### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = EPS8L2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "EPS8L2" "EPS8-like 2" "11" "p15.5" "unknown" "NG_051601.1" "UD_132438346257" "" "https://www.LOVD.nl/EPS8L2" "" "1" "21296" "64787" "614988" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/EPS8L2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2017-08-25 20:04:10" "00000" "2026-02-03 16:55:03" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00007186" "EPS8L2" "EPS8-like 2" "001" "NM_022772.3" "" "NP_073609.2" "" "" "" "-247" "2894" "2148" "706120" "727727" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05103" "deafness" "deafness" "" "" "" "" "" "00006" "2015-12-02 12:30:46" "00006" "2017-08-25 19:47:08" "06118" "DFNB106" "Deafness autosomal recessive 106" "AR" "617637" "" "" "" "00006" "2021-12-10 23:20:41" "" "" "07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "EPS8L2" "06118" ## Individuals ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00117290" "" "" "" "1" "" "00110" "{PMID:Baux 2017:29196752}, {DOI:Baux 2017:10.1038/s41598-017-16846-9}" "Proband" "M" "?" "France" "" "0" "" "" "" "S1812" "00460960" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00460961" "" "" "" "1" "" "04796" "" "" "" "" "Netherlands" "" "0" "" "" "" "" "00465490" "" "" "" "2" "" "00006" "{PMID:Wu 2019:31581539}" "analysis 1291 cases hearing loss" "" "" "Taiwan" "" "0" "" "" "" "" "00470685" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected maternal grandmother" "F" "" "Poland" "" "0" "" "" "" "Pat46" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{individualid}}" "{{diseaseid}}" "00117290" "05103" "00460960" "00198" "00460961" "00198" "00465490" "05086" "00470685" "07210" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 05086, 05103, 06118, 07210 ## Count = 3 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000092537" "05103" "00117290" "00110" "Isolated (sporadic)" "01y" "" "00y" "" "" "" "" "" "" "" "" "" "" "0000351038" "05086" "00465490" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "hearing loss" "" "0000355579" "07210" "00470685" "00006" "Familial" "12y" "see paper; ... scoliosis, no other skeletal defects; no symptoms; physical activity" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" ## Screenings ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000117758" "00117290" "1" "00110" "00110" "2017-08-17 12:42:30" "00006" "2020-09-25 08:53:39" "QMPSF;SEQ;SEQ-NG-I" "DNA" "" "gene panel, Quantitative Multiplex PCR of Short Fluorescent fragments" "0000462592" "00460960" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "fibroblasts" "mRNA splicing analysis on tissue" "0000462593" "00460961" "1" "04796" "00006" "2024-11-05 16:15:00" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "fibroblasts" "mRNA splicing analysis on tissue" "0000467139" "00465490" "1" "00006" "00006" "2025-05-19 19:24:16" "" "" "SEQ;SEQ-NG" "DNA" "" "213-gene panel" "0000472352" "00470685" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 4 "{{screeningid}}" "{{geneid}}" "0000117758" "EPS8L2" "0000117758" "STRC" "0000462592" "EPS8L2" "0000462593" "EPS8L2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 56 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000188768" "0" "90" "11" "723329" "723329" "dup" "0" "00110" "EPS8L2_000001" "g.723329dup" "" "{PMID:Baux 2017:29196752}, {DOI:Baux 2017:10.1038/s41598-017-16846-9}" "" "1430dupC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.723329dup" "" "pathogenic" "" "0000321880" "0" "50" "11" "694961" "694966" "del" "0" "01804" "DEAF1_000015" "g.694961_694966del" "" "" "" "DEAF1(NM_021008.2):c.93_98del (p.(Ala32_Ala33del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.694961_694966del" "" "VUS" "" "0000321882" "0" "50" "11" "695681" "695681" "subst" "0" "01804" "DEAF1_000017" "g.695681G>A" "" "" "" "TMEM80(NM_001042463.1):c.-72G>A (p.(Ala25Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.695681G>A" "" "VUS" "" "0000321884" "0" "50" "11" "695835" "695835" "subst" "0.00393701" "01804" "TMEM80_000002" "g.695835C>T" "" "" "" "TMEM80(NM_001042463.1):c.83C>T (p.(Ala76Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.695835C>T" "" "VUS" "" "0000321887" "0" "50" "11" "695853" "695853" "subst" "0" "01804" "TMEM80_000003" "g.695853T>C" "" "" "" "TMEM80(NM_001042463.1):c.94+7T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.695853T>C" "" "VUS" "" "0000545569" "0" "50" "11" "694759" "694759" "subst" "0" "01943" "DEAF1_000045" "g.694759C>T" "" "" "" "DEAF1(NM_021008.3):c.289G>A (p.E97K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694759C>T" "" "VUS" "" "0000545570" "0" "50" "11" "694771" "694771" "subst" "0" "01804" "DEAF1_000046" "g.694771C>T" "" "" "" "DEAF1(NM_021008.2):c.277G>A (p.(Ala93Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694771C>T" "" "VUS" "" "0000545571" "0" "50" "11" "694797" "694797" "subst" "1.99045E-5" "01943" "DEAF1_000047" "g.694797G>C" "" "" "" "DEAF1(NM_021008.2):c.251C>G (p.(Pro84Arg)), DEAF1(NM_021008.3):c.251C>G (p.P84R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694797G>C" "" "VUS" "" "0000545572" "0" "30" "11" "694961" "694999" "del" "0" "01804" "DEAF1_000048" "g.694961_694999del" "" "" "" "DEAF1(NM_021008.2):c.54_92del (p.(Val19_Ala31del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694961_694999del" "" "likely benign" "" "0000545573" "0" "30" "11" "694968" "694991" "del" "0" "01804" "DEAF1_000049" "g.694968_694991del" "" "" "" "DEAF1(NM_021008.2):c.72_95del (p.(Val25_Ala32del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694968_694991del" "" "likely benign" "" "0000545613" "0" "30" "11" "709463" "709463" "dup" "0" "01943" "DEAF1_000054" "g.709463dup" "" "" "" "EPS8L2(NM_022772.3):c.44+12dupC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.709463dup" "" "likely benign" "" "0000545614" "0" "30" "11" "709549" "709549" "subst" "8.21099E-6" "01943" "DEAF1_000055" "g.709549G>T" "" "" "" "EPS8L2(NM_022772.3):c.45-4G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.709549G>T" "" "likely benign" "" "0000545683" "0" "50" "11" "720712" "720712" "subst" "0" "01943" "EPS8L2_000002" "g.720712C>T" "" "" "" "EPS8L2(NM_022772.3):c.443C>T (p.P148L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.720712C>T" "" "VUS" "" "0000545684" "0" "30" "11" "721122" "721122" "subst" "0.000941915" "01943" "EPS8L2_000003" "g.721122G>T" "" "" "" "EPS8L2(NM_022772.3):c.616G>T (p.A206S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.721122G>T" "" "likely benign" "" "0000545689" "0" "50" "11" "721628" "721628" "subst" "9.57964E-6" "01943" "EPS8L2_000004" "g.721628G>A" "" "" "" "EPS8L2(NM_022772.3):c.832G>A (p.E278K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.721628G>A" "" "VUS" "" "0000545690" "0" "30" "11" "722697" "722697" "subst" "1.28582E-5" "01943" "EPS8L2_000005" "g.722697G>C" "" "" "" "EPS8L2(NM_022772.3):c.1233G>C (p.Q411H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.722697G>C" "" "likely benign" "" "0000545694" "0" "50" "11" "725751" "725751" "subst" "0.0011213" "01943" "EPS8L2_000006" "g.725751G>C" "" "" "" "EPS8L2(NM_022772.3):c.1584G>C (p.W528C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.725751G>C" "" "VUS" "" "0000545695" "0" "30" "11" "726389" "726389" "subst" "6.09581E-5" "01943" "EPS8L2_000007" "g.726389C>T" "" "" "" "EPS8L2(NM_022772.3):c.1839C>T (p.R613=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.726389C>T" "" "likely benign" "" "0000613672" "0" "30" "11" "694961" "694990" "del" "0" "02325" "DEAF1_000062" "g.694961_694990del" "" "" "" "DEAF1(NM_021008.4):c.69_98delCGCTGTGGCGGCGGCGGCCGCGGCCGCGGC (p.A24_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.694961_694990del" "" "likely benign" "" "0000613673" "0" "50" "11" "695724" "695724" "subst" "0" "02325" "DEAF1_000063" "g.695724G>C" "" "" "" "DEAF1(NM_021008.4):c.-677C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.695724G>C" "" "VUS" "" "0000613695" "0" "50" "11" "722169" "722169" "subst" "0" "01943" "EPS8L2_000008" "g.722169C>T" "" "" "" "EPS8L2(NM_022772.3):c.1059+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.722169C>T" "" "VUS" "" "0000613696" "0" "50" "11" "722549" "722549" "subst" "0" "01943" "EPS8L2_000009" "g.722549G>T" "" "" "" "EPS8L2(NM_022772.3):c.1208G>T (p.R403L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.722549G>T" "" "VUS" "" "0000613697" "0" "30" "11" "723309" "723309" "subst" "5.89787E-5" "01943" "EPS8L2_000010" "g.723309C>G" "" "" "" "EPS8L2(NM_022772.3):c.1410C>G (p.P470=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.723309C>G" "" "likely benign" "" "0000613698" "0" "30" "11" "726676" "726676" "subst" "4.24863E-5" "01943" "EPS8L2_000012" "g.726676G>A" "" "" "" "EPS8L2(NM_022772.3):c.1992G>A (p.E664=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.726676G>A" "" "likely benign" "" "0000613699" "0" "30" "11" "726978" "726978" "subst" "0.000885703" "01943" "EPS8L2_000013" "g.726978C>G" "" "" "" "EPS8L2(NM_022772.3):c.2145C>G (p.S715R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.726978C>G" "" "likely benign" "" "0000622724" "0" "90" "11" "725832" "725832" "dup" "0" "01943" "EPS8L2_000011" "g.725832dup" "" "" "" "EPS8L2(NM_022772.3):c.1665dupC (p.A556Rfs*215)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.725832dup" "" "pathogenic" "" "0000656904" "0" "70" "11" "709610" "709610" "subst" "0" "02327" "DEAF1_000065" "g.709610T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.709610T>G" "" "likely pathogenic" "" "0000679318" "0" "30" "11" "694961" "695002" "del" "0" "02325" "DEAF1_000068" "g.694961_695002del" "" "" "" "DEAF1(NM_021008.4):c.51_92del (p.V19_A32del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000679319" "0" "50" "11" "694965" "694991" "del" "0" "02325" "DEAF1_000016" "g.694965_694991del" "" "" "" "DEAF1(NM_021008.4):c.60_86delGGCCGCGGCCGCTGTGGCGGCGGCGGC (p.V25_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000691175" "0" "30" "11" "694959" "695003" "del" "0" "02325" "DEAF1_000070" "g.694959_695003del" "" "" "" "DEAF1(NM_021008.4):c.48_92del (p.V19_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000723688" "0" "30" "11" "694949" "694978" "del" "0" "02325" "DEAF1_000072" "g.694949_694978del" "" "" "" "DEAF1(NM_021008.4):c.71_100delCTGTGGCGGCGGCGGCCGCGGCCGCGGCAG (p.A24_A33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000805374" "0" "50" "11" "694974" "694974" "subst" "0" "02326" "DEAF1_000077" "g.694974A>C" "" "" "" "DEAF1(NM_021008.3):c.74T>G (p.V25G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805392" "0" "50" "11" "721909" "721909" "subst" "0" "01943" "EPS8L2_000014" "g.721909T>A" "" "" "" "EPS8L2(NM_022772.3):c.902T>A (p.V301D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805393" "0" "50" "11" "721910" "721910" "subst" "0" "01943" "EPS8L2_000015" "g.721910C>A" "" "" "" "EPS8L2(NM_022772.3):c.903C>A (p.V301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805394" "0" "30" "11" "726090" "726090" "subst" "0.000246774" "01943" "EPS8L2_000016" "g.726090C>T" "" "" "" "EPS8L2(NM_022772.3):c.1681-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853172" "0" "50" "11" "722405" "722405" "subst" "2.85999E-5" "01943" "EPS8L2_000017" "g.722405T>G" "" "" "" "EPS8L2(NM_022772.3):c.1064T>G (p.V355G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000862698" "0" "50" "11" "722413" "722415" "dup" "0" "01943" "EPS8L2_000018" "g.722413_722415dup" "" "" "" "EPS8L2(NM_022772.3):c.1072_1074dupTGC (p.C358dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000966552" "0" "30" "11" "694961" "695002" "del" "0" "02329" "DEAF1_000068" "g.694961_695002del" "" "" "" "DEAF1(NM_021008.4):c.51_92del (p.V19_A32del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000966571" "0" "50" "11" "725751" "725751" "subst" "0.0011213" "02327" "EPS8L2_000006" "g.725751G>C" "" "" "" "EPS8L2(NM_022772.3):c.1584G>C (p.W528C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979837" "0" "30" "11" "694886" "694886" "subst" "0.00172952" "02326" "DEAF1_000091" "g.694886C>G" "" "" "" "DEAF1(NM_021008.3):c.162G>C (p.S54=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979839" "0" "50" "11" "696721" "696721" "subst" "0" "01804" "DEAF1_000093" "g.696721G>A" "" "" "" "DEAF1(NM_001367390.1):c.-437-5123C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999430" "0" "50" "11" "694797" "694797" "subst" "1.99045E-5" "01804" "DEAF1_000047" "g.694797G>C" "" "" "" "DEAF1(NM_021008.2):c.251C>G (p.(Pro84Arg)), DEAF1(NM_021008.3):c.251C>G (p.P84R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999431" "0" "30" "11" "694895" "694895" "subst" "0" "01804" "DEAF1_000099" "g.694895G>C" "" "" "" "DEAF1(NM_021008.2):c.153C>G (p.(Asp51Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999432" "0" "50" "11" "694914" "694914" "subst" "0" "01804" "DEAF1_000100" "g.694914T>C" "" "" "" "DEAF1(NM_021008.2):c.134A>G (p.(Asp45Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000999433" "0" "30" "11" "694992" "694992" "subst" "0" "02326" "DEAF1_000101" "g.694992A>G" "" "" "" "DEAF1(NM_021008.3):c.56T>C (p.V19A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001022119" "0" "70" "11" "722169" "722169" "subst" "0" "04796" "EPS8L2_000008" "g.722169C>T" "" "" "" "" "effect on RNA exon skipping" "Germline/De novo (untested)" "" "" "0" "" "" "g.722169C>T" "" "likely pathogenic" "" "0001022120" "0" "70" "11" "722549" "722549" "subst" "0" "04796" "EPS8L2_000009" "g.722549G>T" "" "" "" "" "effect on RNA exon skipping" "Germline/De novo (untested)" "" "" "0" "" "" "g.722549G>T" "" "likely pathogenic" "" "0001038720" "0" "50" "11" "694759" "694762" "del" "0" "01804" "DEAF1_000113" "g.694759_694762del" "" "" "" "DEAF1(NM_021008.4):c.289_289+3del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038721" "0" "50" "11" "694976" "694993" "del" "0" "01804" "DEAF1_000114" "g.694976_694993del" "" "" "" "DEAF1(NM_021008.4):c.63_80del (p.(Val25_Ala30del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038765" "0" "50" "11" "721345" "721345" "subst" "0" "01804" "EPS8L2_000019" "g.721345A>C" "" "" "" "EPS8L2(NM_022772.4):c.761A>C (p.(Lys254Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044908" "1" "90" "11" "722768" "722768" "subst" "1.39589E-5" "00006" "EPS8L2_000020" "g.722768G>A" "2/1291 cases hearing loss" "{PMID:Wu 2019:31581539}" "" "" "combination of alleles not reported" "Germline" "" "" "0" "" "" "g.722768G>A" "" "pathogenic (recessive)" "" "0001053754" "0" "30" "11" "696692" "696697" "del" "0" "01804" "DEAF1_000118" "g.696692_696697del" "" "" "" "DEAF1(NM_001367390.1):c.-437-5099_-437-5094del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053755" "0" "30" "11" "696698" "696698" "subst" "0" "01804" "DEAF1_000119" "g.696698C>A" "" "" "" "DEAF1(NM_001367390.1):c.-437-5100G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053756" "0" "50" "11" "722434" "722434" "subst" "6.52071E-5" "01804" "EPS8L2_000021" "g.722434C>T" "" "" "" "EPS8L2(NM_022772.4):c.1093C>T (p.(Arg365Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001060946" "0" "70" "11" "721677" "721687" "del" "0" "00006" "EPS8L2_000022" "g.721677_721687del" "" "{PMID:Horbacz 2025:41210864}" "" "879_889del" "ACMG PVS1, PM2; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.721677_721687del" "" "likely pathogenic" "ACMG" "0001068096" "0" "90" "11" "723329" "723329" "dup" "0" "03779" "EPS8L2_000001" "g.723329dup" "" "" "" "" "" "Unknown" "" "rs758700198" "0" "" "" "" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes EPS8L2 ## Count = 56 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000188768" "00007186" "90" "1430" "0" "1430" "0" "c.1430dup" "r.(?)" "p.(Val478Serfs*25)" "15" "0000321880" "00007186" "50" "-11406" "0" "-11401" "0" "c.-11406_-11401del" "r.(?)" "p.(=)" "" "0000321882" "00007186" "50" "-10686" "0" "-10686" "0" "c.-10686G>A" "r.(?)" "p.(=)" "" "0000321884" "00007186" "50" "-10532" "0" "-10532" "0" "c.-10532C>T" "r.(?)" "p.(=)" "" "0000321887" "00007186" "50" "-10514" "0" "-10514" "0" "c.-10514T>C" "r.(?)" "p.(=)" "" "0000545569" "00007186" "50" "-11608" "0" "-11608" "0" "c.-11608C>T" "r.(?)" "p.(=)" "" "0000545570" "00007186" "50" "-11596" "0" "-11596" "0" "c.-11596C>T" "r.(?)" "p.(=)" "" "0000545571" "00007186" "50" "-11570" "0" "-11570" "0" "c.-11570G>C" "r.(?)" "p.(=)" "" "0000545572" "00007186" "30" "-11406" "0" "-11368" "0" "c.-11406_-11368del" "r.(?)" "p.(=)" "" "0000545573" "00007186" "30" "-11399" "0" "-11376" "0" "c.-11399_-11376del" "r.(?)" "p.(=)" "" "0000545613" "00007186" "30" "44" "12" "44" "12" "c.44+12dup" "r.(=)" "p.(=)" "" "0000545614" "00007186" "30" "45" "-4" "45" "-4" "c.45-4G>T" "r.spl?" "p.?" "" "0000545683" "00007186" "50" "443" "0" "443" "0" "c.443C>T" "r.(?)" "p.(Pro148Leu)" "" "0000545684" "00007186" "30" "616" "0" "616" "0" "c.616G>T" "r.(?)" "p.(Ala206Ser)" "" "0000545689" "00007186" "50" "832" "0" "832" "0" "c.832G>A" "r.(?)" "p.(Glu278Lys)" "" "0000545690" "00007186" "30" "1233" "0" "1233" "0" "c.1233G>C" "r.(?)" "p.(Gln411His)" "" "0000545694" "00007186" "50" "1584" "0" "1584" "0" "c.1584G>C" "r.(?)" "p.(Trp528Cys)" "" "0000545695" "00007186" "30" "1839" "0" "1839" "0" "c.1839C>T" "r.(?)" "p.(Arg613=)" "" "0000613672" "00007186" "30" "-11406" "0" "-11377" "0" "c.-11406_-11377del" "r.(?)" "p.(=)" "" "0000613673" "00007186" "50" "-10643" "0" "-10643" "0" "c.-10643G>C" "r.(?)" "p.(=)" "" "0000613695" "00007186" "50" "1059" "4" "1059" "4" "c.1059+4C>T" "r.spl?" "p.?" "" "0000613696" "00007186" "50" "1208" "0" "1208" "0" "c.1208G>T" "r.(?)" "p.(Arg403Leu)" "" "0000613697" "00007186" "30" "1410" "0" "1410" "0" "c.1410C>G" "r.(?)" "p.(Pro470=)" "" "0000613698" "00007186" "30" "1992" "0" "1992" "0" "c.1992G>A" "r.(?)" "p.(Glu664=)" "" "0000613699" "00007186" "30" "2145" "0" "2145" "0" "c.2145C>G" "r.(?)" "p.(Ser715Arg)" "" "0000622724" "00007186" "90" "1665" "0" "1665" "0" "c.1665dup" "r.(?)" "p.(Ala556ArgfsTer215)" "" "0000656904" "00007186" "70" "100" "2" "100" "2" "c.100+2T>G" "r.spl?" "p.?" "" "0000679318" "00007186" "30" "-11406" "0" "-11365" "0" "c.-11406_-11365del" "r.(?)" "p.(=)" "" "0000679319" "00007186" "50" "-11402" "0" "-11376" "0" "c.-11402_-11376del" "r.(?)" "p.(=)" "" "0000691175" "00007186" "30" "-11408" "0" "-11364" "0" "c.-11408_-11364del" "r.(?)" "p.(=)" "" "0000723688" "00007186" "30" "-11418" "0" "-11389" "0" "c.-11418_-11389del" "r.(?)" "p.(=)" "" "0000805374" "00007186" "50" "-11393" "0" "-11393" "0" "c.-11393A>C" "r.(?)" "p.(=)" "" "0000805392" "00007186" "50" "902" "0" "902" "0" "c.902T>A" "r.(?)" "p.(Val301Asp)" "" "0000805393" "00007186" "50" "903" "0" "903" "0" "c.903C>A" "r.(?)" "p.(Val301=)" "" "0000805394" "00007186" "30" "1681" "-8" "1681" "-8" "c.1681-8C>T" "r.(=)" "p.(=)" "" "0000853172" "00007186" "50" "1064" "0" "1064" "0" "c.1064T>G" "r.(?)" "p.(Val355Gly)" "" "0000862698" "00007186" "50" "1072" "0" "1074" "0" "c.1072_1074dup" "r.(?)" "p.(Cys358dup)" "" "0000966552" "00007186" "30" "-11406" "0" "-11365" "0" "c.-11406_-11365del" "r.(?)" "p.(=)" "" "0000966571" "00007186" "50" "1584" "0" "1584" "0" "c.1584G>C" "r.(?)" "p.(Trp528Cys)" "" "0000979837" "00007186" "30" "-11481" "0" "-11481" "0" "c.-11481C>G" "r.(?)" "p.(=)" "" "0000979839" "00007186" "50" "-9646" "0" "-9646" "0" "c.-9646G>A" "r.(?)" "p.(=)" "" "0000999430" "00007186" "50" "-11570" "0" "-11570" "0" "c.-11570G>C" "r.(?)" "p.(=)" "" "0000999431" "00007186" "30" "-11472" "0" "-11472" "0" "c.-11472G>C" "r.(?)" "p.(=)" "" "0000999432" "00007186" "50" "-11453" "0" "-11453" "0" "c.-11453T>C" "r.(?)" "p.(=)" "" "0000999433" "00007186" "30" "-11375" "0" "-11375" "0" "c.-11375A>G" "r.(?)" "p.(=)" "" "0001022119" "00007186" "70" "1059" "4" "1059" "4" "c.1059+4C>T" "r.985_1059del" "p.Ala329_Leu353del" "12i" "0001022120" "00007186" "70" "1208" "0" "1208" "0" "c.1208G>T" "r.1060_1208del" "p.Ile345PhefsTer99" "13" "0001038720" "00007186" "50" "-11608" "0" "-11605" "0" "c.-11608_-11605del" "r.(?)" "p.(=)" "" "0001038721" "00007186" "50" "-11391" "0" "-11374" "0" "c.-11391_-11374del" "r.(?)" "p.(=)" "" "0001038765" "00007186" "50" "761" "0" "761" "0" "c.761A>C" "r.(?)" "p.(Lys254Thr)" "" "0001044908" "00007186" "90" "1304" "0" "1304" "0" "c.1304G>A" "r,(?)" "p.(Trp435Ter)" "" "0001053754" "00007186" "30" "-9675" "0" "-9670" "0" "c.-9675_-9670del" "r.(?)" "p.(=)" "" "0001053755" "00007186" "30" "-9669" "0" "-9669" "0" "c.-9669C>A" "r.(?)" "p.(=)" "" "0001053756" "00007186" "50" "1093" "0" "1093" "0" "c.1093C>T" "r.(?)" "p.(Arg365Cys)" "" "0001060946" "00007186" "70" "881" "0" "891" "0" "c.881_891del" "r.(?)" "p.(Lys294SerfsTer14)" "" "0001068096" "00007186" "90" "1430" "0" "1430" "0" "c.1430dup" "r.(?)" "p.(Val478SerfsTer25)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 5 "{{screeningid}}" "{{variantid}}" "0000117758" "0000188768" "0000462592" "0001022119" "0000462593" "0001022120" "0000467139" "0001044908" "0000472352" "0001060946"