### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = DYNC1H1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "DYNC1H1" "dynein, cytoplasmic 1, heavy chain 1" "14" "q32.31" "unknown" "NG_008777.1" "UD_132118736913" "" "https://www.LOVD.nl/DYNC1H1" "" "1" "2961" "1778" "600112" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/DYNC1H1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-12-11 17:01:45" "00006" "2026-03-06 17:26:39" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00006789" "DYNC1H1" "dynein, cytoplasmic 1, heavy chain 1" "001" "NM_001376.4" "" "NP_001367.2" "" "" "" "-164" "14176" "13941" "102430865" "102517135" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 23 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00199" "CMT2" "Charcot-Marie-Tooth disease, type 2 (CMT-2)" "" "" "" "" "" "00006" "2013-09-13 14:35:15" "00006" "2021-12-11 13:56:28" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "00385" "DA" "arthrogryposis, distal (DA)" "" "" "" "" "" "00006" "2014-05-27 12:44:13" "00006" "2015-12-08 23:59:30" "00809" "CMT2O" "Charcot-Marie-Tooth disease, axonal, type 2O (CMT2O)" "AD" "614228" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-07-21 14:17:26" "00810" "MRD13" "mental retardation, autosomal dominant, type 13 (MRD13)" "AD" "614563" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-07-21 14:17:56" "00811" "SMALED1" "atrophy, muscular, spinal, lower extremity predominant, type 1" "AD" "158600" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2022-12-22 17:16:32" "00841" "EIEE" "encephalopathy, epileptic, early infantile (EIEE)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2015-02-20 16:58:56" "02293" "HMN8" "Neuronopathy, distal hereditary motor, type VIII" "AD" "600175" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "05106" "MPD" "myopathy, distal (MPD)" "" "" "" "" "" "00006" "2015-12-08 01:43:19" "" "" "05111" "HMN" "neuropathy, motor, distal, hereditary (HMN)" "" "" "" "" "" "00006" "2016-01-11 01:33:03" "00006" "2016-03-20 12:15:43" "05113" "CMT" "Charcot-Marie-Tooth disease (CMT)" "" "" "" "" "" "00006" "2016-01-11 01:40:57" "" "" "05123" "SMA" "atrophy, muscular, spinal (SMA)" "" "" "" "" "" "00006" "2016-01-24 01:41:54" "" "" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05384" "neuropathy" "neuropathy" "" "" "" "" "" "00006" "2018-01-27 20:34:06" "" "" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" "06988" "SMALED" "atrophy, muscular, spinal, lower extremity predominant" "" "" "" "" "" "00006" "2022-12-22 17:16:49" "" "" "07233" "paraplegia" "paraplegia" "" "" "" "" "" "00006" "2026-03-03 14:58:47" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 4 "{{geneid}}" "{{diseaseid}}" "DYNC1H1" "00139" "DYNC1H1" "00809" "DYNC1H1" "00810" "DYNC1H1" "00811" ## Individuals ## Do not remove or alter this header ## ## Count = 76 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00022372" "" "" "" "1" "" "00793" "" "" "F" "no" "China" "" "0" "" "" "" "" "00080905" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected non-carrier parents" "" "" "" "" "0" "" "" "" "" "00180151" "" "" "" "1" "" "00006" "{PMID:Tumienė 2018:29286531}" "" "" "" "(Slovenia)" "" "0" "" "" "" "29286531-Pat03" "00183060" "" "" "" "1" "" "00006" "{PMID:de Ligt 2012:23033978}" "" "F" "" "Netherlands" "" "0" "" "" "" "23033978-Trio54" "00207958" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00210006" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00269477" "" "" "" "1" "" "03512" "{PMID:Minardi 2020:32725632}" "" "" "" "Italy" "" "0" "" "" "" "" "00281786" "" "" "" "1" "" "03752" "{PMID:Sevy 2016:25783436}, {PMID:Cerino 2020:32934002}" "" "F" "" "France" "" "0" "" "" "" "Pat6" "00287377" "" "" "" "1" "" "03564" "" "" "F" "?" "Belgium" "20y" "0" "" "" "" "" "00288201" "" "" "" "1" "" "00006" "{PMID:Lee 2019:31607746}" "" "" "" "United States" "" "0" "" "" "" "Pat11" "00290964" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295567" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00299691" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00299987" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300036" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300037" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300038" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300039" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300040" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat-DYNC1H1-a" "00300041" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300042" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300043" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300044" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00300106" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat-DYNC1H1-b" "00300141" "" "" "" "1" "" "00006" "{PMID:Antoniadi 2015:26392352}" "analysis 448 inherited peripheral neuropathy cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat3" "00302987" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat32" "00305977" "" "" "" "1" "" "00006" "{PMID:Johannesen 2020:32427350}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Denmark" "" "0" "" "" "" "Pat8" "00314238" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314887" "" "" "" "1" "" "00006" "{PMID:Zhu 2015:25590979}" "" "M" "" "Israel" "" "0" "" "" "" "Trio65" "00314903" "" "" "" "1" "" "00006" "{PMID:Zhu 2015:25590979}" "" "M" "" "United States" "" "0" "" "" "" "Trio96" "00315489" "" "" "" "1" "" "00006" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "4-generation family, 10 affected (3F, 7M)" "F;M" "" "Australia" "" "0" "" "" "" "FamAus1" "00315490" "" "" "" "1" "" "00006" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Australia" "" "0" "" "" "" "FamAus2PatII1" "00315491" "" "" "" "1" "" "00006" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Turkey" "" "0" "" "" "" "FamTur1PatII1" "00315492" "" "" "" "1" "" "00006" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "3-generation family, 1 affected" "M" "" "Australia" "" "0" "" "" "" "P4" "00315501" "" "" "" "1" "" "01602" "{PMID:Neubauer 2021:33895855}" "" "M" "" "Switzerland" "19y" "" "" "" "Europe" "SUDS080" "00324338" "" "" "" "1" "" "01164" "" "submission from patient via MGZ - Laner" "F" "?" "" "" "0" "" "" "" "" "00324409" "" "" "" "1" "" "00006" "{PMID:Vissers 2010:21076407}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "(Netherlands)" "" "0" "" "" "" "MRtrio1" "00334938" "" "" "" "1" "" "03286" "{PMID:Courage 2021:33798445}, {DOI:Courage 2021:10.1016/j.ajhg.2021.03.013}" "" "M" "no" "Italy" "" "0" "" "" "" "PME64" "00374264" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2058" "00374718" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2001" "00374719" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-846" "00374720" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4324" "00375639" "" "" "" "1" "" "00006" "{PMID:Srivastava 2014:25131622}" "" "" "" "United States" "" "0" "" "" "" "Pat5" "00377144" "" "" "" "1" "" "04115" "" "" "M" "no" "China" "" "" "" "" "Han" "Huashan DYNC1H1-001" "00377145" "" "" "" "1" "" "04115" "" "" "F" "no" "China" "" "" "" "" "Han" "Huashan DYNC1H1-002" "00398815" "" "" "" "1" "" "04188" "{PMID:Ferese 2021:34354735}" "2-generation family, 1 affected, family members unavailable for testing" "M" "" "Italy" ">36y" "" "" "" "" "962" "00398816" "" "" "" "1" "" "04188" "{PMID:Ferese 2021:34354735}" "2-generation family, 1 affected, family members unavailable for testing" "F" "" "Italy" ">63y" "" "" "" "" "731" "00398989" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P7" "00402727" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "192027" "00408682" "" "" "" "1" "" "00006" "{PMID:Thomas 2022:34085946}" "no family history" "" "no" "France" "" "0" "" "" "" "Pat09" "00414374" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP41" "00415084" "" "" "" "1" "" "01164" "" "" "M" "-" "Germany" "" "0" "" "" "" "203285" "00419884" "" "" "" "1" "" "00006" "{PMID:Angelozzi 2022:35232796}" "2-generation family, 1 affected, unaffected non carrier parents" "F" "" "" "" "0" "" "" "" "Pat6" "00432486" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "209605" "00433656" "" "" "" "1" "" "03544" "" "" "" "" "" "" "" "" "" "" "" "00440375" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED2267.1" "00442657" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat29" "00442658" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat30" "00442747" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat119" "00442748" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat120" "00442768" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat140" "00442774" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat146" "00442775" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat147" "00442803" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat175" "00466000" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "335169" "00466002" "" "" "" "1" "" "01164" "" "" "M" "?" "? (unknown)" "" "0" "" "" "Arabia" "335446" "00466873" "" "" "" "1" "" "01164" "" "" "M" "?" "? (unknown)" "" "0" "" "" "" "345963" "00468828" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00468829" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00468830" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00472251" "" "" "" "1" "" "04653" "Verebi et al. (submitted)" "" "M" "" "France" "" "0" "" "" "" "" "00472661" "" "" "" "1" "" "00006" "{PMID:Estevez-Arias 2025:39333429}" "patient" "" "" "" "" "0" "" "" "" "Pat24" "00473074" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "yes" "Iran" "" "0" "" "" "" "Fam14840Pat194" "00473514" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "no" "Iran" "" "0" "" "" "" "Fam8710101Pat885" "00473733" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "M" "no" "Iran" "" "0" "" "" "" "Fam9606064Pat1173" "00473758" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, no family history" "F" "no" "Iran" "" "0" "" "" "" "Fam9610493Pat1211" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 74 "{{individualid}}" "{{diseaseid}}" "00022372" "00199" "00080905" "00810" "00180151" "00198" "00183060" "00139" "00269477" "00841" "00281786" "05106" "00287377" "05126" "00288201" "00198" "00290964" "00198" "00295567" "00198" "00299691" "00198" "00299987" "05111" "00300036" "00199" "00300037" "05111" "00300038" "00199" "00300039" "00199" "00300040" "05111" "00300041" "05111" "00300042" "05111" "00300043" "00199" "00300044" "05384" "00300106" "05111" "00300141" "05111" "00302987" "05521" "00305977" "04270" "00314238" "05126" "00314887" "00198" "00314903" "00198" "00315489" "00385" "00315490" "00385" "00315491" "00244" "00315492" "00385" "00315501" "05166" "00324338" "05123" "00324409" "00139" "00334938" "02293" "00374264" "00198" "00374718" "00198" "00374719" "00198" "00374720" "00198" "00375639" "00198" "00377144" "00809" "00377145" "00809" "00398815" "00809" "00398816" "00809" "00398989" "05618" "00402727" "00811" "00408682" "05618" "00414374" "00198" "00415084" "00809" "00419884" "05611" "00432486" "06988" "00433656" "00810" "00440375" "00198" "00442657" "05618" "00442658" "05618" "00442747" "05618" "00442748" "05618" "00442768" "05618" "00442774" "05618" "00442775" "05618" "00442803" "05618" "00466000" "00810" "00466002" "00811" "00466873" "00810" "00468828" "00198" "00468829" "00198" "00468830" "00198" "00472251" "00811" "00472661" "05618" "00473074" "07233" "00473514" "05618" "00473733" "05123" "00473758" "05113" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00199, 00244, 00385, 00809, 00810, 00811, 00841, 02293, 04270, 05106, 05111, 05113, 05123, 05126, 05166, 05384, 05521, 05611, 05618, 06988, 07233 ## Count = 73 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000020144" "00199" "00022372" "00793" "Familial, autosomal dominant" "03y" "weakness in lower extremities;mental retardation" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000060474" "00810" "00080905" "01758" "Isolated (sporadic)" "" "Mental retardation, autosomal dominant 13 (OMIM:614563)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000142605" "00198" "00180151" "00006" "Familial, autosomal dominant" "" "(Rett-like syndrome): epilepsy (HP:0001250), focal seizures (HP:0007359), autism (HP:0000717), global developmental delay (HP:0001263), microcephaly (HP:0000252)." "" "" "" "" "" "" "" "" "" "" "MRD-13" "epilepsy or seizures associated with neurodevelopmental disorders and/or congenital malformations" "" "0000143813" "00139" "00183060" "00006" "Unknown" "" "see paper; …" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability (ID)" "" "0000155728" "00198" "00207958" "01164" "Unknown" "" "HP:0011344 (Severe global developmental delay); HP:0001344 (Absent speech); HP:0000252 (Microcephaly); HP:0001250 (Seizures); HP:0002263 (Exaggerated cupid\'s bow); HP:0030051 (Tip-toe gait); HP:0000322 (Short philtrum); HP:0000817 (Poor eye contact)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000207319" "00841" "00269477" "03512" "Isolated (sporadic)" "" "Epileptic Encephalopathy (HP:0200134)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000216367" "05106" "00281786" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "distal myopathy" "" "0000221938" "00198" "00288201" "00006" "Isolated (sporadic)" "15y" "muscle weakness, flexion contracture, muscle atrophy, joint hypermobility, ankle contracture, decreased muscle mass, attention deficit hyperactivity disorder, absent achilles reflex, broad-based gait, shuffling gait, absent patellar reflexes, waddling gait, hyperlordosis, muscular dystrophy, learning disabilities, myopathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000221979" "05126" "00287377" "03564" "Unknown" "19y" "psoas weakness, pelvic girdle weakness, tibialis anterior weakness, easy fatigability" "12y" "" "19y" "proximal lower-limb weakness" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000223132" "00198" "00295567" "01164" "Unknown" "" "Abnormality of the curvature of the vertebral column (HP:0010674); Global developmental delay (HP:0001263); Abnormality of nervous system physiology (HP:0012638); Hip dysplasia (HP:0001385); Abnormality of the esophagus (HP:0002031); Achalasia (HP:0002571); Scoliosis (HP:0002650); Abnormality of the hip bone (HP:0003272); Demyelinating peripheral neuropathy (HP:0007108); Sensorimotor neuropathy (HP:0007141)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000226996" "00198" "00299691" "01164" "Unknown" "" "Intellectual disability (HP:0001249); Abnormality of nervous system physiology (HP:0012638)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000227308" "05111" "00299987" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000227357" "00199" "00300036" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "CMT2" "" "0000227358" "05111" "00300037" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000227359" "00199" "00300038" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "CMT2" "" "0000227360" "00199" "00300039" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "CMT2" "" "0000227361" "05111" "00300040" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000227362" "05111" "00300041" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000227363" "05111" "00300042" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000227364" "00199" "00300043" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "CMT2" "" "0000227365" "05384" "00300044" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "complex inherited peripheral neuropathy" "" "0000227427" "05111" "00300106" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000227462" "05111" "00300141" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "hereditar motor neuropathy" "" "0000230070" "05521" "00302987" "00006" "Isolated (sporadic)" "" "Epileptic Encephalopathy, Infantile Spasms; age onset infantile" "" "" "" "" "" "" "" "" "" "" "MRD13" "seizures" "" "0000231823" "04270" "00305977" "00006" "Isolated (sporadic)" "29y" "" "" "" "" "" "" "" "" "" "" "" "" "Lennox Gastaut syndrome" "" "0000238645" "00198" "00314887" "00006" "Isolated (sporadic)" "4y" "General delay, autism spectrum disorder, intellectual disability, dysmorphic features—Kabuki like, hypotonia." "1d" "" "" "" "" "" "" "" "" "" "" "" "" "0000238661" "00198" "00314903" "00006" "Unknown" "5y" "Failure to thrive, global developmental delay, hypotonia, congenital cataracts, microcephaly with decreased white matter volume, small corpus callosum, and possible migrational abnormality." "1d" "" "" "" "" "" "" "" "" "" "" "" "" "0000239240" "00385" "00315489" "00006" "Familial, autosomal dominant" "" "see paper; distal arthrogryposis , ..." "" "" "" "" "" "" "" "" "" "" "" "distal arthrogryposis" "" "0000239241" "00385" "00315490" "00006" "Isolated (sporadic)" "" "see paper; onset birth; atrophy lower limbs; muscle weakness lower limbs; DTR reduced lower limb; born with feet dorsiflexed to shin, knee contractures, ..." "" "" "" "" "" "" "" "" "" "" "" "distal arthrogryposis" "" "0000239242" "00244" "00315491" "00006" "Isolated (sporadic)" "" "see paper; onset birth; distal lower limb atrophy; muscle weakness upper limb flexors MRC 4/5, lower limb proximal MRC 3/5, Gowers sign; DTR absent in lower limb; no joint contractures; pes cavus, scapular winging, lordosis, high-arched palate; myopathic face, ..." "" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000239243" "00385" "00315492" "00006" "Unknown" "" "see paper; onset birth; severe distal lower limb wasting; muscle weakness quadriceps and hamstrings moderately weak, hip strength normal; DTR absent in lower limbs, normal in upper limbs; no joint contractures; ankles fused in neutral position; low amplitude tibial nerve response, ..." "" "" "" "" "" "" "" "" "" "" "" "distal arthrogryposis" "" "0000242881" "05123" "00324338" "01164" "Unknown" "03y" "Delayed ability to walk; Global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000242951" "00139" "00324409" "00006" "Isolated (sporadic)" "4y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000257425" "02293" "00334938" "00006" "Isolated (sporadic)" "" "Onset age 12 of multifocal action and rest myoclonus. Frequent TCS and absence seizures refractory to medication from 22 years of age. No ataxia, normal cognition. Moderate dysarthria." "" "" "" "" "" "" "" "" "" "" "" "late onset Unverricht-Lundborg disease like" "" "0000269474" "00198" "00374264" "00006" "Familial, autosomal recessive" "" "Hypotonia, muscle atrophy and Gowers\' sign" "" "" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269928" "00198" "00374718" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "lissencephaly" "" "0000269929" "00198" "00374719" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "neuropathy" "" "0000269930" "00198" "00374720" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "neuropathy" "" "0000270852" "00198" "00375639" "00006" "Isolated (sporadic)" "" "intellectual disability/developmental delay; microcephaly; hypotonia, broad-based gait; self-injurious behavior, stereotyped behavior; MRI brain polymicrogyria" "" "" "3y" "" "" "" "" "" "" "" "" "" "" "0000272308" "00809" "00377144" "04115" "Familial, autosomal dominant" "15y" "muscle weakness (HP:0001324); distal amyotrophy (HP:0003693); motor delay (HP:0001270); lordosis (HP:0003307); no intellectual disability (-HP:0001249)" "?" "" "15y" "motor delay (HP:0001270)" "" "" "" "" "" "" "CMT 2O" "" "" "0000272309" "00809" "00377145" "04115" "Familial, autosomal dominant" "14y" "distal amyotrophy (HP:0003693); muscle weakness (HP:0001324); motor delay (HP:0001270); pes cavus (HP:0001761); no intellectual disability (-HP:0001249)" "" "" "14y" "" "" "" "" "" "" "" "CMT 2O" "" "" "0000291910" "00809" "00398815" "04188" "Familial, autosomal recessive" "36y" "Demyelinating peripheral neuropathy (HP:0007108), Decreased nerve conduction velocity (HP:0000762)" "34y" "" "" "Demyelinating peripheral neuropathy (HP:0007108), Decreased nerve conduction velocity (HP:0000762)" "" "" "" "" "" "" "" "CMT" "" "0000291911" "00809" "00398816" "04188" "Unknown" "63y" "Peripheral neuropathy (HP:0009830), Decreased nerve conduction velocity (HP:0000762)" "" "" "" "" "" "" "" "" "" "" "" "CMT" "" "0000292077" "05618" "00398989" "00006" "Unknown" "" "serum CK normal; muscle biopsy yype 1 fiber predominance; plagiocephaly, microcephaly, hypotonia" "8m" "" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000295490" "00811" "00402727" "01164" "Isolated (sporadic)" "18y" "Myopathy, Exercise intolerance, Myopathic facies, Pectoralis amyotrophy, Shoulder girdle muscle weakness, Upper limb muscle weakness, Muscular dystrophy" "" "" "" "" "" "" "" "" "" "" "" "6y" "" "0000300800" "05618" "00408682" "00006" "Isolated (sporadic)" "" "" "12m" "" "" "" "" "" "" "" "" "" "CMT2O" "neuromuscular disease" "" "0000306209" "00198" "00414374" "00000" "Unknown" "28y" "Charcot-Marie-Tooth disease;Autosomal Dominant Lower Extremity-Predominant Spinal Muscular Atrophy 1" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000306885" "00809" "00415084" "01164" "Familial, autosomal dominant" "" "Sensory axonal neuropathy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000311153" "05611" "00419884" "00006" "Isolated (sporadic)" "" "birth 30w2d; no IUGR; failure to thrive; feeding difficulties; axial hypotonia; global developmental delay; gross motor delay; fine motor delay; 20-21m-sit; speech delay, 28m-first words (mama, dada); behavioral problems; hyperactivity/ADHD; no anxiety; stereotypies; no microcephaly; MRI brain hypoplastic cochlear nerves and possible absence of the inferior division of the vestibular nerves bilaterally; EEG mild diffuse background slowing consistent with diffuse encephalopathy of nonspecific etiology; no seizures; hypertonia of upper extremities, moves all extremities but no purposeful movement, no object tracking, mostly does not grasp objects, abnormal movements, likely stereotypies (did not correlate with seizures on video-EEG) since birth.; myopia; alternating esotropia; bilateral auditory neuropathy spectrum disorder vs. sensorineural hearing loss; facial dysmorphism, mild coarse facial appearance, bitemporal narrowing, bulbous nose tip; anteverted nares and low depressed nasal bridge, big cheeks; downturned corners of mouth; philtrum protudes with philtral pillars present, but poorly developed, narrow palate, mild retrognathia; broad secondary alveolar ridges, with normal labial philtrum; normal hands/feet; moderate-large ventricular septal defect; no atrial septal defect; patent foramen; bilateral superior vena cava; no gastrointestinal findings; no genitourinary findings" "" "" "" "" "" "" "" "" "" "" "CSS10" "neurodevelopmental delay" "" "0000322111" "05166" "00315501" "01602" "Unknown" "" "SUD" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000323048" "06988" "00432486" "01164" "Unknown" "13y" "Talipes equinovarus, Motor delay, Lower limb muscle weakness, Skeletal muscle hyperechogenicity" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000324079" "00810" "00433656" "03544" "Familial" "" "intellectual disability, developmental dysphasia, attention-deficit disorder, dyspraxia" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000330285" "00198" "00440375" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "Autosomal dominant axonal Charcot-Marie-Tooth disease type 2O (MIM #614228)" "" "" "0000332004" "05618" "00442657" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "Muscle eye brain disease" "" "0000332005" "05618" "00442658" "00006" "Isolated (sporadic)" "12y" "Limb-girdle and axial muscle weakness with mild hypermobility; muscle biopsy: type 1 fiber size predominance with presence of internal nuclei and some core-like structures" "1y" "" "" "" "" "" "" "" "" "" "" "Congenital myopathy" "" "0000332094" "05618" "00442747" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "Shoulder girdle weakness" "" "0000332095" "05618" "00442748" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000332115" "05618" "00442768" "00006" "Unknown" "" "Distal muscle weakness, hyperCKaemia" "" "" "" "" "" "" "" "" "" "" "" "distal muscle weakness" "" "0000332121" "05618" "00442774" "00006" "Unknown" "" "Distal muscle weakness, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "distal muscle weakness" "" "0000332122" "05618" "00442775" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "congenital myopathy" "" "0000332150" "05618" "00442803" "00006" "Unknown" "" "Muscle weakness, exercise intolerance and myalgia" "" "" "" "" "" "" "" "" "" "" "" "muscle weakness" "" "0000351387" "00810" "00466000" "01164" "Isolated (sporadic)" "" "Global developmental delay, Autistic behavior, Microcephaly" "" "" "02y" "" "" "" "" "" "" "" "" "" "" "0000351389" "00811" "00466002" "01164" "Isolated (sporadic)" "04y" "Neurodevelopmental delay, Gait ataxia, Hypotonia, Elevated circulating hepatic transaminase concentration" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000352237" "00810" "00466873" "01164" "Unknown" "10y" "Global developmental delay, Delayed speech and language development, Motor delay, Intellectual disability, Attention deficit hyperactivity disorder, Low-set ears, Encopresis, Microcephaly, Short stature, Atrial septal defect, Extremely preterm birth, Anteverted ears, Failure to thrive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000353981" "00198" "00468828" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "autism spectrum disorder" "" "0000353982" "00198" "00468829" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000353983" "00198" "00468830" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000357060" "00811" "00472251" "04653" "Unknown" "" "0002515: Waddling gait, 0001270: Motor delay, 0005639: Hyperlaxity of the hand joints, 0003307: Hyperlordosis, 0003326: Myalgia, 0003750: Increased muscle fatigue, 0003325: Muscle weakness in the girdles" "" "" "" "" "" "" "" "" "" "" "Spinal muscular atrophy, lower extremity-predominant" "Myopathy with joint contractures" "" "0000357457" "05618" "00472661" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "axonal neuropathy" "" "0000357869" "07233" "00473074" "00006" "Unknown" "30y" "onset 12y, Seizures; Generalized tremor, hand, face; Progressive myoclonus epilepsy; Prominent & abnormal ears; Thin lips; Spasticity in lower limbs; Spastic gait; Muscle pain; Facial asymmetry; Hx of transient stuttering; Elevated level of CPK & LDH; EMG-NCV suggestive of diffuse motor neuron involvement with minimal active denervation; Moderate abnormal EEG." "" "" "" "" "" "" "" "" "" "" "" "hereditary paraplegia" "" "0000358309" "05618" "00473514" "00006" "Familial, autosomal dominant" "10y" "Bilateral talipes equinovarus; Prominent forehead; Psychomotor delay; Long face; Dull facial expression; Open mouth; Proximal & distal muscle weakness, legs>arms; Generalized muscle wasting; Pectus excavatum; Laxity in fingers, wrists & elbows; Scoliosis; Ulnar deviation of the hand; Flexion deformity of knees; Difficulty swallowing & chewing; Deformity of fingers; Abnormal toes and feet; Mental retardation, mod; Loose skin; Atrophy of hypothenar & thenar; Weak cry; EMG-NCV: chronic anterior horn cell dis; Muscle biopsy: selective type 2 fibers atrophy with denervation & reinnervation, this pathologic findings are not compatible with muscular dystrophy." "" "" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000358528" "05123" "00473733" "00006" "Familial, autosomal dominant" "23y" "Increased muscle fatigability; Muscle weakness; Skeletal muscle atrophy; Myopia (based on HPO nomenclature). EMG-NCV: chronic neurogenic change" "" "" "" "" "" "" "" "" "" "" "" "spinal myscular atrophy" "" "0000358553" "05113" "00473758" "00006" "Unknown" "46y" "onset 9-10y , Difficulty climbing steps & rising from seated position; Pes cavus, bilateral; Rest tremor; Decreased DTR & tone; EMG-NCV: compatible with Chronic Inflammatory Demyelinating Polyneuropathy (CIDP)." "" "" "" "" "" "" "" "" "" "" "" "Charcot-Marie-Tooth disease" "" ## Screenings ## Do not remove or alter this header ## ## Count = 76 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000022371" "00022372" "1" "00793" "00793" "2014-10-09 16:16:45" "00793" "2014-10-09 16:42:58" "SEQ-NG-I" "DNA" "" "" "0000081017" "00080905" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000181054" "00180151" "1" "00006" "00006" "2018-08-24 19:40:22" "" "" "SEQ-NG" "DNA" "" "WES" "0000184020" "00183060" "1" "00006" "00006" "2018-10-12 16:28:55" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000209003" "00207958" "1" "01164" "01164" "2018-12-04 16:43:54" "" "" "SEQ-NG" "DNA" "" "" "0000211063" "00210006" "1" "01164" "01164" "2018-12-25 09:53:54" "" "" "SEQ-NG" "DNA" "" "" "0000270631" "00269477" "1" "03512" "03512" "2019-11-28 17:26:57" "" "" "SEQ-NG-I" "DNA" "" "" "0000288548" "00287377" "1" "03564" "03564" "2020-02-14 15:25:43" "" "" "-" "DNA" "blood" "" "0000289370" "00288201" "1" "00006" "00006" "2020-02-16 14:03:09" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "fibroblast, blood" "WES" "0000292132" "00290964" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296737" "00295567" "1" "01164" "01164" "2020-03-18 10:48:26" "" "" "SEQ-NG-S" "DNA" "" "" "0000300801" "00299691" "1" "01164" "01164" "2020-04-20 10:27:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000301103" "00299987" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301152" "00300036" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301153" "00300037" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301154" "00300038" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301155" "00300039" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301156" "00300040" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301157" "00300041" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301158" "00300042" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301159" "00300043" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301160" "00300044" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301222" "00300106" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000301257" "00300141" "1" "00006" "00006" "2020-04-22 19:54:00" "" "" "SEQ" "DNA" "" "56-gene neuropathy panel" "0000304112" "00302987" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000307107" "00305977" "1" "00006" "00006" "2020-07-06 16:08:38" "" "" "SEQ;SEQ-NG" "DNA" "" "candidate gene panel" "0000312278" "00281786" "1" "03752" "00006" "2020-09-18 15:43:50" "" "" "SEQ;SEQ-NG" "DNA" "" "2nd gene panel" "0000315411" "00314238" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000316061" "00314887" "1" "00006" "00006" "2020-10-20 15:09:17" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000316077" "00314903" "1" "00006" "00006" "2020-10-20 15:09:17" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000316666" "00315489" "1" "00006" "00006" "2020-10-27 09:56:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000316667" "00315490" "1" "00006" "00006" "2020-10-27 09:56:44" "" "" "SEQ;SEQ-NG" "DNA" "" "neurogenic disease panel" "0000316668" "00315491" "1" "00006" "00006" "2020-10-27 09:56:44" "" "" "SEQ;SEQ-NG" "DNA" "" "neurogenic disease panel" "0000316669" "00315492" "1" "00006" "00006" "2020-10-27 09:56:44" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000325528" "00324338" "1" "01164" "01164" "2020-12-07 12:39:23" "" "" "SEQ-NG" "DNA" "" "" "0000325599" "00324409" "1" "00006" "00006" "2020-12-11 17:27:18" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000336168" "00334938" "1" "03286" "03286" "2021-03-02 13:58:34" "00006" "2021-04-14 09:22:08" "SEQ;SEQ-NG" "DNA" "WES trio" "" "0000375458" "00374264" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375912" "00374718" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375913" "00374719" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375914" "00374720" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000376836" "00375639" "1" "00006" "00006" "2021-06-14 20:30:20" "" "" "SEQ-NG" "DNA" "" "WES" "0000378349" "00377144" "1" "04115" "04115" "2021-07-12 05:57:41" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000378350" "00377145" "1" "04115" "04115" "2021-07-12 08:43:33" "" "" "SEQ-NG" "DNA" "blood" "" "0000400056" "00398815" "1" "04188" "04188" "2022-01-13 12:35:39" "" "" "SEQ-NG-I" "DNA" "" "" "0000400057" "00398816" "1" "04188" "04188" "2022-01-13 12:39:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000400234" "00398989" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000403969" "00402727" "1" "01164" "01164" "2022-02-09 11:14:50" "" "" "SEQ-NG-I" "DNA" "" "" "0000409944" "00408682" "1" "00006" "00006" "2022-04-25 19:53:26" "" "" "SEQ-NG" "DNA" "" "clincal WES" "0000415654" "00414374" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000416365" "00415084" "1" "01164" "01164" "2022-08-08 07:37:00" "" "" "SEQ-NG-I" "DNA" "Blood" "WES" "0000421189" "00419884" "1" "00006" "00006" "2022-10-24 18:06:51" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000432963" "00315501" "1" "01602" "01602" "2023-02-14 15:34:09" "" "" "SEQ-NG" "DNA" "" "" "0000433928" "00432486" "1" "01164" "01164" "2023-02-23 14:08:11" "" "" "SEQ-NG-I" "DNA" "" "" "0000435114" "00433656" "1" "03544" "03544" "2023-03-12 18:47:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000441860" "00440375" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444141" "00442657" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444142" "00442658" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444231" "00442747" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444232" "00442748" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444252" "00442768" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444258" "00442774" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444259" "00442775" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444287" "00442803" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000467651" "00466000" "1" "01164" "01164" "2025-07-02 10:55:33" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000467653" "00466002" "1" "01164" "01164" "2025-07-03 11:13:29" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000468538" "00466873" "1" "01164" "01164" "2025-09-26 15:59:52" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000470496" "00468828" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470497" "00468829" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470498" "00468830" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000473921" "00472251" "1" "04653" "04653" "2026-01-20 12:26:43" "" "" "SEQ-NG-I" "DNA" "" "WGS" "0000474329" "00472661" "1" "00006" "00006" "2026-02-25 09:06:35" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000474743" "00473074" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475183" "00473514" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475402" "00473733" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475427" "00473758" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 44 "{{screeningid}}" "{{geneid}}" "0000022371" "DYNC1H1" "0000081017" "DYNC1H1" "0000181054" "DYNC1H1" "0000289370" "DYNC1H1" "0000301103" "DYNC1H1" "0000301152" "DYNC1H1" "0000301153" "DYNC1H1" "0000301154" "DYNC1H1" "0000301155" "DYNC1H1" "0000301156" "DYNC1H1" "0000301157" "DYNC1H1" "0000301158" "DYNC1H1" "0000301159" "DYNC1H1" "0000301160" "DYNC1H1" "0000301222" "DYNC1H1" "0000301257" "DYNC1H1" "0000301257" "PMP22" "0000301257" "REEP1" "0000304112" "DYNC1H1" "0000307107" "DYNC1H1" "0000307107" "GABRG2" "0000312278" "DYNC1H1" "0000315411" "DYNC1H1" "0000316061" "DYNC1H1" "0000316077" "DYNC1H1" "0000316666" "DYNC1H1" "0000316667" "DYNC1H1" "0000316668" "DYNC1H1" "0000316669" "DYNC1H1" "0000325528" "DYNC1H1" "0000325599" "DYNC1H1" "0000375458" "CLCN1" "0000375912" "DYNC1H1" "0000375913" "DYNC1H1" "0000375914" "DYNC1H1" "0000400056" "DYNC1H1" "0000400057" "DYNC1H1" "0000403969" "DYNC1H1" "0000415654" "MPZ" "0000416365" "DYNC1H1" "0000433928" "DYNC1H1" "0000467651" "DYNC1H1" "0000467653" "DYNC1H1" "0000468538" "DYNC1H1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 560 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000044717" "21" "50" "14" "102461408" "102461408" "subst" "4.06072E-5" "00793" "DYNC1H1_000001" "g.102461408C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.101995071C>T" "" "VUS" "" "0000130103" "0" "70" "14" "102494157" "102494157" "subst" "0" "01758" "DYNC1H1_000002" "g.102494157G>A" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "De novo" "" "" "0" "" "" "g.102027820G>A" "" "likely pathogenic" "ACMG" "0000247212" "0" "10" "14" "102463407" "102463407" "subst" "0.140248" "02330" "DYNC1H1_000033" "g.102463407A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3600A>G (p.Q1200=), DYNC1H1(NM_001376.5):c.3600A>G (p.Q1200=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101997070A>G" "" "benign" "" "0000247213" "0" "10" "14" "102493761" "102493761" "subst" "0.137369" "02330" "DYNC1H1_000067" "g.102493761A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8928A>G (p.L2976=), DYNC1H1(NM_001376.5):c.8928A>G (p.L2976=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027424A>G" "" "benign" "" "0000247216" "0" "10" "14" "102495856" "102495856" "subst" "0.0164503" "02330" "DYNC1H1_000070" "g.102495856A>T" "" "" "" "DYNC1H1(NM_001376.4):c.9469-20A>T, DYNC1H1(NM_001376.5):c.9469-20A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102029519A>T" "" "benign" "" "0000247223" "0" "10" "14" "102453073" "102453073" "subst" "0.0116473" "02330" "DYNC1H1_000024" "g.102453073A>G" "" "" "" "DYNC1H1(NM_001376.4):c.2511A>G (p.A837=), DYNC1H1(NM_001376.5):c.2511A>G (p.A837=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986736A>G" "" "benign" "" "0000247244" "0" "10" "14" "102482736" "102482736" "subst" "0.0164213" "02330" "DYNC1H1_000059" "g.102482736A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7524A>G (p.L2508=), DYNC1H1(NM_001376.5):c.7524A>G (p.L2508=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016399A>G" "" "benign" "" "0000247272" "0" "30" "14" "102486364" "102486364" "subst" "0.00019086" "02330" "DYNC1H1_000064" "g.102486364A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8478A>G (p.A2826=), DYNC1H1(NM_001376.5):c.8478A>G (p.A2826=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102020027A>G" "" "likely benign" "" "0000247273" "0" "30" "14" "102500507" "102500507" "subst" "0" "02330" "DYNC1H1_000077" "g.102500507A>C" "" "" "" "DYNC1H1(NM_001376.5):c.10608A>C (p.L3536=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102034170A>C" "" "likely benign" "" "0000247281" "0" "30" "14" "102484776" "102484776" "subst" "2.46122E-5" "02330" "DYNC1H1_000063" "g.102484776A>T" "" "" "" "DYNC1H1(NM_001376.5):c.8178-12A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102018439A>T" "" "likely benign" "" "0000247296" "0" "50" "14" "102508360" "102508360" "subst" "8.12189E-6" "02330" "DYNC1H1_000091" "g.102508360A>G" "" "" "" "DYNC1H1(NM_001376.5):c.12113A>G (p.N4038S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102042023A>G" "" "VUS" "" "0000251962" "0" "30" "14" "102449777" "102449777" "subst" "0" "02326" "DYNC1H1_000015" "g.102449777A>G" "" "" "" "DYNC1H1(NM_001376.4):c.1292A>G (p.Q431R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101983440A>G" "" "likely benign" "" "0000252229" "0" "30" "14" "102473340" "102473340" "subst" "0" "02326" "DYNC1H1_000049" "g.102473340A>C" "" "" "" "DYNC1H1(NM_001376.4):c.5717-5A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102007003A>C" "" "likely benign" "" "0000253362" "0" "10" "14" "102463407" "102463407" "subst" "0.140248" "01943" "DYNC1H1_000033" "g.102463407A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3600A>G (p.Q1200=), DYNC1H1(NM_001376.5):c.3600A>G (p.Q1200=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101997070A>G" "" "benign" "" "0000253363" "0" "10" "14" "102493761" "102493761" "subst" "0.137369" "01943" "DYNC1H1_000067" "g.102493761A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8928A>G (p.L2976=), DYNC1H1(NM_001376.5):c.8928A>G (p.L2976=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027424A>G" "" "benign" "" "0000253419" "0" "10" "14" "102495856" "102495856" "subst" "0.0164503" "01943" "DYNC1H1_000070" "g.102495856A>T" "" "" "" "DYNC1H1(NM_001376.4):c.9469-20A>T, DYNC1H1(NM_001376.5):c.9469-20A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102029519A>T" "" "benign" "" "0000253474" "0" "10" "14" "102483120" "102483120" "subst" "0.0116645" "01943" "DYNC1H1_000060" "g.102483120A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7632A>G (p.E2544=), DYNC1H1(NM_001376.5):c.7632A>G (p.E2544=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016783A>G" "" "benign" "" "0000253591" "0" "10" "14" "102499504" "102499504" "subst" "0" "01943" "DYNC1H1_000075" "g.102499504A>G" "" "" "" "DYNC1H1(NM_001376.4):c.10182A>G (p.K3394=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102033167A>G" "" "benign" "" "0000253663" "0" "10" "14" "102446275" "102446275" "subst" "0.0015351" "01943" "DYNC1H1_000012" "g.102446275A>G" "" "" "" "DYNC1H1(NM_001376.4):c.738A>G (p.Q246=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979938A>G" "" "benign" "" "0000253875" "0" "10" "14" "102431024" "102431024" "subst" "0.012316" "01943" "DYNC1H1_000003" "g.102431024A>G" "" "" "" "DYNC1H1(NM_001376.4):c.-5A>G, DYNC1H1(NM_001376.5):c.-5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101964687A>G" "" "benign" "" "0000254176" "0" "30" "14" "102453073" "102453073" "subst" "0.0116473" "01943" "DYNC1H1_000024" "g.102453073A>G" "" "" "" "DYNC1H1(NM_001376.4):c.2511A>G (p.A837=), DYNC1H1(NM_001376.5):c.2511A>G (p.A837=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986736A>G" "" "likely benign" "" "0000254282" "0" "30" "14" "102446098" "102446098" "subst" "0" "01943" "DYNC1H1_000009" "g.102446098A>G" "" "" "" "DYNC1H1(NM_001376.4):c.561A>G (p.A187=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979761A>G" "" "likely benign" "" "0000254725" "0" "30" "14" "102482391" "102482391" "subst" "1.23016E-5" "01943" "DYNC1H1_000141" "g.102482391A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7441A>G (p.M2481V), DYNC1H1(NM_001376.5):c.7441A>G (p.M2481V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016054A>G" "" "likely benign" "" "0000254908" "0" "30" "14" "102493523" "102493523" "subst" "0.000341108" "01943" "DYNC1H1_000066" "g.102493523A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8784A>G (p.Q2928=), DYNC1H1(NM_001376.5):c.8784A>G (p.Q2928=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027186A>G" "" "likely benign" "" "0000255288" "0" "30" "14" "102449963" "102449963" "subst" "0" "01943" "DYNC1H1_000017" "g.102449963A>G" "" "" "" "DYNC1H1(NM_001376.4):c.1461+17A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101983626A>G" "" "likely benign" "" "0000255863" "0" "50" "14" "102461038" "102461038" "subst" "0" "01943" "DYNC1H1_000030" "g.102461038A>C" "" "" "" "DYNC1H1(NM_001376.4):c.3185A>C (p.D1062A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101994701A>C" "" "VUS" "" "0000256637" "0" "50" "14" "102461348" "102461348" "subst" "0" "01943" "DYNC1H1_000032" "g.102461348A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3359A>G (p.Y1120C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101995011A>G" "" "VUS" "" "0000265757" "0" "30" "14" "102498790" "102498790" "subst" "0.00112791" "02330" "DYNC1H1_000073" "g.102498790T>C" "" "" "" "DYNC1H1(NM_001376.4):c.10065T>C (p.S3355=), DYNC1H1(NM_001376.5):c.10065T>C (p.S3355=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102032453T>C" "" "likely benign" "" "0000265758" "0" "10" "14" "102502958" "102502958" "subst" "0.000292364" "02330" "DYNC1H1_000079" "g.102502958C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10887C>T (p.F3629=), DYNC1H1(NM_001376.5):c.10887C>T (p.F3629=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102036621C>T" "" "benign" "" "0000265759" "0" "10" "14" "102504838" "102504838" "subst" "0.0681829" "02330" "DYNC1H1_000080" "g.102504838C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10950C>T (p.N3650=), DYNC1H1(NM_001376.5):c.10950C>T (p.N3650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102038501C>T" "" "benign" "" "0000265760" "0" "30" "14" "102507911" "102507911" "subst" "0.00311867" "02330" "DYNC1H1_000088" "g.102507911C>G" "" "" "" "DYNC1H1(NM_001376.4):c.11942C>G (p.T3981R, p.(Thr3981Arg)), DYNC1H1(NM_001376.5):c.11942C>G (p.T3981R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041574C>G" "" "likely benign" "" "0000265761" "0" "10" "14" "102508056" "102508056" "subst" "0.0690596" "02330" "DYNC1H1_000089" "g.102508056C>A" "" "" "" "DYNC1H1(NM_001376.4):c.12087C>A (p.H4029Q), DYNC1H1(NM_001376.5):c.12087C>A (p.H4029Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041719C>A" "" "benign" "" "0000265763" "0" "10" "14" "102514227" "102514227" "subst" "0.223244" "02330" "DYNC1H1_000099" "g.102514227T>C" "" "" "" "DYNC1H1(NM_001376.4):c.13080T>C (p.T4360=), DYNC1H1(NM_001376.5):c.13080T>C (p.T4360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102047890T>C" "" "benign" "" "0000265764" "0" "10" "14" "102515015" "102515015" "subst" "0.221516" "02330" "DYNC1H1_000103" "g.102515015G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13372+9G>A, DYNC1H1(NM_001376.5):c.13372+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048678G>A" "" "benign" "" "0000265766" "0" "10" "14" "102452563" "102452563" "subst" "4.06412E-6" "02330" "DYNC1H1_000021" "g.102452563T>C" "" "" "" "DYNC1H1(NM_001376.5):c.2001T>C (p.D667=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986226T>C" "" "benign" "" "0000265768" "0" "10" "14" "102458028" "102458028" "subst" "0.086042" "02330" "DYNC1H1_000029" "g.102458028C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3015+18C>T, DYNC1H1(NM_001376.5):c.3015+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101991691C>T" "" "benign" "" "0000265769" "0" "10" "14" "102466430" "102466430" "subst" "0.00877578" "02330" "DYNC1H1_000037" "g.102466430G>A" "" "" "" "DYNC1H1(NM_001376.4):c.3909G>A (p.A1303=), DYNC1H1(NM_001376.5):c.3909G>A (p.A1303=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102000093G>A" "" "benign" "" "0000265770" "0" "30" "14" "102467710" "102467710" "subst" "0" "02330" "DYNC1H1_000040" "g.102467710C>T" "" "" "" "DYNC1H1(NM_001376.5):c.4395+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102001373C>T" "" "likely benign" "" "0000265771" "0" "10" "14" "102468009" "102468009" "subst" "0.0008771" "02330" "DYNC1H1_000042" "g.102468009G>A" "" "" "" "DYNC1H1(NM_001376.4):c.4533G>A (p.P1511=), DYNC1H1(NM_001376.5):c.4533G>A (p.P1511=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102001672G>A" "" "benign" "" "0000265772" "0" "10" "14" "102471438" "102471438" "subst" "0.00274518" "02330" "DYNC1H1_000045" "g.102471438G>T" "" "" "" "DYNC1H1(NM_001376.4):c.5298G>T (p.L1766=), DYNC1H1(NM_001376.5):c.5298G>T (p.L1766=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102005101G>T" "" "benign" "" "0000265773" "0" "50" "14" "102474668" "102474668" "subst" "0.000231527" "02330" "DYNC1H1_000050" "g.102474668G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5971G>A (p.D1991N), DYNC1H1(NM_001376.5):c.5971G>A (p.D1991N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102008331G>A" "" "VUS" "" "0000265774" "0" "10" "14" "102446161" "102446161" "subst" "0.220892" "02330" "DYNC1H1_000010" "g.102446161G>A" "" "" "" "DYNC1H1(NM_001376.4):c.624G>A (p.P208=), DYNC1H1(NM_001376.5):c.624G>A (p.P208=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979824G>A" "" "benign" "" "0000265775" "0" "50" "14" "102478356" "102478356" "subst" "4.46708E-5" "02330" "DYNC1H1_000053" "g.102478356G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6763G>A (p.D2255N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102012019G>A" "" "VUS" "" "0000265776" "0" "10" "14" "102482399" "102482399" "subst" "0.0327135" "02330" "DYNC1H1_000057" "g.102482399C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7449C>T (p.I2483=), DYNC1H1(NM_001376.5):c.7449C>T (p.I2483=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016062C>T" "" "benign" "" "0000265777" "0" "30" "14" "102482408" "102482408" "subst" "0.00211272" "02330" "DYNC1H1_000058" "g.102482408G>T" "" "" "" "DYNC1H1(NM_001376.4):c.7458G>T (p.L2486=), DYNC1H1(NM_001376.5):c.7458G>T (p.L2486=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016071G>T" "" "likely benign" "" "0000265778" "0" "50" "14" "102483334" "102483334" "subst" "0" "02330" "DYNC1H1_000062" "g.102483334G>A" "" "" "" "DYNC1H1(NM_001376.5):c.7846G>A (p.E2616K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016997G>A" "" "VUS" "" "0000267723" "0" "30" "14" "102482408" "102482408" "subst" "0.00211272" "02325" "DYNC1H1_000058" "g.102482408G>T" "" "" "" "DYNC1H1(NM_001376.4):c.7458G>T (p.L2486=), DYNC1H1(NM_001376.5):c.7458G>T (p.L2486=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016071G>T" "" "likely benign" "" "0000267724" "0" "30" "14" "102449341" "102449341" "dup" "0" "02325" "DYNC1H1_000014" "g.102449341dup" "" "" "" "DYNC1H1(NM_001376.4):c.962-15dupT, DYNC1H1(NM_001376.5):c.962-15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101983004dup" "" "likely benign" "" "0000271038" "0" "30" "14" "102500298" "102500298" "subst" "0" "02326" "DYNC1H1_000076" "g.102500298C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10414-15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102033961C>T" "" "likely benign" "" "0000271039" "0" "30" "14" "102507911" "102507911" "subst" "0.00311867" "02326" "DYNC1H1_000088" "g.102507911C>G" "" "" "" "DYNC1H1(NM_001376.4):c.11942C>G (p.T3981R, p.(Thr3981Arg)), DYNC1H1(NM_001376.5):c.11942C>G (p.T3981R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041574C>G" "" "likely benign" "" "0000271040" "0" "90" "14" "102452889" "102452889" "subst" "0" "02326" "DYNC1H1_000022" "g.102452889C>T" "" "" "" "DYNC1H1(NM_001376.4):c.2327C>T (p.P776L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986552C>T" "" "pathogenic" "" "0000271041" "0" "30" "14" "102455034" "102455034" "subst" "0.000820885" "02326" "DYNC1H1_000026" "g.102455034C>T" "" "" "" "DYNC1H1(NM_001376.4):c.2719-6C>T, DYNC1H1(NM_001376.5):c.2719-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101988697C>T" "" "likely benign" "" "0000271042" "0" "30" "14" "102445646" "102445646" "subst" "0.000617635" "02326" "DYNC1H1_000007" "g.102445646T>G" "" "" "" "DYNC1H1(NM_001376.4):c.345-10T>G, DYNC1H1(NM_001376.5):c.345-10T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979309T>G" "" "likely benign" "" "0000271043" "0" "70" "14" "102493763" "102493763" "subst" "8.12249E-6" "02326" "DYNC1H1_000068" "g.102493763G>A" "" "" "" "DYNC1H1(NM_001376.4):c.8930G>A (p.R2977Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027426G>A" "" "likely pathogenic" "" "0000275768" "0" "30" "14" "102498790" "102498790" "subst" "0.00112791" "01943" "DYNC1H1_000073" "g.102498790T>C" "" "" "" "DYNC1H1(NM_001376.4):c.10065T>C (p.S3355=), DYNC1H1(NM_001376.5):c.10065T>C (p.S3355=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102032453T>C" "" "likely benign" "" "0000275769" "0" "30" "14" "102500685" "102500685" "subst" "6.49699E-5" "01943" "DYNC1H1_000078" "g.102500685G>A" "" "" "" "DYNC1H1(NM_001376.4):c.10650G>A (p.T3550=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102034348G>A" "" "likely benign" "" "0000275770" "0" "30" "14" "102502958" "102502958" "subst" "0.000292364" "01943" "DYNC1H1_000079" "g.102502958C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10887C>T (p.F3629=), DYNC1H1(NM_001376.5):c.10887C>T (p.F3629=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102036621C>T" "" "likely benign" "" "0000275771" "0" "10" "14" "102504838" "102504838" "subst" "0.0681829" "01943" "DYNC1H1_000080" "g.102504838C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10950C>T (p.N3650=), DYNC1H1(NM_001376.5):c.10950C>T (p.N3650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102038501C>T" "" "benign" "" "0000275772" "0" "30" "14" "102505189" "102505189" "subst" "0" "01943" "DYNC1H1_000081" "g.102505189G>T" "" "" "" "DYNC1H1(NM_001376.4):c.11206+4G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102038852G>T" "" "likely benign" "" "0000275773" "0" "50" "14" "102505389" "102505389" "subst" "0" "01943" "DYNC1H1_000082" "g.102505389T>A" "" "" "" "DYNC1H1(NM_001376.4):c.11258T>A (p.L3753Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102039052T>A" "" "VUS" "" "0000275774" "0" "30" "14" "102505492" "102505492" "subst" "3.24857E-5" "01943" "DYNC1H1_000083" "g.102505492G>A" "" "" "" "DYNC1H1(NM_001376.4):c.11361G>A (p.T3787=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102039155G>A" "" "likely benign" "" "0000275775" "0" "10" "14" "102506064" "102506064" "subst" "0.00105235" "01943" "DYNC1H1_000084" "g.102506064C>T" "" "" "" "DYNC1H1(NM_001376.4):c.11685C>T (p.T3895=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102039727C>T" "" "benign" "" "0000275776" "0" "50" "14" "102506646" "102506646" "subst" "0" "01943" "DYNC1H1_000085" "g.102506646C>T" "" "" "" "DYNC1H1(NM_001376.4):c.11764C>T (p.P3922S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102040309C>T" "" "VUS" "" "0000275777" "0" "30" "14" "102506942" "102506942" "subst" "6.09157E-5" "01943" "DYNC1H1_000086" "g.102506942G>T" "" "" "" "DYNC1H1(NM_001376.4):c.11873G>T (p.G3958V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102040605G>T" "" "likely benign" "" "0000275779" "0" "30" "14" "102507911" "102507911" "subst" "0.00311867" "01943" "DYNC1H1_000088" "g.102507911C>G" "" "" "" "DYNC1H1(NM_001376.4):c.11942C>G (p.T3981R, p.(Thr3981Arg)), DYNC1H1(NM_001376.5):c.11942C>G (p.T3981R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041574C>G" "" "likely benign" "" "0000275780" "0" "10" "14" "102508056" "102508056" "subst" "0.0690596" "01943" "DYNC1H1_000089" "g.102508056C>A" "" "" "" "DYNC1H1(NM_001376.4):c.12087C>A (p.H4029Q), DYNC1H1(NM_001376.5):c.12087C>A (p.H4029Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041719C>A" "" "benign" "" "0000275781" "0" "30" "14" "102508077" "102508077" "subst" "0.000219707" "01943" "DYNC1H1_000090" "g.102508077G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12102+6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041740G>A" "" "likely benign" "" "0000275782" "0" "50" "14" "102508438" "102508438" "subst" "4.06068E-6" "01943" "DYNC1H1_000092" "g.102508438C>T" "" "" "" "DYNC1H1(NM_001376.4):c.12191C>T (p.T4064M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102042101C>T" "" "VUS" "" "0000275783" "0" "30" "14" "102508608" "102508608" "subst" "0.000531949" "01943" "DYNC1H1_000093" "g.102508608C>T" "" "" "" "DYNC1H1(NM_001376.4):c.12258C>T (p.T4086=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102042271C>T" "" "likely benign" "" "0000275784" "0" "10" "14" "102510203" "102510203" "subst" "0.000649836" "01943" "DYNC1H1_000094" "g.102510203C>A" "" "" "" "DYNC1H1(NM_001376.4):c.12514-9C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102043866C>A" "" "benign" "" "0000275785" "0" "50" "14" "102510282" "102510282" "subst" "7.30923E-5" "01943" "DYNC1H1_000095" "g.102510282G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12584G>A (p.R4195Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102043945G>A" "" "VUS" "" "0000275786" "0" "30" "14" "102510398" "102510398" "subst" "8.1576E-6" "01943" "DYNC1H1_000096" "g.102510398G>C" "" "" "" "DYNC1H1(NM_001376.4):c.12684+16G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102044061G>C" "" "likely benign" "" "0000275787" "0" "30" "14" "102510608" "102510608" "subst" "0.000211999" "01943" "DYNC1H1_000097" "g.102510608C>T" "" "" "" "DYNC1H1(NM_001376.4):c.12685-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102044271C>T" "" "likely benign" "" "0000275788" "0" "10" "14" "102514227" "102514227" "subst" "0.223244" "01943" "DYNC1H1_000099" "g.102514227T>C" "" "" "" "DYNC1H1(NM_001376.4):c.13080T>C (p.T4360=), DYNC1H1(NM_001376.5):c.13080T>C (p.T4360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102047890T>C" "" "benign" "" "0000275789" "0" "10" "14" "102514844" "102514844" "subst" "0.000735007" "01943" "DYNC1H1_000100" "g.102514844C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13219-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048507C>T" "" "benign" "" "0000275790" "0" "30" "14" "102514917" "102514917" "subst" "1.62429E-5" "01943" "DYNC1H1_000101" "g.102514917G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13283G>A (p.R4428H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048580G>A" "" "likely benign" "" "0000275791" "0" "10" "14" "102515010" "102515010" "subst" "0.0094904" "01943" "DYNC1H1_000102" "g.102515010C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13372+4C>T, DYNC1H1(NM_001376.5):c.13372+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048673C>T" "" "benign" "" "0000275792" "0" "10" "14" "102515015" "102515015" "subst" "0.221516" "01943" "DYNC1H1_000103" "g.102515015G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13372+9G>A, DYNC1H1(NM_001376.5):c.13372+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048678G>A" "" "benign" "" "0000275793" "0" "50" "14" "102449837" "102449837" "subst" "0" "01943" "DYNC1H1_000016" "g.102449837G>A" "" "" "" "DYNC1H1(NM_001376.4):c.1352G>A (p.R451H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101983500G>A" "" "VUS" "" "0000275794" "0" "30" "14" "102516442" "102516442" "subst" "4.06065E-6" "01943" "DYNC1H1_000104" "g.102516442C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13719C>T (p.N4573=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102050105C>T" "" "likely benign" "" "0000275795" "0" "30" "14" "102516472" "102516472" "subst" "8.12189E-6" "01943" "DYNC1H1_000105" "g.102516472C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13749C>T (p.T4583=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102050135C>T" "" "likely benign" "" "0000275796" "0" "30" "14" "102516487" "102516487" "subst" "0.00108423" "01943" "DYNC1H1_000106" "g.102516487G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13764G>A (p.T4588=), DYNC1H1(NM_001376.5):c.13764G>A (p.T4588=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102050150G>A" "" "likely benign" "" "0000275797" "0" "30" "14" "102516531" "102516531" "subst" "0.000219377" "01943" "DYNC1H1_000107" "g.102516531G>T" "" "" "" "DYNC1H1(NM_001376.4):c.13808G>T (p.S4603I), DYNC1H1(NM_001376.5):c.13808G>T (p.S4603I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102050194G>T" "" "likely benign" "" "0000275798" "0" "30" "14" "102516879" "102516879" "subst" "4.06055E-6" "01943" "DYNC1H1_000108" "g.102516879C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13920C>T (p.V4640=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102050542C>T" "" "likely benign" "" "0000275799" "0" "30" "14" "102452266" "102452266" "subst" "0.000138254" "01943" "DYNC1H1_000018" "g.102452266T>C" "" "" "" "DYNC1H1(NM_001376.4):c.1704T>C (p.L568=), DYNC1H1(NM_001376.5):c.1704T>C (p.L568=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101985929T>C" "" "likely benign" "" "0000275800" "0" "50" "14" "102452405" "102452405" "subst" "0" "01943" "DYNC1H1_000020" "g.102452405G>A" "" "" "" "DYNC1H1(NM_001376.4):c.1843G>A (p.D615N, p.(Asp615Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986068G>A" "" "VUS" "" "0000275801" "0" "30" "14" "102452935" "102452935" "subst" "0" "01943" "DYNC1H1_000023" "g.102452935C>T" "" "" "" "DYNC1H1(NM_001376.4):c.2373C>T (p.T791=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986598C>T" "" "likely benign" "" "0000275802" "0" "10" "14" "102453876" "102453876" "subst" "0.0116425" "01943" "DYNC1H1_000025" "g.102453876G>A" "" "" "" "DYNC1H1(NM_001376.4):c.2625G>A (p.S875=), DYNC1H1(NM_001376.5):c.2625G>A (p.S875=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101987539G>A" "" "benign" "" "0000275803" "0" "30" "14" "102442056" "102442056" "subst" "0" "01943" "DYNC1H1_000005" "g.102442056C>T" "" "" "" "DYNC1H1(NM_001376.4):c.264C>T (p.V88=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101975719C>T" "" "likely benign" "" "0000275804" "0" "30" "14" "102455034" "102455034" "subst" "0.000820885" "01943" "DYNC1H1_000026" "g.102455034C>T" "" "" "" "DYNC1H1(NM_001376.4):c.2719-6C>T, DYNC1H1(NM_001376.5):c.2719-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101988697C>T" "" "likely benign" "" "0000275805" "0" "50" "14" "102457870" "102457870" "subst" "4.0627E-5" "01943" "DYNC1H1_000028" "g.102457870G>A" "" "" "" "DYNC1H1(NM_001376.4):c.2875G>A (p.V959I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101991533G>A" "" "VUS" "" "0000275806" "0" "10" "14" "102458028" "102458028" "subst" "0.086042" "01943" "DYNC1H1_000029" "g.102458028C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3015+18C>T, DYNC1H1(NM_001376.5):c.3015+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101991691C>T" "" "benign" "" "0000275807" "0" "30" "14" "102442110" "102442110" "subst" "5.68935E-5" "01943" "DYNC1H1_000006" "g.102442110C>T" "" "" "" "DYNC1H1(NM_001376.4):c.318C>T (p.D106=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101975773C>T" "" "likely benign" "" "0000275808" "0" "30" "14" "102445646" "102445646" "subst" "0.000617635" "01943" "DYNC1H1_000007" "g.102445646T>G" "" "" "" "DYNC1H1(NM_001376.4):c.345-10T>G, DYNC1H1(NM_001376.5):c.345-10T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979309T>G" "" "likely benign" "" "0000275809" "0" "30" "14" "102445680" "102445680" "subst" "5.27966E-5" "01943" "DYNC1H1_000008" "g.102445680C>T" "" "" "" "DYNC1H1(NM_001376.4):c.369C>T (p.P123=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979343C>T" "" "likely benign" "" "0000275810" "0" "30" "14" "102463596" "102463596" "subst" "0" "01943" "DYNC1H1_000034" "g.102463596G>A" "" "" "" "DYNC1H1(NM_001376.4):c.3789G>A (p.K1263=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101997259G>A" "" "likely benign" "" "0000275811" "0" "50" "14" "102466328" "102466328" "subst" "0" "01943" "DYNC1H1_000035" "g.102466328C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3807C>T (p.G1269=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101999991C>T" "" "VUS" "" "0000275812" "0" "30" "14" "102466430" "102466430" "subst" "0.00877578" "01943" "DYNC1H1_000037" "g.102466430G>A" "" "" "" "DYNC1H1(NM_001376.4):c.3909G>A (p.A1303=), DYNC1H1(NM_001376.5):c.3909G>A (p.A1303=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102000093G>A" "" "likely benign" "" "0000275813" "0" "30" "14" "102467421" "102467421" "subst" "0.00307797" "01943" "DYNC1H1_000038" "g.102467421C>T" "" "" "" "DYNC1H1(NM_001376.4):c.4185+20C>T, DYNC1H1(NM_001376.5):c.4185+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102001084C>T" "" "likely benign" "" "0000275814" "0" "30" "14" "102467991" "102467991" "subst" "0.000714674" "01943" "DYNC1H1_000041" "g.102467991G>A" "" "" "" "DYNC1H1(NM_001376.4):c.4515G>A (p.S1505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102001654G>A" "" "likely benign" "" "0000275815" "0" "30" "14" "102468009" "102468009" "subst" "0.0008771" "01943" "DYNC1H1_000042" "g.102468009G>A" "" "" "" "DYNC1H1(NM_001376.4):c.4533G>A (p.P1511=), DYNC1H1(NM_001376.5):c.4533G>A (p.P1511=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102001672G>A" "" "likely benign" "" "0000275816" "0" "30" "14" "102469273" "102469273" "subst" "0.000971956" "01943" "DYNC1H1_000043" "g.102469273T>C" "" "" "" "DYNC1H1(NM_001376.4):c.4854T>C (p.Y1618=), DYNC1H1(NM_001376.5):c.4854T>C (p.Y1618=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102002936T>C" "" "likely benign" "" "0000275817" "0" "30" "14" "102470912" "102470912" "subst" "8.12658E-6" "01943" "DYNC1H1_000044" "g.102470912C>T" "" "" "" "DYNC1H1(NM_001376.4):c.4941C>T (p.V1647=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102004575C>T" "" "likely benign" "" "0000275818" "0" "30" "14" "102471438" "102471438" "subst" "0.00274518" "01943" "DYNC1H1_000045" "g.102471438G>T" "" "" "" "DYNC1H1(NM_001376.4):c.5298G>T (p.L1766=), DYNC1H1(NM_001376.5):c.5298G>T (p.L1766=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102005101G>T" "" "likely benign" "" "0000275819" "0" "50" "14" "102472420" "102472420" "subst" "0" "01943" "DYNC1H1_000047" "g.102472420G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5629G>A (p.D1877N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102006083G>A" "" "VUS" "" "0000275820" "0" "30" "14" "102472440" "102472440" "subst" "8.12249E-6" "01943" "DYNC1H1_000048" "g.102472440C>T" "" "" "" "DYNC1H1(NM_001376.4):c.5649C>T (p.P1883=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102006103C>T" "" "likely benign" "" "0000275821" "0" "30" "14" "102476593" "102476593" "subst" "4.0842E-5" "01943" "DYNC1H1_000051" "g.102476593C>T" "" "" "" "DYNC1H1(NM_001376.4):c.6222-20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102010256C>T" "" "likely benign" "" "0000275822" "0" "10" "14" "102446161" "102446161" "subst" "0.220892" "01943" "DYNC1H1_000010" "g.102446161G>A" "" "" "" "DYNC1H1(NM_001376.4):c.624G>A (p.P208=), DYNC1H1(NM_001376.5):c.624G>A (p.P208=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979824G>A" "" "benign" "" "0000275823" "0" "30" "14" "102477073" "102477073" "subst" "8.54402E-5" "01943" "DYNC1H1_000052" "g.102477073G>C" "" "" "" "DYNC1H1(NM_001376.4):c.6406-4G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102010736G>C" "" "likely benign" "" "0000275824" "0" "50" "14" "102446205" "102446205" "subst" "8.93401E-5" "01943" "DYNC1H1_000011" "g.102446205G>A" "" "" "" "DYNC1H1(NM_001376.4):c.668G>A (p.R223H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979868G>A" "" "VUS" "" "0000275825" "0" "30" "14" "102481564" "102481564" "subst" "0.00238788" "01943" "DYNC1H1_000054" "g.102481564G>A" "" "" "" "DYNC1H1(NM_001376.4):c.7137G>A (p.L2379=), DYNC1H1(NM_001376.5):c.7137G>A (p.L2379=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102015227G>A" "" "likely benign" "" "0000275826" "0" "30" "14" "102481666" "102481666" "subst" "0.00154989" "01943" "DYNC1H1_000055" "g.102481666G>T" "" "" "" "DYNC1H1(NM_001376.4):c.7239G>T (p.L2413=), DYNC1H1(NM_001376.5):c.7239G>T (p.L2413=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102015329G>T" "" "likely benign" "" "0000275827" "0" "30" "14" "102482369" "102482369" "subst" "0.000159128" "01943" "DYNC1H1_000056" "g.102482369C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7419C>T (p.N2473=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016032C>T" "" "likely benign" "" "0000275828" "0" "10" "14" "102482399" "102482399" "subst" "0.0327135" "01943" "DYNC1H1_000057" "g.102482399C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7449C>T (p.I2483=), DYNC1H1(NM_001376.5):c.7449C>T (p.I2483=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016062C>T" "" "benign" "" "0000275829" "0" "30" "14" "102482408" "102482408" "subst" "0.00211272" "01943" "DYNC1H1_000058" "g.102482408G>T" "" "" "" "DYNC1H1(NM_001376.4):c.7458G>T (p.L2486=), DYNC1H1(NM_001376.5):c.7458G>T (p.L2486=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016071G>T" "" "likely benign" "" "0000275830" "0" "30" "14" "102483246" "102483246" "subst" "0.000182905" "01943" "DYNC1H1_000061" "g.102483246C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7758C>T (p.A2586=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016909C>T" "" "likely benign" "" "0000275831" "0" "30" "14" "102431106" "102431106" "subst" "3.28235E-5" "01943" "DYNC1H1_000004" "g.102431106C>T" "" "" "" "DYNC1H1(NM_001376.4):c.78C>T (p.D26=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101964769C>T" "" "likely benign" "" "0000275832" "0" "30" "14" "102494045" "102494045" "subst" "0.000564917" "01943" "DYNC1H1_000069" "g.102494045G>T" "" "" "" "DYNC1H1(NM_001376.4):c.9138G>T (p.S3046=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027708G>T" "" "likely benign" "" "0000275833" "0" "30" "14" "102495878" "102495878" "subst" "1.62475E-5" "01943" "DYNC1H1_000071" "g.102495878G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9471G>A (p.A3157=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102029541G>A" "" "likely benign" "" "0000275834" "0" "10" "14" "102449341" "102449341" "dup" "0" "01943" "DYNC1H1_000014" "g.102449341dup" "" "" "" "DYNC1H1(NM_001376.4):c.962-15dupT, DYNC1H1(NM_001376.5):c.962-15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101983004dup" "" "benign" "" "0000275835" "0" "50" "14" "102496580" "102496580" "subst" "0" "01943" "DYNC1H1_000072" "g.102496580C>G" "" "" "" "DYNC1H1(NM_001376.4):c.9844C>G (p.L3282V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102030243C>G" "" "VUS" "" "0000323855" "0" "50" "14" "102461040" "102461040" "subst" "0" "01804" "DYNC1H1_000031" "g.102461040A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3187A>G (p.(Met1063Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101994703A>G" "" "VUS" "" "0000336891" "0" "10" "14" "102458028" "102458028" "subst" "0.086042" "02327" "DYNC1H1_000029" "g.102458028C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3015+18C>T, DYNC1H1(NM_001376.5):c.3015+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101991691C>T" "" "benign" "" "0000336892" "0" "10" "14" "102495856" "102495856" "subst" "0.0164503" "02327" "DYNC1H1_000070" "g.102495856A>T" "" "" "" "DYNC1H1(NM_001376.4):c.9469-20A>T, DYNC1H1(NM_001376.5):c.9469-20A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102029519A>T" "" "benign" "" "0000336896" "0" "10" "14" "102515010" "102515010" "subst" "0.0094904" "02327" "DYNC1H1_000102" "g.102515010C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13372+4C>T, DYNC1H1(NM_001376.5):c.13372+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048673C>T" "" "benign" "" "0000336897" "0" "10" "14" "102515015" "102515015" "subst" "0.221516" "02327" "DYNC1H1_000103" "g.102515015G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13372+9G>A, DYNC1H1(NM_001376.5):c.13372+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102048678G>A" "" "benign" "" "0000338977" "0" "50" "14" "102478201" "102478201" "subst" "0" "02327" "DYNC1H1_000127" "g.102478201G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6619-11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102011864G>A" "" "VUS" "" "0000339216" "0" "10" "14" "102446161" "102446161" "subst" "0.220892" "02327" "DYNC1H1_000010" "g.102446161G>A" "" "" "" "DYNC1H1(NM_001376.4):c.624G>A (p.P208=), DYNC1H1(NM_001376.5):c.624G>A (p.P208=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979824G>A" "" "benign" "" "0000339217" "0" "10" "14" "102463407" "102463407" "subst" "0.140248" "02327" "DYNC1H1_000033" "g.102463407A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3600A>G (p.Q1200=), DYNC1H1(NM_001376.5):c.3600A>G (p.Q1200=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101997070A>G" "" "benign" "" "0000339218" "0" "10" "14" "102466430" "102466430" "subst" "0.00877578" "02327" "DYNC1H1_000037" "g.102466430G>A" "" "" "" "DYNC1H1(NM_001376.4):c.3909G>A (p.A1303=), DYNC1H1(NM_001376.5):c.3909G>A (p.A1303=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102000093G>A" "" "benign" "" "0000339220" "0" "10" "14" "102482399" "102482399" "subst" "0.0327135" "02327" "DYNC1H1_000057" "g.102482399C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7449C>T (p.I2483=), DYNC1H1(NM_001376.5):c.7449C>T (p.I2483=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016062C>T" "" "benign" "" "0000339221" "0" "10" "14" "102482736" "102482736" "subst" "0.0164213" "02327" "DYNC1H1_000059" "g.102482736A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7524A>G (p.L2508=), DYNC1H1(NM_001376.5):c.7524A>G (p.L2508=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102016399A>G" "" "benign" "" "0000339222" "0" "10" "14" "102493761" "102493761" "subst" "0.137369" "02327" "DYNC1H1_000067" "g.102493761A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8928A>G (p.L2976=), DYNC1H1(NM_001376.5):c.8928A>G (p.L2976=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027424A>G" "" "benign" "" "0000339224" "0" "10" "14" "102504838" "102504838" "subst" "0.0681829" "02327" "DYNC1H1_000080" "g.102504838C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10950C>T (p.N3650=), DYNC1H1(NM_001376.5):c.10950C>T (p.N3650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102038501C>T" "" "benign" "" "0000339226" "0" "10" "14" "102514227" "102514227" "subst" "0.223244" "02327" "DYNC1H1_000099" "g.102514227T>C" "" "" "" "DYNC1H1(NM_001376.4):c.13080T>C (p.T4360=), DYNC1H1(NM_001376.5):c.13080T>C (p.T4360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102047890T>C" "" "benign" "" "0000341799" "0" "30" "14" "102463487" "102463487" "subst" "0" "02327" "DYNC1H1_000117" "g.102463487G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101997150G>A" "" "likely benign" "" "0000342026" "0" "70" "14" "102469287" "102469287" "subst" "0" "02327" "DYNC1H1_000121" "g.102469287G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102002950G>A" "" "likely pathogenic" "" "0000342355" "0" "70" "14" "102481500" "102481500" "subst" "0" "02327" "DYNC1H1_000128" "g.102481500G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102015163G>A" "" "likely pathogenic" "" "0000342421" "0" "90" "14" "102446288" "102446288" "subst" "0" "02327" "DYNC1H1_000109" "g.102446288C>T" "" "" "" "DYNC1H1(NM_001376.5):c.751C>T (p.R251C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979951C>T" "" "pathogenic" "" "0000342422" "0" "90" "14" "102446289" "102446289" "subst" "0" "02327" "DYNC1H1_000110" "g.102446289G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101979952G>A" "" "pathogenic" "" "0000343710" "0" "70" "14" "102496222" "102496222" "subst" "0" "02327" "DYNC1H1_000133" "g.102496222A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102029885A>G" "" "likely pathogenic" "" "0000343718" "0" "30" "14" "102499443" "102499443" "subst" "0" "02327" "DYNC1H1_000134" "g.102499443A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102033106A>T" "" "likely benign" "" "0000344001" "0" "50" "14" "102478356" "102478356" "subst" "4.46708E-5" "02327" "DYNC1H1_000053" "g.102478356G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6763G>A (p.D2255N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102012019G>A" "" "VUS" "" "0000344167" "0" "50" "14" "102452525" "102452525" "subst" "2.03227E-5" "02327" "DYNC1H1_000114" "g.102452525G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986188G>A" "" "VUS" "" "0000345174" "0" "30" "14" "102470973" "102470973" "subst" "4.06128E-6" "02327" "DYNC1H1_000123" "g.102470973G>A" "" "" "" "DYNC1H1(NM_001376.5):c.5002G>A (p.E1668K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102004636G>A" "" "likely benign" "" "0000345657" "0" "50" "14" "102461384" "102461384" "subst" "0" "02327" "DYNC1H1_000116" "g.102461384G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101995047G>T" "" "VUS" "" "0000345970" "0" "50" "14" "102493876" "102493876" "subst" "0" "02327" "DYNC1H1_000130" "g.102493876G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027539G>A" "" "VUS" "" "0000346467" "0" "10" "14" "102508056" "102508056" "subst" "0.0690596" "02327" "DYNC1H1_000089" "g.102508056C>A" "" "" "" "DYNC1H1(NM_001376.4):c.12087C>A (p.H4029Q), DYNC1H1(NM_001376.5):c.12087C>A (p.H4029Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102041719C>A" "" "benign" "" "0000346567" "0" "50" "14" "102466365" "102466365" "subst" "0" "02327" "DYNC1H1_000118" "g.102466365A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102000028A>G" "" "VUS" "" "0000346589" "0" "70" "14" "102469001" "102469001" "subst" "0" "02327" "DYNC1H1_000120" "g.102469001T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102002664T>C" "" "likely pathogenic" "" "0000346965" "0" "30" "14" "102473383" "102473383" "subst" "0" "02327" "DYNC1H1_000126" "g.102473383C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102007046C>T" "" "likely benign" "" "0000347569" "0" "50" "14" "102514235" "102514235" "subst" "6.10168E-5" "02327" "DYNC1H1_000138" "g.102514235A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102047898A>C" "" "VUS" "" "0000347750" "0" "70" "14" "102467995" "102467995" "subst" "0" "02327" "DYNC1H1_000119" "g.102467995A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102001658A>G" "" "likely pathogenic" "" "0000348114" "0" "30" "14" "102460584" "102460584" "subst" "8.12137E-6" "02327" "DYNC1H1_000115" "g.102460584C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101994247C>T" "" "likely benign" "" "0000348375" "0" "90" "14" "102495925" "102495925" "subst" "0" "02327" "DYNC1H1_000132" "g.102495925C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102029588C>G" "" "pathogenic" "" "0000348766" "0" "30" "14" "102470959" "102470959" "subst" "0" "02327" "DYNC1H1_000122" "g.102470959G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102004622G>A" "" "likely benign" "" "0000349011" "0" "50" "14" "102514250" "102514250" "subst" "4.06997E-6" "02327" "DYNC1H1_000140" "g.102514250C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102047913C>T" "" "VUS" "" "0000350343" "0" "30" "14" "102471163" "102471163" "subst" "0" "02327" "DYNC1H1_000124" "g.102471163T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102004826T>C" "" "likely benign" "" "0000350352" "0" "30" "14" "102471388" "102471388" "subst" "5.68588E-5" "02327" "DYNC1H1_000125" "g.102471388G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5248G>A (p.V1750M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102005051G>A" "" "likely benign" "" "0000350444" "0" "50" "14" "102484810" "102484810" "subst" "5.6987E-5" "02327" "DYNC1H1_000129" "g.102484810G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102018473G>A" "" "VUS" "" "0000350470" "0" "50" "14" "102494097" "102494097" "subst" "4.0618E-6" "02327" "DYNC1H1_000131" "g.102494097G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102027760G>A" "" "VUS" "" "0000350528" "0" "30" "14" "102509068" "102509068" "subst" "2.84331E-5" "02327" "DYNC1H1_000137" "g.102509068G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12496G>A (p.(Val4166Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.102042731G>A" "" "likely benign" "" "0000350607" "0" "90" "14" "102452396" "102452396" "subst" "0" "02327" "DYNC1H1_000113" "g.102452396G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.101986059G>A" "" "pathogenic" "" "0000404690" "0" "70" "14" "102478787" "102478787" "subst" "0" "00006" "DYNC1H1_000142" "g.102478787C>T" "" "{PMID:Tumienė 2018:29286531}" "" "" "" "De novo" "" "" "0" "" "" "g.102012450C>T" "" "likely pathogenic" "ACMG" "0000407958" "0" "70" "14" "102468883" "102468883" "subst" "0" "00006" "DYNC1H1_000143" "g.102468883G>A" "" "{PMID:de Ligt 2012:23033978}" "" "NM_001376.4:c.4552G>A (Glu1518Lys)" "candidate variant" "De novo" "" "" "0" "" "" "g.102002546G>A" "" "likely pathogenic" "" "0000439075" "0" "50" "14" "102514191" "102514191" "subst" "0" "01164" "DYNC1H1_000144" "g.102514191G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.102047854G>A" "" "VUS" "ACMG" "0000442481" "0" "50" "14" "102482751" "102482751" "subst" "1.21819E-5" "01164" "DYNC1H1_000145" "g.102482751G>C" "" "" "" "" "" "Germline" "" "rs376901405" "0" "" "" "g.102016414G>C" "" "VUS" "ACMG" "0000551165" "0" "10" "14" "102431074" "102431074" "subst" "0.0122534" "01943" "DYNC1H1_000146" "g.102431074T>C" "" "" "" "DYNC1H1(NM_001376.4):c.46T>C (p.L16=), DYNC1H1(NM_001376.5):c.46T>C (p.L16=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101964737T>C" "" "benign" "" "0000551167" "0" "30" "14" "102445646" "102445646" "subst" "0.000617635" "02330" "DYNC1H1_000007" "g.102445646T>G" "" "" "" "DYNC1H1(NM_001376.4):c.345-10T>G, DYNC1H1(NM_001376.5):c.345-10T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101979309T>G" "" "likely benign" "" "0000551168" "0" "50" "14" "102445729" "102445729" "subst" "0" "02327" "DYNC1H1_000148" "g.102445729C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101979392C>A" "" "VUS" "" "0000551169" "0" "90" "14" "102446288" "102446288" "subst" "0" "02330" "DYNC1H1_000109" "g.102446288C>T" "" "" "" "DYNC1H1(NM_001376.5):c.751C>T (p.R251C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101979951C>T" "" "pathogenic" "" "0000551171" "0" "50" "14" "102446800" "102446800" "subst" "0" "01943" "DYNC1H1_000149" "g.102446800C>T" "" "" "" "DYNC1H1(NM_001376.4):c.874C>T (p.R292W), DYNC1H1(NM_001376.5):c.874C>T (p.R292W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101980463C>T" "" "VUS" "" "0000551172" "0" "70" "14" "102446800" "102446800" "subst" "0" "02327" "DYNC1H1_000149" "g.102446800C>T" "" "" "" "DYNC1H1(NM_001376.4):c.874C>T (p.R292W), DYNC1H1(NM_001376.5):c.874C>T (p.R292W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101980463C>T" "" "likely pathogenic" "" "0000551173" "0" "10" "14" "102449341" "102449341" "dup" "0" "02330" "DYNC1H1_000014" "g.102449341dup" "" "" "" "DYNC1H1(NM_001376.4):c.962-15dupT, DYNC1H1(NM_001376.5):c.962-15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101983004dup" "" "benign" "" "0000551174" "0" "70" "14" "102449870" "102449870" "subst" "0" "01804" "DYNC1H1_000150" "g.102449870G>A" "" "" "" "DYNC1H1(NM_001376.4):c.1385G>A (p.(Arg462His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101983533G>A" "" "likely pathogenic" "" "0000551175" "0" "50" "14" "102452240" "102452240" "subst" "0" "01943" "DYNC1H1_000151" "g.102452240G>A" "" "" "" "DYNC1H1(NM_001376.4):c.1678G>A (p.V560M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101985903G>A" "" "VUS" "" "0000551176" "0" "30" "14" "102452266" "102452266" "subst" "0.000138254" "02330" "DYNC1H1_000018" "g.102452266T>C" "" "" "" "DYNC1H1(NM_001376.4):c.1704T>C (p.L568=), DYNC1H1(NM_001376.5):c.1704T>C (p.L568=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101985929T>C" "" "likely benign" "" "0000551177" "0" "50" "14" "102452379" "102452379" "subst" "0" "01804" "DYNC1H1_000152" "g.102452379C>T" "" "" "" "DYNC1H1(NM_001376.4):c.1817C>T (p.(Thr606Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986042C>T" "" "VUS" "" "0000551178" "0" "50" "14" "102452463" "102452463" "del" "0" "01804" "DYNC1H1_000153" "g.102452463del" "" "" "" "DYNC1H1(NM_001376.4):c.1900delA (p.(Lys634ArgfsTer2))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986126del" "" "VUS" "" "0000551179" "0" "30" "14" "102452773" "102452773" "subst" "0.000113712" "02330" "DYNC1H1_000154" "g.102452773T>A" "" "" "" "DYNC1H1(NM_001376.4):c.2211T>A (p.V737=), DYNC1H1(NM_001376.5):c.2211T>A (p.V737=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986436T>A" "" "likely benign" "" "0000551180" "0" "70" "14" "102452837" "102452837" "subst" "0" "02327" "DYNC1H1_000155" "g.102452837C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986500C>T" "" "likely pathogenic" "" "0000551181" "0" "10" "14" "102455034" "102455034" "subst" "0.000820885" "02330" "DYNC1H1_000026" "g.102455034C>T" "" "" "" "DYNC1H1(NM_001376.4):c.2719-6C>T, DYNC1H1(NM_001376.5):c.2719-6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101988697C>T" "" "benign" "" "0000551182" "0" "10" "14" "102455042" "102455042" "subst" "0.0012352" "01943" "DYNC1H1_000156" "g.102455042T>C" "" "" "" "DYNC1H1(NM_001376.4):c.2721T>C (p.I907=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101988705T>C" "" "benign" "" "0000551183" "0" "50" "14" "102455194" "102455194" "subst" "0" "02327" "DYNC1H1_000157" "g.102455194G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101988857G>A" "" "VUS" "" "0000551184" "0" "30" "14" "102466375" "102466375" "subst" "0" "02327" "DYNC1H1_000158" "g.102466375G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102000038G>T" "" "likely benign" "" "0000551186" "0" "10" "14" "102467421" "102467421" "subst" "0.00307797" "02330" "DYNC1H1_000038" "g.102467421C>T" "" "" "" "DYNC1H1(NM_001376.4):c.4185+20C>T, DYNC1H1(NM_001376.5):c.4185+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102001084C>T" "" "benign" "" "0000551188" "0" "50" "14" "102468873" "102468873" "subst" "0" "02325" "DYNC1H1_000161" "g.102468873G>C" "" "" "" "DYNC1H1(NM_001376.5):c.4543-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102002536G>C" "" "VUS" "" "0000551189" "0" "10" "14" "102469273" "102469273" "subst" "0.000971956" "02330" "DYNC1H1_000043" "g.102469273T>C" "" "" "" "DYNC1H1(NM_001376.4):c.4854T>C (p.Y1618=), DYNC1H1(NM_001376.5):c.4854T>C (p.Y1618=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102002936T>C" "" "benign" "" "0000551190" "0" "30" "14" "102471295" "102471295" "subst" "0" "01804" "DYNC1H1_000162" "g.102471295A>G" "" "" "" "DYNC1H1(NM_001376.4):c.5238+8A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102004958A>G" "" "likely benign" "" "0000551192" "0" "50" "14" "102474534" "102474534" "subst" "0" "02325" "DYNC1H1_000164" "g.102474534T>C" "" "" "" "DYNC1H1(NM_001376.5):c.5837T>C (p.V1946A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102008197T>C" "" "VUS" "" "0000551193" "0" "30" "14" "102476187" "102476187" "subst" "0.000487361" "02330" "DYNC1H1_000165" "g.102476187C>T" "" "" "" "DYNC1H1(NM_001376.5):c.5985C>T (p.A1995=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102009850C>T" "" "likely benign" "" "0000551195" "0" "50" "14" "102478455" "102478455" "subst" "4.06494E-6" "01943" "DYNC1H1_000167" "g.102478455G>A" "" "" "" "DYNC1H1(NM_001376.4):c.6857+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102012118G>A" "" "VUS" "" "0000551196" "0" "30" "14" "102478660" "102478660" "subst" "4.06075E-6" "02330" "DYNC1H1_000168" "g.102478660C>T" "" "" "" "DYNC1H1(NM_001376.5):c.6867C>T (p.D2289=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102012323C>T" "" "likely benign" "" "0000551197" "0" "50" "14" "102478802" "102478802" "subst" "1.62422E-5" "02330" "DYNC1H1_000169" "g.102478802C>T" "" "" "" "DYNC1H1(NM_001376.5):c.7009C>T (p.P2337S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102012465C>T" "" "VUS" "" "0000551198" "0" "30" "14" "102481666" "102481666" "subst" "0.00154989" "02330" "DYNC1H1_000055" "g.102481666G>T" "" "" "" "DYNC1H1(NM_001376.4):c.7239G>T (p.L2413=), DYNC1H1(NM_001376.5):c.7239G>T (p.L2413=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102015329G>T" "" "likely benign" "" "0000551199" "0" "30" "14" "102481670" "102481670" "subst" "0" "02327" "DYNC1H1_000170" "g.102481670G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102015333G>T" "" "likely benign" "" "0000551200" "0" "30" "14" "102482267" "102482267" "subst" "3.65574E-5" "01943" "DYNC1H1_000171" "g.102482267C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7317C>T (p.H2439=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102015930C>T" "" "likely benign" "" "0000551201" "0" "30" "14" "102484914" "102484914" "subst" "0.00102033" "02330" "DYNC1H1_000172" "g.102484914G>A" "" "" "" "DYNC1H1(NM_001376.4):c.8304G>A (p.P2768=), DYNC1H1(NM_001376.5):c.8304G>A (p.P2768=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102018577G>A" "" "likely benign" "" "0000551202" "0" "50" "14" "102489099" "102489099" "subst" "0" "02330" "DYNC1H1_000173" "g.102489099A>G" "" "" "" "DYNC1H1(NM_001376.5):c.8519A>G (p.D2840G, p.(Asp2840Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102022762A>G" "" "VUS" "" "0000551203" "0" "30" "14" "102489136" "102489136" "subst" "8.12216E-6" "02330" "DYNC1H1_000174" "g.102489136G>A" "" "" "" "DYNC1H1(NM_001376.5):c.8556G>A (p.T2852=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102022799G>A" "" "likely benign" "" "0000551204" "0" "30" "14" "102493586" "102493586" "subst" "4.06062E-6" "01943" "DYNC1H1_000175" "g.102493586C>T" "" "" "" "DYNC1H1(NM_001376.4):c.8847C>T (p.F2949=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027249C>T" "" "likely benign" "" "0000551205" "0" "70" "14" "102493959" "102493959" "subst" "0" "02327" "DYNC1H1_000176" "g.102493959C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027622C>T" "" "likely pathogenic" "" "0000551207" "0" "70" "14" "102494049" "102494049" "subst" "0" "01943" "DYNC1H1_000178" "g.102494049G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9142G>A (p.E3048K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027712G>A" "" "likely pathogenic" "" "0000551208" "0" "70" "14" "102494049" "102494049" "subst" "0" "02327" "DYNC1H1_000178" "g.102494049G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9142G>A (p.E3048K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027712G>A" "" "likely pathogenic" "" "0000551209" "0" "70" "14" "102494066" "102494066" "subst" "0" "02327" "DYNC1H1_000179" "g.102494066G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027729G>T" "" "likely pathogenic" "" "0000551210" "0" "50" "14" "102494085" "102494085" "subst" "1.21879E-5" "02330" "DYNC1H1_000180" "g.102494085C>T" "" "" "" "DYNC1H1(NM_001376.4):c.9178C>T (p.R3060C), DYNC1H1(NM_001376.5):c.9178C>T (p.R3060C, p.(Arg3060Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027748C>T" "" "VUS" "" "0000551211" "0" "70" "14" "102495988" "102495988" "subst" "0" "02327" "DYNC1H1_000181" "g.102495988T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102029651T>C" "" "likely pathogenic" "" "0000551212" "0" "30" "14" "102496149" "102496149" "del" "0" "01943" "DYNC1H1_000182" "g.102496149del" "" "" "" "DYNC1H1(NM_001376.4):c.9643-7delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102029812del" "" "likely benign" "" "0000551213" "0" "30" "14" "102499611" "102499611" "subst" "4.46682E-5" "02327" "DYNC1H1_000183" "g.102499611C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10203C>T (p.N3401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102033274C>T" "" "likely benign" "" "0000551214" "0" "70" "14" "102499639" "102499639" "subst" "0" "01804" "DYNC1H1_000184" "g.102499639C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10231C>T (p.(Pro3411Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102033302C>T" "" "likely pathogenic" "" "0000551215" "0" "50" "14" "102499744" "102499744" "subst" "0" "01804" "DYNC1H1_000185" "g.102499744C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10336C>T (p.(Arg3446Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102033407C>T" "" "VUS" "" "0000551216" "0" "50" "14" "102500421" "102500421" "subst" "0.000166565" "02330" "DYNC1H1_000186" "g.102500421C>A" "" "" "" "DYNC1H1(NM_001376.4):c.10522C>A (p.L3508I), DYNC1H1(NM_001376.5):c.10522C>A (p.L3508I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102034084C>A" "" "VUS" "" "0000551217" "0" "90" "14" "102504862" "102504862" "dup" "0" "01943" "DYNC1H1_000187" "g.102504862dup" "" "" "" "DYNC1H1(NM_001376.4):c.10974dupG (p.R3659Efs*48)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102038525dup" "" "pathogenic" "" "0000551218" "0" "30" "14" "102504951" "102504951" "subst" "0" "01943" "DYNC1H1_000188" "g.102504951A>G" "" "" "" "DYNC1H1(NM_001376.4):c.11055+8A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102038614A>G" "" "likely benign" "" "0000551219" "0" "70" "14" "102505060" "102505060" "subst" "0" "01804" "DYNC1H1_000189" "g.102505060C>T" "" "" "" "DYNC1H1(NM_001376.4):c.11081C>T (p.(Ser3694Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102038723C>T" "" "likely pathogenic" "" "0000551220" "0" "50" "14" "102505069" "102505069" "subst" "0" "02327" "DYNC1H1_000190" "g.102505069C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102038732C>G" "" "VUS" "" "0000551221" "0" "30" "14" "102505531" "102505531" "subst" "0.00121057" "02330" "DYNC1H1_000191" "g.102505531G>A" "" "" "" "DYNC1H1(NM_001376.5):c.11400G>A (p.Q3800=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102039194G>A" "" "likely benign" "" "0000551223" "0" "50" "14" "102506710" "102506710" "subst" "0" "02330" "DYNC1H1_000193" "g.102506710C>T" "" "" "" "DYNC1H1(NM_001376.5):c.11828C>T (p.A3943V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102040373C>T" "" "VUS" "" "0000551224" "0" "30" "14" "102507911" "102507911" "subst" "0.00311867" "01804" "DYNC1H1_000088" "g.102507911C>G" "" "" "" "DYNC1H1(NM_001376.4):c.11942C>G (p.T3981R, p.(Thr3981Arg)), DYNC1H1(NM_001376.5):c.11942C>G (p.T3981R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102041574C>G" "" "likely benign" "" "0000551226" "0" "10" "14" "102508439" "102508439" "subst" "0.000897418" "02330" "DYNC1H1_000194" "g.102508439G>T" "" "" "" "DYNC1H1(NM_001376.5):c.12192G>T (p.T4064=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102042102G>T" "" "benign" "" "0000551227" "0" "50" "14" "102508991" "102508991" "subst" "4.06177E-6" "02330" "DYNC1H1_000195" "g.102508991G>A" "" "" "" "DYNC1H1(NM_001376.5):c.12419G>A (p.R4140H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102042654G>A" "" "VUS" "" "0000551228" "0" "50" "14" "102510737" "102510737" "subst" "8.12275E-6" "02327" "DYNC1H1_000196" "g.102510737C>T" "" "" "" "DYNC1H1(NM_001376.5):c.12811C>T (p.R4271C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102044400C>T" "" "VUS" "" "0000551229" "0" "50" "14" "102514265" "102514265" "subst" "0" "02327" "DYNC1H1_000197" "g.102514265G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102047928G>A" "" "VUS" "" "0000551230" "0" "50" "14" "102514979" "102514979" "subst" "0" "01804" "DYNC1H1_000198" "g.102514979C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13345C>T (p.(Arg4449Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102048642C>T" "" "VUS" "" "0000551231" "0" "30" "14" "102515844" "102515844" "subst" "0.000304635" "01943" "DYNC1H1_000199" "g.102515844C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13440C>T (p.S4480=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102049507C>T" "" "likely benign" "" "0000551233" "0" "30" "14" "102516398" "102516398" "subst" "4.66885E-5" "02330" "DYNC1H1_000201" "g.102516398C>T" "" "" "" "DYNC1H1(NM_001376.5):c.13685-10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102050061C>T" "" "likely benign" "" "0000551235" "0" "30" "14" "102516790" "102516790" "subst" "8.12117E-6" "01943" "DYNC1H1_000203" "g.102516790C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13831C>T (p.L4611=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102050453C>T" "" "likely benign" "" "0000551236" "0" "30" "14" "102516867" "102516867" "subst" "2.03029E-5" "02330" "DYNC1H1_000204" "g.102516867C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13908C>T (p.Y4636=), DYNC1H1(NM_001376.5):c.13908C>T (p.Y4636=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102050530C>T" "" "likely benign" "" "0000604416" "0" "70" "14" "102446852" "102446852" "subst" "0" "03512" "DYNC1H1_000205" "g.102446852G>A" "" "{PMID:Minardi 2020:32725632}" "" "" "" "De novo" "" "" "0" "" "" "g.101980515G>A" "" "likely pathogenic (dominant)" "" "0000614694" "0" "50" "14" "102449610" "102449610" "subst" "4.06689E-6" "02326" "DYNC1H1_000207" "g.102449610T>C" "" "" "" "DYNC1H1(NM_001376.4):c.1216T>C (p.Y406H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101983273T>C" "" "VUS" "" "0000614695" "0" "50" "14" "102452463" "102452463" "subst" "0" "01804" "DYNC1H1_000208" "g.102452463A>G" "" "" "" "DYNC1H1(NM_001376.4):c.1901A>G (p.(Lys634Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986126A>G" "" "VUS" "" "0000614696" "0" "50" "14" "102452669" "102452669" "subst" "0" "02327" "DYNC1H1_000209" "g.102452669G>A" "" "" "" "DYNC1H1(NM_001376.5):c.2107G>A (p.A703T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986332G>A" "" "VUS" "" "0000614699" "0" "50" "14" "102471388" "102471388" "subst" "5.68588E-5" "01943" "DYNC1H1_000125" "g.102471388G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5248G>A (p.V1750M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102005051G>A" "" "VUS" "" "0000614700" "0" "30" "14" "102471435" "102471435" "subst" "0.000186799" "01943" "DYNC1H1_000213" "g.102471435A>G" "" "" "" "DYNC1H1(NM_001376.4):c.5295A>G (p.A1765=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102005098A>G" "" "likely benign" "" "0000614701" "0" "30" "14" "102477202" "102477202" "subst" "0" "02330" "DYNC1H1_000215" "g.102477202C>T" "" "" "" "DYNC1H1(NM_001376.5):c.6531C>T (p.A2177=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102010865C>T" "" "likely benign" "" "0000614702" "0" "50" "14" "102478348" "102478348" "subst" "0" "02327" "DYNC1H1_000217" "g.102478348A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102012011A>C" "" "VUS" "" "0000614703" "0" "30" "14" "102481498" "102481498" "subst" "8.93372E-5" "02330" "DYNC1H1_000218" "g.102481498G>A" "" "" "" "DYNC1H1(NM_001376.5):c.7071G>A (p.S2357=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102015161G>A" "" "likely benign" "" "0000614704" "0" "30" "14" "102481579" "102481579" "subst" "0.000280239" "01943" "DYNC1H1_000219" "g.102481579C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7152C>T (p.S2384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102015242C>T" "" "likely benign" "" "0000614705" "0" "50" "14" "102486294" "102486294" "del" "0" "01943" "DYNC1H1_000221" "g.102486294del" "" "" "" "DYNC1H1(NM_001376.4):c.8408delT (p.V2803Gfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102019957del" "" "VUS" "" "0000614706" "0" "50" "14" "102493804" "102493804" "subst" "0" "02327" "DYNC1H1_000222" "g.102493804G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102027467G>A" "" "VUS" "" "0000614709" "0" "10" "14" "102508406" "102508406" "subst" "0.00212367" "02330" "DYNC1H1_000226" "g.102508406A>T" "" "" "" "DYNC1H1(NM_001376.5):c.12159A>T (p.G4053=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102042069A>T" "" "benign" "" "0000614711" "0" "30" "14" "102514224" "102514224" "subst" "4.06623E-6" "02326" "DYNC1H1_000228" "g.102514224G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13077G>A (p.E4359=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102047887G>A" "" "likely benign" "" "0000614712" "0" "30" "14" "102514260" "102514260" "subst" "0.000126269" "02326" "DYNC1H1_000229" "g.102514260C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13113C>T (p.D4371=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102047923C>T" "" "likely benign" "" "0000614713" "0" "30" "14" "102514328" "102514328" "subst" "0.000245918" "01943" "DYNC1H1_000230" "g.102514328C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13181C>T (p.T4394M), DYNC1H1(NM_001376.5):c.13181C>T (p.T4394M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102047991C>T" "" "likely benign" "" "0000614714" "0" "50" "14" "102514895" "102514895" "subst" "1.2182E-5" "01943" "DYNC1H1_000231" "g.102514895G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13261G>A (p.A4421T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102048558G>A" "" "VUS" "" "0000614715" "0" "30" "14" "102515026" "102515026" "subst" "0" "02330" "DYNC1H1_000232" "g.102515026C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13372+20C>T, DYNC1H1(NM_001376.5):c.13372+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102048689C>T" "" "likely benign" "" "0000623080" "0" "30" "14" "102467359" "102467359" "subst" "9.7454E-5" "02330" "DYNC1H1_000211" "g.102467359G>A" "" "" "" "DYNC1H1(NM_001376.5):c.4143G>A (p.A1381=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102001022G>A" "" "likely benign" "" "0000623081" "0" "30" "14" "102471206" "102471206" "subst" "0" "02330" "DYNC1H1_000212" "g.102471206G>A" "" "" "" "DYNC1H1(NM_001376.5):c.5157G>A (p.E1719=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102004869G>A" "" "likely benign" "" "0000623082" "0" "50" "14" "102476726" "102476726" "dup" "0" "01943" "DYNC1H1_000214" "g.102476726dup" "" "" "" "DYNC1H1(NM_001376.4):c.6335dupA (p.R2113Efs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102010389dup" "" "VUS" "" "0000623083" "0" "30" "14" "102477298" "102477298" "subst" "0" "02330" "DYNC1H1_000216" "g.102477298G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6618+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102010961G>A" "" "likely benign" "" "0000623084" "0" "30" "14" "102482258" "102482258" "subst" "0.000109674" "02330" "DYNC1H1_000220" "g.102482258G>A" "" "" "" "DYNC1H1(NM_001376.5):c.7308G>A (p.A2436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102015921G>A" "" "likely benign" "" "0000623085" "0" "30" "14" "102502989" "102502989" "subst" "0.000556327" "01943" "DYNC1H1_000223" "g.102502989G>A" "" "" "" "DYNC1H1(NM_001376.4):c.10908+10G>A, DYNC1H1(NM_001376.5):c.10908+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102036652G>A" "" "likely benign" "" "0000623086" "0" "30" "14" "102505420" "102505420" "subst" "8.12163E-6" "01943" "DYNC1H1_000224" "g.102505420C>T" "" "" "" "DYNC1H1(NM_001376.4):c.11289C>T (p.D3763=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102039083C>T" "" "likely benign" "" "0000623087" "0" "50" "14" "102510737" "102510737" "subst" "8.12275E-6" "02330" "DYNC1H1_000196" "g.102510737C>T" "" "" "" "DYNC1H1(NM_001376.5):c.12811C>T (p.R4271C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102044400C>T" "" "VUS" "" "0000623088" "0" "30" "14" "102516867" "102516867" "subst" "2.03029E-5" "01943" "DYNC1H1_000204" "g.102516867C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13908C>T (p.Y4636=), DYNC1H1(NM_001376.5):c.13908C>T (p.Y4636=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102050530C>T" "" "likely benign" "" "0000644804" "0" "50" "14" "102494175" "102494175" "subst" "4.47049E-5" "03564" "DYNC1H1_000233" "g.102494175G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.102027838G>A" "" "VUS" "" "0000645299" "11" "70" "14" "102452889" "102452889" "subst" "0" "00006" "DYNC1H1_000022" "g.102452889C>T" "" "{PMID:Lee 2019:31607746}" "" "" "carrier father mosaic" "Germline" "" "" "0" "" "" "g.101986552C>T" "{CV:000746573.2}" "likely pathogenic" "" "0000648821" "1" "90" "14" "102498758" "102498758" "subst" "0" "03575" "DYNC1H1_000234" "g.102498758G>A" "1/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs797044928}" "Germline" "" "rs797044928" "0" "" "" "g.102032421G>A" "" "pathogenic" "" "0000653436" "0" "50" "14" "102483576" "102483576" "subst" "0" "01164" "DYNC1H1_000235" "g.102483576A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.102017239A>G" "" "VUS" "ACMG" "0000657327" "0" "30" "14" "102442040" "102442040" "subst" "4.06696E-6" "01943" "DYNC1H1_000236" "g.102442040G>A" "" "" "" "DYNC1H1(NM_001376.4):c.257-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101975703G>A" "" "likely benign" "" "0000657328" "0" "50" "14" "102452669" "102452669" "subst" "0" "02330" "DYNC1H1_000209" "g.102452669G>A" "" "" "" "DYNC1H1(NM_001376.5):c.2107G>A (p.A703T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986332G>A" "" "VUS" "" "0000657329" "0" "30" "14" "102452737" "102452737" "subst" "4.06081E-6" "01943" "DYNC1H1_000237" "g.102452737T>C" "" "" "" "DYNC1H1(NM_001376.4):c.2175T>C (p.V725=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.101986400T>C" "" "likely benign" "" "0000657331" "0" "90" "14" "102469031" "102469031" "subst" "0" "02327" "DYNC1H1_000239" "g.102469031G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102002694G>A" "" "pathogenic" "" "0000657332" "0" "50" "14" "102483128" "102483128" "subst" "0" "02327" "DYNC1H1_000240" "g.102483128C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102016791C>T" "" "VUS" "" "0000657333" "0" "50" "14" "102516480" "102516480" "subst" "8.12163E-6" "02327" "DYNC1H1_000241" "g.102516480C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13757C>T (p.P4586L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102050143C>T" "" "VUS" "" "0000657334" "0" "30" "14" "102516531" "102516531" "subst" "0.000219377" "02326" "DYNC1H1_000107" "g.102516531G>T" "" "" "" "DYNC1H1(NM_001376.4):c.13808G>T (p.S4603I), DYNC1H1(NM_001376.5):c.13808G>T (p.S4603I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.102050194G>T" "" "likely benign" "" "0000663699" "0" "50" "14" "102493874" "102493874" "subst" "0" "01164" "DYNC1H1_000252" "g.102493874A>G" "" "" "" "" "13 year old boy with mild dysmorphic mental retardation" "Germline" "" "" "0" "" "" "g.102027537A>G" "" "VUS" "" "0000663998" "0" "90" "14" "102452354" "102452354" "subst" "0" "00006" "DYNC1H1_000245" "g.102452354C>T" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "Germline" "" "rs587780564" "0" "" "" "g.101986017C>T" "" "pathogenic (dominant)" "" "0000664047" "0" "70" "14" "102446129" "102446129" "subst" "0" "00006" "DYNC1H1_000242" "g.102446129C>A" "" "{PMID:Antoniadi 2015:26392352}" "" "" "AD, segregates with disease" "Germline" "" "" "0" "" "" "g.101979792C>A" "" "likely pathogenic (dominant)" "" "0000664048" "0" "70" "14" "102446289" "102446289" "subst" "0" "00006" "DYNC1H1_000110" "g.102446289G>A" "" "{PMID:Antoniadi 2015:26392352}" "" "" "AD, segregates with disease" "Germline" "" "" "0" "" "" "g.101979952G>A" "" "likely pathogenic (dominant)" "" "0000664049" "0" "70" "14" "102483498" "102483498" "subst" "0" "00006" "DYNC1H1_000251" "g.102483498A>G" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "Germline" "" "" "0" "" "" "g.102017161A>G" "" "likely pathogenic (dominant)" "" "0000664050" "0" "70" "14" "102449406" "102449406" "subst" "0" "00006" "DYNC1H1_000243" "g.102449406G>A" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "Germline" "" "" "0" "" "" "g.101983069G>A" "" "likely pathogenic (dominant)" "" "0000664051" "0" "70" "14" "102449589" "102449589" "subst" "0" "00006" "DYNC1H1_000244" "g.102449589A>G" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "Germline" "" "" "0" "" "" "g.101983252A>G" "" "likely pathogenic (dominant)" "" "0000664052" "0" "70" "14" "102452371" "102452371" "subst" "0" "00006" "DYNC1H1_000246" "g.102452371A>T" "" "{PMID:Antoniadi 2015:26392352}" "" "" "AD, segregates with disease" "Germline" "" "" "0" "" "" "g.101986034A>T" "" "likely pathogenic (dominant)" "" "0000664053" "0" "70" "14" "102463413" "102463413" "subst" "0" "00006" "DYNC1H1_000248" "g.102463413C>A" "" "{PMID:Antoniadi 2015:26392352}" "" "" "AD, segregates with disease" "Germline" "" "" "0" "" "" "g.101997076C>A" "" "likely pathogenic (dominant)" "" "0000664054" "0" "70" "14" "102467555" "102467555" "subst" "0" "00006" "DYNC1H1_000249" "g.102467555T>G" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "De novo" "" "" "0" "" "" "g.102001218T>G" "" "likely pathogenic (dominant)" "" "0000664055" "0" "70" "14" "102469227" "102469227" "subst" "0" "00006" "DYNC1H1_000250" "g.102469227G>C" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "De novo" "" "" "0" "" "" "g.102002890G>C" "" "likely pathogenic (dominant)" "" "0000664117" "0" "70" "14" "102449589" "102449589" "subst" "0" "00006" "DYNC1H1_000244" "g.102449589A>G" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "Germline" "" "" "0" "" "" "g.101983252A>G" "" "likely pathogenic (dominant)" "" "0000664152" "0" "70" "14" "102461573" "102461573" "subst" "0" "00006" "DYNC1H1_000247" "g.102461573T>A" "" "{PMID:Antoniadi 2015:26392352}" "" "" "" "De novo" "" "" "0" "" "" "g.101995236T>A" "" "likely pathogenic (dominant)" "" "0000667510" "0" "90" "14" "102461131" "102461131" "subst" "0" "00006" "DYNC1H1_000253" "g.102461131T>C" "" "{PMID:Helbig 2016:26795593}" "" "" "" "De novo" "" "" "0" "" "" "g.101994794T>C" "" "pathogenic (dominant)" "ACMG" "0000673711" "0" "50" "14" "102509056" "102509056" "subst" "0" "00006" "DYNC1H1_000254" "g.102509056A>G" "" "{PMID:Johannesen 2020:32427350}" "" "1284A>G (Ser4162Gly)" "ACMG PM2, PM6" "De novo" "" "" "0" "" "" "g.102042719A>G" "" "VUS" "" "0000679864" "0" "10" "14" "102431024" "102431024" "subst" "0.012316" "02330" "DYNC1H1_000003" "g.102431024A>G" "" "" "" "DYNC1H1(NM_001376.4):c.-5A>G, DYNC1H1(NM_001376.5):c.-5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000679865" "0" "10" "14" "102431074" "102431074" "subst" "0.0122534" "02330" "DYNC1H1_000146" "g.102431074T>C" "" "" "" "DYNC1H1(NM_001376.4):c.46T>C (p.L16=), DYNC1H1(NM_001376.5):c.46T>C (p.L16=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000679866" "0" "70" "14" "102449497" "102449497" "subst" "0" "02325" "DYNC1H1_000255" "g.102449497G>A" "" "" "" "DYNC1H1(NM_001376.5):c.1103G>A (p.R368Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000679867" "0" "10" "14" "102453876" "102453876" "subst" "0.0116425" "02330" "DYNC1H1_000025" "g.102453876G>A" "" "" "" "DYNC1H1(NM_001376.4):c.2625G>A (p.S875=), DYNC1H1(NM_001376.5):c.2625G>A (p.S875=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000679869" "0" "50" "14" "102461042" "102461042" "subst" "0" "02327" "DYNC1H1_000257" "g.102461042G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000679870" "0" "10" "14" "102483120" "102483120" "subst" "0.0116645" "02330" "DYNC1H1_000060" "g.102483120A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7632A>G (p.E2544=), DYNC1H1(NM_001376.5):c.7632A>G (p.E2544=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000679871" "0" "10" "14" "102515010" "102515010" "subst" "0.0094904" "02330" "DYNC1H1_000102" "g.102515010C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13372+4C>T, DYNC1H1(NM_001376.5):c.13372+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000679873" "0" "50" "14" "102516202" "102516202" "subst" "5.2986E-5" "02330" "DYNC1H1_000259" "g.102516202G>A" "" "" "" "DYNC1H1(NM_001376.5):c.13667G>A (p.C4556Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691571" "0" "50" "14" "102446858" "102446858" "subst" "0" "01943" "DYNC1H1_000261" "g.102446858A>G" "" "" "" "DYNC1H1(NM_001376.4):c.932A>G (p.H311R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691572" "0" "50" "14" "102478201" "102478201" "subst" "0" "02325" "DYNC1H1_000127" "g.102478201G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6619-11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691573" "0" "30" "14" "102496053" "102496053" "subst" "2.84285E-5" "01804" "DYNC1H1_000262" "g.102496053C>T" "" "" "" "DYNC1H1(NM_001376.4):c.9642+4C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691574" "0" "70" "14" "102499640" "102499640" "subst" "0" "02325" "DYNC1H1_000263" "g.102499640C>T" "" "" "" "DYNC1H1(NM_001376.5):c.10232C>T (p.P3411L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000691575" "0" "50" "14" "102514238" "102514238" "subst" "2.03398E-5" "02330" "DYNC1H1_000264" "g.102514238C>T" "" "" "" "DYNC1H1(NM_001376.5):c.13091C>T (p.T4364M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693853" "1" "50" "14" "102446774" "102446774" "subst" "0" "03752" "DYNC1H1_000260" "g.102446774G>A" "" "{PMID:Cerino 2020:32934002}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000697500" "0" "70" "14" "102446111" "102446111" "subst" "0" "00006" "DYNC1H1_000265" "g.102446111G>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.101979774G>A" "" "likely pathogenic" "" "0000698187" "0" "90" "14" "102474582" "102474582" "subst" "0" "00006" "DYNC1H1_000266" "g.102474582G>T" "" "{PMID:Zhu 2015:25590979}" "" "" "" "De novo" "" "" "0" "" "" "g.102008245G>T" "" "pathogenic (dominant)" "" "0000698203" "0" "90" "14" "102478787" "102478787" "subst" "0" "00006" "DYNC1H1_000142" "g.102478787C>T" "" "{PMID:Zhu 2015:25590979}" "" "" "" "De novo" "" "" "0" "" "" "g.102012450C>T" "" "pathogenic (dominant)" "" "0000698827" "1" "90" "14" "102452354" "102452354" "subst" "0" "00006" "DYNC1H1_000245" "g.102452354C>T" "" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "" "" "" "Germline" "" "" "0" "" "" "g.101986017C>T" "" "pathogenic (dominant)" "" "0000698828" "0" "90" "14" "102452889" "102452889" "subst" "0" "00006" "DYNC1H1_000022" "g.102452889C>T" "" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "" "" "" "De novo" "" "" "0" "" "" "g.101986552C>T" "" "pathogenic (dominant)" "" "0000698829" "0" "90" "14" "102452354" "102452354" "subst" "0" "00006" "DYNC1H1_000245" "g.102452354C>T" "" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "" "" "" "De novo" "" "" "0" "" "" "g.101986017C>T" "" "pathogenic (dominant)" "" "0000698830" "0" "90" "14" "102452354" "102452354" "subst" "0" "00006" "DYNC1H1_000245" "g.102452354C>T" "" "{PMID:Beecroft 2017:28554554}, {PMID:Ravenscroft 2020:33060286}, {DOI:Ravenscroft 2020:10.1136/jmedgenet-2020-106901}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.101986017C>T" "" "pathogenic (dominant)" "" "0000708538" "0" "50" "14" "102461070" "102461070" "subst" "0" "01164" "DYNC1H1_000267" "g.102461070G>A" "" "" "" "" "ACMG: PM2, PP3: class 3" "Germline" "?" "" "" "" "" "" "" "VUS" "ACMG" "0000708721" "0" "70" "14" "102505753" "102505753" "subst" "0" "00006" "DYNC1H1_000268" "g.102505753A>C" "" "{PMID:Vissers 2010:21076407}" "" "" "" "De novo" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" "" "0000724591" "0" "10" "14" "102442098" "102442098" "subst" "0.000390171" "02330" "DYNC1H1_000269" "g.102442098C>T" "" "" "" "DYNC1H1(NM_001376.5):c.306C>T (p.N102=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000724592" "0" "50" "14" "102445736" "102445736" "subst" "0" "02329" "DYNC1H1_000206" "g.102445736A>C" "" "" "" "DYNC1H1(NM_001376.4):c.425A>C (p.E142A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724593" "0" "90" "14" "102446288" "102446288" "subst" "0" "02329" "DYNC1H1_000109" "g.102446288C>T" "" "" "" "DYNC1H1(NM_001376.5):c.751C>T (p.R251C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000724594" "0" "30" "14" "102446777" "102446777" "subst" "8.1215E-6" "02327" "DYNC1H1_000270" "g.102446777C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724595" "0" "70" "14" "102446800" "102446800" "subst" "0" "02329" "DYNC1H1_000149" "g.102446800C>T" "" "" "" "DYNC1H1(NM_001376.4):c.874C>T (p.R292W), DYNC1H1(NM_001376.5):c.874C>T (p.R292W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000724596" "0" "70" "14" "102452355" "102452355" "subst" "0" "02329" "DYNC1H1_000019" "g.102452355G>T" "" "" "" "DYNC1H1(NM_001376.5):c.1793G>T (p.R598L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000724597" "0" "70" "14" "102452376" "102452376" "subst" "0" "02327" "DYNC1H1_000271" "g.102452376A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000724598" "0" "50" "14" "102455089" "102455089" "subst" "3.24963E-5" "02329" "DYNC1H1_000027" "g.102455089C>T" "" "" "" "DYNC1H1(NM_001376.4):c.2768C>T (p.T923M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724599" "0" "50" "14" "102466473" "102466473" "subst" "4.06138E-6" "01943" "DYNC1H1_000272" "g.102466473C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3952C>T (p.R1318C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724600" "0" "10" "14" "102466497" "102466497" "subst" "0.00358263" "02330" "DYNC1H1_000273" "g.102466497G>A" "" "" "" "DYNC1H1(NM_001376.5):c.3960+16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000724601" "0" "10" "14" "102466655" "102466655" "subst" "0.00360989" "02330" "DYNC1H1_000274" "g.102466655C>T" "" "" "" "DYNC1H1(NM_001376.5):c.3993C>T (p.G1331=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000724602" "0" "30" "14" "102473346" "102473346" "subst" "0.000146189" "01943" "DYNC1H1_000275" "g.102473346A>C" "" "" "" "DYNC1H1(NM_001376.4):c.5718A>C (p.G1906=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724603" "0" "50" "14" "102473370" "102473370" "subst" "0" "02329" "DYNC1H1_000163" "g.102473370G>T" "" "" "" "DYNC1H1(NM_001376.4):c.5742G>T (p.E1914D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724604" "0" "50" "14" "102474630" "102474630" "subst" "0" "02325" "DYNC1H1_000276" "g.102474630T>G" "" "" "" "DYNC1H1(NM_001376.5):c.5933T>G (p.I1978R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724605" "0" "50" "14" "102474668" "102474668" "subst" "0.000231527" "02329" "DYNC1H1_000050" "g.102474668G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5971G>A (p.D1991N), DYNC1H1(NM_001376.5):c.5971G>A (p.D1991N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724606" "0" "50" "14" "102481575" "102481575" "subst" "8.12282E-6" "02330" "DYNC1H1_000277" "g.102481575G>A" "" "" "" "DYNC1H1(NM_001376.5):c.7148G>A (p.R2383H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724607" "0" "30" "14" "102484914" "102484914" "subst" "0.00102033" "01943" "DYNC1H1_000172" "g.102484914G>A" "" "" "" "DYNC1H1(NM_001376.4):c.8304G>A (p.P2768=), DYNC1H1(NM_001376.5):c.8304G>A (p.P2768=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724608" "0" "50" "14" "102493736" "102493736" "subst" "0" "01943" "DYNC1H1_000278" "g.102493736C>T" "" "" "" "DYNC1H1(NM_001376.4):c.8903C>T (p.T2968I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724609" "0" "50" "14" "102494085" "102494085" "subst" "1.21879E-5" "02329" "DYNC1H1_000180" "g.102494085C>T" "" "" "" "DYNC1H1(NM_001376.4):c.9178C>T (p.R3060C), DYNC1H1(NM_001376.5):c.9178C>T (p.R3060C, p.(Arg3060Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724610" "0" "30" "14" "102494175" "102494175" "subst" "4.47049E-5" "01804" "DYNC1H1_000233" "g.102494175G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9263+5G>A (p.?), DYNC1H1(NM_001376.5):c.9263+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724611" "0" "30" "14" "102498685" "102498685" "subst" "8.12328E-6" "02330" "DYNC1H1_000279" "g.102498685G>A" "" "" "" "DYNC1H1(NM_001376.5):c.9960G>A (p.A3320=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724612" "0" "50" "14" "102498795" "102498795" "subst" "0" "02329" "DYNC1H1_000074" "g.102498795A>G" "" "" "" "DYNC1H1(NM_001376.4):c.10070A>G (p.E3357G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724613" "0" "50" "14" "102499726" "102499726" "subst" "0" "02327" "DYNC1H1_000280" "g.102499726C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724614" "0" "30" "14" "102500646" "102500646" "subst" "1.62427E-5" "02330" "DYNC1H1_000281" "g.102500646C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10627-16C>T, DYNC1H1(NM_001376.5):c.10627-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724616" "0" "30" "14" "102508412" "102508412" "subst" "1.62426E-5" "02330" "DYNC1H1_000283" "g.102508412C>T" "" "" "" "DYNC1H1(NM_001376.5):c.12165C>T (p.V4055=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724617" "0" "50" "14" "102508438" "102508438" "subst" "4.06068E-6" "02329" "DYNC1H1_000092" "g.102508438C>T" "" "" "" "DYNC1H1(NM_001376.4):c.12191C>T (p.T4064M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724618" "0" "50" "14" "102510932" "102510932" "subst" "4.06088E-6" "02329" "DYNC1H1_000227" "g.102510932G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12903G>A (p.R4301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724619" "0" "30" "14" "102516531" "102516531" "subst" "0.000219377" "02330" "DYNC1H1_000107" "g.102516531G>T" "" "" "" "DYNC1H1(NM_001376.4):c.13808G>T (p.S4603I), DYNC1H1(NM_001376.5):c.13808G>T (p.S4603I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000735294" "0" "90" "14" "102483316" "102483316" "del" "0" "03286" "DYNC1H1_000284" "g.102483316del" "" "{PMID:Courage 2021:33798445}, {DOI:Courage 2021:10.1016/j.ajhg.2021.03.013}" "" "7828delC" "ACMG PVS1, PM2, PM6, PP4; The patient\'s electro-clinical phenotype has little to no overlap with what has been previously reported for this gene. However, the novel frameshift variant is confirmed de novo and it is therefore with moderate confidence we expand the DYNC1H1 clinical spectrum to PME." "De novo" "" "" "0" "" "" "g.102016979del" "" "pathogenic" "ACMG" "0000787263" "0" "50" "14" "102452067" "102452067" "subst" "4.06065E-6" "00006" "DYNC1H1_000285" "g.102452067C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs1435555404" "0" "" "" "g.101985730C>T" "" "VUS" "" "0000787264" "0" "50" "14" "102494342" "102494342" "subst" "4.06058E-6" "00006" "DYNC1H1_000287" "g.102494342G>C" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs1395404099" "0" "" "" "g.102028005G>C" "" "VUS" "" "0000787265" "0" "50" "14" "102516442" "102516444" "del" "0" "00006" "DYNC1H1_000288" "g.102516442_102516444del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs1013209915" "0" "" "" "g.102050105_102050107del" "{CV-RCV:000649562.1}" "VUS" "" "0000787459" "0" "50" "14" "102467321" "102467321" "subst" "0" "00000" "DYNC1H1_000286" "g.102467321C>A" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.102000984C>A" "" "VUS" "" "0000788891" "0" "70" "14" "102469031" "102469031" "subst" "0" "00006" "DYNC1H1_000239" "g.102469031G>A" "" "{PMID:Srivastava 2014:25131622}" "" "4700G>A" "" "De novo" "" "" "0" "" "" "g.102002694G>A" "" "likely pathogenic" "" "0000791100" "0" "50" "14" "102446716" "102446716" "subst" "0" "04115" "DYNC1H1_000289" "g.102446716C>G" "" "" "" "g.15299T>G" "" "De novo" "" "" "0" "" "" "g.101980379C>G" "" "pathogenic (dominant)" "ACMG" "0000791101" "0" "90" "14" "102452354" "102452354" "subst" "0" "04115" "DYNC1H1_000245" "g.102452354C>T" "" "" "" "g.21490C>T" "" "De novo" "" "" "0" "" "" "g.101986017C>T" "" "pathogenic (dominant)" "ACMG" "0000806230" "0" "30" "14" "102446038" "102446038" "subst" "0.00011001" "02330" "DYNC1H1_000291" "g.102446038T>C" "" "" "" "DYNC1H1(NM_001376.4):c.519-18T>C, DYNC1H1(NM_001376.5):c.519-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806231" "0" "30" "14" "102449352" "102449352" "subst" "8.13544E-6" "01943" "DYNC1H1_000292" "g.102449352A>G" "" "" "" "DYNC1H1(NM_001376.4):c.962-4A>G, DYNC1H1(NM_001376.5):c.962-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806232" "0" "50" "14" "102452535" "102452535" "subst" "0" "01943" "DYNC1H1_000293" "g.102452535T>C" "" "" "" "DYNC1H1(NM_001376.4):c.1973T>C (p.L658P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806233" "0" "30" "14" "102452773" "102452773" "subst" "0.000113712" "02326" "DYNC1H1_000154" "g.102452773T>A" "" "" "" "DYNC1H1(NM_001376.4):c.2211T>A (p.V737=), DYNC1H1(NM_001376.5):c.2211T>A (p.V737=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806234" "0" "30" "14" "102463566" "102463566" "subst" "3.65916E-5" "01943" "DYNC1H1_000294" "g.102463566C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3759C>T (p.R1253=), DYNC1H1(NM_001376.5):c.3759C>T (p.R1253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806235" "0" "50" "14" "102467996" "102467996" "subst" "0" "01943" "DYNC1H1_000295" "g.102467996T>C" "" "" "" "DYNC1H1(NM_001376.4):c.4520T>C (p.M1507T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806236" "0" "30" "14" "102469030" "102469030" "subst" "2.43659E-5" "02330" "DYNC1H1_000296" "g.102469030C>A" "" "" "" "DYNC1H1(NM_001376.5):c.4699C>A (p.R1567=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806237" "0" "50" "14" "102481479" "102481479" "subst" "0" "02325" "DYNC1H1_000297" "g.102481479C>T" "" "" "" "DYNC1H1(NM_001376.5):c.7052C>T (p.A2351V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806238" "0" "10" "14" "102481564" "102481564" "subst" "0.00238788" "02330" "DYNC1H1_000054" "g.102481564G>A" "" "" "" "DYNC1H1(NM_001376.4):c.7137G>A (p.L2379=), DYNC1H1(NM_001376.5):c.7137G>A (p.L2379=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000806239" "0" "50" "14" "102482798" "102482798" "subst" "8.12117E-6" "02325" "DYNC1H1_000298" "g.102482798C>T" "" "" "" "DYNC1H1(NM_001376.5):c.7586C>T (p.A2529V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806240" "0" "30" "14" "102484902" "102484902" "subst" "2.43811E-5" "02330" "DYNC1H1_000299" "g.102484902G>A" "" "" "" "DYNC1H1(NM_001376.5):c.8292G>A (p.T2764=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806241" "0" "50" "14" "102493731" "102493731" "subst" "0" "01943" "DYNC1H1_000300" "g.102493731G>C" "" "" "" "DYNC1H1(NM_001376.4):c.8898G>C (p.K2966N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806242" "0" "50" "14" "102494085" "102494085" "subst" "1.21879E-5" "02325" "DYNC1H1_000180" "g.102494085C>T" "" "" "" "DYNC1H1(NM_001376.4):c.9178C>T (p.R3060C), DYNC1H1(NM_001376.5):c.9178C>T (p.R3060C, p.(Arg3060Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806243" "0" "30" "14" "102508427" "102508427" "subst" "8.1213E-6" "01943" "DYNC1H1_000301" "g.102508427C>T" "" "" "" "DYNC1H1(NM_001376.4):c.12180C>T (p.A4060=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806244" "0" "30" "14" "102508960" "102508960" "subst" "7.72276E-5" "02330" "DYNC1H1_000302" "g.102508960G>A" "" "" "" "DYNC1H1(NM_001376.5):c.12400-12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806245" "0" "30" "14" "102515808" "102515808" "subst" "4.87563E-5" "01943" "DYNC1H1_000303" "g.102515808G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13404G>A (p.T4468=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000832809" "0" "70" "14" "102498644" "102498644" "subst" "0" "04188" "DYNC1H1_000305" "g.102498644G>T" "" "{PMID:Ferese 2021:34354735}" "" "" "ACMG: PM1-PM2-BP4" "Unknown" "" "" "0" "" "" "g.102032307G>T" "SCV001424525" "VUS" "ACMG" "0000832810" "0" "70" "14" "102478336" "102478336" "subst" "0" "04188" "DYNC1H1_000304" "g.102478336A>G" "" "{PMID:Ferese 2021:34354735}" "" "" "ACMG: PM2-PP3" "Unknown" "" "" "0" "" "" "g.102011999A>G" "SCV001424526" "VUS" "ACMG" "0000833041" "1" "70" "14" "102499786" "102499786" "subst" "0" "00006" "DYNC1H1_000306" "g.102499786G>C" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.102033449G>C" "" "likely pathogenic" "" "0000839544" "0" "70" "14" "102431189" "102431200" "del" "0" "01164" "DYNC1H1_000307" "g.102431189_102431200del" "" "" "" "" "ACMG PS2_MOD, PM4, PM2_SUP, PP2; confirmed de novo in trio-exome" "De novo" "yes" "" "0" "" "" "g.101964852_101964863del" "" "likely pathogenic (dominant)" "ACMG" "0000847160" "0" "90" "14" "102446124" "102446124" "subst" "0" "00006" "DYNC1H1_000308" "g.102446124T>G" "" "{PMID:Thomas 2022:34085946}" "" "" "" "De novo" "" "" "0" "" "" "g.101979787T>G" "" "pathogenic" "" "0000853706" "0" "50" "14" "102452601" "102452601" "subst" "0" "02327" "DYNC1H1_000309" "g.102452601A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853707" "0" "50" "14" "102466620" "102466620" "subst" "4.06062E-6" "02325" "DYNC1H1_000310" "g.102466620C>T" "" "" "" "DYNC1H1(NM_001376.5):c.3961-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853708" "0" "50" "14" "102493789" "102493789" "subst" "0" "01943" "DYNC1H1_000312" "g.102493789A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8956A>G (p.K2986E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853709" "0" "30" "14" "102500646" "102500646" "subst" "1.62427E-5" "02326" "DYNC1H1_000281" "g.102500646C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10627-16C>T, DYNC1H1(NM_001376.5):c.10627-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863428" "0" "30" "14" "102471434" "102471434" "subst" "0.000121824" "01943" "DYNC1H1_000311" "g.102471434C>T" "" "" "" "DYNC1H1(NM_001376.4):c.5294C>T (p.A1765V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000873499" "0" "70" "14" "102510730" "102510730" "subst" "1.2185E-5" "00000" "DYNC1H1_000313" "g.102510730C>T" "141" "{PMID:Sun 2018:30076350}" "" "MPZ (NM_000530.6):c.286A>C(p.K96Q);DYNC1H1(NM_001376.4):c.12804C>T(p.F4268F)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.102044393C>T" "" "likely pathogenic" "" "0000874410" "0" "30" "14" "102446205" "102446205" "subst" "8.93401E-5" "01164" "DYNC1H1_000011" "g.102446205G>A" "" "PMID:29700284" "" "" "ACMG: BS2_SUP, BP4 (homozygous in unaffected)" "Germline" "" "" "0" "" "" "" "" "likely benign (dominant)" "ACMG" "0000881825" "10" "50" "14" "102505559" "102505559" "subst" "0" "00006" "DYNC1H1_000314" "g.102505559A>T" "" "{PMID:Angelozzi 2022:35232796}" "" "(Ser3910Cys)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000891577" "0" "30" "14" "102442261" "102442261" "dup" "0" "02326" "DYNC1H1_000315" "g.102442261dup" "" "" "" "DYNC1H1(NM_001376.4):c.344+125dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891578" "0" "10" "14" "102445607" "102445607" "subst" "0.139184" "02326" "DYNC1H1_000316" "g.102445607T>C" "" "" "" "DYNC1H1(NM_001376.4):c.345-49T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891579" "0" "10" "14" "102449341" "102449341" "dup" "0" "02326" "DYNC1H1_000014" "g.102449341dup" "" "" "" "DYNC1H1(NM_001376.4):c.962-15dupT, DYNC1H1(NM_001376.5):c.962-15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891580" "0" "10" "14" "102451983" "102451983" "subst" "0.157034" "02326" "DYNC1H1_000317" "g.102451983G>A" "" "" "" "DYNC1H1(NM_001376.4):c.1462-41G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891581" "0" "30" "14" "102452473" "102452473" "subst" "2.0313E-5" "02326" "DYNC1H1_000318" "g.102452473C>T" "" "" "" "DYNC1H1(NM_001376.4):c.1911C>T (p.H637=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891582" "0" "10" "14" "102454115" "102454115" "subst" "0" "02326" "DYNC1H1_000319" "g.102454115A>G" "" "" "" "DYNC1H1(NM_001376.4):c.2718+146A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891583" "0" "10" "14" "102454933" "102454933" "subst" "0" "02326" "DYNC1H1_000320" "g.102454933C>A" "" "" "" "DYNC1H1(NM_001376.4):c.2719-107C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891584" "0" "10" "14" "102457817" "102457817" "subst" "0.15952" "02326" "DYNC1H1_000321" "g.102457817T>A" "" "" "" "DYNC1H1(NM_001376.4):c.2869-47T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891585" "0" "90" "14" "102461131" "102461131" "subst" "0" "02327" "DYNC1H1_000253" "g.102461131T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000891586" "0" "10" "14" "102461209" "102461209" "subst" "0.14028" "02326" "DYNC1H1_000322" "g.102461209A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3333+23A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891587" "0" "30" "14" "102461319" "102461319" "subst" "2.03049E-5" "02325" "DYNC1H1_000323" "g.102461319T>C" "" "" "" "DYNC1H1(NM_001376.5):c.3334-4T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891588" "0" "10" "14" "102463407" "102463407" "subst" "0.140248" "02326" "DYNC1H1_000033" "g.102463407A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3600A>G (p.Q1200=), DYNC1H1(NM_001376.5):c.3600A>G (p.Q1200=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891589" "0" "50" "14" "102463573" "102463573" "subst" "4.06762E-6" "02330" "DYNC1H1_000324" "g.102463573G>A" "" "" "" "DYNC1H1(NM_001376.5):c.3766G>A (p.D1256N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891590" "0" "10" "14" "102466178" "102466178" "subst" "0" "02326" "DYNC1H1_000325" "g.102466178A>G" "" "" "" "DYNC1H1(NM_001376.4):c.3805-148A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891591" "0" "10" "14" "102466253" "102466253" "subst" "0" "02326" "DYNC1H1_000326" "g.102466253C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3805-73C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891592" "0" "30" "14" "102466928" "102466928" "del" "0" "02326" "DYNC1H1_000327" "g.102466928del" "" "" "" "DYNC1H1(NM_001376.4):c.4074+192delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891593" "0" "10" "14" "102467847" "102467847" "subst" "0.172109" "02326" "DYNC1H1_000328" "g.102467847A>G" "" "" "" "DYNC1H1(NM_001376.4):c.4396-25A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891594" "0" "10" "14" "102470762" "102470762" "subst" "0" "02326" "DYNC1H1_000329" "g.102470762G>C" "" "" "" "DYNC1H1(NM_001376.4):c.4884-93G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891595" "0" "30" "14" "102471027" "102471027" "subst" "1.2186E-5" "02330" "DYNC1H1_000330" "g.102471027T>C" "" "" "" "DYNC1H1(NM_001376.5):c.5049+7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891597" "0" "10" "14" "102474286" "102474286" "subst" "0" "02326" "DYNC1H1_000332" "g.102474286G>C" "" "" "" "DYNC1H1(NM_001376.4):c.5818-229G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891598" "0" "90" "14" "102474581" "102474581" "subst" "0" "02325" "DYNC1H1_000333" "g.102474581C>T" "" "" "" "DYNC1H1(NM_001376.5):c.5884C>T (p.R1962C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000891599" "0" "70" "14" "102476659" "102476659" "subst" "0" "02327" "DYNC1H1_000334" "g.102476659C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000891600" "0" "70" "14" "102476662" "102476662" "subst" "0" "02325" "DYNC1H1_000335" "g.102476662C>T" "" "" "" "DYNC1H1(NM_001376.5):c.6271C>T (p.R2091W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000891601" "0" "70" "14" "102476663" "102476663" "subst" "0" "02329" "DYNC1H1_000336" "g.102476663G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6272G>A (p.R2091Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000891602" "0" "30" "14" "102476742" "102476742" "subst" "0" "02330" "DYNC1H1_000337" "g.102476742A>G" "" "" "" "DYNC1H1(NM_001376.5):c.6351A>G (p.E2117=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891603" "0" "50" "14" "102478269" "102478269" "subst" "0" "02327" "DYNC1H1_000338" "g.102478269T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891604" "0" "30" "14" "102478678" "102478678" "subst" "4.06068E-6" "02330" "DYNC1H1_000339" "g.102478678G>T" "" "" "" "DYNC1H1(NM_001376.5):c.6885G>T (p.L2295=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891605" "0" "30" "14" "102481634" "102481634" "subst" "3.25797E-5" "02325" "DYNC1H1_000340" "g.102481634G>A" "" "" "" "DYNC1H1(NM_001376.5):c.7207G>A (p.D2403N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891606" "0" "10" "14" "102483882" "102483885" "dup" "0" "02326" "DYNC1H1_000341" "g.102483882_102483885dup" "" "" "" "DYNC1H1(NM_001376.4):c.8177+41_8177+44dupAGCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891607" "0" "70" "14" "102484930" "102484930" "subst" "0" "02329" "DYNC1H1_000342" "g.102484930G>C" "" "" "" "DYNC1H1(NM_001376.5):c.8320G>C (p.V2774L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000891608" "0" "10" "14" "102485055" "102485055" "del" "0" "02326" "DYNC1H1_000343" "g.102485055del" "" "" "" "DYNC1H1(NM_001376.4):c.8343+102delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891609" "0" "10" "14" "102486200" "102486200" "subst" "0.169994" "02326" "DYNC1H1_000344" "g.102486200G>A" "" "" "" "DYNC1H1(NM_001376.4):c.8344-30G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891610" "0" "10" "14" "102493761" "102493761" "subst" "0.137369" "02326" "DYNC1H1_000067" "g.102493761A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8928A>G (p.L2976=), DYNC1H1(NM_001376.5):c.8928A>G (p.L2976=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891611" "0" "30" "14" "102494000" "102494000" "subst" "7.31321E-5" "02326" "DYNC1H1_000345" "g.102494000G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9093G>A (p.T3031=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891612" "0" "50" "14" "102494085" "102494085" "subst" "1.21879E-5" "02327" "DYNC1H1_000180" "g.102494085C>T" "" "" "" "DYNC1H1(NM_001376.4):c.9178C>T (p.R3060C), DYNC1H1(NM_001376.5):c.9178C>T (p.R3060C, p.(Arg3060Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891613" "0" "70" "14" "102494154" "102494154" "subst" "0" "02327" "DYNC1H1_000346" "g.102494154C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000891614" "0" "10" "14" "102494586" "102494586" "subst" "0" "02326" "DYNC1H1_000347" "g.102494586T>C" "" "" "" "DYNC1H1(NM_001376.4):c.9468+108T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891615" "0" "30" "14" "102495938" "102495938" "subst" "4.46755E-5" "02330" "DYNC1H1_000348" "g.102495938G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9531G>A (p.L3177=), DYNC1H1(NM_001376.5):c.9531G>A (p.L3177=, p.(Leu3177=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891616" "0" "10" "14" "102496352" "102496352" "subst" "0" "02326" "DYNC1H1_000349" "g.102496352C>A" "" "" "" "DYNC1H1(NM_001376.4):c.9762+77C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891617" "0" "10" "14" "102496413" "102496414" "del" "0" "02326" "DYNC1H1_000350" "g.102496413_102496414del" "" "" "" "DYNC1H1(NM_001376.4):c.9763-86_9763-85delGT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891618" "0" "10" "14" "102498510" "102498510" "subst" "0" "02326" "DYNC1H1_000351" "g.102498510A>G" "" "" "" "DYNC1H1(NM_001376.4):c.9884-99A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891619" "0" "50" "14" "102499490" "102499490" "subst" "0" "02327" "DYNC1H1_000352" "g.102499490G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891620" "0" "50" "14" "102499646" "102499646" "subst" "4.06078E-6" "02327" "DYNC1H1_000353" "g.102499646G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891621" "0" "10" "14" "102499914" "102499914" "subst" "0" "02326" "DYNC1H1_000354" "g.102499914G>A" "" "" "" "DYNC1H1(NM_001376.4):c.10413+93G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891622" "0" "30" "14" "102502958" "102502958" "subst" "0.000292364" "02326" "DYNC1H1_000079" "g.102502958C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10887C>T (p.F3629=), DYNC1H1(NM_001376.5):c.10887C>T (p.F3629=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891623" "0" "10" "14" "102504838" "102504838" "subst" "0.0681829" "02326" "DYNC1H1_000080" "g.102504838C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10950C>T (p.N3650=), DYNC1H1(NM_001376.5):c.10950C>T (p.N3650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891624" "0" "10" "14" "102505263" "102505263" "del" "0" "02326" "DYNC1H1_000355" "g.102505263del" "" "" "" "DYNC1H1(NM_001376.4):c.11207-75delC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891626" "0" "10" "14" "102506569" "102506569" "subst" "0.000190871" "02325" "DYNC1H1_000357" "g.102506569G>T" "" "" "" "DYNC1H1(NM_001376.5):c.11691-4G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891627" "0" "10" "14" "102509953" "102509953" "subst" "0" "02326" "DYNC1H1_000358" "g.102509953G>C" "" "" "" "DYNC1H1(NM_001376.4):c.12514-259G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891628" "0" "10" "14" "102510863" "102510863" "subst" "0.0658824" "02326" "DYNC1H1_000359" "g.102510863G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12902+35G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891629" "0" "10" "14" "102510874" "102510874" "subst" "0.253216" "02326" "DYNC1H1_000360" "g.102510874G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12902+46G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891630" "0" "10" "14" "102511086" "102511113" "del" "0" "02326" "DYNC1H1_000361" "g.102511086_102511113del" "" "" "" "DYNC1H1(NM_001376.4):c.13006+51_13006+78delTCACGCGGGGTGGGTGGCGAGGGTCCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891631" "0" "30" "14" "102514000" "102514001" "del" "0" "02326" "DYNC1H1_000362" "g.102514000_102514001del" "" "" "" "DYNC1H1(NM_001376.4):c.13007-154_13007-153delAT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891632" "0" "10" "14" "102514227" "102514227" "subst" "0.223244" "02326" "DYNC1H1_000099" "g.102514227T>C" "" "" "" "DYNC1H1(NM_001376.4):c.13080T>C (p.T4360=), DYNC1H1(NM_001376.5):c.13080T>C (p.T4360=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891633" "0" "10" "14" "102514713" "102514713" "subst" "0" "02326" "DYNC1H1_000363" "g.102514713G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13219-140G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891634" "0" "10" "14" "102515015" "102515015" "subst" "0.221516" "02326" "DYNC1H1_000103" "g.102515015G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13372+9G>A, DYNC1H1(NM_001376.5):c.13372+9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000891635" "0" "30" "14" "102515026" "102515026" "subst" "0" "02326" "DYNC1H1_000232" "g.102515026C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13372+20C>T, DYNC1H1(NM_001376.5):c.13372+20C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891636" "0" "50" "14" "102516060" "102516060" "subst" "0" "02329" "DYNC1H1_000364" "g.102516060G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13525G>A (p.V4509M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891637" "0" "50" "14" "102516480" "102516480" "subst" "8.12163E-6" "02329" "DYNC1H1_000241" "g.102516480C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13757C>T (p.P4586L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891638" "0" "50" "14" "102516530" "102516530" "subst" "0" "02325" "DYNC1H1_000365" "g.102516530A>G" "" "" "" "DYNC1H1(NM_001376.5):c.13807A>G (p.S4603G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914121" "0" "10" "14" "102449567" "102449567" "subst" "0.000381887" "02330" "DYNC1H1_000366" "g.102449567A>G" "" "" "" "DYNC1H1(NM_001376.4):c.1173A>G (p.Q391=), DYNC1H1(NM_001376.5):c.1173A>G (p.Q391=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914122" "0" "50" "14" "102452240" "102452240" "subst" "0" "02330" "DYNC1H1_000367" "g.102452240G>T" "" "" "" "DYNC1H1(NM_001376.5):c.1678G>T (p.V560L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914123" "0" "90" "14" "102452354" "102452354" "subst" "0" "02326" "DYNC1H1_000245" "g.102452354C>T" "" "" "" "DYNC1H1(NM_001376.4):c.1792C>T (p.R598C), DYNC1H1(NM_001376.5):c.1792C>T (p.(Arg598Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000914124" "0" "50" "14" "102482391" "102482391" "subst" "1.23016E-5" "02325" "DYNC1H1_000141" "g.102482391A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7441A>G (p.M2481V), DYNC1H1(NM_001376.5):c.7441A>G (p.M2481V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914125" "0" "10" "14" "102489229" "102489229" "subst" "0.000199091" "02330" "DYNC1H1_000368" "g.102489229G>A" "" "" "" "DYNC1H1(NM_001376.5):c.8637+12G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914126" "0" "50" "14" "102494175" "102494175" "subst" "4.47049E-5" "02330" "DYNC1H1_000233" "g.102494175G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9263+5G>A (p.?), DYNC1H1(NM_001376.5):c.9263+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914127" "0" "30" "14" "102500421" "102500421" "subst" "0.000166565" "02326" "DYNC1H1_000186" "g.102500421C>A" "" "" "" "DYNC1H1(NM_001376.4):c.10522C>A (p.L3508I), DYNC1H1(NM_001376.5):c.10522C>A (p.L3508I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914128" "0" "50" "14" "102506966" "102506966" "subst" "0" "02329" "DYNC1H1_000369" "g.102506966C>T" "" "" "" "DYNC1H1(NM_001376.5):c.11897C>T (p.P3966L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000914129" "0" "30" "14" "102510671" "102510671" "subst" "3.65592E-5" "02325" "DYNC1H1_000370" "g.102510671C>G" "" "" "" "DYNC1H1(NM_001376.5):c.12745C>G (p.Q4249E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000914130" "0" "10" "14" "102516035" "102516035" "subst" "0.00154004" "02330" "DYNC1H1_000371" "g.102516035C>T" "" "" "" "DYNC1H1(NM_001376.5):c.13516-16C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000914131" "0" "10" "14" "102516487" "102516487" "subst" "0.00108423" "02330" "DYNC1H1_000106" "g.102516487G>A" "" "" "" "DYNC1H1(NM_001376.4):c.13764G>A (p.T4588=), DYNC1H1(NM_001376.5):c.13764G>A (p.T4588=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000917012" "0" "70" "14" "102452268" "102452268" "subst" "0" "03779" "DYNC1H1_000372" "g.102452268G>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000918584" "0" "90" "14" "102452564" "102452564" "subst" "4.06412E-6" "01602" "DYNC1H1_000374" "g.102452564G>A" "" "" "" "" "" "Unknown" "" "rs1406149790" "" "" "" "" "" "pathogenic" "ACMG" "0000919578" "0" "90" "14" "102452354" "102452354" "subst" "0" "01164" "DYNC1H1_000245" "g.102452354C>T" "" "PMID: 25484024, 25497877, 25512093, 27549087, 28554554" "" "" "ACMG: PS4, PM5, PP3_MOD, PS3_SUP, PM2_SUP, PP1" "Germline" "?" "" "" "" "" "" "VCV000139652.16" "pathogenic (dominant)" "ACMG" "0000921051" "11" "70" "14" "102481486" "102481486" "subst" "0" "03544" "DYNC1H1_000373" "g.102481486G>C" "" "" "" "" "mosaic ~0.15 in sligthly affected father" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (paternal)" "ACMG" "0000925824" "0" "50" "14" "102442054" "102442054" "subst" "0" "02330" "DYNC1H1_000375" "g.102442054G>A" "" "" "" "DYNC1H1(NM_001376.5):c.262G>A (p.V88I, p.(Val88Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000925825" "0" "30" "14" "102471388" "102471388" "subst" "5.68588E-5" "02326" "DYNC1H1_000125" "g.102471388G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5248G>A (p.V1750M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925826" "0" "50" "14" "102476696" "102476696" "subst" "0" "01804" "DYNC1H1_000376" "g.102476696A>G" "" "" "" "DYNC1H1(NM_001376.4):c.6305A>G (p.(Asn2102Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000925827" "0" "30" "14" "102486364" "102486364" "subst" "0.00019086" "02326" "DYNC1H1_000064" "g.102486364A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8478A>G (p.A2826=), DYNC1H1(NM_001376.5):c.8478A>G (p.A2826=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925828" "0" "30" "14" "102486394" "102486394" "subst" "0" "02327" "DYNC1H1_000377" "g.102486394G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925829" "0" "30" "14" "102500341" "102500341" "subst" "0" "02327" "DYNC1H1_000378" "g.102500341G>A" "" "" "" "DYNC1H1(NM_001376.5):c.10442G>A (p.(Ser3481Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925830" "0" "30" "14" "102509052" "102509052" "subst" "1.21838E-5" "02330" "DYNC1H1_000379" "g.102509052G>A" "" "" "" "DYNC1H1(NM_001376.5):c.12480G>A (p.T4160=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930258" "0" "30" "14" "102442034" "102442037" "del" "0" "02330" "DYNC1H1_000380" "g.102442034_102442037del" "" "" "" "DYNC1H1(NM_001376.5):c.257-15_257-12delTATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000930259" "0" "50" "14" "102463555" "102463555" "subst" "4.06521E-6" "02325" "DYNC1H1_000381" "g.102463555G>T" "" "" "" "DYNC1H1(NM_001376.5):c.3748G>T (p.V1250L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000930260" "0" "30" "14" "102504786" "102504786" "subst" "4.87472E-5" "02330" "DYNC1H1_000382" "g.102504786G>A" "" "" "" "DYNC1H1(NM_001376.5):c.10909-11G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000939802" "0" "70" "14" "102446124" "102446124" "subst" "0" "00006" "DYNC1H1_000308" "g.102446124T>G" "" "{PMID:Nambot 2018:29095811}" "" "" "" "De novo" "" "" "0" "" "" "g.101979787T>G" "" "likely pathogenic (dominant)" "" "0000945998" "0" "90" "14" "102495925" "102495925" "subst" "0" "00006" "DYNC1H1_000132" "g.102495925C>G" "" "{PMID:Westra 2019:31127727}" "" "" "" "De novo" "" "" "0" "" "" "g.102029588C>G" "" "pathogenic (dominant)" "" "0000945999" "0" "90" "14" "102452396" "102452396" "subst" "0" "00006" "DYNC1H1_000113" "g.102452396G>A" "" "{PMID:Westra 2019:31127727}" "" "" "" "De novo" "" "" "0" "" "" "g.101986059G>A" "" "pathogenic (dominant)" "" "0000946088" "0" "50" "14" "102445718" "102445718" "subst" "1.62437E-5" "00006" "DYNC1H1_000383" "g.102445718G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.101979381G>A" "" "VUS" "" "0000946089" "0" "50" "14" "102452525" "102452525" "subst" "2.03227E-5" "00006" "DYNC1H1_000114" "g.102452525G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.101986188G>A" "" "VUS" "" "0000946114" "0" "50" "14" "102457861" "102457861" "subst" "1.62521E-5" "00006" "DYNC1H1_000384" "g.102457861C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.101991524C>T" "" "VUS" "" "0000946115" "0" "50" "14" "102509068" "102509068" "subst" "2.84331E-5" "00006" "DYNC1H1_000137" "g.102509068G>A" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.102042731G>A" "" "VUS" "" "0000946143" "11" "30" "14" "102478356" "102478356" "subst" "4.46708E-5" "00006" "DYNC1H1_000053" "g.102478356G>A" "" "{PMID:Westra 2019:31127727}" "" "" "present in healthy father" "Germline" "" "" "0" "" "" "g.102012019G>A" "" "likely benign" "" "0000946190" "0" "50" "14" "102467693" "102467693" "subst" "0.000605199" "00006" "DYNC1H1_000385" "g.102467693C>T" "" "{PMID:Westra 2019:31127727}" "" "" "no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.102001356C>T" "" "VUS" "" "0000950188" "0" "30" "14" "102446038" "102446038" "subst" "0.00011001" "02326" "DYNC1H1_000291" "g.102446038T>C" "" "" "" "DYNC1H1(NM_001376.4):c.519-18T>C, DYNC1H1(NM_001376.5):c.519-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950189" "0" "30" "14" "102449352" "102449352" "subst" "8.13544E-6" "02330" "DYNC1H1_000292" "g.102449352A>G" "" "" "" "DYNC1H1(NM_001376.4):c.962-4A>G, DYNC1H1(NM_001376.5):c.962-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950190" "0" "50" "14" "102452805" "102452805" "subst" "0" "02330" "DYNC1H1_000386" "g.102452805A>G" "" "" "" "DYNC1H1(NM_001376.5):c.2243A>G (p.K748R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950191" "0" "30" "14" "102463566" "102463566" "subst" "3.65916E-5" "02330" "DYNC1H1_000294" "g.102463566C>T" "" "" "" "DYNC1H1(NM_001376.4):c.3759C>T (p.R1253=), DYNC1H1(NM_001376.5):c.3759C>T (p.R1253=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000950192" "0" "10" "14" "102470972" "102470972" "subst" "0.00199001" "02330" "DYNC1H1_000387" "g.102470972C>T" "" "" "" "DYNC1H1(NM_001376.5):c.5001C>T (p.N1667=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000950193" "0" "50" "14" "102478440" "102478440" "subst" "2.43734E-5" "02325" "DYNC1H1_000388" "g.102478440G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6847G>A (p.V2283M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950194" "0" "50" "14" "102510249" "102510249" "subst" "0" "02325" "DYNC1H1_000389" "g.102510249C>G" "" "" "" "DYNC1H1(NM_001376.5):c.12551C>G (p.A4184G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950195" "0" "50" "14" "102510318" "102510318" "subst" "0" "02325" "DYNC1H1_000390" "g.102510318T>C" "" "" "" "DYNC1H1(NM_001376.5):c.12620T>C (p.F4207S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000950196" "0" "30" "14" "102514328" "102514328" "subst" "0.000245918" "02325" "DYNC1H1_000230" "g.102514328C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13181C>T (p.T4394M), DYNC1H1(NM_001376.5):c.13181C>T (p.T4394M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000967362" "0" "50" "14" "102431055" "102431055" "subst" "0" "02325" "DYNC1H1_000391" "g.102431055C>T" "" "" "" "DYNC1H1(NM_001376.5):c.27C>T (p.G9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000967364" "0" "30" "14" "102449567" "102449567" "subst" "0.000381887" "02326" "DYNC1H1_000366" "g.102449567A>G" "" "" "" "DYNC1H1(NM_001376.4):c.1173A>G (p.Q391=), DYNC1H1(NM_001376.5):c.1173A>G (p.Q391=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000967374" "0" "30" "14" "102499611" "102499611" "subst" "4.46682E-5" "02326" "DYNC1H1_000183" "g.102499611C>T" "" "" "" "DYNC1H1(NM_001376.4):c.10203C>T (p.N3401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000967381" "0" "30" "14" "102514296" "102514296" "subst" "0.000204123" "02326" "DYNC1H1_000393" "g.102514296C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13149C>T (p.T4383=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000967382" "0" "30" "14" "102514993" "102514993" "subst" "0.000121872" "02326" "DYNC1H1_000394" "g.102514993C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13359C>T (p.N4453=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980733" "0" "30" "14" "102449611" "102449611" "subst" "4.06616E-6" "01804" "DYNC1H1_000396" "g.102449611A>T" "" "" "" "DYNC1H1(NM_001376.5):c.1217A>T (p.(Tyr406Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980734" "0" "30" "14" "102460669" "102460669" "subst" "0" "01804" "DYNC1H1_000397" "g.102460669A>T" "" "" "" "DYNC1H1(NM_001376.5):c.3156+8A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980735" "0" "50" "14" "102467585" "102467585" "subst" "0" "01804" "DYNC1H1_000398" "g.102467585C>T" "" "" "" "DYNC1H1(NM_001376.5):c.4289C>T (p.(Thr1430Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980736" "0" "50" "14" "102470997" "102470997" "subst" "0" "02325" "DYNC1H1_000399" "g.102470997A>G" "" "" "" "DYNC1H1(NM_001376.5):c.5026A>G (p.I1676V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980737" "0" "50" "14" "102477281" "102477281" "subst" "0" "02325" "DYNC1H1_000400" "g.102477281G>T" "" "" "" "DYNC1H1(NM_001376.5):c.6610G>T (p.V2204F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980738" "0" "50" "14" "102482397" "102482397" "subst" "0" "02330" "DYNC1H1_000401" "g.102482397A>G" "" "" "" "DYNC1H1(NM_001376.5):c.7447A>G (p.I2483V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980739" "0" "50" "14" "102483596" "102483596" "subst" "0" "02330" "DYNC1H1_000402" "g.102483596T>C" "" "" "" "DYNC1H1(NM_001376.5):c.8020T>C (p.Y2674H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000980740" "0" "30" "14" "102495938" "102495938" "subst" "4.46755E-5" "01804" "DYNC1H1_000348" "g.102495938G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9531G>A (p.L3177=), DYNC1H1(NM_001376.5):c.9531G>A (p.L3177=, p.(Leu3177=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980741" "0" "70" "14" "102499494" "102499494" "subst" "0" "02327" "DYNC1H1_000403" "g.102499494C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000980742" "0" "30" "14" "102500799" "102500799" "subst" "1.21852E-5" "01804" "DYNC1H1_000404" "g.102500799C>T" "" "" "" "DYNC1H1(NM_001376.5):c.10754+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000980743" "0" "70" "14" "102505063" "102505063" "subst" "0" "01804" "DYNC1H1_000405" "g.102505063G>A" "" "" "" "DYNC1H1(NM_001376.5):c.11084G>A (p.(Arg3695Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000980744" "0" "50" "14" "102505454" "102505454" "subst" "0" "01804" "DYNC1H1_000406" "g.102505454A>G" "" "" "" "DYNC1H1(NM_001376.5):c.11323A>G (p.(Arg3775Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000663" "0" "50" "14" "102445810" "102445810" "subst" "0" "01804" "DYNC1H1_000407" "g.102445810G>A" "" "" "" "DYNC1H1(NM_001376.4):c.499G>A (p.(Glu167Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000664" "0" "70" "14" "102446820" "102446822" "del" "0" "01804" "DYNC1H1_000408" "g.102446820_102446822del" "" "" "" "DYNC1H1(NM_001376.4):c.894_896delCCT (p.(Leu299del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001000665" "0" "50" "14" "102452379" "102452379" "subst" "0" "02327" "DYNC1H1_000152" "g.102452379C>T" "" "" "" "DYNC1H1(NM_001376.4):c.1817C>T (p.(Thr606Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000666" "0" "50" "14" "102452405" "102452405" "subst" "0" "01804" "DYNC1H1_000020" "g.102452405G>A" "" "" "" "DYNC1H1(NM_001376.4):c.1843G>A (p.D615N, p.(Asp615Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000667" "0" "30" "14" "102452915" "102452915" "subst" "4.87325E-5" "02325" "DYNC1H1_000409" "g.102452915G>A" "" "" "" "DYNC1H1(NM_001376.5):c.2353G>A (p.V785I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000668" "0" "30" "14" "102457919" "102457919" "subst" "0" "01804" "DYNC1H1_000410" "g.102457919T>C" "" "" "" "DYNC1H1(NM_001376.4):c.2924T>C (p.(Ile975Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000669" "0" "50" "14" "102466366" "102466366" "subst" "0" "01804" "DYNC1H1_000411" "g.102466366T>G" "" "" "" "DYNC1H1(NM_001376.4):c.3845T>G (p.(Ile1282Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000670" "0" "50" "14" "102470973" "102470973" "subst" "4.06128E-6" "02330" "DYNC1H1_000123" "g.102470973G>A" "" "" "" "DYNC1H1(NM_001376.5):c.5002G>A (p.E1668K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000671" "0" "50" "14" "102472508" "102472508" "subst" "0" "01804" "DYNC1H1_000412" "g.102472508G>T" "" "" "" "DYNC1H1(NM_001376.4):c.5716+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000672" "0" "50" "14" "102482412" "102482412" "subst" "0" "01804" "DYNC1H1_000413" "g.102482412C>T" "" "" "" "DYNC1H1(NM_001376.4):c.7462C>T (p.(Arg2488Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000673" "0" "50" "14" "102493781" "102493781" "subst" "0" "02327" "DYNC1H1_000414" "g.102493781C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000674" "0" "50" "14" "102496601" "102496601" "subst" "0" "01804" "DYNC1H1_000415" "g.102496601G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9865G>A (p.(Val3289Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000675" "0" "50" "14" "102506003" "102506003" "subst" "0" "01804" "DYNC1H1_000416" "g.102506003T>C" "" "" "" "DYNC1H1(NM_001376.4):c.11624T>C (p.(Met3875Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000676" "0" "50" "14" "102506939" "102506939" "subst" "0" "01804" "DYNC1H1_000417" "g.102506939T>C" "" "" "" "DYNC1H1(NM_001376.4):c.11870T>C (p.(Phe3957Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001000677" "0" "30" "14" "102509068" "102509068" "subst" "2.84331E-5" "01804" "DYNC1H1_000137" "g.102509068G>A" "" "" "" "DYNC1H1(NM_001376.4):c.12496G>A (p.(Val4166Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000678" "0" "30" "14" "102514992" "102514992" "subst" "0" "01804" "DYNC1H1_000418" "g.102514992A>G" "" "" "" "DYNC1H1(NM_001376.4):c.13358A>G (p.(Asn4453Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000679" "0" "30" "14" "102516429" "102516429" "subst" "8.12176E-6" "01804" "DYNC1H1_000419" "g.102516429C>T" "" "" "" "DYNC1H1(NM_001376.4):c.13706C>T (p.(Thr4569Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001000680" "0" "30" "14" "102516473" "102516473" "subst" "8.12189E-6" "01804" "DYNC1H1_000420" "g.102516473G>T" "" "" "" "DYNC1H1(NM_001376.4):c.13750G>T (p.(Ala4584Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015099" "0" "30" "14" "102431016" "102431016" "subst" "3.07122E-5" "02330" "DYNC1H1_000421" "g.102431016C>G" "" "" "" "DYNC1H1(NM_001376.5):c.-13C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015100" "0" "10" "14" "102476436" "102476436" "subst" "0.00302644" "02330" "DYNC1H1_000422" "g.102476436G>T" "" "" "" "DYNC1H1(NM_001376.5):c.6221+13G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001015101" "0" "50" "14" "102482368" "102482368" "subst" "0" "02325" "DYNC1H1_000423" "g.102482368A>T" "" "" "" "DYNC1H1(NM_001376.5):c.7418A>T (p.N2473I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015102" "0" "30" "14" "102492904" "102492904" "subst" "3.65536E-5" "02330" "DYNC1H1_000424" "g.102492904T>C" "" "" "" "DYNC1H1(NM_001376.5):c.8638-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015103" "0" "30" "14" "102493895" "102493895" "subst" "2.03034E-5" "02326" "DYNC1H1_000425" "g.102493895G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9048+14G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015104" "0" "30" "14" "102494078" "102494078" "subst" "3.65631E-5" "02330" "DYNC1H1_000426" "g.102494078G>A" "" "" "" "DYNC1H1(NM_001376.5):c.9171G>A (p.Q3057=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015105" "0" "10" "14" "102502989" "102502989" "subst" "0.000556327" "02330" "DYNC1H1_000223" "g.102502989G>A" "" "" "" "DYNC1H1(NM_001376.4):c.10908+10G>A, DYNC1H1(NM_001376.5):c.10908+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001015106" "0" "10" "14" "102505895" "102505895" "subst" "8.52736E-5" "02330" "DYNC1H1_000427" "g.102505895T>C" "" "" "" "DYNC1H1(NM_001376.5):c.11595+12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001015107" "0" "10" "14" "102514209" "102514209" "subst" "7.72684E-5" "02330" "DYNC1H1_000428" "g.102514209C>T" "" "" "" "DYNC1H1(NM_001376.5):c.13062C>T (p.D4354=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001023418" "0" "90" "14" "102478787" "102478787" "subst" "0" "03779" "DYNC1H1_000142" "g.102478787C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs1057518961" "0" "" "" "" "" "pathogenic" "" "0001026347" "0" "70" "14" "102449596" "102449596" "subst" "0" "02329" "DYNC1H1_000429" "g.102449596T>G" "" "" "" "DYNC1H1(NM_001376.5):c.1202T>G (p.L401W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001026348" "0" "30" "14" "102482736" "102482736" "subst" "0.0164213" "01943" "DYNC1H1_000059" "g.102482736A>G" "" "" "" "DYNC1H1(NM_001376.4):c.7524A>G (p.L2508=), DYNC1H1(NM_001376.5):c.7524A>G (p.L2508=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039769" "0" "50" "14" "102431289" "102431289" "subst" "0" "01804" "DYNC1H1_000430" "g.102431289G>A" "" "" "" "DYNC1H1(NM_001376.5):c.256+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001039770" "0" "30" "14" "102452478" "102452478" "subst" "0" "01804" "DYNC1H1_000431" "g.102452478G>A" "" "" "" "DYNC1H1(NM_001376.5):c.1916G>A (p.(Arg639His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039771" "0" "30" "14" "102457598" "102457598" "subst" "0" "01804" "DYNC1H1_000432" "g.102457598G>A" "" "" "" "DYNC1H1(NM_001376.5):c.2869-266G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039772" "0" "50" "14" "102471422" "102471422" "subst" "0" "02325" "DYNC1H1_000433" "g.102471422A>G" "" "" "" "DYNC1H1(NM_001376.5):c.5282A>G (p.N1761S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001039773" "0" "30" "14" "102478388" "102478388" "subst" "3.24855E-5" "02326" "DYNC1H1_000434" "g.102478388C>T" "" "" "" "DYNC1H1(NM_001376.4):c.6795C>T (p.Y2265=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039774" "0" "10" "14" "102493523" "102493523" "subst" "0.000341108" "02330" "DYNC1H1_000066" "g.102493523A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8784A>G (p.Q2928=), DYNC1H1(NM_001376.5):c.8784A>G (p.Q2928=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001039775" "0" "30" "14" "102493523" "102493523" "subst" "0.000341108" "02326" "DYNC1H1_000066" "g.102493523A>G" "" "" "" "DYNC1H1(NM_001376.4):c.8784A>G (p.Q2928=), DYNC1H1(NM_001376.5):c.8784A>G (p.Q2928=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039776" "0" "30" "14" "102495972" "102495972" "subst" "2.03102E-5" "01804" "DYNC1H1_000435" "g.102495972G>A" "" "" "" "DYNC1H1(NM_001376.5):c.9565G>A (p.(Glu3189Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039777" "0" "50" "14" "102500341" "102500341" "subst" "0" "01804" "DYNC1H1_000378" "g.102500341G>A" "" "" "" "DYNC1H1(NM_001376.5):c.10442G>A (p.(Ser3481Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001039778" "0" "30" "14" "102506762" "102506762" "subst" "0" "02330" "DYNC1H1_000436" "g.102506762G>A" "" "" "" "DYNC1H1(NM_001376.5):c.11865+15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039779" "0" "30" "14" "102506997" "102506997" "subst" "0" "02326" "DYNC1H1_000437" "g.102506997A>G" "" "" "" "DYNC1H1(NM_001376.4):c.11928A>G (p.E3976=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001039780" "0" "50" "14" "102516183" "102516183" "subst" "0" "01804" "DYNC1H1_000438" "g.102516183G>A" "" "" "" "DYNC1H1(NM_001376.5):c.13648G>A (p.(Gly4550Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045534" "0" "70" "14" "102498755" "102498755" "subst" "0" "01164" "DYNC1H1_000439" "g.102498755C>T" "" "PMID: 29671837, 26100331, 25512093, 25609763" "" "" "ACMG: PS2-strong,PM1-moderate,PM2-supporting,PM5-moderate,PP3-moderate" "Germline/De novo (untested)" "-" "" "0" "" "" "g.102032398C>T" "VCV000996573.9" "pathogenic (dominant)" "ACMG" "0001045540" "0" "70" "14" "102500335" "102500335" "subst" "0" "01164" "DYNC1H1_000440" "g.102500335T>C" "" "" "" "" "ACMG: PS2-moderate,PS4-supporting,PM2-supporting,PP2-supporting,PP3-moderate" "De novo" "-" "" "0" "" "" "g.102033998T>C" "VCV002632640.2" "likely pathogenic (dominant)" "ACMG" "0001046456" "0" "30" "14" "102446146" "102446146" "subst" "1.21874E-5" "02326" "DYNC1H1_000441" "g.102446146G>A" "" "" "" "DYNC1H1(NM_001376.4):c.609G>A (p.P203=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046457" "0" "30" "14" "102495938" "102495938" "subst" "4.46755E-5" "02326" "DYNC1H1_000348" "g.102495938G>A" "" "" "" "DYNC1H1(NM_001376.4):c.9531G>A (p.L3177=), DYNC1H1(NM_001376.5):c.9531G>A (p.L3177=, p.(Leu3177=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046458" "0" "50" "14" "102505475" "102505475" "subst" "0" "02325" "DYNC1H1_000442" "g.102505475A>G" "" "" "" "DYNC1H1(NM_001376.5):c.11344A>G (p.R3782G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001048414" "0" "50" "14" "102486263" "102486268" "del" "0" "01164" "DYNC1H1_000443" "g.102486263_102486268del" "" "" "" "" "ACMG: PM2-supporting,PM4-moderate,PP2-supporting,PP3-supporting" "Germline" "?" "" "0" "" "" "g.102019926_102019931del" "" "VUS (!)" "ACMG" "0001054971" "0" "50" "14" "102442054" "102442054" "subst" "0" "01804" "DYNC1H1_000375" "g.102442054G>A" "" "" "" "DYNC1H1(NM_001376.5):c.262G>A (p.V88I, p.(Val88Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054972" "0" "50" "14" "102452082" "102452082" "subst" "0" "01804" "DYNC1H1_000444" "g.102452082T>C" "" "" "" "DYNC1H1(NM_001376.5):c.1520T>C (p.(Val507Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054973" "0" "90" "14" "102452354" "102452354" "subst" "0" "01804" "DYNC1H1_000245" "g.102452354C>T" "" "" "" "DYNC1H1(NM_001376.4):c.1792C>T (p.R598C), DYNC1H1(NM_001376.5):c.1792C>T (p.(Arg598Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001054974" "0" "50" "14" "102467295" "102467295" "subst" "0" "01804" "DYNC1H1_000445" "g.102467295G>A" "" "" "" "DYNC1H1(NM_001376.5):c.4079G>A (p.(Arg1360Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054975" "0" "50" "14" "102489099" "102489099" "subst" "0" "01804" "DYNC1H1_000173" "g.102489099A>G" "" "" "" "DYNC1H1(NM_001376.5):c.8519A>G (p.D2840G, p.(Asp2840Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054976" "0" "30" "14" "102494085" "102494085" "subst" "1.21879E-5" "01804" "DYNC1H1_000180" "g.102494085C>T" "" "" "" "DYNC1H1(NM_001376.4):c.9178C>T (p.R3060C), DYNC1H1(NM_001376.5):c.9178C>T (p.R3060C, p.(Arg3060Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001058618" "0" "90" "14" "102500472" "102500472" "subst" "0" "00006" "DYNC1H1_000447" "g.102500472C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.102034135C>T" "" "pathogenic" "" "0001058619" "0" "70" "14" "102474579" "102474579" "subst" "0" "00006" "DYNC1H1_000446" "g.102474579A>G" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.102008242A>G" "" "likely pathogenic" "" "0001058620" "0" "70" "14" "102446288" "102446288" "subst" "0" "00006" "DYNC1H1_000109" "g.102446288C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.101979951C>T" "" "likely pathogenic" "" "0001062891" "0" "70" "14" "102446288" "102446288" "subst" "0" "04653" "DYNC1H1_000109" "g.102446288C>T" "" "Verebi et al. (submitted)" "" "" "" "De novo" "" "" "0" "" "" "g.101979951C>T" "" "pathogenic" "ACMG" "0001066133" "0" "70" "14" "102469030" "102469030" "subst" "0" "02325" "DYNC1H1_000448" "g.102469030C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001066134" "0" "30" "14" "102471388" "102471388" "subst" "5.68588E-5" "02325" "DYNC1H1_000125" "g.102471388G>A" "" "" "" "DYNC1H1(NM_001376.4):c.5248G>A (p.V1750M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001066135" "0" "50" "14" "102472429" "102472429" "subst" "0" "02325" "DYNC1H1_000449" "g.102472429G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066136" "0" "50" "14" "102478356" "102478356" "subst" "4.46708E-5" "02325" "DYNC1H1_000053" "g.102478356G>A" "" "" "" "DYNC1H1(NM_001376.5):c.6763G>A (p.D2255N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066137" "0" "50" "14" "102483636" "102483636" "subst" "0" "02325" "DYNC1H1_000450" "g.102483636G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066138" "0" "50" "14" "102483804" "102483804" "subst" "4.06055E-6" "02325" "DYNC1H1_000451" "g.102483804C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066139" "0" "50" "14" "102500674" "102500674" "subst" "0" "02325" "DYNC1H1_000452" "g.102500674A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066140" "0" "50" "14" "102504876" "102504876" "subst" "0" "02325" "DYNC1H1_000453" "g.102504876C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001068625" "0" "90" "14" "102452303" "102452303" "subst" "0" "00006" "DYNC1H1_000454" "g.102452303A>T" "" "{PMID:Estevez-Arias 2025:39333429}" "" "" "ACMG PS4, PM1, PP2, PM2, PP3" "De novo" "" "" "0" "" "" "g.101985966A>T" "" "pathogenic (dominant)" "" "0001069141" "0" "50" "14" "102478703" "102478703" "subst" "0" "00006" "DYNC1H1_000455" "g.102478703G>A" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PM2, PP2, PP3, 4L" "Germline" "" "" "0" "" "" "g.102012366G>A" "SCV006074887.1" "VUS" "ACMG" "0001069579" "0" "70" "14" "102500321" "102500323" "dup" "0" "00006" "DYNC1H1_000456" "g.102500321_102500323dup" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PS2, PM2, PM4" "Germline" "" "" "0" "" "" "g.102033984_102033986dup" "SCV001755189" "likely pathogenic" "ACMG" "0001069797" "0" "90" "14" "102446289" "102446289" "subst" "0" "00006" "DYNC1H1_000110" "g.102446289G>A" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PS2, PM1, PM2, PM5, PP3, PP5" "Germline" "" "" "0" "" "" "g.101979952G>A" "SCV000992237.1" "pathogenic" "ACMG" "0001069822" "0" "50" "14" "102500460" "102500460" "subst" "0" "00006" "DYNC1H1_000457" "g.102500460G>C" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PM2, PP3" "Germline" "" "" "0" "" "" "g.102034123G>C" "SCV006074888.1" "VUS" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes DYNC1H1 ## Count = 560 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000044717" "00006789" "50" "3419" "0" "3419" "0" "c.3419C>T" "r.(?)" "p.(Thr1140Met)" "14" "0000130103" "00006789" "70" "9250" "0" "9250" "0" "c.9250G>A" "r.(?)" "p.(Ala3084Thr)" "" "0000247212" "00006789" "10" "3600" "0" "3600" "0" "c.3600A>G" "r.(?)" "p.(Gln1200=)" "" "0000247213" "00006789" "10" "8928" "0" "8928" "0" "c.8928A>G" "r.(?)" "p.(Leu2976=)" "" "0000247216" "00006789" "10" "9469" "-20" "9469" "-20" "c.9469-20A>T" "r.(=)" "p.(=)" "" "0000247223" "00006789" "10" "2511" "0" "2511" "0" "c.2511A>G" "r.(?)" "p.(Ala837=)" "" "0000247244" "00006789" "10" "7524" "0" "7524" "0" "c.7524A>G" "r.(?)" "p.(Leu2508=)" "" "0000247272" "00006789" "30" "8478" "0" "8478" "0" "c.8478A>G" "r.(?)" "p.(Ala2826=)" "" "0000247273" "00006789" "30" "10608" "0" "10608" "0" "c.10608A>C" "r.(?)" "p.(Leu3536=)" "" "0000247281" "00006789" "30" "8178" "-12" "8178" "-12" "c.8178-12A>T" "r.(=)" "p.(=)" "" "0000247296" "00006789" "50" "12113" "0" "12113" "0" "c.12113A>G" "r.(?)" "p.(Asn4038Ser)" "" "0000251962" "00006789" "30" "1292" "0" "1292" "0" "c.1292A>G" "r.(?)" "p.(Gln431Arg)" "" "0000252229" "00006789" "30" "5717" "-5" "5717" "-5" "c.5717-5A>C" "r.spl?" "p.?" "" "0000253362" "00006789" "10" "3600" "0" "3600" "0" "c.3600A>G" "r.(?)" "p.(Gln1200=)" "" "0000253363" "00006789" "10" "8928" "0" "8928" "0" "c.8928A>G" "r.(?)" "p.(Leu2976=)" "" "0000253419" "00006789" "10" "9469" "-20" "9469" "-20" "c.9469-20A>T" "r.(=)" "p.(=)" "" "0000253474" "00006789" "10" "7632" "0" "7632" "0" "c.7632A>G" "r.(?)" "p.(Glu2544=)" "" "0000253591" "00006789" "10" "10182" "0" "10182" "0" "c.10182A>G" "r.(?)" "p.(Lys3394=)" "" "0000253663" "00006789" "10" "738" "0" "738" "0" "c.738A>G" "r.(?)" "p.(Gln246=)" "" "0000253875" "00006789" "10" "-5" "0" "-5" "0" "c.-5A>G" "r.(?)" "p.(=)" "" "0000254176" "00006789" "30" "2511" "0" "2511" "0" "c.2511A>G" "r.(?)" "p.(Ala837=)" "" "0000254282" "00006789" "30" "561" "0" "561" "0" "c.561A>G" "r.(?)" "p.(Ala187=)" "" "0000254725" "00006789" "30" "7441" "0" "7441" "0" "c.7441A>G" "r.(?)" "p.(Met2481Val)" "" "0000254908" "00006789" "30" "8784" "0" "8784" "0" "c.8784A>G" "r.(?)" "p.(Gln2928=)" "" "0000255288" "00006789" "30" "1461" "17" "1461" "17" "c.1461+17A>G" "r.(=)" "p.(=)" "" "0000255863" "00006789" "50" "3185" "0" "3185" "0" "c.3185A>C" "r.(?)" "p.(Asp1062Ala)" "" "0000256637" "00006789" "50" "3359" "0" "3359" "0" "c.3359A>G" "r.(?)" "p.(Tyr1120Cys)" "" "0000265757" "00006789" "30" "10065" "0" "10065" "0" "c.10065T>C" "r.(?)" "p.(Ser3355=)" "" "0000265758" "00006789" "10" "10887" "0" "10887" "0" "c.10887C>T" "r.(?)" "p.(Phe3629=)" "" "0000265759" "00006789" "10" "10950" "0" "10950" "0" "c.10950C>T" "r.(?)" "p.(Asn3650=)" "" "0000265760" "00006789" "30" "11942" "0" "11942" "0" "c.11942C>G" "r.(?)" "p.(Thr3981Arg)" "" "0000265761" "00006789" "10" "12087" "0" "12087" "0" "c.12087C>A" "r.(?)" "p.(His4029Gln)" "" "0000265763" "00006789" "10" "13080" "0" "13080" "0" "c.13080T>C" "r.(?)" "p.(Thr4360=)" "" "0000265764" "00006789" "10" "13372" "9" "13372" "9" "c.13372+9G>A" "r.(=)" "p.(=)" "" "0000265766" "00006789" "10" "2001" "0" "2001" "0" "c.2001T>C" "r.(?)" "p.(Asp667=)" "" "0000265768" "00006789" "10" "3015" "18" "3015" "18" "c.3015+18C>T" "r.(=)" "p.(=)" "" "0000265769" "00006789" "10" "3909" "0" "3909" "0" "c.3909G>A" "r.(?)" "p.(Ala1303=)" "" "0000265770" "00006789" "30" "4395" "19" "4395" "19" "c.4395+19C>T" "r.(=)" "p.(=)" "" "0000265771" "00006789" "10" "4533" "0" "4533" "0" "c.4533G>A" "r.(?)" "p.(Pro1511=)" "" "0000265772" "00006789" "10" "5298" "0" "5298" "0" "c.5298G>T" "r.(?)" "p.(Leu1766=)" "" "0000265773" "00006789" "50" "5971" "0" "5971" "0" "c.5971G>A" "r.(?)" "p.(Asp1991Asn)" "" "0000265774" "00006789" "10" "624" "0" "624" "0" "c.624G>A" "r.(?)" "p.(Pro208=)" "" "0000265775" "00006789" "50" "6763" "0" "6763" "0" "c.6763G>A" "r.(?)" "p.(Asp2255Asn)" "" "0000265776" "00006789" "10" "7449" "0" "7449" "0" "c.7449C>T" "r.(?)" "p.(Ile2483=)" "" "0000265777" "00006789" "30" "7458" "0" "7458" "0" "c.7458G>T" "r.(?)" "p.(Leu2486=)" "" "0000265778" "00006789" "50" "7846" "0" "7846" "0" "c.7846G>A" "r.(?)" "p.(Glu2616Lys)" "" "0000267723" "00006789" "30" "7458" "0" "7458" "0" "c.7458G>T" "r.(?)" "p.(Leu2486=)" "" "0000267724" "00006789" "30" "962" "-15" "962" "-15" "c.962-15dup" "r.(=)" "p.(=)" "" "0000271038" "00006789" "30" "10414" "-15" "10414" "-15" "c.10414-15C>T" "r.(=)" "p.(=)" "" "0000271039" "00006789" "30" "11942" "0" "11942" "0" "c.11942C>G" "r.(?)" "p.(Thr3981Arg)" "" "0000271040" "00006789" "90" "2327" "0" "2327" "0" "c.2327C>T" "r.(?)" "p.(Pro776Leu)" "" "0000271041" "00006789" "30" "2719" "-6" "2719" "-6" "c.2719-6C>T" "r.(=)" "p.(=)" "" "0000271042" "00006789" "30" "345" "-10" "345" "-10" "c.345-10T>G" "r.(=)" "p.(=)" "" "0000271043" "00006789" "70" "8930" "0" "8930" "0" "c.8930G>A" "r.(?)" "p.(Arg2977Gln)" "" "0000275768" "00006789" "30" "10065" "0" "10065" "0" "c.10065T>C" "r.(?)" "p.(Ser3355=)" "" "0000275769" "00006789" "30" "10650" "0" "10650" "0" "c.10650G>A" "r.(?)" "p.(Thr3550=)" "" "0000275770" "00006789" "30" "10887" "0" "10887" "0" "c.10887C>T" "r.(?)" "p.(Phe3629=)" "" "0000275771" "00006789" "10" "10950" "0" "10950" "0" "c.10950C>T" "r.(?)" "p.(Asn3650=)" "" "0000275772" "00006789" "30" "11206" "4" "11206" "4" "c.11206+4G>T" "r.spl?" "p.?" "" "0000275773" "00006789" "50" "11258" "0" "11258" "0" "c.11258T>A" "r.(?)" "p.(Leu3753Gln)" "" "0000275774" "00006789" "30" "11361" "0" "11361" "0" "c.11361G>A" "r.(?)" "p.(Thr3787=)" "" "0000275775" "00006789" "10" "11685" "0" "11685" "0" "c.11685C>T" "r.(?)" "p.(Thr3895=)" "" "0000275776" "00006789" "50" "11764" "0" "11764" "0" "c.11764C>T" "r.(?)" "p.(Pro3922Ser)" "" "0000275777" "00006789" "30" "11873" "0" "11873" "0" "c.11873G>T" "r.(?)" "p.(Gly3958Val)" "" "0000275779" "00006789" "30" "11942" "0" "11942" "0" "c.11942C>G" "r.(?)" "p.(Thr3981Arg)" "" "0000275780" "00006789" "10" "12087" "0" "12087" "0" "c.12087C>A" "r.(?)" "p.(His4029Gln)" "" "0000275781" "00006789" "30" "12102" "6" "12102" "6" "c.12102+6G>A" "r.(=)" "p.(=)" "" "0000275782" "00006789" "50" "12191" "0" "12191" "0" "c.12191C>T" "r.(?)" "p.(Thr4064Met)" "" "0000275783" "00006789" "30" "12258" "0" "12258" "0" "c.12258C>T" "r.(?)" "p.(Thr4086=)" "" "0000275784" "00006789" "10" "12514" "-9" "12514" "-9" "c.12514-9C>A" "r.(=)" "p.(=)" "" "0000275785" "00006789" "50" "12584" "0" "12584" "0" "c.12584G>A" "r.(?)" "p.(Arg4195Gln)" "" "0000275786" "00006789" "30" "12684" "16" "12684" "16" "c.12684+16G>C" "r.(=)" "p.(=)" "" "0000275787" "00006789" "30" "12685" "-3" "12685" "-3" "c.12685-3C>T" "r.spl?" "p.?" "" "0000275788" "00006789" "10" "13080" "0" "13080" "0" "c.13080T>C" "r.(?)" "p.(Thr4360=)" "" "0000275789" "00006789" "10" "13219" "-9" "13219" "-9" "c.13219-9C>T" "r.(=)" "p.(=)" "" "0000275790" "00006789" "30" "13283" "0" "13283" "0" "c.13283G>A" "r.(?)" "p.(Arg4428His)" "" "0000275791" "00006789" "10" "13372" "4" "13372" "4" "c.13372+4C>T" "r.spl?" "p.?" "" "0000275792" "00006789" "10" "13372" "9" "13372" "9" "c.13372+9G>A" "r.(=)" "p.(=)" "" "0000275793" "00006789" "50" "1352" "0" "1352" "0" "c.1352G>A" "r.(?)" "p.(Arg451His)" "" "0000275794" "00006789" "30" "13719" "0" "13719" "0" "c.13719C>T" "r.(?)" "p.(Asn4573=)" "" "0000275795" "00006789" "30" "13749" "0" "13749" "0" "c.13749C>T" "r.(?)" "p.(Thr4583=)" "" "0000275796" "00006789" "30" "13764" "0" "13764" "0" "c.13764G>A" "r.(?)" "p.(Thr4588=)" "" "0000275797" "00006789" "30" "13808" "0" "13808" "0" "c.13808G>T" "r.(?)" "p.(Ser4603Ile)" "" "0000275798" "00006789" "30" "13920" "0" "13920" "0" "c.13920C>T" "r.(?)" "p.(Val4640=)" "" "0000275799" "00006789" "30" "1704" "0" "1704" "0" "c.1704T>C" "r.(?)" "p.(Leu568=)" "" "0000275800" "00006789" "50" "1843" "0" "1843" "0" "c.1843G>A" "r.(?)" "p.(Asp615Asn)" "" "0000275801" "00006789" "30" "2373" "0" "2373" "0" "c.2373C>T" "r.(?)" "p.(Thr791=)" "" "0000275802" "00006789" "10" "2625" "0" "2625" "0" "c.2625G>A" "r.(?)" "p.(Ser875=)" "" "0000275803" "00006789" "30" "264" "0" "264" "0" "c.264C>T" "r.(?)" "p.(Val88=)" "" "0000275804" "00006789" "30" "2719" "-6" "2719" "-6" "c.2719-6C>T" "r.(=)" "p.(=)" "" "0000275805" "00006789" "50" "2875" "0" "2875" "0" "c.2875G>A" "r.(?)" "p.(Val959Ile)" "" "0000275806" "00006789" "10" "3015" "18" "3015" "18" "c.3015+18C>T" "r.(=)" "p.(=)" "" "0000275807" "00006789" "30" "318" "0" "318" "0" "c.318C>T" "r.(?)" "p.(Asp106=)" "" "0000275808" "00006789" "30" "345" "-10" "345" "-10" "c.345-10T>G" "r.(=)" "p.(=)" "" "0000275809" "00006789" "30" "369" "0" "369" "0" "c.369C>T" "r.(?)" "p.(Pro123=)" "" "0000275810" "00006789" "30" "3789" "0" "3789" "0" "c.3789G>A" "r.(?)" "p.(Lys1263=)" "" "0000275811" "00006789" "50" "3807" "0" "3807" "0" "c.3807C>T" "r.(?)" "p.(Gly1269=)" "" "0000275812" "00006789" "30" "3909" "0" "3909" "0" "c.3909G>A" "r.(?)" "p.(Ala1303=)" "" "0000275813" "00006789" "30" "4185" "20" "4185" "20" "c.4185+20C>T" "r.(=)" "p.(=)" "" "0000275814" "00006789" "30" "4515" "0" "4515" "0" "c.4515G>A" "r.(?)" "p.(Ser1505=)" "" "0000275815" "00006789" "30" "4533" "0" "4533" "0" "c.4533G>A" "r.(?)" "p.(Pro1511=)" "" "0000275816" "00006789" "30" "4854" "0" "4854" "0" "c.4854T>C" "r.(?)" "p.(Tyr1618=)" "" "0000275817" "00006789" "30" "4941" "0" "4941" "0" "c.4941C>T" "r.(?)" "p.(Val1647=)" "" "0000275818" "00006789" "30" "5298" "0" "5298" "0" "c.5298G>T" "r.(?)" "p.(Leu1766=)" "" "0000275819" "00006789" "50" "5629" "0" "5629" "0" "c.5629G>A" "r.(?)" "p.(Asp1877Asn)" "" "0000275820" "00006789" "30" "5649" "0" "5649" "0" "c.5649C>T" "r.(?)" "p.(Pro1883=)" "" "0000275821" "00006789" "30" "6222" "-20" "6222" "-20" "c.6222-20C>T" "r.(=)" "p.(=)" "" "0000275822" "00006789" "10" "624" "0" "624" "0" "c.624G>A" "r.(?)" "p.(Pro208=)" "" "0000275823" "00006789" "30" "6406" "-4" "6406" "-4" "c.6406-4G>C" "r.spl?" "p.?" "" "0000275824" "00006789" "50" "668" "0" "668" "0" "c.668G>A" "r.(?)" "p.(Arg223His)" "" "0000275825" "00006789" "30" "7137" "0" "7137" "0" "c.7137G>A" "r.(?)" "p.(Leu2379=)" "" "0000275826" "00006789" "30" "7239" "0" "7239" "0" "c.7239G>T" "r.(?)" "p.(Leu2413=)" "" "0000275827" "00006789" "30" "7419" "0" "7419" "0" "c.7419C>T" "r.(?)" "p.(Asn2473=)" "" "0000275828" "00006789" "10" "7449" "0" "7449" "0" "c.7449C>T" "r.(?)" "p.(Ile2483=)" "" "0000275829" "00006789" "30" "7458" "0" "7458" "0" "c.7458G>T" "r.(?)" "p.(Leu2486=)" "" "0000275830" "00006789" "30" "7758" "0" "7758" "0" "c.7758C>T" "r.(?)" "p.(Ala2586=)" "" "0000275831" "00006789" "30" "78" "0" "78" "0" "c.78C>T" "r.(?)" "p.(Asp26=)" "" "0000275832" "00006789" "30" "9138" "0" "9138" "0" "c.9138G>T" "r.(?)" "p.(Ser3046=)" "" "0000275833" "00006789" "30" "9471" "0" "9471" "0" "c.9471G>A" "r.(?)" "p.(Ala3157=)" "" "0000275834" "00006789" "10" "962" "-15" "962" "-15" "c.962-15dup" "r.(=)" "p.(=)" "" "0000275835" "00006789" "50" "9844" "0" "9844" "0" "c.9844C>G" "r.(?)" "p.(Leu3282Val)" "" "0000323855" "00006789" "50" "3187" "0" "3187" "0" "c.3187A>G" "r.(?)" "p.(Met1063Val)" "" "0000336891" "00006789" "10" "3015" "18" "3015" "18" "c.3015+18C>T" "r.(=)" "p.(=)" "" "0000336892" "00006789" "10" "9469" "-20" "9469" "-20" "c.9469-20A>T" "r.(=)" "p.(=)" "" "0000336896" "00006789" "10" "13372" "4" "13372" "4" "c.13372+4C>T" "r.spl?" "p.?" "" "0000336897" "00006789" "10" "13372" "9" "13372" "9" "c.13372+9G>A" "r.(=)" "p.(=)" "" "0000338977" "00006789" "50" "6619" "-11" "6619" "-11" "c.6619-11G>A" "r.(=)" "p.(=)" "" "0000339216" "00006789" "10" "624" "0" "624" "0" "c.624G>A" "r.(?)" "p.(Pro208=)" "" "0000339217" "00006789" "10" "3600" "0" "3600" "0" "c.3600A>G" "r.(?)" "p.(Gln1200=)" "" "0000339218" "00006789" "10" "3909" "0" "3909" "0" "c.3909G>A" "r.(?)" "p.(Ala1303=)" "" "0000339220" "00006789" "10" "7449" "0" "7449" "0" "c.7449C>T" "r.(?)" "p.(Ile2483=)" "" "0000339221" "00006789" "10" "7524" "0" "7524" "0" "c.7524A>G" "r.(?)" "p.(Leu2508=)" "" "0000339222" "00006789" "10" "8928" "0" "8928" "0" "c.8928A>G" "r.(?)" "p.(Leu2976=)" "" "0000339224" "00006789" "10" "10950" "0" "10950" "0" "c.10950C>T" "r.(?)" "p.(Asn3650=)" "" "0000339226" "00006789" "10" "13080" "0" "13080" "0" "c.13080T>C" "r.(?)" "p.(Thr4360=)" "" "0000341799" "00006789" "30" "3680" "0" "3680" "0" "c.3680G>A" "r.(?)" "p.(Arg1227Gln)" "" "0000342026" "00006789" "70" "4868" "0" "4868" "0" "c.4868G>A" "r.(?)" "p.(Arg1623Gln)" "" "0000342355" "00006789" "70" "7073" "0" "7073" "0" "c.7073G>A" "r.(?)" "p.(Arg2358His)" "" "0000342421" "00006789" "90" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Arg251Cys)" "" "0000342422" "00006789" "90" "752" "0" "752" "0" "c.752G>A" "r.(?)" "p.(Arg251His)" "" "0000343710" "00006789" "70" "9709" "0" "9709" "0" "c.9709A>G" "r.(?)" "p.(Asn3237Asp)" "" "0000343718" "00006789" "30" "10121" "0" "10121" "0" "c.10121A>T" "r.(?)" "p.(Asn3374Ile)" "" "0000344001" "00006789" "50" "6763" "0" "6763" "0" "c.6763G>A" "r.(?)" "p.(Asp2255Asn)" "" "0000344167" "00006789" "50" "1963" "0" "1963" "0" "c.1963G>A" "r.(?)" "p.(Asp655Asn)" "" "0000345174" "00006789" "30" "5002" "0" "5002" "0" "c.5002G>A" "r.(?)" "p.(Glu1668Lys)" "" "0000345657" "00006789" "50" "3395" "0" "3395" "0" "c.3395G>T" "r.(?)" "p.(Gly1132Val)" "" "0000345970" "00006789" "50" "9043" "0" "9043" "0" "c.9043G>A" "r.(?)" "p.(Gly3015Arg)" "" "0000346467" "00006789" "10" "12087" "0" "12087" "0" "c.12087C>A" "r.(?)" "p.(His4029Gln)" "" "0000346567" "00006789" "50" "3844" "0" "3844" "0" "c.3844A>G" "r.(?)" "p.(Ile1282Val)" "" "0000346589" "00006789" "70" "4670" "0" "4670" "0" "c.4670T>C" "r.(?)" "p.(Ile1557Thr)" "" "0000346965" "00006789" "30" "5755" "0" "5755" "0" "c.5755C>T" "r.(?)" "p.(Leu1919Phe)" "" "0000347569" "00006789" "50" "13088" "0" "13088" "0" "c.13088A>C" "r.(?)" "p.(Lys4363Thr)" "" "0000347750" "00006789" "70" "4519" "0" "4519" "0" "c.4519A>G" "r.(?)" "p.(Met1507Val)" "" "0000348114" "00006789" "30" "3079" "0" "3079" "0" "c.3079C>T" "r.(?)" "p.(Pro1027Ser)" "" "0000348375" "00006789" "90" "9518" "0" "9518" "0" "c.9518C>G" "r.(?)" "p.(Pro3173Arg)" "" "0000348766" "00006789" "30" "4988" "0" "4988" "0" "c.4988G>A" "r.(?)" "p.(Ser1663Asn)" "" "0000349011" "00006789" "50" "13103" "0" "13103" "0" "c.13103C>T" "r.(?)" "p.(Ser4368Phe)" "" "0000350343" "00006789" "30" "5114" "0" "5114" "0" "c.5114T>C" "r.(?)" "p.(Val1705Ala)" "" "0000350352" "00006789" "30" "5248" "0" "5248" "0" "c.5248G>A" "r.(?)" "p.(Val1750Met)" "" "0000350444" "00006789" "50" "8200" "0" "8200" "0" "c.8200G>A" "r.(?)" "p.(Val2734Met)" "" "0000350470" "00006789" "50" "9190" "0" "9190" "0" "c.9190G>A" "r.(?)" "p.(Val3064Ile)" "" "0000350528" "00006789" "30" "12496" "0" "12496" "0" "c.12496G>A" "r.(?)" "p.(Val4166Ile)" "" "0000350607" "00006789" "90" "1834" "0" "1834" "0" "c.1834G>A" "r.(?)" "p.(Val612Met)" "" "0000404690" "00006789" "70" "6994" "0" "6994" "0" "c.6994C>T" "r.(?)" "p.(Arg2332Cys)" "34" "0000407958" "00006789" "00" "4552" "0" "4552" "0" "c.4552G>A" "r.(?)" "p.(Glu1518Lys)" "" "0000439075" "00006789" "50" "13044" "0" "13044" "0" "c.13044G>A" "r.(?)" "p.Met4348Ile" "" "0000442481" "00006789" "50" "7539" "0" "7539" "0" "c.7539G>C" "r.(?)" "p.Glu2513Asp" "" "0000551165" "00006789" "10" "46" "0" "46" "0" "c.46T>C" "r.(?)" "p.(Leu16=)" "" "0000551167" "00006789" "30" "345" "-10" "345" "-10" "c.345-10T>G" "r.(=)" "p.(=)" "" "0000551168" "00006789" "50" "418" "0" "418" "0" "c.418C>A" "r.(?)" "p.(Leu140Ile)" "" "0000551169" "00006789" "90" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Arg251Cys)" "" "0000551171" "00006789" "50" "874" "0" "874" "0" "c.874C>T" "r.(?)" "p.(Arg292Trp)" "" "0000551172" "00006789" "70" "874" "0" "874" "0" "c.874C>T" "r.(?)" "p.(Arg292Trp)" "" "0000551173" "00006789" "10" "962" "-15" "962" "-15" "c.962-15dup" "r.(=)" "p.(=)" "" "0000551174" "00006789" "70" "1385" "0" "1385" "0" "c.1385G>A" "r.(?)" "p.(Arg462His)" "" "0000551175" "00006789" "50" "1678" "0" "1678" "0" "c.1678G>A" "r.(?)" "p.(Val560Met)" "" "0000551176" "00006789" "30" "1704" "0" "1704" "0" "c.1704T>C" "r.(?)" "p.(Leu568=)" "" "0000551177" "00006789" "50" "1817" "0" "1817" "0" "c.1817C>T" "r.(?)" "p.(Thr606Ile)" "" "0000551178" "00006789" "50" "1901" "0" "1901" "0" "c.1901del" "r.(?)" "p.(Lys634ArgfsTer2)" "" "0000551179" "00006789" "30" "2211" "0" "2211" "0" "c.2211T>A" "r.(?)" "p.(Val737=)" "" "0000551180" "00006789" "70" "2275" "0" "2275" "0" "c.2275C>T" "r.(?)" "p.(Arg759Cys)" "" "0000551181" "00006789" "10" "2719" "-6" "2719" "-6" "c.2719-6C>T" "r.(=)" "p.(=)" "" "0000551182" "00006789" "10" "2721" "0" "2721" "0" "c.2721T>C" "r.(?)" "p.(Ile907=)" "" "0000551183" "00006789" "50" "2868" "5" "2868" "5" "c.2868+5G>A" "r.spl?" "p.?" "" "0000551184" "00006789" "30" "3854" "0" "3854" "0" "c.3854G>T" "r.(?)" "p.(Gly1285Val)" "" "0000551186" "00006789" "10" "4185" "20" "4185" "20" "c.4185+20C>T" "r.(=)" "p.(=)" "" "0000551188" "00006789" "50" "4543" "-1" "4543" "-1" "c.4543-1G>C" "r.spl?" "p.?" "" "0000551189" "00006789" "10" "4854" "0" "4854" "0" "c.4854T>C" "r.(?)" "p.(Tyr1618=)" "" "0000551190" "00006789" "30" "5238" "8" "5238" "8" "c.5238+8A>G" "r.(=)" "p.(=)" "" "0000551192" "00006789" "50" "5837" "0" "5837" "0" "c.5837T>C" "r.(?)" "p.(Val1946Ala)" "" "0000551193" "00006789" "30" "5985" "0" "5985" "0" "c.5985C>T" "r.(?)" "p.(Ala1995=)" "" "0000551195" "00006789" "50" "6857" "5" "6857" "5" "c.6857+5G>A" "r.spl?" "p.?" "" "0000551196" "00006789" "30" "6867" "0" "6867" "0" "c.6867C>T" "r.(?)" "p.(Asp2289=)" "" "0000551197" "00006789" "50" "7009" "0" "7009" "0" "c.7009C>T" "r.(?)" "p.(Pro2337Ser)" "" "0000551198" "00006789" "30" "7239" "0" "7239" "0" "c.7239G>T" "r.(?)" "p.(Leu2413=)" "" "0000551199" "00006789" "30" "7242" "1" "7242" "1" "c.7242+1G>T" "r.spl?" "p.?" "" "0000551200" "00006789" "30" "7317" "0" "7317" "0" "c.7317C>T" "r.(?)" "p.(His2439=)" "" "0000551201" "00006789" "30" "8304" "0" "8304" "0" "c.8304G>A" "r.(?)" "p.(Pro2768=)" "" "0000551202" "00006789" "50" "8519" "0" "8519" "0" "c.8519A>G" "r.(?)" "p.(Asp2840Gly)" "" "0000551203" "00006789" "30" "8556" "0" "8556" "0" "c.8556G>A" "r.(?)" "p.(Thr2852=)" "" "0000551204" "00006789" "30" "8847" "0" "8847" "0" "c.8847C>T" "r.(?)" "p.(Phe2949=)" "" "0000551205" "00006789" "70" "9052" "0" "9052" "0" "c.9052C>T" "r.(?)" "p.(Pro3018Ser)" "" "0000551207" "00006789" "70" "9142" "0" "9142" "0" "c.9142G>A" "r.(?)" "p.(Glu3048Lys)" "" "0000551208" "00006789" "70" "9142" "0" "9142" "0" "c.9142G>A" "r.(?)" "p.(Glu3048Lys)" "" "0000551209" "00006789" "70" "9159" "0" "9159" "0" "c.9159G>T" "r.(?)" "p.(Trp3053Cys)" "" "0000551210" "00006789" "50" "9178" "0" "9178" "0" "c.9178C>T" "r.(?)" "p.(Arg3060Cys)" "" "0000551211" "00006789" "70" "9581" "0" "9581" "0" "c.9581T>C" "r.(?)" "p.(Leu3194Pro)" "" "0000551212" "00006789" "30" "9643" "-7" "9643" "-7" "c.9643-7del" "r.(=)" "p.(=)" "" "0000551213" "00006789" "30" "10203" "0" "10203" "0" "c.10203C>T" "r.(?)" "p.(Asn3401=)" "" "0000551214" "00006789" "70" "10231" "0" "10231" "0" "c.10231C>T" "r.(?)" "p.(Pro3411Ser)" "" "0000551215" "00006789" "50" "10336" "0" "10336" "0" "c.10336C>T" "r.(?)" "p.(Arg3446Cys)" "" "0000551216" "00006789" "50" "10522" "0" "10522" "0" "c.10522C>A" "r.(?)" "p.(Leu3508Ile)" "" "0000551217" "00006789" "90" "10974" "0" "10974" "0" "c.10974dup" "r.(?)" "p.(Arg3659GlufsTer48)" "" "0000551218" "00006789" "30" "11055" "8" "11055" "8" "c.11055+8A>G" "r.(=)" "p.(=)" "" "0000551219" "00006789" "70" "11081" "0" "11081" "0" "c.11081C>T" "r.(?)" "p.(Ser3694Phe)" "" "0000551220" "00006789" "50" "11090" "0" "11090" "0" "c.11090C>G" "r.(?)" "p.(Thr3697Ser)" "" "0000551221" "00006789" "30" "11400" "0" "11400" "0" "c.11400G>A" "r.(?)" "p.(Gln3800=)" "" "0000551223" "00006789" "50" "11828" "0" "11828" "0" "c.11828C>T" "r.(?)" "p.(Ala3943Val)" "" "0000551224" "00006789" "30" "11942" "0" "11942" "0" "c.11942C>G" "r.(?)" "p.(Thr3981Arg)" "" "0000551226" "00006789" "10" "12192" "0" "12192" "0" "c.12192G>T" "r.(?)" "p.(Thr4064=)" "" "0000551227" "00006789" "50" "12419" "0" "12419" "0" "c.12419G>A" "r.(?)" "p.(Arg4140His)" "" "0000551228" "00006789" "50" "12811" "0" "12811" "0" "c.12811C>T" "r.(?)" "p.(Arg4271Cys)" "" "0000551229" "00006789" "50" "13118" "0" "13118" "0" "c.13118G>A" "r.(?)" "p.(Arg4373His)" "" "0000551230" "00006789" "50" "13345" "0" "13345" "0" "c.13345C>T" "r.(?)" "p.(Arg4449Cys)" "" "0000551231" "00006789" "30" "13440" "0" "13440" "0" "c.13440C>T" "r.(?)" "p.(Ser4480=)" "" "0000551233" "00006789" "30" "13685" "-10" "13685" "-10" "c.13685-10C>T" "r.(=)" "p.(=)" "" "0000551235" "00006789" "30" "13831" "0" "13831" "0" "c.13831C>T" "r.(?)" "p.(Leu4611=)" "" "0000551236" "00006789" "30" "13908" "0" "13908" "0" "c.13908C>T" "r.(?)" "p.(Tyr4636=)" "" "0000604416" "00006789" "70" "926" "0" "926" "0" "c.926G>A" "r.(?)" "p.(Arg309His)" "" "0000614694" "00006789" "50" "1216" "0" "1216" "0" "c.1216T>C" "r.(?)" "p.(Tyr406His)" "" "0000614695" "00006789" "50" "1901" "0" "1901" "0" "c.1901A>G" "r.(?)" "p.(Lys634Arg)" "" "0000614696" "00006789" "50" "2107" "0" "2107" "0" "c.2107G>A" "r.(?)" "p.(Ala703Thr)" "" "0000614699" "00006789" "50" "5248" "0" "5248" "0" "c.5248G>A" "r.(?)" "p.(Val1750Met)" "" "0000614700" "00006789" "30" "5295" "0" "5295" "0" "c.5295A>G" "r.(?)" "p.(Ala1765=)" "" "0000614701" "00006789" "30" "6531" "0" "6531" "0" "c.6531C>T" "r.(?)" "p.(Ala2177=)" "" "0000614702" "00006789" "50" "6755" "0" "6755" "0" "c.6755A>C" "r.(?)" "p.(His2252Pro)" "" "0000614703" "00006789" "30" "7071" "0" "7071" "0" "c.7071G>A" "r.(?)" "p.(Ser2357=)" "" "0000614704" "00006789" "30" "7152" "0" "7152" "0" "c.7152C>T" "r.(?)" "p.(Ser2384=)" "" "0000614705" "00006789" "50" "8408" "0" "8408" "0" "c.8408del" "r.(?)" "p.(Val2803GlyfsTer8)" "" "0000614706" "00006789" "50" "8971" "0" "8971" "0" "c.8971G>A" "r.(?)" "p.(Ala2991Thr)" "" "0000614709" "00006789" "10" "12159" "0" "12159" "0" "c.12159A>T" "r.(?)" "p.(Gly4053=)" "" "0000614711" "00006789" "30" "13077" "0" "13077" "0" "c.13077G>A" "r.(?)" "p.(Glu4359=)" "" "0000614712" "00006789" "30" "13113" "0" "13113" "0" "c.13113C>T" "r.(?)" "p.(Asp4371=)" "" "0000614713" "00006789" "30" "13181" "0" "13181" "0" "c.13181C>T" "r.(?)" "p.(Thr4394Met)" "" "0000614714" "00006789" "50" "13261" "0" "13261" "0" "c.13261G>A" "r.(?)" "p.(Ala4421Thr)" "" "0000614715" "00006789" "30" "13372" "20" "13372" "20" "c.13372+20C>T" "r.(=)" "p.(=)" "" "0000623080" "00006789" "30" "4143" "0" "4143" "0" "c.4143G>A" "r.(?)" "p.(Ala1381=)" "" "0000623081" "00006789" "30" "5157" "0" "5157" "0" "c.5157G>A" "r.(?)" "p.(Glu1719=)" "" "0000623082" "00006789" "50" "6335" "0" "6335" "0" "c.6335dup" "r.(?)" "p.(Arg2113GlufsTer11)" "" "0000623083" "00006789" "30" "6618" "9" "6618" "9" "c.6618+9G>A" "r.(=)" "p.(=)" "" "0000623084" "00006789" "30" "7308" "0" "7308" "0" "c.7308G>A" "r.(?)" "p.(Ala2436=)" "" "0000623085" "00006789" "30" "10908" "10" "10908" "10" "c.10908+10G>A" "r.(=)" "p.(=)" "" "0000623086" "00006789" "30" "11289" "0" "11289" "0" "c.11289C>T" "r.(?)" "p.(Asp3763=)" "" "0000623087" "00006789" "50" "12811" "0" "12811" "0" "c.12811C>T" "r.(?)" "p.(Arg4271Cys)" "" "0000623088" "00006789" "30" "13908" "0" "13908" "0" "c.13908C>T" "r.(?)" "p.(Tyr4636=)" "" "0000644804" "00006789" "50" "9263" "5" "9263" "5" "c.9263+5G>A" "r.spl?" "p.?" "47" "0000645299" "00006789" "70" "2327" "0" "2327" "0" "c.2327C>T" "r.2327c>u" "p.(Pro776Leu)" "" "0000648821" "00006789" "90" "10033" "0" "10033" "0" "c.10033G>A" "r.(?)" "p.(Glu3345Lys)" "" "0000653436" "00006789" "50" "8000" "0" "8000" "0" "c.8000A>G" "r.(?)" "p.(Asn2667Ser)" "" "0000657327" "00006789" "30" "257" "-9" "257" "-9" "c.257-9G>A" "r.(=)" "p.(=)" "" "0000657328" "00006789" "50" "2107" "0" "2107" "0" "c.2107G>A" "r.(?)" "p.(Ala703Thr)" "" "0000657329" "00006789" "30" "2175" "0" "2175" "0" "c.2175T>C" "r.(?)" "p.(Val725=)" "" "0000657331" "00006789" "90" "4700" "0" "4700" "0" "c.4700G>A" "r.(?)" "p.(Arg1567Gln)" "" "0000657332" "00006789" "50" "7640" "0" "7640" "0" "c.7640C>T" "r.(?)" "p.(Pro2547Leu)" "" "0000657333" "00006789" "50" "13757" "0" "13757" "0" "c.13757C>T" "r.(?)" "p.(Pro4586Leu)" "" "0000657334" "00006789" "30" "13808" "0" "13808" "0" "c.13808G>T" "r.(?)" "p.(Ser4603Ile)" "" "0000663699" "00006789" "50" "9041" "0" "9041" "0" "c.9041A>G" "r.(?)" "p.(Asn3014Ser)" "" "0000663998" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0000664047" "00006789" "70" "592" "0" "592" "0" "c.592C>A" "r.(?)" "p.(Gln198Lys)" "" "0000664048" "00006789" "70" "752" "0" "752" "0" "c.752G>A" "r.(?)" "p.(Arg251His)" "" "0000664049" "00006789" "70" "7922" "0" "7922" "0" "c.7922A>G" "r.(?)" "p.(Tyr2641Cys)" "" "0000664050" "00006789" "70" "1012" "0" "1012" "0" "c.1012G>A" "r.(?)" "p.(Asp338Asn)" "" "0000664051" "00006789" "70" "1195" "0" "1195" "0" "c.1195A>G" "r.(?)" "p.(Arg399Gly)" "" "0000664052" "00006789" "70" "1809" "0" "1809" "0" "c.1809A>T" "r.(?)" "p.(Glu603Asp)" "" "0000664053" "00006789" "70" "3606" "0" "3606" "0" "c.3606C>A" "r.(?)" "p.(Phe1202Leu)" "" "0000664054" "00006789" "70" "4259" "0" "4259" "0" "c.4259T>G" "r.(?)" "p.(Leu1420Arg)" "" "0000664055" "00006789" "70" "4808" "0" "4808" "0" "c.4808G>C" "r.(?)" "p.(Arg1603Thr)" "" "0000664117" "00006789" "70" "1195" "0" "1195" "0" "c.1195A>G" "r.(?)" "p.(Arg399Gly)" "" "0000664152" "00006789" "70" "3500" "0" "3500" "0" "c.3500T>A" "r.(?)" "p.(Val1167Glu)" "" "0000667510" "00006789" "90" "3278" "0" "3278" "0" "c.3278T>C" "r.(?)" "p.(Phe1093Ser)" "" "0000673711" "00006789" "50" "12484" "0" "12484" "0" "c.12484A>G" "r.(?)" "p.(Ser4162Gly)" "" "0000679864" "00006789" "10" "-5" "0" "-5" "0" "c.-5A>G" "r.(?)" "p.(=)" "" "0000679865" "00006789" "10" "46" "0" "46" "0" "c.46T>C" "r.(?)" "p.(Leu16=)" "" "0000679866" "00006789" "70" "1103" "0" "1103" "0" "c.1103G>A" "r.(?)" "p.(Arg368Gln)" "" "0000679867" "00006789" "10" "2625" "0" "2625" "0" "c.2625G>A" "r.(?)" "p.(Ser875=)" "" "0000679869" "00006789" "50" "3189" "0" "3189" "0" "c.3189G>A" "r.(?)" "p.(Met1063Ile)" "" "0000679870" "00006789" "10" "7632" "0" "7632" "0" "c.7632A>G" "r.(?)" "p.(Glu2544=)" "" "0000679871" "00006789" "10" "13372" "4" "13372" "4" "c.13372+4C>T" "r.spl?" "p.?" "" "0000679873" "00006789" "50" "13667" "0" "13667" "0" "c.13667G>A" "r.(?)" "p.(Cys4556Tyr)" "" "0000691571" "00006789" "50" "932" "0" "932" "0" "c.932A>G" "r.(?)" "p.(His311Arg)" "" "0000691572" "00006789" "50" "6619" "-11" "6619" "-11" "c.6619-11G>A" "r.(=)" "p.(=)" "" "0000691573" "00006789" "30" "9642" "4" "9642" "4" "c.9642+4C>T" "r.spl?" "p.?" "" "0000691574" "00006789" "70" "10232" "0" "10232" "0" "c.10232C>T" "r.(?)" "p.(Pro3411Leu)" "" "0000691575" "00006789" "50" "13091" "0" "13091" "0" "c.13091C>T" "r.(?)" "p.(Thr4364Met)" "" "0000693853" "00006789" "50" "848" "0" "848" "0" "c.848G>A" "r.(?)" "p.(Arg283His)" "" "0000697500" "00006789" "70" "574" "0" "574" "0" "c.574G>A" "r.(?)" "p.(Gly192Arg)" "" "0000698187" "00006789" "90" "5885" "0" "5885" "0" "c.5885G>T" "r.(?)" "p.(Arg1962Leu)" "" "0000698203" "00006789" "90" "6994" "0" "6994" "0" "c.6994C>T" "r.(?)" "p.(Arg2332Cys)" "" "0000698827" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0000698828" "00006789" "90" "2327" "0" "2327" "0" "c.2327C>T" "r.(?)" "p.(Pro776Leu)" "" "0000698829" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0000698830" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0000708538" "00006789" "50" "3217" "0" "3217" "0" "c.3217G>A" "r.(?)" "p.(Gly1073Arg)" "13" "0000708721" "00006789" "70" "11465" "0" "11465" "0" "c.11465A>C" "r.(?)" "p.(His3822Pro)" "" "0000724591" "00006789" "10" "306" "0" "306" "0" "c.306C>T" "r.(?)" "p.(Asn102=)" "" "0000724592" "00006789" "50" "425" "0" "425" "0" "c.425A>C" "r.(?)" "p.(Glu142Ala)" "" "0000724593" "00006789" "90" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Arg251Cys)" "" "0000724594" "00006789" "30" "851" "0" "851" "0" "c.851C>T" "r.(?)" "p.(Ala284Val)" "" "0000724595" "00006789" "70" "874" "0" "874" "0" "c.874C>T" "r.(?)" "p.(Arg292Trp)" "" "0000724596" "00006789" "70" "1793" "0" "1793" "0" "c.1793G>T" "r.(?)" "p.(Arg598Leu)" "" "0000724597" "00006789" "70" "1814" "0" "1814" "0" "c.1814A>G" "r.(?)" "p.(Gln605Arg)" "" "0000724598" "00006789" "50" "2768" "0" "2768" "0" "c.2768C>T" "r.(?)" "p.(Thr923Met)" "" "0000724599" "00006789" "50" "3952" "0" "3952" "0" "c.3952C>T" "r.(?)" "p.(Arg1318Cys)" "" "0000724600" "00006789" "10" "3960" "16" "3960" "16" "c.3960+16G>A" "r.(=)" "p.(=)" "" "0000724601" "00006789" "10" "3993" "0" "3993" "0" "c.3993C>T" "r.(?)" "p.(Gly1331=)" "" "0000724602" "00006789" "30" "5718" "0" "5718" "0" "c.5718A>C" "r.(?)" "p.(Gly1906=)" "" "0000724603" "00006789" "50" "5742" "0" "5742" "0" "c.5742G>T" "r.(?)" "p.(Glu1914Asp)" "" "0000724604" "00006789" "50" "5933" "0" "5933" "0" "c.5933T>G" "r.(?)" "p.(Ile1978Arg)" "" "0000724605" "00006789" "50" "5971" "0" "5971" "0" "c.5971G>A" "r.(?)" "p.(Asp1991Asn)" "" "0000724606" "00006789" "50" "7148" "0" "7148" "0" "c.7148G>A" "r.(?)" "p.(Arg2383His)" "" "0000724607" "00006789" "30" "8304" "0" "8304" "0" "c.8304G>A" "r.(?)" "p.(Pro2768=)" "" "0000724608" "00006789" "50" "8903" "0" "8903" "0" "c.8903C>T" "r.(?)" "p.(Thr2968Ile)" "" "0000724609" "00006789" "50" "9178" "0" "9178" "0" "c.9178C>T" "r.(?)" "p.(Arg3060Cys)" "" "0000724610" "00006789" "30" "9263" "5" "9263" "5" "c.9263+5G>A" "r.spl?" "p.?" "" "0000724611" "00006789" "30" "9960" "0" "9960" "0" "c.9960G>A" "r.(?)" "p.(Ala3320=)" "" "0000724612" "00006789" "50" "10070" "0" "10070" "0" "c.10070A>G" "r.(?)" "p.(Glu3357Gly)" "" "0000724613" "00006789" "50" "10318" "0" "10318" "0" "c.10318C>G" "r.(?)" "p.(Leu3440Val)" "" "0000724614" "00006789" "30" "10627" "-16" "10627" "-16" "c.10627-16C>T" "r.(=)" "p.(=)" "" "0000724616" "00006789" "30" "12165" "0" "12165" "0" "c.12165C>T" "r.(?)" "p.(Val4055=)" "" "0000724617" "00006789" "50" "12191" "0" "12191" "0" "c.12191C>T" "r.(?)" "p.(Thr4064Met)" "" "0000724618" "00006789" "50" "12903" "0" "12903" "0" "c.12903G>A" "r.(?)" "p.(Arg4301=)" "" "0000724619" "00006789" "30" "13808" "0" "13808" "0" "c.13808G>T" "r.(?)" "p.(Ser4603Ile)" "" "0000735294" "00006789" "90" "7828" "0" "7828" "0" "c.7828del" "r.(?)" "p.(Arg2610Glyfs*23)" "" "0000787263" "00006789" "50" "1505" "0" "1505" "0" "c.1505C>T" "r.(?)" "p.(Pro502Leu)" "8" "0000787264" "00006789" "50" "9332" "0" "9332" "0" "c.9332G>C" "r.(?)" "p.(Ser3111Thr)" "48" "0000787265" "00006789" "50" "13719" "0" "13721" "0" "c.13719_13721del" "r.(?)" "p.(Asn4573del)" "77" "0000787459" "00006789" "50" "4105" "0" "4105" "0" "c.4105C>A" "r.(?)" "p.(Gln1369Lys)" "19" "0000788891" "00006789" "70" "4700" "0" "4700" "0" "c.4700G>A" "r.(?)" "p.(Arg1567Gln)" "" "0000791100" "00006789" "50" "790" "0" "790" "0" "c.790C>G" "r.(?)" "p.(Arg264Gly)" "5" "0000791101" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "8" "0000806230" "00006789" "30" "519" "-18" "519" "-18" "c.519-18T>C" "r.(=)" "p.(=)" "" "0000806231" "00006789" "30" "962" "-4" "962" "-4" "c.962-4A>G" "r.spl?" "p.?" "" "0000806232" "00006789" "50" "1973" "0" "1973" "0" "c.1973T>C" "r.(?)" "p.(Leu658Pro)" "" "0000806233" "00006789" "30" "2211" "0" "2211" "0" "c.2211T>A" "r.(?)" "p.(Val737=)" "" "0000806234" "00006789" "30" "3759" "0" "3759" "0" "c.3759C>T" "r.(?)" "p.(Arg1253=)" "" "0000806235" "00006789" "50" "4520" "0" "4520" "0" "c.4520T>C" "r.(?)" "p.(Met1507Thr)" "" "0000806236" "00006789" "30" "4699" "0" "4699" "0" "c.4699C>A" "r.(?)" "p.(Arg1567=)" "" "0000806237" "00006789" "50" "7052" "0" "7052" "0" "c.7052C>T" "r.(?)" "p.(Ala2351Val)" "" "0000806238" "00006789" "10" "7137" "0" "7137" "0" "c.7137G>A" "r.(?)" "p.(Leu2379=)" "" "0000806239" "00006789" "50" "7586" "0" "7586" "0" "c.7586C>T" "r.(?)" "p.(Ala2529Val)" "" "0000806240" "00006789" "30" "8292" "0" "8292" "0" "c.8292G>A" "r.(?)" "p.(Thr2764=)" "" "0000806241" "00006789" "50" "8898" "0" "8898" "0" "c.8898G>C" "r.(?)" "p.(Lys2966Asn)" "" "0000806242" "00006789" "50" "9178" "0" "9178" "0" "c.9178C>T" "r.(?)" "p.(Arg3060Cys)" "" "0000806243" "00006789" "30" "12180" "0" "12180" "0" "c.12180C>T" "r.(?)" "p.(Ala4060=)" "" "0000806244" "00006789" "30" "12400" "-12" "12400" "-12" "c.12400-12G>A" "r.(=)" "p.(=)" "" "0000806245" "00006789" "30" "13404" "0" "13404" "0" "c.13404G>A" "r.(?)" "p.(Thr4468=)" "" "0000832809" "00006789" "70" "9919" "0" "9919" "0" "c.9919G>T" "r.(?)" "p.(Val3307Leu)" "" "0000832810" "00006789" "70" "6743" "0" "6743" "0" "c.6743A>G" "r.(?)" "p.(Glu2248Gly)" "" "0000833041" "00006789" "70" "10378" "0" "10378" "0" "c.10378G>C" "r.(?)" "p.(Ala3460Pro)" "" "0000839544" "00006789" "70" "161" "0" "172" "0" "c.161_172del" "r.(?)" "p.(Ala54_Glu57del)" "" "0000847160" "00006789" "90" "587" "0" "587" "0" "c.587T>G" "r.(?)" "p.(Leu196Trp)" "" "0000853706" "00006789" "50" "2039" "0" "2039" "0" "c.2039A>G" "r.(?)" "p.(Gln680Arg)" "" "0000853707" "00006789" "50" "3961" "-3" "3961" "-3" "c.3961-3C>T" "r.spl?" "p.?" "" "0000853708" "00006789" "50" "8956" "0" "8956" "0" "c.8956A>G" "r.(?)" "p.(Lys2986Glu)" "" "0000853709" "00006789" "30" "10627" "-16" "10627" "-16" "c.10627-16C>T" "r.(=)" "p.(=)" "" "0000863428" "00006789" "30" "5294" "0" "5294" "0" "c.5294C>T" "r.(?)" "p.(Ala1765Val)" "" "0000873499" "00006789" "70" "12804" "0" "12804" "0" "c.12804C>T" "r.(?)" "p.(Phe4268=)" "" "0000874410" "00006789" "30" "668" "0" "668" "0" "c.668G>A" "r.(?)" "p.(Arg223His)" "" "0000881825" "00006789" "50" "11428" "0" "11428" "0" "c.11428A>T" "r.(?)" "p.(Ser3810Cys)" "" "0000891577" "00006789" "30" "344" "125" "344" "125" "c.344+125dup" "r.(=)" "p.(=)" "" "0000891578" "00006789" "10" "345" "-49" "345" "-49" "c.345-49T>C" "r.(=)" "p.(=)" "" "0000891579" "00006789" "10" "962" "-15" "962" "-15" "c.962-15dup" "r.(=)" "p.(=)" "" "0000891580" "00006789" "10" "1462" "-41" "1462" "-41" "c.1462-41G>A" "r.(=)" "p.(=)" "" "0000891581" "00006789" "30" "1911" "0" "1911" "0" "c.1911C>T" "r.(?)" "p.(His637=)" "" "0000891582" "00006789" "10" "2718" "146" "2718" "146" "c.2718+146A>G" "r.(=)" "p.(=)" "" "0000891583" "00006789" "10" "2719" "-107" "2719" "-107" "c.2719-107C>A" "r.(=)" "p.(=)" "" "0000891584" "00006789" "10" "2869" "-47" "2869" "-47" "c.2869-47T>A" "r.(=)" "p.(=)" "" "0000891585" "00006789" "90" "3278" "0" "3278" "0" "c.3278T>C" "r.(?)" "p.(Phe1093Ser)" "" "0000891586" "00006789" "10" "3333" "23" "3333" "23" "c.3333+23A>G" "r.(=)" "p.(=)" "" "0000891587" "00006789" "30" "3334" "-4" "3334" "-4" "c.3334-4T>C" "r.spl?" "p.?" "" "0000891588" "00006789" "10" "3600" "0" "3600" "0" "c.3600A>G" "r.(?)" "p.(Gln1200=)" "" "0000891589" "00006789" "50" "3766" "0" "3766" "0" "c.3766G>A" "r.(?)" "p.(Asp1256Asn)" "" "0000891590" "00006789" "10" "3805" "-148" "3805" "-148" "c.3805-148A>G" "r.(=)" "p.(=)" "" "0000891591" "00006789" "10" "3805" "-73" "3805" "-73" "c.3805-73C>T" "r.(=)" "p.(=)" "" "0000891592" "00006789" "30" "4074" "192" "4074" "192" "c.4074+192del" "r.(=)" "p.(=)" "" "0000891593" "00006789" "10" "4396" "-25" "4396" "-25" "c.4396-25A>G" "r.(=)" "p.(=)" "" "0000891594" "00006789" "10" "4884" "-93" "4884" "-93" "c.4884-93G>C" "r.(=)" "p.(=)" "" "0000891595" "00006789" "30" "5049" "7" "5049" "7" "c.5049+7T>C" "r.(=)" "p.(=)" "" "0000891597" "00006789" "10" "5818" "-229" "5818" "-229" "c.5818-229G>C" "r.(=)" "p.(=)" "" "0000891598" "00006789" "90" "5884" "0" "5884" "0" "c.5884C>T" "r.(?)" "p.(Arg1962Cys)" "" "0000891599" "00006789" "70" "6268" "0" "6268" "0" "c.6268C>T" "r.(?)" "p.(Leu2090Phe)" "" "0000891600" "00006789" "70" "6271" "0" "6271" "0" "c.6271C>T" "r.(?)" "p.(Arg2091Trp)" "" "0000891601" "00006789" "70" "6272" "0" "6272" "0" "c.6272G>A" "r.(?)" "p.(Arg2091Gln)" "" "0000891602" "00006789" "30" "6351" "0" "6351" "0" "c.6351A>G" "r.(?)" "p.(Glu2117=)" "" "0000891603" "00006789" "50" "6676" "0" "6676" "0" "c.6676T>C" "r.(?)" "p.(Ser2226Pro)" "" "0000891604" "00006789" "30" "6885" "0" "6885" "0" "c.6885G>T" "r.(?)" "p.(Leu2295=)" "" "0000891605" "00006789" "30" "7207" "0" "7207" "0" "c.7207G>A" "r.(?)" "p.(Asp2403Asn)" "" "0000891606" "00006789" "10" "8177" "41" "8177" "44" "c.8177+41_8177+44dup" "r.(=)" "p.(=)" "" "0000891607" "00006789" "70" "8320" "0" "8320" "0" "c.8320G>C" "r.(?)" "p.(Val2774Leu)" "" "0000891608" "00006789" "10" "8343" "102" "8343" "102" "c.8343+102del" "r.(=)" "p.(=)" "" "0000891609" "00006789" "10" "8344" "-30" "8344" "-30" "c.8344-30G>A" "r.(=)" "p.(=)" "" "0000891610" "00006789" "10" "8928" "0" "8928" "0" "c.8928A>G" "r.(?)" "p.(Leu2976=)" "" "0000891611" "00006789" "30" "9093" "0" "9093" "0" "c.9093G>A" "r.(?)" "p.(Thr3031=)" "" "0000891612" "00006789" "50" "9178" "0" "9178" "0" "c.9178C>T" "r.(?)" "p.(Arg3060Cys)" "" "0000891613" "00006789" "70" "9247" "0" "9247" "0" "c.9247C>T" "r.(?)" "p.(Pro3083Ser)" "" "0000891614" "00006789" "10" "9468" "108" "9468" "108" "c.9468+108T>C" "r.(=)" "p.(=)" "" "0000891615" "00006789" "30" "9531" "0" "9531" "0" "c.9531G>A" "r.(?)" "p.(Leu3177=)" "" "0000891616" "00006789" "10" "9762" "77" "9762" "77" "c.9762+77C>A" "r.(=)" "p.(=)" "" "0000891617" "00006789" "10" "9763" "-86" "9763" "-85" "c.9763-86_9763-85del" "r.(=)" "p.(=)" "" "0000891618" "00006789" "10" "9884" "-99" "9884" "-99" "c.9884-99A>G" "r.(=)" "p.(=)" "" "0000891619" "00006789" "50" "10168" "0" "10168" "0" "c.10168G>A" "r.(?)" "p.(Gly3390Ser)" "" "0000891620" "00006789" "50" "10238" "0" "10238" "0" "c.10238G>A" "r.(?)" "p.(Arg3413His)" "" "0000891621" "00006789" "10" "10413" "93" "10413" "93" "c.10413+93G>A" "r.(=)" "p.(=)" "" "0000891622" "00006789" "30" "10887" "0" "10887" "0" "c.10887C>T" "r.(?)" "p.(Phe3629=)" "" "0000891623" "00006789" "10" "10950" "0" "10950" "0" "c.10950C>T" "r.(?)" "p.(Asn3650=)" "" "0000891624" "00006789" "10" "11207" "-75" "11207" "-75" "c.11207-75del" "r.(=)" "p.(=)" "" "0000891626" "00006789" "10" "11691" "-4" "11691" "-4" "c.11691-4G>T" "r.spl?" "p.?" "" "0000891627" "00006789" "10" "12514" "-259" "12514" "-259" "c.12514-259G>C" "r.(=)" "p.(=)" "" "0000891628" "00006789" "10" "12902" "35" "12902" "35" "c.12902+35G>A" "r.(=)" "p.(=)" "" "0000891629" "00006789" "10" "12902" "46" "12902" "46" "c.12902+46G>A" "r.(=)" "p.(=)" "" "0000891630" "00006789" "10" "13006" "51" "13006" "78" "c.13006+51_13006+78del" "r.(=)" "p.(=)" "" "0000891631" "00006789" "30" "13007" "-154" "13007" "-153" "c.13007-154_13007-153del" "r.(=)" "p.(=)" "" "0000891632" "00006789" "10" "13080" "0" "13080" "0" "c.13080T>C" "r.(?)" "p.(Thr4360=)" "" "0000891633" "00006789" "10" "13219" "-140" "13219" "-140" "c.13219-140G>A" "r.(=)" "p.(=)" "" "0000891634" "00006789" "10" "13372" "9" "13372" "9" "c.13372+9G>A" "r.(=)" "p.(=)" "" "0000891635" "00006789" "30" "13372" "20" "13372" "20" "c.13372+20C>T" "r.(=)" "p.(=)" "" "0000891636" "00006789" "50" "13525" "0" "13525" "0" "c.13525G>A" "r.(?)" "p.(Val4509Met)" "" "0000891637" "00006789" "50" "13757" "0" "13757" "0" "c.13757C>T" "r.(?)" "p.(Pro4586Leu)" "" "0000891638" "00006789" "50" "13807" "0" "13807" "0" "c.13807A>G" "r.(?)" "p.(Ser4603Gly)" "" "0000914121" "00006789" "10" "1173" "0" "1173" "0" "c.1173A>G" "r.(?)" "p.(Gln391=)" "" "0000914122" "00006789" "50" "1678" "0" "1678" "0" "c.1678G>T" "r.(?)" "p.(Val560Leu)" "" "0000914123" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0000914124" "00006789" "50" "7441" "0" "7441" "0" "c.7441A>G" "r.(?)" "p.(Met2481Val)" "" "0000914125" "00006789" "10" "8637" "12" "8637" "12" "c.8637+12G>A" "r.(=)" "p.(=)" "" "0000914126" "00006789" "50" "9263" "5" "9263" "5" "c.9263+5G>A" "r.spl?" "p.?" "" "0000914127" "00006789" "30" "10522" "0" "10522" "0" "c.10522C>A" "r.(?)" "p.(Leu3508Ile)" "" "0000914128" "00006789" "50" "11897" "0" "11897" "0" "c.11897C>T" "r.(?)" "p.(Pro3966Leu)" "" "0000914129" "00006789" "30" "12745" "0" "12745" "0" "c.12745C>G" "r.(?)" "p.(Gln4249Glu)" "" "0000914130" "00006789" "10" "13516" "-16" "13516" "-16" "c.13516-16C>T" "r.(=)" "p.(=)" "" "0000914131" "00006789" "10" "13764" "0" "13764" "0" "c.13764G>A" "r.(?)" "p.(Thr4588=)" "" "0000917012" "00006789" "70" "1706" "0" "1706" "0" "c.1706G>T" "r.(?)" "p.(Arg569Leu)" "" "0000918584" "00006789" "90" "2002" "0" "2002" "0" "c.2002G>A" "r.(?)" "p.(Val668Ile)" "" "0000919578" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0000921051" "00006789" "70" "7059" "0" "7059" "0" "c.7059G>C" "r.(?)" "p.(Leu2353Phe)" "" "0000925824" "00006789" "50" "262" "0" "262" "0" "c.262G>A" "r.(?)" "p.(Val88Ile)" "" "0000925825" "00006789" "30" "5248" "0" "5248" "0" "c.5248G>A" "r.(?)" "p.(Val1750Met)" "" "0000925826" "00006789" "50" "6305" "0" "6305" "0" "c.6305A>G" "r.(?)" "p.(Asn2102Ser)" "" "0000925827" "00006789" "30" "8478" "0" "8478" "0" "c.8478A>G" "r.(?)" "p.(Ala2826=)" "" "0000925828" "00006789" "30" "8507" "1" "8507" "1" "c.8507+1G>T" "r.spl?" "p.?" "" "0000925829" "00006789" "30" "10442" "0" "10442" "0" "c.10442G>A" "r.(?)" "p.(Ser3481Asn)" "" "0000925830" "00006789" "30" "12480" "0" "12480" "0" "c.12480G>A" "r.(?)" "p.(Thr4160=)" "" "0000930258" "00006789" "30" "257" "-15" "257" "-12" "c.257-15_257-12del" "r.(=)" "p.(=)" "" "0000930259" "00006789" "50" "3748" "0" "3748" "0" "c.3748G>T" "r.(?)" "p.(Val1250Leu)" "" "0000930260" "00006789" "30" "10909" "-11" "10909" "-11" "c.10909-11G>A" "r.(=)" "p.(=)" "" "0000939802" "00006789" "70" "587" "0" "587" "0" "c.587T>G" "r.(?)" "p.(Leu196Trp)" "4" "0000945998" "00006789" "90" "9518" "0" "9518" "0" "c.9518C>G" "r.(?)" "p.(Pro3173Arg)" "" "0000945999" "00006789" "90" "1834" "0" "1834" "0" "c.1834G>A" "r.(?)" "p.(Val612Met)" "" "0000946088" "00006789" "50" "407" "0" "407" "0" "c.407G>A" "r.(?)" "p.(Arg136Gln)" "" "0000946089" "00006789" "50" "1963" "0" "1963" "0" "c.1963G>A" "r.(?)" "p.(Asp655Asn)" "" "0000946114" "00006789" "50" "2869" "-3" "2869" "-3" "c.2869-3C>T" "r.spl?" "p.?" "" "0000946115" "00006789" "50" "12496" "0" "12496" "0" "c.12496G>A" "r.(?)" "p.(Val4166Ile)" "" "0000946143" "00006789" "30" "6763" "0" "6763" "0" "c.6763G>A" "r.(?)" "p.(Asp2255Asn)" "" "0000946190" "00006789" "50" "4395" "2" "4395" "2" "c.4395+2C>T" "r.spl?" "p.?" "" "0000950188" "00006789" "30" "519" "-18" "519" "-18" "c.519-18T>C" "r.(=)" "p.(=)" "" "0000950189" "00006789" "30" "962" "-4" "962" "-4" "c.962-4A>G" "r.spl?" "p.?" "" "0000950190" "00006789" "50" "2243" "0" "2243" "0" "c.2243A>G" "r.(?)" "p.(Lys748Arg)" "" "0000950191" "00006789" "30" "3759" "0" "3759" "0" "c.3759C>T" "r.(?)" "p.(Arg1253=)" "" "0000950192" "00006789" "10" "5001" "0" "5001" "0" "c.5001C>T" "r.(?)" "p.(=)" "" "0000950193" "00006789" "50" "6847" "0" "6847" "0" "c.6847G>A" "r.(?)" "p.(Val2283Met)" "" "0000950194" "00006789" "50" "12551" "0" "12551" "0" "c.12551C>G" "r.(?)" "p.(Ala4184Gly)" "" "0000950195" "00006789" "50" "12620" "0" "12620" "0" "c.12620T>C" "r.(?)" "p.(Phe4207Ser)" "" "0000950196" "00006789" "30" "13181" "0" "13181" "0" "c.13181C>T" "r.(?)" "p.(Thr4394Met)" "" "0000967362" "00006789" "50" "27" "0" "27" "0" "c.27C>T" "r.(?)" "p.(=)" "" "0000967364" "00006789" "30" "1173" "0" "1173" "0" "c.1173A>G" "r.(?)" "p.(Gln391=)" "" "0000967374" "00006789" "30" "10203" "0" "10203" "0" "c.10203C>T" "r.(?)" "p.(Asn3401=)" "" "0000967381" "00006789" "30" "13149" "0" "13149" "0" "c.13149C>T" "r.(?)" "p.(=)" "" "0000967382" "00006789" "30" "13359" "0" "13359" "0" "c.13359C>T" "r.(?)" "p.(=)" "" "0000980733" "00006789" "30" "1217" "0" "1217" "0" "c.1217A>T" "r.(?)" "p.(Tyr406Phe)" "" "0000980734" "00006789" "30" "3156" "8" "3156" "8" "c.3156+8A>T" "r.(=)" "p.(=)" "" "0000980735" "00006789" "50" "4289" "0" "4289" "0" "c.4289C>T" "r.(?)" "p.(Thr1430Ile)" "" "0000980736" "00006789" "50" "5026" "0" "5026" "0" "c.5026A>G" "r.(?)" "p.(Ile1676Val)" "" "0000980737" "00006789" "50" "6610" "0" "6610" "0" "c.6610G>T" "r.(?)" "p.(Val2204Phe)" "" "0000980738" "00006789" "50" "7447" "0" "7447" "0" "c.7447A>G" "r.(?)" "p.(Ile2483Val)" "" "0000980739" "00006789" "50" "8020" "0" "8020" "0" "c.8020T>C" "r.(?)" "p.(Tyr2674His)" "" "0000980740" "00006789" "30" "9531" "0" "9531" "0" "c.9531G>A" "r.(?)" "p.(Leu3177=)" "" "0000980741" "00006789" "70" "10172" "0" "10172" "0" "c.10172C>T" "r.(?)" "p.(Pro3391Leu)" "" "0000980742" "00006789" "30" "10754" "10" "10754" "10" "c.10754+10C>T" "r.(=)" "p.(=)" "" "0000980743" "00006789" "70" "11084" "0" "11084" "0" "c.11084G>A" "r.(?)" "p.(Arg3695Gln)" "" "0000980744" "00006789" "50" "11323" "0" "11323" "0" "c.11323A>G" "r.(?)" "p.(Arg3775Gly)" "" "0001000663" "00006789" "50" "499" "0" "499" "0" "c.499G>A" "r.(?)" "p.(Glu167Lys)" "" "0001000664" "00006789" "70" "894" "0" "896" "0" "c.894_896del" "r.(?)" "p.(Leu299del)" "" "0001000665" "00006789" "50" "1817" "0" "1817" "0" "c.1817C>T" "r.(?)" "p.(Thr606Ile)" "" "0001000666" "00006789" "50" "1843" "0" "1843" "0" "c.1843G>A" "r.(?)" "p.(Asp615Asn)" "" "0001000667" "00006789" "30" "2353" "0" "2353" "0" "c.2353G>A" "r.(?)" "p.(Val785Ile)" "" "0001000668" "00006789" "30" "2924" "0" "2924" "0" "c.2924T>C" "r.(?)" "p.(Ile975Thr)" "" "0001000669" "00006789" "50" "3845" "0" "3845" "0" "c.3845T>G" "r.(?)" "p.(Ile1282Arg)" "" "0001000670" "00006789" "50" "5002" "0" "5002" "0" "c.5002G>A" "r.(?)" "p.(Glu1668Lys)" "" "0001000671" "00006789" "50" "5716" "1" "5716" "1" "c.5716+1G>T" "r.spl?" "p.?" "" "0001000672" "00006789" "50" "7462" "0" "7462" "0" "c.7462C>T" "r.(?)" "p.(Arg2488Cys)" "" "0001000673" "00006789" "50" "8948" "0" "8948" "0" "c.8948C>T" "r.(?)" "p.(Ser2983Phe)" "" "0001000674" "00006789" "50" "9865" "0" "9865" "0" "c.9865G>A" "r.(?)" "p.(Val3289Ile)" "" "0001000675" "00006789" "50" "11624" "0" "11624" "0" "c.11624T>C" "r.(?)" "p.(Met3875Thr)" "" "0001000676" "00006789" "50" "11870" "0" "11870" "0" "c.11870T>C" "r.(?)" "p.(Phe3957Ser)" "" "0001000677" "00006789" "30" "12496" "0" "12496" "0" "c.12496G>A" "r.(?)" "p.(Val4166Ile)" "" "0001000678" "00006789" "30" "13358" "0" "13358" "0" "c.13358A>G" "r.(?)" "p.(Asn4453Ser)" "" "0001000679" "00006789" "30" "13706" "0" "13706" "0" "c.13706C>T" "r.(?)" "p.(Thr4569Met)" "" "0001000680" "00006789" "30" "13750" "0" "13750" "0" "c.13750G>T" "r.(?)" "p.(Ala4584Ser)" "" "0001015099" "00006789" "30" "-13" "0" "-13" "0" "c.-13C>G" "r.(?)" "p.(=)" "" "0001015100" "00006789" "10" "6221" "13" "6221" "13" "c.6221+13G>T" "r.(=)" "p.(=)" "" "0001015101" "00006789" "50" "7418" "0" "7418" "0" "c.7418A>T" "r.(?)" "p.(Asn2473Ile)" "" "0001015102" "00006789" "30" "8638" "-7" "8638" "-7" "c.8638-7T>C" "r.(=)" "p.(=)" "" "0001015103" "00006789" "30" "9048" "14" "9048" "14" "c.9048+14G>A" "r.(=)" "p.(=)" "" "0001015104" "00006789" "30" "9171" "0" "9171" "0" "c.9171G>A" "r.(?)" "p.(=)" "" "0001015105" "00006789" "10" "10908" "10" "10908" "10" "c.10908+10G>A" "r.(=)" "p.(=)" "" "0001015106" "00006789" "10" "11595" "12" "11595" "12" "c.11595+12T>C" "r.(=)" "p.(=)" "" "0001015107" "00006789" "10" "13062" "0" "13062" "0" "c.13062C>T" "r.(?)" "p.(=)" "" "0001023418" "00006789" "90" "6994" "0" "6994" "0" "c.6994C>T" "r.(?)" "p.(Arg2332Cys)" "" "0001026347" "00006789" "70" "1202" "0" "1202" "0" "c.1202T>G" "r.(?)" "p.(Leu401Trp)" "" "0001026348" "00006789" "30" "7524" "0" "7524" "0" "c.7524A>G" "r.(?)" "p.(Leu2508=)" "" "0001039769" "00006789" "50" "256" "5" "256" "5" "c.256+5G>A" "r.spl?" "p.?" "" "0001039770" "00006789" "30" "1916" "0" "1916" "0" "c.1916G>A" "r.(?)" "p.(Arg639His)" "" "0001039771" "00006789" "30" "2869" "-266" "2869" "-266" "c.2869-266G>A" "r.(=)" "p.(=)" "" "0001039772" "00006789" "50" "5282" "0" "5282" "0" "c.5282A>G" "r.(?)" "p.(Asn1761Ser)" "" "0001039773" "00006789" "30" "6795" "0" "6795" "0" "c.6795C>T" "r.(?)" "p.(=)" "" "0001039774" "00006789" "10" "8784" "0" "8784" "0" "c.8784A>G" "r.(?)" "p.(Gln2928=)" "" "0001039775" "00006789" "30" "8784" "0" "8784" "0" "c.8784A>G" "r.(?)" "p.(Gln2928=)" "" "0001039776" "00006789" "30" "9565" "0" "9565" "0" "c.9565G>A" "r.(?)" "p.(Glu3189Lys)" "" "0001039777" "00006789" "50" "10442" "0" "10442" "0" "c.10442G>A" "r.(?)" "p.(Ser3481Asn)" "" "0001039778" "00006789" "30" "11865" "15" "11865" "15" "c.11865+15G>A" "r.(=)" "p.(=)" "" "0001039779" "00006789" "30" "11928" "0" "11928" "0" "c.11928A>G" "r.(?)" "p.(=)" "" "0001039780" "00006789" "50" "13648" "0" "13648" "0" "c.13648G>A" "r.(?)" "p.(Gly4550Ser)" "" "0001045534" "00006789" "70" "10030" "0" "10030" "0" "c.10030C>T" "r.(?)" "p.(Arg3344Trp)" "52" "0001045540" "00006789" "70" "10436" "0" "10436" "0" "c.10436T>C" "r.(10436T>C)" "p.(Leu3479Pro)" "55" "0001046456" "00006789" "30" "609" "0" "609" "0" "c.609G>A" "r.(?)" "p.(=)" "" "0001046457" "00006789" "30" "9531" "0" "9531" "0" "c.9531G>A" "r.(?)" "p.(Leu3177=)" "" "0001046458" "00006789" "50" "11344" "0" "11344" "0" "c.11344A>G" "r.(?)" "p.(Arg3782Gly)" "" "0001048414" "00006789" "50" "8377" "0" "8382" "0" "c.8377_8382del" "r.(?)" "p.(Ile2793_Tyr2794del)" "42" "0001054971" "00006789" "50" "262" "0" "262" "0" "c.262G>A" "r.(?)" "p.(Val88Ile)" "" "0001054972" "00006789" "50" "1520" "0" "1520" "0" "c.1520T>C" "r.(?)" "p.(Val507Ala)" "" "0001054973" "00006789" "90" "1792" "0" "1792" "0" "c.1792C>T" "r.(?)" "p.(Arg598Cys)" "" "0001054974" "00006789" "50" "4079" "0" "4079" "0" "c.4079G>A" "r.(?)" "p.(Arg1360Gln)" "" "0001054975" "00006789" "50" "8519" "0" "8519" "0" "c.8519A>G" "r.(?)" "p.(Asp2840Gly)" "" "0001054976" "00006789" "30" "9178" "0" "9178" "0" "c.9178C>T" "r.(?)" "p.(Arg3060Cys)" "" "0001058618" "00006789" "90" "10573" "0" "10573" "0" "c.10573C>T" "r.(?)" "p.(Arg3525Cys)" "" "0001058619" "00006789" "70" "5882" "0" "5882" "0" "c.5882A>G" "r.(?)" "p.(Asn1961Ser)" "" "0001058620" "00006789" "70" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Arg251Cys)" "" "0001062891" "00006789" "70" "751" "0" "751" "0" "c.751C>T" "r.(?)" "p.(Arg251Cys)" "4" "0001066133" "00006789" "70" "4699" "0" "4699" "0" "c.4699C>T" "r.(?)" "p.(Arg1567Trp)" "" "0001066134" "00006789" "30" "5248" "0" "5248" "0" "c.5248G>A" "r.(?)" "p.(Val1750Met)" "" "0001066135" "00006789" "50" "5638" "0" "5638" "0" "c.5638G>A" "r.(?)" "p.(Val1880Ile)" "" "0001066136" "00006789" "50" "6763" "0" "6763" "0" "c.6763G>A" "r.(?)" "p.(Asp2255Asn)" "" "0001066137" "00006789" "50" "8055" "5" "8055" "5" "c.8055+5G>T" "r.spl?" "p.?" "" "0001066138" "00006789" "50" "8140" "0" "8140" "0" "c.8140C>T" "r.(?)" "p.(Pro2714Ser)" "" "0001066139" "00006789" "50" "10639" "0" "10639" "0" "c.10639A>G" "r.(?)" "p.(Ile3547Val)" "" "0001066140" "00006789" "50" "10988" "0" "10988" "0" "c.10988C>T" "r.(?)" "p.(Thr3663Ile)" "" "0001068625" "00006789" "90" "1741" "0" "1741" "0" "c.1741A>T" "r.(?)" "p.(Met581Leu)" "" "0001069141" "00006789" "50" "6910" "0" "6910" "0" "c.6910G>A" "r.(?)" "p.(Asp2304Asn)" "" "0001069579" "00006789" "70" "10422" "0" "10424" "0" "c.10422_10424dup" "r.(?)" "p.(Arg3474dup)" "" "0001069797" "00006789" "90" "752" "0" "752" "0" "c.752G>A" "r.(?)" "p.(Arg251His)" "" "0001069822" "00006789" "50" "10561" "0" "10561" "0" "c.10561G>C" "r.(?)" "p.(Asp3521His)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 76 "{{screeningid}}" "{{variantid}}" "0000022371" "0000044717" "0000081017" "0000130103" "0000181054" "0000404690" "0000184020" "0000407958" "0000209003" "0000439075" "0000211063" "0000442481" "0000270631" "0000604416" "0000288548" "0000644804" "0000289370" "0000645299" "0000292132" "0000648821" "0000296737" "0000653436" "0000300801" "0000663699" "0000301103" "0000663998" "0000301152" "0000664047" "0000301153" "0000664048" "0000301154" "0000664049" "0000301155" "0000664050" "0000301156" "0000664051" "0000301157" "0000664052" "0000301158" "0000664053" "0000301159" "0000664054" "0000301160" "0000664055" "0000301222" "0000664117" "0000301257" "0000664152" "0000304112" "0000667510" "0000307107" "0000673711" "0000312278" "0000693853" "0000315411" "0000697500" "0000316061" "0000698187" "0000316077" "0000698203" "0000316666" "0000698827" "0000316667" "0000698828" "0000316668" "0000698829" "0000316669" "0000698830" "0000325528" "0000708538" "0000325599" "0000708721" "0000336168" "0000735294" "0000375458" "0000787459" "0000375912" "0000787263" "0000375913" "0000787264" "0000375914" "0000787265" "0000376836" "0000788891" "0000378349" "0000791100" "0000378350" "0000791101" "0000400056" "0000832809" "0000400057" "0000832810" "0000400234" "0000833041" "0000403969" "0000839544" "0000409944" "0000847160" "0000415654" "0000873499" "0000416365" "0000874410" "0000421189" "0000881825" "0000432963" "0000918584" "0000433928" "0000919578" "0000435114" "0000921051" "0000441860" "0000939802" "0000444141" "0000945998" "0000444142" "0000945999" "0000444231" "0000946088" "0000444232" "0000946089" "0000444252" "0000946190" "0000444258" "0000946114" "0000444259" "0000946115" "0000444287" "0000946143" "0000467651" "0001045534" "0000467653" "0001045540" "0000468538" "0001048414" "0000470496" "0001058618" "0000470497" "0001058619" "0000470498" "0001058620" "0000473921" "0001062891" "0000474329" "0001068625" "0000474743" "0001069141" "0000475183" "0001069579" "0000475402" "0001069797" "0000475427" "0001069822"