### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = DPAGT1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "DPAGT1" "dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)" "11" "q23.3" "unknown" "NG_008918.1" "UD_132119014832" "" "http://www.LOVD.nl/DPAGT1" "Congenital Disorder of Glycosylation pages " "1" "2995" "1798" "191350" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/DPAGT1_codingDNA.html" "1" "" "\"EuroglycanetCongenital Disorders of Glycosylation (CDG)
Some variants in this database are copied from the CDG database at the Euroglycanet site." "-1" "" "-1" "00001" "2012-09-05 00:00:00" "00006" "2015-03-20 22:08:49" "00006" "2026-03-06 17:26:39" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00006639" "DPAGT1" "dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)" "001" "NM_001382.3" "" "NP_001373.2" "" "" "" "-420" "1722" "1227" "118972785" "118967213" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00963" "CDG1J" "glycosylation, congenital disorder of, type Ij (CDG-1J)" "AR" "608093" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "00964" "CMSTA2" "myasthenic syndrome, congenital, with tubular aggregates, type 2 (CMSTA-2)" "AR" "614750" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04312" "CMS" "myasthenic syndrome, congenital (CMS)" "" "" "" "" "" "00006" "2015-08-28 20:21:50" "00006" "2021-12-10 21:51:32" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "DPAGT1" "00139" "DPAGT1" "00963" "DPAGT1" "00964" ## Individuals ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00034428" "" "" "" "1" "" "01259" "" "" "M" "no" "Netherlands" "" "0" "" "neostigmine, pyridostigmine, 3,4-DAP" "white" "" "00035671" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00300629" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00427823" "" "" "" "2" "" "02153" "" "" "F" "no" "Italy" "" "" "" "" "" "Raffaella Brugnoni" "00442746" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat118" "00473434" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "yes" "Iran" "" "0" "" "" "" "Fam210485Pat745" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{individualid}}" "{{diseaseid}}" "00034428" "00964" "00300629" "00198" "00427823" "00964" "00442746" "05618" "00473434" "04312" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00963, 00964, 04312, 05618 ## Count = 4 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000027824" "00964" "00034428" "01259" "Unknown" "00y" "Generalized Hypotonia, myasthenia, psychomotor developmental delay, short stature, small genitals" "00y" "" "" "" "" "" "" "" "" "" "" "0000227940" "00198" "00300629" "01164" "Unknown" "" "Abnormality of muscle physiology (HP:0011804); Abnormality of muscle morphology (HP:0011805); Abnormality of nervous system physiology (HP:0012638); Muscle weakness (HP:0001324); Specific learning disability (HP:0001328); Neurological speech impairment (HP:0002167); Language impairment (HP:0002463); EMG: myopathic abnormalities (HP:0003458)" "" "" "" "" "" "" "" "" "" "" "" "0000332093" "05618" "00442746" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Limb girdle muscular dystrophy, autosomal recessive" "" "0000358229" "04312" "00473434" "00006" "Unknown" "22y" "Delayed walking; Proximal weakness, upper limbs; Proximal and distal muscle weakness, lower limbs; Gowers sign; Inability to heel walk; Hx of diplopia; EMG-NCV: myopathic process; Muscle biopsy: no evidence of dystrophy; Hx of Thymectomy 8y, Normal IHC-testing" "" "" "" "" "" "" "" "" "" "congenital myasthenic syndrome" "" ## Screenings ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000034495" "00034428" "1" "01259" "01259" "2015-03-18 17:57:25" "00006" "2015-03-20 11:57:46" "SEQ" "DNA" "blood" "" "0000035741" "00035671" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000301750" "00300629" "1" "01164" "01164" "2020-05-04 10:16:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000429147" "00427823" "1" "02153" "02153" "2022-12-14 16:43:26" "" "" "SEQ-NG" "DNA" "" "" "0000444230" "00442746" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000475103" "00473434" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{geneid}}" "0000034495" "DPAGT1" "0000035741" "DPAGT1" "0000429147" "DPAGT1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 58 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000061627" "0" "50" "11" "118971510" "118971510" "subst" "0" "01259" "DPAGT1_000001" "g.118971510A>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.119100800A>T" "" "VUS" "" "0000062866" "1" "10" "11" "118967758" "118967758" "subst" "0.418079" "01164" "DPAGT1_000002" "g.118967758T>C" "frequency up to 0,49%" "" "" "" "" "Germline" "" "rs643788" "0" "" "" "g.119097048T>C" "" "benign" "" "0000255453" "0" "90" "11" "118963178" "118963178" "subst" "0" "01943" "HMBS_000022" "g.118963178A>G" "" "" "" "HMBS(NM_000190.4):c.716A>G (p.H239R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092468A>G" "" "pathogenic" "" "0000267508" "0" "10" "11" "118967758" "118967758" "subst" "0.418079" "02325" "DPAGT1_000002" "g.118967758T>C" "" "" "" "DPAGT1(NM_001382.4):c.1177A>G (p.I393V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119097048T>C" "" "benign" "" "0000270887" "0" "10" "11" "118967758" "118967758" "subst" "0.418079" "02326" "DPAGT1_000002" "g.118967758T>C" "" "" "" "DPAGT1(NM_001382.4):c.1177A>G (p.I393V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119097048T>C" "" "benign" "" "0000270888" "0" "70" "11" "118971076" "118971076" "subst" "0" "02326" "DPAGT1_000005" "g.118971076C>G" "" "" "" "DPAGT1(NM_001382.4):c.539G>C (p.C180S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119100366C>G" "" "likely pathogenic" "" "0000270889" "0" "70" "11" "118968190" "118968190" "subst" "2.43645E-5" "02326" "DPAGT1_000004" "g.118968190C>T" "" "" "" "DPAGT1(NM_001382.4):c.989G>A (p.G330D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119097480C>T" "" "likely pathogenic" "" "0000277686" "0" "10" "11" "118962230" "118962230" "subst" "0.235217" "02330" "HMBS_000016" "g.118962230G>T" "" "" "" "HMBS(NM_000190.4):c.606G>T (p.V202=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119091520G>T" "" "benign" "" "0000277687" "0" "10" "11" "118962816" "118962816" "subst" "0.300982" "02330" "HMBS_000018" "g.118962816C>A" "" "" "" "HMBS(NM_000190.4):c.613-19C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092106C>A" "" "benign" "" "0000281376" "0" "10" "11" "118962230" "118962230" "subst" "0.235217" "02325" "HMBS_000016" "g.118962230G>T" "" "" "" "HMBS(NM_000190.4):c.606G>T (p.V202=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119091520G>T" "" "benign" "" "0000281377" "0" "10" "11" "118962816" "118962816" "subst" "0.300982" "02325" "HMBS_000018" "g.118962816C>A" "" "" "" "HMBS(NM_000190.4):c.613-19C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092106C>A" "" "benign" "" "0000283414" "0" "30" "11" "118963750" "118963750" "subst" "0.00417448" "02329" "HMBS_000029" "g.118963750G>A" "" "" "" "HMBS(NM_000190.4):c.912+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119093040G>A" "" "likely benign" "" "0000283415" "0" "30" "11" "118963869" "118963869" "subst" "0.00117351" "02329" "HMBS_000031" "g.118963869G>A" "" "" "" "HMBS(NM_000190.4):c.962G>A (p.R321H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119093159G>A" "" "likely benign" "" "0000289091" "0" "10" "11" "118962816" "118962816" "subst" "0.300982" "01943" "HMBS_000018" "g.118962816C>A" "" "" "" "HMBS(NM_000190.4):c.613-19C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092106C>A" "" "benign" "" "0000289092" "0" "90" "11" "118963113" "118963113" "subst" "0" "01943" "HMBS_000019" "g.118963113G>C" "" "" "" "HMBS(NM_000190.4):c.652-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092403G>C" "" "pathogenic" "" "0000289093" "0" "90" "11" "118963129" "118963129" "subst" "0" "01943" "HMBS_000020" "g.118963129G>A" "" "" "" "HMBS(NM_000190.4):c.667G>A (p.E223K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092419G>A" "" "pathogenic" "" "0000289094" "0" "90" "11" "118963136" "118963136" "subst" "0.000170597" "01943" "HMBS_000021" "g.118963136G>A" "" "" "" "HMBS(NM_000190.4):c.674G>A (p.R225Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092426G>A" "" "pathogenic" "" "0000289096" "0" "90" "11" "118963201" "118963201" "subst" "0" "01943" "HMBS_000024" "g.118963201T>C" "" "" "" "HMBS(NM_000190.4):c.739T>C (p.C247R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092491T>C" "" "pathogenic" "" "0000289097" "0" "90" "11" "118963487" "118963487" "del" "0" "01943" "HMBS_000026" "g.118963487del" "" "" "" "HMBS(NM_000190.4):c.791delC (p.P264Qfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092777del" "" "pathogenic" "" "0000289098" "0" "90" "11" "118963522" "118963522" "subst" "0" "01943" "HMBS_000027" "g.118963522G>A" "" "" "" "HMBS(NM_000190.4):c.825+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092812G>A" "" "pathogenic" "" "0000289100" "0" "30" "11" "118963736" "118963736" "subst" "8.12117E-6" "01943" "HMBS_000028" "g.118963736C>T" "" "" "" "HMBS(NM_000190.4):c.912+5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119093026C>T" "" "likely benign" "" "0000289101" "0" "10" "11" "118963793" "118963793" "subst" "0.000158367" "01943" "HMBS_000030" "g.118963793C>G" "" "" "" "HMBS(NM_000190.4):c.913-27C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119093083C>G" "" "benign" "" "0000289103" "0" "90" "11" "118963898" "118963898" "subst" "0" "01943" "HMBS_000032" "g.118963898G>A" "" "" "" "HMBS(NM_000190.4):c.991G>A (p.A331T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119093188G>A" "" "pathogenic" "" "0000322541" "0" "30" "11" "118963227" "118963227" "subst" "0" "01804" "HMBS_000025" "g.118963227G>C" "" "" "" "HMBS(NM_000190.3):c.765G>C (p.(Arg255Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119092517G>C" "" "likely benign" "" "0000322542" "0" "50" "11" "118967888" "118967888" "subst" "0" "01804" "DPAGT1_000003" "g.118967888A>C" "" "" "" "DPAGT1(NM_001382.3):c.1125T>G (p.(His375Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119097178A>C" "" "VUS" "" "0000322543" "0" "50" "11" "118971122" "118971122" "subst" "2.03363E-5" "01804" "DPAGT1_000006" "g.118971122C>T" "" "" "" "DPAGT1(NM_001382.3):c.497-4G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119100412C>T" "" "VUS" "" "0000347988" "0" "50" "11" "118969174" "118969174" "subst" "0" "02327" "DPAGT1_000007" "g.118969174A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.119098464A>C" "" "VUS" "" "0000542640" "0" "90" "11" "118963186" "118963205" "dup" "0" "01943" "DPAGT1_000008" "g.118963186_118963205dup" "" "" "" "HMBS(NM_000190.4):c.724_743dupGAGACTCTGCTTCGCTGCAT (p.I248Mfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119092476_119092495dup" "" "pathogenic" "" "0000542641" "0" "50" "11" "118963971" "118963971" "subst" "3.25219E-5" "01943" "DPAGT1_000009" "g.118963971G>A" "" "" "" "HMBS(NM_000190.4):c.1064G>A (p.R355Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119093261G>A" "" "VUS" "" "0000542642" "0" "30" "11" "118963982" "118963982" "subst" "8.53985E-5" "01943" "DPAGT1_000010" "g.118963982G>A" "" "" "" "HMBS(NM_000190.4):c.1075G>A (p.D359N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119093272G>A" "" "likely benign" "" "0000542644" "0" "50" "11" "118971059" "118971059" "subst" "0" "02327" "DPAGT1_000011" "g.118971059T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119100349T>C" "" "VUS" "" "0000542645" "0" "50" "11" "118971085" "118971085" "subst" "0" "02327" "DPAGT1_000012" "g.118971085G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119100375G>A" "" "VUS" "" "0000542646" "0" "50" "11" "118971528" "118971528" "subst" "0" "02327" "DPAGT1_000013" "g.118971528A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119100818A>C" "" "VUS" "" "0000656717" "0" "30" "11" "118963869" "118963869" "subst" "0.00117351" "02327" "HMBS_000031" "g.118963869G>A" "" "" "" "HMBS(NM_000190.4):c.962G>A (p.R321H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.119093159G>A" "" "likely benign" "" "0000664820" "3" "70" "11" "118969189" "118969189" "subst" "4.06134E-6" "01164" "DPAGT1_000015" "g.118969189G>A" "" "" "" "" "Basiri et al. 2013. Neuriomuscul Disord 23: 843" "Germline" "" "rs1053302601" "0" "" "" "g.119098479G>A" "" "likely pathogenic" "" "0000804927" "0" "90" "11" "118963192" "118963193" "del" "0" "01943" "DPAGT1_000016" "g.118963192_118963193del" "" "" "" "HMBS(NM_000190.4):c.730_731delCT (p.L244Afs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000804928" "0" "50" "11" "118971337" "118971337" "subst" "0.00012191" "01804" "DPAGT1_000017" "g.118971337T>C" "" "" "" "DPAGT1(NM_001382.3):c.496+3A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000804929" "0" "30" "11" "118971734" "118971734" "subst" "0" "01943" "DPAGT1_000018" "g.118971734G>A" "" "" "" "DPAGT1(NM_001382.3):c.276C>T (p.H92=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862337" "0" "30" "11" "118963677" "118963677" "subst" "1.21817E-5" "01943" "DPAGT1_000019" "g.118963677C>T" "" "" "" "HMBS(NM_000190.4):c.858C>T (p.D286=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862338" "0" "90" "11" "118968749" "118968750" "del" "0" "01943" "DPAGT1_000020" "g.118968749_118968750del" "" "" "" "DPAGT1(NM_001382.3):c.733_734delCC (p.P245Ifs*104)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000908572" "0" "70" "11" "118971474" "118971474" "subst" "0" "02153" "DPAGT1_000022" "g.118971474C>T" "" "" "" "" "" "Germline" "yes" "rs1131691904" "0" "" "" "g.119100764C>T" "" "likely pathogenic" "ACMG" "0000908573" "0" "70" "11" "118968628" "118968628" "subst" "0" "02153" "DPAGT1_000021" "g.118968628T>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.119097918T>C" "" "VUS" "ACMG" "0000913516" "0" "10" "11" "118962816" "118962816" "subst" "0.300982" "02329" "HMBS_000018" "g.118962816C>A" "" "" "" "HMBS(NM_000190.4):c.613-19C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000925330" "0" "10" "11" "118962230" "118962230" "subst" "0.235217" "02329" "HMBS_000016" "g.118962230G>T" "" "" "" "HMBS(NM_000190.4):c.606G>T (p.V202=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000929808" "0" "30" "11" "118963927" "118963927" "subst" "0.000694461" "02329" "DPAGT1_000023" "g.118963927C>T" "" "" "" "HMBS(NM_000190.4):c.1020C>T (p.N340=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000946087" "3" "50" "11" "118971370" "118971370" "subst" "8.12532E-6" "00006" "DPAGT1_000024" "g.118971370G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.119100660G>A" "" "VUS" "" "0000949601" "0" "50" "11" "118967936" "118967938" "del" "0" "01804" "DPAGT1_000025" "g.118967936_118967938del" "" "" "" "DPAGT1(NM_001382.3):c.1079_1081del (p.(Asn360del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979392" "0" "50" "11" "118968266" "118968266" "subst" "0" "01804" "DPAGT1_000026" "g.118968266G>T" "" "" "" "DPAGT1(NM_001382.4):c.918-5C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979393" "0" "30" "11" "118971042" "118971042" "subst" "0.000324868" "01804" "DPAGT1_000027" "g.118971042G>A" "" "" "" "DPAGT1(NM_001382.4):c.573C>T (p.(Asn191=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000998809" "0" "50" "11" "118963677" "118963677" "subst" "0" "01804" "DPAGT1_000028" "g.118963677C>A" "" "" "" "HMBS(NM_000190.3):c.858C>A (p.(Asp286Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014759" "0" "70" "11" "118963136" "118963136" "subst" "0.000170597" "02329" "HMBS_000021" "g.118963136G>A" "" "" "" "HMBS(NM_000190.4):c.674G>A (p.R225Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001014760" "0" "50" "11" "118963136" "118963136" "subst" "0.000170597" "02327" "HMBS_000021" "g.118963136G>A" "" "" "" "HMBS(NM_000190.4):c.674G>A (p.R225Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014761" "0" "30" "11" "118963750" "118963750" "subst" "0.00417448" "02330" "HMBS_000029" "g.118963750G>A" "" "" "" "HMBS(NM_000190.4):c.912+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038270" "0" "30" "11" "118968558" "118968558" "subst" "1.62447E-5" "01804" "DPAGT1_000029" "g.118968558C>T" "" "" "" "DPAGT1(NM_001382.4):c.917+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038271" "0" "50" "11" "118968662" "118968662" "subst" "0" "01804" "DPAGT1_000030" "g.118968662T>A" "" "" "" "DPAGT1(NM_001382.4):c.820A>T (p.(Thr274Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038272" "0" "50" "11" "118971335" "118971335" "subst" "0" "01804" "DPAGT1_000031" "g.118971335C>T" "" "" "" "DPAGT1(NM_001382.4):c.496+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038273" "0" "50" "11" "118972281" "118972281" "subst" "0.000105581" "01804" "DPAGT1_000032" "g.118972281T>A" "" "" "" "DPAGT1(NM_001382.4):c.85A>T (p.(Ile29Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001069499" "3" "50" "11" "118968245" "118968245" "subst" "0" "00006" "DPAGT1_000033" "g.118968245C>G" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PM2, PP3_mod, PP2" "Germline" "" "" "0" "" "" "g.119097535C>G" "SCV006074885" "VUS" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes DPAGT1 ## Count = 58 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000061627" "00006639" "50" "326" "0" "326" "0" "c.326T>A" "r.(?)" "p.(Ile109Asn)" "3" "0000062866" "00006639" "10" "1177" "0" "1177" "0" "c.1177A>G" "r.(?)" "p.(Ile393Val)" "" "0000255453" "00006639" "90" "5757" "0" "5757" "0" "c.*4530T>C" "r.(=)" "p.(=)" "" "0000267508" "00006639" "10" "1177" "0" "1177" "0" "c.1177A>G" "r.(?)" "p.(Ile393Val)" "" "0000270887" "00006639" "10" "1177" "0" "1177" "0" "c.1177A>G" "r.(?)" "p.(Ile393Val)" "" "0000270888" "00006639" "70" "539" "0" "539" "0" "c.539G>C" "r.(?)" "p.(Cys180Ser)" "" "0000270889" "00006639" "70" "989" "0" "989" "0" "c.989G>A" "r.(?)" "p.(Gly330Asp)" "" "0000277686" "00006639" "10" "6705" "0" "6705" "0" "c.*5478C>A" "r.(=)" "p.(=)" "" "0000277687" "00006639" "10" "6119" "0" "6119" "0" "c.*4892G>T" "r.(=)" "p.(=)" "" "0000281376" "00006639" "10" "6705" "0" "6705" "0" "c.*5478C>A" "r.(=)" "p.(=)" "" "0000281377" "00006639" "10" "6119" "0" "6119" "0" "c.*4892G>T" "r.(=)" "p.(=)" "" "0000283414" "00006639" "30" "5185" "0" "5185" "0" "c.*3958C>T" "r.(=)" "p.(=)" "" "0000283415" "00006639" "30" "5066" "0" "5066" "0" "c.*3839C>T" "r.(=)" "p.(=)" "" "0000289091" "00006639" "10" "6119" "0" "6119" "0" "c.*4892G>T" "r.(=)" "p.(=)" "" "0000289092" "00006639" "90" "5822" "0" "5822" "0" "c.*4595C>G" "r.(=)" "p.(=)" "" "0000289093" "00006639" "90" "5806" "0" "5806" "0" "c.*4579C>T" "r.(=)" "p.(=)" "" "0000289094" "00006639" "90" "5799" "0" "5799" "0" "c.*4572C>T" "r.(=)" "p.(=)" "" "0000289096" "00006639" "90" "5734" "0" "5734" "0" "c.*4507A>G" "r.(=)" "p.(=)" "" "0000289097" "00006639" "90" "5449" "0" "5449" "0" "c.*4222del" "r.(?)" "p.(=)" "" "0000289098" "00006639" "90" "5413" "0" "5413" "0" "c.*4186C>T" "r.(=)" "p.(=)" "" "0000289100" "00006639" "30" "5199" "0" "5199" "0" "c.*3972G>A" "r.(=)" "p.(=)" "" "0000289101" "00006639" "10" "5142" "0" "5142" "0" "c.*3915G>C" "r.(=)" "p.(=)" "" "0000289103" "00006639" "90" "5037" "0" "5037" "0" "c.*3810C>T" "r.(=)" "p.(=)" "" "0000322541" "00006639" "30" "5708" "0" "5708" "0" "c.*4481C>G" "r.(=)" "p.(=)" "" "0000322542" "00006639" "50" "1125" "0" "1125" "0" "c.1125T>G" "r.(?)" "p.(His375Gln)" "" "0000322543" "00006639" "50" "497" "-4" "497" "-4" "c.497-4G>A" "r.spl?" "p.?" "" "0000347988" "00006639" "50" "667" "0" "667" "0" "c.667T>G" "r.(?)" "p.(Phe223Val)" "" "0000542640" "00006639" "90" "5730" "0" "5749" "0" "c.*4503_*4522dup" "r.(=)" "p.(=)" "" "0000542641" "00006639" "50" "4964" "0" "4964" "0" "c.*3737C>T" "r.(=)" "p.(=)" "" "0000542642" "00006639" "30" "4953" "0" "4953" "0" "c.*3726C>T" "r.(=)" "p.(=)" "" "0000542644" "00006639" "50" "556" "0" "556" "0" "c.556A>G" "r.(?)" "p.(Ile186Val)" "" "0000542645" "00006639" "50" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" "" "0000542646" "00006639" "50" "308" "0" "308" "0" "c.308T>G" "r.(?)" "p.(Leu103Arg)" "" "0000656717" "00006639" "30" "5066" "0" "5066" "0" "c.*3839C>T" "r.(=)" "p.(=)" "" "0000664820" "00006639" "70" "652" "0" "652" "0" "c.652C>T" "r.(?)" "p.(Arg218Trp)" "" "0000804927" "00006639" "90" "5744" "0" "5745" "0" "c.*4517_*4518del" "r.(=)" "p.(=)" "" "0000804928" "00006639" "50" "496" "3" "496" "3" "c.496+3A>G" "r.spl?" "p.?" "" "0000804929" "00006639" "30" "276" "0" "276" "0" "c.276C>T" "r.(?)" "p.(His92=)" "" "0000862337" "00006639" "30" "5258" "0" "5258" "0" "c.*4031G>A" "r.(=)" "p.(=)" "" "0000862338" "00006639" "90" "733" "0" "734" "0" "c.733_734del" "r.(?)" "p.(Pro245Ilefs*104)" "" "0000908572" "00006639" "70" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "3" "0000908573" "00006639" "70" "854" "0" "854" "0" "c.854A>G" "r.(?)" "p.(Asn285Ser)" "6" "0000913516" "00006639" "10" "6119" "0" "6119" "0" "c.*4892G>T" "r.(=)" "p.(=)" "" "0000925330" "00006639" "10" "6705" "0" "6705" "0" "c.*5478C>A" "r.(=)" "p.(=)" "" "0000929808" "00006639" "30" "5008" "0" "5008" "0" "c.*3781G>A" "r.(=)" "p.(=)" "" "0000946087" "00006639" "50" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Arg156Cys)" "" "0000949601" "00006639" "50" "1079" "0" "1081" "0" "c.1079_1081del" "r.(?)" "p.(Asn360del)" "" "0000979392" "00006639" "50" "918" "-5" "918" "-5" "c.918-5C>A" "r.spl?" "p.?" "" "0000979393" "00006639" "30" "573" "0" "573" "0" "c.573C>T" "r.(?)" "p.(=)" "" "0000998809" "00006639" "50" "5258" "0" "5258" "0" "c.*4031G>T" "r.(=)" "p.(=)" "" "0001014759" "00006639" "70" "5799" "0" "5799" "0" "c.*4572C>T" "r.(=)" "p.(=)" "" "0001014760" "00006639" "50" "5799" "0" "5799" "0" "c.*4572C>T" "r.(=)" "p.(=)" "" "0001014761" "00006639" "30" "5185" "0" "5185" "0" "c.*3958C>T" "r.(=)" "p.(=)" "" "0001038270" "00006639" "30" "917" "7" "917" "7" "c.917+7G>A" "r.(=)" "p.(=)" "" "0001038271" "00006639" "50" "820" "0" "820" "0" "c.820A>T" "r.(?)" "p.(Thr274Ser)" "" "0001038272" "00006639" "50" "496" "5" "496" "5" "c.496+5G>A" "r.spl?" "p.?" "" "0001038273" "00006639" "50" "85" "0" "85" "0" "c.85A>T" "r.(?)" "p.(Ile29Phe)" "" "0001069499" "00006639" "50" "934" "0" "934" "0" "c.934G>C" "r.(?)" "p.(Gly312Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 7 "{{screeningid}}" "{{variantid}}" "0000034495" "0000061627" "0000035741" "0000062866" "0000301750" "0000664820" "0000429147" "0000908572" "0000429147" "0000908573" "0000444230" "0000946087" "0000475103" "0001069499"