### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = EVC2)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"EVC2"	"Ellis van Creveld syndrome 2"	"4"	"p16.2-p16.1"	"unknown"	"NG_015821.1"	"UD_132119148835"	""	"https://www.LOVD.nl/EVC2"	""	"1"	"19747"	"132884"	"607261"	"1"	"1"	"1"	"1"	"Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>."	""	"g"	"https://databases.lovd.nl/shared/refseq/EVC2_codingDNA.html"	"1"	""	""	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00006"	"2021-01-03 21:04:59"	"00006"	"2025-11-20 12:33:25"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00007281"	"EVC2"	"transcript variant 1"	"002"	"NM_147127.4"	""	"NP_667338.3"	""	""	""	"-54"	"4356"	"3927"	"5710294"	"5564146"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 8
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00139"	"ID"	"intellectual disability (ID)"	""	""	""	""	""	"00084"	"2013-06-04 18:18:07"	"00006"	"2015-02-09 10:02:49"
"00152"	"CHD"	"heart disease, congenital (CHD)"	""	""	""	""	""	"00008"	"2013-06-19 09:27:11"	"00006"	"2015-01-23 22:14:45"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00433"	"NBIA1"	"neurodegeneration, with brain iron accumulation, type 1 (NBIA)"	"AR"	"234200"	""	""	""	"00006"	"2014-06-24 21:43:21"	"00006"	"2021-12-10 21:51:32"
"00603"	"EVC"	"Ellis-van Creveld syndrome (EVC)"	"AR"	"225500"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"00604"	"WAD"	"dysostosis, acrodental, Weyers (WAD)"	"AD"	"193530"	""	"autosomal dominant"	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"
"05517"	"skeletal dysplasia"	"dysplasia, skeletal"	""	""	""	""	""	"00006"	"2018-11-16 16:43:21"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 3
"{{geneid}}"	"{{diseaseid}}"
"EVC2"	"00139"
"EVC2"	"00603"
"EVC2"	"00604"


## Individuals ## Do not remove or alter this header ##
## Count = 100
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00017613"	""	""	""	"1"	""	"00705"	"{PMID:Dusi 2014:24360804}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents/sibs"	"F"	"yes"	"Italy"	""	"0"	""	""	""	""
"00058524"	""	""	""	"1"	""	"01396"	""	""	"M"	"?"	"Brazil"	""	"0"	""	""	""	""
"00225672"	""	""	""	"1"	""	"00006"	"{PMID:Shaheen 2013:23169490}, {PMID:Alazami 2015:25558065}, {DOI:Alazami 2015:10.1016/j.celrep.2014.12.015}"	""	""	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"23169490-PatMKS_F2, -Fam10DG1721"
"00293631"	""	""	""	"120"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293633"	""	""	""	"11"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293634"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00293635"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00304998"	""	""	""	"2"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00307126"	""	""	""	"1"	""	"00006"	"{PMID:Rudnik-Schöneborn 2011:22190900}, {DOI:Rudnik-Schöneborn 2011:10.1159/000331338}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents from same town not known to be related"	"F"	"?"	"Turkey"	""	"0"	""	""	""	"Pat1"
"00325865"	""	""	""	"3"	""	"00006"	"{PMID:Valencia 2015:26064711}"	"5-generation family, 3 affected (2F, M)"	"F;M"	"yes"	"Lebanon"	""	"0"	""	""	""	"Fam1"
"00325866"	""	""	""	"2"	""	"00006"	"{PMID:Valencia 2015:26064711}"	"3-generation family, 2 affected (2M)"	"M"	"yes"	"Lebanon"	""	"0"	""	""	""	"Fam2"
"00325883"	""	""	""	"1"	""	"00006"	"{PMID:Sund 2009:19251731}"	""	"M"	""	"United States"	""	"0"	""	""	"white"	"Pat7-11"
"00325884"	""	""	""	"1"	""	"00006"	"{PMID:Sund 2009:19251731}"	""	"M"	""	"United States"	""	"0"	""	""	"white"	"Pat8-3"
"00325885"	""	""	""	"1"	""	"00006"	"{PMID:Sund 2009:19251731}"	""	"F"	""	"United States"	""	"0"	""	""	"white"	"Pat11-3"
"00325910"	""	""	""	"2"	""	"00006"	"{PMID:Galdzicka 2002:12468274}"	"2-generation family, 2 affected brothers"	"M"	""	"United States"	""	"0"	""	""	"Jewish-Ashkenazi"	"FamPatB100"
"00325911"	""	""	""	"1"	""	"00006"	"{PMID:Ruiz‐Perez 2003:12571802}"	""	""	""	""	""	"0"	""	""	"gypsy"	""
"00325912"	""	""	""	"1"	""	"00006"	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"F;M"	""	"Brazil"	""	"0"	""	""	""	""
"00325913"	""	""	""	"1"	""	"00006"	"{PMID:Ruiz‐Perez 2003:12571802}"	"patient, second-cousin parents"	"F"	"yes"	""	""	"0"	""	""	""	""
"00325914"	""	""	""	"1"	""	"00006"	"{PMID:Ruiz‐Perez 2003:12571802}"	"stillborn child"	""	""	""	""	"0"	""	""	""	""
"00325915"	""	""	""	"2"	""	"00006"	"{PMID:Ruiz‐Perez 2003:12571802}"	"family, 2 affected sisters"	"F"	""	"Ecuador"	""	"0"	""	""	""	""
"00325916"	""	""	""	"2"	""	"00006"	"{PMID:Ruiz‐Perez 2003:12571802}"	"family, 2 affected"	""	""	""	""	"0"	""	""	""	""
"00325917"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"45274"
"00325918"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"38064"
"00325919"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"47440"
"00325920"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"31815"
"00325921"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"9239"
"00325922"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"9293"
"00325923"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"35113a"
"00325924"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"35142"
"00325925"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"53770"
"00325926"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"12752"
"00325927"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"34373"
"00325928"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"31085"
"00325929"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"23757"
"00325930"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"31768"
"00325931"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"31685"
"00325932"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"48518"
"00325933"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"36151"
"00325934"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"35582"
"00325935"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"12315"
"00325936"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"20596"
"00325937"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"51235"
"00325938"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"10711"
"00325939"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	""	""	"0"	""	""	""	"34713"
"00325940"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	"Spain"	""	"0"	""	""	"gypsy"	"36643"
"00325941"	""	""	""	"1"	""	"00006"	"{PMID:Tompson 2007:17024374}"	""	""	""	"Spain"	""	"0"	""	""	"gypsy"	"35537"
"00325942"	""	""	""	"11"	""	"00006"	"{PMID:Ye 2006:16404586}"	"5-generation famiy, 11 affected (6F, 5M)"	"F"	""	"China"	""	"0"	""	""	"Han Chinese"	""
"00326026"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	""	"M"	"no"	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat21"
"00326027"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	""	"M"	"yes"	"Pakistan"	""	"0"	""	""	""	"Pat22"
"00326028"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	""	"F"	"yes"	"Afghanistan"	""	"0"	""	""	""	"Pat23"
"00326029"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	"fetus"	"M"	"no"	"Morocco"	""	"0"	""	""	""	"Pat24"
"00326030"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	""	"F"	"no"	"Spain"	""	"0"	""	""	""	"Pat25"
"00326031"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	"fetus"	"F"	"no"	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat26"
"00326032"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	"2-generation family, 1 affected, unaffected non-carrier parents"	"M"	"no"	"Italy"	""	"0"	""	""	""	"Pat27"
"00326033"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	"fetus"	"M"	"no"	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat28"
"00326034"	""	""	""	"1"	""	"00006"	"{PMID:D\'Asdia 2013:23220543}"	""	"F"	"yes"	"Spain"	""	"0"	""	""	""	"Pat29"
"00326042"	""	""	""	"1"	""	"00006"	"{PMID:Ali 2010:20184732}"	"3-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	"yes"	"United Arab Emirates"	""	"0"	""	""	"Yemini"	"Fam1"
"00326044"	""	""	""	"1"	""	"00006"	"{PMID:Ali 2010:20184732}"	"3-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"Egypt"	""	"0"	""	""	""	"Fam3"
"00326046"	""	""	""	"1"	""	"00006"	"{PMID:Shen 2011:21815252}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	"F"	""	"China"	""	"0"	""	""	"Han"	"patient"
"00326065"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Turkey"	""	"0"	""	""	""	"Pat24"
"00326066"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"Brazil"	""	"0"	""	""	""	"Pat15"
"00326067"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"United Kingdom (Great Britain)"	""	"0"	""	""	"Pakistan"	"Pat2"
"00326068"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Egypt"	""	"0"	""	""	""	"Pat19"
"00326069"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Brazil"	""	"0"	""	""	""	"Pat23"
"00326070"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"Spain"	""	"0"	""	""	""	"Pat25"
"00326071"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"Spain"	""	"0"	""	""	""	"Pat9"
"00326072"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"France"	""	"0"	""	""	"Algeria"	"Pat32"
"00326073"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Egypt"	""	"0"	""	""	""	"Pat10"
"00326074"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"Spain"	""	"0"	""	""	""	"Pat17"
"00326075"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Egypt"	""	"0"	""	""	""	"Pat11"
"00326076"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"Spain"	""	"0"	""	""	""	"Pat4"
"00326077"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"United States"	""	"0"	""	""	""	"Pat1"
"00326078"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Turkey"	""	"0"	""	""	""	"Pat28"
"00326079"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"no"	"Spain"	""	"0"	""	""	""	"Pat6"
"00326080"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Spain"	""	"0"	""	""	""	"Pat14"
"00326081"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Spain"	""	"0"	""	""	""	"Pat16"
"00326082"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	""	""	"yes"	"Jordan"	""	"0"	""	""	""	"Pat35"
"00326083"	""	""	""	"5"	""	"00006"	"{PMID:Valencia 2009:19810119}"	"4-generation family, 5 affected (3F, 2M)"	"F;M"	"no"	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"Pat33"
"00326084"	""	""	""	"1"	""	"00006"	"{PMID:Valencia 2009:19810119}"	"2-generation family, 1 affected, unaffected non-carrier parents"	""	"no"	"Switzerland"	""	"0"	""	""	""	"Pat26"
"00326085"	""	""	""	"5"	""	"00006"	"{PMID:Valencia 2009:19810119}"	"3-generation family, 5 affected (F, 4M)"	"F;M"	"no"	"Italy"	""	"0"	""	""	""	"Pat27"
"00327547"	""	""	""	"5"	""	"00006"	"{PMID:Beck 2014:25044745}"	"2-generation family, 5 affected (2F, 3M)"	"F;M"	"yes"	"Iraq"	""	"0"	""	""	""	"family"
"00331429"	""	""	""	"1"	""	"00000"	"{PMID:Maddirevula 2018:29620724}"	"family"	"M"	"yes"	""	""	"0"	""	""	"Arab"	"10DG1721"
"00359444"	""	""	""	"1"	""	"01709"	""	""	""	""	"(Brazil)"	""	"0"	""	""	""	""
"00388425"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"white"	"R02-082A"
"00388426"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"Latino"	"R06-193"
"00388427"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"Latino"	"R08-353A"
"00388428"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"white"	"R09-040A"
"00388429"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"white"	"R09-040D"
"00388430"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"white"	"R96-138"
"00388431"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	""	""	""	""	""	"0"	""	""	"white"	"R98-219A"
"00388459"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	"Unsolved case: biallelic causative mutations not identify"	""	""	""	""	"0"	""	""	"white"	"R10-640A"
"00388460"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	"Unsolved case: biallelic causative mutations not identify"	""	""	""	""	"0"	""	""	"Unknown"	"R02-363A"
"00388466"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	"Unsolved case: biallelic causative mutations not identify"	""	""	""	""	"0"	""	""	"white"	"R97-291"
"00388468"	""	""	""	"1"	""	"00000"	"{PMID:Zhang-2019:29068549}"	"Unsolved case: biallelic causative mutations not identify"	""	""	""	""	"0"	""	""	"Latino"	"R03-383A"
"00434900"	""	""	""	"1"	""	"04216"	""	"2-generations family, 1 affected patient, unaffected heterozygous carrier parents"	"F"	"no"	"Mexico"	">16y"	"0"	""	""	"Mexico"	"L50014"
"00453756"	""	""	""	"1"	""	"00006"	"{PMID:Mansoorshahi 2024:39226896}"	"analysis 215 early-onset complications bicuspid aortic valve-affected families."	""	""	"United States"	""	"0"	""	""	""	"BAV488"
"00453757"	""	""	""	"1"	""	"00006"	"{PMID:Mansoorshahi 2024:39226896}"	"analysis 215 early-onset complications bicuspid aortic valve-affected families."	""	""	"United States"	""	"0"	""	""	""	"BAV334"
"00453807"	""	""	""	"1"	""	"00006"	"{PMID:Mansoorshahi 2024:39226896}"	"analysis 215 early-onset complications bicuspid aortic valve-affected families."	""	""	"United States"	""	"0"	""	""	""	"BAV483"
"00459489"	""	""	""	"3"	""	"04787"	""	""	"M"	"yes"	"Pakistan"	""	"0"	""	""	""	"TID-10 V1"
"00469793"	""	""	""	"1"	""	"00006"	"{PMID:Jacob 2025:39706863}"	"2-generation family, 1 affected, unaffected parents"	""	""	"India"	""	"0"	""	""	""	""


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 100
"{{individualid}}"	"{{diseaseid}}"
"00017613"	"00433"
"00058524"	"00603"
"00225672"	"00198"
"00293631"	"00198"
"00293633"	"00198"
"00293634"	"00198"
"00293635"	"00198"
"00304998"	"00198"
"00307126"	"00603"
"00325865"	"00603"
"00325866"	"00603"
"00325883"	"00603"
"00325884"	"00603"
"00325885"	"00603"
"00325910"	"00603"
"00325911"	"00603"
"00325912"	"00603"
"00325913"	"00603"
"00325914"	"00603"
"00325915"	"00603"
"00325916"	"00603"
"00325917"	"00603"
"00325918"	"00603"
"00325919"	"00603"
"00325920"	"00603"
"00325921"	"00603"
"00325922"	"00603"
"00325923"	"00603"
"00325924"	"00603"
"00325925"	"00603"
"00325926"	"00603"
"00325927"	"00603"
"00325928"	"00603"
"00325929"	"00603"
"00325930"	"00603"
"00325931"	"00603"
"00325932"	"00603"
"00325933"	"00603"
"00325934"	"00603"
"00325935"	"00603"
"00325936"	"00603"
"00325937"	"00603"
"00325938"	"00603"
"00325939"	"00603"
"00325940"	"00603"
"00325941"	"00603"
"00325942"	"00604"
"00326026"	"00604"
"00326027"	"00603"
"00326028"	"00603"
"00326029"	"00603"
"00326030"	"00603"
"00326031"	"00603"
"00326032"	"00603"
"00326033"	"00603"
"00326034"	"00603"
"00326042"	"00603"
"00326044"	"00603"
"00326046"	"00603"
"00326065"	"00603"
"00326066"	"00603"
"00326067"	"00603"
"00326068"	"00603"
"00326069"	"00603"
"00326070"	"00603"
"00326071"	"00603"
"00326072"	"00603"
"00326073"	"00603"
"00326074"	"00603"
"00326075"	"00603"
"00326076"	"00603"
"00326077"	"00603"
"00326078"	"00603"
"00326079"	"00603"
"00326080"	"00603"
"00326081"	"00603"
"00326082"	"00603"
"00326083"	"00604"
"00326084"	"00604"
"00326085"	"00604"
"00327547"	"04214"
"00331429"	"05517"
"00359444"	"00603"
"00388425"	"00198"
"00388426"	"00198"
"00388427"	"00198"
"00388428"	"00198"
"00388429"	"00198"
"00388430"	"00198"
"00388431"	"00198"
"00388459"	"00198"
"00388460"	"00198"
"00388466"	"00198"
"00388468"	"00198"
"00434900"	"00603"
"00453756"	"00152"
"00453757"	"00152"
"00453807"	"00152"
"00459489"	"00603"
"00469793"	"05517"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00139, 00152, 00198, 00433, 00603, 00604, 04214, 05517
## Count = 95
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000045145"	"00603"	"00058524"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000053525"	"00433"	"00017613"	"00705"	"Familial, autosomal recessive"	"25y"	"birth weight: 3,850 g; No history of perinatal complications;Normal early\r\ndevelopmental milestones; 24 months: parents reported gait difficulties and persistent toe walking; 6y: poor academic ability;15y: Normal general physical examination; Mild oro-mandibular dystonia with dysarthria; spastic dystonic paraparesis; still able to walk unaided; IQ ¼ 49; 20y:unable to ambulate independently; 25y: severe spastic bradykinetic-rigid syndrome associated with mild dystonia with distal areflexia in the lower limbs"	""	""	""	""	""	""	""	""	""	""	""
"0000170778"	"00198"	"00225672"	"00006"	"Familial, autosomal recessive"	""	"see paper; …, Meckel-Gruber syndrome"	""	""	""	""	""	""	""	""	""	"neurogenetic disorder"	""
"0000232931"	"00603"	"00307126"	"00006"	"Familial, autosomal recessive"	"18y"	"see paper; ..., height 124.5 cm; short limbs, polydactyly hands/feet, no syndactyly, brachydactyly; nail dysplasia; genu valgum; no cardiac malformation; hypodontia/dysplastic teeth"	""	""	""	""	""	""	""	""	"EVC"	"Ellis-van Creveld syndrome"	""
"0000244352"	"00603"	"00325865"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"EVC"	"Ellis-van Creveld syndrome"	""
"0000244353"	"00603"	"00325866"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"EVC"	"Ellis-van Creveld syndrome"	""
"0000244370"	"00603"	"00325883"	"00006"	"Familial, autosomal recessive"	""	"common atrium/partial AV canal, large patent ductus arteriosis, short stature, polydactyly"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244371"	"00603"	"00325884"	"00006"	"Familial, autosomal recessive"	""	"common atrium/partial AV canal, coarctation of the aorta, short stature, polydactyly"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244372"	"00603"	"00325885"	"00006"	"Familial, autosomal recessive"	""	"common atrium/partial AV canal, short stature, polydactyly"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244397"	"00603"	"00325910"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244398"	"00603"	"00325911"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244399"	"00603"	"00325912"	"00006"	"Familial, autosomal recessive"	""	"see paper; ...,  atrial septal defect, short limb dysplasia with genu valgum, polydactyly, multiple oral frenulae, oligodontia, dysplastic teeth"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244400"	"00603"	"00325913"	"00006"	"Familial, autosomal recessive"	""	"short limb dysplasia, short ribs, postaxial polydactyly hands, dysplastic nails, dysplastic teeth, hyperplasia alveolar ridges, multiple oral frenulae; patent arterial duct, no other cardiac abnormality"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244401"	"00603"	"00325914"	"00006"	"Familial, autosomal recessive"	""	"stillborn child, ventricular septal defect, short limbs with postaxial polydactyly hands; radiographs short limbs, classical pelvic configuration"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244402"	"00603"	"00325915"	"00006"	"Familial, autosomal recessive"	""	"disproportionate short stature, acromesomelic limb shortening, short ribs, postaxial polydactyly hands, nail dysplasia, fusion hamate and capitate; oligodontia, dysplastic teeth, multiple oral frenulae; genu valgum (1/2)"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244403"	"00603"	"00325916"	"00006"	"Familial, autosomal recessive"	""	"ostium primum atrial septal defects, short limb dysplasia, postaxial polydactyly hands, nail dysplasia, tooth dysplasia"	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244404"	"00603"	"00325917"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244405"	"00603"	"00325918"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244406"	"00603"	"00325919"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244407"	"00603"	"00325920"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244408"	"00603"	"00325921"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244409"	"00603"	"00325922"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244410"	"00603"	"00325923"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244411"	"00603"	"00325924"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244412"	"00603"	"00325925"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244413"	"00603"	"00325926"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244414"	"00603"	"00325927"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244415"	"00603"	"00325928"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244416"	"00603"	"00325929"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244417"	"00603"	"00325930"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244418"	"00603"	"00325931"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244419"	"00603"	"00325932"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244420"	"00603"	"00325933"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244421"	"00603"	"00325934"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244422"	"00603"	"00325935"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244423"	"00603"	"00325936"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244424"	"00603"	"00325937"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244425"	"00603"	"00325938"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244426"	"00603"	"00325939"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244427"	"00603"	"00325940"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244428"	"00603"	"00325941"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis van Creveld syndrome"	""
"0000244429"	"00604"	"00325942"	"00006"	"Familial, autosomal dominant"	""	"see paper; ..."	""	""	""	""	""	""	""	""	"WAD"	"Weyers acrofacial dysostosis"	""
"0000244511"	"00604"	"00326026"	"00006"	"Isolated (sporadic)"	"26y"	"short stature, postaxial polydactyly, nail hypoplasia, teeth abnormalities"	""	""	""	""	""	""	""	""	"WAD"	"Ellis van Creveld syndrome"	""
"0000244512"	"00603"	"00326027"	"00006"	"Familial, autosomal recessive"	"23y"	"short stature, postaxial polydactyly, short ribs, narrow palate"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244513"	"00603"	"00326028"	"00006"	"Familial, autosomal recessive"	"6y"	"short stature, postaxial polydactyly, short limbs, hypoplastic nails, multiple oral frenula, patent ductus arteriosus, aortic valve stenosis, congenital thoracolumbar scoliosis"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244514"	"00603"	"00326029"	"00006"	"Familial, autosomal recessive"	"<0d"	"postaxial polydactyly, short limbs, short ribs, partial atrioventricular canal, hypoplastic lungs, club feet"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244515"	"00603"	"00326030"	"00006"	"Unknown"	"11m"	"bilateral postaxial hands and feet polydactyly, nail hypoplasia, thin dry hair, abnormally shaped teeth, multiple oral frenula, ventricular septal defect, aortic coarctation,"	""	""	""	""	""	""	""	""	""	"Ellis van Creveld syndrome"	""
"0000244516"	"00603"	"00326031"	"00006"	"Familial, autosomal recessive"	"<0d"	"short stature, postaxial polydactyly, short ribs, anteriorly placed anus"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244517"	"00603"	"00326032"	"00006"	"Unknown"	"4y"	"normal stature, postaxial polydactyly, hypoplastic nails, hypodontia and enamel hypoplasia, abnormally shaped teeth"	""	""	""	""	""	""	""	""	"WAD"	"Ellis van Creveld syndrome"	""
"0000244518"	"00603"	"00326033"	"00006"	"Familial, autosomal recessive"	"<0d"	"postaxial polydactyly, hypoplastic nails, atrial septal defect, patent ductus arteriosus, multiple oral frenula"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244519"	"00603"	"00326034"	"00006"	"Familial, autosomal recessive"	"2y"	"short stature, postaxial polydactyly, dysplastic or absent nails, sparse hair, multiple oral frenula, Shone\'s complex,ventricular septal defect, bilateral deafness"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244527"	"00603"	"00326042"	"00006"	"Familial, autosomal recessive"	""	"common atrium with dilated coronary sinus; short/thin upper lip, short/multiple frenula, irregular alveolar ridge, no natal teeth, short broad nose, long philtrum; postaxial polydactyly hands right, limb shortening mesomelic, narrow chest, nail hypoplasia; short long bones, short ribs with narrow chest, small iliac bones with downward spike"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis-van Creveld syndrome"	""
"0000244529"	"00603"	"00326044"	"00006"	"Familial, autosomal recessive"	""	"heart AV canal defect; short/thin upper lip, short/multiple frenula, irregular alveolar ridge, natal teeth, short broad nose, long philtrum; postaxial polydactyly hands, limb shortening mesomelic, narrow chest, nail hypoplasia; short long bones, short ribs with narrow chest, small iliac bones with downward spike"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis-van Creveld syndrome"	""
"0000244531"	"00603"	"00326046"	"00006"	"Familial, autosomal recessive"	"06y"	"postaxial polydactyly, no cardiac anomalies, no narrow chest, short stature, distal limb shortening, dysplastic nails, no excess frenula, hypodontia, tooth abnormalities, syndactyly, no hair changes, genu valgum, abnormal clavicles"	""	""	""	""	""	""	""	""	"EVC2"	"Ellis-van Creveld syndrome"	""
"0000244550"	"00603"	"00326065"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244551"	"00603"	"00326066"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244552"	"00603"	"00326067"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244553"	"00603"	"00326068"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244554"	"00603"	"00326069"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244555"	"00603"	"00326070"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244556"	"00603"	"00326071"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244557"	"00603"	"00326072"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244558"	"00603"	"00326073"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244559"	"00603"	"00326074"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244560"	"00603"	"00326075"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244561"	"00603"	"00326076"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244562"	"00603"	"00326077"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244563"	"00603"	"00326078"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244564"	"00603"	"00326079"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244565"	"00603"	"00326080"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244566"	"00603"	"00326081"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244567"	"00603"	"00326082"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC2"	"Ellis van Creveld syndrome"	""
"0000244568"	"00604"	"00326083"	"00006"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"WAD"	"Weyers acrodental dysostosis"	""
"0000244569"	"00604"	"00326084"	"00006"	"Isolated (sporadic)"	""	""	""	""	""	""	""	""	""	""	"WAD"	"Weyers acrodental dysostosis"	""
"0000244570"	"00604"	"00326085"	"00006"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"WAD"	"Weyers acrodental dysostosis"	""
"0000245811"	"04214"	"00327547"	"00006"	"Familial, autosomal recessive"	""	"see paper; ..., Leber congenital amaurosis , Joubert syndrome, polycystic kidney disease"	""	""	""	""	""	""	""	""	""	""	""
"0000249621"	"05517"	"00331429"	"00000"	"Familial, autosomal recessive"	""	"Neonatal death, Potter facies, Sloping forehead, Hypertelorism, Low-set ears, Occipital en No"	""	""	""	""	""	""	""	""	"Ciliopathies with major skeletal involvement"	"skeletal dysplasia"	""
"0000254685"	"00603"	"00359444"	"01709"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"EVC"	""
"0000281977"	"00198"	"00388425"	"00000"	"Familial, autosomal recessive"	""	"polydactyly"	""	""	""	""	""	""	""	""	""	"asphyxiating thoracic dystrophy (ATD)"	""
"0000281978"	"00198"	"00388426"	"00000"	"Familial, autosomal recessive"	""	"polydactyly"	""	""	""	""	""	""	""	""	""	"perinatal lethal short-rib polydactyly syndromes (SRPS II)"	""
"0000281979"	"00198"	"00388427"	"00000"	"Familial, autosomal recessive"	""	"polydactyly"	""	""	""	""	""	""	""	""	""	"Ellis van Creveld (EVC)"	""
"0000281980"	"00198"	"00388428"	"00000"	"Familial, autosomal recessive"	""	"polydactyly"	""	""	""	""	""	""	""	""	""	"Ellis van Creveld (EVC)"	""
"0000281981"	"00198"	"00388429"	"00000"	"Familial, autosomal recessive"	""	"polydactyly"	""	""	""	""	""	""	""	""	""	"Ellis van Creveld (EVC)"	""
"0000281982"	"00198"	"00388430"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"asphyxiating thoracic dystrophy (ATD)"	""
"0000281983"	"00198"	"00388431"	"00000"	"Familial, autosomal recessive"	""	"polydactyly"	""	""	""	""	""	""	""	""	""	"perinatal lethal short-rib polydactyly syndromes (SRPS II)"	""
"0000282011"	"00198"	"00388459"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"perinatal lethal short-rib polydactyly syndromes (SRPS IV)"	""
"0000282012"	"00198"	"00388460"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"perinatal lethal short-rib polydactyly syndromes (SRPS IV)"	""
"0000282018"	"00198"	"00388466"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"perinatal lethal short-rib polydactyly syndromes (SRPS IV)"	""
"0000282020"	"00198"	"00388468"	"00000"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"asphyxiating thoracic dystrophy (ATD)"	""
"0000325146"	"00603"	"00434900"	"04216"	"Familial, autosomal recessive"	"15y"	"HP:0000007 Autosomal recessive inheritance\r\nHP:0008921 Neonatal short-limb short stature\r\nHP:0008873 Disproportionate short-limb short stature\r\nHP:0000668 Hypodontia\r\nHP:0002857 Genu valgum\r\nHP:0001162 Postaxial hand polydactyly\r\nHP:0002164 Nail dysplasia\r\nHP:0000968 Ectodermal dysplasia"	""	"15y"	""	""	""	""	""	""	"Ellis-van Creveld syndrome"	"Ellis-van Creveld syndrome"	""
"0000342413"	"00152"	"00453756"	"00006"	"Unknown"	""	"aortic valve replacement; large ascending aneurysm,CHARGE syndrome"	""	""	""	""	""	""	""	""	""	"bicuspid aortic valve"	""
"0000342414"	"00152"	"00453757"	"00006"	"Unknown"	""	"root aneurysm"	""	""	""	""	""	""	""	""	""	"bicuspid aortic valve"	""
"0000342464"	"00152"	"00453807"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	"bicuspid aortic valve"	""
"0000347565"	"00603"	"00459489"	"04787"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"EVC"	"Ellis-van Creveld syndrome"	""
"0000354938"	"05517"	"00469793"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	"EVC"	"skeletal dysplasia"	""


## Screenings ## Do not remove or alter this header ##
## Count = 100
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000017596"	"00017613"	"1"	"00705"	"00705"	"2014-06-24 14:06:02"	""	""	"SEQ"	"DNA"	""	""
"0000058487"	"00058524"	"1"	"01396"	"01396"	"2016-01-27 18:00:04"	""	""	"SEQ-NG"	"DNA"	""	""
"0000226739"	"00225672"	"1"	"00006"	"00006"	"2019-02-22 18:37:24"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000294799"	"00293631"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294801"	"00293633"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294802"	"00293634"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000294803"	"00293635"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000306127"	"00304998"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000308268"	"00307126"	"1"	"00006"	"00006"	"2020-08-03 12:48:10"	"00006"	"2020-08-03 12:52:28"	"SEQ"	"DNA"	""	""
"0000327075"	"00325865"	"1"	"00006"	"00006"	"2021-01-04 12:15:38"	"00006"	"2021-01-04 12:23:05"	"SEQ"	"DNA"	""	""
"0000327076"	"00325866"	"1"	"00006"	"00006"	"2021-01-04 12:19:34"	""	""	"SEQ"	"DNA"	""	""
"0000327093"	"00325883"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327094"	"00325884"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327095"	"00325885"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327120"	"00325910"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327121"	"00325911"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327122"	"00325912"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327123"	"00325913"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327124"	"00325914"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327125"	"00325915"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327126"	"00325916"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327127"	"00325917"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327128"	"00325918"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327129"	"00325919"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327130"	"00325920"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327131"	"00325921"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327132"	"00325922"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327133"	"00325923"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327134"	"00325924"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327135"	"00325925"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327136"	"00325926"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327137"	"00325927"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327138"	"00325928"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327139"	"00325929"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327140"	"00325930"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327141"	"00325931"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327142"	"00325932"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327143"	"00325933"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000327144"	"00325934"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327145"	"00325935"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327146"	"00325936"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327147"	"00325937"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327148"	"00325938"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327149"	"00325939"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327150"	"00325940"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327151"	"00325941"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327152"	"00325942"	"1"	"00006"	"00006"	"2021-01-05 09:10:52"	""	""	"SEQ"	"DNA"	""	""
"0000327236"	"00326026"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327237"	"00326027"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327238"	"00326028"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327239"	"00326029"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327240"	"00326030"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327241"	"00326031"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327242"	"00326032"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327243"	"00326033"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327244"	"00326034"	"1"	"00006"	"00006"	"2021-01-06 18:59:52"	""	""	"SEQ"	"DNA"	""	""
"0000327252"	"00326042"	"1"	"00006"	"00006"	"2021-01-06 19:50:30"	""	""	"SEQ"	"DNA"	""	""
"0000327254"	"00326044"	"1"	"00006"	"00006"	"2021-01-06 19:58:03"	""	""	"SEQ"	"DNA"	""	""
"0000327256"	"00326046"	"1"	"00006"	"00006"	"2021-01-06 20:40:41"	""	""	"SEQ"	"DNA"	""	""
"0000327275"	"00326065"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327276"	"00326066"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327277"	"00326067"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327278"	"00326068"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327279"	"00326069"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327280"	"00326070"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327281"	"00326071"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327282"	"00326072"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327283"	"00326073"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327284"	"00326074"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327285"	"00326075"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327286"	"00326076"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327287"	"00326077"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327288"	"00326078"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327289"	"00326079"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327290"	"00326080"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327291"	"00326081"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327292"	"00326082"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327293"	"00326083"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327294"	"00326084"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000327295"	"00326085"	"1"	"00006"	"00006"	"2021-01-06 21:50:31"	""	""	"SEQ"	"DNA"	""	""
"0000328762"	"00327547"	"1"	"00006"	"00006"	"2021-01-23 14:41:55"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000332648"	"00331429"	"1"	"00000"	"00006"	"2021-02-11 15:29:38"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000360674"	"00359444"	"1"	"01709"	"00006"	"2021-03-22 12:01:49"	""	""	"SEQ"	"DNA"	""	""
"0000389666"	"00388425"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389667"	"00388426"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389668"	"00388427"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389669"	"00388428"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389670"	"00388429"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389671"	"00388430"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389672"	"00388431"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389700"	"00388459"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389701"	"00388460"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389707"	"00388466"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000389709"	"00388468"	"1"	"00000"	"00008"	"2021-11-04 08:27:28"	""	""	"SEQ-NG"	"DNA"	""	"Exome sequencing"
"0000436373"	"00434900"	"1"	"04216"	"04216"	"2023-04-13 03:22:34"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	"WES"
"0000455368"	"00453756"	"1"	"00006"	"00006"	"2024-09-11 19:50:28"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000455369"	"00453757"	"1"	"00006"	"00006"	"2024-09-11 19:50:28"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000455419"	"00453807"	"1"	"00006"	"00006"	"2024-09-11 19:50:28"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000461117"	"00459489"	"1"	"04787"	"04787"	"2025-01-06 09:28:57"	""	""	"SEQ-NG-I"	"DNA"	"Blood"	"WES"
"0000471461"	"00469793"	"1"	"00006"	"00006"	"2025-11-20 12:33:13"	""	""	"SEQ;SEQ-NG"	"DNA"	""	""


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 120
"{{screeningid}}"	"{{geneid}}"
"0000017596"	"COASY"
"0000058487"	"EVC"
"0000058487"	"EVC2"
"0000226739"	"EVC2"
"0000308268"	"EVC2"
"0000327075"	"EVC2"
"0000327076"	"EVC2"
"0000327093"	"EVC2"
"0000327094"	"EVC2"
"0000327095"	"EVC2"
"0000327120"	"EVC2"
"0000327121"	"EVC2"
"0000327122"	"EVC2"
"0000327123"	"EVC2"
"0000327124"	"EVC2"
"0000327125"	"EVC2"
"0000327126"	"EVC2"
"0000327127"	"EVC2"
"0000327128"	"EVC2"
"0000327129"	"EVC2"
"0000327130"	"EVC2"
"0000327131"	"EVC2"
"0000327132"	"EVC2"
"0000327133"	"EVC2"
"0000327134"	"EVC2"
"0000327135"	"EVC2"
"0000327136"	"EVC2"
"0000327137"	"EVC2"
"0000327138"	"EVC2"
"0000327139"	"EVC2"
"0000327140"	"EVC2"
"0000327141"	"EVC2"
"0000327142"	"EVC2"
"0000327143"	"EVC2"
"0000327144"	"EVC2"
"0000327145"	"EVC2"
"0000327146"	"EVC2"
"0000327147"	"EVC2"
"0000327148"	"EVC2"
"0000327149"	"EVC2"
"0000327150"	"EVC2"
"0000327151"	"EVC2"
"0000327152"	"EVC2"
"0000327236"	"EVC"
"0000327236"	"EVC2"
"0000327237"	"EVC"
"0000327237"	"EVC2"
"0000327238"	"EVC"
"0000327238"	"EVC2"
"0000327239"	"EVC"
"0000327239"	"EVC2"
"0000327240"	"EVC"
"0000327240"	"EVC2"
"0000327241"	"EVC"
"0000327241"	"EVC2"
"0000327242"	"EVC"
"0000327242"	"EVC2"
"0000327243"	"EVC"
"0000327243"	"EVC2"
"0000327244"	"EVC"
"0000327244"	"EVC2"
"0000327252"	"EVC2"
"0000327254"	"EVC2"
"0000327256"	"EVC"
"0000327256"	"EVC2"
"0000327275"	"EVC"
"0000327275"	"EVC2"
"0000327276"	"EVC"
"0000327276"	"EVC2"
"0000327277"	"EVC"
"0000327277"	"EVC2"
"0000327278"	"EVC"
"0000327278"	"EVC2"
"0000327279"	"EVC"
"0000327279"	"EVC2"
"0000327280"	"EVC"
"0000327280"	"EVC2"
"0000327281"	"EVC"
"0000327281"	"EVC2"
"0000327282"	"EVC"
"0000327282"	"EVC2"
"0000327283"	"EVC"
"0000327283"	"EVC2"
"0000327284"	"EVC"
"0000327284"	"EVC2"
"0000327285"	"EVC"
"0000327285"	"EVC2"
"0000327286"	"EVC"
"0000327286"	"EVC2"
"0000327287"	"EVC"
"0000327287"	"EVC2"
"0000327288"	"EVC"
"0000327288"	"EVC2"
"0000327289"	"EVC"
"0000327289"	"EVC2"
"0000327290"	"EVC"
"0000327290"	"EVC2"
"0000327291"	"EVC"
"0000327291"	"EVC2"
"0000327292"	"EVC"
"0000327292"	"EVC2"
"0000327293"	"EVC"
"0000327293"	"EVC2"
"0000327294"	"EVC"
"0000327294"	"EVC2"
"0000327295"	"EVC"
"0000327295"	"EVC2"
"0000332648"	"EVC2"
"0000389666"	"EVC2"
"0000389667"	"EVC2"
"0000389668"	"EVC2"
"0000389669"	"EVC2"
"0000389670"	"EVC2"
"0000389671"	"EVC2"
"0000389672"	"EVC2"
"0000389700"	"EVC2"
"0000389701"	"EVC2"
"0000389707"	"DYNC2H1"
"0000389709"	"EVC2"
"0000461117"	"EVC2"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 286
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000089068"	"3"	"70"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"01396"	"EVC2_000001"	"g.5642516G>A"	""	""	""	"g.68760C>T"	""	"Germline"	""	"rs137852924"	"0"	""	""	"g.5640789G>A"	""	"likely pathogenic"	""
"0000117670"	"3"	"50"	"4"	"5624616"	"5624616"	"subst"	"0"	"00006"	"EVC2_000002"	"g.5624616G>C"	""	"{PMID:Dusi 2014:24360804}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5622889G>C"	""	"VUS"	""
"0000117671"	"3"	"50"	"4"	"5667370"	"5667370"	"subst"	"0"	"00006"	"EVC2_000003"	"g.5667370G>A"	""	"{PMID:Dusi 2014:24360804}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5665643G>A"	""	"VUS"	""
"0000250706"	"0"	"10"	"4"	"5630481"	"5630481"	"del"	"0"	"02326"	"EVC2_000026"	"g.5630481del"	""	""	""	"EVC2(NM_001166136.1):c.1471-10delT, EVC2(NM_147127.5):c.1711-10delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5628754del"	""	"benign"	""
"0000251123"	"0"	"10"	"4"	"5630442"	"5630442"	"subst"	"0.00227856"	"02326"	"EVC2_000024"	"g.5630442A>G"	""	""	""	"EVC2(NM_001166136.1):c.1490T>C (p.(Met497Thr)), EVC2(NM_147127.5):c.1730T>C (p.M577T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5628715A>G"	""	"benign"	""
"0000253058"	"0"	"10"	"4"	"5630481"	"5630481"	"del"	"0"	"01943"	"EVC2_000026"	"g.5630481del"	""	""	""	"EVC2(NM_001166136.1):c.1471-10delT, EVC2(NM_147127.5):c.1711-10delT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5628754del"	""	"benign"	""
"0000267914"	"0"	"10"	"4"	"5570221"	"5570221"	"subst"	"0.390569"	"02325"	"EVC2_000008"	"g.5570221G>A"	""	""	""	"EVC2(NM_001166136.2):c.3267C>T (p.H1089=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5568494G>A"	""	"benign"	""
"0000267915"	"0"	"10"	"4"	"5690902"	"5690902"	"subst"	"0.23838"	"02325"	"EVC2_000035"	"g.5690902T>C"	""	""	""	"EVC2(NM_001166136.2):c.448A>G (p.S150G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5689175T>C"	""	"benign"	""
"0000271258"	"0"	"30"	"4"	"5713196"	"5713196"	"subst"	"0"	"02326"	"EVC_000002"	"g.5713196C>T"	""	""	""	"EVC(NM_153717.2):c.89C>T (p.(Pro30Leu)), EVC(NM_153717.3):c.89C>T (p.P30L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5711469C>T"	""	"likely benign"	""
"0000271260"	"0"	"10"	"4"	"5710255"	"5710255"	"subst"	"0.132807"	"02326"	"EVC2_000039"	"g.5710255C>T"	""	""	""	"EVC2(NM_147127.5):c.-15G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5708528C>T"	""	"benign"	""
"0000271261"	"0"	"10"	"4"	"5642327"	"5642327"	"subst"	"0.00422738"	"02326"	"EVC2_000028"	"g.5642327T>C"	""	""	""	"EVC2(NM_001166136.1):c.1144A>G (p.(Thr382Ala)), EVC2(NM_147127.5):c.1384A>G (p.T462A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5640600T>C"	""	"benign"	""
"0000271262"	"0"	"10"	"4"	"5642249"	"5642249"	"subst"	"0.00217464"	"02326"	"EVC2_000027"	"g.5642249C>T"	""	""	""	"EVC2(NM_001166136.1):c.1222G>A (p.G408S, p.(Gly408Ser)), EVC2(NM_147127.5):c.1462G>A (p.G488S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5640522C>T"	""	"benign"	""
"0000271263"	"0"	"10"	"4"	"5630480"	"5630481"	"dup"	"0"	"02326"	"EVC2_000025"	"g.5630480_5630481dup"	""	""	""	"EVC2(NM_001166136.1):c.1471-12_1471-11dupTT, EVC2(NM_147127.5):c.1711-12_1711-11dupTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5628753_5628754dup"	""	"benign"	""
"0000271264"	"0"	"10"	"4"	"5627493"	"5627493"	"subst"	"0.00393627"	"02326"	"EVC2_000021"	"g.5627493G>T"	""	""	""	"EVC2(NM_147127.5):c.2029C>A (p.(Arg677=), p.R677=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5625766G>T"	""	"benign"	""
"0000271265"	"0"	"10"	"4"	"5624727"	"5624727"	"subst"	"0.00391386"	"02326"	"EVC2_000019"	"g.5624727T>A"	""	""	""	"EVC2(NM_147127.5):c.2047-9A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5623000T>A"	""	"benign"	""
"0000271266"	"0"	"10"	"4"	"5586367"	"5586367"	"subst"	"0.00352216"	"02326"	"EVC2_000011"	"g.5586367G>C"	""	""	""	"EVC2(NM_147127.5):c.3040C>G (p.(Leu1014Val), p.L1014V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5584640G>C"	""	"benign"	""
"0000271267"	"0"	"10"	"4"	"5570161"	"5570161"	"subst"	"0.0183405"	"02326"	"EVC2_000007"	"g.5570161C>T"	""	""	""	"EVC2(NM_147127.5):c.3557+10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5568434C>T"	""	"benign"	""
"0000271268"	"0"	"10"	"4"	"5710189"	"5710189"	"subst"	"0.152165"	"02326"	"EVC2_000038"	"g.5710189G>A"	""	""	""	"EVC2(NM_147127.5):c.52C>T (p.L18F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5708462G>A"	""	"benign"	""
"0000276423"	"0"	"30"	"4"	"5710119"	"5710119"	"subst"	"0.00361849"	"01943"	"EVC2_000037"	"g.5710119G>T"	""	""	""	"EVC2(NM_147127.4):c.122C>A (p.P41H, p.(Pro41His)), EVC2(NM_147127.5):c.122C>A (p.P41H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5708392G>T"	""	"likely benign"	""
"0000276424"	"0"	"30"	"4"	"5564770"	"5564770"	"subst"	"3.65506E-5"	"01943"	"EVC2_000005"	"g.5564770C>T"	""	""	""	"EVC2(NM_001166136.1):c.3492G>A (p.L1164=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5563043C>T"	""	"likely benign"	""
"0000329858"	"0"	"50"	"4"	"5566977"	"5566977"	"subst"	"0.000791923"	"01804"	"EVC2_000006"	"g.5566977A>G"	""	""	""	"EVC2(NM_001166136.1):c.3419+8T>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5565250A>G"	""	"VUS"	""
"0000329859"	"0"	"50"	"4"	"5577959"	"5577959"	"subst"	"0.000869382"	"01804"	"EVC2_000009"	"g.5577959C>T"	""	""	""	"EVC2(NM_001166136.1):c.3032+8G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5576232C>T"	""	"VUS"	""
"0000329860"	"0"	"30"	"4"	"5578101"	"5578101"	"subst"	"0.00336422"	"01804"	"EVC2_000010"	"g.5578101G>C"	""	""	""	"EVC2(NM_001166136.1):c.2898C>G (p.(Ser966Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5576374G>C"	""	"likely benign"	""
"0000329861"	"0"	"50"	"4"	"5586400"	"5586400"	"subst"	"0.00059831"	"01804"	"EVC2_000012"	"g.5586400C>T"	""	""	""	"EVC2(NM_001166136.1):c.2767G>A (p.(Glu923Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5584673C>T"	""	"VUS"	""
"0000329862"	"0"	"50"	"4"	"5586544"	"5586544"	"subst"	"0.00123899"	"01804"	"EVC2_000013"	"g.5586544G>A"	""	""	""	"EVC2(NM_001166136.1):c.2623C>T (p.(Arg875Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5584817G>A"	""	"VUS"	""
"0000329863"	"0"	"50"	"4"	"5624313"	"5624313"	"subst"	"1.22109E-5"	"01804"	"EVC2_000014"	"g.5624313C>T"	""	""	""	"EVC2(NM_001166136.1):c.2212G>A (p.(Val738Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5622586C>T"	""	"VUS"	""
"0000329864"	"0"	"50"	"4"	"5624405"	"5624405"	"subst"	"0"	"01804"	"EVC2_000015"	"g.5624405C>T"	""	""	""	"EVC2(NM_001166136.1):c.2120G>A (p.R707Q, p.(Arg707Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5622678C>T"	""	"VUS"	""
"0000329865"	"0"	"50"	"4"	"5624562"	"5624562"	"subst"	"8.12803E-6"	"01804"	"EVC2_000016"	"g.5624562C>T"	""	""	""	"EVC2(NM_001166136.1):c.1963G>A (p.(Asp655Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5622835C>T"	""	"VUS"	""
"0000329866"	"0"	"50"	"4"	"5624580"	"5624580"	"subst"	"0"	"01804"	"EVC2_000017"	"g.5624580C>G"	""	""	""	"EVC2(NM_001166136.1):c.1945G>C (p.(Asp649His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5622853C>G"	""	"VUS"	""
"0000329867"	"0"	"50"	"4"	"5624714"	"5624714"	"subst"	"8.2375E-6"	"01804"	"EVC2_000018"	"g.5624714C>T"	""	""	""	"EVC2(NM_001166136.1):c.1811G>A (p.(Arg604Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5622987C>T"	""	"VUS"	""
"0000329868"	"0"	"50"	"4"	"5627483"	"5627483"	"subst"	"0.000231547"	"01804"	"EVC2_000020"	"g.5627483A>G"	""	""	""	"EVC2(NM_147127.5):c.2039T>C (p.(Leu680Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5625756A>G"	""	"VUS"	""
"0000329870"	"0"	"50"	"4"	"5630368"	"5630368"	"subst"	"4.06062E-6"	"01804"	"EVC2_000023"	"g.5630368G>T"	""	""	""	"EVC2(NM_001166136.1):c.1564C>A (p.(Leu522Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5628641G>T"	""	"VUS"	""
"0000329871"	"0"	"30"	"4"	"5630442"	"5630442"	"subst"	"0.00227856"	"01804"	"EVC2_000024"	"g.5630442A>G"	""	""	""	"EVC2(NM_001166136.1):c.1490T>C (p.(Met497Thr)), EVC2(NM_147127.5):c.1730T>C (p.M577T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5628715A>G"	""	"likely benign"	""
"0000329873"	"0"	"50"	"4"	"5642496"	"5642496"	"subst"	"2.03155E-5"	"01804"	"EVC2_000029"	"g.5642496A>T"	""	""	""	"EVC2(NM_001166136.1):c.975T>A (p.D325E, p.(Asp325Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5640769A>T"	""	"VUS"	""
"0000329874"	"0"	"50"	"4"	"5664939"	"5664939"	"subst"	"0.00149839"	"01804"	"EVC2_000030"	"g.5664939G>A"	""	""	""	"EVC2(NM_001166136.1):c.800C>T (p.(Pro267Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5663212G>A"	""	"VUS"	""
"0000329875"	"0"	"50"	"4"	"5667287"	"5667287"	"subst"	"7.71605E-5"	"01804"	"EVC2_000031"	"g.5667287C>G"	""	""	""	"EVC2(NM_001166136.1):c.720G>C (p.(Met240Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5665560C>G"	""	"VUS"	""
"0000329876"	"0"	"50"	"4"	"5667334"	"5667334"	"subst"	"0.000572654"	"01804"	"EVC2_000032"	"g.5667334C>A"	""	""	""	"EVC2(NM_001166136.1):c.673G>T (p.A225S, p.(Ala225Ser)), EVC2(NM_147127.5):c.913G>T (p.A305S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5665607C>A"	""	"VUS"	""
"0000329877"	"0"	"50"	"4"	"5667343"	"5667343"	"subst"	"0.000572668"	"01804"	"EVC2_000033"	"g.5667343A>T"	""	""	""	"EVC2(NM_001166136.1):c.664T>A (p.F222I, p.(Phe222Ile)), EVC2(NM_147127.5):c.904T>A (p.F302I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5665616A>T"	""	"VUS"	""
"0000329878"	"0"	"50"	"4"	"5690898"	"5690898"	"subst"	"0.00189243"	"01804"	"EVC2_000034"	"g.5690898T>C"	""	""	""	"EVC2(NM_001166136.1):c.452A>G (p.(Lys151Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5689171T>C"	""	"VUS"	""
"0000329881"	"0"	"50"	"4"	"5713196"	"5713196"	"subst"	"0"	"01804"	"EVC_000002"	"g.5713196C>T"	""	""	""	"EVC(NM_153717.2):c.89C>T (p.(Pro30Leu)), EVC(NM_153717.3):c.89C>T (p.P30L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5711469C>T"	""	"VUS"	""
"0000344467"	"0"	"90"	"4"	"5699339"	"5699339"	"subst"	"4.06075E-6"	"02327"	"EVC2_000040"	"g.5699339G>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.5697612G>T"	""	"pathogenic"	""
"0000459774"	"3"	"90"	"4"	"5564609"	"5564632"	"dup"	"0"	"00006"	"EVC2_000041"	"g.5564609_5564632dup"	""	"{PMID:Shaheen 2013:23169490}, {PMID:Alazami 2015:25558065}, {DOI:Alazami 2015:10.1016/j.celrep.2014.12.015}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.5562882_5562905dup"	""	"pathogenic (recessive)"	""
"0000522672"	"0"	"30"	"4"	"5566977"	"5566977"	"subst"	"0.000791923"	"01943"	"EVC2_000006"	"g.5566977A>G"	""	""	""	"EVC2(NM_001166136.1):c.3419+8T>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5565250A>G"	""	"likely benign"	""
"0000522673"	"0"	"30"	"4"	"5577959"	"5577959"	"subst"	"0.000869382"	"01943"	"EVC2_000009"	"g.5577959C>T"	""	""	""	"EVC2(NM_001166136.1):c.3032+8G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5576232C>T"	""	"likely benign"	""
"0000522674"	"0"	"30"	"4"	"5586367"	"5586367"	"subst"	"0.00352216"	"01804"	"EVC2_000011"	"g.5586367G>C"	""	""	""	"EVC2(NM_147127.5):c.3040C>G (p.(Leu1014Val), p.L1014V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5584640G>C"	""	"likely benign"	""
"0000522675"	"0"	"10"	"4"	"5586384"	"5586384"	"subst"	"0.00869501"	"01804"	"EVC2_000042"	"g.5586384G>A"	""	""	""	"EVC2(NM_001166136.1):c.2783C>T (p.(Ser928Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5584657G>A"	""	"benign"	""
"0000522686"	"0"	"50"	"4"	"5620230"	"5620230"	"subst"	"4.06204E-6"	"02325"	"EVC2_000043"	"g.5620230T>A"	""	""	""	"EVC2(NM_001166136.2):c.2441A>T (p.Q814L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5618503T>A"	""	"VUS"	""
"0000522687"	"0"	"30"	"4"	"5620263"	"5620263"	"subst"	"0.00387096"	"01804"	"EVC2_000044"	"g.5620263G>A"	""	""	""	"EVC2(NM_001166136.1):c.2408C>T (p.A803V, p.(Ala803Val)), EVC2(NM_147127.5):c.2648C>T (p.A883V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5618536G>A"	""	"likely benign"	""
"0000522688"	"0"	"50"	"4"	"5620297"	"5620297"	"subst"	"0.000174788"	"01804"	"EVC2_000045"	"g.5620297G>A"	""	""	""	"EVC2(NM_001166136.1):c.2374C>T (p.(Arg792Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5618570G>A"	""	"VUS"	""
"0000522692"	"0"	"10"	"4"	"5624278"	"5624278"	"subst"	"0.00394823"	"01943"	"EVC2_000046"	"g.5624278C>T"	""	""	""	"EVC2(NM_001166136.1):c.2247G>A (p.E749=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5622551C>T"	""	"benign"	""
"0000522693"	"0"	"50"	"4"	"5624558"	"5624558"	"subst"	"0"	"01943"	"EVC2_000047"	"g.5624558A>C"	""	""	""	"EVC2(NM_001166136.1):c.1967T>G (p.L656R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5622831A>C"	""	"VUS"	""
"0000522694"	"0"	"30"	"4"	"5624614"	"5624614"	"subst"	"0.00275197"	"01943"	"EVC2_000048"	"g.5624614G>A"	""	""	""	"EVC2(NM_001166136.1):c.1911C>T (p.H637=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5622887G>A"	""	"likely benign"	""
"0000522695"	"0"	"10"	"4"	"5627471"	"5627471"	"subst"	"0.0168061"	"01804"	"EVC2_000049"	"g.5627471T>C"	""	""	""	"EVC2(NM_001166136.1):c.1806+5A>G (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5625744T>C"	""	"benign"	""
"0000522697"	"0"	"30"	"4"	"5630349"	"5630349"	"subst"	"0.00144563"	"01804"	"EVC2_000050"	"g.5630349C>T"	""	""	""	"EVC2(NM_001166136.1):c.1583G>A (p.(Arg528His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5628622C>T"	""	"likely benign"	""
"0000522700"	"0"	"30"	"4"	"5642249"	"5642249"	"subst"	"0.00217464"	"01943"	"EVC2_000027"	"g.5642249C>T"	""	""	""	"EVC2(NM_001166136.1):c.1222G>A (p.G408S, p.(Gly408Ser)), EVC2(NM_147127.5):c.1462G>A (p.G488S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5640522C>T"	""	"likely benign"	""
"0000522701"	"0"	"30"	"4"	"5642327"	"5642327"	"subst"	"0.00422738"	"01804"	"EVC2_000028"	"g.5642327T>C"	""	""	""	"EVC2(NM_001166136.1):c.1144A>G (p.(Thr382Ala)), EVC2(NM_147127.5):c.1384A>G (p.T462A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5640600T>C"	""	"likely benign"	""
"0000522702"	"0"	"30"	"4"	"5642347"	"5642347"	"subst"	"0.00369152"	"01943"	"EVC2_000051"	"g.5642347G>C"	""	""	""	"EVC2(NM_001166136.1):c.1124C>G (p.T375R, p.(Thr375Arg)), EVC2(NM_147127.5):c.1364C>G (p.T455R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5640620G>C"	""	"likely benign"	""
"0000522703"	"0"	"30"	"4"	"5642503"	"5642503"	"subst"	"0.000812651"	"01943"	"EVC2_000052"	"g.5642503C>T"	""	""	""	"EVC2(NM_001166136.1):c.968G>A (p.S323N, p.(Ser323Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5640776C>T"	""	"likely benign"	""
"0000522704"	"0"	"30"	"4"	"5642513"	"5642513"	"subst"	"0.00158882"	"01804"	"EVC2_000053"	"g.5642513T>C"	""	""	""	"EVC2(NM_001166136.1):c.958A>G (p.(Thr320Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5640786T>C"	""	"likely benign"	""
"0000522705"	"0"	"50"	"4"	"5664935"	"5664935"	"subst"	"0"	"01943"	"EVC2_000054"	"g.5664935G>T"	""	""	""	"EVC2(NM_001166136.1):c.804C>A (p.F268L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5663208G>T"	""	"VUS"	""
"0000522713"	"0"	"30"	"4"	"5687099"	"5687099"	"subst"	"0.00118178"	"01804"	"EVC2_000056"	"g.5687099G>A"	""	""	""	"EVC2(NM_001166136.1):c.574C>T (p.(Arg192Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5685372G>A"	""	"likely benign"	""
"0000522714"	"0"	"30"	"4"	"5687210"	"5687210"	"subst"	"0.00357247"	"01804"	"EVC2_000057"	"g.5687210C>T"	""	""	""	"EVC2(NM_001166136.1):c.467-4G>A (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5685483C>T"	""	"likely benign"	""
"0000522718"	"0"	"50"	"4"	"5691040"	"5691040"	"subst"	"0.000129945"	"01804"	"EVC2_000058"	"g.5691040G>A"	""	""	""	"EVC2(NM_001166136.1):c.310C>T (p.(Arg104Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5689313G>A"	""	"VUS"	""
"0000522720"	"0"	"50"	"4"	"5691069"	"5691069"	"subst"	"0"	"01943"	"EVC2_000060"	"g.5691069A>G"	""	""	""	"EVC2(NM_001166136.1):c.281T>C (p.V94A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5689342A>G"	""	"VUS"	""
"0000522722"	"0"	"90"	"4"	"5699376"	"5699376"	"subst"	"1.62473E-5"	"02325"	"EVC2_000062"	"g.5699376T>C"	""	""	""	"EVC2(NM_001166136.2):c.-12-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5697649T>C"	""	"pathogenic"	""
"0000522725"	"0"	"30"	"4"	"5710119"	"5710119"	"subst"	"0.00361849"	"01804"	"EVC2_000037"	"g.5710119G>T"	""	""	""	"EVC2(NM_147127.4):c.122C>A (p.P41H, p.(Pro41His)), EVC2(NM_147127.5):c.122C>A (p.P41H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5708392G>T"	""	"likely benign"	""
"0000522726"	"0"	"30"	"4"	"5710179"	"5710179"	"subst"	"0"	"01943"	"EVC_000036"	"g.5710179A>G"	""	""	""	"EVC2(NM_147127.4):c.62T>C (p.V21A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5708452A>G"	""	"likely benign"	""
"0000609236"	"0"	"30"	"4"	"5570317"	"5570317"	"subst"	"0.001271"	"01943"	"EVC2_000063"	"g.5570317G>A"	""	""	""	"EVC2(NM_001166136.1):c.3171C>T (p.A1057=), EVC2(NM_147127.5):c.3411C>T (p.(Ala1137=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5568590G>A"	""	"likely benign"	""
"0000609237"	"0"	"50"	"4"	"5617199"	"5617199"	"subst"	"0"	"01804"	"EVC2_000064"	"g.5617199C>G"	""	""	""	"EVC2(NM_001166136.1):c.2539G>C (p.(Asp847His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5615472C>G"	""	"VUS"	""
"0000609238"	"0"	"30"	"4"	"5620290"	"5620290"	"subst"	"0.000568842"	"01804"	"EVC2_000065"	"g.5620290C>T"	""	""	""	"EVC2(NM_001166136.1):c.2381G>A (p.(Arg794Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5618563C>T"	""	"likely benign"	""
"0000609242"	"0"	"30"	"4"	"5627593"	"5627593"	"subst"	"7.30976E-5"	"01804"	"EVC2_000066"	"g.5627593C>G"	""	""	""	"EVC2(NM_001166136.1):c.1689G>C (p.(Glu563Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5625866C>G"	""	"likely benign"	""
"0000609244"	"0"	"30"	"4"	"5633766"	"5633766"	"subst"	"0.000544658"	"01804"	"EVC2_000067"	"g.5633766A>G"	""	""	""	"EVC2(NM_001166136.1):c.1231-7T>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5632039A>G"	""	"likely benign"	""
"0000609245"	"0"	"30"	"4"	"5667334"	"5667334"	"subst"	"0.000572654"	"01943"	"EVC2_000032"	"g.5667334C>A"	""	""	""	"EVC2(NM_001166136.1):c.673G>T (p.A225S, p.(Ala225Ser)), EVC2(NM_147127.5):c.913G>T (p.A305S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5665607C>A"	""	"likely benign"	""
"0000609246"	"0"	"50"	"4"	"5667343"	"5667343"	"subst"	"0.000572668"	"01943"	"EVC2_000033"	"g.5667343A>T"	""	""	""	"EVC2(NM_001166136.1):c.664T>A (p.F222I, p.(Phe222Ile)), EVC2(NM_147127.5):c.904T>A (p.F302I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5665616A>T"	""	"VUS"	""
"0000609247"	"0"	"30"	"4"	"5693057"	"5693057"	"subst"	"0"	"01943"	"EVC2_000068"	"g.5693057C>T"	""	""	""	"EVC2(NM_001166136.1):c.214G>A (p.G72R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5691330C>T"	""	"likely benign"	""
"0000621400"	"0"	"10"	"4"	"5630480"	"5630481"	"dup"	"0"	"01943"	"EVC2_000025"	"g.5630480_5630481dup"	""	""	""	"EVC2(NM_001166136.1):c.1471-12_1471-11dupTT, EVC2(NM_147127.5):c.1711-12_1711-11dupTT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5628753_5628754dup"	""	"benign"	""
"0000651488"	"1"	"10"	"4"	"5617337"	"5617337"	"subst"	"0"	"03575"	"EVC2_000069"	"g.5617337G>A"	"120/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"120 heterozygous; {DB:CLININrs112863054}"	"Germline"	""	"rs112863054"	"0"	""	""	"g.5615610G>A"	""	"benign"	""
"0000651490"	"1"	"50"	"4"	"5630290"	"5630290"	"subst"	"0.000885365"	"03575"	"EVC2_000070"	"g.5630290C>T"	"11/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 11 heterozygous, no homozygous; {DB:CLININrs186197620}"	"Germline"	""	"rs186197620"	"0"	""	""	"g.5628563C>T"	""	"VUS"	""
"0000651491"	"1"	"50"	"4"	"5633732"	"5633732"	"subst"	"2.8434E-5"	"03575"	"EVC2_000071"	"g.5633732G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs148248777}"	"Germline"	""	"rs148248777"	"0"	""	""	"g.5632005G>A"	""	"VUS"	""
"0000651492"	"1"	"50"	"4"	"5642347"	"5642347"	"subst"	"0.00369152"	"03575"	"EVC2_000051"	"g.5642347G>C"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"conflicting interpretations of pathogenicity; 1 heterozygous, no homozygous; {DB:CLININrs141287105}"	"Germline"	""	"rs141287105"	"0"	""	""	"g.5640620G>C"	""	"VUS"	""
"0000655154"	"0"	"50"	"4"	"5624288"	"5624288"	"subst"	"1.63031E-5"	"01804"	"EVC2_000072"	"g.5624288C>T"	""	""	""	"EVC2(NM_001166136.1):c.2237G>A (p.(Arg746Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5622561C>T"	""	"VUS"	""
"0000655155"	"0"	"30"	"4"	"5642249"	"5642249"	"subst"	"0.00217464"	"01804"	"EVC2_000027"	"g.5642249C>T"	""	""	""	"EVC2(NM_001166136.1):c.1222G>A (p.G408S, p.(Gly408Ser)), EVC2(NM_147127.5):c.1462G>A (p.G488S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.5640522C>T"	""	"likely benign"	""
"0000669815"	"3"	"10"	"4"	"5617337"	"5617337"	"subst"	"0"	"03575"	"EVC2_000069"	"g.5617337G>A"	"2/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"2 homozygous; {DB:CLININrs112863054}"	"Germline"	""	"rs112863054"	"0"	""	""	"g.5615610G>A"	""	"benign"	""
"0000675164"	"3"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00006"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Rudnik-Schöneborn 2011:22190900}, {DOI:Rudnik-Schöneborn 2011:10.1159/000331338}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000677293"	"0"	"30"	"4"	"5642347"	"5642347"	"subst"	"0.00369152"	"01804"	"EVC2_000051"	"g.5642347G>C"	""	""	""	"EVC2(NM_001166136.1):c.1124C>G (p.T375R, p.(Thr375Arg)), EVC2(NM_147127.5):c.1364C>G (p.T455R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000677294"	"0"	"30"	"4"	"5710149"	"5710149"	"subst"	"0.00125443"	"01804"	"EVC_000088"	"g.5710149A>G"	""	""	""	"EVC2(NM_001166136.1):c.-13+407T>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000689311"	"0"	"30"	"4"	"5564809"	"5564809"	"subst"	"8.12401E-6"	"01943"	"EVC2_000073"	"g.5564809C>G"	""	""	""	"EVC2(NM_001166136.1):c.3453G>C (p.E1151D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000689312"	"0"	"50"	"4"	"5586351"	"5586351"	"subst"	"6.19742E-5"	"02325"	"EVC2_000074"	"g.5586351C>T"	""	""	""	"EVC2(NM_147127.5):c.3056G>A (p.R1019Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000689313"	"0"	"50"	"4"	"5642332"	"5642332"	"subst"	"0"	"02325"	"EVC2_000075"	"g.5642332A>C"	""	""	""	"EVC2(NM_147127.5):c.1379T>G (p.L460R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000710707"	"3"	"90"	"4"	"5620258"	"5620258"	"subst"	"8.12401E-6"	"00006"	"EVC2_000076"	"g.5620258G>A"	""	"{PMID:Valencia 2015:26064711}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.5618531G>A"	""	"pathogenic (recessive)"	""
"0000710708"	"3"	"90"	"4"	"5627510"	"5627513"	"del"	"0"	"00006"	"EVC2_000077"	"g.5627510_5627513del"	""	"{PMID:Valencia 2015:26064711}"	""	"2012_2015delTAAT"	""	"Germline"	"yes"	""	"0"	""	""	"g.5625783_5625786del"	""	"pathogenic (recessive)"	""
"0000710726"	"3"	"90"	"4"	"5664955"	"5664955"	"subst"	"4.06068E-6"	"00006"	"EVC2_000125"	"g.5664955T>A"	""	"{PMID:Sund 2009:19251731}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5663228T>A"	""	"pathogenic (recessive)"	""
"0000710727"	"1"	"90"	"4"	"5620213"	"5620213"	"subst"	"0"	"00006"	"EVC2_000101"	"g.5620213C>A"	""	"{PMID:Sund 2009:19251731}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5618486C>A"	""	"pathogenic (recessive)"	""
"0000710728"	"1"	"90"	"4"	"5690971"	"5690971"	"subst"	"4.06068E-6"	"00006"	"EVC2_000129"	"g.5690971C>A"	""	"{PMID:Sund 2009:19251731}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5689244C>A"	""	"pathogenic (recessive)"	""
"0000710753"	"3"	"90"	"4"	"5577974"	"5577974"	"subst"	"7.71555E-5"	"00006"	"EVC2_000095"	"g.5577974G>A"	""	"{PMID:Galdzicka 2002:12468274}"	""	"3754CT (Q1009X)"	""	"Germline"	""	""	"0"	""	""	"g.5576247G>A"	""	"pathogenic (recessive)"	""
"0000710754"	"3"	"90"	"4"	"5586559"	"5586559"	"subst"	"0.000158486"	"00006"	"EVC2_000078"	"g.5586559G>A"	""	"{PMID:Galdzicka 2002:12468274}"	""	"3337CT (Arg870Trp)"	""	"Germline"	""	""	"0"	""	""	"g.5584832G>A"	""	"pathogenic (recessive)"	""
"0000710755"	"3"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710756"	"3"	"90"	"4"	"5710046"	"5710050"	"dup"	"0"	"00006"	"EVC2_000133"	"g.5710046_5710050dup"	""	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"198insGGCGG"	""	"Germline"	""	""	"0"	""	""	"g.5708319_5708323dup"	""	"pathogenic (recessive)"	""
"0000710757"	"3"	"90"	"4"	"5624709"	"5624709"	"dup"	"0"	"00006"	"EVC2_000109"	"g.5624709dup"	""	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"2056insC"	""	"Germline"	""	""	"0"	""	""	"g.5622982dup"	""	"pathogenic (recessive)"	""
"0000710758"	"3"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00006"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"C1195T"	""	"Germline"	""	""	"0"	""	""	"g.5640789G>A"	""	"pathogenic (recessive)"	""
"0000710759"	"3"	"90"	"4"	"5630317"	"5630317"	"subst"	"4.06075E-6"	"00006"	"EVC2_000114"	"g.5630317G>A"	""	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"C1855T"	""	"Germline"	""	""	"0"	""	""	"g.5628590G>A"	""	"pathogenic (recessive)"	""
"0000710760"	"3"	"70"	"4"	"5683009"	"5683009"	"subst"	"8.12236E-6"	"00006"	"EVC2_000127"	"g.5683009A>C"	""	"{PMID:Ruiz‐Perez 2003:12571802}"	""	"T848G"	""	"Germline"	""	""	"0"	""	""	"g.5681282A>C"	""	"likely pathogenic (recessive)"	""
"0000710761"	"3"	"90"	"4"	"5664946"	"5664952"	"del"	"0"	"00006"	"EVC2_000124"	"g.5664946_5664952del"	""	"{PMID:Tompson 2007:17024374}"	""	"1028_1034delTGGAACC"	""	"Germline"	""	""	"0"	""	""	"g.5663219_5663225del"	""	"pathogenic (recessive)"	""
"0000710762"	"1"	"90"	"4"	"5642324"	"5642325"	"del"	"0"	"00006"	"EVC2_000121"	"g.5642324_5642325del"	""	"{PMID:Tompson 2007:17024374}"	""	"1386_1387delAA"	""	"Germline"	""	""	"0"	""	""	"g.5640597_5640598del"	""	"pathogenic (recessive)"	""
"0000710763"	"3"	"90"	"4"	"5642245"	"5642246"	"dup"	"0"	"00006"	"EVC2_000120"	"g.5642245_5642246dup"	""	"{PMID:Tompson 2007:17024374}"	""	"1468insGA"	""	"Germline"	""	""	"0"	""	""	"g.5640518_5640519dup"	""	"pathogenic (recessive)"	""
"0000710764"	"1"	"90"	"4"	"5633692"	"5633693"	"del"	"0"	"00006"	"EVC2_000119"	"g.5633692_5633693del"	""	"{PMID:Tompson 2007:17024374}"	""	"1541_1542delTC"	""	"Germline"	""	""	"0"	""	""	"g.5631965_5631966del"	""	"pathogenic (recessive)"	""
"0000710765"	"1"	"90"	"4"	"5624502"	"5624502"	"subst"	"4.06398E-6"	"00006"	"EVC2_000108"	"g.5624502G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5622775G>A"	""	"pathogenic (recessive)"	""
"0000710766"	"1"	"90"	"4"	"5627516"	"5627516"	"del"	"0"	"00006"	"EVC2_000112"	"g.5627516del"	""	"{PMID:Tompson 2007:17024374}"	""	"2006delA"	"unknown variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.5625789del"	""	"pathogenic (recessive)"	""
"0000710767"	"1"	"90"	"4"	"5627503"	"5627503"	"dup"	"0"	"00006"	"EVC2_000111"	"g.5627503dup"	""	"{PMID:Tompson 2007:17024374}"	""	"2019insT"	"unknown variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.5625776dup"	""	"pathogenic (recessive)"	""
"0000710768"	"3"	"90"	"4"	"5624314"	"5624318"	"dup"	"0"	"00006"	"EVC2_000105"	"g.5624314_5624318dup"	""	"{PMID:Tompson 2007:17024374}"	""	"2447_2452dupAGGCC"	""	"Germline"	""	""	"0"	""	""	"g.5622587_5622591dup"	""	"pathogenic (recessive)"	""
"0000710769"	"3"	"90"	"4"	"5699332"	"5699332"	"dup"	"0"	"00006"	"EVC2_000132"	"g.5699332dup"	""	"{PMID:Tompson 2007:17024374}"	""	"273insT"	""	"Germline"	""	""	"0"	""	""	"g.5697605dup"	""	"pathogenic (recessive)"	""
"0000710770"	"1"	"90"	"4"	"5586553"	"5586553"	"dup"	"0"	"00006"	"EVC2_000098"	"g.5586553dup"	""	"{PMID:Tompson 2007:17024374}"	""	"2854insA"	""	"Germline"	""	""	"0"	""	""	"g.5584826dup"	""	"pathogenic (recessive)"	""
"0000710771"	"1"	"90"	"4"	"5578105"	"5578105"	"subst"	"2.03669E-5"	"00006"	"EVC2_000096"	"g.5578105G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5576378G>A"	""	"pathogenic (recessive)"	""
"0000710772"	"3"	"90"	"4"	"5692990"	"5692990"	"subst"	"0"	"00006"	"EVC2_000130"	"g.5692990A>G"	""	"{PMID:Tompson 2007:17024374}"	""	"IVS4+2T>C"	""	"Germline"	""	""	"0"	""	""	"g.5691263A>G"	""	"pathogenic (recessive)"	""
"0000710773"	"1"	"90"	"4"	"5687168"	"5687168"	"subst"	"1.21827E-5"	"00006"	"EVC2_000128"	"g.5687168G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	"unknown variant 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.5685441G>A"	""	"pathogenic (recessive)"	""
"0000710774"	"3"	"90"	"4"	"5667354"	"5667354"	"del"	"8.12526E-6"	"00006"	"EVC2_000126"	"g.5667354del"	""	"{PMID:Tompson 2007:17024374}"	""	"893delA"	""	"Germline"	""	""	"0"	""	""	"g.5665627del"	""	"pathogenic (recessive)"	""
"0000710775"	"3"	"90"	"4"	"5667266"	"5667266"	"del"	"0"	"00006"	"EVC2_000080"	"g.5667266del"	""	"{PMID:Tompson 2007:17024374}"	""	"981delG"	""	"Germline"	""	""	"0"	""	""	"g.5665539del"	""	"pathogenic (recessive)"	""
"0000710776"	"3"	"90"	"4"	"5630894"	"5694978"	"del"	"0"	"00006"	"EVC2_000116"	"g.5630894_5694978del"	""	"{PMID:Tompson 2007:17024374}"	""	"Del_IVS3+1086_IVS11‐431"	"61 kb deletion"	"Germline"	""	""	"0"	""	""	"g.5629167_5693251del"	""	"pathogenic (recessive)"	""
"0000710777"	"3"	"90"	"4"	"5624317"	"5628155"	"del"	"0"	"00006"	"EVC2_000106"	"g.5624317_5628155del"	""	"{PMID:Tompson 2007:17024374}"	""	"del‐520ex13_2448"	"3,837 bp deletion"	"Germline"	""	""	"0"	""	""	"g.5622590_5626428del"	""	"pathogenic (recessive)"	""
"0000710778"	"3"	"90"	"4"	"5710046"	"5710050"	"dup"	"0"	"00006"	"EVC2_000133"	"g.5710046_5710050dup"	""	"{PMID:Tompson 2007:17024374}"	""	"198insGGCGG"	""	"Germline"	""	""	"0"	""	""	"g.5708319_5708323dup"	""	"pathogenic (recessive)"	""
"0000710779"	"3"	"90"	"4"	"5683009"	"5683009"	"subst"	"8.12236E-6"	"00006"	"EVC2_000127"	"g.5683009A>C"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5681282A>C"	""	"pathogenic (recessive)"	""
"0000710780"	"3"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00006"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5640789G>A"	""	"pathogenic (recessive)"	""
"0000710781"	"3"	"90"	"4"	"5633522"	"5633522"	"subst"	"2.84956E-5"	"00006"	"EVC2_000117"	"g.5633522G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5631795G>A"	""	"pathogenic (recessive)"	""
"0000710782"	"3"	"90"	"4"	"5630317"	"5630317"	"subst"	"4.06075E-6"	"00006"	"EVC2_000114"	"g.5630317G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5628590G>A"	""	"pathogenic (recessive)"	""
"0000710783"	"3"	"90"	"4"	"5624709"	"5624709"	"dup"	"0"	"00006"	"EVC2_000109"	"g.5624709dup"	""	"{PMID:Tompson 2007:17024374}"	""	"2056insC"	""	"Germline"	""	""	"0"	""	""	"g.5622982dup"	""	"pathogenic (recessive)"	""
"0000710784"	"3"	"90"	"4"	"5564842"	"5564842"	"dup"	"0"	"00006"	"EVC2_000090"	"g.5564842dup"	""	"{PMID:Tompson 2007:17024374}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115dup"	""	"pathogenic (recessive)"	""
"0000710785"	"3"	"90"	"4"	"5564842"	"5564842"	"dup"	"0"	"00006"	"EVC2_000090"	"g.5564842dup"	""	"{PMID:Tompson 2007:17024374}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115dup"	""	"pathogenic (recessive)"	""
"0000710786"	"1"	"90"	"4"	"5564709"	"5564709"	"del"	"0"	"00006"	"EVC2_000086"	"g.5564709del"	""	"{PMID:Ye 2006:16404586}"	""	"3793delC"	""	"Germline"	""	""	"0"	""	""	"g.5562982del"	""	"pathogenic (dominant)"	""
"0000710787"	"2"	"90"	"4"	"5566983"	"5566983"	"subst"	"2.43657E-5"	"00006"	"EVC2_000091"	"g.5566983A>G"	""	"{PMID:Sund 2009:19251731}"	""	"IVS21 + 2T > C"	""	"Germline"	""	""	"0"	""	""	"g.5565256A>G"	""	"pathogenic (recessive)"	""
"0000710788"	"2"	"90"	"4"	"5620291"	"5620291"	"subst"	"1.21899E-5"	"00006"	"EVC2_000103"	"g.5620291G>A"	""	"{PMID:Sund 2009:19251731}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5618564G>A"	""	"pathogenic (recessive)"	""
"0000710793"	"2"	"90"	"4"	"5617235"	"5617235"	"del"	"0"	"00006"	"EVC2_000099"	"g.5617235del"	""	"{PMID:Tompson 2007:17024374}"	""	"2743delA"	""	"Germline"	""	""	"0"	""	""	"g.5615508del"	""	"pathogenic (recessive)"	""
"0000710794"	"2"	"90"	"4"	"5633572"	"5633575"	"del"	"0"	"00006"	"EVC2_000118"	"g.5633572_5633575del"	""	"{PMID:Tompson 2007:17024374}"	""	"1655_1658delGGGA"	""	"Germline"	""	""	"0"	""	""	"g.5631845_5631848del"	""	"pathogenic (recessive)"	""
"0000710795"	"2"	"90"	"4"	"5633522"	"5633522"	"subst"	"2.84956E-5"	"00006"	"EVC2_000117"	"g.5633522G>A"	""	"{PMID:Tompson 2007:17024374}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5631795G>A"	""	"pathogenic (recessive)"	""
"0000710796"	"2"	"90"	"4"	"5566983"	"5566983"	"subst"	"2.43657E-5"	"00006"	"EVC2_000091"	"g.5566983A>G"	""	"{PMID:Tompson 2007:17024374}"	""	"IVS21 + 2T > C"	""	"Germline"	""	""	"0"	""	""	"g.5565256A>G"	""	"pathogenic (recessive)"	""
"0000710797"	"2"	"90"	"4"	"5627516"	"5627516"	"del"	"0"	"00006"	"EVC2_000112"	"g.5627516del"	""	"{PMID:Tompson 2007:17024374}"	""	"2006delA"	""	"Germline"	""	""	"0"	""	""	"g.5625789del"	""	"pathogenic (recessive)"	""
"0000710924"	"1"	"90"	"4"	"5564709"	"5564709"	"del"	"0"	"00006"	"EVC2_000086"	"g.5564709del"	""	"{PMID:D\'Asdia 2013:23220543}"	""	"3793delC"	""	"Germline"	""	""	"0"	""	""	"g.5562982del"	""	"pathogenic (dominant)"	""
"0000710925"	"3"	"90"	"4"	"5683009"	"5683009"	"subst"	"8.12236E-6"	"00006"	"EVC2_000127"	"g.5683009A>C"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5681282A>C"	""	"pathogenic (recessive)"	""
"0000710926"	"3"	"90"	"4"	"5642245"	"5642246"	"dup"	"0"	"00006"	"EVC2_000120"	"g.5642245_5642246dup"	""	"{PMID:D\'Asdia 2013:23220543}"	""	"1467_1468dupGA"	""	"Germline"	""	""	"0"	""	""	"g.5640518_5640519dup"	""	"pathogenic (recessive)"	""
"0000710927"	"1"	"90"	"4"	"5664833"	"5664833"	"subst"	"0"	"00006"	"EVC2_000123"	"g.5664833C>T"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5663106C>T"	""	"pathogenic (recessive)"	""
"0000710928"	"1"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:D\'Asdia 2013:23220543}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic"	""
"0000710929"	"1"	"90"	"4"	"5566983"	"5566983"	"subst"	"2.43657E-5"	"00006"	"EVC2_000091"	"g.5566983A>G"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5565256A>G"	""	"pathogenic (recessive)"	""
"0000710930"	"1"	"90"	"4"	"5564697"	"5564697"	"subst"	"0"	"00006"	"EVC2_000087"	"g.5564697C>A"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.5562970C>A"	""	"pathogenic"	""
"0000710931"	"1"	"90"	"4"	"5664955"	"5664955"	"subst"	"4.06068E-6"	"00006"	"EVC2_000125"	"g.5664955T>A"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5663228T>A"	""	"pathogenic (recessive)"	""
"0000710932"	"3"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:D\'Asdia 2013:23220543}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710945"	"2"	"90"	"4"	"5693036"	"5693036"	"subst"	"0"	"00006"	"EVC2_000131"	"g.5693036G>A"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5691309G>A"	""	"pathogenic (recessive)"	""
"0000710946"	"2"	"90"	"4"	"5577974"	"5577974"	"subst"	"7.71555E-5"	"00006"	"EVC2_000095"	"g.5577974G>A"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5576247G>A"	""	"pathogenic (recessive)"	""
"0000710947"	"2"	"50"	"4"	"5586559"	"5586559"	"subst"	"0.000158486"	"00006"	"EVC2_000078"	"g.5586559G>A"	""	"{PMID:D\'Asdia 2013:23220543}"	""	"Arg950Trp"	""	"Germline"	""	""	"0"	""	""	"g.5584832G>A"	""	"VUS"	""
"0000710948"	"2"	"90"	"4"	"5642557"	"5642557"	"del"	"0"	"00006"	"EVC2_000122"	"g.5642557del"	""	"{PMID:D\'Asdia 2013:23220543}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5640830del"	""	"pathogenic (recessive)"	""
"0000710950"	"3"	"90"	"4"	"5624719"	"5624719"	"subst"	"0"	"00006"	"EVC2_000079"	"g.5624719C>A"	""	"{PMID:Ali 2010:20184732}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000710952"	"3"	"90"	"4"	"5667264"	"5667264"	"del"	"0"	"00006"	"EVC2_000080"	"g.5667264del"	""	"{PMID:Ali 2010:20184732}"	""	"981delG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000710953"	"11"	"90"	"4"	"5620258"	"5620258"	"subst"	"8.12401E-6"	"00006"	"EVC2_000076"	"g.5620258G>A"	""	"{PMID:Shen 2011:21815252}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000710954"	"21"	"90"	"4"	"5687208"	"5687208"	"subst"	"0"	"00006"	"EVC2_000081"	"g.5687208T>C"	""	"{PMID:Shen 2011:21815252}"	""	"IVS5‐2A>G"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000710973"	"3"	"90"	"4"	"5687096"	"5696229"	"del"	"0"	"00006"	"EVC2_000082"	"g.(5683041_5687096)_(5696229_5699319)del"	""	"{PMID:Valencia 2009:19810119}"	""	"Ex3_6del"	""	"Germline"	""	""	"0"	""	""	"g.(5681314_5685369)_(5694502_5697592)del"	""	"pathogenic (recessive)"	""
"0000710974"	"3"	"90"	"4"	"5687168"	"5687168"	"subst"	"1.21827E-5"	"00006"	"EVC2_000128"	"g.5687168G>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5685441G>A"	""	"pathogenic (recessive)"	""
"0000710975"	"3"	"90"	"4"	"5683009"	"5683009"	"subst"	"8.12236E-6"	"00006"	"EVC2_000127"	"g.5683009A>C"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5681282A>C"	""	"pathogenic (recessive)"	""
"0000710976"	"3"	"90"	"4"	"5630344"	"5630344"	"subst"	"0"	"00006"	"EVC2_000115"	"g.5630344G>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5628617G>A"	""	"pathogenic (recessive)"	""
"0000710977"	"3"	"90"	"4"	"5617148"	"5630462"	"del"	"0"	"00006"	"EVC2_000083"	"g.(5586578_5617148)_(5630462_5633519)del"	""	"{PMID:Valencia 2009:19810119}"	""	"Ex13_16del"	""	"Germline"	""	""	"0"	""	""	"g.(5584851_5615421)_(5628735_5631792)del"	""	"pathogenic (recessive)"	""
"0000710978"	"1"	"90"	"4"	"5627606"	"5627606"	"del"	"0"	"00006"	"EVC2_000113"	"g.5627606del"	""	"{PMID:Valencia 2009:19810119}"	""	"1918delA"	""	"Germline"	""	""	"0"	""	""	"g.5625879del"	""	"pathogenic (recessive)"	""
"0000710979"	"3"	"90"	"4"	"5627493"	"5627493"	"subst"	"3.24976E-5"	"00006"	"EVC2_000110"	"g.5627493G>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5625766G>A"	""	"pathogenic (recessive)"	""
"0000710980"	"3"	"90"	"4"	"5624400"	"5624400"	"subst"	"0"	"00006"	"EVC2_000107"	"g.5624400C>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5622673C>A"	""	"pathogenic (recessive)"	""
"0000710981"	"3"	"90"	"4"	"5624289"	"5624289"	"subst"	"0"	"00006"	"EVC2_000104"	"g.5624289G>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5622562G>A"	""	"pathogenic (recessive)"	""
"0000710982"	"1"	"90"	"4"	"5620259"	"5620259"	"subst"	"0"	"00006"	"EVC2_000102"	"g.5620259C>T"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5618532C>T"	""	"pathogenic (recessive)"	""
"0000710983"	"3"	"90"	"4"	"5617268"	"5617268"	"subst"	"4.06118E-6"	"00006"	"EVC2_000100"	"g.5617268G>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5615541G>A"	""	"pathogenic (recessive)"	""
"0000710984"	"1"	"90"	"4"	"5586523"	"5586523"	"del"	"0"	"00006"	"EVC2_000097"	"g.5586523del"	""	"{PMID:Valencia 2009:19810119}"	""	"2885delG"	""	"Germline"	""	""	"0"	""	""	"g.5584796del"	""	"pathogenic (recessive)"	""
"0000710985"	"1"	"90"	"4"	"5576489"	"5576489"	"subst"	"0"	"00006"	"EVC2_000094"	"g.5576489C>A"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5574762C>A"	""	"pathogenic (recessive)"	""
"0000710986"	"3"	"90"	"4"	"5576411"	"5576411"	"subst"	"0"	"00006"	"EVC2_000093"	"g.5576411C>T"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5574684C>T"	""	"pathogenic (recessive)"	""
"0000710987"	"3"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Valencia 2009:19810119}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710988"	"3"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Valencia 2009:19810119}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710989"	"3"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Valencia 2009:19810119}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710990"	"3"	"90"	"4"	"5564771"	"5564771"	"dup"	"0"	"00006"	"EVC2_000088"	"g.5564771dup"	""	"{PMID:Valencia 2009:19810119}"	""	"3731dupT"	""	"Germline"	""	""	"0"	""	""	"g.5563044dup"	""	"pathogenic (recessive)"	""
"0000710991"	"1"	"90"	"4"	"5564709"	"5564709"	"del"	"0"	"00006"	"EVC2_000086"	"g.5564709del"	""	"{PMID:Valencia 2009:19810119}"	""	"3793delC"	""	"Germline"	"yes"	""	"0"	""	""	"g.5562982del"	""	"pathogenic (dominant)"	""
"0000710992"	"3"	"90"	"4"	"5564705"	"5564705"	"subst"	"0"	"00006"	"EVC2_000084"	"g.5564705A>T"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"De novo"	""	""	"0"	""	""	"g.5562978A>T"	""	"pathogenic (dominant)"	""
"0000710993"	"3"	"90"	"4"	"5564705"	"5564705"	"subst"	"0"	"00006"	"EVC2_000085"	"g.5564705A>C"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.5562978A>C"	""	"pathogenic (dominant)"	""
"0000710994"	"2"	"90"	"4"	"5570320"	"5570326"	"del"	"0"	"00006"	"EVC2_000092"	"g.5570320_5570326del"	""	"{PMID:Valencia 2009:19810119}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5568593_5568599del"	""	"pathogenic (recessive)"	""
"0000710995"	"2"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Valencia 2009:19810119}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710996"	"2"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Valencia 2009:19810119}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000710997"	"2"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"00006"	"EVC2_000089"	"g.5564842del"	""	"{PMID:Valencia 2009:19810119}"	""	"3660delC"	""	"Germline"	""	""	"0"	""	""	"g.5563115del"	""	"pathogenic (recessive)"	""
"0000712824"	"1"	"50"	"4"	"5633675"	"5633677"	"del"	"0"	"00000"	"EVC2_000134"	"g.5633675_5633677del"	""	"{PMID:Beck 2014:25044745}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5631948_5631950del"	""	"VUS"	""
"0000712825"	"0"	"50"	"4"	"5667334"	"5667334"	"subst"	"0.000572654"	"00000"	"EVC2_000032"	"g.5667334C>A"	""	"{PMID:Beck 2014:25044745}"	""	""	""	"Germline"	""	"rs150367317"	"0"	""	""	"g.5665607C>A"	""	"VUS"	""
"0000712826"	"0"	"50"	"4"	"5667343"	"5667343"	"subst"	"0.000572668"	"00000"	"EVC2_000033"	"g.5667343A>T"	""	"{PMID:Beck 2014:25044745}"	""	""	""	"Germline"	""	"rs138728350"	"0"	""	""	"g.5665616A>T"	""	"VUS"	""
"0000719928"	"0"	"30"	"4"	"5620263"	"5620263"	"subst"	"0.00387096"	"01943"	"EVC2_000044"	"g.5620263G>A"	""	""	""	"EVC2(NM_001166136.1):c.2408C>T (p.A803V, p.(Ala803Val)), EVC2(NM_147127.5):c.2648C>T (p.A883V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000719929"	"0"	"30"	"4"	"5624468"	"5624468"	"subst"	"3.65678E-5"	"01804"	"EVC2_000135"	"g.5624468C>A"	""	""	""	"EVC2(NM_001166136.1):c.2057G>T (p.(Arg686Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000719930"	"0"	"50"	"4"	"5627634"	"5627634"	"subst"	"0.000207167"	"01804"	"EVC2_000136"	"g.5627634C>T"	""	""	""	"EVC2(NM_001166136.1):c.1648G>A (p.(Ala550Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000719931"	"0"	"50"	"4"	"5667297"	"5667297"	"subst"	"0"	"02325"	"EVC2_000137"	"g.5667297A>G"	""	""	""	"EVC2(NM_147127.5):c.950T>C (p.L317P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000719932"	"0"	"90"	"4"	"5710046"	"5710050"	"dup"	"0"	"01943"	"EVC2_000133"	"g.5710046_5710050dup"	""	""	""	"EVC2(NM_147127.4):c.194_198dupGGCGG (p.S67Gfs*17)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000719933"	"0"	"30"	"4"	"5710065"	"5710065"	"subst"	"0"	"01804"	"EVC_000144"	"g.5710065C>G"	""	""	""	"EVC2(NM_147127.4):c.176G>C (p.(Gly59Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000719934"	"0"	"30"	"4"	"5713212"	"5713212"	"subst"	"0"	"01943"	"EVC_000145"	"g.5713212C>A"	""	""	""	"EVC(NM_153717.2):c.105C>A (p.G35=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000729930"	"3"	"90"	"4"	"5564609"	"5564632"	"dup"	"0"	"00000"	"EVC2_000041"	"g.5564609_5564632dup"	""	"{PMID:Maddirevula 2018:29620724}"	""	"NM_147127.4:c.3870_3893dup:p.(Lys1293_Lys1300dup)"	""	"Germline"	""	""	"0"	""	""	"g.5562882_5562905dup"	""	"pathogenic (recessive)"	""
"0000760748"	"0"	"70"	"4"	"5624448"	"5624448"	"del"	"0"	"01709"	"EVC2_000138"	"g.5624448del"	""	""	""	""	""	"Unknown"	""	""	"0"	""	""	""	""	"pathogenic"	"ACMG"
"0000801652"	"0"	"30"	"4"	"5567086"	"5567086"	"subst"	"0"	"01943"	"EVC2_000139"	"g.5567086C>T"	""	""	""	"EVC2(NM_001166136.1):c.3318G>A (p.R1106=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801653"	"0"	"90"	"4"	"5570170"	"5570170"	"subst"	"0"	"02327"	"EVC2_000140"	"g.5570170C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000801656"	"0"	"30"	"4"	"5624498"	"5624498"	"subst"	"7.31446E-5"	"02326"	"EVC2_000141"	"g.5624498T>G"	""	""	""	"EVC2(NM_147127.5):c.2267A>C (p.N756T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801657"	"0"	"30"	"4"	"5633673"	"5633673"	"subst"	"4.06085E-6"	"01943"	"EVC2_000142"	"g.5633673T>C"	""	""	""	"EVC2(NM_001166136.1):c.1317A>G (p.E439=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801658"	"0"	"30"	"4"	"5633688"	"5633688"	"subst"	"2.84262E-5"	"01943"	"EVC2_000143"	"g.5633688G>A"	""	""	""	"EVC2(NM_001166136.1):c.1302C>T (p.L434=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801659"	"0"	"30"	"4"	"5633752"	"5633752"	"subst"	"0.00031281"	"01943"	"EVC2_000144"	"g.5633752A>G"	""	""	""	"EVC2(NM_001166136.1):c.1238T>C (p.V413A), EVC2(NM_147127.4):c.1478T>C (p.(Val493Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801660"	"0"	"30"	"4"	"5642496"	"5642496"	"subst"	"2.03155E-5"	"01943"	"EVC2_000029"	"g.5642496A>T"	""	""	""	"EVC2(NM_001166136.1):c.975T>A (p.D325E, p.(Asp325Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801661"	"0"	"30"	"4"	"5667239"	"5667239"	"subst"	"0.000231527"	"01943"	"EVC2_000145"	"g.5667239C>T"	""	""	""	"EVC2(NM_001166136.1):c.765+3G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801662"	"0"	"30"	"4"	"5682993"	"5682993"	"subst"	"0.00227825"	"02326"	"EVC2_000146"	"g.5682993G>A"	""	""	""	"EVC2(NM_147127.5):c.864C>T (p.(Asn288=), p.N288=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000801665"	"0"	"30"	"4"	"5710119"	"5710119"	"subst"	"0.00361849"	"02326"	"EVC2_000037"	"g.5710119G>T"	""	""	""	"EVC2(NM_147127.4):c.122C>A (p.P41H, p.(Pro41His)), EVC2(NM_147127.5):c.122C>A (p.P41H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000818859"	"0"	"90"	"4"	"5570317"	"5570323"	"del"	"1.26336E-5"	"00000"	"EVC2_000092"	"g.5570317_5570323del"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.3405_3411delCGGGGCC"	"Variant published before in Valencia 2009 with p.E1095X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818860"	"0"	"90"	"4"	"5690971"	"5690971"	"subst"	"4.06068E-6"	"00000"	"EVC2_000129"	"g.5690971C>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.619G>T"	"Variant published before in Sund 2009 with p.R874X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818861"	"0"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00000"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1195C>T"	"variant 2nd chromosome not mentioned; Variant published before in Chen 2010;  Chen 2012;  Zhang 2012; Tompson 2007; Ruiz-Perez 2003 with c.871-2_894del26 or p.W828X or Hom"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818862"	"0"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00000"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1195C>T"	"variant 2nd chromosome not mentioned; Variant published before in Chen 2010;  Chen 2012;  Zhang 2012; Tompson 2007; Ruiz-Perez 2003 with c.871-2_894del26 or p.W828X or Hom"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818863"	"0"	"90"	"4"	"5633522"	"5633522"	"subst"	"2.84956E-5"	"00000"	"EVC2_000117"	"g.5633522G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1708C>T"	"Variant published before in Tompson 2007 as Hom or with p.Q755X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818864"	"0"	"90"	"4"	"5690971"	"5690971"	"subst"	"4.06068E-6"	"00000"	"EVC2_000129"	"g.5690971C>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.619G>T"	"Variant published before in Sund 2009 with p.R874X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818865"	"0"	"90"	"4"	"5633522"	"5633522"	"subst"	"2.84956E-5"	"00000"	"EVC2_000117"	"g.5633522G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1708C>T"	"Variant published before in Tompson 2007 as Hom or with p.Q755X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818866"	"0"	"90"	"4"	"5690971"	"5690971"	"subst"	"4.06068E-6"	"00000"	"EVC2_000129"	"g.5690971C>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.619G>T"	"Variant published before in Sund 2009 with p.R874X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818867"	"0"	"90"	"4"	"5630459"	"5630459"	"dup"	"0"	"00000"	"EVC2_000149"	"g.5630459dup"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1713dupG"	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818868"	"0"	"90"	"4"	"5576411"	"5576411"	"subst"	"0"	"00000"	"EVC2_000093"	"g.5576411C>T"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.3360+1G>A"	"Variant published before in Valencia 2009 as Hom"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818869"	"0"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00000"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1195C>T"	"Variant published before in Chen 2010;  Chen 2012;  Zhang 2012; Tompson 2007; Ruiz-Perez 2003 with c.871-2_894del26 or p.W828X or Hom"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818870"	"0"	"90"	"4"	"5633522"	"5633522"	"subst"	"2.84956E-5"	"00000"	"EVC2_000117"	"g.5633522G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1708C>T"	"Variant published before in Tompson 2007 as Hom or with p.Q755X"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000818905"	"0"	"70"	"4"	"5578118"	"5578118"	"subst"	"4.09598E-6"	"00000"	"EVC2_000147"	"g.5578118G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.3121C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000818906"	"0"	"70"	"4"	"5633522"	"5633522"	"subst"	"2.84956E-5"	"00000"	"EVC2_000117"	"g.5633522G>A"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1708C>T"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000818917"	"0"	"70"	"4"	"5630349"	"5630349"	"subst"	"0.00144563"	"00000"	"EVC2_000050"	"g.5630349C>T"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.1823G>A"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000818920"	"0"	"70"	"4"	"5617239"	"5617239"	"subst"	"0.00011777"	"00000"	"EVC2_000148"	"g.5617239C>G"	""	"{PMID:Zhang-2019:29068549}"	""	"NM_147127.4:c.2739G>C"	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000850628"	"0"	"30"	"4"	"5564709"	"5564709"	"subst"	"0"	"01943"	"EVC2_000150"	"g.5564709G>A"	""	""	""	"EVC2(NM_001166136.1):c.3553C>T (p.L1185=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000850629"	"0"	"30"	"4"	"5570297"	"5570297"	"subst"	"0.000804879"	"01804"	"EVC2_000151"	"g.5570297C>T"	""	""	""	"EVC2(NM_001166136.1):c.3191G>A (p.(Ser1064Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000850632"	"0"	"10"	"4"	"5620310"	"5620310"	"subst"	"0.00387982"	"02326"	"EVC2_000152"	"g.5620310G>A"	""	""	""	"EVC2(NM_147127.5):c.2601C>T (p.(Ala867=), p.A867=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000850633"	"0"	"30"	"4"	"5642503"	"5642503"	"subst"	"0.000812651"	"01804"	"EVC2_000052"	"g.5642503C>T"	""	""	""	"EVC2(NM_001166136.1):c.968G>A (p.S323N, p.(Ser323Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000850634"	"0"	"30"	"4"	"5664933"	"5664933"	"subst"	"4.06065E-6"	"01804"	"EVC2_000155"	"g.5664933G>A"	""	""	""	"EVC2(NM_001166136.1):c.806C>T (p.(Thr269Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000850635"	"0"	"30"	"4"	"5667244"	"5667244"	"subst"	"0.00022339"	"02325"	"EVC2_000156"	"g.5667244G>A"	""	""	""	"EVC2(NM_147127.5):c.1003C>T (p.R335W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000859454"	"0"	"10"	"4"	"5620263"	"5620263"	"subst"	"0.00387096"	"02326"	"EVC2_000044"	"g.5620263G>A"	""	""	""	"EVC2(NM_001166136.1):c.2408C>T (p.A803V, p.(Ala803Val)), EVC2(NM_147127.5):c.2648C>T (p.A883V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000859455"	"0"	"30"	"4"	"5624405"	"5624405"	"subst"	"0"	"01943"	"EVC2_000015"	"g.5624405C>T"	""	""	""	"EVC2(NM_001166136.1):c.2120G>A (p.R707Q, p.(Arg707Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000859456"	"0"	"30"	"4"	"5624557"	"5624557"	"subst"	"4.06289E-6"	"02326"	"EVC2_000153"	"g.5624557G>T"	""	""	""	"EVC2(NM_147127.5):c.2208C>A (p.L736=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000859457"	"0"	"50"	"4"	"5633725"	"5633725"	"subst"	"0.000125899"	"01804"	"EVC2_000154"	"g.5633725A>C"	""	""	""	"EVC2(NM_001166136.1):c.1265T>G (p.(Leu422Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000886296"	"0"	"50"	"4"	"5570255"	"5570255"	"subst"	"0"	"01804"	"EVC2_000157"	"g.5570255A>C"	""	""	""	"EVC2(NM_147127.4):c.3473T>G (p.(Leu1158Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000886297"	"0"	"30"	"4"	"5577960"	"5577960"	"subst"	"0.00132423"	"02326"	"EVC2_000158"	"g.5577960G>A"	""	""	""	"EVC2(NM_147127.4):c.3272+7C>T (p.?), EVC2(NM_147127.5):c.3272+7C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000886300"	"0"	"30"	"4"	"5624370"	"5624370"	"subst"	"0.00294826"	"01804"	"EVC2_000159"	"g.5624370C>G"	""	""	""	"EVC2(NM_001166136.1):c.2155G>C (p.(Asp719His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000886301"	"0"	"30"	"4"	"5624669"	"5624669"	"subst"	"3.66662E-5"	"01804"	"EVC2_000160"	"g.5624669G>A"	""	""	""	"EVC2(NM_001166136.1):c.1856C>T (p.(Thr619Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000886302"	"0"	"30"	"4"	"5642347"	"5642347"	"subst"	"0.00369152"	"02326"	"EVC2_000051"	"g.5642347G>C"	""	""	""	"EVC2(NM_001166136.1):c.1124C>G (p.T375R, p.(Thr375Arg)), EVC2(NM_147127.5):c.1364C>G (p.T455R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000886303"	"0"	"30"	"4"	"5642400"	"5642400"	"subst"	"0.00215288"	"02326"	"EVC2_000161"	"g.5642400T>C"	""	""	""	"EVC2(NM_147127.5):c.1311A>G (p.L437=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000886304"	"0"	"90"	"4"	"5710125"	"5710125"	"subst"	"0"	"02327"	"EVC_000161"	"g.5710125C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000912118"	"0"	"30"	"4"	"5570188"	"5570188"	"subst"	"2.23459E-5"	"02326"	"EVC2_000162"	"g.5570188G>A"	""	""	""	"EVC2(NM_147127.5):c.3540C>T (p.A1180=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000922745"	"21"	"70"	"4"	"5692991"	"5692992"	"delins"	"0"	"04216"	"EVC2_000163"	"g.5692991_5692992delinsA"	""	""	""	""	""	"Germline"	"no"	""	"0"	""	""	"g.5691264_5691265delinsA"	""	"likely pathogenic (recessive)"	"ACMG"
"0000928913"	"0"	"50"	"4"	"5586577"	"5586577"	"subst"	"4.06709E-6"	"02325"	"EVC2_000164"	"g.5586577C>T"	""	""	""	"EVC2(NM_147127.5):c.2830G>A (p.V944I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000928914"	"0"	"50"	"4"	"5642366"	"5642366"	"subst"	"5.2806E-5"	"02325"	"EVC2_000165"	"g.5642366G>A"	""	""	""	"EVC2(NM_147127.5):c.1345C>T (p.R449W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000928915"	"0"	"50"	"4"	"5667334"	"5667334"	"subst"	"0.000572654"	"02325"	"EVC2_000032"	"g.5667334C>A"	""	""	""	"EVC2(NM_001166136.1):c.673G>T (p.A225S, p.(Ala225Ser)), EVC2(NM_147127.5):c.913G>T (p.A305S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000928916"	"0"	"50"	"4"	"5667343"	"5667343"	"subst"	"0.000572668"	"02325"	"EVC2_000033"	"g.5667343A>T"	""	""	""	"EVC2(NM_001166136.1):c.664T>A (p.F222I, p.(Phe222Ile)), EVC2(NM_147127.5):c.904T>A (p.F302I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000928917"	"0"	"30"	"4"	"5713115"	"5713115"	"subst"	"0"	"02326"	"EVC_000170"	"g.5713115G>C"	""	""	""	"EVC(NM_153717.3):c.8G>C (p.(Arg3Pro), p.R3P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000948334"	"0"	"50"	"4"	"5624705"	"5624705"	"subst"	"0.000533377"	"02325"	"EVC2_000166"	"g.5624705C>T"	""	""	""	"EVC2(NM_147127.5):c.2060G>A (p.R687H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000976308"	"0"	"50"	"4"	"5567045"	"5567045"	"subst"	"4.06068E-6"	"01804"	"EVC2_000167"	"g.5567045C>T"	""	""	""	"EVC2(NM_147127.5):c.3599G>A (p.(Arg1200Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000976309"	"0"	"10"	"4"	"5570161"	"5570161"	"subst"	"0.0183405"	"01804"	"EVC2_000007"	"g.5570161C>T"	""	""	""	"EVC2(NM_147127.5):c.3557+10G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000976310"	"0"	"50"	"4"	"5586543"	"5586543"	"subst"	"0.000243706"	"01804"	"EVC2_000168"	"g.5586543C>T"	""	""	""	"EVC2(NM_147127.4):c.2864G>A (p.(Arg955Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000976313"	"0"	"30"	"4"	"5617276"	"5617276"	"subst"	"0.00155956"	"01804"	"EVC2_000169"	"g.5617276A>G"	""	""	""	"EVC2(NM_147127.5):c.2707-5T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000976317"	"0"	"50"	"4"	"5633647"	"5633647"	"subst"	"0.000142127"	"01804"	"EVC2_000170"	"g.5633647T>C"	""	""	""	"EVC2(NM_147127.5):c.1583A>G (p.(Gln528Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000976318"	"0"	"70"	"4"	"5642245"	"5642246"	"dup"	"0"	"01804"	"EVC2_000120"	"g.5642245_5642246dup"	""	""	""	"EVC2(NM_147127.5):c.1468_1469dup (p.(Ser491Glyfs*4))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000976319"	"0"	"30"	"4"	"5642570"	"5642570"	"subst"	"0.000134321"	"01804"	"EVC2_000171"	"g.5642570G>C"	""	""	""	"EVC2(NM_147127.5):c.1146-5C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000976322"	"0"	"30"	"4"	"5713115"	"5713115"	"subst"	"0"	"01804"	"EVC_000170"	"g.5713115G>C"	""	""	""	"EVC(NM_153717.3):c.8G>C (p.(Arg3Pro), p.R3P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000976323"	"0"	"50"	"4"	"5713196"	"5713196"	"subst"	"0"	"02325"	"EVC_000002"	"g.5713196C>T"	""	""	""	"EVC(NM_153717.2):c.89C>T (p.(Pro30Leu)), EVC(NM_153717.3):c.89C>T (p.P30L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000994332"	"0"	"30"	"4"	"5564591"	"5564591"	"subst"	"0"	"01804"	"EVC2_000172"	"g.5564591G>A"	""	""	""	"EVC2(NM_147127.4):c.3911C>T (p.(Ala1304Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000994333"	"0"	"90"	"4"	"5564842"	"5564842"	"del"	"2.03774E-5"	"01804"	"EVC2_000089"	"g.5564842del"	""	""	""	"EVC2(NM_147127.4):c.3660delC (p.(Ser1220fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000994334"	"0"	"30"	"4"	"5577960"	"5577960"	"subst"	"0.00132423"	"01804"	"EVC2_000158"	"g.5577960G>A"	""	""	""	"EVC2(NM_147127.4):c.3272+7C>T (p.?), EVC2(NM_147127.5):c.3272+7C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000994335"	"0"	"50"	"4"	"5586352"	"5586352"	"subst"	"3.71061E-5"	"01804"	"EVC2_000173"	"g.5586352G>A"	""	""	""	"EVC2(NM_147127.4):c.3055C>T (p.(Arg1019Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000994338"	"0"	"30"	"4"	"5617202"	"5617202"	"subst"	"1.62429E-5"	"01804"	"EVC2_000174"	"g.5617202C>T"	""	""	""	"EVC2(NM_147127.4):c.2776G>A (p.(Glu926Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000994339"	"0"	"30"	"4"	"5617220"	"5617220"	"subst"	"4.06085E-6"	"01804"	"EVC2_000175"	"g.5617220G>A"	""	""	""	"EVC2(NM_147127.4):c.2758C>T (p.(Leu920Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000994342"	"0"	"30"	"4"	"5633752"	"5633752"	"subst"	"0.00031281"	"01804"	"EVC2_000144"	"g.5633752A>G"	""	""	""	"EVC2(NM_001166136.1):c.1238T>C (p.V413A), EVC2(NM_147127.4):c.1478T>C (p.(Val493Ala))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000994343"	"0"	"50"	"4"	"5642515"	"5642515"	"subst"	"4.06405E-6"	"01804"	"EVC2_000176"	"g.5642515C>T"	""	""	""	"EVC2(NM_147127.4):c.1196G>A (p.(Arg399Gln))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000994344"	"0"	"70"	"4"	"5667359"	"5667384"	"del"	"0"	"01804"	"EVC2_000177"	"g.5667359_5667384del"	""	""	""	"EVC2(NM_147127.4):c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC (p.(Val291_Ala299del))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000994349"	"0"	"90"	"4"	"5687096"	"5687096"	"subst"	"0"	"02325"	"EVC2_000178"	"g.5687096C>A"	""	""	""	"EVC2(NM_147127.5):c.816+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000994350"	"0"	"50"	"4"	"5687147"	"5687147"	"subst"	"4.06068E-6"	"01804"	"EVC2_000179"	"g.5687147C>A"	""	""	""	"EVC2(NM_147127.4):c.766G>T (p.(Gly256Trp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000994351"	"0"	"30"	"4"	"5687153"	"5687153"	"subst"	"1.62431E-5"	"01804"	"EVC2_000180"	"g.5687153C>T"	""	""	""	"EVC2(NM_147127.4):c.760G>A (p.(Gly254Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001007475"	"0"	"90"	"4"	"5642516"	"5642516"	"subst"	"4.87694E-5"	"00006"	"EVC2_000001"	"g.5642516G>A"	""	"{PMID:Mansoorshahi 2024:39226896}"	""	""	""	"Germline"	""	"rs137852924"	"0"	""	""	"g.5640789G>A"	""	"pathogenic"	""
"0001007476"	"0"	"70"	"4"	"5624291"	"5624291"	"subst"	"4.07229E-6"	"00006"	"EVC2_000181"	"g.5624291A>G"	""	"{PMID:Mansoorshahi 2024:39226896}"	""	""	""	"Germline"	""	"rs1270446777"	"0"	""	""	"g.5622564A>G"	""	"VUS"	""
"0001007564"	"0"	"70"	"4"	"5627591"	"5627591"	"subst"	"8.12196E-6"	"00006"	"EVC2_000182"	"g.5627591C>T"	""	"{PMID:Mansoorshahi 2024:39226896}"	""	""	""	"Germline"	""	"rs773470850"	"0"	""	""	"g.5625864C>T"	""	"VUS"	""
"0001013973"	"0"	"50"	"4"	"5633675"	"5633677"	"del"	"0"	"02325"	"EVC2_000134"	"g.5633675_5633677del"	""	""	""	"EVC2(NM_147127.5):c.1560_1562delAGA (p.E520del)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001020256"	"3"	"70"	"4"	"5667372"	"5667373"	"delins"	"0"	"04787"	"EVC2_000184"	"g.5667372_5667373delinsGGAGGCCGTGGTGCGGCAC"	""	""	"Amatul Raqeeb"	"[873_874insGTGCCGCACCACGGC;875_876insCC]"	""	"Germline"	"yes"	""	"0"	""	""	"g.5665645_5665646delinsGGAGGCCGTGGTGCGGCAC"	""	"likely pathogenic (recessive)"	"ACMG"
"0001034585"	"0"	"50"	"4"	"5564642"	"5564642"	"del"	"0"	"01804"	"EVC2_000185"	"g.5564642del"	""	""	""	"EVC2(NM_147127.5):c.3861del (p.(Pro1288Leufs*9))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001034586"	"0"	"30"	"4"	"5564715"	"5564715"	"subst"	"0"	"01804"	"EVC2_000186"	"g.5564715T>A"	""	""	""	"EVC2(NM_147127.5):c.3787A>T (p.(Ile1263Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001034587"	"0"	"30"	"4"	"5570317"	"5570317"	"subst"	"0.001271"	"01804"	"EVC2_000063"	"g.5570317G>A"	""	""	""	"EVC2(NM_001166136.1):c.3171C>T (p.A1057=), EVC2(NM_147127.5):c.3411C>T (p.(Ala1137=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001034588"	"0"	"10"	"4"	"5620310"	"5620310"	"subst"	"0.00387982"	"01804"	"EVC2_000152"	"g.5620310G>A"	""	""	""	"EVC2(NM_147127.5):c.2601C>T (p.(Ala867=), p.A867=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001034592"	"0"	"30"	"4"	"5624530"	"5624530"	"subst"	"0.0242489"	"01804"	"EVC2_000187"	"g.5624530T>C"	""	""	""	"EVC2(NM_147127.5):c.2235A>G (p.(Glu745=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001034593"	"0"	"10"	"4"	"5624727"	"5624727"	"subst"	"0.00391386"	"01804"	"EVC2_000019"	"g.5624727T>A"	""	""	""	"EVC2(NM_147127.5):c.2047-9A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001034594"	"0"	"10"	"4"	"5627493"	"5627493"	"subst"	"0.00393627"	"01804"	"EVC2_000021"	"g.5627493G>T"	""	""	""	"EVC2(NM_147127.5):c.2029C>A (p.(Arg677=), p.R677=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001034601"	"0"	"50"	"4"	"5633726"	"5633726"	"subst"	"0"	"01804"	"EVC2_000188"	"g.5633726G>A"	""	""	""	"EVC2(NM_147127.5):c.1504C>T (p.(Leu502Phe))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001034602"	"0"	"30"	"4"	"5642259"	"5642259"	"subst"	"0.000483661"	"01804"	"EVC2_000189"	"g.5642259C>T"	""	""	""	"EVC2(NM_147127.5):c.1452G>A (p.(Leu484=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001034603"	"0"	"30"	"4"	"5664982"	"5664982"	"subst"	"0"	"01804"	"EVC2_000190"	"g.5664982G>A"	""	""	""	"EVC2(NM_147127.5):c.1006-9C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001034604"	"0"	"30"	"4"	"5682993"	"5682993"	"subst"	"0.00227825"	"01804"	"EVC2_000146"	"g.5682993G>A"	""	""	""	"EVC2(NM_147127.5):c.864C>T (p.(Asn288=), p.N288=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001034608"	"0"	"70"	"4"	"5710195"	"5710195"	"dup"	"0"	"01804"	"EVC_000187"	"g.5710195dup"	""	""	""	"EVC2(NM_147127.5):c.50dup (p.(Leu18Serfs*38))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001034609"	"0"	"30"	"4"	"5710223"	"5710223"	"subst"	"0.000178117"	"01804"	"EVC_000188"	"g.5710223G>A"	""	""	""	"EVC2(NM_147127.5):c.18C>T (p.(Ser6=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001051680"	"0"	"90"	"4"	"5566983"	"5566983"	"subst"	"2.43657E-5"	"01804"	"EVC2_000091"	"g.5566983A>G"	""	""	""	"EVC2(NM_147127.5):c.3659+2T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001051681"	"0"	"70"	"4"	"5578001"	"5578001"	"del"	"0"	"01804"	"EVC2_000191"	"g.5578001del"	""	""	""	"EVC2(NM_147127.5):c.3239del (p.(Lys1080Argfs*13))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001051682"	"0"	"50"	"4"	"5617239"	"5617239"	"subst"	"0.00011777"	"01804"	"EVC2_000148"	"g.5617239C>G"	""	""	""	"EVC2(NM_147127.5):c.2739G>C (p.(Lys913Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001051683"	"0"	"50"	"4"	"5624507"	"5624507"	"subst"	"2.43879E-5"	"01804"	"EVC2_000192"	"g.5624507C>T"	""	""	""	"EVC2(NM_147127.5):c.2258G>A (p.(Arg753His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001051684"	"0"	"50"	"4"	"5633678"	"5633678"	"subst"	"0"	"01804"	"EVC2_000193"	"g.5633678G>T"	""	""	""	"EVC2(NM_147127.5):c.1552C>A (p.(Gln518Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001059609"	"1"	"70"	"4"	"5633595"	"5633595"	"del"	"0"	"00006"	"EVC2_000194"	"g.5633595del"	""	"{PMID:Jacob 2025:39706863}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.5631868del"	"SCV002507168.1"	"likely pathogenic"	""
"0001059710"	"2"	"70"	"4"	"5624709"	"5624709"	"dup"	"0"	"00006"	"EVC2_000109"	"g.5624709dup"	""	"{PMID:Jacob 2025:39706863}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.5622982dup"	"SCV002507169.1"	"likely pathogenic (recessive)"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes EVC2
## Count = 286
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000089068"	"00007281"	"70"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	"10"
"0000117670"	"00007281"	"50"	"2149"	"0"	"2149"	"0"	"c.2149C>G"	"r.(?)"	"p.(His717Asp)"	""
"0000117671"	"00007281"	"50"	"877"	"0"	"877"	"0"	"c.877C>T"	"r.(?)"	"p.(Pro293Ser)"	""
"0000250706"	"00007281"	"10"	"1711"	"-10"	"1711"	"-10"	"c.1711-10del"	"r.(=)"	"p.(=)"	""
"0000251123"	"00007281"	"10"	"1730"	"0"	"1730"	"0"	"c.1730T>C"	"r.(?)"	"p.(Met577Thr)"	""
"0000253058"	"00007281"	"10"	"1711"	"-10"	"1711"	"-10"	"c.1711-10del"	"r.(=)"	"p.(=)"	""
"0000267914"	"00007281"	"10"	"3507"	"0"	"3507"	"0"	"c.3507C>T"	"r.(?)"	"p.(His1169=)"	""
"0000267915"	"00007281"	"10"	"688"	"0"	"688"	"0"	"c.688A>G"	"r.(?)"	"p.(Ser230Gly)"	""
"0000271258"	"00007281"	"30"	"-2956"	"0"	"-2956"	"0"	"c.-2956G>A"	"r.(?)"	"p.(=)"	""
"0000271260"	"00007281"	"10"	"-15"	"0"	"-15"	"0"	"c.-15G>A"	"r.(?)"	"p.(=)"	""
"0000271261"	"00007281"	"10"	"1384"	"0"	"1384"	"0"	"c.1384A>G"	"r.(?)"	"p.(Thr462Ala)"	""
"0000271262"	"00007281"	"10"	"1462"	"0"	"1462"	"0"	"c.1462G>A"	"r.(?)"	"p.(Gly488Ser)"	""
"0000271263"	"00007281"	"10"	"1711"	"-11"	"1711"	"-10"	"c.1711-11_1711-10dup"	"r.(=)"	"p.(=)"	""
"0000271264"	"00007281"	"10"	"2029"	"0"	"2029"	"0"	"c.2029C>A"	"r.(?)"	"p.(Arg677=)"	""
"0000271265"	"00007281"	"10"	"2047"	"-9"	"2047"	"-9"	"c.2047-9A>T"	"r.(=)"	"p.(=)"	""
"0000271266"	"00007281"	"10"	"3040"	"0"	"3040"	"0"	"c.3040C>G"	"r.(?)"	"p.(Leu1014Val)"	""
"0000271267"	"00007281"	"10"	"3557"	"10"	"3557"	"10"	"c.3557+10G>A"	"r.(=)"	"p.(=)"	""
"0000271268"	"00007281"	"10"	"52"	"0"	"52"	"0"	"c.52C>T"	"r.(?)"	"p.(Leu18Phe)"	""
"0000276423"	"00007281"	"30"	"122"	"0"	"122"	"0"	"c.122C>A"	"r.(?)"	"p.(Pro41His)"	""
"0000276424"	"00007281"	"30"	"3732"	"0"	"3732"	"0"	"c.3732G>A"	"r.(?)"	"p.(Leu1244=)"	""
"0000329858"	"00007281"	"50"	"3659"	"8"	"3659"	"8"	"c.3659+8T>C"	"r.(=)"	"p.(=)"	""
"0000329859"	"00007281"	"50"	"3272"	"8"	"3272"	"8"	"c.3272+8G>A"	"r.(=)"	"p.(=)"	""
"0000329860"	"00007281"	"30"	"3138"	"0"	"3138"	"0"	"c.3138C>G"	"r.(?)"	"p.(Ser1046Arg)"	""
"0000329861"	"00007281"	"50"	"3007"	"0"	"3007"	"0"	"c.3007G>A"	"r.(?)"	"p.(Glu1003Lys)"	""
"0000329862"	"00007281"	"50"	"2863"	"0"	"2863"	"0"	"c.2863C>T"	"r.(?)"	"p.(Arg955Trp)"	""
"0000329863"	"00007281"	"50"	"2452"	"0"	"2452"	"0"	"c.2452G>A"	"r.(?)"	"p.(Val818Met)"	""
"0000329864"	"00007281"	"50"	"2360"	"0"	"2360"	"0"	"c.2360G>A"	"r.(?)"	"p.(Arg787Gln)"	""
"0000329865"	"00007281"	"50"	"2203"	"0"	"2203"	"0"	"c.2203G>A"	"r.(?)"	"p.(Asp735Asn)"	""
"0000329866"	"00007281"	"50"	"2185"	"0"	"2185"	"0"	"c.2185G>C"	"r.(?)"	"p.(Asp729His)"	""
"0000329867"	"00007281"	"50"	"2051"	"0"	"2051"	"0"	"c.2051G>A"	"r.(?)"	"p.(Arg684Lys)"	""
"0000329868"	"00007281"	"50"	"2039"	"0"	"2039"	"0"	"c.2039T>C"	"r.(?)"	"p.(Leu680Pro)"	""
"0000329870"	"00007281"	"50"	"1804"	"0"	"1804"	"0"	"c.1804C>A"	"r.(?)"	"p.(Leu602Ile)"	""
"0000329871"	"00007281"	"30"	"1730"	"0"	"1730"	"0"	"c.1730T>C"	"r.(?)"	"p.(Met577Thr)"	""
"0000329873"	"00007281"	"50"	"1215"	"0"	"1215"	"0"	"c.1215T>A"	"r.(?)"	"p.(Asp405Glu)"	""
"0000329874"	"00007281"	"50"	"1040"	"0"	"1040"	"0"	"c.1040C>T"	"r.(?)"	"p.(Pro347Leu)"	""
"0000329875"	"00007281"	"50"	"960"	"0"	"960"	"0"	"c.960G>C"	"r.(?)"	"p.(Met320Ile)"	""
"0000329876"	"00007281"	"50"	"913"	"0"	"913"	"0"	"c.913G>T"	"r.(?)"	"p.(Ala305Ser)"	""
"0000329877"	"00007281"	"50"	"904"	"0"	"904"	"0"	"c.904T>A"	"r.(?)"	"p.(Phe302Ile)"	""
"0000329878"	"00007281"	"50"	"692"	"0"	"692"	"0"	"c.692A>G"	"r.(?)"	"p.(Lys231Arg)"	""
"0000329881"	"00007281"	"50"	"-2956"	"0"	"-2956"	"0"	"c.-2956G>A"	"r.(?)"	"p.(=)"	""
"0000344467"	"00007281"	"90"	"264"	"0"	"264"	"0"	"c.264C>A"	"r.(?)"	"p.(Cys88Ter)"	""
"0000459774"	"00007281"	"90"	"3870"	"0"	"3893"	"0"	"c.3870_3893dup"	"r.(?)"	"p.(Lys1293_Lys1300dup)"	""
"0000522672"	"00007281"	"30"	"3659"	"8"	"3659"	"8"	"c.3659+8T>C"	"r.(=)"	"p.(=)"	""
"0000522673"	"00007281"	"30"	"3272"	"8"	"3272"	"8"	"c.3272+8G>A"	"r.(=)"	"p.(=)"	""
"0000522674"	"00007281"	"30"	"3040"	"0"	"3040"	"0"	"c.3040C>G"	"r.(?)"	"p.(Leu1014Val)"	""
"0000522675"	"00007281"	"10"	"3023"	"0"	"3023"	"0"	"c.3023C>T"	"r.(?)"	"p.(Ser1008Leu)"	""
"0000522686"	"00007281"	"50"	"2681"	"0"	"2681"	"0"	"c.2681A>T"	"r.(?)"	"p.(Gln894Leu)"	""
"0000522687"	"00007281"	"30"	"2648"	"0"	"2648"	"0"	"c.2648C>T"	"r.(?)"	"p.(Ala883Val)"	""
"0000522688"	"00007281"	"50"	"2614"	"0"	"2614"	"0"	"c.2614C>T"	"r.(?)"	"p.(Arg872Trp)"	""
"0000522692"	"00007281"	"10"	"2487"	"0"	"2487"	"0"	"c.2487G>A"	"r.(?)"	"p.(Glu829=)"	""
"0000522693"	"00007281"	"50"	"2207"	"0"	"2207"	"0"	"c.2207T>G"	"r.(?)"	"p.(Leu736Arg)"	""
"0000522694"	"00007281"	"30"	"2151"	"0"	"2151"	"0"	"c.2151C>T"	"r.(?)"	"p.(His717=)"	""
"0000522695"	"00007281"	"10"	"2046"	"5"	"2046"	"5"	"c.2046+5A>G"	"r.spl?"	"p.?"	""
"0000522697"	"00007281"	"30"	"1823"	"0"	"1823"	"0"	"c.1823G>A"	"r.(?)"	"p.(Arg608His)"	""
"0000522700"	"00007281"	"30"	"1462"	"0"	"1462"	"0"	"c.1462G>A"	"r.(?)"	"p.(Gly488Ser)"	""
"0000522701"	"00007281"	"30"	"1384"	"0"	"1384"	"0"	"c.1384A>G"	"r.(?)"	"p.(Thr462Ala)"	""
"0000522702"	"00007281"	"30"	"1364"	"0"	"1364"	"0"	"c.1364C>G"	"r.(?)"	"p.(Thr455Arg)"	""
"0000522703"	"00007281"	"30"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Ser403Asn)"	""
"0000522704"	"00007281"	"30"	"1198"	"0"	"1198"	"0"	"c.1198A>G"	"r.(?)"	"p.(Thr400Ala)"	""
"0000522705"	"00007281"	"50"	"1044"	"0"	"1044"	"0"	"c.1044C>A"	"r.(?)"	"p.(Phe348Leu)"	""
"0000522713"	"00007281"	"30"	"814"	"0"	"814"	"0"	"c.814C>T"	"r.(?)"	"p.(Arg272Trp)"	""
"0000522714"	"00007281"	"30"	"707"	"-4"	"707"	"-4"	"c.707-4G>A"	"r.spl?"	"p.?"	""
"0000522718"	"00007281"	"50"	"550"	"0"	"550"	"0"	"c.550C>T"	"r.(?)"	"p.(Arg184Cys)"	""
"0000522720"	"00007281"	"50"	"521"	"0"	"521"	"0"	"c.521T>C"	"r.(?)"	"p.(Val174Ala)"	""
"0000522722"	"00007281"	"90"	"229"	"-2"	"229"	"-2"	"c.229-2A>G"	"r.spl?"	"p.?"	""
"0000522725"	"00007281"	"30"	"122"	"0"	"122"	"0"	"c.122C>A"	"r.(?)"	"p.(Pro41His)"	""
"0000522726"	"00007281"	"30"	"62"	"0"	"62"	"0"	"c.62T>C"	"r.(?)"	"p.(Val21Ala)"	""
"0000609236"	"00007281"	"30"	"3411"	"0"	"3411"	"0"	"c.3411C>T"	"r.(?)"	"p.(Ala1137=)"	""
"0000609237"	"00007281"	"50"	"2779"	"0"	"2779"	"0"	"c.2779G>C"	"r.(?)"	"p.(Asp927His)"	""
"0000609238"	"00007281"	"30"	"2621"	"0"	"2621"	"0"	"c.2621G>A"	"r.(?)"	"p.(Arg874Gln)"	""
"0000609242"	"00007281"	"30"	"1929"	"0"	"1929"	"0"	"c.1929G>C"	"r.(?)"	"p.(Glu643Asp)"	""
"0000609244"	"00007281"	"30"	"1471"	"-7"	"1471"	"-7"	"c.1471-7T>C"	"r.(=)"	"p.(=)"	""
"0000609245"	"00007281"	"30"	"913"	"0"	"913"	"0"	"c.913G>T"	"r.(?)"	"p.(Ala305Ser)"	""
"0000609246"	"00007281"	"50"	"904"	"0"	"904"	"0"	"c.904T>A"	"r.(?)"	"p.(Phe302Ile)"	""
"0000609247"	"00007281"	"30"	"454"	"0"	"454"	"0"	"c.454G>A"	"r.(?)"	"p.(Gly152Arg)"	""
"0000621400"	"00007281"	"10"	"1711"	"-11"	"1711"	"-10"	"c.1711-11_1711-10dup"	"r.(=)"	"p.(=)"	""
"0000651488"	"00007281"	"10"	"2707"	"-66"	"2707"	"-66"	"c.2707-66C>T"	"r.(=)"	"p.(=)"	""
"0000651490"	"00007281"	"50"	"1882"	"0"	"1882"	"0"	"c.1882G>A"	"r.(?)"	"p.(Glu628Lys)"	""
"0000651491"	"00007281"	"50"	"1498"	"0"	"1498"	"0"	"c.1498C>T"	"r.(?)"	"p.(Arg500Trp)"	""
"0000651492"	"00007281"	"50"	"1364"	"0"	"1364"	"0"	"c.1364C>G"	"r.(?)"	"p.(Thr455Arg)"	""
"0000655154"	"00007281"	"50"	"2477"	"0"	"2477"	"0"	"c.2477G>A"	"r.(?)"	"p.(Arg826Gln)"	""
"0000655155"	"00007281"	"30"	"1462"	"0"	"1462"	"0"	"c.1462G>A"	"r.(?)"	"p.(Gly488Ser)"	""
"0000669815"	"00007281"	"10"	"2707"	"-66"	"2707"	"-66"	"c.2707-66C>T"	"r.(=)"	"p.(=)"	""
"0000675164"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	""
"0000677293"	"00007281"	"30"	"1364"	"0"	"1364"	"0"	"c.1364C>G"	"r.(?)"	"p.(Thr455Arg)"	""
"0000677294"	"00007281"	"30"	"92"	"0"	"92"	"0"	"c.92T>C"	"r.(?)"	"p.(Leu31Pro)"	""
"0000689311"	"00007281"	"30"	"3693"	"0"	"3693"	"0"	"c.3693G>C"	"r.(?)"	"p.(Glu1231Asp)"	""
"0000689312"	"00007281"	"50"	"3056"	"0"	"3056"	"0"	"c.3056G>A"	"r.(?)"	"p.(Arg1019Gln)"	""
"0000689313"	"00007281"	"50"	"1379"	"0"	"1379"	"0"	"c.1379T>G"	"r.(?)"	"p.(Leu460Arg)"	""
"0000710707"	"00007281"	"90"	"2653"	"0"	"2653"	"0"	"c.2653C>T"	"r.(?)"	"p.(Arg885*)"	"15"
"0000710708"	"00007281"	"90"	"2012"	"0"	"2015"	"0"	"c.2012_2015del"	"r.(?)"	"p.(Leu671*)"	"13"
"0000710726"	"00007281"	"90"	"1024"	"0"	"1024"	"0"	"c.1024A>T"	"r.(?)"	"p.(Lys342*)"	"9"
"0000710727"	"00007281"	"90"	"2698"	"0"	"2698"	"0"	"c.2698G>T"	"r.(?)"	"p.(Glu900*)"	"15"
"0000710728"	"00007281"	"90"	"619"	"0"	"619"	"0"	"c.619G>T"	"r.(?)"	"p.(Asp207Tyr)"	"5"
"0000710753"	"00007281"	"90"	"3265"	"0"	"3265"	"0"	"c.3265C>T"	"r.(?)"	"p.(Gln1089*)"	"18"
"0000710754"	"00007281"	"90"	"2848"	"0"	"2848"	"0"	"c.2848C>T"	"r.(?)"	"p.(Arg950Trp)"	"17"
"0000710755"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000710756"	"00007281"	"90"	"194"	"0"	"198"	"0"	"c.194_198dup"	"r.(?)"	"p.(Ser67Glyfs*17)"	"1"
"0000710757"	"00007281"	"90"	"2056"	"0"	"2056"	"0"	"c.2056dup"	"r.(?)"	"p.(Gln686Profs*3)"	""
"0000710758"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	"10"
"0000710759"	"00007281"	"90"	"1855"	"0"	"1855"	"0"	"c.1855C>T"	"r.(?)"	"p.(Gln619*)"	"12"
"0000710760"	"00007281"	"70"	"848"	"0"	"848"	"0"	"c.848T>G"	"r.(?)"	"p.(Ile283Arg)"	"7"
"0000710761"	"00007281"	"90"	"1028"	"0"	"1034"	"0"	"c.1028_1034del"	"r.(?)"	"p.(Leu343Profs*10)"	"9"
"0000710762"	"00007281"	"90"	"1386"	"0"	"1387"	"0"	"c.1386_1387del"	"r.(?)"	"p.(Arg463Lysfs*26)"	"10"
"0000710763"	"00007281"	"90"	"1468"	"0"	"1469"	"0"	"c.1468_1469dup"	"r.(?)"	"p.(Ser491Glyfs*4)"	"10"
"0000710764"	"00007281"	"90"	"1541"	"0"	"1542"	"0"	"c.1541_1542del"	"r.(?)"	"p.(Leu514Argfs*22)"	"11"
"0000710765"	"00007281"	"90"	"2263"	"0"	"2263"	"0"	"c.2263C>T"	"r.(?)"	"p.(Gln755*)"	"14"
"0000710766"	"00007281"	"90"	"2010"	"0"	"2010"	"0"	"c.2010del"	"r.(?)"	"p.(Lys670Asnfs*2)"	"13"
"0000710767"	"00007281"	"90"	"2019"	"0"	"2019"	"0"	"c.2019dup"	"r.(?)"	"p.(Lys674*)"	"12"
"0000710768"	"00007281"	"90"	"2447"	"0"	"2451"	"0"	"c.2447_2451dup"	"r.(?)"	"p.(Val818Argfs*3)"	"14"
"0000710769"	"00007281"	"90"	"273"	"0"	"273"	"0"	"c.273dup"	"r.(?)"	"p.(Lys92*)"	"2"
"0000710770"	"00007281"	"90"	"2854"	"0"	"2854"	"0"	"c.2854dup"	"r.(?)"	"p.(Arg952Lysfs*52)"	"17"
"0000710771"	"00007281"	"90"	"3134"	"0"	"3134"	"0"	"c.3134C>T"	"r.(?)"	"p.(Ala1045Val)"	"18"
"0000710772"	"00007281"	"90"	"519"	"2"	"519"	"2"	"c.519+2T>C"	"r.spl"	"p.?"	"4i"
"0000710773"	"00007281"	"90"	"745"	"0"	"745"	"0"	"c.745C>T"	"r.(?)"	"p.(Gln249*)"	"6"
"0000710774"	"00007281"	"90"	"893"	"0"	"893"	"0"	"c.893del"	"r.(?)"	"p.(His298Profs*15)"	"8"
"0000710775"	"00007281"	"90"	"983"	"0"	"983"	"0"	"c.983del"	"r.(?)"	"p.(Gly328Glufs*27)"	"8"
"0000710776"	"00007281"	"90"	"450"	"1086"	"1711"	"-431"	"c.450+1086_1711-431del"	"r.?"	"p.?"	"3i_11i"
"0000710777"	"00007281"	"90"	"1887"	"-520"	"2448"	"0"	"c.1887-520_2448del"	"r.1877_2501del"	"p.Ala630_Met834del"	"12i_14"
"0000710778"	"00007281"	"90"	"194"	"0"	"198"	"0"	"c.194_198dup"	"r.(?)"	"p.(Ser67Glyfs*17)"	"1"
"0000710779"	"00007281"	"90"	"848"	"0"	"848"	"0"	"c.848T>G"	"r.(?)"	"p.(Ile283Arg)"	"7"
"0000710780"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	"10"
"0000710781"	"00007281"	"90"	"1708"	"0"	"1708"	"0"	"c.1708C>T"	"r.(?)"	"p.(Gln570*)"	"11"
"0000710782"	"00007281"	"90"	"1855"	"0"	"1855"	"0"	"c.1855C>T"	"r.(?)"	"p.(Gln619*)"	"12"
"0000710783"	"00007281"	"90"	"2056"	"0"	"2056"	"0"	"c.2056dup"	"r.(?)"	"p.(Gln686Profs*3)"	"14"
"0000710784"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660dup"	"r.(?)"	"p.(Ile1221Hisfs*44)"	"22"
"0000710785"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660dup"	"r.(?)"	"p.(Ile1221Hisfs*44)"	"22"
"0000710786"	"00007281"	"90"	"3793"	"0"	"3793"	"0"	"c.3793del"	"r.(?)"	"p.(Leu1265Tyrfs*2)"	"22"
"0000710787"	"00007281"	"90"	"3659"	"2"	"3659"	"2"	"c.3659+2T>C"	"r.spl"	"p.?"	"21"
"0000710788"	"00007281"	"90"	"2620"	"0"	"2620"	"0"	"c.2620C>T"	"r.(?)"	"p.(Arg874*)"	"15"
"0000710793"	"00007281"	"90"	"2746"	"0"	"2746"	"0"	"c.2746del"	"r.(?)"	"p.(Ser916Alafs*6)"	"16"
"0000710794"	"00007281"	"90"	"1655"	"0"	"1658"	"0"	"c.1655_1658del"	"r.(?)"	"p.(Gly552Aspfs*2)"	"11"
"0000710795"	"00007281"	"90"	"1708"	"0"	"1708"	"0"	"c.1708C>T"	"r.(?)"	"p.(Gln570*)"	"11"
"0000710796"	"00007281"	"90"	"3659"	"2"	"3659"	"2"	"c.3659+2T>C"	"r.spl"	"p.?"	"21i"
"0000710797"	"00007281"	"90"	"2010"	"0"	"2010"	"0"	"c.2010del"	"r.(?)"	"p.(Lys670Asnfs*2)"	"13"
"0000710924"	"00007281"	"90"	"3793"	"0"	"3793"	"0"	"c.3793del"	"r.(?)"	"p.(Leu1265Tyrfs*2)"	""
"0000710925"	"00007281"	"90"	"848"	"0"	"848"	"0"	"c.848T>G"	"r.(?)"	"p.(Ile283Arg)"	""
"0000710926"	"00007281"	"90"	"1468"	"0"	"1469"	"0"	"c.1468_1469dup"	"r.(?)"	"p.(Ser491Glyfs*4)"	""
"0000710927"	"00007281"	"90"	"1145"	"1"	"1145"	"1"	"c.1145+1G>A"	"r.spl"	"p.?"	""
"0000710928"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	""
"0000710929"	"00007281"	"90"	"3659"	"2"	"3659"	"2"	"c.3659+2T>C"	"r.spl"	"p.?"	""
"0000710930"	"00007281"	"90"	"3805"	"0"	"3805"	"0"	"c.3805G>T"	"r.(?)"	"p.(Gly1269*)"	""
"0000710931"	"00007281"	"90"	"1024"	"0"	"1024"	"0"	"c.1024A>T"	"r.(?)"	"p.(Lys342*)"	""
"0000710932"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	""
"0000710945"	"00007281"	"90"	"475"	"0"	"475"	"0"	"c.475C>T"	"r.(?)"	"p.(Gln159*)"	""
"0000710946"	"00007281"	"90"	"3265"	"0"	"3265"	"0"	"c.3265C>T"	"r.(?)"	"p.(Gln1089*)"	""
"0000710947"	"00007281"	"50"	"2848"	"0"	"2848"	"0"	"c.2848C>T"	"r.(?)"	"p.(Arg950Trp)"	""
"0000710948"	"00007281"	"90"	"1155"	"0"	"1155"	"0"	"c.1155del"	"r.(?)"	"p.(Ile385Metfs*4)"	""
"0000710950"	"00007281"	"90"	"2047"	"-1"	"2047"	"-1"	"c.2047-1G>T"	"r.spl"	"p.?"	""
"0000710952"	"00007281"	"90"	"983"	"0"	"983"	"0"	"c.983del"	"r.(?)"	"p.(Gly328Glufs*27)"	""
"0000710953"	"00007281"	"90"	"2653"	"0"	"2653"	"0"	"c.2653C>T"	"r.(?)"	"p.(Arg885*)"	""
"0000710954"	"00007281"	"90"	"707"	"-2"	"707"	"-2"	"c.707-2A>G"	"r.spl"	"p.?"	""
"0000710973"	"00007281"	"90"	"0"	"0"	"0"	"0"	"c.(283+1_284-1)_()del"	"r.?"	"p.?"	"2i_6i"
"0000710974"	"00007281"	"90"	"745"	"0"	"745"	"0"	"c.745C>T"	"r.(?)"	"p.(Gln249*)"	"6"
"0000710975"	"00007281"	"90"	"848"	"0"	"848"	"0"	"c.848T>G"	"r.(?)"	"p.(Ile283Arg)"	"7"
"0000710976"	"00007281"	"90"	"1828"	"0"	"1828"	"0"	"c.1828C>T"	"r.(?)"	"p.(Gln610*)"	"12"
"0000710977"	"00007281"	"90"	"1711"	"-1"	"2829"	"1"	"c.(1710+1_1711-1)_(2829+1_2830-1)del"	"r.?"	"p.?"	"12i_16i"
"0000710978"	"00007281"	"90"	"1918"	"0"	"1918"	"0"	"c.1918del"	"r.(?)"	"p.(Met640Cysfs*21)"	"13"
"0000710979"	"00007281"	"90"	"2029"	"0"	"2029"	"0"	"c.2029C>T"	"r.(?)"	"p.(Arg677*)"	"13"
"0000710980"	"00007281"	"90"	"2365"	"0"	"2365"	"0"	"c.2365G>T"	"r.(?)"	"p.(Glu789*)"	"14"
"0000710981"	"00007281"	"90"	"2476"	"0"	"2476"	"0"	"c.2476C>T"	"r.(?)"	"p.(Arg826*)"	"14"
"0000710982"	"00007281"	"90"	"2652"	"0"	"2652"	"0"	"c.2652G>A"	"r.(?)"	"p.(Trp884*)"	"15"
"0000710983"	"00007281"	"90"	"2710"	"0"	"2710"	"0"	"c.2710C>T"	"r.(?)"	"p.(Gln904*)"	"16"
"0000710984"	"00007281"	"90"	"2885"	"0"	"2885"	"0"	"c.2885del"	"r.(?)"	"p.(Gly962Alafs*17)"	"17"
"0000710985"	"00007281"	"90"	"3283"	"0"	"3283"	"0"	"c.3283G>T"	"r.(?)"	"p.(Glu1095*)"	"19"
"0000710986"	"00007281"	"90"	"3360"	"1"	"3360"	"1"	"c.3360+1G>A"	"r.spl"	"p.?"	"19i"
"0000710987"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000710988"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000710989"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000710990"	"00007281"	"90"	"3731"	"0"	"3731"	"0"	"c.3731dup"	"r.(?)"	"p.(Ser1245Valfs*20)"	"22"
"0000710991"	"00007281"	"90"	"3793"	"0"	"3793"	"0"	"c.3793del"	"r.(?)"	"p.(Leu1265Tyrfs*2)"	"22"
"0000710992"	"00007281"	"90"	"3797"	"0"	"3797"	"0"	"c.3797T>A"	"r.(?)"	"p.(Leu1266*)"	"22"
"0000710993"	"00007281"	"90"	"3797"	"0"	"3797"	"0"	"c.3797T>G"	"r.(?)"	"p.(Leu1266*)"	"22"
"0000710994"	"00007281"	"90"	"3405"	"0"	"3411"	"0"	"c.3405_3411del"	"r.(?)"	"p.(Gly1136Argfs*6)"	"20"
"0000710995"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000710996"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000710997"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	"22"
"0000712824"	"00007281"	"50"	"1560"	"0"	"1562"	"0"	"c.1560_1562del"	"r.(?)"	"p.(Glu520del)"	""
"0000712825"	"00007281"	"50"	"913"	"0"	"913"	"0"	"c.913G>T"	"r.(?)"	"p.(Ala305Ser)"	""
"0000712826"	"00007281"	"50"	"904"	"0"	"904"	"0"	"c.904T>A"	"r.(?)"	"p.(Phe302Ile)"	""
"0000719928"	"00007281"	"30"	"2648"	"0"	"2648"	"0"	"c.2648C>T"	"r.(?)"	"p.(Ala883Val)"	""
"0000719929"	"00007281"	"30"	"2297"	"0"	"2297"	"0"	"c.2297G>T"	"r.(?)"	"p.(Arg766Leu)"	""
"0000719930"	"00007281"	"50"	"1888"	"0"	"1888"	"0"	"c.1888G>A"	"r.(?)"	"p.(Ala630Thr)"	""
"0000719931"	"00007281"	"50"	"950"	"0"	"950"	"0"	"c.950T>C"	"r.(?)"	"p.(Leu317Pro)"	""
"0000719932"	"00007281"	"90"	"194"	"0"	"198"	"0"	"c.194_198dup"	"r.(?)"	"p.(Ser67GlyfsTer17)"	""
"0000719933"	"00007281"	"30"	"176"	"0"	"176"	"0"	"c.176G>C"	"r.(?)"	"p.(Gly59Ala)"	""
"0000719934"	"00007281"	"30"	"-2972"	"0"	"-2972"	"0"	"c.-2972G>T"	"r.(?)"	"p.(=)"	""
"0000729930"	"00007281"	"90"	"3870"	"0"	"3893"	"0"	"c.3870_3893dup"	"r.(?)"	"p.(Lys1293_Lys1300dup)"	""
"0000760748"	"00007281"	"70"	"2317"	"0"	"2317"	"0"	"c.2317del"	"r.(?)"	"p.(Leu773Cysfs*34)"	""
"0000801652"	"00007281"	"30"	"3558"	"0"	"3558"	"0"	"c.3558G>A"	"r.(?)"	"p.(Arg1186=)"	""
"0000801653"	"00007281"	"90"	"3557"	"1"	"3557"	"1"	"c.3557+1G>A"	"r.spl?"	"p.?"	""
"0000801656"	"00007281"	"30"	"2267"	"0"	"2267"	"0"	"c.2267A>C"	"r.(?)"	"p.(Asn756Thr)"	""
"0000801657"	"00007281"	"30"	"1557"	"0"	"1557"	"0"	"c.1557A>G"	"r.(?)"	"p.(Glu519=)"	""
"0000801658"	"00007281"	"30"	"1542"	"0"	"1542"	"0"	"c.1542C>T"	"r.(?)"	"p.(Leu514=)"	""
"0000801659"	"00007281"	"30"	"1478"	"0"	"1478"	"0"	"c.1478T>C"	"r.(?)"	"p.(Val493Ala)"	""
"0000801660"	"00007281"	"30"	"1215"	"0"	"1215"	"0"	"c.1215T>A"	"r.(?)"	"p.(Asp405Glu)"	""
"0000801661"	"00007281"	"30"	"1005"	"3"	"1005"	"3"	"c.1005+3G>A"	"r.spl?"	"p.?"	""
"0000801662"	"00007281"	"30"	"864"	"0"	"864"	"0"	"c.864C>T"	"r.(?)"	"p.(Asn288=)"	""
"0000801665"	"00007281"	"30"	"122"	"0"	"122"	"0"	"c.122C>A"	"r.(?)"	"p.(Pro41His)"	""
"0000818859"	"00007281"	"90"	"3405"	"0"	"3411"	"0"	"c.3405_3411del"	"r.(?)"	"p.(Lys1136Serfs*5)"	"21"
"0000818860"	"00007281"	"90"	"619"	"0"	"619"	"0"	"c.619G>T"	"r.(?)"	"p.(Glu207*)"	"7"
"0000818861"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	"10"
"0000818862"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	"10"
"0000818863"	"00007281"	"90"	"1708"	"0"	"1708"	"0"	"c.1708C>T"	"r.(?)"	"p.(Gln570*)"	"13"
"0000818864"	"00007281"	"90"	"619"	"0"	"619"	"0"	"c.619G>T"	"r.(?)"	"p.(Glu207*)"	"7"
"0000818865"	"00007281"	"90"	"1708"	"0"	"1708"	"0"	"c.1708C>T"	"r.(?)"	"p.(Gln570*)"	"13"
"0000818866"	"00007281"	"90"	"619"	"0"	"619"	"0"	"c.619G>T"	"r.(?)"	"p.(Glu207*)"	"7"
"0000818867"	"00007281"	"90"	"1713"	"0"	"1713"	"0"	"c.1713dup"	"r.(?)"	"p.(Ile572Asnfs*8)"	"13"
"0000818868"	"00007281"	"90"	"3360"	"1"	"3360"	"1"	"c.3360+1G>A"	"r.spl?"	"p.?"	"21i"
"0000818869"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399*)"	"10"
"0000818870"	"00007281"	"90"	"1708"	"0"	"1708"	"0"	"c.1708C>T"	"r.(?)"	"p.(Gln570*)"	"13"
"0000818905"	"00007281"	"70"	"3121"	"0"	"3121"	"0"	"c.3121C>T"	"r.(?)"	"p.(Gln1041*)"	"20"
"0000818906"	"00007281"	"70"	"1708"	"0"	"1708"	"0"	"c.1708C>T"	"r.(?)"	"p.(Gln570*)"	"13"
"0000818917"	"00007281"	"70"	"1823"	"0"	"1823"	"0"	"c.1823G>A"	"r.(?)"	"p.(Arg608Lys)"	"14"
"0000818920"	"00007281"	"70"	"2739"	"0"	"2739"	"0"	"c.2739G>C"	"r.(?)"	"p.(Lys913Asn)"	"17"
"0000850628"	"00007281"	"30"	"3793"	"0"	"3793"	"0"	"c.3793C>T"	"r.(?)"	"p.(Leu1265=)"	""
"0000850629"	"00007281"	"30"	"3431"	"0"	"3431"	"0"	"c.3431G>A"	"r.(?)"	"p.(Ser1144Asn)"	""
"0000850632"	"00007281"	"10"	"2601"	"0"	"2601"	"0"	"c.2601C>T"	"r.(?)"	"p.(Ala867=)"	""
"0000850633"	"00007281"	"30"	"1208"	"0"	"1208"	"0"	"c.1208G>A"	"r.(?)"	"p.(Ser403Asn)"	""
"0000850634"	"00007281"	"30"	"1046"	"0"	"1046"	"0"	"c.1046C>T"	"r.(?)"	"p.(Thr349Ile)"	""
"0000850635"	"00007281"	"30"	"1003"	"0"	"1003"	"0"	"c.1003C>T"	"r.(?)"	"p.(Arg335Trp)"	""
"0000859454"	"00007281"	"10"	"2648"	"0"	"2648"	"0"	"c.2648C>T"	"r.(?)"	"p.(Ala883Val)"	""
"0000859455"	"00007281"	"30"	"2360"	"0"	"2360"	"0"	"c.2360G>A"	"r.(?)"	"p.(Arg787Gln)"	""
"0000859456"	"00007281"	"30"	"2208"	"0"	"2208"	"0"	"c.2208C>A"	"r.(?)"	"p.(Leu736=)"	""
"0000859457"	"00007281"	"50"	"1505"	"0"	"1505"	"0"	"c.1505T>G"	"r.(?)"	"p.(Leu502Arg)"	""
"0000886296"	"00007281"	"50"	"3473"	"0"	"3473"	"0"	"c.3473T>G"	"r.(?)"	"p.(Leu1158Arg)"	""
"0000886297"	"00007281"	"30"	"3272"	"7"	"3272"	"7"	"c.3272+7C>T"	"r.(=)"	"p.(=)"	""
"0000886300"	"00007281"	"30"	"2395"	"0"	"2395"	"0"	"c.2395G>C"	"r.(?)"	"p.(Asp799His)"	""
"0000886301"	"00007281"	"30"	"2096"	"0"	"2096"	"0"	"c.2096C>T"	"r.(?)"	"p.(Thr699Met)"	""
"0000886302"	"00007281"	"30"	"1364"	"0"	"1364"	"0"	"c.1364C>G"	"r.(?)"	"p.(Thr455Arg)"	""
"0000886303"	"00007281"	"30"	"1311"	"0"	"1311"	"0"	"c.1311A>G"	"r.(?)"	"p.(Leu437=)"	""
"0000886304"	"00007281"	"90"	"116"	"0"	"116"	"0"	"c.116G>A"	"r.(?)"	"p.(Trp39*)"	""
"0000912118"	"00007281"	"30"	"3540"	"0"	"3540"	"0"	"c.3540C>T"	"r.(?)"	"p.(Ala1180=)"	""
"0000922745"	"00007281"	"70"	"519"	"0"	"519"	"1"	"c.519_519+1delinsT"	"r.spl"	"p.?"	"4"
"0000928913"	"00007281"	"50"	"2830"	"0"	"2830"	"0"	"c.2830G>A"	"r.(?)"	"p.(Val944Ile)"	""
"0000928914"	"00007281"	"50"	"1345"	"0"	"1345"	"0"	"c.1345C>T"	"r.(?)"	"p.(Arg449Trp)"	""
"0000928915"	"00007281"	"50"	"913"	"0"	"913"	"0"	"c.913G>T"	"r.(?)"	"p.(Ala305Ser)"	""
"0000928916"	"00007281"	"50"	"904"	"0"	"904"	"0"	"c.904T>A"	"r.(?)"	"p.(Phe302Ile)"	""
"0000928917"	"00007281"	"30"	"-2875"	"0"	"-2875"	"0"	"c.-2875C>G"	"r.(?)"	"p.(=)"	""
"0000948334"	"00007281"	"50"	"2060"	"0"	"2060"	"0"	"c.2060G>A"	"r.(?)"	"p.(Arg687His)"	""
"0000976308"	"00007281"	"50"	"3599"	"0"	"3599"	"0"	"c.3599G>A"	"r.(?)"	"p.(Arg1200Gln)"	""
"0000976309"	"00007281"	"10"	"3557"	"10"	"3557"	"10"	"c.3557+10G>A"	"r.(=)"	"p.(=)"	""
"0000976310"	"00007281"	"50"	"2864"	"0"	"2864"	"0"	"c.2864G>A"	"r.(?)"	"p.(Arg955Gln)"	""
"0000976313"	"00007281"	"30"	"2707"	"-5"	"2707"	"-5"	"c.2707-5T>C"	"r.spl?"	"p.?"	""
"0000976317"	"00007281"	"50"	"1583"	"0"	"1583"	"0"	"c.1583A>G"	"r.(?)"	"p.(Gln528Arg)"	""
"0000976318"	"00007281"	"70"	"1468"	"0"	"1469"	"0"	"c.1468_1469dup"	"r.(?)"	"p.(Ser491Glyfs*4)"	""
"0000976319"	"00007281"	"30"	"1146"	"-5"	"1146"	"-5"	"c.1146-5C>G"	"r.spl?"	"p.?"	""
"0000976322"	"00007281"	"30"	"-2875"	"0"	"-2875"	"0"	"c.-2875C>G"	"r.(?)"	"p.(=)"	""
"0000976323"	"00007281"	"50"	"-2956"	"0"	"-2956"	"0"	"c.-2956G>A"	"r.(?)"	"p.(=)"	""
"0000994332"	"00007281"	"30"	"3911"	"0"	"3911"	"0"	"c.3911C>T"	"r.(?)"	"p.(Ala1304Val)"	""
"0000994333"	"00007281"	"90"	"3660"	"0"	"3660"	"0"	"c.3660del"	"r.(?)"	"p.(Ser1220Argfs*3)"	""
"0000994334"	"00007281"	"30"	"3272"	"7"	"3272"	"7"	"c.3272+7C>T"	"r.(=)"	"p.(=)"	""
"0000994335"	"00007281"	"50"	"3055"	"0"	"3055"	"0"	"c.3055C>T"	"r.(?)"	"p.(Arg1019Trp)"	""
"0000994338"	"00007281"	"30"	"2776"	"0"	"2776"	"0"	"c.2776G>A"	"r.(?)"	"p.(Glu926Lys)"	""
"0000994339"	"00007281"	"30"	"2758"	"0"	"2758"	"0"	"c.2758C>T"	"r.(?)"	"p.(Leu920Phe)"	""
"0000994342"	"00007281"	"30"	"1478"	"0"	"1478"	"0"	"c.1478T>C"	"r.(?)"	"p.(Val493Ala)"	""
"0000994343"	"00007281"	"50"	"1196"	"0"	"1196"	"0"	"c.1196G>A"	"r.(?)"	"p.(Arg399Gln)"	""
"0000994344"	"00007281"	"70"	"871"	"-2"	"894"	"0"	"c.871-2_894del"	"r.(?)"	"p.(Val291_Gly296delinsIleLeuLeuSerSerCys)"	""
"0000994349"	"00007281"	"90"	"816"	"1"	"816"	"1"	"c.816+1G>T"	"r.spl?"	"p.?"	""
"0000994350"	"00007281"	"50"	"766"	"0"	"766"	"0"	"c.766G>T"	"r.(?)"	"p.(Gly256Trp)"	""
"0000994351"	"00007281"	"30"	"760"	"0"	"760"	"0"	"c.760G>A"	"r.(?)"	"p.(Gly254Arg)"	""
"0001007475"	"00007281"	"90"	"1195"	"0"	"1195"	"0"	"c.1195C>T"	"r.(?)"	"p.(Arg399Ter)"	""
"0001007476"	"00007281"	"70"	"2474"	"0"	"2474"	"0"	"c.2474T>C"	"r.(?)"	"p.(Leu825Pro)"	""
"0001007564"	"00007281"	"70"	"1931"	"0"	"1931"	"0"	"c.1931G>A"	"r.(?)"	"p.(Arg644Gln)"	""
"0001013973"	"00007281"	"50"	"1560"	"0"	"1562"	"0"	"c.1560_1562del"	"r.(?)"	"p.(Glu520del)"	""
"0001020256"	"00007281"	"70"	"874"	"0"	"875"	"0"	"c.874_875delinsGTGCCGCACCACGGCCTCC"	"r.(874_875delinsGTGCCGCACCACGGCCTCC)"	"p.(Leu292ValfsTer27)"	"8"
"0001034585"	"00007281"	"50"	"3861"	"0"	"3861"	"0"	"c.3861del"	"r.(?)"	"p.(Pro1288Leufs*9)"	""
"0001034586"	"00007281"	"30"	"3787"	"0"	"3787"	"0"	"c.3787A>T"	"r.(?)"	"p.(Ile1263Phe)"	""
"0001034587"	"00007281"	"30"	"3411"	"0"	"3411"	"0"	"c.3411C>T"	"r.(?)"	"p.(Ala1137=)"	""
"0001034588"	"00007281"	"10"	"2601"	"0"	"2601"	"0"	"c.2601C>T"	"r.(?)"	"p.(Ala867=)"	""
"0001034592"	"00007281"	"30"	"2235"	"0"	"2235"	"0"	"c.2235A>G"	"r.(?)"	"p.(=)"	""
"0001034593"	"00007281"	"10"	"2047"	"-9"	"2047"	"-9"	"c.2047-9A>T"	"r.(=)"	"p.(=)"	""
"0001034594"	"00007281"	"10"	"2029"	"0"	"2029"	"0"	"c.2029C>A"	"r.(?)"	"p.(Arg677=)"	""
"0001034601"	"00007281"	"50"	"1504"	"0"	"1504"	"0"	"c.1504C>T"	"r.(?)"	"p.(Leu502Phe)"	""
"0001034602"	"00007281"	"30"	"1452"	"0"	"1452"	"0"	"c.1452G>A"	"r.(?)"	"p.(=)"	""
"0001034603"	"00007281"	"30"	"1006"	"-9"	"1006"	"-9"	"c.1006-9C>T"	"r.(=)"	"p.(=)"	""
"0001034604"	"00007281"	"30"	"864"	"0"	"864"	"0"	"c.864C>T"	"r.(?)"	"p.(Asn288=)"	""
"0001034608"	"00007281"	"70"	"50"	"0"	"50"	"0"	"c.50dup"	"r.(?)"	"p.(Leu18Serfs*38)"	""
"0001034609"	"00007281"	"30"	"18"	"0"	"18"	"0"	"c.18C>T"	"r.(?)"	"p.(=)"	""
"0001051680"	"00007281"	"90"	"3659"	"2"	"3659"	"2"	"c.3659+2T>C"	"r.spl?"	"p.?"	""
"0001051681"	"00007281"	"70"	"3239"	"0"	"3239"	"0"	"c.3239del"	"r.(?)"	"p.(Lys1080Argfs*13)"	""
"0001051682"	"00007281"	"50"	"2739"	"0"	"2739"	"0"	"c.2739G>C"	"r.(?)"	"p.(Lys913Asn)"	""
"0001051683"	"00007281"	"50"	"2258"	"0"	"2258"	"0"	"c.2258G>A"	"r.(?)"	"p.(Arg753His)"	""
"0001051684"	"00007281"	"50"	"1552"	"0"	"1552"	"0"	"c.1552C>A"	"r.(?)"	"p.(Gln518Lys)"	""
"0001059609"	"00007281"	"70"	"1639"	"0"	"1639"	"0"	"c.1639del"	"r.(?)"	"p.(Ser547ValfsTer8)"	""
"0001059710"	"00007281"	"70"	"2056"	"0"	"2056"	"0"	"c.2056dup"	"r.(?)"	"p.(Gln686ProfsTer3)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 126
"{{screeningid}}"	"{{variantid}}"
"0000017596"	"0000117670"
"0000017596"	"0000117671"
"0000058487"	"0000089068"
"0000226739"	"0000459774"
"0000294799"	"0000651488"
"0000294801"	"0000651490"
"0000294802"	"0000651491"
"0000294803"	"0000651492"
"0000306127"	"0000669815"
"0000308268"	"0000675164"
"0000327075"	"0000710707"
"0000327076"	"0000710708"
"0000327093"	"0000710726"
"0000327094"	"0000710727"
"0000327094"	"0000710787"
"0000327095"	"0000710728"
"0000327095"	"0000710788"
"0000327120"	"0000710753"
"0000327120"	"0000710754"
"0000327121"	"0000710755"
"0000327122"	"0000710756"
"0000327123"	"0000710757"
"0000327124"	"0000710758"
"0000327125"	"0000710759"
"0000327126"	"0000710760"
"0000327127"	"0000710761"
"0000327128"	"0000710762"
"0000327128"	"0000710793"
"0000327129"	"0000710763"
"0000327130"	"0000710764"
"0000327130"	"0000710794"
"0000327131"	"0000710765"
"0000327131"	"0000710795"
"0000327132"	"0000710766"
"0000327133"	"0000710767"
"0000327134"	"0000710768"
"0000327135"	"0000710769"
"0000327136"	"0000710770"
"0000327136"	"0000710796"
"0000327137"	"0000710771"
"0000327137"	"0000710797"
"0000327138"	"0000710772"
"0000327139"	"0000710773"
"0000327140"	"0000710774"
"0000327141"	"0000710775"
"0000327142"	"0000710776"
"0000327143"	"0000710777"
"0000327144"	"0000710778"
"0000327145"	"0000710779"
"0000327146"	"0000710780"
"0000327147"	"0000710781"
"0000327148"	"0000710782"
"0000327149"	"0000710783"
"0000327150"	"0000710784"
"0000327151"	"0000710785"
"0000327152"	"0000710786"
"0000327236"	"0000710924"
"0000327237"	"0000710925"
"0000327238"	"0000710926"
"0000327239"	"0000710927"
"0000327239"	"0000710945"
"0000327240"	"0000710928"
"0000327241"	"0000710929"
"0000327241"	"0000710946"
"0000327241"	"0000710947"
"0000327242"	"0000710930"
"0000327243"	"0000710931"
"0000327243"	"0000710948"
"0000327244"	"0000710932"
"0000327252"	"0000710950"
"0000327254"	"0000710952"
"0000327256"	"0000710953"
"0000327256"	"0000710954"
"0000327275"	"0000710973"
"0000327276"	"0000710974"
"0000327277"	"0000710975"
"0000327278"	"0000710976"
"0000327279"	"0000710977"
"0000327280"	"0000710978"
"0000327280"	"0000710995"
"0000327281"	"0000710979"
"0000327282"	"0000710980"
"0000327283"	"0000710981"
"0000327284"	"0000710982"
"0000327284"	"0000710996"
"0000327285"	"0000710983"
"0000327286"	"0000710984"
"0000327286"	"0000710997"
"0000327287"	"0000710985"
"0000327287"	"0000710994"
"0000327288"	"0000710986"
"0000327289"	"0000710987"
"0000327290"	"0000710988"
"0000327291"	"0000710989"
"0000327292"	"0000710990"
"0000327293"	"0000710991"
"0000327294"	"0000710992"
"0000327295"	"0000710993"
"0000328762"	"0000712824"
"0000328762"	"0000712825"
"0000328762"	"0000712826"
"0000332648"	"0000729930"
"0000360674"	"0000760748"
"0000389666"	"0000818859"
"0000389666"	"0000818860"
"0000389667"	"0000818861"
"0000389668"	"0000818862"
"0000389669"	"0000818863"
"0000389669"	"0000818864"
"0000389670"	"0000818865"
"0000389670"	"0000818866"
"0000389671"	"0000818867"
"0000389671"	"0000818868"
"0000389672"	"0000818869"
"0000389672"	"0000818870"
"0000389700"	"0000818905"
"0000389701"	"0000818906"
"0000389707"	"0000818917"
"0000389709"	"0000818920"
"0000436373"	"0000922745"
"0000455368"	"0001007475"
"0000455369"	"0001007476"
"0000455419"	"0001007564"
"0000461117"	"0001020256"
"0000471461"	"0001059609"
"0000471461"	"0001059710"