### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = EDN3)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"EDN3" "endothelin 3" "20" "q13.2-q13.3" "unknown" "NG_008050.1" "UD_132084434798" "" "https://www.LOVD.nl/ED3" "" "1" "3178" "1908" "131242" "1" "1" "1" "1" "Initiated as Waardenburg syndrome gene variant databases by Veronique Pingault.\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/EDN3_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2009-10-05 00:00:00" "00006" "2020-10-28 09:55:37" "00006" "2025-11-13 15:11:47"
## Transcripts ## Do not remove or alter this header ##
## Count = 2
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00006873" "EDN3" "transcript variant 1" "003" "NM_000114.2" "" "NP_000105.1" "" "" "" "-369" "2029" "717" "57875499" "57901047" "" "0000-00-00 00:00:00" "" ""
"00025776" "EDN3" "transcript variant 4" "002" "NM_207034.1" "" "NP_996917.1" "" "" "" "-369" "2250" "717" "57875499" "57901047" "00006" "2022-12-18 12:43:26" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 7
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"01271" "CDHS" "craniofacial deafness hand syndrome (CDHS)" "AD" "122880" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03295" "WS4B" "Waardenburg syndrome, type 4B (WS4B)" "AD;AR" "613265" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-10-28 09:56:27"
"03402" "HSCR4" "Hirschsprung disease, type 4 (HSCR-4)" "AD" "613712" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"05103" "deafness" "deafness" "" "" "" "" "" "00006" "2015-12-02 12:30:46" "00006" "2017-08-25 19:47:08"
"05667" "WS" "Waardenburg syndrome (WS)" "" "" "" "" "" "00008" "2019-10-30 16:28:42" "00006" "2021-12-10 21:51:32"
"05863" "HSCR" "Hirschsprung disease (HSCR)" "" "" "" "" "" "00006" "2020-10-26 17:45:34" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"EDN3" "03295"
"EDN3" "03402"
## Individuals ## Do not remove or alter this header ##
## Count = 29
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00285365" "" "" "" "1" "" "00004" "{PMID:Sangkhathat 2006:17009072}" "" "" "" "" "" "0" "" "" "" ""
"00285366" "" "" "" "1" "" "00004" "{PMID:Garcia-Barceló 2004:14633923}" "" "" "" "" "" "0" "" "" "" ""
"00285368" "" "" "" "1" "" "00004" "{PMID:Svensson 1999:10231870}" "" "" "" "" "" "0" "" "" "" ""
"00285376" "" "" "" "1" "" "00004" "{PMID:Miller 2010:20466091}, {PMID:Farwell 2015:25356970}" "" "" "" "" "" "0" "" "" "" ""
"00285378" "" "" "" "1" "" "00004" "{PMID:Sangkhathat 2006:17009072}" "" "" "" "" "" "0" "" "" "" ""
"00285379" "" "" "" "1" "" "00004" "{PMID:Xiong 2015:25525159}" "" "" "" "" "" "0" "" "" "" ""
"00285380" "" "" "" "1" "" "00004" "{PMID:Sangkhathat 2006:17009072}" "" "" "" "" "" "0" "" "" "" ""
"00285381" "" "" "" "1" "" "00004" "{PMID:Miyagawa 2013:23967202}" "" "" "" "" "" "0" "" "" "" ""
"00315505" "" "" "" "1" "" "03808" "{PMID:Bidaud 1997:9359047}, {PMID:Garcia-Barcelo 2004:14633923}" "" "" "" "" "" "0" "" "" "" ""
"00315506" "" "" "" "2" "" "03808" "{PMID:Bidaud 1997:9359047}, {PMID:Bidaud 1997:9587491}" "" "M" "yes" "" "" "0" "" "" "" ""
"00315507" "" "" "" "2" "" "03808" "{PMID:Edery 1996:8630502}, {PMID:Bidaud 1997:9587491}" "" "F" "no" "" "" "0" "" "" "" ""
"00315508" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "M" "no" "Bosnia and Herzegovina" "" "0" "" "" "Bosnia" ""
"00315509" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "F" "no" "" "" "0" "" "" "" ""
"00315510" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "M" "yes" "India;Madagascar" "" "0" "" "" "Caribbean" ""
"00315511" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "M" "yes" "India" "" "0" "" "" "" ""
"00315512" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "F" "" "India" "" "0" "" "" "" ""
"00315513" "" "" "" "1" "" "03808" "{PMID:Vinuela 2009:19764030}" "" "M" "yes" "" "" "0" "" "" "" ""
"00315514" "" "" "" "1" "" "03808" "{PMID:Pingault 2002:12189494}" "" "M" "" "India" "" "0" "" "" "" ""
"00315515" "" "" "" "1" "" "03808" "{PMID:Hofstra 1996:8630503}" "" "" "yes" "Pakistan" "" "0" "" "" "" ""
"00315516" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "" "yes" "Pakistan" "" "0" "" "" "" ""
"00315517" "" "" "" "1" "" "03808" "{PMID:Pingault 2010:20127975}" "" "" "yes" "Pakistan" "" "0" "" "" "" ""
"00315518" "" "" "" "1" "" "03808" "{PMID:Pingault 2001:11303518}" "" "F" "" "Yugoslavia" "" "0" "" "" "" ""
"00315519" "" "" "" "1" "" "03808" "{PMID:Bolk 1996:8696331}" "" "" "" "" "" "0" "" "" "" ""
"00315520" "" "" "" "1" "" "03808" "{PMID:Bidaud 1997:9359047}" "" "" "" "" "" "0" "" "" "" ""
"00315521" "" "" "" "1" "" "03808" "{PMID:Shamseldin 2010:20583152}" "" "M" "" "Egypt" "" "0" "" "" "" ""
"00315522" "" "" "" "1" "" "03808" "{PMID:Kapoor 2012:22876130}" "patient also has Duchenne muscular dystrophy, homozygote brother has WS4" "M" "yes" "India" "" "0" "" "" "" ""
"00315557" "" "" "" "5" "" "03808" "{PMID:Cui 2013:23840513}" "3-generation family, 5 affected (2F, 3M), mixed phenotypes" "M" "" "Brazil" "" "0" "" "" "European" "FamPatII5"
"00428017" "" "" "" "1" "" "00006" "{PMID:Bournazos 2022:34906502}" "family, 1 affected" "" "" "Australia" "" "0" "" "" "" "A158"
"00468843" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040)" "" "" "United States" "" "0" "" "" "" ""
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 28
"{{individualid}}" "{{diseaseid}}"
"00285365" "00198"
"00285366" "00198"
"00285368" "00198"
"00285378" "00198"
"00285379" "05667"
"00285380" "00198"
"00285381" "05103"
"00315505" "05863"
"00315506" "05667"
"00315507" "05667"
"00315508" "05667"
"00315509" "05667"
"00315510" "05667"
"00315511" "05667"
"00315512" "05667"
"00315513" "05667"
"00315514" "05667"
"00315515" "05667"
"00315516" "05667"
"00315517" "05667"
"00315518" "05667"
"00315519" "01271"
"00315520" "05863"
"00315521" "05667"
"00315522" "05667"
"00315557" "05863"
"00428017" "00198"
"00468843" "00198"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00198, 01271, 03295, 03402, 05103, 05667, 05863
## Count = 28
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000217224" "00198" "00285365" "00008" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000217225" "00198" "00285366" "00008" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000217227" "00198" "00285368" "00008" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000217233" "00198" "00285378" "00008" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000217234" "00198" "00285380" "00008" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000218639" "05103" "00285381" "00008" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "deafness" ""
"0000219392" "05667" "00285379" "00008" "Unknown" "" "Hirschsprung disease" "" "" "" "" "" "" "" "" "" "Waardenburg syndrome" ""
"0000239250" "05863" "00315505" "03808" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000239251" "05667" "00315506" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239252" "05667" "00315507" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239253" "05667" "00315508" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239254" "05667" "00315509" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239255" "05667" "00315510" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239256" "05667" "00315511" "03808" "Familial, autosomal recessive" "" "depigmentations in heterozygous relatives" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239257" "05667" "00315512" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239258" "05667" "00315513" "03808" "Familial, autosomal recessive" "" "depigmentation, deafness in heterozygous relatives" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239259" "05667" "00315514" "03808" "Familial, autosomal recessive" "" "depigmentation, deafness in heterozygous relatives" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239260" "05667" "00315515" "03808" "Familial, autosomal recessive" "" "depigmentation in heterozygous relatives" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239261" "05667" "00315516" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239262" "05667" "00315517" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239263" "05667" "00315518" "03808" "Unknown" "" "" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239264" "01271" "00315519" "03808" "Unknown" "" "" "" "" "" "" "" "" "" "" "CDHS" "craniofacial deafness hand syndrome" ""
"0000239265" "05863" "00315520" "03808" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000239266" "05667" "00315521" "03808" "Familial, autosomal recessive" "" "hypoplastic ears. Consanguineous family" "" "" "" "" "" "" "" "" "WS4" "Waardenburg syndrome" ""
"0000239267" "05667" "00315522" "03808" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "WS2" "Waardenburg syndrome" ""
"0000239313" "05863" "00315557" "03808" "Familial, autosomal dominant" "" "see paper; ..., Hirschsprung disease, heterochromia iridum" "" "" "" "" "" "" "" "" "" "Hirschsprung disease" ""
"0000318963" "00198" "00428017" "00006" "Unknown" "3y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000353996" "00198" "00468843" "00006" "Unknown" "" "developmental dealy, short stature, hearing loss, brachydactyly" "" "" "" "" "" "" "" "" "" "multiple congenital anomalies" ""
## Screenings ## Do not remove or alter this header ##
## Count = 29
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000286515" "00285365" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286516" "00285366" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286518" "00285368" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286526" "00285376" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286528" "00285378" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286529" "00285379" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286530" "00285380" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000286531" "00285381" "1" "00004" "00008" "2020-02-05 13:36:16" "" "" "?" "DNA" "" ""
"0000316685" "00315505" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:27:12" "SSCA;SEQ" "DNA" "" ""
"0000316686" "00315506" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:27:35" "SSCA;SEQ" "DNA" "" ""
"0000316687" "00315507" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:28:02" "SEQ" "DNA" "" ""
"0000316688" "00315508" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:29:32" "SEQ" "DNA" "" ""
"0000316689" "00315509" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:29:54" "SEQ" "DNA" "" ""
"0000316690" "00315510" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:30:20" "SEQ" "DNA" "" ""
"0000316691" "00315511" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:30:51" "SEQ" "DNA" "" ""
"0000316692" "00315512" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:31:11" "SEQ" "DNA" "" ""
"0000316693" "00315513" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:32:17" "SEQ" "DNA" "" ""
"0000316694" "00315514" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:32:49" "SEQ" "DNA" "" ""
"0000316695" "00315515" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:33:12" "DGGE;SEQ" "DNA" "" ""
"0000316696" "00315516" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:33:39" "SEQ" "DNA" "" ""
"0000316697" "00315517" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:34:00" "SEQ" "DNA" "" ""
"0000316698" "00315518" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:34:18" "SSCA;SEQ" "DNA" "" ""
"0000316699" "00315519" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:34:40" "SSCA;SEQ" "DNA" "" ""
"0000316700" "00315520" "1" "03808" "03808" "2009-11-18 13:59:47" "03808" "2010-02-04 15:35:02" "SSCA;SEQ" "DNA" "" ""
"0000316701" "00315521" "1" "03808" "03808" "2013-12-27 09:27:00" "" "" "SEQ" "DNA" "" ""
"0000316702" "00315522" "1" "03808" "03808" "2013-12-27 09:27:00" "" "" "SEQ" "DNA" "" ""
"0000316737" "00315557" "1" "03808" "03808" "2013-12-27 09:27:00" "00006" "2020-10-28 09:12:55" "arrayCGH;SEQ" "DNA" "" ""
"0000429430" "00428017" "1" "00006" "00006" "2022-12-19 13:11:26" "" "" "RT-PCR;SEQ;SEQ-NG-RNA" "DNA;RNA" "whole blood, urothelial cells" "trio WES"
"0000470511" "00468843" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 27
"{{screeningid}}" "{{geneid}}"
"0000286515" "EDN3"
"0000286516" "EDN3"
"0000286518" "EDN3"
"0000286526" "EDN3"
"0000286528" "EDN3"
"0000286529" "EDN3"
"0000286530" "EDN3"
"0000286531" "EDN3"
"0000316685" "EDN3"
"0000316686" "EDN3"
"0000316687" "EDN3"
"0000316688" "EDN3"
"0000316689" "EDN3"
"0000316690" "EDN3"
"0000316691" "EDN3"
"0000316692" "EDN3"
"0000316693" "EDN3"
"0000316694" "EDN3"
"0000316695" "EDN3"
"0000316696" "EDN3"
"0000316697" "EDN3"
"0000316698" "EDN3"
"0000316699" "EDN3"
"0000316700" "EDN3"
"0000316701" "EDN3"
"0000316702" "EDN3"
"0000316737" "EDNRB"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 49
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000275903" "0" "50" "20" "57876690" "57876690" "subst" "4.06441E-6" "01943" "EDN3_000016" "g.57876690G>A" "" "" "" "EDN3(NM_207032.2):c.278G>A (p.R93Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.59301635G>A" "" "VUS" ""
"0000349338" "0" "50" "20" "57897449" "57897449" "dup" "0" "02327" "EDN3_000011" "g.57897449dup" "" "" "" "EDN3(NM_207032.2):c.565dupA (p.T189Nfs*63)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.59322394dup" "" "VUS" ""
"0000570129" "0" "30" "20" "57876579" "57876602" "del" "0" "01943" "EDN3_000018" "g.57876579_57876602del" "" "" "" "EDN3(NM_207032.2):c.167_190delAGACTGTGGCTGGCCCTGGCGAGG (p.E56_E63del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59301524_59301547del" "" "likely benign" ""
"0000570130" "0" "50" "20" "57897449" "57897449" "dup" "0" "01943" "EDN3_000011" "g.57897449dup" "" "" "" "EDN3(NM_207032.2):c.565dupA (p.T189Nfs*63)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59322394dup" "" "VUS" ""
"0000570131" "0" "50" "20" "57897452" "57897453" "del" "0" "01943" "EDN3_000019" "g.57897452_57897453del" "" "" "" "EDN3(NM_207032.2):c.568_569delGA (p.D190Qfs*61)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59322397_59322398del" "" "VUS" ""
"0000570132" "0" "30" "20" "57899443" "57899443" "subst" "0" "01943" "EDN3_000020" "g.57899443A>C" "" "" "" "EDN3(NM_207034.2):c.646A>C (p.M216L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59324388A>C" "" "likely benign" ""
"0000618243" "0" "30" "20" "57876507" "57876507" "subst" "4.13876E-6" "01943" "EDN3_000021" "g.57876507G>C" "" "" "" "EDN3(NM_207032.2):c.95G>C (p.G32A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59301452G>C" "" "likely benign" ""
"0000618244" "0" "50" "20" "57897432" "57897432" "subst" "0" "01943" "EDN3_000022" "g.57897432C>T" "" "" "" "EDN3(NM_207032.2):c.548C>T (p.S183L), EDN3(NM_207034.3):c.548C>T (p.(Ser183Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59322377C>T" "" "VUS" ""
"0000642257" "1" "99" "20" "57875743" "57875743" "subst" "0" "00004" "EDN3_000023" "g.57875743G>A" "" "{DB:DVD}, {PMID:Sangkhathat 2006:17009072}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59300688G>A" "" "pathogenic" ""
"0000642258" "1" "99" "20" "57876556" "57876556" "subst" "4.08904E-6" "00004" "EDN3_000024" "g.57876556G>C" "" "{DB:DVD}, {PMID:Garcia-Barceló 2004:14633923}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59301501G>C" "" "pathogenic" ""
"0000642260" "1" "99" "20" "57876674" "57876674" "dup" "0" "00004" "EDN3_000025" "g.57876674dup" "" "{DB:DVD}, {PMID:Svensson 1999:10231870}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59301619dup" "" "pathogenic" ""
"0000642268" "1" "55" "20" "57896178" "57896178" "subst" "4.06058E-6" "00004" "EDN3_000026" "g.57896178C>A" "" "{DB:DVD}, {PMID:Miller 2010:20466091}, {PMID:Farwell 2015:25356970}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59321123C>A" "" "VUS" ""
"0000642270" "1" "99" "20" "57896204" "57896204" "subst" "0" "00004" "EDN3_000027" "g.57896204C>G" "" "{DB:DVD}, {PMID:Sangkhathat 2006:17009072}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59321149C>G" "" "pathogenic" ""
"0000642271" "1" "99" "20" "57896213" "57896213" "subst" "0" "00004" "EDN3_000009" "g.57896213C>A" "" "{DB:DVD}, {PMID:Xiong 2015:25525159}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59321158C>A" "" "pathogenic" ""
"0000642272" "1" "99" "20" "57896223" "57896223" "subst" "0" "00004" "EDN3_000010" "g.57896223T>C" "" "{DB:DVD}, {PMID:Sangkhathat 2006:17009072}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59321168T>C" "" "pathogenic" ""
"0000642273" "1" "99" "20" "57897438" "57897438" "subst" "8.52785E-5" "00004" "EDN3_000028" "g.57897438C>T" "" "{DB:DVD}, {PMID:Miyagawa 2013:23967202}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.59322383C>T" "" "pathogenic" ""
"0000658789" "0" "30" "20" "57876615" "57876615" "subst" "4.07571E-6" "01943" "EDN3_000029" "g.57876615C>T" "" "" "" "EDN3(NM_207032.2):c.203C>T (p.P68L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.59301560C>T" "" "likely benign" ""
"0000681669" "0" "30" "20" "57875913" "57875913" "subst" "1.26815E-5" "01943" "EDN3_000030" "g.57875913G>A" "" "" "" "EDN3(NM_207032.2):c.46G>A (p.A16T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000698847" "0" "73" "20" "57875916" "57875916" "subst" "0.00323475" "03808" "EDN3_000001" "g.57875916G>A" "0.007" "{PMID:Bidaud 1997:9359047}, {PMID:Garcia-Barcelo 2004:14633923}" "" "A17T" "initialy reported as a Hirschsprung disease-causing variant" "Germline" "" "rs11570255" "0" "" "" "g.59300861G>A" "" "likely pathogenic" ""
"0000698848" "0" "99" "20" "57876575" "57876575" "subst" "0" "03808" "EDN3_000002" "g.57876575G>T" "" "{PMID:Bidaud 1997:9359047}, {PMID:Bidaud 1997:9587491}" "" "E55X" "" "Germline" "" "" "0" "" "" "g.59301520G>T" "" "pathogenic" ""
"0000698849" "0" "99" "20" "57876674" "57876675" "delins" "0" "03808" "EDN3_000003" "g.57876674_57876675delinsT" "" "{PMID:Edery 1996:8630502}, {PMID:Bidaud 1997:9587491}" "" "262 GC>T" "" "Germline" "" "" "0" "" "" "g.59301619_59301620delinsT" "" "pathogenic" ""
"0000698850" "0" "99" "20" "57876674" "57876675" "delins" "0" "03808" "EDN3_000003" "g.57876674_57876675delinsT" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59301619_59301620delinsT" "" "pathogenic" ""
"0000698851" "0" "77" "20" "57876698" "57876698" "subst" "0" "03808" "EDN3_000004" "g.57876698C>T" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59301643C>T" "" "likely pathogenic" ""
"0000698852" "0" "77" "20" "57876705" "57876705" "subst" "2.03242E-5" "03808" "EDN3_000005" "g.57876705C>A" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59301650C>A" "" "likely pathogenic" ""
"0000698853" "0" "77" "20" "57876705" "57876705" "subst" "2.03242E-5" "03808" "EDN3_000005" "g.57876705C>A" "" "{PMID:Pingault 2010:20127975}" "" "" "variant has been excluded as a frequent polymorphism in a control population of India" "Germline" "" "" "0" "" "" "g.59301650C>A" "" "likely pathogenic" ""
"0000698854" "11" "77" "20" "57876705" "57876705" "subst" "2.03242E-5" "03808" "EDN3_000005" "g.57876705C>A" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59301650C>A" "" "likely pathogenic (recessive)" ""
"0000698855" "21" "77" "20" "57896223" "57896223" "subst" "0" "03808" "EDN3_000010" "g.57896223T>C" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59321168T>C" "" "likely pathogenic (recessive)" ""
"0000698856" "0" "77" "20" "57876747" "57876747" "subst" "0" "03808" "EDN3_000006" "g.57876747A>G" "" "{PMID:Vinuela 2009:19764030}" "" "" "" "Germline" "" "" "0" "" "" "g.59301692A>G" "" "likely pathogenic" ""
"0000698857" "0" "77" "20" "57896086" "57896086" "subst" "4.06114E-6" "03808" "EDN3_000007" "g.57896086A>G" "" "{PMID:Pingault 2002:12189494}" "" "Y127C" "" "Germline" "" "" "0" "" "" "g.59321031A>G" "" "likely pathogenic" ""
"0000698858" "0" "77" "20" "57896182" "57896182" "subst" "0" "03808" "EDN3_000008" "g.57896182G>T" "" "{PMID:Hofstra 1996:8630503}" "" "" "" "Germline" "" "" "0" "" "" "g.59321127G>T" "" "likely pathogenic" ""
"0000698859" "0" "77" "20" "57896182" "57896182" "subst" "0" "03808" "EDN3_000008" "g.57896182G>T" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59321127G>T" "" "likely pathogenic" ""
"0000698860" "0" "77" "20" "57896182" "57896182" "subst" "0" "03808" "EDN3_000008" "g.57896182G>T" "" "{PMID:Pingault 2010:20127975}" "" "" "" "Germline" "" "" "0" "" "" "g.59321127G>T" "" "likely pathogenic" ""
"0000698861" "21" "99" "20" "57896213" "57896213" "subst" "0" "03808" "EDN3_000009" "g.57896213C>A" "" "{PMID:Pingault 2001:11303518}" "" "C169X" "" "Germline" "" "" "0" "" "" "g.59321158C>A" "" "pathogenic" ""
"0000698862" "0" "73" "20" "57897449" "57897449" "dup" "0" "03808" "EDN3_000011" "g.57897449dup" "0.006" "{PMID:Bolk 1996:8696331}" "" "565dupA" "initialy reported as a CCHS-causing mutation; functional test show no alteration of the proteolytic processing of preproendothelin" "Germline" "" "rs11570344" "0" "" "" "g.59322394dup" "" "likely pathogenic" ""
"0000698863" "0" "73" "20" "57899467" "57899467" "subst" "0.000402537" "03808" "EDN3_000012" "g.57899467G>A" "0.006" "{PMID:Bidaud 1997:9359047}" "" "A224T" "initialy reported as a Hirschsprung disease-causing mutation" "Unknown" "" "rs11570351" "0" "" "" "g.59324412G>A" "" "likely pathogenic" ""
"0000698864" "0" "77" "20" "57876689" "57876689" "subst" "0" "03808" "EDN3_000013" "g.57876689C>G" "" "{PMID:Shamseldin 2010:20583152}" "" "" "predicted to alter furin cleavage" "Germline" "" "" "0" "" "" "g.59301634C>G" "" "likely pathogenic" ""
"0000698865" "0" "77" "20" "57876705" "57876705" "subst" "0" "03808" "EDN3_000014" "g.57876705C>T" "" "{PMID:Kapoor 2012:22876130}" "" "" "not in 50 ehtnically matched controls" "Germline" "" "" "0" "" "" "g.59301650C>T" "" "likely pathogenic" ""
"0000698915" "0" "73" "20" "57875620" "57875620" "subst" "0" "03808" "EDN3_000015" "g.57875620G>A" "" "{PMID:Cui 2013:23840513}" "" "" "suggested to alter mRNA expression, but found in control population PMID20009762:Sanchez-Mejias 2010; also has 45 kb de novo duplication DACH1" "Germline" "" "" "0" "" "" "g.59300565G>A" "" "likely benign" ""
"0000727808" "0" "50" "20" "57876725" "57876725" "subst" "0" "02327" "EDN3_000031" "g.57876725A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000908903" "0" "50" "20" "57876778" "57876778" "subst" "0" "00006" "EDN3_000032" "g.57876778G>C" "" "{PMID:Bournazos 2022:34906502}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.59301723G>C" "" "VUS" ""
"0000983868" "0" "50" "20" "57896160" "57896160" "subst" "4.06055E-6" "01804" "EDN3_000033" "g.57896160T>C" "" "" "" "EDN3(NM_207034.3):c.454T>C (p.(Ser152Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000983869" "0" "50" "20" "57896161" "57896161" "subst" "4.06055E-6" "01804" "EDN3_000034" "g.57896161C>T" "" "" "" "EDN3(NM_207034.3):c.455C>T (p.(Ser152Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001005506" "0" "30" "20" "57899468" "57899468" "subst" "8.13107E-6" "01804" "EDN3_000035" "g.57899468C>T" "" "" "" "EDN3(NM_207034.1):c.671C>T (p.(Ala224Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001005507" "0" "50" "20" "57899485" "57899485" "subst" "3.25489E-5" "01804" "EDN3_000036" "g.57899485C>T" "" "" "" "EDN3(NM_207034.1):c.688C>T (p.(Arg230Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001043457" "0" "50" "20" "57876579" "57876602" "dup" "0" "01804" "EDN3_000037" "g.57876579_57876602dup" "" "" "" "EDN3(NM_207034.3):c.167_190dup (p.(Glu56_Glu63dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001043458" "0" "50" "20" "57876669" "57876669" "subst" "0.000121941" "02325" "EDN3_000038" "g.57876669A>T" "" "" "" "EDN3(NM_207034.3):c.257A>T (p.E86V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001043459" "0" "50" "20" "57897452" "57897455" "del" "0" "02325" "EDN3_000039" "g.57897452_57897455del" "" "" "" "EDN3(NM_207034.3):c.568_571delGACA (p.D190Kfs*18)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001056942" "0" "50" "20" "57897432" "57897432" "subst" "0" "01804" "EDN3_000022" "g.57897432C>T" "" "" "" "EDN3(NM_207032.2):c.548C>T (p.S183L), EDN3(NM_207034.3):c.548C>T (p.(Ser183Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001058633" "11" "90" "20" "57897449" "57897449" "dup" "0" "00006" "EDN3_000011" "g.57897449dup" "" "{PMID:Retterer 2016:26633542}" "" "565dupA" "" "Germline" "" "" "0" "" "" "g.59322394dup" "" "pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes EDN3
## Count = 68
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000275903" "00025776" "50" "278" "0" "278" "0" "c.278G>A" "r.(?)" "p.(Arg93Gln)" ""
"0000275903" "00006873" "50" "278" "0" "278" "0" "c.278G>A" "r.(?)" "p.(Arg93Gln)" "2"
"0000349338" "00025776" "50" "565" "0" "565" "0" "c.565dup" "r.(?)" "p.(Thr189AsnfsTer10)" ""
"0000349338" "00006873" "50" "565" "0" "565" "0" "c.565dup" "r.(?)" "p.(Thr189AsnfsTer10)" "4"
"0000570129" "00025776" "30" "167" "0" "190" "0" "c.167_190del" "r.(?)" "p.(Glu56_Glu63del)" ""
"0000570129" "00006873" "30" "167" "0" "190" "0" "c.167_190del" "r.(?)" "p.(Glu56_Glu63del)" "2"
"0000570130" "00025776" "50" "565" "0" "565" "0" "c.565dup" "r.(?)" "p.(Thr189AsnfsTer10)" ""
"0000570130" "00006873" "50" "565" "0" "565" "0" "c.565dup" "r.(?)" "p.(Thr189AsnfsTer10)" "4"
"0000570131" "00025776" "50" "568" "0" "569" "0" "c.568_569del" "r.(?)" "p.(Asp190GlnfsTer8)" ""
"0000570131" "00006873" "50" "568" "0" "569" "0" "c.568_569del" "r.(?)" "p.(Asp190GlnfsTer8)" "4"
"0000570132" "00025776" "30" "646" "0" "646" "0" "c.646A>C" "r.(?)" "p.(Met216Leu)" ""
"0000570132" "00006873" "30" "646" "0" "646" "0" "c.646A>C" "r.(?)" "p.(Met216Leu)" "5"
"0000618243" "00025776" "30" "95" "0" "95" "0" "c.95G>C" "r.(?)" "p.(Gly32Ala)" ""
"0000618243" "00006873" "30" "95" "0" "95" "0" "c.95G>C" "r.(?)" "p.(Gly32Ala)" "2"
"0000618244" "00025776" "50" "548" "0" "548" "0" "c.548C>T" "r.(?)" "p.(Ser183Leu)" ""
"0000618244" "00006873" "50" "548" "0" "548" "0" "c.548C>T" "r.(?)" "p.(Ser183Leu)" "4"
"0000642257" "00006873" "99" "-125" "0" "-125" "0" "c.-125G>A" "r.(=)" "p.(=)" "1"
"0000642258" "00006873" "99" "144" "0" "144" "0" "c.144G>C" "r.(?)" "p.(Glu48Asp)" "2"
"0000642260" "00006873" "99" "262" "0" "262" "0" "c.262dup" "r.(?)" "p.(Ala88Glyfs*3)" "2"
"0000642268" "00006873" "55" "472" "0" "472" "0" "c.472C>A" "r.(?)" "p.(Arg158Ser)" "3"
"0000642270" "00006873" "99" "498" "0" "498" "0" "c.498C>G" "r.(?)" "p.(Asp166Glu)" "3"
"0000642271" "00006873" "99" "507" "0" "507" "0" "c.507C>A" "r.(?)" "p.(Cys169*)" "3"
"0000642272" "00006873" "99" "517" "0" "517" "0" "c.517T>C" "r.(?)" "p.(Cys173Arg)" "3"
"0000642273" "00006873" "99" "554" "0" "554" "0" "c.554C>T" "r.(?)" "p.(Thr185Met)" "4"
"0000658789" "00025776" "30" "203" "0" "203" "0" "c.203C>T" "r.(?)" "p.(Pro68Leu)" ""
"0000658789" "00006873" "30" "203" "0" "203" "0" "c.203C>T" "r.(?)" "p.(Pro68Leu)" "2"
"0000681669" "00025776" "30" "46" "0" "46" "0" "c.46G>A" "r.(?)" "p.(Ala16Thr)" ""
"0000681669" "00006873" "30" "46" "0" "46" "0" "c.46G>A" "r.(?)" "p.(Ala16Thr)" "1"
"0000698847" "00006873" "73" "49" "0" "49" "0" "c.49G>A" "r.(?)" "p.(Ala17Thr)" "1"
"0000698848" "00006873" "99" "163" "0" "163" "0" "c.163G>T" "r.(?)" "p.(Glu55*)" "2"
"0000698849" "00006873" "99" "262" "0" "263" "0" "c.262_263delinsT" "r.(?)" "p.(Ala88Serfs*121)" "2"
"0000698850" "00006873" "99" "262" "0" "263" "0" "c.262_263delinsT" "r.(?)" "p.(Ala88Serfs*121)" "2"
"0000698851" "00006873" "77" "286" "0" "286" "0" "c.286C>T" "r.(?)" "p.(Arg96Cys)" "2"
"0000698852" "00006873" "77" "293" "0" "293" "0" "c.293C>A" "r.(?)" "p.(Thr98Lys)" "2"
"0000698853" "00006873" "77" "293" "0" "293" "0" "c.293C>A" "r.(?)" "p.(Thr98Lys)" "2"
"0000698854" "00006873" "77" "293" "0" "293" "0" "c.293C>A" "r.(?)" "p.(Thr98Lys)" "2"
"0000698855" "00006873" "77" "517" "0" "517" "0" "c.517T>C" "r.(?)" "p.(Cys173Arg)" "3"
"0000698856" "00006873" "77" "335" "0" "335" "0" "c.335A>G" "r.(?)" "p.(His112Arg)" "2"
"0000698857" "00006873" "77" "380" "0" "380" "0" "c.380A>G" "r.(?)" "p.(Tyr127Cys)" "3"
"0000698858" "00006873" "77" "476" "0" "476" "0" "c.476G>T" "r.(?)" "p.(Cys159Phe)" "3"
"0000698859" "00006873" "77" "476" "0" "476" "0" "c.476G>T" "r.(?)" "p.(Cys159Phe)" "3"
"0000698860" "00006873" "77" "476" "0" "476" "0" "c.476G>T" "r.(?)" "p.(Cys159Phe)" "3"
"0000698861" "00006873" "99" "507" "0" "507" "0" "c.507C>A" "r.(?)" "p.(Cys169*)" "3"
"0000698862" "00006873" "73" "565" "0" "565" "0" "c.565dup" "r.(?)" "p.(Thr189Asnfs*10)" "4"
"0000698863" "00006873" "73" "670" "0" "670" "0" "c.670G>A" "r.(?)" "p.(Ala224Thr)" "5"
"0000698864" "00006873" "77" "277" "0" "277" "0" "c.277C>G" "r.(?)" "p.(Arg93Gly)" "2"
"0000698865" "00006873" "77" "293" "0" "293" "0" "c.293C>T" "r.(?)" "p.(Thr98Met)" "2"
"0000698915" "00006873" "73" "-248" "0" "-248" "0" "c.-248G>A" "r.(?)" "p.(=)" "1"
"0000727808" "00025776" "50" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Lys105Glu)" ""
"0000727808" "00006873" "50" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Lys105Glu)" ""
"0000908903" "00006873" "50" "365" "1" "365" "1" "c.365+1G>C" "r.0?" "p.0?" ""
"0000983868" "00025776" "50" "454" "0" "454" "0" "c.454T>C" "r.(?)" "p.(Ser152Pro)" ""
"0000983868" "00006873" "50" "454" "0" "454" "0" "c.454T>C" "r.(?)" "p.(Ser152Pro)" ""
"0000983869" "00025776" "50" "455" "0" "455" "0" "c.455C>T" "r.(?)" "p.(Ser152Leu)" ""
"0000983869" "00006873" "50" "455" "0" "455" "0" "c.455C>T" "r.(?)" "p.(Ser152Leu)" ""
"0001005506" "00025776" "30" "671" "0" "671" "0" "c.671C>T" "r.(?)" "p.(Ala224Val)" ""
"0001005506" "00006873" "30" "671" "0" "671" "0" "c.671C>T" "r.(?)" "p.(Ala224Val)" ""
"0001005507" "00025776" "50" "688" "0" "688" "0" "c.688C>T" "r.(?)" "p.(Arg230Cys)" ""
"0001005507" "00006873" "50" "688" "0" "688" "0" "c.688C>T" "r.(?)" "p.(Arg230Cys)" ""
"0001043457" "00025776" "50" "167" "0" "190" "0" "c.167_190dup" "r.(?)" "p.(Glu56_Glu63dup)" ""
"0001043457" "00006873" "50" "167" "0" "190" "0" "c.167_190dup" "r.(?)" "p.(Glu56_Glu63dup)" ""
"0001043458" "00025776" "50" "257" "0" "257" "0" "c.257A>T" "r.(?)" "p.(Glu86Val)" ""
"0001043458" "00006873" "50" "257" "0" "257" "0" "c.257A>T" "r.(?)" "p.(Glu86Val)" ""
"0001043459" "00025776" "50" "568" "0" "571" "0" "c.568_571del" "r.(?)" "p.(Asp190Lysfs*18)" ""
"0001043459" "00006873" "50" "568" "0" "571" "0" "c.568_571del" "r.(?)" "p.(Asp190Lysfs*18)" ""
"0001056942" "00025776" "50" "548" "0" "548" "0" "c.548C>T" "r.(?)" "p.(Ser183Leu)" ""
"0001056942" "00006873" "50" "548" "0" "548" "0" "c.548C>T" "r.(?)" "p.(Ser183Leu)" ""
"0001058633" "00006873" "90" "565" "0" "565" "0" "c.565dup" "r.(?)" "p.(Thr189AsnfsTer10)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 30
"{{screeningid}}" "{{variantid}}"
"0000286515" "0000642257"
"0000286516" "0000642258"
"0000286518" "0000642260"
"0000286526" "0000642268"
"0000286528" "0000642270"
"0000286529" "0000642271"
"0000286530" "0000642272"
"0000286531" "0000642273"
"0000316685" "0000698847"
"0000316686" "0000698848"
"0000316687" "0000698849"
"0000316688" "0000698850"
"0000316689" "0000698851"
"0000316690" "0000698852"
"0000316691" "0000698853"
"0000316692" "0000698854"
"0000316692" "0000698855"
"0000316693" "0000698856"
"0000316694" "0000698857"
"0000316695" "0000698858"
"0000316696" "0000698859"
"0000316697" "0000698860"
"0000316698" "0000698861"
"0000316699" "0000698862"
"0000316700" "0000698863"
"0000316701" "0000698864"
"0000316702" "0000698865"
"0000316737" "0000698915"
"0000429430" "0000908903"
"0000470511" "0001058633"