C" "r.(?)" "p.(Ser605Pro)" "" "0000612126" "00025575" "50" "2272" "0" "2272" "0" "c.2272C>T" "r.(?)" "p.(Arg758Cys)" "" "0000612127" "00025575" "50" "2296" "0" "2296" "0" "c.2296G>A" "r.(?)" "p.(Glu766Lys)" "" "0000612128" "00025575" "50" "2372" "0" "2372" "0" "c.2372T>C" "r.(?)" "p.(Phe791Ser)" "" "0000612130" "00025575" "30" "2594" "0" "2594" "0" "c.2594T>C" "r.(?)" "p.(Val865Ala)" "" "0000612133" "00025575" "70" "2874" "1" "2874" "1" "c.2874+1G>T" "r.spl?" "p.?" "" "0000612134" "00025575" "50" "3179" "0" "3179" "0" "c.3179T>C" "r.(?)" "p.(Leu1060Pro)" "" "0000612144" "00025575" "50" "5223" "4" "5223" "4" "c.5223+4A>G" "r.spl?" "p.?" "" "0000622250" "00025575" "30" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "" "0000622254" "00025575" "30" "914" "0" "914" "0" "c.914G>T" "r.(?)" "p.(Cys305Phe)" "" "0000622273" "00025575" "30" "3058" "0" "3058" "0" "c.3058A>G" "r.(?)" "p.(Ile1020Val)" "" "0000622277" "00025575" "30" "5781" "0" "5781" "0" "c.5781C>T" "r.(?)" "p.(Tyr1927=)" "" "0000652698" "00025575" "30" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Glu237Lys)" "" "0000652702" "00025575" "50" "986" "0" "986" "0" "c.986C>T" "r.(?)" "p.(Ala329Val)" "" "0000652715" "00025575" "30" "1790" "0" "1790" "0" "c.1790C>T" "r.(?)" "p.(Ala597Val)" "" "0000652721" "00025575" "50" "3022" "0" "3022" "0" "c.3022C>T" "r.(?)" "p.(Arg1008Trp)" "" "0000652722" "00025575" "50" "3460" "0" "3460" "0" "c.3460C>T" "r.(?)" "p.(Arg1154Cys)" "" "0000652727" "00025575" "50" "4019" "0" "4019" "0" "c.4019A>G" "r.(?)" "p.(Tyr1340Cys)" "" "0000656338" "00025575" "50" "452" "0" "452" "0" "c.452G>A" "r.(?)" "p.(Arg151Gln)" "" "0000656339" "00025575" "30" "470" "0" "470" "0" "c.470C>T" "r.(?)" "p.(Thr157Met)" "" "0000656340" "00025575" "30" "623" "0" "623" "0" "c.623A>G" "r.(?)" "p.(Lys208Arg)" "" "0000656344" "00025575" "30" "1098" "0" "1098" "0" "c.1098G>A" "r.(?)" "p.(Thr366=)" "" "0000656360" "00025575" "50" "3123" "0" "3123" "0" "c.3123A>C" "r.(?)" "p.(Glu1041Asp)" "" "0000656361" "00025575" "30" "3234" "8" "3234" "9" "c.3234+8_3234+9insGC" "r.(=)" "p.(=)" "" "0000656362" "00025575" "30" "4283" "0" "4283" "0" "c.4283A>G" "r.(?)" "p.(Asn1428Ser)" "" "0000656364" "00025575" "50" "5501" "0" "5501" "0" "c.5501G>A" "r.(?)" "p.(Gly1834Asp)" "" "0000656365" "00025575" "10" "5908" "0" "5908" "0" "c.5908G>C" "r.(?)" "p.(Ala1970Pro)" "" "0000656366" "00025575" "30" "5962" "-17" "5962" "-8" "c.5962-17_5962-8del" "r.(=)" "p.(=)" "" "0000660601" "00025575" "50" "3496" "0" "3496" "0" "c.3496G>T" "r.(?)" "p.(Glu1166*)" "" "0000670065" "00025575" "30" "709" "0" "709" "0" "c.709G>A" "r.(?)" "p.(Glu237Lys)" "" "0000670066" "00025575" "30" "1790" "0" "1790" "0" "c.1790C>T" "r.(?)" "p.(Ala597Val)" "" "0000678655" "00025575" "30" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Val194Ile)" "" "0000678681" "00025575" "30" "2304" "0" "2304" "0" "c.2304G>A" "r.(?)" "p.(Ala768=)" "" "0000678682" "00025575" "50" "3480" "0" "3480" "0" "c.3480C>A" "r.(?)" "p.(Thr1160=)" "" "0000678686" "00025575" "50" "3707" "0" "3707" "0" "c.3707A>G" "r.(?)" "p.(Asp1236Gly)" "" "0000678687" "00025575" "30" "4019" "0" "4019" "0" "c.4019A>G" "r.(?)" "p.(Tyr1340Cys)" "" "0000690515" "00025575" "70" "54" "-1" "54" "-1" "c.54-1G>T" "r.spl?" "p.?" "" "0000690516" "00025575" "50" "688" "0" "688" "0" "c.688C>T" "r.(?)" "p.(Arg230Trp)" "" "0000690521" "00025575" "50" "1016" "0" "1016" "0" "c.1016C>T" "r.(?)" "p.(Pro339Leu)" "" "0000690523" "00025575" "50" "1178" "0" "1178" "0" "c.1178G>A" "r.(?)" "p.(Arg393His)" "" "0000690552" "00025575" "30" "2109" "11" "2109" "11" "c.2109+11del" "r.(=)" "p.(=)" "" "0000690555" "00025575" "30" "2364" "0" "2364" "0" "c.2364C>T" "r.(?)" "p.(Leu788=)" "" "0000690561" "00025575" "30" "3701" "-17" "3701" "-17" "c.3701-17C>T" "r.(=)" "p.(=)" "" "0000690562" "00025575" "50" "5206" "0" "5206" "0" "c.5206G>A" "r.(?)" "p.(Ala1736Thr)" "" "0000690563" "00025575" "50" "5345" "0" "5345" "0" "c.5345T>C" "r.(?)" "p.(Ile1782Thr)" "" "0000701846" "00025575" "50" "295" "0" "295" "0" "c.295G>A" "r.(?)" "p.(Glu99Lys)" "" "0000708585" "00025575" "90" "0" "0" "0" "0" "c.-112_*1040{0}" "r.0" "p.0" "_1_48_" "0000708586" "00025575" "90" "828" "-1" "2874" "1" "c.(827+1_828-1)_(2874+1_2875-1)del" "r.?" "p.?" "7i_23i" "0000722479" "00025575" "50" "663" "0" "663" "0" "c.663C>A" "r.(?)" "p.(Asp221Glu)" "" "0000722488" "00025575" "50" "874" "0" "874" "0" "c.874G>A" "r.(?)" "p.(Asp292Asn)" "" "0000722492" "00025575" "50" "1623" "0" "1623" "0" "c.1623C>G" "r.(?)" "p.(His541Gln)" "" "0000722531" "00025575" "50" "1798" "-4" "1798" "-4" "c.1798-4A>G" "r.spl?" "p.?" "" "0000722533" "00025575" "50" "2074" "0" "2074" "0" "c.2074A>G" "r.(?)" "p.(Lys692Glu)" "" "0000722536" "00025575" "50" "2494" "0" "2494" "0" "c.2494C>T" "r.(?)" "p.(His832Tyr)" "" "0000722537" "00025575" "50" "3220" "0" "3220" "0" "c.3220C>A" "r.(?)" "p.(His1074Asn)" "" "0000722538" "00025575" "30" "3234" "15" "3234" "15" "c.3234+15del" "r.(=)" "p.(=)" "" "0000722539" "00025575" "30" "3274" "0" "3274" "0" "c.3274A>G" "r.(?)" "p.(Met1092Val)" "" "0000722540" "00025575" "50" "4154" "-5" "4154" "-5" "c.4154-5C>G" "r.spl?" "p.?" "" "0000722541" "00025575" "10" "4887" "-16" "4887" "-16" "c.4887-16C>T" "r.(=)" "p.(=)" "" "0000722542" "00025575" "30" "5205" "0" "5205" "0" "c.5205C>T" "r.(?)" "p.(Ala1735=)" "" "0000734175" "00025575" "50" "1036" "0" "1036" "0" "c.1036G>A" "r.(?)" "p.(Val346Ile)" "" "0000734604" "00025575" "50" "986" "0" "986" "0" "c.986C>T" "r.(?)" "p.(Ala329Val)" "" "0000734663" "00025575" "50" "4976" "0" "4976" "0" "c.4976C>T" "r.(?)" "p.(Thr1659Met)" "" "0000735025" "00025575" "50" "2436" "0" "2436" "0" "c.2436G>C" "r.(?)" "p.(Gln812His)" "" "0000735427" "00025575" "50" "6020" "0" "6020" "0" "c.6020A>G" "r.(?)" "p.(Tyr2007Cys)" "" "0000735485" "00025575" "50" "157" "-1" "157" "-1" "c.157-1G>C" "r.spl?" "p.?" "" "0000804087" "00025575" "30" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "" "0000804088" "00025575" "30" "405" "-7" "405" "-7" "c.405-7A>T" "r.(=)" "p.(=)" "" "0000804089" "00025575" "50" "745" "0" "745" "0" "c.745G>A" "r.(?)" "p.(Asp249Asn)" "" "0000804130" "00025575" "50" "1683" "0" "1683" "0" "c.1683C>A" "r.(?)" "p.(Asn561Lys)" "" "0000804131" "00025575" "50" "1683" "0" "1683" "0" "c.1683C>A" "r.(?)" "p.(Asn561Lys)" "" "0000804136" "00025575" "50" "1798" "-4" "1798" "-4" "c.1798-4A>G" "r.spl?" "p.?" "" "0000804137" "00025575" "50" "1869" "0" "1869" "0" "c.1869G>T" "r.(?)" "p.(Lys623Asn)" "" "0000804138" "00025575" "90" "1963" "0" "1963" "0" "c.1963C>T" "r.(?)" "p.(Gln655*)" "" "0000804143" "00025575" "30" "2629" "0" "2629" "0" "c.2629C>T" "r.(?)" "p.(Pro877Ser)" "" "0000804152" "00025575" "50" "3844" "0" "3844" "0" "c.3844T>C" "r.(?)" "p.(Tyr1282His)" "" "0000804154" "00025575" "30" "4886" "6" "4886" "6" "c.4886+6C>T" "r.(=)" "p.(=)" "" "0000804157" "00025575" "30" "5581" "-5" "5581" "-5" "c.5581-5C>T" "r.spl?" "p.?" "" "0000804158" "00025575" "50" "5612" "0" "5612" "0" "c.5612A>G" "r.(?)" "p.(Tyr1871Cys)" "" "0000818155" "00025575" "90" "5625" "0" "5625" "0" "c.5625T>G" "r.(?)" "p.(Tyr1875*)" "" "0000818993" "00025575" "90" "5625" "0" "5625" "0" "c.5625T>G" "r.(?)" "p.(Tyr1875*)" "" "0000818995" "00025575" "90" "5625" "0" "5625" "0" "c.5625T>G" "r.(?)" "p.(Tyr1875*)" "" "0000852249" "00025575" "30" "528" "7" "528" "7" "c.528+7C>A" "r.(=)" "p.(=)" "" "0000852283" "00025575" "30" "1881" "0" "1881" "0" "c.1881T>C" "r.(?)" "p.(Phe627=)" "" "0000852293" "00025575" "50" "4019" "0" "4019" "0" "c.4019A>G" "r.(?)" "p.(Tyr1340Cys)" "" "0000852294" "00025575" "30" "5962" "-34" "5962" "-21" "c.5962-34_5962-21del" "r.(=)" "p.(=)" "" "0000861702" "00025575" "50" "2782" "0" "2782" "0" "c.2782G>A" "r.(?)" "p.(Ala928Thr)" "" "0000861705" "00025575" "30" "3230" "0" "3230" "0" "c.3230G>A" "r.(?)" "p.(Ser1077Asn)" "" "0000861707" "00025575" "50" "4283" "0" "4283" "0" "c.4283A>G" "r.(?)" "p.(Asn1428Ser)" "" "0000861708" "00025575" "50" "4486" "0" "4486" "0" "c.4486C>T" "r.(?)" "p.(Leu1496Phe)" "" "0000888803" "00025575" "30" "485" "0" "485" "0" "c.485C>T" "r.(?)" "p.(Thr162Met)" "" "0000888804" "00025575" "30" "559" "0" "559" "0" "c.559G>A" "r.(?)" "p.(Asp187Asn)" "" "0000888817" "00025575" "30" "1286" "0" "1286" "0" "c.1286G>A" "r.(?)" "p.(Gly429Glu)" "" "0000888859" "00025575" "50" "2017" "0" "2017" "0" "c.2017A>G" "r.(?)" "p.(Ile673Val)" "" "0000888861" "00025575" "30" "2275" "0" "2275" "0" "c.2275G>A" "r.(?)" "p.(Val759Met)" "" "0000888864" "00025575" "30" "2971" "-14" "2971" "-14" "c.2971-14A>G" "r.(=)" "p.(=)" "" "0000888865" "00025575" "30" "3460" "0" "3460" "0" "c.3460C>T" "r.(?)" "p.(Arg1154Cys)" "" "0000888870" "00025575" "10" "3840" "3" "3840" "3" "c.3840+3A>G" "r.spl?" "p.?" "" "0000888872" "00025575" "70" "4627" "-1" "4627" "-1" "c.4627-1G>T" "r.spl?" "p.?" "" "0000888873" "00025575" "50" "5546" "0" "5546" "0" "c.5546C>A" "r.(?)" "p.(Thr1849Asn)" "" "0000888874" "00025575" "30" "5581" "-19" "5581" "-19" "c.5581-19C>G" "r.(=)" "p.(=)" "" "0000888875" "00025575" "30" "6064" "0" "6064" "0" "c.6064A>G" "r.(?)" "p.(Met2022Val)" "" "0000904111" "00025575" "30" "622" "0" "622" "0" "c.622A>G" "r.(?)" "p.(Lys208Glu)" "" "0000904112" "00025575" "70" "305" "0" "305" "0" "c.305C>T" "r.(?)" "p.(Thr102Ile)" "" "0000904113" "00025575" "50" "3535" "0" "3535" "0" "c.3535A>T" "r.(?)" "p.(Ser1179Cys)" "" "0000904114" "00025575" "30" "1151" "0" "1151" "0" "c.1151A>G" "r.(?)" "p.(Lys384Arg)" "" "0000904115" "00025575" "50" "5822" "0" "5822" "0" "c.5822T>C" "r.(?)" "p.(Val1941Ala)" "" "0000904116" "00025575" "50" "76" "0" "76" "0" "c.76A>C" "r.(?)" "p.(Lys26Gln)" "" "0000913146" "00025575" "30" "1286" "-5" "1286" "-5" "c.1286-5T>A" "r.spl?" "p.?" "" "0000913147" "00025575" "30" "1422" "18" "1422" "18" "c.1422+18A>T" "r.(=)" "p.(=)" "" "0000913166" "00025575" "50" "2560" "0" "2560" "0" "c.2560T>C" "r.(?)" "p.(Tyr854His)" "" "0000913167" "00025575" "30" "2660" "0" "2660" "0" "c.2660C>T" "r.(?)" "p.(Ser887Leu)" "" "0000913168" "00025575" "50" "3023" "0" "3023" "0" "c.3023G>A" "r.(?)" "p.(Arg1008Gln)" "" "0000913169" "00025575" "50" "3312" "0" "3312" "0" "c.3312G>C" "r.(?)" "p.(Glu1104Asp)" "" "0000913170" "00025575" "30" "3840" "15" "3840" "15" "c.3840+15A>T" "r.(=)" "p.(=)" "" "0000913171" "00025575" "30" "5296" "0" "5296" "0" "c.5296C>T" "r.(?)" "p.(Arg1766Trp)" "" "0000920249" "00025575" "90" "-112" "0" "2605" "1" "c.-112_(2605+1_?)del" "r.?" "p.?" "_1_19i" "0000920253" "00025575" "50" "6137" "0" "6137" "0" "c.6137T>G" "r.(?)" "p.(Leu2046Arg)" "47" "0000920282" "00025575" "50" "4626" "76" "4626" "76" "c.4626+76A>G" "r.spl" "p.?" "36i" "0000920289" "00025575" "90" "1790" "0" "6064" "0" "c.(?_1790)_(6064_?)del" "r.?" "p.?" "" "0000925055" "00025575" "30" "2410" "0" "2410" "0" "c.2410G>A" "r.(?)" "p.(Val804Met)" "" "0000925056" "00025575" "30" "2440" "13" "2440" "22" "c.2440+13_2440+22del" "r.(=)" "p.(=)" "" "0000925057" "00025575" "30" "2991" "0" "2991" "0" "c.2991C>T" "r.(?)" "p.(His997=)" "" "0000925058" "00025575" "50" "3023" "0" "3023" "0" "c.3023G>A" "r.(?)" "p.(Arg1008Gln)" "" "0000929589" "00025575" "10" "528" "13" "528" "13" "c.528+13A>G" "r.(=)" "p.(=)" "" "0000929594" "00025575" "30" "1125" "18" "1125" "18" "c.1125+18T>C" "r.(=)" "p.(=)" "" "0000934953" "00025575" "90" "0" "0" "0" "0" "c.[NM_004006.2:c.(9084+1_9085-1)ins(?_54)_(966_?)" "r.?" "p.?" "_2_9_" "0000949267" "00025575" "10" "679" "0" "679" "0" "c.679G>A" "r.(?)" "p.(Glu227Lys)" "" "0000949268" "00025575" "50" "689" "0" "689" "0" "c.689G>A" "r.(?)" "p.(Arg230Gln)" "" "0000949302" "00025575" "30" "2971" "-5" "2971" "-5" "c.2971-5C>T" "r.spl?" "p.?" "" "0000949304" "00025575" "30" "3984" "0" "3984" "0" "c.3984A>G" "r.(?)" "p.(=)" "" "0000965386" "00025575" "50" "1285" "1" "1285" "1" "c.1285+1G>A" "r.spl?" "p.?" "" "0000965447" "00025575" "30" "4627" "-13" "4627" "-12" "c.4627-13_4627-12del" "r.(=)" "p.(=)" "" "0000965456" "00025575" "10" "5962" "-34" "5962" "-26" "c.5962-34_5962-26del" "r.(=)" "p.(=)" "" "0000965457" "00025575" "30" "5962" "-20" "5962" "-9" "c.5962-20_5962-9del" "r.(=)" "p.(=)" "" "0000978670" "00025575" "50" "452" "0" "452" "0" "c.452G>A" "r.(?)" "p.(Arg151Gln)" "" "0000978675" "00025575" "30" "1126" "-3" "1126" "-3" "c.1126-3C>T" "r.spl?" "p.?" "" "0000978713" "00025575" "50" "1823" "0" "1823" "0" "c.1823C>G" "r.(?)" "p.(Pro608Arg)" "" "0000978716" "00025575" "50" "2110" "-3" "2110" "-3" "c.2110-3C>G" "r.spl?" "p.?" "" "0000978717" "00025575" "50" "2272" "0" "2272" "0" "c.2272C>T" "r.(?)" "p.(Arg758Cys)" "" "0000978725" "00025575" "50" "3031" "0" "3031" "0" "c.3031C>T" "r.(?)" "p.(Arg1011Cys)" "" "0000978726" "00025575" "30" "3234" "10" "3234" "10" "c.3234+10C>A" "r.(=)" "p.(=)" "" "0000978735" "00025575" "50" "6287" "0" "6287" "0" "c.6287C>G" "r.(?)" "p.(Ser2096*)" "" "0000997829" "00025575" "30" "290" "0" "290" "0" "c.290C>T" "r.(?)" "p.(Pro97Leu)" "" "0000997830" "00025575" "30" "460" "0" "460" "0" "c.460T>A" "r.(?)" "p.(Phe154Ile)" "" "0000997836" "00025575" "50" "935" "0" "935" "0" "c.935T>C" "r.(?)" "p.(Phe312Ser)" "" "0000997901" "00025575" "30" "3430" "0" "3430" "0" "c.3430G>A" "r.(?)" "p.(Ala1144Thr)" "" "0000997904" "00025575" "30" "3761" "0" "3761" "0" "c.3761C>T" "r.(?)" "p.(Ala1254Val)" "" "0000997911" "00025575" "50" "5300" "0" "5300" "0" "c.5300A>C" "r.(?)" "p.(Lys1767Thr)" "" "0000997912" "00025575" "30" "5962" "-36" "5962" "-23" "c.5962-36_5962-23del" "r.(=)" "p.(=)" "" "0001014558" "00025575" "50" "4252" "0" "4252" "0" "c.4252G>A" "r.(?)" "p.(Glu1418Lys)" "" "0001037477" "00025575" "70" "54" "-1" "54" "-1" "c.54-1G>T" "r.spl?" "p.?" "" "0001037490" "00025575" "50" "1192" "0" "1192" "0" "c.1192C>T" "r.(?)" "p.(Arg398Trp)" "" "0001037537" "00025575" "30" "1869" "-8" "1869" "-8" "c.1869-8T>G" "r.(=)" "p.(=)" "" "0001037549" "00025575" "10" "4627" "-12" "4627" "-12" "c.4627-12del" "r.(=)" "p.(=)" "" "0001037554" "00025575" "50" "5645" "0" "5645" "0" "c.5645C>A" "r.(?)" "p.(Thr1882Lys)" "" "0001037555" "00025575" "30" "5962" "-9" "5962" "-9" "c.5962-9del" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 35 "{{screeningid}}" "{{variantid}}" "0000050504" "0000079484" "0000104490" "0000169359" "0000104501" "0000169399" "0000296009" "0000652698" "0000296013" "0000652702" "0000296026" "0000652715" "0000296032" "0000652721" "0000296033" "0000652722" "0000296038" "0000652727" "0000297893" "0000660601" "0000306377" "0000670065" "0000306378" "0000670066" "0000319182" "0000701846" "0000325570" "0000708585" "0000325570" "0000708586" "0000335589" "0000734175" "0000335762" "0000734604" "0000335775" "0000734663" "0000336078" "0000735025" "0000336243" "0000735427" "0000336258" "0000735485" "0000389235" "0000818155" "0000389238" "0000818993" "0000389244" "0000818995" "0000426964" "0000904111" "0000426965" "0000904112" "0000426966" "0000904113" "0000426967" "0000904114" "0000426968" "0000904115" "0000426969" "0000904116" "0000434490" "0000920249" "0000434496" "0000920253" "0000434528" "0000920282" "0000434535" "0000920289" "0000439248" "0000934953"