### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = EYS) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "EYS" "eyes shut homolog (Drosophila)" "6" "q12" "unknown" "NG_023443.2" "UD_132085377375" "" "http://www.LOVD.nl/EYS" "" "1" "21555" "346007" "612424" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases.
Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/EYS_NM_001142800.1_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases.\r\nWhen using this database, please refer to Messchaert et al. 2018." "-1" "" "-1" "00001" "2012-02-13 00:00:00" "00006" "2023-08-30 13:08:19" "00006" "2026-05-25 15:42:54" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00007329" "EYS" "transcript variant 1" "001" "NM_001142800.1" "" "NP_001136272.1" "" "" "" "-538" "10051" "9435" "66417118" "64429876" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 16 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00012" "PSORS" "psoriasis, pustular, generalized (PSORS)" "" "" "" "" "" "00006" "2012-07-06 21:50:32" "00006" "2019-08-12 13:38:21" "00058" "CORD" "dystrophy, cone-rod (CORD)" "" "" "" "" "" "00006" "2012-09-22 11:31:25" "00006" "2020-08-30 09:43:59" "00112" "RP" "retinitis pigmentosa (RP)" "" "268000" "" "" "" "00001" "2013-02-21 17:12:36" "00006" "2021-01-18 09:53:26" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00173" "SLOS" "Smith-Lemli-Opitz syndrome (SLOS)" "AR" "270400" "" "" "" "00006" "2013-08-01 11:16:14" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "02156" "-" "retinitis pigmentosa, X-linked, and sinorespiratory infections, with/without deafness" "" "300455" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02440" "RP25" "retinitis pigmentosa, type 25 (RP25)" "AR" "602772" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04249" "macular dystrophy" "dystrophy, macular" "" "" "" "" "" "00006" "2015-05-04 22:10:58" "00006" "2024-02-15 21:18:39" "05086" "HL" "hearing loss (HL)" "" "" "" "" "" "00006" "2015-10-23 11:41:05" "00006" "2015-10-23 11:43:00" "05412" "maculopathy" "maculopathy" "" "" "" "" "" "00006" "2018-03-23 12:21:26" "" "" "05415" "USH" "Usher syndrome (USH)" "" "" "" "" "" "00006" "2018-04-02 16:40:44" "" "" "05468" "uveitis" "uveitis" "" "" "" "" "" "00006" "2018-08-22 09:47:04" "" "" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "EYS" "00112" "EYS" "02440" ## Individuals ## Do not remove or alter this header ## ## Count = 1531 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000135" "" "" "" "3" "" "00006" "{PMID:Marrakchi 2011:21848462}" "5-generation family, 3 affecteds (M)" "M" "yes" "Tunisia" "" "" "" "" "" "" "00000210" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "(Saudi Arabia)" "" "" "" "" "" "" "00001962" "" "" "" "1" "" "00025" "" "" "M" "?" "Germany" "" "" "" "" "white" "" "00016605" "" "" "" "1" "" "00552" "" "" "" "" "" "" "0" "" "" "" "" "00033096" "" "" "" "1" "" "00229" "{PMID:Neveling 2012:22334370}" "" "M" "no" "" "" "0" "" "" "" "" "00033109" "" "" "" "1" "" "00229" "{PMID:Neveling 2012:22334370}" "" "F" "no" "" "" "0" "" "" "" "" "00033132" "" "" "" "1" "" "00229" "{PMID:Neveling 2012:22334370}" "" "M" "no" "" "" "0" "" "" "" "" "00033157" "" "" "" "1" "" "00229" "{PMID:Neveling 2012:22334370}" "" "F" "no" "" "" "0" "" "" "" "" "00033349" "" "" "" "1" "" "00039" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00038358" "" "" "" "1" "" "01251" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "?" "23591405-Pat658" "00095925" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "?" "Pakistan" "" "0" "" "" "Pakistani" "61016" "00100104" "" "" "" "1" "" "01769" "{PMID:Li 2017:28418496}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "61192" "00104565" "" "" "" "1" "" "01836" "{PMID:Poirier 2017:28585349}, {DOI:Poirier 2017:10.1002/humu.23270}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "France" "" "0" "" "" "" "28585349-FamPat2" "00105016" "" "" "" "1" "" "01244" "{PMID:de Castro-Miró 2016:28005958}" "" "F" "no" "Argentina" "" "0" "" "" "" "68ORG1" "00143834" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143835" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143836" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "yes" "Spain" "" "0" "" "" "Spanish" "" "00143837" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "yes" "Spain" "" "0" "" "" "Spanish" "" "00143838" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "F" "yes" "Spain" "" "0" "" "" "Spanish" "" "00143839" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143840" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00143841" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00143842" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00143843" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00143844" "" "" "" "1" "" "01780" "{PMID:Collin 2008:18976725}" "" "M" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143845" "" "" "" "1" "" "01780" "{PMID:Collin 2008:18976725}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143846" "" "" "" "1" "" "01780" "{PMID:Collin 2008:18976725}" "" "M" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143847" "" "" "" "1" "" "01780" "{PMID:Collin 2008:18976725}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143848" "" "" "" "1" "" "01780" "{PMID:Collin 2008:18976725}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143849" "" "" "" "1" "" "01780" "{PMID:Collin 2008:18976725}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143850" "" "" "" "1" "" "01780" "{PMID:Jinda 2014:24618324}" "" "F" "no" "Thailand" "" "0" "" "" "Thai" "" "00143851" "" "" "" "1" "" "01780" "{PMID:Jinda 2014:24618324}" "" "M" "no" "Thailand" "" "0" "" "" "Thai" "" "00143852" "" "" "" "2" "" "01780" "{PMID:Kimchi 2018:29276052}, {PMID:Beryozkin 2014:24474277}" "family, 2 affected, index patient" "M" "yes" "Lithuania" "" "0" "" "" "Jewish" "MOL0788PatII3" "00143853" "" "" "00143852" "1" "" "01780" "{PMID:Beryozkin 2014:24474277}, {PMID:Kimchi 2018:29276052}" "sister of MOL0788PatII3" "F" "yes" "Lithuania" "" "0" "" "" "Jewish" "MOL0788PatII2" "00143854" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "white" "" "00143855" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "index patient" "F" "yes" "Senegal" "" "0" "" "" "Senegalese descent (Dakar)" "" "00143856" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "yes" "Senegal" "" "0" "" "" "Senegalese descent (Dakar)" "" "00143857" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "" "" "0" "" "" "Jewish-Sephardic" "" "00143858" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "yes" "Egypt" "" "0" "" "" "Egyptian" "" "00143859" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "yes" "Turkey" "" "0" "" "" "" "" "00143860" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "sibling of CIC00157" "M" "?" "Turkey" "" "0" "" "" "" "" "00143861" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "yes" "Morocco" "" "0" "" "" "Jewish" "" "00143862" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "F" "yes" "Morocco" "" "0" "" "" "Jewish" "" "00143863" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "M" "no" "Morocco" "" "0" "" "" "Jewish" "" "00143864" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "no" "Morocco" "" "0" "" "" "Jewish" "" "00143865" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "M" "yes" "Palestine" "" "0" "" "" "muslim" "" "00143866" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "yes" "Morocco" "" "0" "" "" "Jewish" "" "00143867" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "M" "no" "Iraq" "" "0" "" "" "Jewish" "" "00143868" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "M" "yes" "Morocco" "" "0" "" "" "Jewish" "" "00143869" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "M" "yes" "Morocco" "" "0" "" "" "Jewish" "" "00143870" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "yes" "Morocco" "" "0" "" "" "Jewish" "" "00143871" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "M" "no" "Canada" "" "0" "" "" "" "" "00143872" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "F" "no" "Canada" "" "0" "" "" "" "" "00143873" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "M" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143874" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "M" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143875" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "M" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143876" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00143877" "" "" "" "1" "" "01780" "{PMID:Huang 2010:20696082}" "index patient" "M" "yes" "China" "" "0" "" "" "Chinese" "" "00143878" "" "" "" "1" "" "01780" "{PMID:Huang 2010:20696082}" "sibling of II2" "F" "yes" "China" "" "0" "" "" "Chinese" "" "00143879" "" "" "" "1" "" "01780" "{PMID:Huang 2010:20696082}" "sibling of II2" "F" "yes" "China" "" "0" "" "" "Chinese" "" "00143880" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "yes" "Spain" "" "0" "" "" "Spanish" "" "00143881" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00143882" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143883" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143884" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "yes" "Spain" "" "0" "" "" "Spanish" "" "00143885" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "M" "yes" "Spain" "" "0" "" "" "Spanish" "" "00143886" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "" "F" "no" "Pakistan" "" "0" "" "" "Pakistani" "" "00143887" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00143888" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "proband" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00143889" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "" "F" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00143890" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00143891" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "" "M" "yes" "Pakistan" "" "0" "" "" "Pakistani" "" "00143892" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "proband" "M" "yes" "Indonesia" "" "0" "" "" "Indonesian" "" "00143893" "" "" "" "1" "" "01780" "{PMID:Khan 2010:21179430}" "" "M" "yes" "Indonesia" "" "0" "" "" "Indonesian" "" "00143894" "" "" "" "1" "" "01780" "{PMID:Pieras 2011:21519034}" "" "?" "?" "(Spain);(France)" "" "0" "" "" "" "" "00143895" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00143896" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "index patient" "F" "yes" "" "" "0" "" "" "Jewish" "" "00143897" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "index patient" "M" "yes" "" "" "0" "" "" "Jewish" "" "00143898" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "" "F" "yes" "" "" "0" "" "" "Jewish" "" "00143899" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "" "F" "yes" "" "" "0" "" "" "Jewish" "" "00143900" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "" "F" "yes" "" "" "0" "" "" "Jewish" "" "00143901" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "" "M" "yes" "" "" "0" "" "" "Jewish" "" "00143902" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00143903" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00143904" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00143905" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00143906" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00143907" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00143908" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "index patient" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00143909" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "Sibling of RP3H, II-6" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00143910" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00143911" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "M" "no" "Japan" "" "0" "" "" "Hamamatsu, Japanese" "" "00143912" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "M" "no" "Japan" "" "0" "" "" "Toyooka, Japanese" "" "00143913" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "M" "no" "Japan" "" "0" "" "" "Himeji, Japanese" "" "00143914" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "F" "no" "Japan" "" "0" "" "" "Japanese, Aichi" "" "00143915" "" "" "" "1" "" "01780" "{PMID:Katagiri 2014:25268133}" "index patient" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00143916" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143917" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143918" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143919" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143920" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143921" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143922" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143923" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143924" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00143925" "" "" "" "1" "" "01780" "{PMID:Pierrottet 2014:25366773}" "" "M" "?" "Italy" "" "0" "" "" "north" "" "00143926" "" "" "" "3" "" "01780" "{PMID:Kastner 2015:26720455}" "5-generation family, 3 affected (F, 2M), unaffected heterozygous carrier parents/relatives" "F" "yes" "Turkey" "" "0" "" "" "Turkish" "" "00143927" "" "" "00143926" "1" "" "01780" "{PMID:Kastner 2015:26720455}" "index patient" "M" "yes" "Turkey" "" "0" "" "" "Turkish" "" "00143928" "" "" "00143926" "1" "" "01780" "{PMID:Kastner 2015:26720455}" "index patient" "M" "yes" "Turkey" "" "0" "" "" "Turkish" "" "00143929" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "proband" "M" "yes" "India" "" "0" "" "" "Indian" "" "00143930" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "sibling of ARRP-206 IV-1" "M" "yes" "India" "" "0" "" "" "Indian" "" "00143931" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "M" "?" "India" "" "0" "" "" "Indian" "" "00143932" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "M" "?" "India" "" "0" "" "" "Indian" "" "00143933" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "M" "?" "India" "" "0" "" "" "Indian" "" "00143934" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "F" "?" "India" "" "0" "" "" "Indian" "" "00143935" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "M" "?" "India" "" "0" "" "" "Indian" "" "00143936" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "F" "?" "India" "" "0" "" "" "Indian" "" "00143937" "" "" "" "1" "" "01780" "{PMID:Gu 2016:27375351}" "proband" "F" "no" "China" "" "0" "" "" "Chinese" "" "00143938" "" "" "" "1" "" "01780" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00143939" "" "" "" "1" "" "01780" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00143940" "" "" "" "1" "" "01780" "{PMID:Abu-Safieh 2013:23105016}" "" "" "" "" "" "0" "" "" "" "" "00143941" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00143942" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00143943" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00143944" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00143947" "" "" "" "2" "" "01780" "{PMID:Habibi 2016:27874104}" "5-generation family, affected brother/sister" "M" "yes" "Tunisia" "" "0" "" "" "Tunisian" "Fam9PatIV-II" "00143948" "" "" "00143947" "1" "" "01780" "{PMID:Habibi 2016:27874104}" "sister F9IV-II" "F" "yes" "Tunisia" "" "0" "" "" "Tunisian" "Fam9PatIV-III" "00143949" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143950" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143951" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143952" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143953" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143954" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143955" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143956" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143957" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143958" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143959" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143960" "" "" "" "1" "" "01780" "{PMID:Hashmi 2017:28419563}" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00143961" "" "" "" "1" "" "01780" "{PMID:Eisenberger 2014:24265693}" "" "F" "yes" "Syria" "" "0" "" "" "" "" "00143962" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "yes" "China" "" "0" "" "" "Chinese" "" "00143963" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "yes" "China" "" "0" "" "" "Chinese" "" "00143964" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00143965" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "yes" "Netherlands" "" "0" "" "" "Dutch" "" "00143966" "" "" "" "1" "" "01780" "{PMID:Xu 2014:24938718}" "" "M" "yes" "China" "" "0" "" "" "Chinese" "" "00143967" "" "" "" "1" "" "01780" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-323-766" "00143968" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "index patient" "F" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143969" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "sister of 1" "F" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143970" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143971" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143972" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143973" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143974" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143975" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00143976" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143977" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00143978" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2008:18836446}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00143979" "" "" "" "1" "" "01780" "{PMID:Jinda 2014:24618324}" "" "F" "no" "Thailand" "" "0" "" "" "Thai" "" "00143980" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "proband" "F" "no" "China" "" "0" "" "" "Chinese" "" "00143981" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00143982" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00143983" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "F" "?" "China" "" "0" "" "" "Chinese" "" "00143984" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "white" "" "00143985" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "Asian" "" "00143986" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "white" "" "00143987" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "white" "" "00143988" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "white" "" "00143989" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "Asian" "" "00143990" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "white" "" "00143991" "" "" "" "1" "" "01780" "{PMID:Abd El-Aziz 2010:20237254}" "" "?" "?" "" "" "0" "" "" "Asian" "" "00143992" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "Adopted" "F" "?" "" "" "0" "" "" "?" "" "00143993" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "Greece" "" "0" "" "" "Greek" "" "00143994" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "" "" "0" "" "" "white, French-Italian-German descent" "" "00143995" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "yes" "Mali" "" "0" "" "" "Soninke" "" "00143996" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "France" "" "0" "" "" "French descent" "" "00143997" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "index patient" "M" "no" "France" "" "0" "" "" "French descent" "" "00143998" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "sibling of CIC00951 (II-3)" "M" "no" "France" "" "0" "" "" "French descent" "" "00143999" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "France" "" "0" "" "" "French" "" "00144000" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "sibling of CIC01001" "F" "?" "France" "" "0" "" "" "French" "" "00144001" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "index patient" "M" "no" "France" "" "0" "" "" "French" "" "00144002" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "sibling of CIC01265 (II-1)" "F" "no" "France" "" "0" "" "" "French" "" "00144003" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "Adopted" "M" "?" "" "" "0" "" "" "" "" "00144004" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "France" "" "0" "" "" "" "" "00144005" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "" "" "0" "" "" "Africa, north" "" "00144006" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "Algeria" "" "0" "" "" "" "" "00144007" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "France" "" "0" "" "" "French West Indies, Guadeloupe" "" "00144008" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "France" "" "0" "" "" "" "" "00144009" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "France" "" "0" "" "" "" "" "00144010" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "France" "" "0" "" "" "" "" "00144011" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "France" "" "0" "" "" "" "" "00144012" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "Cote D\'Ivoire (Ivory Coast)" "" "0" "" "" "" "" "00144013" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "Belgium" "" "0" "" "" "Flemish" "" "00144014" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "" "" "0" "" "" "Africa, north" "" "00144015" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "Morocco" "" "0" "" "" "" "" "00144016" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "France" "" "0" "" "" "" "" "00144017" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "M" "?" "France" "" "0" "" "" "" "" "00144018" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "France;Italy" "" "0" "" "" "" "" "00144019" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "F" "?" "" "" "0" "" "" "Africa, north" "" "00144020" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144021" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144022" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144023" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144024" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144025" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144026" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144027" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144028" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144029" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144030" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144031" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144032" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144033" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144034" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144035" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144036" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144037" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144038" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144039" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144040" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144041" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144042" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144043" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144044" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144045" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144046" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144047" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144048" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144049" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144050" "" "" "" "1" "" "01780" "{PMID:Audo 2010:20333770}" "" "?" "?" "" "" "0" "" "" "" "" "00144051" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "no" "Morocco" "" "0" "" "" "Jewish" "" "00144052" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "no" "Morocco;Iraq" "" "0" "" "" "Jewish" "" "00144053" "" "" "" "1" "" "01780" "{PMID:Bandah-Rozenfeld 2010:20375346}" "index patient" "F" "no" "Iraq" "" "0" "" "" "Jewish" "" "00144054" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "M" "no" "Canada" "" "0" "" "" "" "" "00144055" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "M" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144056" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144057" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144058" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144059" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "index patient" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144060" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "F" "no" "Korea, South (Republic);United States" "" "0" "" "" "" "" "00144061" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "M" "no" "" "" "0" "" "" "Curaçao" "" "00144062" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "F" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144063" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144064" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144065" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144066" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144067" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "United States" "" "0" "" "" "" "" "00144068" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144069" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144070" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144071" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144072" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144073" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144074" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144075" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144076" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144077" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144078" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144079" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144080" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144081" "" "" "" "1" "" "01780" "{PMID:Littink 2010:20537394}" "" "?" "?" "Netherlands" "" "0" "" "" "Dutch" "" "00144082" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144083" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144084" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144085" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00144086" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144087" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00144088" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144089" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "M" "no" "Spain" "" "0" "" "" "Spanish" "" "00144090" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144091" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144092" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144093" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "F" "no" "Spain" "" "0" "" "" "Spanish" "" "00144094" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144095" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144096" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144097" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144098" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144099" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144100" "" "" "" "1" "" "01780" "{PMID:Barragán 2010:21069908}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144101" "" "" "" "1" "" "01780" "{PMID:Pieras 2011:21519034}" "" "?" "?" "(Spain);(France)" "" "0" "" "" "" "" "00144102" "" "" "" "1" "" "01780" "{PMID:Pieras 2011:21519034}" "" "?" "?" "(Spain);(France)" "" "0" "" "" "" "" "00144103" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}, {PMID:Bravo-Gil 2016:27032803}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "234" "00144104" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144105" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144106" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144107" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144108" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144109" "" "" "" "1" "" "01780" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "?" "?" "Spain" "" "0" "" "" "Spanish" "" "00144110" "" "" "" "1" "" "01780" "{PMID:Audo 2012:22277662}" "Affected sister not this variant" "" "yes" "" "" "0" "" "" "" "" "00144111" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144112" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144113" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144114" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144115" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144116" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144117" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144118" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144119" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144120" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144121" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144122" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144123" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144124" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144125" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144126" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144127" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144128" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "M" "?" "Japan" "" "0" "" "" "Japanese" "" "00144129" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144130" "" "" "" "1" "" "01780" "{PMID:Iwanami 2012:22302105}" "" "F" "?" "Japan" "" "0" "" "" "Japanese" "" "00144131" "" "" "" "1" "" "01780" "" "index patient" "M" "no" "Japan" "" "0" "" "" "Tokyo, Japanese" "" "00144132" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00144133" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "index patient, onset childhood" "F" "no" "Japan" "" "0" "" "" "Higashi-Osaka, Japanese" "" "00144134" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "F" "no" "Japan" "" "0" "" "" "Tokyo, Japanese" "" "00144135" "" "" "" "1" "" "01780" "{PMID:Suto 2014:23421333}" "" "M" "no" "Japan" "" "0" "" "" "Nagoya, Japanese" "" "00144136" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144137" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144138" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144139" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144140" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144141" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144142" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144143" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144144" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144145" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144146" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144147" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144148" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144149" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144150" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144151" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144152" "" "" "" "1" "" "01780" "{PMID:Hosono 2012:22363543}" "" "" "?" "Japan" "" "0" "" "" "Japanese" "" "00144153" "" "" "" "2" "" "01780" "{PMID:Nishiguchi 2013:24043777}" "2-generation family, 2 affected sisters, unaffected heterozygous carrier parents, index patient" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00144154" "" "" "00144153" "1" "" "01780" "{PMID:Nishiguchi 2013:24043777}" "" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00144155" "" "" "" "1" "" "01780" "{PMID:Katagiri 2014:24652164}" "" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00144156" "" "" "" "1" "" "01780" "{PMID:Katagiri 2014:25268133}" "index patient" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00144157" "" "" "" "1" "" "01780" "{PMID:Katagiri 2014:25268133}" "index patient" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00144158" "" "" "" "1" "" "01780" "{PMID:Katagiri 2014:25268133}" "index patient" "M" "no" "Japan" "" "0" "" "" "Japanese" "" "00144159" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144160" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144161" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144162" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144163" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144164" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144165" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144166" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144167" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144168" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144169" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144170" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144171" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144172" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144173" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144174" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144175" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "same family as K6003" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144176" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "same family as K6001" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144177" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144178" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144179" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144180" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144181" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144182" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144183" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144184" "" "" "" "1" "" "01780" "{PMID:Oishi 2014:25324289}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144185" "" "" "" "1" "" "01780" "{PMID:Pierrottet 2014:25366773}" "" "F" "?" "Italy" "" "0" "" "" "north" "" "00144186" "" "" "" "1" "" "01780" "{PMID:Pierrottet 2014:25366773}" "" "F" "?" "Italy" "" "0" "" "" "north" "" "00144187" "" "" "" "1" "" "01780" "{PMID:Bonilha 2015:25491159}" "" "F" "no" "Ireland;France" "" "0" "" "" "" "" "00144188" "" "" "" "1" "" "01780" "{PMID:Bonilha 2015:25491159}" "" "M" "no" "Ireland;France" "" "0" "" "" "" "" "00144189" "" "" "" "1" "" "01780" "{PMID:Bonilha 2015:25491159}" "" "F" "no" "Ireland;France" "" "0" "" "" "" "" "00144190" "" "" "" "1" "" "01780" "{PMID:Bonilha 2015:25491159}" "" "F" "no" "" "" "0" "" "" "Scandinavian" "" "00144191" "" "" "" "1" "" "01780" "{PMID:Bonilha 2015:25491159}" "sister of donor 2, family 2, II-1, FFB #937" "F" "no" "" "" "0" "" "" "Scandinavian" "" "00144192" "" "" "" "1" "" "01780" "{PMID:Chen 2015:25753737}" "proband" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144193" "" "" "" "1" "" "01780" "{PMID:Chen 2015:25753737}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144194" "" "" "" "1" "" "01780" "{PMID:Chen 2015:25753737}" "proband" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144195" "" "" "" "1" "" "01780" "{PMID:Chen 2015:25753737}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144196" "" "" "" "1" "" "01780" "{PMID:Chen 2015:25753737}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00144197" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144198" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144199" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144200" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144201" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144202" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144203" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144204" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144205" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144206" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144207" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144208" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144209" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "proband" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00144210" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "sibling II-2" "F" "no" "Japan" "" "0" "" "" "Japanese" "" "00144211" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144212" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144213" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144214" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144215" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144216" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144217" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144218" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144219" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144220" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144221" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144222" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144223" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144224" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144225" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144226" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144227" "" "" "" "1" "" "01780" "{PMID:Arai 2015:26161267}" "" "?" "?" "Japan" "" "0" "" "" "Japanese" "" "00144228" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "sibling of ARRP-49 II-5" "M" "yes" "India" "" "0" "" "" "Indian" "" "00144229" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "proband" "M" "yes" "India" "" "0" "" "" "Indian" "" "00144230" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "sibling of ARRP-49 II-5" "F" "yes" "India" "" "0" "" "" "Indian" "" "00144231" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "M" "?" "India" "" "0" "" "" "Indian" "" "00144232" "" "" "" "1" "" "01780" "{PMID:Di 2016:26787102}" "" "M" "?" "India" "" "0" "" "" "Indian" "" "00144233" "" "" "" "1" "" "01780" "{PMID:Perez-Carro 2016:26806561}" "" "?" "?" "Spain" "" "0" "" "" "" "" "00144234" "" "" "" "1" "" "01780" "{PMID:Perez-Carro 2016:26806561}" "" "?" "?" "Spain" "" "0" "" "" "" "" "00144235" "" "" "" "1" "" "01780" "{PMID:Perez-Carro 2016:26806561}" "" "?" "?" "Spain" "" "0" "" "" "" "" "00144236" "" "" "" "1" "" "01780" "{PMID:Gu 2016:27375351}" "proband" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144237" "" "" "" "1" "" "01780" "{PMID:Gu 2016:27375351}" "proband" "F" "no" "China" "" "0" "" "" "Chinese" "" "00144238" "" "" "" "1" "" "01780" "{PMID:Gu 2016:27375351}" "proband" "F" "no" "China" "" "0" "" "" "Chinese" "" "00144239" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "index patient" "?" "?" "" "" "0" "" "" "white" "" "00144240" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "brother of 1066" "M" "?" "" "" "0" "" "" "white" "" "00144241" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00144242" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00144243" "" "" "" "1" "" "01780" "{PMID:Glöckle 2014:23591405}" "" "?" "?" "" "" "0" "" "" "white" "" "00144244" "" "" "" "1" "" "01780" "{PMID:O\'Sullivan 2012:22581970 }" "" "?" "?" "" "" "0" "" "" "" "" "00144245" "" "" "" "1" "" "01780" "{PMID:O\'Sullivan 2012:22581970 }" "" "?" "?" "" "" "0" "" "" "" "" "00144248" "" "" "" "1" "" "01780" "{PMID:Gao 2017:28251098}" "" "M" "?" "China" "" "0" "" "" "Chinese" "" "00144249" "" "" "" "1" "" "01780" "{PMID:Eisenberger 2014:24265693}" "" "M" "no" "Austria" "" "0" "" "" "" "" "00144250" "" "" "" "1" "" "01780" "{PMID:Eisenberger 2014:24265693}" "" "F" "no" "Germany" "" "0" "" "" "" "" "00144251" "" "" "" "1" "" "01780" "{PMID:Eisenberger 2014:24265693}" "inheritance familial, autosomal recessive/X-linked" "M" "no" "Germany" "" "0" "" "" "" "" "00144252" "" "" "" "1" "" "01780" "{PMID:Eisenberger 2014:24265693}" "index patient" "M" "no" "Germany" "" "0" "" "" "" "" "00144253" "" "" "" "1" "" "01780" "{PMID:Eisenberger 2014:24265693}" "sibling of patient 93" "F" "no" "Germany" "" "0" "" "" "" "" "00144254" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144255" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00144256" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "F" "yes" "China" "" "0" "" "" "Chinese" "" "00144257" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144258" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144259" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144260" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00144261" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144262" "" "" "" "1" "" "01780" "{PMID:Huang 2015:25356976}" "" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144263" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144264" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144265" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144266" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144267" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144268" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144269" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144270" "" "" "" "1" "" "01780" "{PMID:Haer-Wigman 2017:28224992}" "" "?" "no" "Netherlands" "" "0" "" "" "Dutch" "" "00144271" "" "" "" "1" "" "01780" "{PMID:Xu 2014:24938718}" "onset early childhood" "M" "no" "China" "" "0" "" "" "Chinese" "" "00144272" "" "" "" "1" "" "01780" "{PMID:Xu 2014:24938718}" "" "F" "no" "China" "" "0" "" "" "Chinese" "" "00144273" "" "" "" "1" "" "01780" "{PMID:Consugar 2015:25412400}" "" "" "" "United States" "" "0" "" "" "" "OGI-555-1134" "00144274" "" "" "" "1" "" "01780" "{PMID:Ge 2015:26667666}" "2-generation family, 2 affected sisters, unaffected parents" "F" "" "United States" "" "0" "" "" "?" " VGM+V.35" "00144275" "" "" "" "1" "" "01780" "{PMID:Ge 2015:26667666}" "" "?" "" "United States" "" "0" "" "" "" "U6H+2.34" "00144276" "" "" "" "1" "" "01780" "{PMID:Ge 2015:26667666}" "" "?" "" "United States" "" "0" "" "" "?" "TW+H.97" "00144277" "" "" "" "1" "" "01780" "{PMID:Ge 2015:26667666}" "" "?" "" "United States" "" "0" "" "" "?" "3U6+9.42" "00144278" "" "" "" "1" "" "01780" "{PMID:Ge 2015:26667666}" "" "?" "" "United States" "" "0" "" "" "?" "VNM+T.47" "00144279" "" "" "" "1" "" "01780" "{PMID:Yoon 2015:26155838}" "sporadic case" "?" "" "Korea" "" "0" "" "" "Korean" "439" "00144280" "" "" "" "1" "" "01780" "{PMID:Yoon 2015:26155838}" "sporadic case" "?" "" "Korea" "" "0" "" "" "Korean" "440" "00144281" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "M" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144282" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144283" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144284" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "index patient" "M" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144285" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "sister of 8" "F" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144286" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144287" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144288" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144289" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144290" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144291" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144292" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144293" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144294" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144295" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144296" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144297" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144298" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144299" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144300" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Indonesia" "" "0" "" "" "Indonesian" "" "00144301" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144302" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144303" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144304" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144305" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144306" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144307" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144308" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144309" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "index patient" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144310" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "relative of 35" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144311" "" "" "" "1" "" "01780" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "?" "" "Netherlands" "" "0" "" "" "Dutch" "" "00144313" "" "" "" "1" "" "00006" "{PMID:Glöckle 2014:23591405}" "" "" "" "Germany" "" "0" "" "" "" "23591405-Pat1289" "00155316" "" "" "" "2" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "African-N;Jewish" "" "00155460" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "" "00155461" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Jewish" "" "00155462" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "no" "Israel" "" "0" "" "" "Jewish-Oriental" "" "00155463" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "yes" "Israel" "" "0" "" "" "African-N;Jewish" "" "00155464" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155465" "" "" "" "2" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155466" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Arab-Muslim" "" "00155467" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "no" "Israel" "" "0" "" "" "Ethiopia;Jewish" "" "00155468" "" "" "" "1" "" "01243" "Sharon, submitted" "" "M" "no" "Israel" "" "0" "" "" "Turkey;Jewish" "" "00155469" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "no" "Israel" "" "0" "" "" "Jewish" "" "00155470" "" "" "" "1" "" "01243" "Sharon, submitted" "" "F" "yes" "Israel" "" "0" "" "" "Morocco;Jewish" "" "00173838" "" "" "" "1" "" "02449" "{PMID:Wang 2014b:25097241}" "" "M" "" "United States" "" "0" "" "" "" "20" "00173872" "" "" "" "1" "" "02449" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP191" "00180416" "" "" "" "1" "" "02555" "{PMID:Brown 2015:25200001}" "European cohort" "F;M" "" "(United Kingdom (Great Britain))" "" "0" "{DB:Uveo3522?snp=rs665873&t=1535717138}" "" "European" "" "00207593" "" "" "" "2" "" "01244" "" "" "F" "" "" "" "0" "" "" "" "" "00232716" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232717" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232718" "" "" "" "6" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232719" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232720" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232721" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232722" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232723" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232724" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232725" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232726" "" "" "" "64" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232727" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232728" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232729" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232730" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232731" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232732" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232733" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232734" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232735" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232736" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232737" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232738" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232739" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232740" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232741" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232742" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232743" "" "" "" "8" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232744" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232745" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232746" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232747" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1196 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232748" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232749" "" "" "" "450" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1201 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232750" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232751" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232752" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232753" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232754" "" "" "" "104" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232755" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232756" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232757" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232758" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232759" "" "" "" "500" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232760" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232761" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232762" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232763" "" "" "" "20" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1198 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232764" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1198 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232765" "" "" "" "35" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1198 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232766" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232767" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232768" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232769" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232770" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1197 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232771" "" "" "" "538" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232772" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232773" "" "" "" "118" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232774" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232775" "" "" "" "145" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232776" "" "" "" "7" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232777" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232778" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232779" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232780" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232781" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232782" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232783" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232784" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232785" "" "" "" "467" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232786" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232787" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232788" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232789" "" "" "" "22" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232790" "" "" "" "352" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232791" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232792" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232793" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232794" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232795" "" "" "" "13" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232796" "" "" "" "537" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232797" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232798" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232799" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232800" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232801" "" "" "" "573" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232802" "" "" "" "148" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232803" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232804" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232805" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232806" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232807" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232808" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1180 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232809" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232810" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232811" "" "" "" "71" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232812" "" "" "" "175" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232813" "" "" "" "179" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232814" "" "" "" "13" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232815" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232816" "" "" "" "206" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232817" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232818" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232819" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232820" "" "" "" "98" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232821" "" "" "" "548" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232822" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232823" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232824" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232825" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232826" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232827" "" "" "" "22" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232828" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232829" "" "" "" "6" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232830" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232831" "" "" "" "4" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232832" "" "" "" "25" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232833" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232834" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232835" "" "" "" "475" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232836" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232837" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232838" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232839" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232840" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00232841" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233691" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233692" "" "" "" "9" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233693" "" "" "" "143" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1201 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233694" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233695" "" "" "" "316" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233696" "" "" "" "2" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1198 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233697" "" "" "" "237" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233698" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233699" "" "" "" "5" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233700" "" "" "" "29" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233701" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233702" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233703" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233704" "" "" "" "630" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233705" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233706" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233707" "" "" "" "65" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233708" "" "" "" "148" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233709" "" "" "" "279" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233710" "" "" "" "19" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233711" "" "" "" "3" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233712" "" "" "" "6" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233713" "" "" "" "1017" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233714" "" "" "" "22" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233715" "" "" "" "7" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233716" "" "" "" "378" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1202 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233717" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233718" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233719" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233720" "" "" "" "1" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1203 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00233721" "" "" "" "121" "" "02591" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "analysis 1204 retinitis pigmentosa cases" "" "" "Japan" "" "0" "" "" "" "" "00244508" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00294168" "" "" "" "237" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294169" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294170" "" "" "" "10" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294171" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294172" "" "" "" "7" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295602" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00296002" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00301666" "" "" "" "1" "" "01807" "" "" "F" "" "(Germany)" "" "0" "" "" "" "" "00305112" "" "" "" "7" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00308406" "" "" "" "1" "" "00004" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "3-generation family, 1 affected, unaffected non-carrier parents" "F" "" "France" "" "0" "" "" "" "CIC03953" "00308507" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308508" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308509" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308510" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308511" "" "" "" "1" "" "00004" "{PMID:Holtan 2020:31429209}" "1 patient with variant in heterozygous or compound heterozygous form" "" "" "Norway" "" "0" "" "" "" "" "00308636" "" "" "" "3" "" "00004" "{PMID:Holtan 2020:31429209}" "3 homozygous patients" "" "" "Norway" "" "0" "" "" "" "" "00308643" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" "" "00308644" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" "" "00308645" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" "" "00308646" "" "" "" "1" "" "00004" "{PMID:Kim 2019:31144483}" "" "" "" "Korea" "" "0" "" "" "" "" "00309136" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309137" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309138" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309139" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309140" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309141" "" "" "" "4" "" "00004" "{PMID:Sharon 2019:31456290}" "4 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309142" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309143" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309144" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309145" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309146" "" "" "" "6" "" "00004" "{PMID:Sharon 2019:31456290}" "6 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309147" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309148" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309149" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309150" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309151" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309152" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309153" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309154" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309155" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309156" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309157" "" "" "" "3" "" "00004" "{PMID:Sharon 2019:31456290}" "3 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309158" "" "" "" "2" "" "00004" "{PMID:Sharon 2019:31456290}" "2 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309159" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309160" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309161" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309162" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309163" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309164" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" "" "00309165" "" "" "" "18" "" "00004" "{PMID:Sharon 2019:31456290}" "18 IRD families" "" "" "Israel" "" "0" "" "" "" "" "00309725" "" "" "" "1" "" "00006" "{PMID:Kimchi 2018:29276052}" "" "" "" "Israel" "" "0" "" "" "Jewish-Ashkenazi" "CHRD5249" "00309755" "" "" "" "1" "" "00006" "{PMID:Kimchi 2018:29276052}" "" "" "" "" "" "0" "" "" "Jewish-Ashkenazi " "MOL0333" "00309756" "" "" "" "1" "" "00006" "{PMID:Kimchi 2018:29276052}" "" "" "" "" "" "0" "" "" "Jewish-Ashkenazi " "MOL0605" "00309757" "" "" "" "1" "" "00006" "{PMID:Kimchi 2018:29276052}" "" "" "" "" "" "0" "" "" "Jewish-Ashkenazi " "MOL1189" "00325464" "" "" "" "1" "" "00006" "{PMID:Zenteno 2020:31736247}" "family" "" "" "Mexico" "" "0" "" "" "" "3349" "00327933" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240056" "00327954" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "B240219" "00328010" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G001048" "00328061" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G002641" "00328087" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "G005008" "00328159" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G006019" "00328167" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia-South" "G006302" "00328218" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Africa" "G007742" "00328229" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G008145" "00328266" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "G009847" "00328293" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}, {PMID:Turro 2020:32581362}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000164" "00328315" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000239" "00328323" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000316" "00328324" "" "" "" "1" "" "00000" "{PMID:Carss 2017:28041643}, {PMID:Turro 2020:32581362}" "" "F" "" "United Kingdom (Great Britain)" "" "0" "" "" "Europe" "W000325" "00331247" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "M" "" "Japan" "" "0" "" "" "" "Pat1" "00331248" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "F" "" "Japan" "" "0" "" "" "" "Pat2" "00331249" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "M" "" "Japan" "" "0" "" "" "" "Pat3" "00331250" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "M" "" "Japan" "" "0" "" "" "" "Pat4" "00331251" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "M" "" "Japan" "" "0" "" "" "" "Pat5" "00331252" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "F" "" "Japan" "" "0" "" "" "" "Pat6" "00331253" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "family" "F" "" "Japan" "" "0" "" "" "" "Pat7" "00331254" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat8" "00331255" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat9" "00331256" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat10" "00331257" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat11" "00331258" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat12" "00331259" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat13" "00331260" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "F" "" "Japan" "" "0" "" "" "" "Pat14" "00331261" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "F" "" "Japan" "" "0" "" "" "" "Pat15" "00331262" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat16" "00331263" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "F" "" "Japan" "" "0" "" "" "" "Pat17" "00331264" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat18" "00331265" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "M" "" "Japan" "" "0" "" "" "" "Pat19" "00331266" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "F" "" "Japan" "" "0" "" "" "" "Pat20" "00331267" "" "" "" "1" "" "00000" "{PMID:Maeda 2018:29785639}" "patient, no family history" "F" "" "Japan" "" "0" "" "" "" "Pat21" "00331703" "" "" "" "1" "" "00000" "{PMID:Sun 2018:29625443}" "sporadic case" "" "no" "China" "" "0" "" "" "" "19415" "00332488" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat13" "00332489" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat14" "00332490" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat15" "00332507" "" "" "" "1" "" "00000" "{PMID:Avela 2018:29068140}" "" "" "" "Finland" "" "0" "" "" "" "Pat32" "00333399" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD4–06" "00333400" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD6–07" "00333401" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD12–05" "00333402" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD15–04" "00333423" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD4–05" "00333424" "" "" "" "1" "" "00000" "{PMID:Wang 2017:28838317}" "" "" "" "United States" "" "0" "" "" "" "RD11–02" "00333824" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "20" "00333825" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "21" "00333826" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "F" "" "(United States)" "" "0" "" "" "" "22" "00333827" "" "" "" "1" "" "00000" "{PMID:Stone 2017:28559085}" "1 affected" "M" "" "(United States)" "" "0" "" "" "" "23" "00333890" "" "" "" "3" "" "00000" "{PMID:Stone 2017:28559085}" "family, 3 affected" "M" "" "(United States)" "" "0" "" "" "" "196" "00333901" "" "" "" "2" "" "00000" "{PMID:Stone 2017:28559085}" "family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "268" "00334416" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "patient" "" "" "China" "" "0" "" "" "" "RP-084" "00334417" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28512305}" "family" "" "" "China" "" "0" "" "" "" "RP-097" "00334558" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP011" "00334560" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP019" "00334563" "" "" "" "1" "" "00000" "{PMID:Jinda 2017:28453600}" "patient" "" "" "Thailand" "" "0" "" "" "" "RP027" "00335231" "" "" "" "1" "" "00000" "{PMID:Riera 2017:28181551}" "patient" "" "" "Spain" "" "0" "" "" "" "Fi15/27" "00335245" "" "" "" "1" "" "00000" "{PMID:Riera 2017:28181551}" "patient" "" "" "Spain" "" "0" "" "" "" "Fi15/16" "00335274" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "patient" "" "" "Spain" "" "0" "" "" "" "Pat56" "00335336" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Spain" "" "0" "" "" "" "Pat57" "00335337" "" "" "" "1" "" "02485" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Spain" "" "0" "" "" "" "Pat19" "00335416" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP015" "00335420" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP026" "00335424" "" "" "" "1" "" "00000" "{PMID:Huang 2018:29641573}" "" "" "" "" "" "0" "" "" "" "RP036" "00335973" "" "" "" "1" "" "00000" "{PMID:Sergouniotis 2016:27628848}" "analysis 486 cases" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00358979" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71808" "00359131" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12002958" "00359149" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13004716" "00359160" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13007240" "00359162" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13002044" "00359164" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12002963" "00359185" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "13004487" "00359207" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "13013377" "00359329" "" "" "" "1" "" "00000" "{PMID:Khan 2017:27160483}" "see paper" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "32452" "00361426" "" "" "" "1" "" "04036" "{PMID:Xu 2014:24938718}" "index case" "M" "no" "China" "" "0" "" "" "Asia" "RP405" "00362210" "" "" "" "1" "" "04043" "Fadaie 2021, submitted" "" "" "no" "Israel" "" "0" "" "" "" "?" "00362212" "" "" "" "2" "" "04043" "{PMID:Fadaie 2021:34795310}" "family, 2 affected" "M" "" "Israel" "" "0" "" "" "" "Pat10" "00362216" "" "" "" "1" "" "04043" "{PMID:Fadaie 2021:34795310}" "" "M" "" "Israel" "" "0" "" "" "" "Pat11" "00362218" "" "" "" "1" "" "04043" "Fadaie 2021, submitted" "" "" "no" "Israel" "" "0" "" "" "" "?" "00362234" "" "" "" "1" "" "04043" "Fadaie 2021, submitted" "" "" "no" "Netherlands" "" "0" "" "" "" "?" "00362240" "" "" "" "2" "" "04043" "{PMID:Fadaie 2021:34795310}" "family, 2 affected" "F" "" "Netherlands" "" "0" "" "" "" "Pat9" "00362243" "" "" "" "1" "" "04043" "{PMID:Fadaie 2021:34795310}" "" "M" "" "Netherlands" "" "0" "" "" "" "Pat12" "00362906" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ARRP28" "00362907" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "ARRP50" "00363635" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "10DG1649" "00372628" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "F" "" "China" "" "0" "" "" "" "RP373" "00372638" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP305" "00372645" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP289" "00372646" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP339" "00372653" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "F" "" "China" "" "0" "" "" "" "RP385" "00372655" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP296" "00372667" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP022" "00372677" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "patient" "M" "" "China" "" "0" "" "" "" "RP236" "00372681" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP292" "00372683" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP396" "00372687" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "family" "M" "" "China" "" "0" "" "" "" "RP288" "00372688" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP065" "00372690" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP190" "00372693" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP290" "00372697" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP341" "00372699" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP374" "00372700" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP380" "00372701" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP391" "00372719" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP276" "00372722" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP285" "00372732" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP069" "00372733" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP092" "00372736" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP224" "00372741" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP271" "00372745" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP306" "00372750" "" "" "" "1" "" "00000" "{PMID:Xu 2014:24938718}" "" "" "" "China" "" "0" "" "" "" "RP378" "00372757" "" "" "" "1" "" "01164" "" "" "" "" "" "" "0" "" "" "" "175713" "00373365" "" "" "" "1" "" "00000" "{PMID:Van Huet 2015:25999674}" "" "" "" "Netherlands" "" "0" "" "" "" "" "00373368" "" "" "" "1" "" "00000" "{PMID:Van Huet 2015:25999674}" "" "" "" "Netherlands" "" "0" "" "" "" "" "00373820" "" "" "" "1" "" "00000" "{PMID:Méndez-Vidal 2014:25494902}" "" "" "" "Spain" "" "0" "" "" "" "Pat17" "00375411" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#002" "00375416" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#008" "00375426" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#020" "00375428" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#022" "00375429" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#023" "00375430" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#024" "00375435" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#030" "00376288" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376289" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376313" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "at least carrier of mutation" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376314" "" "" "" "1" "" "00000" "{PMID:Avela 2019:18487375}" "at least carrier of mutation" "" "" "Finland" "" "0" "" "" "Finnish" "" "00376751" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "11" "00376752" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "12" "00376753" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "13" "00376754" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "14" "00376755" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "15" "00376758" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "18" "00376760" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "22" "00376763" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "25" "00376765" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "27" "00376770" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "34" "00376777" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "42" "00376778" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "44" "00376782" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "48" "00376783" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "49" "00376784" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "M" "" "United States" "" "0" "" "" "" "50" "00376789" "" "" "" "1" "" "00000" "{PMID:Wang 2014:25097241}" "" "F" "" "United States" "" "0" "" "" "" "56" "00376866" "" "" "" "1" "" "00000" "{PMID:Coppieters 2014:24625443}" "see paper" "" "" "" "" "0" "" "" "" "Fam15" "00377242" "" "" "" "1" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "354" "00377256" "" "" "" "2" "" "00000" "Tracewska 2021, MolVis in press" "proband" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "371" "00377257" "" "" "00377256" "1" "" "00000" "Tracewska 2021, MolVis in press" "brother" "M" "no" "Poland" "" "0" "yes" "" "Slavic" "878" "00377502" "" "" "" "1" "" "00000" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Spain" "" "0" "" "" "" "RP-1217" "00377526" "" "" "" "1" "" "00000" "{PMID:Hosono 2018:29844330}" "proband, family EYE103" "M" "no" "Japan" "" "0" "" "" "Asian" "EYE103" "00377935" "" "" "" "1" "" "00000" "{PMID: Siemiatkowska 2011:22128245}" "" "M" "yes" "Indonesia" "" "0" "" "" "Indonesian" "" "00377936" "" "" "" "1" "" "00000" "{PMID: Siemiatkowska 2011:22128245}" "" "M" "yes" "Indonesia" "" "0" "" "" "Indonesian" "" "00377945" "" "" "" "1" "" "00000" "{PMID:_Audo-2012:22277662}" "" "" "yes" "" "" "0" "" "" "Jewish" "" "00377946" "" "" "" "1" "" "00000" "{PMID:_Audo-2012:22277662}" "" "" "yes" "" "" "0" "" "" "Jewish" "" "00377957" "" "" "" "1" "" "00000" "{PMID:_Audo-2012:22277662}" "affected sister also both variants but both come from father, no other variant in lower covered region." "" "" "" "" "0" "" "" "" "" "00378015" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0005" "00378021" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0009" "00378031" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0017" "00378049" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0022" "00378051" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0025" "00378052" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0029" "00378065" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0046" "00378067" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0050" "00378070" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0055" "00379376" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00379377" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00379378" "" "" "" "1" "" "00000" "{PMID:Collin-2011:21217109}" "" "M" "" "Netherlands" "" "0" "" "" "" "" "00379534" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0056" "00379537" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_SH_0060" "00379545" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0003" "00379547" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0006" "00379559" "" "" "" "1" "" "00000" "{PMID:O\'Sullivan-2012:22581970}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00379573" "" "" "" "1" "" "00000" "{PMID:O\'Sullivan-2012:22581970}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00379633" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0012" "00379650" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0032" "00379668" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0055" "00379671" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0060" "00379748" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0090" "00379753" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0097" "00379755" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0101" "00379763" "" "" "" "1" "" "03508" "" "" "F" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0111" "00379766" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0118" "00379775" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GS_0133" "00379795" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GJ_0154" "00379835" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016101012" "00379836" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016112112" "00379837" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "F" "?" "China" "" "0" "" "" "Han Chinese" "2016120512" "00379838" "" "" "" "1" "" "00000" "{PMID:Wang 2018:30029497}" "" "M" "?" "China" "" "0" "" "" "Han Chinese" "2016102420" "00380148" "" "" "" "1" "" "00000" "{PMID:Patel 2018:30054919}" "" "" "likely" "Saudi Arabia" "" "0" "" "" "" "16DG0629" "00380158" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_BDC_0005" "00380170" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP1, II:1" "?" "yes" "Spain" "" "0" "" "" "" "II:1" "00380171" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP106, II:1" "?" "no" "Spain" "" "0" "" "" "" "II:1" "00380173" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP117, II:1" "?" "no" "Spain" "" "0" "" "" "" "II:1" "00380205" "" "" "" "1" "" "00000" "{PMID:Ezquerra-Inchausti 2018:30337596}" "Family RP49, II:1" "?" "no" "Spain" "" "0" "" "" "" "II:1" "00381013" "" "" "" "1" "" "00000" "{PMID:Schorderet-2013:23484092}" "" "" "" "Switzerland" "" "0" "" "" "Swiss, Algerian or Tunisian" "" "00381675" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "F" "yes" "Iran" "" "0" "" "" "" "" "00381684" "" "" "" "1" "" "00000" "{PMID:Eisenberger-2013:24265693}" "" "M" "no" "" "" "0" "" "" "Southeast Europe" "" "00381851" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "1" "00381852" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "2" "00381853" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "3" "00381854" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "4" "00381855" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "5" "00381856" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "6" "00381857" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "7" "00381858" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "8" "00381859" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "F" "" "Germany" "" "0" "" "" "" "9" "00381860" "" "" "" "1" "" "00000" "{PMID:Birtel 2018:30543658}" "" "M" "" "Germany" "" "0" "" "" "" "10" "00382278" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "107" "00382279" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "108" "00382280" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "109" "00382281" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "110" "00382282" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "111" "00382283" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "112" "00382284" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "113" "00382285" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "114" "00382286" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "115" "00382287" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "116" "00382288" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "117" "00382289" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "118" "00382290" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "119" "00382291" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "120" "00382292" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "121" "00382293" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "122" "00382294" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "123" "00382295" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "124" "00382296" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "125" "00382297" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "126" "00382298" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "127" "00382299" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "128" "00382300" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "129" "00382301" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "130" "00382302" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "131" "00382303" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "132" "00382304" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "133" "00382305" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "134" "00382306" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "135" "00382419" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "248" "00382464" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "293" "00382540" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "402" "00382541" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "403" "00382542" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "404" "00382543" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "405" "00382544" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "406" "00382545" "" "" "" "1" "" "00000" "{PMID:Jespersgaar 2019:30718709}" "" "?" "" "Denmark" "" "0" "" "" "" "407" "00382725" "" "" "" "1" "" "03840" "{PMID:Tracewska 2019:31766579}" "proband" "F" "no" "Poland" "" "0" "yes" "" "Slavic" "419" "00382855" "" "" "" "1" "" "00000" "{PMID:Beryozkin-2014:24474277}" "" "" "yes" "Lithuania" "" "0" "" "" "Lithuania;Jewish" "" "00383489" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?" "00383490" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?" "00383491" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?" "00383492" "" "" "" "1" "" "00000" "{PMID:Kim 2019:31496144}" "" "?" "" "Korea, South (Republic)" "" "0" "" "" "" "?" "00383741" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "DP1806007651" "00383748" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD17031985_A" "00383764" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18070029_A" "00383786" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18084001_A" "00383787" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18084039_A" "00383789" "" "" "" "1" "" "00000" "{PMID:Gao 2019:31054281}" "" "?" "" "China" "" "0" "" "" "" "RD18184066_B" "00383824" "" "" "" "1" "" "00000" "{PMID:Hariri 2018:31047384}" "" "?" "" "" "" "0" "" "" "" "" "00383842" "" "" "" "1" "" "00000" "{PMID:Hariri 2018:31047384}" "" "?" "" "" "" "0" "" "" "" "" "00383904" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0014" "00383908" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0088" "00383924" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0540" "00383950" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-0927" "00383977" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1254" "00384008" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1623" "00384052" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1935" "00384055" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-1965" "00384059" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2024" "00384089" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2201" "00384102" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2306" "00384121" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2428" "00384128" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2466" "00384168" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2906" "00384173" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2930" "00384175" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-2989" "00384182" "" "" "" "1" "" "00000" "{PMID:Martin Merida 2019:30902645}" "" "?" "" "Spain" "" "0" "" "" "" "RP-3030" "00384271" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13329" "00384283" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13411" "00384741" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384742" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384743" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384757" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384758" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384759" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384760" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00384761" "" "" "" "1" "" "00000" "{PMID:González-del Pozo-2011:22164218}" "" "" "" "" "" "0" "" "" "Spanish" "" "00385175" "" "" "" "1" "" "00000" "{PMID:Jiman 2020:31836858}" "" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "68" "00385395" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31872526}" "" "M" "" "Taiwan" "" "0" "" "" "" "F5-I-2" "00385397" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31872526}" "" "M" "" "Taiwan" "" "0" "" "" "" "F7-II-1" "00385405" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31872526}" "" "F" "" "Taiwan" "" "0" "" "" "" "F16-I-1" "00385702" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "?" "China" "" "0" "" "" "" "7" "00385713" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "F" "?" "China" "" "0" "" "" "" "62" "00385720" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "?" "China" "" "0" "" "" "" "112" "00385728" "" "" "" "1" "" "00000" "{PMID:Dan 2020:31960602}" "" "M" "?" "China" "" "0" "" "" "" "135" "00385846" "" "" "" "1" "" "00000" "{PMID:Cho 2020:32000842}" "" "F" "" "(United States)" "" "0" "" "" "" "21" "00386226" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RPN-404" "00386234" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-198, proband" "F" "" "Spain" "" "0" "" "" "" "RPN-444" "00386257" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-232, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-602" "00386274" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-66, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-170" "00386282" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-84, family member" "M" "" "Spain" "" "0" "" "" "" "RPN-213" "00386283" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-84, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-214" "00386291" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "?" "" "Spain" "" "0" "" "" "" "RP-632" "00386302" "" "" "" "1" "" "00000" "{PMID:Rodriguez-Munoz 2020:32036094}" "family fRPN-SRT, proband" "M" "" "Spain" "" "0" "" "" "" "RPN-443" "00386567" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "001-598" "00386573" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "003-039" "00386574" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "003-059" "00386588" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "003-392" "00386593" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "039-169" "00386601" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "099-016" "00386609" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-016" "00386618" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-059" "00386623" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-102" "00386624" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-103" "00386628" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-1076" "00386635" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-160" "00386645" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-182" "00386651" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-202" "00386652" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-204" "00386669" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-588" "00386673" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-623" "00386700" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI1788_003115" "00386712" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2843_004428" "00386726" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2861_004446" "00386734" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2872_004457" "00386736" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2874_004459" "00386740" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2883_004468" "00386741" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2884_004469" "00386758" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2906_004491" "00386799" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2955_004540" "00386812" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI582_001196" "00386825" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI625_001288" "00386848" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI703_001401" "00386872" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "121-001" "00386917" "" "" "" "1" "" "00000" "{PMID:Liu 2020:32090030}" "" "F" "no" "" "" "0" "" "" "" "RP04-II:2" "00387039" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "65" "00387040" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "66" "00387041" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "Asian" "67" "00387042" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "F" "" "(United States)" "" "0" "" "" "white" "68" "00387043" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "69" "00387044" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "70" "00387045" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "71" "00387046" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "72" "00387047" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "73" "00387048" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "74" "00387049" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "75" "00387050" "" "" "" "1" "" "00000" "{PMID:Jauregui 2020:32098976}" "" "M" "" "(United States)" "" "0" "" "" "white" "76" "00387390" "" "" "" "1" "" "00000" "{PMID:Sun 2020:32100970}" "" "M" "" "China" "" "0" "" "" "" "10" "00387392" "" "" "" "1" "" "00000" "{PMID:Sun 2020:32100970}" "" "M" "" "China" "" "0" "" "" "" "12" "00387629" "" "" "" "1" "" "00000" "{PMID:Zanolli 2020:32141364}" "individual ID not present in paper, consecutive numbers given" "?" "" "Chile" "" "0" "" "" "" "14" "00388478" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "15005265" "00388480" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "13011434" "00388488" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "13001147" "00388504" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "13018538" "00388505" "" "" "" "1" "" "00000" "{PMID:Ellingsford 2018:29074561}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "14001342" "00388542" "" "" "" "1" "" "00000" "{PMID:Dineiro 2020:32483926}" "" "?" "" "Spain" "" "0" "" "" "" "OFTALMO.003" "00388826" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 50, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "110" "00388827" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 50, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "111" "00388834" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 53, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "118" "00388835" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 53, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "119" "00388851" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 59, central areolar choroidal dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "135" "00388881" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 66, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "165" "00389195" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 157, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "479" "00389268" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 198, cone-rod dystrophy, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "552" "00389274" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 200, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "558" "00389275" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 200, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "559" "00389300" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 211, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "584" "00389301" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 211, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "585" "00389335" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 222, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "619" "00389336" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 222, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "620" "00389394" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 246, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "678" "00389435" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 270, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "719" "00389436" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 270, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "720" "00389442" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 274, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "726" "00389537" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 335, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "821" "00389542" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 338, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "826" "00389573" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 354, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "857" "00389601" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 369, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "885" "00389605" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 372, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "889" "00389638" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 394, autosomal recessive retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "922" "00389639" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 394, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "923" "00389646" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 399, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "930" "00389683" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 433, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "967" "00389769" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 642, cone-rod dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1053" "00389790" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 699, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1074" "00389803" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 724, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1087" "00389809" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 728, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1093" "00389812" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 733, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1096" "00389827" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 753, cone-rod dystrophy, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1111" "00389876" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 824, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1160" "00389932" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 951, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1216" "00389934" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 957, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "F" "" "Germany" "" "0" "" "" "" "1218" "00389963" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1026, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1247" "00389977" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1055, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1261" "00390010" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2020:32531858}" "Filing key number: 1142, sporadic retinitis pigmentosa, no patient Ids, consecutive numbers given" "M" "" "Germany" "" "0" "" "" "" "1294" "00390251" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001048" "00390252" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G002641" "00390253" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005008" "00390254" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006019" "00390255" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G006302" "00390256" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G007742" "00390257" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G008145" "00390258" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "G009847" "00390259" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000239" "00390260" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "" "" "0" "" "" "" "W000316" "00390473" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005211" "00390738" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F20, patient II.5" "F" "" "Tunisia" "" "0" "" "" "" "F20_II.5" "00390739" "" "" "" "1" "" "00000" "{PMID:Habibi 2020:32641690}" "Family F21, patient II.5" "F" "" "Tunisia" "" "0" "" "" "" "F21_II.5" "00390808" "" "" "" "2" "" "00000" "{PMID:Khateb-2016:27208209}" "two affected siblings, index case (homozygous), affected sister (homozygous), unaffected mother (heterozygous), unaffected father (heterozygous), 6 unaffected sister (WT), 7 unaffected brother" "" "" "" "" "0" "" "" "Arab/Muslim" "" "00391227" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-167" "00391229" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-169" "00391230" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-180" "00391231" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-183" "00391233" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "N-224" "00391235" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-228" "00391238" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-257" "00391239" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-259" "00391240" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-27" "00391243" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-303" "00391244" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "N-34" "00391245" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-37" "00391246" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "N-38" "00391248" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "N-71" "00391260" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-209" "00391262" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-279" "00391263" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-293" "00391267" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-423" "00391272" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-499" "00391273" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-51" "00391274" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-552" "00391276" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-613" "00391277" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-616" "00391278" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-617" "00391279" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-698" "00391281" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-767" "00391284" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-824" "00391285" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "F" "" "Japan" "" "0" "" "" "" "OPH-864" "00391286" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-908" "00391287" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-980" "00391288" "" "" "" "1" "" "00000" "{PMID:Koyanagi 2020:32749464}" "" "M" "" "Japan" "" "0" "" "" "" "OPH-985" "00392371" "" "" "" "1" "" "00000" "{PMID:Xiao-2021:33598457}" "" "M" "" "China" "" "0" "" "" "" "19645" "00392575" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "21" "00392578" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "28" "00392579" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "29" "00392583" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "37" "00392600" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "59" "00392602" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "61" "00392604" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "64" "00392652" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "138" "00392660" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "151" "00392661" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "152" "00392662" "" "" "" "1" "" "00000" "{PMID:Ma 2021:33691693}" "" "?" "" "Korea" "" "0" "" "" "" "153" "00393494" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "yes" "" "" "0" "" "" "" "" "00393562" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393569" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393584" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393590" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393594" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393601" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393617" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393686" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393698" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393700" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393714" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393747" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393776" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393805" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393813" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393825" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393853" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393869" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393897" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" "" "00393902" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" "" "00393998" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" "" "00394319" "" "" "" "1" "" "00000" "{PMID:Thorsteinsson 2021:33851411}" "" "?" "" "Iceland" "" "0" "" "" "" "RP1" "00394320" "" "" "" "1" "" "00000" "{PMID:Thorsteinsson 2021:33851411}" "" "?" "" "Iceland" "" "0" "" "" "" "RP2" "00394554" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394570" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394571" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394572" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394573" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394574" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394575" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394576" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394577" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394578" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394579" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394580" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394581" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394582" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394583" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394584" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394585" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394586" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394587" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394588" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394589" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394590" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394591" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394592" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "yes" "" "" "0" "" "" "" "" "00394593" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "yes" "" "" "0" "" "" "" "" "00394594" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394595" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "F" "no" "" "" "0" "" "" "" "" "00394596" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "no" "" "" "0" "" "" "" "" "00394597" "" "" "" "1" "" "00000" "{PMID:Colombo-2020:33576794}" "" "M" "yes" "" "" "0" "" "" "" "" "00395422" "" "" "" "1" "" "00000" "{PMID:Shen 2021:34130719}" "" "M" "yes" "China" "" "0" "" "" "" "F5‑III" "00395423" "" "" "" "1" "" "00000" "{PMID:Shen 2021:34130719}" "" "F" "yes" "China" "" "0" "" "" "" "F3‑III" "00395424" "" "" "" "1" "" "00000" "{PMID:Shen 2021:34130719}" "" "F" "yes" "China" "" "0" "" "" "" "F4‑III" "00395577" "" "" "" "1" "" "00000" "{PMID:Perea-Romero 2021:34448047}" "" "" "" "Spain" "" "0" "" "" "" "RP-1022" "00395789" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F083" "00395791" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F092" "00395799" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F095" "00395811" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F262" "00395814" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F272" "00395817" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F273" "00395818" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F040" "00395832" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F023" "00395833" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F014" "00395834" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F180" "00395835" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F144" "00395837" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F207" "00395838" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F240" "00395839" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F192" "00395840" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F005" "00395845" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F304" "00395848" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F086" "00395884" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F182" "00395904" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F281" "00395913" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F251" "00395923" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F244" "00395929" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F147" "00395949" "" "" "" "1" "" "00000" "{PMID:Chen 2021:43360855}" "" "?" "" "Taiwan" "" "0" "" "" "" "F011" "00395964" "" "" "" "1" "" "00000" "{PMID:Georgiou 2021:32795431}" "pedigree ID: 22692, genetic ID: 34950" "F" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "P10" "00396429" "" "" "" "1" "" "00006" "{PMID:Ellingford 2016:26872967}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "067429" "00396463" "" "" "" "1" "" "00006" "{PMID:Ellingford 2017:28378820}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "13004716" "00396491" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396492" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396493" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396495" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396498" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396500" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396501" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396503" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396504" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396505" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396506" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396514" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396516" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396517" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396518" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396519" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396523" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396524" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396534" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396535" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396540" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396542" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396552" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396556" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396562" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396574" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396578" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396580" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396582" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396586" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396588" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396590" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396598" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396602" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396604" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396606" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396608" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396614" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396622" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396624" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396630" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396631" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396632" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396638" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396641" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396643" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396644" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396645" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396651" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00396652" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396653" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00396654" "" "" "" "1" "" "00000" "{PMID:Numa 2020:33247286}" "" "M" "" "Japan" "" "0" "" "" "Japanese" "" "00400083" "" "" "" "1" "" "00000" "{PMID:Ng 2019:30948794}" "proband; pedigree patient numbers differ from table numbers" "F" "" "China" "" "0" "" "" "" "F3-II-6" "00402260" "" "" "" "1" "" "00000" "{PMID:Zhu 2021:32675063}" "family 83, patient 44270633" "M" "" "China" "" "0" "" "" "" "44270633" "00402269" "" "" "" "1" "" "00000" "{PMID:Zhu 2021:32675063}" "family 30, patient 42474243" "M" "" "China" "" "0" "" "" "" "42474243" "00408415" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "8" "00408416" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "" "?" "" "Finland" "" "0" "" "" "" "9" "00408440" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 28, invidivual a" "?" "" "Finland" "" "0" "" "" "" "28a" "00408441" "" "" "" "1" "" "00000" "{PMID:Avela 2019:31087526}" "Family 28, invidivual b" "?" "" "Finland" "" "0" "" "" "" "28b" "00408996" "" "" "" "1" "" "04303" "" "" "" "" "" "" "" "" "" "" "" "00408997" "" "" "" "1" "" "04303" "" "" "" "" "" "" "0" "" "" "" "" "00409501" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "M" "" "" "" "0" "" "" "" "9 (EYS-RP group)" "00409502" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "1 (EYS-RP group)" "00409504" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "10 (EYS-RP group)" "00409505" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "8 (EYS-RP group)" "00409506" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "M" "" "" "" "0" "" "" "" "15 (EYS-RP group)" "00409509" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "M" "" "" "" "0" "" "" "" "2 (EYS-RP group)" "00409510" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "3 (EYS-RP group)" "00409511" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "4 (EYS-RP group)" "00409512" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "M" "" "" "" "0" "" "" "" "5 (EYS-RP group)" "00409513" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "M" "" "" "" "0" "" "" "" "6 (EYS-RP group)" "00409514" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "7 (EYS-RP group)" "00409519" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "11 (EYS-RP group)" "00409520" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "12 (EYS-RP group)" "00409521" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "M" "" "" "" "0" "" "" "" "13 (EYS-RP group)" "00409522" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "14 (EYS-RP group)" "00409523" "" "" "" "1" "" "00000" "{PMID:Hirashima 2017:28763560}" "" "F" "" "" "" "0" "" "" "" "16 (EYS-RP group)" "00410969" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "Russian/Ukrainian" "P1" "00410970" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "Polish/Russian" "P2" "00410971" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "Iranian/Irish, German" "P3" "00410972" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Hispanic" "P4" "00410973" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "Italian" "P5" "00410974" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "East Indian/Iranian" "P6" "00410975" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "Polish/Russian" "P7" "00410976" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Iranian" "P8" "00410977" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "Irish" "P9" "00410978" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Middle Eastern" "P10" "00410979" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Indian" "P11" "00410980" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Italian" "P12" "00410981" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "F" "" "" "" "0" "" "" "African American" "P13" "00410982" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Chinese" "P14" "00410983" "" "" "" "1" "" "00000" "{PMID:McGuigan 2017:28704921}" "" "M" "" "" "" "0" "" "" "Ashkenazi Jewish" "P15" "00410984" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P1" "00410985" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P2" "00410986" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P3" "00410987" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "F" "" "(United States)" "" "0" "" "" "" "P4" "00410988" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P5" "00410989" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P6" "00410990" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P7" "00410991" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P8" "00410992" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "F" "" "(United States)" "" "0" "" "" "" "P9" "00410993" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P10" "00410994" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P11" "00410995" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P12" "00410996" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "F" "" "(United States)" "" "0" "" "" "" "P13" "00410997" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "F" "" "(United States)" "" "0" "" "" "" "P14" "00410998" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P15" "00410999" "" "" "" "1" "" "00000" "{PMID:Sengillio 2018:29550188}" "" "M" "" "(United States)" "" "0" "" "" "" "P16" "00411000" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "M" "" "Italy" "" "0" "" "" "Italian" "P1" "00411001" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "M" "" "Italy" "" "0" "" "" "Italian" "P2" "00411002" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "" "" "Italy" "" "0" "" "" "Italian" "P3" "00411003" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "" "" "Italy" "" "0" "" "" "Italian" "P4" "00411004" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "" "" "Italy" "" "0" "" "" "Italian" "P5" "00411005" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "" "" "Italy" "" "0" "" "" "Italian" "P6" "00411006" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "" "" "Italy" "" "0" "" "" "Italian" "P7" "00411007" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "M" "" "Italy" "" "0" "" "" "Italian" "P8" "00411008" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "F" "" "Italy" "" "0" "" "" "Italian" "P9" "00411009" "" "" "" "1" "" "00000" "{PMID:Mucciolo_2018:30153090}" "" "" "" "Italy" "" "0" "" "" "Italian" "P10" "00414435" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "M" "" "China" "" "0" "" "" "" "WHP102" "00419691" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}" "" "M" "" "" "" "0" "" "" "" "070682" "00419869" "" "" "" "1" "" "00006" "{PMID:Sano 2022:35710107}, {PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "M" "" "Japan" "" "0" "" "" "" "OPH641" "00419870" "" "" "" "1" "" "00006" "{PMID:Sano 2022:35710107}, {PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "M" "" "Japan" "" "0" "" "" "" "OPH861" "00419871" "" "" "" "9" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419872" "" "" "" "4" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "OPH125/OPH217/OPH693/OPH556" "00419873" "" "" "" "15" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419874" "" "" "" "10" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419875" "" "" "" "10" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419876" "" "" "" "8" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419877" "" "" "" "4" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419878" "" "" "" "15" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419879" "" "" "" "15" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419880" "" "" "" "15" "" "00006" "{PMID:Sano 2022:35710107}" "" "" "" "Japan" "" "0" "" "" "" "" "00419881" "" "" "" "1" "" "00006" "{PMID:Sano 2022:35710107}, {PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "M" "" "Japan" "" "0" "" "" "" "OPH690" "00420391" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F005" "00420395" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F011" "00420398" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F014" "00420407" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F023" "00420420" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F040" "00420443" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F083" "00420445" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F086" "00420450" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F092" "00420451" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F095" "00420476" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F144" "00420479" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F147" "00420499" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F180" "00420500" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F182" "00420505" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F192" "00420518" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F207" "00420542" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F240" "00420545" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F244" "00420548" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F251" "00420556" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F262" "00420563" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F272" "00420564" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F273" "00420570" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F281" "00420586" "" "" "" "1" "" "00000" "{PMID:Chen 2021:33608557}" "" "" "" "Taiwan" "" "0" "" "" "" "F304" "00425888" "" "" "" "1" "" "00000" "{PMID:Xiao 2017:29260190}" "family RP-F2, individual II:5, sibling of II:1" "F" "" "China" "" "0" "" "" "Chinese" "II:5" "00426913" "" "" "" "1" "" "00000" "{PMID:Zhu 2022:35456422}" "family 19, individual 21" "F" "" "" "" "0" "" "" "" "19_21" "00429496" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429502" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429512" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429519" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429529" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429545" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429548" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429553" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429554" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429555" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429558" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429565" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429566" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429575" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429576" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429577" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429580" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429582" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429592" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429593" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429597" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429602" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429624" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429626" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429673" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429679" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429683" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429691" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429717" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429734" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429737" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429746" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429771" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429775" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429801" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429806" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429851" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429854" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429904" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429917" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429921" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429934" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429941" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429966" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00429978" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00429999" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430026" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430043" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430052" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430055" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430067" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430068" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430073" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430078" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430089" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430116" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "F" "" "" "" "0" "" "" "" "" "00430118" "" "" "" "1" "" "04436" "{PMID:Panneman 2023:36819107}" "" "M" "" "" "" "0" "" "" "" "" "00430904" "" "" "" "1" "" "04091" "{PMID:Reurink 2023:36785559}, {DOI:Reurink 2023:10.1016/j.xhgg.2023.100181}" "" "" "" "" "" "0" "" "" "" "arRP6" "00436163" "" "" "" "1" "" "00006" "{PMID:Dai 2023:37643323}" "4-generation family, 7 affected (5F, 2M)" "F" "no" "China" "" "0" "" "" "" "FamPatIII2" "00436418" "" "" "" "1" "" "04552" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "F" "no" "Mexico" "" "" "yes" "None" "Hispanic" "2468476" "00436438" "" "" "" "1" "" "04552" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "F" "no" "Mexico" "" "" "" "none" "Hispanic" "3846505" "00438692" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSJ0709" "00441658" "" "" "" "1" "" "04542" "{PMID:de Bruijn 2023:36524988}" "" "" "" "" "" "0" "" "" "" "071149" "00441659" "" "" "" "1" "" "04542" "{PMID:de Bruijn 2023:36524988}" "" "" "" "" "" "0" "" "" "" "071193" "00444256" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat15" "00446969" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-274" "00446986" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-425" "00446987" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-432" "00446993" "" "" "" "3" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 3 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-441" "00446994" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-442" "00447004" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "F" "" "Germany" "" "0" "" "" "" "ARRP-461" "00447020" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "M" "" "Germany" "" "0" "" "" "" "ARRP-490" "00447059" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "F" "" "Germany" "" "0" "" "" "" "CD-626" "00447258" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-968" "00447261" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1067" "00447266" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1123" "00447268" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1125" "00447269" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1127" "00447272" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1131" "00447278" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1149" "00447290" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1179" "00447305" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1215" "00447456" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "XRP-199" "00447504" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "ARRP-444" "00447505" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "ARRP-445" "00447508" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-459" "00447509" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "ARRP-467" "00447513" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "ARRP-474" "00447515" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "M" "" "Germany" "" "0" "" "" "" "ARRP-495" "00447594" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-867" "00447610" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1182" "00447614" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1235" "00447620" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "M" "" "Germany" "" "0" "" "" "" "SRP-1273" "00447632" "" "" "" "2" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, 2 affected" "F" "" "Germany" "" "0" "" "" "" "STGD-446" "00447702" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1105" "00447707" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1167" "00447716" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "F" "" "Germany" "" "0" "" "" "" "SRP-1249" "00447718" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient, no family history" "M" "" "Germany" "" "0" "" "" "" "SRP-1274" "00447720" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "M" "" "Germany" "" "0" "" "" "" "SRP-1299" "00449982" "" "" "" "1" "" "02230" "{PMID:Zeuli 2024:38816995}" "" "M" "" "Italy" "" "0" "" "" "white" "Pt-13" "00450840" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "067139" "00450841" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "067307" "00450842" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "072144" "00450843" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "M" "" "" "" "0" "" "" "" "073789" "00450844" "" "" "" "1" "" "04405" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "F" "" "" "" "0" "" "" "" "074634" "00451067" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "066832" "00451068" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "066836" "00451149" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "071445" "00451155" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "071493" "00451166" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "071788" "00451252" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "072857" "00451259" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "073069" "00451333" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "075139" "00451348" "" "" "" "1" "" "00006" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "" "" "0" "" "" "" "080622" "00458998" "" "" "" "1" "" "00006" "{PMID:Jimenez 2022:36362148}" "" "M" "" "United States" "" "0" "" "" "" "Pat4" "00459006" "" "" "" "1" "" "00006" "{PMID:Wen 2023:36811936}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "United States" "" "0" "" "" "" "SRF_979" "00459007" "" "" "" "1" "" "00006" "{PMID:Wen 2023:36811936}" "2-generation family, 1 affected, unaffected parents" "M" "" "United States" "" "0" "" "" "" "MEP_970" "00461113" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "M" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat48" "00461135" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "F" "" "South Africa" "" "0" "" "" "Africa-indigenous" "Pat70" "00461137" "" "" "" "1" "" "00006" "{PMID:Midgley 2024:39676705}" "" "F" "" "South Africa" "" "0" "" "" "mixed" "Pat72" "00465319" "" "" "" "1" "" "04846" "" "" "F" "likely" "Mexico" "" "" "" "" "Latin american" "Case #2" "00467828" "" "" "" "1" "" "00006" "{PMID:Hussain 2023:36833373}" "2-generation family, 1 affected, unaffected parents" "F" "" "United States" "" "0" "" "" "white" "MEP-123" "00479985" "" "" "" "1" "" "00006" "{PMID:Van Vooren 2024:40985799}" "patient" "M" "" "Canada" "" "0" "" "" "" "S32" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 1530 "{{individualid}}" "{{diseaseid}}" "00000135" "00012" "00000210" "00058" "00001962" "00173" "00033096" "04214" "00033109" "04214" "00033132" "04214" "00033157" "04214" "00033349" "04214" "00038358" "04214" "00095925" "04211" "00100104" "04214" "00104565" "00139" "00105016" "04214" "00143834" "04214" "00143835" "04214" "00143836" "04214" "00143837" "04214" "00143838" "04214" "00143839" "04214" "00143840" "04214" "00143841" "04214" "00143842" "04214" "00143843" "04214" "00143844" "04214" "00143845" "04214" "00143846" "04214" "00143847" "04214" "00143848" "04214" "00143849" "04214" "00143850" "04214" "00143851" "04214" "00143852" "04214" "00143853" "04214" "00143854" "04214" "00143855" "04214" "00143856" "04214" "00143857" "04214" "00143858" "04214" "00143859" "04214" "00143860" "04214" "00143861" "04214" "00143862" "04214" "00143863" "04214" "00143864" "04214" "00143865" "04214" "00143866" "04214" "00143867" "04214" "00143868" "04214" "00143869" "04214" "00143870" "04214" "00143871" "04214" "00143872" "04214" "00143873" "04214" "00143874" "04214" "00143875" "04214" "00143876" "04214" "00143877" "04214" "00143878" "04214" "00143879" "04214" "00143880" "04214" "00143881" "04214" "00143882" "04214" "00143883" "04214" "00143884" "04214" "00143885" "04214" "00143886" "04214" "00143887" "04214" "00143888" "04214" "00143889" "04214" "00143890" "04214" "00143891" "04214" "00143892" "04214" "00143893" "04214" "00143894" "04214" "00143895" "04214" "00143896" "04214" "00143897" "04214" "00143898" "04214" "00143899" "04214" "00143900" "04214" "00143901" "04214" "00143902" "04214" "00143903" "04214" "00143904" "04214" "00143905" "04214" "00143906" "04214" "00143907" "04214" "00143908" "04214" "00143909" "04214" "00143910" "04214" "00143911" "04214" "00143912" "04214" "00143913" "04214" "00143914" "04214" "00143915" "04214" "00143916" "04214" "00143917" "04214" "00143918" "04214" "00143919" "04214" "00143920" "04214" "00143921" "04214" "00143922" "04214" "00143923" "04214" "00143924" "04214" "00143925" "04214" "00143926" "04214" "00143927" "04214" "00143928" "04214" "00143929" "04214" "00143930" "04214" "00143931" "04214" "00143932" "04214" "00143933" "04214" "00143934" "04214" "00143935" "04214" "00143936" "04214" "00143937" "04214" "00143938" "04214" "00143939" "04214" "00143940" "04214" "00143941" "04214" "00143942" "04214" "00143943" "04214" "00143944" "04214" "00143947" "04214" "00143948" "04214" "00143949" "04214" "00143950" "04214" "00143951" "04214" "00143952" "04214" "00143953" "04214" "00143954" "04214" "00143955" "04214" "00143956" "04214" "00143957" "04214" "00143958" "04214" "00143959" "04214" "00143960" "04214" "00143961" "04214" "00143962" "04214" "00143963" "04214" "00143964" "04214" "00143965" "04214" "00143966" "04214" "00143967" "04214" "00143968" "04214" "00143969" "04214" "00143970" "04214" "00143971" "04214" "00143972" "04214" "00143973" "04214" "00143974" "00058" "00143975" "04214" "00143976" "04214" "00143977" "04214" "00143978" "04214" "00143979" "04214" "00143980" "04214" "00143981" "04214" "00143982" "04214" "00143983" "04214" "00143984" "04214" "00143985" "04214" "00143986" "04214" "00143987" "04214" "00143988" "04214" "00143989" "04214" "00143990" "04214" "00143991" "04214" "00143992" "04214" "00143993" "04214" "00143994" "04214" "00143995" "04214" "00143996" "04214" "00143997" "04214" "00143998" "04214" "00143999" "04214" "00144000" "04214" "00144001" "04214" "00144002" "04214" "00144003" "04214" "00144004" "04214" "00144005" "04214" "00144006" "04214" "00144007" "04214" "00144008" "04214" "00144009" "04214" "00144010" "04214" "00144011" "04214" "00144012" "04214" "00144013" "04214" "00144014" "04214" "00144015" "04214" "00144016" "04214" "00144017" "04214" "00144018" "04214" "00144019" "04214" "00144020" "04214" "00144021" "04214" "00144022" "04214" "00144023" "04214" "00144024" "04214" "00144025" "04214" "00144026" "04214" "00144027" "04214" "00144028" "04214" "00144029" "04214" "00144030" "04214" "00144031" "04214" "00144032" "04214" "00144033" "04214" "00144034" "04214" "00144035" "04214" "00144036" "04214" "00144037" "04214" "00144038" "04214" "00144039" "04214" "00144040" "04214" "00144041" "04214" "00144042" "04214" "00144043" "04214" "00144044" "04214" "00144045" "04214" "00144046" "04214" "00144047" "04214" "00144048" "04214" "00144049" "04214" "00144050" "04214" "00144051" "04214" "00144052" "04214" "00144053" "04214" "00144054" "04214" "00144055" "04214" "00144056" "04214" "00144057" "04214" "00144058" "04214" "00144059" "04214" "00144060" "04214" "00144061" "04214" "00144062" "04214" "00144063" "04214" "00144064" "04214" "00144065" "04214" "00144066" "04214" "00144067" "04214" "00144068" "04214" "00144069" "04214" "00144070" "04214" "00144071" "04214" "00144072" "04214" "00144073" "04214" "00144074" "04214" "00144075" "04214" "00144076" "04214" "00144077" "04214" "00144078" "04214" "00144079" "04214" "00144080" "04214" "00144081" "04214" "00144082" "04214" "00144083" "04214" "00144084" "04214" "00144085" "04214" "00144086" "04214" "00144087" "04214" "00144088" "04214" "00144089" "04214" "00144090" "04214" "00144091" "04214" "00144092" "04214" "00144093" "04214" "00144094" "04214" "00144095" "04214" "00144096" "04214" "00144097" "04214" "00144098" "04214" "00144099" "04214" "00144100" "04214" "00144101" "04214" "00144102" "04214" "00144103" "04214" "00144104" "04214" "00144105" "04214" "00144106" "04214" "00144107" "04214" "00144108" "04214" "00144109" "04214" "00144110" "00058" "00144111" "04214" "00144112" "04214" "00144113" "04214" "00144114" "04214" "00144115" "04214" "00144116" "04214" "00144117" "04214" "00144118" "04214" "00144119" "04214" "00144120" "04214" "00144121" "04214" "00144122" "04214" "00144123" "04214" "00144124" "04214" "00144125" "04214" "00144126" "04214" "00144127" "04214" "00144128" "04214" "00144129" "04214" "00144130" "04214" "00144131" "04214" "00144132" "04214" "00144133" "04214" "00144134" "04214" "00144135" "04214" "00144136" "04214" "00144137" "04214" "00144138" "04214" "00144139" "04214" "00144140" "04214" "00144141" "04214" "00144142" "04214" "00144143" "04214" "00144144" "04214" "00144145" "04214" "00144146" "04214" "00144147" "04214" "00144148" "04214" "00144149" "04214" "00144150" "04214" "00144151" "04214" "00144152" "04214" "00144153" "04214" "00144154" "04214" "00144155" "04214" "00144156" "04214" "00144157" "04214" "00144158" "04214" "00144159" "04214" "00144160" "04214" "00144161" "04214" "00144162" "04214" "00144163" "04214" "00144164" "04214" "00144165" "04214" "00144166" "04214" "00144167" "04214" "00144168" "04214" "00144169" "04214" "00144170" "04214" "00144171" "04214" "00144172" "04214" "00144173" "04214" "00144174" "04214" "00144175" "04214" "00144176" "04214" "00144177" "04214" "00144178" "04214" "00144179" "04214" "00144180" "04214" "00144181" "04214" "00144182" "04214" "00144183" "04214" "00144184" "04214" "00144185" "04214" "00144186" "04214" "00144187" "04214" "00144188" "04214" "00144189" "04214" "00144190" "04214" "00144191" "04214" "00144192" "04214" "00144193" "04214" "00144194" "04214" "00144195" "04214" "00144196" "04214" "00144197" "04214" "00144198" "04214" "00144199" "04214" "00144200" "04214" "00144201" "04214" "00144202" "04214" "00144203" "04214" "00144204" "04214" "00144205" "04214" "00144206" "04214" "00144207" "04214" "00144208" "04214" "00144209" "04214" "00144210" "04214" "00144211" "04214" "00144212" "04214" "00144213" "04214" "00144214" "04214" "00144215" "04214" "00144216" "04214" "00144217" "04214" "00144218" "04214" "00144219" "04214" "00144220" "04214" "00144221" "04214" "00144222" "04214" "00144223" "04214" "00144224" "04214" "00144225" "04214" "00144226" "04214" "00144227" "04214" "00144228" "04214" "00144229" "04214" "00144230" "04214" "00144231" "04214" "00144232" "04214" "00144233" "04214" "00144234" "04214" "00144235" "04214" "00144236" "04214" "00144237" "04214" "00144238" "04214" "00144239" "04214" "00144240" "04214" "00144241" "04214" "00144242" "04214" "00144243" "04214" "00144244" "04214" "00144245" "04214" "00144248" "04214" "00144249" "04214" "00144250" "04214" "00144251" "04214" "00144252" "04214" "00144253" "04214" "00144254" "04214" "00144255" "04214" "00144256" "04214" "00144257" "04214" "00144258" "04214" "00144259" "04214" "00144260" "04214" "00144261" "04214" "00144262" "04214" "00144263" "04214" "00144264" "04214" "00144265" "04214" "00144266" "04214" "00144267" "04214" "00144268" "04214" "00144269" "04249" "00144270" "04214" "00144271" "04214" "00144272" "04214" "00144273" "04214" "00144274" "04214" "00144275" "04214" "00144276" "04214" "00144277" "04214" "00144278" "04214" "00144279" "04214" "00144280" "04214" "00144281" "04249" "00144282" "04214" "00144283" "00058" "00144284" "04214" "00144285" "04214" "00144286" "04214" "00144287" "04214" "00144288" "04214" "00144289" "04214" "00144290" "04214" "00144291" "04214" "00144292" "04214" "00144293" "04214" "00144294" "04214" "00144295" "04214" "00144296" "04214" "00144297" "04214" "00144298" "04214" "00144299" "04214" "00144300" "04214" "00144301" "04214" "00144302" "04214" "00144303" "04214" "00144304" "04214" "00144305" "04214" "00144306" "04214" "00144307" "04214" "00144308" "04214" "00144309" "04214" "00144310" "04214" "00144311" "04214" "00144313" "04214" "00155316" "04214" "00155460" "04214" "00155461" "04214" "00155462" "04214" "00155463" "04214" "00155464" "04214" "00155465" "04214" "00155466" "04214" "00155467" "04214" "00155468" "04214" "00155469" "04214" "00155470" "04214" "00173838" "04214" "00173872" "04214" "00180416" "05468" "00207593" "04214" "00232716" "04214" "00232717" "04214" "00232718" "04214" "00232719" "04214" "00232720" "04214" "00232721" "04214" "00232722" "04214" "00232723" "04214" "00232724" "04214" "00232725" "04214" "00232726" "04214" "00232727" "04214" "00232728" "04214" "00232729" "04214" "00232730" "04214" "00232731" "04214" "00232732" "04214" "00232733" "04214" "00232734" "04214" "00232735" "04214" "00232736" "04214" "00232737" "04214" "00232738" "04214" "00232739" "04214" "00232740" "04214" "00232741" "04214" "00232742" "04214" "00232743" "04214" "00232744" "04214" "00232745" "04214" "00232746" "04214" "00232747" "04214" "00232748" "04214" "00232749" "04214" "00232750" "04214" "00232751" "04214" "00232752" "04214" "00232753" "04214" "00232754" "04214" "00232755" "04214" "00232756" "04214" "00232757" "04214" "00232758" "04214" "00232759" "04214" "00232760" "04214" "00232761" "04214" "00232762" "04214" "00232763" "04214" "00232764" "04214" "00232765" "04214" "00232766" "04214" "00232767" "04214" "00232768" "04214" "00232769" "04214" "00232770" "04214" "00232771" "04214" "00232772" "04214" "00232773" "04214" "00232774" "04214" "00232775" "04214" "00232776" "04214" "00232777" "04214" "00232778" "04214" "00232779" "04214" "00232780" "04214" "00232781" "04214" "00232782" "04214" "00232783" "04214" "00232784" "04214" "00232785" "04214" "00232786" "04214" "00232787" "04214" "00232788" "04214" "00232789" "04214" "00232790" "04214" "00232791" "04214" "00232792" "04214" "00232793" "04214" "00232794" "04214" "00232795" "04214" "00232796" "04214" "00232797" "04214" "00232798" "04214" "00232799" "04214" "00232800" "04214" "00232801" "04214" "00232802" "04214" "00232803" "04214" "00232804" "04214" "00232805" "04214" "00232806" "04214" "00232807" "04214" "00232808" "04214" "00232809" "04214" "00232810" "04214" "00232811" "04214" "00232812" "04214" "00232813" "04214" "00232814" "04214" "00232815" "04214" "00232816" "04214" "00232817" "04214" "00232818" "04214" "00232819" "04214" "00232820" "04214" "00232821" "04214" "00232822" "04214" "00232823" "04214" "00232824" "04214" "00232825" "04214" "00232826" "04214" "00232827" "04214" "00232828" "04214" "00232829" "04214" "00232830" "04214" "00232831" "04214" "00232832" "04214" "00232833" "04214" "00232834" "04214" "00232835" "04214" "00232836" "04214" "00232837" "04214" "00232838" "04214" "00232839" "04214" "00232840" "04214" "00232841" "04214" "00233691" "04214" "00233692" "04214" "00233693" "04214" "00233694" "04214" "00233695" "04214" "00233696" "04214" "00233697" "04214" "00233698" "04214" "00233699" "04214" "00233700" "04214" "00233701" "04214" "00233702" "04214" "00233703" "04214" "00233704" "04214" "00233705" "04214" "00233706" "04214" "00233707" "04214" "00233708" "04214" "00233709" "04214" "00233710" "04214" "00233711" "04214" "00233712" "04214" "00233713" "04214" "00233714" "04214" "00233715" "04214" "00233716" "04214" "00233717" "04214" "00233718" "04214" "00233719" "04214" "00233720" "04214" "00233721" "04214" "00244508" "00198" "00294168" "00198" "00294169" "00198" "00294170" "00198" "00294171" "00198" "00294172" "00198" "00295602" "00198" "00296002" "00198" "00301666" "00198" "00305112" "00198" "00308406" "04214" "00308507" "04214" "00308508" "04214" "00308509" "04214" "00308510" "04214" "00308511" "04214" "00308636" "04214" "00308643" "04214" "00308644" "04214" "00308645" "04214" "00308646" "04214" "00309136" "04214" "00309137" "04214" "00309138" "04214" "00309139" "04214" "00309140" "04214" "00309141" "04214" "00309142" "04214" "00309143" "04214" "00309144" "04214" "00309145" "04214" "00309146" "04214" "00309147" "04214" "00309148" "04214" "00309149" "04214" "00309150" "04214" "00309151" "04214" "00309152" "04214" "00309153" "04214" "00309154" "04214" "00309155" "04214" "00309156" "04214" "00309157" "04214" "00309158" "04214" "00309159" "04214" "00309160" "04214" "00309161" "04214" "00309162" "04214" "00309163" "04214" "00309164" "04214" "00309165" "04214" "00309725" "04214" "00309755" "04214" "00309756" "04214" "00309757" "04214" "00325464" "04214" "00327933" "04214" "00327954" "04214" "00328010" "04214" "00328061" "04214" "00328087" "04214" "00328159" "04214" "00328167" "04214" "00328218" "04214" "00328229" "04214" "00328266" "04214" "00328293" "04214" "00328315" "04214" "00328323" "04214" "00328324" "04214" "00331247" "04214" "00331248" "04214" "00331249" "04214" "00331250" "04214" "00331251" "04214" "00331252" "04214" "00331253" "04214" "00331254" "04214" "00331255" "04214" "00331256" "04214" "00331257" "04214" "00331258" "04214" "00331259" "04214" "00331260" "04214" "00331261" "04214" "00331262" "04214" "00331263" "04214" "00331264" "04214" "00331265" "04214" "00331266" "04214" "00331267" "04214" "00331703" "05086" "00332488" "04214" "00332489" "04214" "00332490" "04214" "00332507" "04214" "00333399" "04214" "00333400" "04214" "00333401" "04214" "00333402" "04214" "00333423" "04214" "00333424" "04214" "00333824" "04214" "00333825" "04214" "00333826" "04214" "00333827" "04214" "00333890" "04214" "00333901" "04214" "00334416" "04214" "00334417" "04214" "00334558" "04214" "00334560" "04214" "00334563" "04214" "00335231" "04214" "00335245" "04214" "00335274" "04214" "00335336" "04214" "00335337" "04214" "00335416" "04214" "00335420" "04214" "00335424" "04214" "00335973" "04214" "00358979" "04214" "00359131" "04214" "00359149" "04214" "00359160" "04214" "00359162" "04214" "00359164" "04214" "00359185" "04214" "00359207" "04214" "00359329" "04214" "00361426" "04214" "00362210" "04214" "00362212" "04214" "00362216" "04214" "00362218" "04214" "00362234" "04214" "00362240" "04214" "00362243" "04214" "00362906" "04214" "00362907" "04214" "00363635" "04214" "00372628" "04214" "00372638" "04214" "00372645" "04214" "00372646" "04214" "00372653" "04214" "00372655" "04214" "00372667" "04214" "00372677" "04214" "00372681" "04214" "00372683" "04214" "00372687" "04214" "00372688" "04214" "00372690" "04214" "00372693" "04214" "00372697" "04214" "00372699" "04214" "00372700" "04214" "00372701" "04214" "00372719" "04214" "00372722" "04214" "00372732" "04214" "00372733" "04214" "00372736" "04214" "00372741" "04214" "00372745" "04214" "00372750" "04214" "00372757" "02440" "00373365" "04214" "00373368" "04214" "00373820" "04214" "00375411" "04214" "00375416" "04214" "00375426" "04214" "00375428" "04214" "00375429" "04214" "00375430" "04214" "00375435" "04214" "00376288" "04214" "00376289" "04214" "00376313" "04214" "00376314" "04214" "00376751" "04214" "00376752" "04214" "00376753" "04214" "00376754" "04214" "00376755" "04214" "00376758" "04214" "00376760" "04214" "00376763" "04214" "00376765" "04214" "00376770" "04214" "00376777" "04214" "00376778" "04214" "00376782" "04214" "00376783" "04214" "00376784" "04214" "00376789" "04214" "00376866" "04214" "00377242" "04214" "00377256" "04214" "00377257" "04214" "00377502" "04214" "00377526" "04214" "00377935" "04214" "00377936" "04214" "00377945" "04214" "00377946" "04214" "00377957" "04214" "00378015" "00112" "00378021" "00112" "00378031" "00112" "00378049" "00112" "00378051" "00112" "00378052" "00112" "00378065" "00112" "00378067" "00112" "00378070" "00112" "00379376" "04214" "00379377" "04214" "00379378" "04214" "00379534" "00112" "00379537" "00112" "00379545" "00112" "00379547" "00112" "00379559" "04214" "00379573" "04214" "00379633" "00112" "00379650" "00112" "00379668" "00112" "00379671" "00112" "00379748" "00112" "00379753" "00112" "00379755" "00112" "00379763" "00112" "00379766" "00112" "00379775" "00112" "00379795" "00112" "00379835" "04214" "00379836" "04214" "00379837" "04214" "00379838" "04214" "00380148" "04214" "00380158" "00112" "00380170" "04214" "00380171" "04214" "00380173" "04214" "00380205" "04214" "00381013" "04214" "00381675" "04214" "00381684" "04214" "00381851" "04214" "00381852" "04214" "00381853" "04214" "00381854" "04214" "00381855" "04214" "00381856" "04214" "00381857" "04214" "00381858" "04214" "00381859" "04214" "00381860" "04214" "00382278" "04214" "00382279" "04214" "00382280" "04214" "00382281" "04214" "00382282" "04214" "00382283" "04214" "00382284" "04214" "00382285" "04214" "00382286" "04214" "00382287" "04214" "00382288" "04214" "00382289" "04214" "00382290" "04214" "00382291" "04214" "00382292" "04214" "00382293" "04214" "00382294" "04214" "00382295" "04214" "00382296" "04214" "00382297" "04214" "00382298" "04214" "00382299" "04214" "00382300" "04214" "00382301" "04214" "00382302" "04214" "00382303" "04214" "00382304" "04214" "00382305" "04214" "00382306" "04214" "00382419" "04214" "00382464" "04214" "00382540" "04214" "00382541" "04214" "00382542" "04214" "00382543" "04214" "00382544" "04214" "00382545" "04214" "00382725" "04214" "00382855" "04214" "00383489" "04214" "00383490" "04214" "00383491" "04214" "00383492" "04214" "00383741" "04214" "00383748" "04214" "00383764" "04214" "00383786" "04214" "00383787" "04214" "00383789" "04214" "00383824" "04214" "00383842" "04214" "00383904" "04214" "00383908" "04214" "00383924" "04214" "00383950" "04214" "00383977" "04214" "00384008" "04214" "00384052" "04214" "00384055" "04214" "00384059" "04214" "00384089" "04214" "00384102" "04214" "00384121" "04214" "00384128" "04214" "00384168" "04214" "00384173" "04214" "00384175" "04214" "00384182" "04214" "00384271" "04214" "00384283" "04214" "00384741" "04214" "00384742" "04214" "00384743" "04214" "00384757" "04214" "00384758" "04214" "00384759" "04214" "00384760" "04214" "00384761" "04214" "00385175" "04214" "00385395" "04214" "00385397" "04214" "00385405" "04214" "00385702" "04214" "00385713" "04214" "00385720" "04214" "00385728" "04214" "00385846" "04214" "00386226" "04214" "00386234" "04214" "00386257" "04214" "00386274" "04214" "00386282" "04214" "00386283" "04214" "00386291" "04214" "00386302" "04214" "00386567" "04214" "00386573" "04214" "00386574" "04214" "00386588" "04214" "00386593" "04214" "00386601" "04214" "00386609" "04214" "00386618" "04214" "00386623" "04214" "00386624" "04214" "00386628" "04214" "00386635" "04214" "00386645" "04214" "00386651" "04214" "00386652" "04214" "00386669" "04214" "00386673" "04214" "00386700" "04214" "00386712" "04214" "00386726" "04214" "00386734" "04214" "00386736" "04214" "00386740" "04214" "00386741" "04214" "00386758" "04214" "00386799" "04214" "00386812" "04214" "00386825" "04214" "00386848" "04214" "00386872" "04214" "00386917" "04214" "00387039" "04214" "00387040" "04214" "00387041" "04214" "00387042" "04214" "00387043" "04214" "00387044" "04214" "00387045" "04214" "00387046" "04214" "00387047" "04214" "00387048" "04214" "00387049" "04214" "00387050" "04214" "00387390" "04214" "00387392" "04214" "00387629" "04214" "00388478" "04214" "00388480" "04214" "00388488" "04214" "00388504" "04214" "00388505" "04214" "00388542" "04214" "00388826" "04214" "00388827" "04214" "00388834" "04214" "00388835" "04214" "00388851" "04214" "00388881" "04214" "00389195" "04214" "00389268" "04214" "00389274" "04214" "00389275" "04214" "00389300" "04214" "00389301" "04214" "00389335" "04214" "00389336" "04214" "00389394" "04214" "00389435" "04214" "00389436" "04214" "00389442" "04214" "00389537" "04214" "00389542" "04214" "00389573" "04214" "00389601" "04214" "00389605" "04214" "00389638" "04214" "00389639" "04214" "00389646" "04214" "00389683" "04214" "00389769" "04214" "00389790" "04214" "00389803" "04214" "00389809" "04214" "00389812" "04214" "00389827" "04214" "00389876" "04214" "00389932" "04214" "00389934" "04214" "00389963" "04214" "00389977" "04214" "00390010" "04214" "00390251" "04214" "00390252" "04214" "00390253" "04214" "00390254" "04214" "00390255" "04214" "00390256" "04214" "00390257" "04214" "00390258" "04214" "00390259" "04214" "00390260" "04214" "00390473" "04214" "00390738" "04214" "00390739" "04214" "00390808" "04214" "00391227" "04214" "00391229" "04214" "00391230" "04214" "00391231" "04214" "00391233" "04214" "00391235" "04214" "00391238" "04214" "00391239" "04214" "00391240" "04214" "00391243" "04214" "00391244" "04214" "00391245" "04214" "00391246" "04214" "00391248" "04214" "00391260" "04214" "00391262" "04214" "00391263" "04214" "00391267" "04214" "00391272" "04214" "00391273" "04214" "00391274" "04214" "00391276" "04214" "00391277" "04214" "00391278" "04214" "00391279" "04214" "00391281" "04214" "00391284" "04214" "00391285" "04214" "00391286" "04214" "00391287" "04214" "00391288" "04214" "00392371" "04214" "00392575" "04214" "00392578" "04214" "00392579" "04214" "00392583" "04214" "00392600" "04214" "00392602" "04214" "00392604" "04214" "00392652" "04214" "00392660" "04214" "00392661" "04214" "00392662" "04214" "00393494" "04214" "00393562" "04214" "00393569" "04214" "00393584" "04214" "00393590" "04214" "00393594" "04214" "00393601" "04214" "00393617" "04214" "00393686" "04214" "00393698" "04214" "00393700" "04214" "00393714" "04214" "00393747" "04214" "00393776" "04214" "00393805" "04214" "00393813" "04214" "00393825" "04214" "00393853" "04214" "00393869" "04214" "00393897" "04214" "00393902" "04214" "00393998" "04214" "00394319" "04214" "00394320" "04214" "00394554" "04214" "00394570" "04214" "00394571" "04214" "00394572" "04214" "00394573" "04214" "00394574" "04214" "00394575" "04214" "00394576" "04214" "00394577" "04214" "00394578" "04214" "00394579" "04214" "00394580" "04214" "00394581" "04214" "00394582" "04214" "00394583" "04214" "00394584" "04214" "00394585" "04214" "00394586" "04214" "00394587" "04214" "00394588" "04214" "00394589" "04214" "00394590" "04214" "00394591" "04214" "00394592" "04214" "00394593" "04214" "00394594" "04214" "00394595" "04214" "00394596" "04214" "00394597" "04214" "00395422" "04214" "00395423" "04214" "00395424" "04214" "00395577" "04214" "00395789" "04214" "00395791" "04214" "00395799" "04214" "00395811" "04214" "00395814" "04214" "00395817" "04214" "00395818" "04214" "00395832" "04214" "00395833" "04214" "00395834" "04214" "00395835" "04214" "00395837" "04214" "00395838" "04214" "00395839" "04214" "00395840" "04214" "00395845" "04214" "00395848" "04214" "00395884" "04214" "00395904" "04214" "00395913" "04214" "00395923" "04214" "00395929" "04214" "00395949" "04214" "00395964" "04214" "00396429" "04214" "00396463" "04214" "00396491" "04214" "00396492" "04214" "00396493" "04214" "00396495" "04214" "00396498" "04214" "00396500" "04214" "00396501" "04214" "00396503" "04214" "00396504" "04214" "00396505" "04214" "00396506" "04214" "00396514" "04214" "00396516" "04214" "00396517" "04214" "00396518" "04214" "00396519" "04214" "00396523" "04214" "00396524" "04214" "00396534" "04214" "00396535" "04214" "00396540" "04214" "00396542" "04214" "00396552" "04214" "00396556" "04214" "00396562" "04214" "00396574" "04214" "00396578" "04214" "00396580" "04214" "00396582" "04214" "00396586" "04214" "00396588" "04214" "00396590" "04214" "00396598" "04214" "00396602" "04214" "00396604" "04214" "00396606" "04214" "00396608" "04214" "00396614" "04214" "00396622" "04214" "00396624" "04214" "00396630" "04214" "00396631" "04214" "00396632" "04214" "00396638" "04214" "00396641" "04214" "00396643" "04214" "00396644" "04214" "00396645" "04214" "00396651" "04214" "00396652" "04214" "00396653" "04214" "00396654" "04214" "00400083" "05415" "00402260" "04214" "00402269" "04214" "00408415" "04214" "00408416" "04214" "00408440" "04214" "00408441" "04214" "00408996" "00112" "00408997" "00112" "00409501" "04214" "00409502" "04214" "00409504" "04214" "00409505" "04214" "00409506" "04214" "00409509" "04214" "00409510" "04214" "00409511" "04214" "00409512" "04214" "00409513" "04214" "00409514" "04214" "00409519" "04214" "00409520" "04214" "00409521" "04214" "00409522" "04214" "00409523" "04214" "00410969" "04214" "00410970" "04214" "00410971" "04214" "00410972" "04214" "00410973" "04214" "00410974" "04214" "00410975" "04214" "00410976" "04214" "00410977" "04214" "00410978" "04214" "00410979" "04214" "00410980" "04214" "00410981" "04214" "00410982" "04214" "00410983" "04214" "00410984" "04214" "00410985" "04214" "00410986" "04214" "00410987" "04214" "00410988" "04214" "00410989" "04214" "00410990" "04214" "00410991" "04214" "00410992" "04214" "00410993" "04214" "00410994" "04214" "00410995" "04214" "00410996" "04214" "00410997" "04214" "00410998" "04214" "00410999" "04214" "00411000" "04214" "00411001" "04214" "00411002" "04214" "00411003" "04214" "00411004" "04214" "00411005" "04214" "00411006" "04214" "00411007" "04214" "00411008" "04214" "00411009" "04214" "00414435" "00198" "00419691" "04214" "00419869" "00112" "00419870" "00112" "00419871" "00112" "00419872" "00112" "00419873" "00112" "00419874" "00112" "00419875" "00112" "00419876" "00112" "00419877" "00112" "00419878" "00112" "00419879" "00112" "00419880" "00112" "00419881" "00112" "00420391" "04214" "00420395" "04214" "00420398" "04214" "00420407" "04214" "00420420" "04214" "00420443" "04214" "00420445" "04214" "00420450" "04214" "00420451" "04214" "00420476" "04214" "00420479" "04214" "00420499" "04214" "00420500" "04214" "00420505" "04214" "00420518" "04214" "00420542" "04214" "00420545" "04214" "00420548" "04214" "00420556" "04214" "00420563" "04214" "00420564" "04214" "00420570" "04214" "00420586" "04214" "00425888" "04214" "00426913" "04214" "00429496" "00112" "00429502" "00112" "00429512" "00112" "00429519" "00112" "00429529" "00112" "00429545" "00112" "00429548" "00112" "00429553" "00112" "00429554" "00112" "00429555" "00112" "00429558" "00112" "00429565" "00112" "00429566" "00112" "00429575" "00112" "00429576" "00112" "00429577" "00112" "00429580" "00112" "00429582" "00112" "00429592" "00112" "00429593" "00112" "00429597" "00112" "00429602" "00112" "00429624" "00112" "00429626" "00112" "00429673" "00112" "00429679" "00112" "00429683" "00112" "00429691" "00112" "00429717" "00112" "00429734" "00112" "00429737" "00112" "00429746" "00112" "00429771" "00112" "00429775" "00112" "00429801" "00112" "00429806" "00112" "00429851" "00112" "00429854" "00112" "00429904" "00112" "00429917" "04214" "00429921" "00112" "00429934" "00112" "00429941" "00112" "00429966" "00112" "00429978" "00112" "00429999" "00112" "00430026" "00112" "00430043" "00112" "00430052" "00112" "00430055" "00112" "00430067" "00112" "00430068" "04214" "00430073" "00112" "00430078" "00112" "00430089" "00112" "00430116" "00112" "00430118" "00112" "00430904" "04214" "00436163" "04214" "00436418" "04211" "00436438" "02156" "00438692" "06906" "00441658" "00058" "00441659" "00112" "00444256" "04214" "00446969" "00198" "00446986" "00198" "00446987" "00198" "00446993" "00198" "00446994" "00198" "00447004" "00198" "00447020" "00198" "00447059" "00198" "00447258" "00198" "00447261" "00198" "00447266" "00198" "00447268" "00198" "00447269" "00198" "00447272" "00198" "00447278" "00198" "00447290" "00198" "00447305" "00198" "00447456" "00198" "00447504" "00198" "00447505" "00198" "00447508" "00198" "00447509" "00198" "00447513" "00198" "00447515" "00198" "00447594" "00198" "00447610" "00198" "00447614" "00198" "00447620" "00198" "00447632" "00198" "00447702" "00198" "00447707" "00198" "00447716" "00198" "00447718" "00198" "00447720" "00198" "00449982" "04214" "00450840" "04249" "00450841" "04249" "00450842" "04249" "00450843" "04249" "00450844" "04249" "00451067" "04249" "00451068" "04249" "00451149" "04249" "00451155" "04249" "00451166" "04249" "00451252" "04249" "00451259" "04249" "00451333" "04249" "00451348" "04249" "00458998" "04214" "00459006" "00112" "00459007" "00112" "00461113" "04214" "00461135" "04214" "00461137" "04214" "00465319" "02440" "00467828" "04214" "00479985" "05412" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00012, 00058, 00112, 00139, 00173, 00198, 02156, 02440, 04211, 04214, 04249, 05086, 05412, 05415, 05468, 06906 ## Count = 1343 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Biochem_param}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Severity_score}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000000008" "00012" "00000135" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000000026" "00058" "00000210" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000000941" "00173" "00001962" "00025" "Familial" "" "2-3 toe syndactyly" "" "" "" "5" "" "" "" "" "" "" "" "" "0000026525" "04214" "00033096" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026538" "04214" "00033109" "00229" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026561" "04214" "00033132" "00229" "Unknown" "06y" "retinal degeneration, severe, early onset (EOSRD)" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026586" "04214" "00033157" "00229" "Familial, autosomal recessive" "58y" "extraocular phenotype; cardiomyopathy, hypertrophic" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000026778" "04214" "00033349" "00039" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000028901" "04214" "00038358" "01251" "Isolated (sporadic)" "" "?" "" "" "" "" "?" "" "" "" "" "" "retinitis pigmentosa" "" "0000074213" "04211" "00095925" "01769" "Familial, autosomal recessive" "" "Progressive RP" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000078341" "04214" "00100104" "01769" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000082482" "00139" "00104565" "01836" "Isolated (sporadic)" "" "born at term, uneventful pregnancy; birth weight/height/head circumference normal; mild developmental delay10m-crawling, 18m walking; 18m myoclonic epilepsy; 4y brain MRI normal, ECG generalized spike/(poly)spike waves discharges; 7y difficulty speech/language/walking, no pyramidal and cerebellar syndromes; 12y never seizure-free (1 every 10d; 19y minor facial dysmorphy, dental anomalies, strabismus, down turned corners mouth" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000082908" "04214" "00105016" "01244" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116612" "04214" "00143834" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116613" "04214" "00143835" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116614" "04214" "00143836" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116615" "04214" "00143837" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116616" "04214" "00143838" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116617" "04214" "00143839" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116618" "04214" "00143840" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116619" "04214" "00143841" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116620" "04214" "00143842" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116621" "04214" "00143843" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116622" "04214" "00143844" "01780" "Familial, autosomal recessive" "" "characteristic RP abnormalities, including night blindness as the initial symptom, retinal bone-spicule pigmentations and attenuated retinal vessels, constriction of the visual fields, and a nonrecordable ERG or ERG responses in a rod-cone pattern; posterior subcapsular cataract" "" "12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116623" "04214" "00143845" "01780" "Familial, autosomal recessive" "" "photoreceptor dystrophy, but the cones were more severly affected than were the rods. This is also reflected by the central scotomas on the kinetic visual field. Fundus abnormalities included central abnormalities at the level of the RPE and moderate attenuation of the retinal vessels" "" "28y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116624" "04214" "00143846" "01780" "Familial, autosomal recessive" "" "characteristic RP abnormalities, including night blindness as the initial symptom, retinal bone-spicule pigmentations and attenuated retinal vessels, constriction of the visual fields, and a nonrecordable ERG or ERG responses in a rod-cone pattern" "" "45y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116625" "04214" "00143847" "01780" "Familial, autosomal recessive" "" "characteristic RP abnormalities, including night blindness as the initial symptom, retinal bone-spicule pigmentations and attenuated retinal vessels, constriction of the visual fields, and a nonrecordable ERG or ERG responses in a rod-cone pattern" "" "46y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116626" "04214" "00143848" "01780" "Familial, autosomal recessive" "" "characteristic RP abnormalities, including night blindness as the initial symptom, retinal bone-spicule pigmentations and attenuated retinal vessels, constriction of the visual fields, and a nonrecordable ERG or ERG responses in a rod-cone pattern" "" "42y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116627" "04214" "00143849" "01780" "Familial, autosomal recessive" "" "characteristic RP abnormalities, including night blindness as the initial symptom, retinal bone-spicule pigmentations and attenuated retinal vessels, constriction of the visual fields, and a nonrecordable ERG or ERG responses in a rod-cone pattern; posterior subcapsular cataract" "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116628" "04214" "00143850" "01780" "Isolated (sporadic)" "" "At age 49: Progressive vision loss; poor night vision; poor color discrimination; BCVA R 6/24 L 6/18; visual evoked potential R/L normal; fundus Pale optic disc; moderate bone spicules in mid periphery" "" "47y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116629" "04214" "00143851" "01780" "Isolated (sporadic)" "" "At age 51: Poor night vision; BCVA R 6/36 L 6/24; visual evoked potential R/L moderately decreased amplitude; fundus Pink optic disc; RPE changes in midperiphery without macular involvement; no bone spicules" "" "50y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116630" "04214" "00143852" "01780" "Familial, autosomal recessive" "" "At age 62: visual acuity HM; vitreous fibrosis and bone spicules pigments in the retina" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116631" "04214" "00143853" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116632" "04214" "00143854" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116633" "04214" "00143855" "01780" "Familial, autosomal recessive" "" "At age 28: visual acuity: OD 20/25, OS 20/32; No pale optic disc, narrowed retinal vessels, little changes in the periphery with white dots and few bone spicules, relatively preserved posterior pole; relatively preserved foveal lamination; patchy loss of AF outside the vascular arcade, perifoveal ring of AF" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116634" "04214" "00143856" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116635" "04214" "00143857" "01780" "Familial, autosomal recessive" "" "At age 48: visual acuity: OD HM, OS HM; Some degree of bilateral posterior subcapsular cataract, pale optic discs, optic disc drusen; Narrowed blood vessels, perifoveal atrophy; RPE changes and bone spicules in periphery; Foveal thining, perifoveal loss of AF heretogeneous loss of AF outside and within the arcade" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116636" "04214" "00143858" "01780" "Familial, autosomal recessive" "" "At age 42: visual acuity: OD 20/25, OS 20/20; Normal optic disc and blood vessels, RPE atrophy and bone spicules predominant in the inferior part of the retina resembling sector RP; Preserved foveal lamination; Loss of autofluorescnec in the inferior part of the retina and within the temporal side outlined by an area of increased autofluorescence" "" "" "" "" "Night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116637" "04214" "00143859" "01780" "Familial, autosomal recessive" "" "At age 25: visual acuity: OD 20/32, OS 20/32; Normal optic disc and blood vessels; some RPE changes in periphery; Relative preservation of foveal lamination; Loss of AF outside the vascular arcade with perifoveal ring of increase AF" "" "" "" "" "Night blindness since early childhood, visual field constriction noticed at 10" "" "" "" "" "" "retinitis pigmentosa" "" "0000116638" "04214" "00143860" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116639" "04214" "00143861" "01780" "Familial, autosomal recessive" "" "Refraction: NA; visual acuity: NA; ffERG: R&L Extinguished" "" "36y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116640" "04214" "00143862" "01780" "Familial, autosomal recessive" "" "Refraction: R -4.25/-1.00 x 35°, L -6.00/-0.75 x 175°; visual acuity: R&L CF 2m; ffERG: R&L Extinguished" "" "36y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116641" "04214" "00143863" "01780" "Familial, autosomal recessive" "" "Refraction: NA; visual acuity: NA; ffERG: R Extinguished L not performed" "" "19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116642" "04214" "00143864" "01780" "Familial, autosomal recessive" "" "Refraction: NA; visual acuity: R/L 0.7; ffERG: R not performed L Extinguished" "" "18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116643" "04214" "00143865" "01780" "Isolated (sporadic)" "" "Refraction: R -2.00/-0.25 x 35°, L -2.00/-1.00 x 140°; visual acuity: R 0.5 L 0.8; ffERG: R&L Extinguished" "" "21y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116644" "04214" "00143866" "01780" "Familial, autosomal recessive" "" "Refraction: NA; visual acuity: R 0.1 L 0.25; ffERG: R&L Extinguished" "" "33y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116645" "04214" "00143867" "01780" "Isolated (sporadic)" "" "Refraction: NA; visual acuity: R 0.5 L 0.6; ffERG: R 27; 53/97; 8, 36, L 29; 31/81; 7, 36 (rod response b-wave amplitude (normal, 200 V); mixed cone–rod a-/b-wave (normal a-wave, 90 V; normal b-wave, 400 V); cone response (normal, 60 V), implicit time (normal, 33 ms))" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116646" "04214" "00143868" "01780" "Isolated (sporadic)" "" "Refraction: NA; visual acuity: R 0.15 L 0.15; ffERG: NP" "" "41y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116647" "04214" "00143869" "01780" "Isolated (sporadic)" "" "Refraction: R -0.75/-3.00 x 40°, L -2.50/-1.50 x 50°; visual acuity: R CF 2.5m L CF 1m; ffERG: NP" "" "57y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116648" "04214" "00143870" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116649" "04214" "00143871" "01780" "Familial, autosomal recessive" "" "Age 63; visual acuity R=2/400, L=2/400; Optic disc pallor, narrow vessels, and peripapillary atrophy. Extensive and diffuse choroidal show and choroidal sclerosis, with RPE loss and bone spicule pigmentation." "" "8y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116650" "04214" "00143872" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116651" "04214" "00143873" "01780" "Isolated (sporadic)" "" "Age 25; visual acuity R=20/20, L=20/25; Pink optic disc, moderately attenuated vessels, cystoid maculopathy, in (mid)periphery RPE atrophy with some bone-spicules and some drusen-like deposits." "" "17y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116652" "04214" "00143874" "01780" "Isolated (sporadic)" "" "Age 42; visual acuity R=20/25, L=20/25; Waxy pallor of the optic disc, attenuated retinal vasculature, generalized chorioretinal atrophy, mild bone spicule pigmentation clustered in periphery" "" "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116653" "04214" "00143875" "01780" "Familial, autosomal recessive" "" "Age 39; visual acuity R=20/50, L=20/40; pink, waxy optic disc, moderately attenuated retinal vessels, and generalized chorioretinal atrophy with macular sparing, bone spicules in periphery" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116654" "04214" "00143876" "01780" "Familial, autosomal recessive" "" "Age 36; visual acuity R=20/32, L=20/32; Waxy optic disc with temporal pallor, attenuated retinal vasculature, extensive chorioretinal atrophy few bone spicules in periphery." "" "17y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116655" "04214" "00143877" "01780" "Familial, autosomal recessive" "" "night blindness at the age of 15 years, and progressively lost his visual acuity to 20/400 at approximately the age of 35-40 years; attenuation of the retinal arteries, waxen color of discs, and bone-spicule pigmentation in the peripheral-mid retina; extinguished or very low amplitude ERG in both eyes" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116656" "04214" "00143878" "01780" "Familial, autosomal recessive" "" "Night blindness appeared late in the second decade of life, low visual acuity between 20/400 and hand movement, and a flat ERG" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116657" "04214" "00143879" "01780" "Familial, autosomal recessive" "" "Night blindness appeared late in the second decade of life, low visual acuity between 20/400 and hand movement, and a flat ERG" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116658" "04214" "00143880" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116659" "04214" "00143881" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116660" "04214" "00143882" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116661" "04214" "00143883" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116662" "04214" "00143884" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116663" "04214" "00143885" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116664" "04214" "00143886" "01780" "Familial, autosomal recessive" "" "night blindness that started early in the second decade of life" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116665" "04214" "00143887" "01780" "Familial, autosomal recessive" "" "night blindness that started early in the second decade of life; age 40 bone spicule pigmentations at the periphery (arrows), and attenuated retinal vessels (arrowheads); VA RE (OD)= 20/630 LE (OS)=20/630, at time of diagnosis 20/400 both eyes" "" "12y-15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116666" "04214" "00143888" "01780" "Familial, autosomal recessive" "" "night blindness that started early in the second decade of life; age 38 bone spicule pigmentations at the periphery (arrows), and attenuated retinal vessels (arrowheads); at age 42 VA RE (OD)= 20/125 LE (OS)=20/400, at time of diagnosis 20/125 both eyes" "" "12y-15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116667" "04214" "00143889" "01780" "Familial, autosomal recessive" "" "night blindness that started early in the second decade of life" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116668" "04214" "00143890" "01780" "Familial, autosomal recessive" "" "night blindness that started early in the second decade of life" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116669" "04214" "00143891" "01780" "Familial, autosomal recessive" "" "night blindness that started early in the second decade of life" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116670" "04214" "00143892" "01780" "Familial, autosomal recessive" "" "Onset of night blindness was at adolescence, whereas fundus examination revealed bone spicules and arterial attenuation (no fundus picture available). Low visual acuity; VA at time of diagnosis 20/400 both eyes" "" "16y-18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116671" "04214" "00143893" "01780" "Familial, autosomal recessive" "" "Onset of night blindness was at adolescence, whereas fundus examination revealed bone spicules and arterial attenuation (no fundus picture available). Low visual acuity; VA at time of diagnosis 20/400 both eyes" "" "16y-18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116672" "04214" "00143894" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116673" "04214" "00143895" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116674" "04214" "00143896" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116675" "04214" "00143897" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116676" "04214" "00143898" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116677" "04214" "00143899" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116678" "04214" "00143900" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116679" "04214" "00143901" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116680" "04214" "00143902" "01780" "Familial, autosomal dominant" "" "Age 56; Age diagnosis 55; symptom: Night blindness in her mid-twenties; visual acuity: R 0,2 L 0,5; lens status: IOL (NS); Fundoscopy results: Normal optic disc, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116681" "04214" "00143903" "01780" "Familial, autosomal recessive" "" "Age 53; Age diagnosis 33; symptom: Night blindness after age 20; visual acuity: R 0,2 L 0,03; lens status: IOL (ASC); Fundoscopy results: Normal optic disc, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules. OCT: severe foveal atrophy in both eyes." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116682" "04214" "00143904" "01780" "Isolated (sporadic)" "" "Age 67; Age diagnosis 41; symptom: Night blindness after age 20; visual acuity: R 0,3 L 0,3; lens status: IOL (NS); Fundoscopy results: Mild optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116683" "04214" "00143905" "01780" "Isolated (sporadic)" "" "Age 50; Age diagnosis 48; symptom: Night blindness since early childhood; visual acuity: R 1,2 L 1,2; lens status: NS cataract; Fundoscopy results: Mild optic disc pallor, moderately attenuated vessels, mid-periphery and macular RPE atrophy with bone spicules" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116684" "04214" "00143906" "01780" "Isolated (sporadic)" "" "Age 50; Age diagnosis 39; symptom: Night blindness since age 12; visual acuity: R 1 L 1; lens status: IOL (PSC); Fundoscopy results: Normal optic disc, moderately attenuated vessels, mid-periphery RPE atrophy with bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116685" "04214" "00143907" "01780" "Isolated (sporadic)" "" "Age 54; Age diagnosis 39; symptom: Night blindness after age 20; visual acuity: R 0,9 L 1; lens status: Clear; Fundoscopy results: Normal optic disc, mild attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116686" "04214" "00143908" "01780" "Familial, autosomal recessive" "" "visual acuity: R 0.07 L 0.08; refraction R(D) +1 L(D) +1.25; lens status: bilateral pseudophakia; Goldmann Perimetry: OD 8°, OS 7°; fundoscopy: waxy optic disc, attenuated retinal vasulature, RPE changes in periphery, extensive bone spicules throughout periphery; ERG: extinguished" "" "14y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116687" "04214" "00143909" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116688" "04214" "00143910" "01780" "Isolated (sporadic)" "" "visual acuity: R 0.6 L 0.6; refraction R(D) -1.25 L(D) -.; lens status: clear; Goldmann Perimetry: OD 6°, OS 7°; fundoscopy: normal optic disc, slightly attenuated vessels, RPE changes in periphery and posterior pole, extensive bone spicules throughout periphery" "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116689" "04214" "00143911" "01780" "Familial, autosomal recessive" "" "visual acuity: R LP L LP; refraction R(D) -3 L(D) -3; lens status: bilateral pseudophakia; Goldmann Perimetry: unmeasurable; fundoscopy: waxy optic disc, attenuated retinal vasulature, RPE changes in periphery and posterior pole, extensive bone spicules throughout periphery; OCT: relatively preserved foveal lamination; ERG: extinguished" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116690" "04214" "00143912" "01780" "Isolated (sporadic)" "" "visual acuity: R 1 L 1; refraction R(D) -6 L(D) -5.25; lens status: clear; Goldmann Perimetry: OD, OS: concentric constriction with remaining centrl island, remaining peripheral island. P0; fundoscopy: normal optic disc, slightly attenuated vessels, RPE changes in periphery, bone spicules sprinkled throughout periphery" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116691" "04214" "00143913" "01780" "Familial, autosomal recessive" "" "visual acuity: R 0.7 L 0.3; refraction R(D) -2.25 L(D) -1.5; lens status: right cateract, left pseudophakia; Goldmann Perimetry: OD 8°, OS 8°; fundoscopy: waxy optic disc, attenuated retinal vasulature, RPE changes in periphery and posterior pole, extensive bone spicules throughout periphery; OCT: foveal thinning" "" "20y-30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116692" "04214" "00143914" "01780" "Isolated (sporadic)" "" "visual acuity: R 0.6 L 0.6; refraction R(D) 0 L(D) 0; lens status clear; Goldmann Preimetry: OD, OS: concentric constriction with remaining central island, remaining peripheral island; fundoscopy: waxy optic disc, attenuated retinal vasulature, RPE changes in periphery, extensive bone spicules throughout periphery" "" "06y-12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116693" "04214" "00143915" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116694" "04214" "00143916" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116695" "04214" "00143917" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116696" "04214" "00143918" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116697" "04214" "00143919" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116698" "04214" "00143920" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116699" "04214" "00143921" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116700" "04214" "00143922" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116701" "04214" "00143923" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116702" "04214" "00143924" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116703" "04214" "00143925" "01780" "Isolated (sporadic)" "" "At age 78: blurred vision, night blindness, visual field defect (contraction); visual acuity (logMAR) R=0.2 L=0.3; visual field tubular ≤10°; pale optic disc, attenuated arterioles, bone spicules; ERG estinguished" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116704" "04214" "00143926" "01780" "Familial, autosomal recessive" "" "Fundus: bone spicule pigmentation, attenuation of the retinal vessels, waxy pallor of the optic disc" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116705" "04214" "00143927" "01780" "Familial, autosomal recessive" "" "Fundus: bone spicule pigmentation, attenuation of the retinal vessels, waxy pallor of the optic disc" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116706" "04214" "00143928" "01780" "Familial, autosomal recessive" "" "Fundus: bone spicule pigmentation, attenuation of the retinal vessels, waxy pallor of the optic disc" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116707" "04214" "00143929" "01780" "Familial, autosomal recessive" "" "NA" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116708" "04214" "00143930" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116709" "04214" "00143931" "01780" "Isolated (sporadic)" "" "NA" "" "1y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116710" "04214" "00143932" "01780" "Isolated (sporadic)" "" "ERG L and R a/b-wave with reduced amplitude; Fundus L and R pigment deposits, optic disk waxy" "" "1d" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116711" "04214" "00143933" "01780" "Isolated (sporadic)" "" "NA" "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116712" "04214" "00143934" "01780" "Isolated (sporadic)" "" "NA" "" "14y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116713" "04214" "00143935" "01780" "Isolated (sporadic)" "" "NA" "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116714" "04214" "00143936" "01780" "Isolated (sporadic)" "" "ERG L and R a/b-wave with reduced amplitude; Fundus L and R pigment deposits, optic disk waxy" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116715" "04214" "00143937" "01780" "Familial, autosomal recessive" "" "disease progressed so slowly that she did not notice VF constriction until age 24. At age 33: BCVA R 20/50 L 20/40; VF less than 15° for both eyes; no pigment deposit; OCT thickened inner/outer segment (IS/OS) layer with a preserved macular structure" "" "8y" "" "" "night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "0000116716" "04214" "00143938" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116717" "04214" "00143939" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116718" "04214" "00143940" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116719" "04214" "00143941" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116720" "04214" "00143942" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116721" "04214" "00143943" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116722" "04214" "00143944" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116725" "04214" "00143947" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116726" "04214" "00143948" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116727" "04214" "00143949" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116728" "04214" "00143950" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116729" "04214" "00143951" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116730" "04214" "00143952" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116731" "04214" "00143953" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116732" "04214" "00143954" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116733" "04214" "00143955" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116734" "04214" "00143956" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116735" "04214" "00143957" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116736" "04214" "00143958" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116737" "04214" "00143959" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116738" "04214" "00143960" "01780" "Familial, autosomal recessive" "" "variable grades of low visual acuity, waxy pallor of the optic disc, bone spicule pigmentation in the mid-retinal periphery extending to the far periphery and unmasking the underlying choroidal blood vessels, attenuated retinal arteries, and atrophy of foveal and retinal layer and flat or absent ERGs." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116739" "04214" "00143961" "01780" "Isolated (sporadic)" "" "" "" "40y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116740" "04214" "00143962" "01780" "Familial, autosomal recessive" "" "Age 34, BCVA: 0,5/0,4" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116741" "04214" "00143963" "01780" "Isolated (sporadic)" "" "Age 31, BCVA: 0,2/0,2" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116742" "04214" "00143964" "01780" "Familial, autosomal recessive" "" "Age diagnosis 23" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116743" "04214" "00143965" "01780" "Isolated (sporadic)" "" "Age diagnosis 15" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116744" "04214" "00143966" "01780" "Familial, autosomal recessive" "" "Age examination 30: first symptom: poor vision, night blindness; visual acuity OD/OS: 0,3/0,4, fundus exam.: attenuated retinal arteries, pigment deposit, no foveal reflex" "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116745" "04214" "00143967" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116746" "04214" "00143968" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116747" "04214" "00143969" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116748" "04214" "00143970" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116749" "04214" "00143971" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116750" "04214" "00143972" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116751" "04214" "00143973" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116752" "00058" "00143974" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000116753" "04214" "00143975" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116754" "04214" "00143976" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116755" "04214" "00143977" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116756" "04214" "00143978" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116757" "04214" "00143979" "01780" "Isolated (sporadic)" "" "At age 29: Poor night vision; BCVA R 6/9 L 6/9; visual evoked potential R/L normal; fundus Mildly pale optic disc; generalized RPE changes without macular involvement; mild bone spicules" "" "19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116758" "04214" "00143980" "01780" "Familial, autosomal recessive" "" "At age 60: bone-spicule–like pigmentation in the periphery of the retina" "" "43y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116759" "04214" "00143981" "01780" "Familial, autosomal recessive" "" "" "" "36y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116760" "04214" "00143982" "01780" "Familial, autosomal recessive" "" "" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116761" "04214" "00143983" "01780" "Familial, autosomal recessive" "" "no RP symptoms, and she also had a normal fundus appearance until the age of 29 but showed extinguished ERGs" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116762" "04214" "00143984" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116763" "04214" "00143985" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116764" "04214" "00143986" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116765" "04214" "00143987" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116766" "04214" "00143988" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116767" "04214" "00143989" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116768" "04214" "00143990" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116769" "04214" "00143991" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116770" "04214" "00143992" "01780" "Unknown" "" "At age 19: visual acuity: OD 20/50, OS 20/50; small pigmented opacities on posterior capsule; Pale optic disc, optic disc drusen, discrete narrowing of retinal vessels, little changes in the periphery with few bone spicules; chronic CME; Patchy loss of AFoutside the vascular arcade, perifoveal ring of increased AF, foveal changes due to CME" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116771" "04214" "00143993" "01780" "Unknown" "" "At age 30: visual acuity: OD 20/25, OS 20/20; No pale optic disc, narrowed retinal vessels, little changes in the periphery with white dots and few bone spicules, relatively preserved posterior pole; relatively preserved foveal lamination; patchy loss of AF outside the vascular arcade, perifoveal ring of AF" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116772" "04214" "00143994" "01780" "Familial, autosomal recessive" "" "At age 73: visual acuity: OD 20/40, OS 20/32; bilateral IOL since age 65; Pale optic disc, narrowed retinal vessels, bone spicules in periphery, some perifoveal RPE atrophy; some degree of macular thickening, history of CME; loss of AF outside the vascular arcade also associated with perifoveal loss of AF" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116773" "04214" "00143995" "01780" "Familial, autosomal recessive" "" "At age 33: visual acuity: OD 20/40, OS 20/40; mild pale optic disc and narrowed blood vessels, perifoveal atrophy; relative preseration of foveal lamination; loss of AF outside the vascular arcade also associated with perifoveal loss of AF" "" "13y" "" "" "Night blindness since age 13" "" "" "" "" "" "retinitis pigmentosa" "" "0000116774" "04214" "00143996" "01780" "Familial, autosomal recessive" "" "At age 38: visual acuity: OD 20/63, OS HM; Waxy disc pallor, narrowed retinal vessels, bone spicules in periphery, some perifoveal RPE atrophy; Relatively preserved foveal laminationwith some areas of PR/IS/OS thining; Loss of AF outside the vascular arcade as well as in perifoveolar area" "" "" "" "" "Night blindness since early childhood, photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "0000116775" "04214" "00143997" "01780" "Familial, autosomal recessive" "" "At age 34: visual acuity: OD 20/50, OS 20/50; Optic disc pallor, narrowed retinal vessels, little changes in the periphery with few bone spicules; Relatively preserved foveal lamination; Patchy areas of loss of autofluorescence outside the vascular arcades with perifoveal ring of increased AF" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116776" "04214" "00143998" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116777" "04214" "00143999" "01780" "Familial, autosomal recessive" "" "At age 63: visual acuity: OD 20/63, OS 20/100; Some degree of bilateral posterior subcapsular cataract, waxy optic disc pallor narrowed retinal vessels RPE changes outside vascular arcades with relatively preserved central retina, peripappilary atrophy; CME; Widespread loss of peripheral AF with some preservation centrally" "" "" "" "" "Night blindness since early childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116778" "04214" "00144000" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116779" "04214" "00144001" "01780" "Familial, autosomal recessive" "" "At age 16: visual acuity: OD 20/16, OS 20/20; normal optic disc and blood vessels; some RPE changes in periphery; Preserved foveal lamination; Relatively preserved outside vascular arcade, perifoveal ring of hyper AF" "" "" "" "" "Night blindness since early childhood, photopsia" "" "" "" "" "" "retinitis pigmentosa" "" "0000116780" "04214" "00144002" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116781" "04214" "00144003" "01780" "Familial, autosomal recessive" "" "At age 37: visual acuity: OD 20/50, OS 20/63; Waxy optic disc pallor, narrowed retinal vessels, RPE atrophy and bone spicules in the periphery, perifoveal atrophy; Foveal thinning; Loss of AF outside the vascular arcade associated with perifoveal loss of AF" "" "" "" "" "Night blindness since childhood, photopsia, visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "0000116782" "04214" "00144004" "01780" "Familial, autosomal recessive" "" "At age 28: visual acuity: OD 20/20, OS 20/20; Slight optic disc pallor and moderate narrowing of retinal blood vessels; CME; Patchy loss of some RPE changes in periphery; peripheral AF involving the posterior pole, perifoveal ring of hyper AF" "" "" "" "" "Night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116783" "04214" "00144005" "01780" "Familial, autosomal recessive" "" "At age 28: visual acuity: OD 20/50, OS 20/25; Waxy optic disc pallor, narrowed retinal vessels, few RPE changes in the periphery and within the posterior pole; Relative preservation of foveal lamination; Irregular AF with patchy atrophy within posterior pole and periphery" "" "" "" "" "visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "0000116784" "04214" "00144006" "01780" "Familial, autosomal recessive" "" "At age 30: visual acuity: OD HM, OS HM; No optic disc pallor, narrowed retinal vessels, RPE changes in periphery and posterior pole; Foveal thinning; Irregular AF with patchy atrophy within posterior pole and periphery" "" "" "" "" "Night blindness since teenage years then decreased vision and nystagmus" "" "" "" "" "" "retinitis pigmentosa" "" "0000116785" "04214" "00144007" "01780" "Familial, autosomal recessive" "" "At age 39: visual acuity: OD 20/32, OS 20/50; Waxy optic disc pallor, narrowed retinal vessels, few RPE changes in the periphery, perifoveal atrophy; Foveal thinning; Patchy loss of AF outside the vascular arcade and perifoveal irregular hypoAF" "" "" "" "" "Night blindness since teenage years" "" "" "" "" "" "retinitis pigmentosa" "" "0000116786" "04214" "00144008" "01780" "Familial, autosomal recessive" "" "At age 31: visual acuity: OD 20/32, OS 20/40; Normal optic disc and blood vessels; some RPE changes in periphery, CME; Patchy loss of AF outside the vascular arcade with macular changes in relation with CME; perifoveal ring of hyper AF" "" "" "" "" "adaptation problem from light to dark" "" "" "" "" "" "retinitis pigmentosa" "" "0000116787" "04214" "00144009" "01780" "Familial, autosomal recessive" "" "At age 28: visual acuity: ODS 20/20; Mild optic disc pallor, narrowed retinal vessels, RPE changes in the periphery; Preserved foveal lamination; Patchy loss of AF outside the vascular arcade and perifoveal ring of hyper AF of oval shape" "" "" "" "" "Night blindness" "" "" "" "" "" "retinitis pigmentosa" "" "0000116788" "04214" "00144010" "01780" "Familial, autosomal recessive" "" "At age 51: visual acuity: OD 20/320, OS 20/80; IOL OD at 49, Posterior subcapsular cataract OS; Waxy optic disc pallor, narrowed retinal vessels, few RPE changes in the periphery, perifoveal atrophy; Foveal thinning; Irregular AF throughout the posterior pole, foveal hyper AF" "" "" "" "" "No real symptoms at time of diagnosis, then night vision problem and photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "0000116789" "04214" "00144011" "01780" "Familial, autosomal recessive" "" "At age 34: visual acuity: OD 20/63, OS 20/25; Mild bilateral subcapsular cataract; Mild optic disc pallor, narrowed retinal vessels, RPE changes in the periphery and cryo scar in periphery of OD; Preserved foveal lamination; Loss of AF outsidethe vascular arcade with perifoveal loss of AF" "" "" "" "" "Night blindness, photophobia +++" "" "" "" "" "" "retinitis pigmentosa" "" "0000116790" "04214" "00144012" "01780" "Familial, autosomal recessive" "" "At age 48: visual acuity: OD 20/50, OS 20/50; Mild optic disc pallor, narrowed retinal vessels, RPE changes in the periphery and within the posterior pole; Relatively preserved foveal lamination; Patchy loss of AF outside the vascular arcade and within the posterior pole, small perifoveal ring of hyper AF" "" "" "" "" "Night blindness since age 38" "" "" "" "" "" "retinitis pigmentosa" "" "0000116791" "04214" "00144013" "01780" "Familial, autosomal recessive" "" "At age 68: visual acuity: ODS 20/25; Moderate bilateral posterior subcapsular cataract; Waxy optic disc pallor, narrowed retinal blood vessels, RPE changes in the periphery, peripapillary atrophy and some degree of perifoveolar atrophy; Preserved foveal lamination; Irregular loss of AF outside and within vascular arcade, some perifoveaolar patchy loss of AF" "" "" "" "" "visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "0000116792" "04214" "00144014" "01780" "Familial, autosomal recessive" "" "At age 50: visual acuity: OD 20/50, OS 20/63; Moderate bilateral posterior subcapsular cataract; Mild disc pallor, narrowed retinal vessels, RPE changes in the periphery, relatively preserved posterior pole; Relatively preserved foveal lamination, CME OS; Loss of AF outside the vascular arcade, perifoveal ring of hyper AF with some patchy loss of AF within the posterior pole" "" "" "" "" "Night blindness and visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "0000116793" "04214" "00144015" "01780" "Familial, autosomal recessive" "" "At age 52: visual acuity: OD 20/63, OS 20/80; Bilateral posterior subcapsular cataract++; Mild optic disc pallor, narrowed retinal vessels, RPE changes in the periphery and peripapilary atrophy; Relatively preserved foveal lamination; Loss of AF outside the vascular arcade, perifoveal, small perfioveal ring of AF" "" "" "" "" "Night blindness since childhood, visual field constriction" "" "" "" "" "" "retinitis pigmentosa" "" "0000116794" "04214" "00144016" "01780" "Familial, autosomal recessive" "" "At age 26: visual acuity: OD 20/20, OS 20/25; Mild optic disc pallor, no narrowing of retinal vessels, few RPE changes in the periphery; Preserved foveal lamination; Loss of AF outside the vascular arcade, perifoveal ring of hyper AF" "" "" "" "" "Night blindness, photopsia" "" "" "" "" "" "retinitis pigmentosa" "" "0000116795" "04214" "00144017" "01780" "Familial, autosomal recessive" "" "At age 37: visual acuity: OD 20/50, OS 20/63; Mild optic disc pallor, no narrowing of retinal vessels, few RPE changes in the periphery, CME; Patchy loss of AF outside the vascular arcade with macular changes in relation with CME; perifoveal ring of hyper AF" "" "" "" "" "Night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116796" "04214" "00144018" "01780" "Familial, autosomal recessive" "" "At age 66: visual acuity: OD 20/50, OS 20/32; IOL ODS at 62; Mild optic disc pallor, no narrowing of retinal vessels, few RPE changes in the periphery, CME; Patchy loss of AF outside the vascular arcade with macular changes in relation with CME" "" "" "" "" "No real night blindness, more photophobia" "" "" "" "" "" "retinitis pigmentosa" "" "0000116797" "04214" "00144019" "01780" "Familial, autosomal recessive" "" "At age 36: visual acuity: OD 20/400, OS 20/640; Normal optic disc color, narrowed retinal vessels, extensive RPE changes involving both the periphery and the posterior pole; CME; Patchy loss of autofluorescence involving both the periphery and the posterior pole" "" "" "" "" "Night blindness since childhood" "" "" "" "" "" "retinitis pigmentosa" "" "0000116798" "04214" "00144020" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116799" "04214" "00144021" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116800" "04214" "00144022" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116801" "04214" "00144023" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116802" "04214" "00144024" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116803" "04214" "00144025" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116804" "04214" "00144026" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116805" "04214" "00144027" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116806" "04214" "00144028" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116807" "04214" "00144029" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116808" "04214" "00144030" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116809" "04214" "00144031" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116810" "04214" "00144032" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116811" "04214" "00144033" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116812" "04214" "00144034" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116813" "04214" "00144035" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116814" "04214" "00144036" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116815" "04214" "00144037" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116816" "04214" "00144038" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116817" "04214" "00144039" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116818" "04214" "00144040" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116819" "04214" "00144041" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116820" "04214" "00144042" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116821" "04214" "00144043" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116822" "04214" "00144044" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116823" "04214" "00144045" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116824" "04214" "00144046" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116825" "04214" "00144047" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116826" "04214" "00144048" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116827" "04214" "00144049" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116828" "04214" "00144050" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116829" "04214" "00144051" "01780" "Familial, autosomal recessive" "" "Refraction: NA; visual acuity: R 0.4 L 0.4; ffERG: R&L Extinguished" "" "50y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116830" "04214" "00144052" "01780" "Isolated (sporadic)" "" "Refraction: R -0.75/-0.25 x 18°, L -0.25/-1.50 x 132°; visual acuity: R 0.5 L 0.4; ffERG: R&L Extinguished" "" "40y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116831" "04214" "00144053" "01780" "Isolated (sporadic)" "" "Refraction: R -3.50/-0.75 x 160°, L -4.25/-0.50 x 44°; visual acuity: R 0.8 L 0.8; ffERG: R&L Extinguished" "" "19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116832" "04214" "00144054" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116833" "04214" "00144055" "01780" "Isolated (sporadic)" "" "Age 64; visual acuity R=20/200, L=LP; Optic nerve head drusen, severely attenuated vessels, atrophic macular region with foveal island, relatively preserved RPE midperipheral, atrophic RPE far periphery with bone-spicules and paving stone-like degenerations." "" "36y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116834" "04214" "00144056" "01780" "Familial, autosomal recessive" "" "Age 69; visual acuity R=HM, L=HM; very pale, waxy optic disc, severely attenuated retinal vasculature, and extensive chorioretinal atrophy with minimal residual retinal pigment epithelium at the macular region, heavy irregular pigmentations in the (mid)peripheral retina" "" "14y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116835" "04214" "00144057" "01780" "Familial, autosomal recessive" "" "Age 73; visual acuity R=20/63, L=20/50; Attenuated retinal vasculature, generalized atrophy with macular sparing, extensive bone spicules throughout periphery." "" "21y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116836" "04214" "00144058" "01780" "Isolated (sporadic)" "" "Age 64; visual acuity R=20/32, L=20/25; Pallor of the optic disc, attenuated retinal vasculature, preserved RPE posterior pole, (mid)periphery RPE atrophy with bone-spicules, inferior quadrants (both eyes) fibrotic lesions resembling old Coats\'-like vasculopathy." "" "62y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116837" "04214" "00144059" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116838" "04214" "00144060" "01780" "Isolated (sporadic)" "" "Age 36; visual acuity R=20/25, L=20/25; Pink optic disc, severely attenuated vessels with sheathing, preserved RPE macular region, (mid)periphery pronounced RPE atrophy with bone-spicules and some drusen-like deposits." "" "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116839" "04214" "00144061" "01780" "Isolated (sporadic)" "" "Age 26; visual acuity R=20/32, L=20/40; Mild pallor optic disc, vessels near normal caliber, preserved RPE posterior pole with mild epiretinal membrane, RPE changes in macula with 3 intraretinal crystals. Right eye: (mid)periphery atrophic with bone-spicules." "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116840" "04214" "00144062" "01780" "Isolated (sporadic)" "" "Age 66; visual acuity R=20/100, L=CF; Pink optic disc. Mild to moderate attenuation of retinal vasculature, marked chorioretinal atrophy extending into the posterior pole. Clustered bone spicule pigmentation in periphery" "" "35y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116841" "04214" "00144063" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116842" "04214" "00144064" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116843" "04214" "00144065" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116844" "04214" "00144066" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116845" "04214" "00144067" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116846" "04214" "00144068" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116847" "04214" "00144069" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116848" "04214" "00144070" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116849" "04214" "00144071" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116850" "04214" "00144072" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116851" "04214" "00144073" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116852" "04214" "00144074" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116853" "04214" "00144075" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116854" "04214" "00144076" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116855" "04214" "00144077" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116856" "04214" "00144078" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116857" "04214" "00144079" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116858" "04214" "00144080" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116859" "04214" "00144081" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116860" "04214" "00144082" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116861" "04214" "00144083" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116862" "04214" "00144084" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116863" "04214" "00144085" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116864" "04214" "00144086" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116865" "04214" "00144087" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116866" "04214" "00144088" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116867" "04214" "00144089" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116868" "04214" "00144090" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116869" "04214" "00144091" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116870" "04214" "00144092" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116871" "04214" "00144093" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116872" "04214" "00144094" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116873" "04214" "00144095" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116874" "04214" "00144096" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116875" "04214" "00144097" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116876" "04214" "00144098" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116877" "04214" "00144099" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116878" "04214" "00144100" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116879" "04214" "00144101" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116880" "04214" "00144102" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116881" "04214" "00144103" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116882" "04214" "00144104" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116883" "04214" "00144105" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116884" "04214" "00144106" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116885" "04214" "00144107" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116886" "04214" "00144108" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116887" "04214" "00144109" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116888" "00058" "00144110" "01780" "Unknown" "" "Index and affected sister early onset arCD, macro-cephaly and mental retardation in affected sister consang." "" "" "" "" "" "" "" "" "" "" "" "" "0000116889" "04214" "00144111" "01780" "Familial, autosomal recessive" "" "Age 57; Age diagnosis 47; symptom: Night blindness in her mid-twenties; visual acuity: R 0,3 L 0,2; lens status: NS cataract; Fundoscopy results: Normal optic disc, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116890" "04214" "00144112" "01780" "Familial, autosomal recessive" "" "Age 33; Age diagnosis 18; symptom: Night blindness since early childhood; visual acuity: R 1,2 L 1,2; lens status: IOL (PSC); Fundoscopy results: Mild optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116891" "04214" "00144113" "01780" "Familial, autosomal recessive" "" "Age 28; Age diagnosis _; symptom: _; visual acuity: R 0,4 L 0,3; lens status: cataract; Fundoscopy results: Normal optic disc, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116892" "04214" "00144114" "01780" "Isolated (sporadic)" "" "Age 33; Age diagnosis 32; symptom: Night blindness since early childhood; visual acuity: R 0,7 L 0,7; lens status: Clear; Fundoscopy results: Normal optic disc, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116893" "04214" "00144115" "01780" "Isolated (sporadic)" "" "Age 54; Age diagnosis 39; symptom: Night blindness since early childhood; visual acuity: R HM L HM; lens status: NS cataract; Fundoscopy results: Optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116894" "04214" "00144116" "01780" "Familial, autosomal recessive" "" "Age 43; Age diagnosis 34; symptom: Night blindness after age 20; visual acuity: R 0,02 L 0,01; lens status: Clear; Fundoscopy results: Mild optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116895" "04214" "00144117" "01780" "Familial, autosomal recessive" "" "Age 57; Age diagnosis 50; symptom: Night blindness after age 20; visual acuity: R 0,04 L 0,04; lens status: IOL (NS); Fundoscopy results: Mild optic disc pallor, severely attenuated vessels, mid-periphery RPE atrophy with bone spicules. OCT: foveal thinning." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116896" "04214" "00144118" "01780" "Isolated (sporadic)" "" "Age 69; Age diagnosis 61; symptom: Night blindness after age 20; visual acuity: R 0,4 L 0,5; lens status: IOL (PSC); Fundoscopy results: Mild optic disc pallor, severely attenuated vessels, atrophic RPE changes involving both periphery and posterior poles with bone spicules. OCT: foveal thinning." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116897" "04214" "00144119" "01780" "Isolated (sporadic)" "" "Age 47; Age diagnosis 38; symptom: Night blindness since early childhood; visual acuity: R LP L 0,04; lens status: IOL (PSC); Fundoscopy results: Optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116898" "04214" "00144120" "01780" "Isolated (sporadic)" "" "Age 64; Age diagnosis 61; symptom: Night blindness since early childhood; visual acuity: R 0,02 L LP(-); lens status: Right eye cataract and iris coloboma; Fundoscopy results: Right eye: optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules, iris coloboma in inferior anterior chamber. Left eye: congenitally blindness with developmental abnormality in anterior chamber." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116899" "04214" "00144121" "01780" "Isolated (sporadic)" "" "Age 45; Age diagnosis 35; symptom: Night blindness since childhood; visual acuity: R 0,4 L 0,3; lens status: IOL (PSC); Fundoscopy results: Normal optic disc, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules. OCT: macula preserved, frequent vitreous hemorrhage episodes in both eyes." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116900" "04214" "00144122" "01780" "Familial, autosomal recessive" "" "Age 58; Age diagnosis 42; symptom: Night blindness after age 20; visual acuity: R HM L HM; lens status: IOL (NS); Fundoscopy results: Optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116901" "04214" "00144123" "01780" "Isolated (sporadic)" "" "Age 56; Age diagnosis 37; symptom: Night blindness after age 20; visual acuity: R 0,5 L 0,6; lens status: IOL (NS); Fundoscopy results: Mild optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116902" "04214" "00144124" "01780" "Isolated (sporadic)" "" "Age 51; Age diagnosis 48; symptom: Night blindness since early childhood; visual acuity: R 0,03 L 0,04; lens status: IOL (PSC); Fundoscopy results: Optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116903" "04214" "00144125" "01780" "Familial, autosomal recessive" "" "Age 52; Age diagnosis 36; symptom: Night blindness at age 23; visual acuity: R 0,1 L HM; lens status: Right-IOL; Fundoscopy results: Optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules. Left eye: aphakic because of traumatic failure." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116904" "04214" "00144126" "01780" "Familial, autosomal recessive" "" "Age 62; Age diagnosis 21; symptom: Night blindness since childhood; visual acuity: R HM L 0,01; lens status: Aphakic eyes after cataract surgery; Fundoscopy results: Optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116905" "04214" "00144127" "01780" "Familial, autosomal recessive" "" "Age 63; Age diagnosis _; symptom: _; visual acuity: R 0,07 L 0,01; lens status: cataract; Fundoscopy results: Optic disc pallor, severely attenuated vessels, extensive atrophic RPE changes involving both periphery and posterior poles with bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116906" "04214" "00144128" "01780" "Isolated (sporadic)" "" "Age 35; Age diagnosis _; symptom: _; visual acuity: R 0,03 L 0,06; lens status: cataract; Fundoscopy results: Optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116907" "04214" "00144129" "01780" "Familial, autosomal recessive" "" "Age 71; Age diagnosis 45; symptom: Night blindness since age 40; visual acuity: R 0,06 L 0,3; lens status: NS cataract; Fundoscopy results: Mild optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116908" "04214" "00144130" "01780" "Isolated (sporadic)" "" "Age 44; Age diagnosis 44; symptom: Night blindness in his mid-twenties, cataract was diagnosed at age 12; visual acuity: R 1,2 L 1,2; lens status: IOL (PSC) ; Fundoscopy results: Mild optic disc pallor, moderately attenuated vessels, mid-periphery RPE atrophy with few bone spicules, macula preserved." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116909" "04214" "00144131" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116910" "04214" "00144132" "01780" "Familial, autosomal recessive" "" "visual acuity: R 0.04 L 0.2; refraction R(D) -1.5 L(D) -1.5; lens status: bilateral pseudophakia; Goldmann Perimetry: OD 8°, OS 9°; fundoscopy: waxy optic disc, attenuated retinal vasulature, RPE changes in periphery and posterior pole, extensive bone spicules throughout periphery; OCT: foveal thinning" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116911" "04214" "00144133" "01780" "Familial, autosomal recessive" "" "visual acuity: R 0.6 L 0.6; refraction R(D) 0 L(D) +1.5; lens status: bilateral cateract; Goldmann Perimetry: OD 11°, OS 11°; fundoscopy: waxy optic disc, attenuated retinal vasulature, RPE changes in periphery and posterior pole, some drusen-like deposits" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116912" "04214" "00144134" "01780" "Familial, autosomal recessive" "" "visual acuity: R 0.4 L CF; refraction R(D) +0.5 L(D) 0; lens status: bilateral cateract; Goldmann Perimetry: OD: concentric constriction with remaining central island , OS: concentric constriction with remaining peripheral island. P0; fundoscopy: normal optic disc, attenuated retinal vasculature, RPE changes in periphery and posterior pole, extensive bone spicules throughout periphery; ERG: extinguished" "" "14y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116913" "04214" "00144135" "01780" "Isolated (sporadic)" "" "visual acuity: R 1 L 0.8; refraction R(D) 0 L(D) -1; lens status: bilateral cateract; Goldmann Perimetry: OD 10°, OS 10°; fundoscopy: normal optic disc, attenuated retinal vasulature, RPE changes in periphery, extensive bone spicules throughout periphery" "" "50y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116914" "04214" "00144136" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116915" "04214" "00144137" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116916" "04214" "00144138" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116917" "04214" "00144139" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116918" "04214" "00144140" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116919" "04214" "00144141" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116920" "04214" "00144142" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116921" "04214" "00144143" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116922" "04214" "00144144" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116923" "04214" "00144145" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116924" "04214" "00144146" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116925" "04214" "00144147" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116926" "04214" "00144148" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116927" "04214" "00144149" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116928" "04214" "00144150" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116929" "04214" "00144151" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116930" "04214" "00144152" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116931" "04214" "00144153" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116932" "04214" "00144154" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116933" "04214" "00144155" "01780" "Familial, autosomal recessive" "" "At age 31: best-corrected visual acuity (BCVA) was 0.9 [with −6.00 diopter (dpt), cylinder (cyl) −1.25 dpt axis (Ax) 130°] in his right eye and 0.6 (with −4.50 dpt, cyl −0.75 dpt Ax 180°) in his left eye; Funduscopy showed retinal degenerations within the vascular arcade in both eyes" "" "29y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116934" "04214" "00144156" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116935" "04214" "00144157" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116936" "04214" "00144158" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116937" "04214" "00144159" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116938" "04214" "00144160" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116939" "04214" "00144161" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116940" "04214" "00144162" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116941" "04214" "00144163" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116942" "04214" "00144164" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116943" "04214" "00144165" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116944" "04214" "00144166" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116945" "04214" "00144167" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116946" "04214" "00144168" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116947" "04214" "00144169" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116948" "04214" "00144170" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116949" "04214" "00144171" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116950" "04214" "00144172" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116951" "04214" "00144173" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116952" "04214" "00144174" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116953" "04214" "00144175" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116954" "04214" "00144176" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116955" "04214" "00144177" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116956" "04214" "00144178" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116957" "04214" "00144179" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116958" "04214" "00144180" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116959" "04214" "00144181" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116960" "04214" "00144182" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116961" "04214" "00144183" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116962" "04214" "00144184" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116963" "04214" "00144185" "01780" "Familial, autosomal recessive" "" "At age 60: blurred vision; visual acuity (logMAR) R/L 0.2; visual field mild contraction; pale optic disc, attenuated arterioles, bone spicules, cystoid macular edema; partial sparing of photopic ERG" "" "45y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116964" "04214" "00144186" "01780" "Isolated (sporadic)" "" "At age 52: blurred vision, night blindness, photophobia; visual acuity (logMAR) R=0.15 L=0.5; visual field tubular ≤10°; pale optic disc, attenuated arterioles, bone spicules, cystoid macular edema; ERG estinguished" "" "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116965" "04214" "00144187" "01780" "Familial, autosomal recessive" "" "At age 70:visual acuity was hand motion OD and 20/400 OS; dilated fundus examination of both eyes showed a pale optic nerve head, attenuated vessels, and bone spicule pigment in the periphery with pavingstone degeneration inferiorly; some mottled RPE pigmentation in her left eye" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116966" "04214" "00144188" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116967" "04214" "00144189" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116968" "04214" "00144190" "01780" "Familial, autosomal recessive" "" "At age 96: visual acuity was 20/400 OU. Dilated fundus exam showed optic disc atrophy, choroidal atrophy, vascular attenuation, and chorioretinal degeneration" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116969" "04214" "00144191" "01780" "Familial, autosomal recessive" "" "At age 88: light perception vision in both eyes; optic nerve head pallor, attenuated retinal vessels, and bone spicule pigmentation in the periphery" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116970" "04214" "00144192" "01780" "Familial, autosomal recessive" "" "BCVA left/right: finger count; fundus left/right: severe macula degeneration, waxy optic disk, artery attenuation, pigment deposits; ERG diminished" "" "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116971" "04214" "00144193" "01780" "Familial, autosomal recessive" "" "BCVA left/right: 0.1; fundus left/right: mild macula degeneration, waxy optic disk, artery attenuation, pigment deposits; ERG diminished" "" "25y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116972" "04214" "00144194" "01780" "Familial, autosomal recessive" "" "BCVA left/right: light perception; fundus left/right: severe macula degeneration, waxy optic disk, artery attenuation, pigment deposits; ERG diminished" "" "18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116973" "04214" "00144195" "01780" "Familial, autosomal recessive" "" "BCVA left/right: light perception; fundus left/right: severe macula degeneration, waxy optic disk, artery attenuation, pigment deposits; ERG diminished" "" "35y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116974" "04214" "00144196" "01780" "Familial, autosomal recessive" "" "BCVA left/right: 0.8; fundus left/right: waxy optic disk, artery attenuation, pigment deposits; ERG reduced; visual field left/right <10°" "" "32y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116975" "04214" "00144197" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116976" "04214" "00144198" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116977" "04214" "00144199" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116978" "04214" "00144200" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116979" "04214" "00144201" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116980" "04214" "00144202" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116981" "04214" "00144203" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116982" "04214" "00144204" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116983" "04214" "00144205" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116984" "04214" "00144206" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116985" "04214" "00144207" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116986" "04214" "00144208" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116987" "04214" "00144209" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116988" "04214" "00144210" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116989" "04214" "00144211" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116990" "04214" "00144212" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116991" "04214" "00144213" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116992" "04214" "00144214" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116993" "04214" "00144215" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116994" "04214" "00144216" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116995" "04214" "00144217" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116996" "04214" "00144218" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116997" "04214" "00144219" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116998" "04214" "00144220" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000116999" "04214" "00144221" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117000" "04214" "00144222" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117001" "04214" "00144223" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117002" "04214" "00144224" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117003" "04214" "00144225" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117004" "04214" "00144226" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117005" "04214" "00144227" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117006" "04214" "00144228" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117007" "04214" "00144229" "01780" "Familial, autosomal recessive" "" "Fundus L and R pigment deposits, optic disk waxy, RR" "" "32y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117008" "04214" "00144230" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117009" "04214" "00144231" "01780" "Isolated (sporadic)" "" "NA" "" "40y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117010" "04214" "00144232" "01780" "Isolated (sporadic)" "" "NA" "" "52y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117011" "04214" "00144233" "01780" "Familial, autosomal recessive" "" "Night Blindness (10y), VF constriction (6y) and loss of VA (15y); Pale optic disc. Bone spicule pigmentation and attenuated vessels. ERG: NR; Posterior subcapsular cataract (42y)" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117012" "04214" "00144234" "01780" "Familial, autosomal recessive" "" "Night Blindness (10y), VF constriction (10y) and loss of VA (10y); Pale optic disc. Bone spicule pigmentation. ERG: ND; Posterior subcapsular cataract (70y)" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117013" "04214" "00144235" "01780" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117014" "04214" "00144236" "01780" "Familial, autosomal recessive" "" "late RP onset but fast disease progression; Age 40; BCVA 20/40 both eyes; VF less than 30°; optic disc pallor, attenuated retinal arterioles, and bone spicule-like pigments in the mid-peripheral retina of patients; OCT thickened inner/outer segment (IS/OS) layer with a preserved macular structure" "" "35y" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "0000117015" "04214" "00144237" "01780" "Familial, autosomal recessive" "" "BCVA 20/50 for both eyes; no pigment deposit; OCT thickened inner/outer segment (IS/OS) layer with a preserved macular structure" "" "20y" "" "" "nyctalopia" "" "" "" "" "" "retinitis pigmentosa" "" "0000117016" "04214" "00144238" "01780" "Familial, autosomal recessive" "" "late RP onset but fast disease progression; age 41; BCVA 20/40 both eyes; optic disc pallor, attenuated retinal arterioles, and bone spicule-like pigments in the mid-peripheral retina of patients; OCT thickened inner/outer segment (IS/OS) layer with a preserved macular structure" "" "32y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117017" "04214" "00144239" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117018" "04214" "00144240" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117019" "04214" "00144241" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117020" "04214" "00144242" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117021" "04214" "00144243" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117022" "04214" "00144244" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117023" "04214" "00144245" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117026" "04214" "00144248" "01780" "Familial, autosomal recessive" "" "At age 30: decreased vision, night blindness, red-green blindness, attenuated vessels and bone spicule-shaped pigment deposits in the peripheral retina in both eyes, profound loss of photoreceptor layer structure, No detectable cone or rod responses were recorded by ERG" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117027" "04214" "00144249" "01780" "Isolated (sporadic)" "" "" "" "52y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117028" "04214" "00144250" "01780" "Isolated (sporadic)" "" "" "" "32y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117029" "04214" "00144251" "01780" "Unknown" "" "" "" "48y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117030" "04214" "00144252" "01780" "Familial, autosomal recessive" "" "" "" "23y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117031" "04214" "00144253" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117032" "04214" "00144254" "01780" "Familial, autosomal recessive" "" "Age 34, BCVA: 0,5/0,5" "" "14y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117033" "04214" "00144255" "01780" "Familial, autosomal recessive" "" "Age 48, BCVA: 0,2/0,4" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117034" "04214" "00144256" "01780" "Familial, autosomal recessive" "" "Age 37, BCVA: FC/FC" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117035" "04214" "00144257" "01780" "Isolated (sporadic)" "" "Age 43, BCVA: FC/0,5" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117036" "04214" "00144258" "01780" "Isolated (sporadic)" "" "Age 48, BCVA :0,4/0,4" "" "41y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117037" "04214" "00144259" "01780" "Isolated (sporadic)" "" "Age 43, BCVA: 0,2/0,2" "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117038" "04214" "00144260" "01780" "Isolated (sporadic)" "" "Age 43, BCVA 0,5/0,5" "" "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117039" "04214" "00144261" "01780" "Isolated (sporadic)" "" "Age 25, BCVA: 0,6/0,6" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117040" "04214" "00144262" "01780" "Familial, autosomal recessive" "" "Age 63, BCVA: 0,15/0,2" "" "41y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117041" "04214" "00144263" "01780" "Familial, autosomal recessive" "" "Age diagnosis 21" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117042" "04214" "00144264" "01780" "Isolated (sporadic)" "" "Age diagnosis 35" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117043" "04214" "00144265" "01780" "Isolated (sporadic)" "" "Age diagnosis 26" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117044" "04214" "00144266" "01780" "Isolated (sporadic)" "" "Age diagnosis 1" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117045" "04214" "00144267" "01780" "Isolated (sporadic)" "" "Age diagnosis 31" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117046" "04214" "00144268" "01780" "Isolated (sporadic)" "" "Age diagnosis 24" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117047" "04249" "00144269" "01780" "Familial, autosomal recessive" "" "Age diagnosis 32" "" "" "" "" "" "" "" "" "" "" "" "" "0000117048" "04214" "00144270" "01780" "Isolated (sporadic)" "" "Age diagnosis 28" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117049" "04214" "00144271" "01780" "Isolated (sporadic)" "" "first symptom: poor vision, visual acuity OD/OS: 0,2/0,2, fundus exam.: attenuated retinal arteries, pigment bone spicule-like;" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117050" "04214" "00144272" "01780" "Isolated (sporadic)" "" "Age examination 43: first symptom: poor vision, visual acuity OD/OS: 0,8/0,7, fundus exam.: attenuated retinal arteries, pigment deposit" "" "43y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117051" "04214" "00144273" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117052" "04214" "00144274" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117053" "04214" "00144275" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117054" "04214" "00144276" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117055" "04214" "00144277" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117056" "04214" "00144278" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117057" "04214" "00144279" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117058" "04214" "00144280" "01780" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117059" "04249" "00144281" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000117060" "04214" "00144282" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117061" "00058" "00144283" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000117062" "04214" "00144284" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117063" "04214" "00144285" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117064" "04214" "00144286" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117065" "04214" "00144287" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117066" "04214" "00144288" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117067" "04214" "00144289" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117068" "04214" "00144290" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117069" "04214" "00144291" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117070" "04214" "00144292" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117071" "04214" "00144293" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117072" "04214" "00144294" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117073" "04214" "00144295" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117074" "04214" "00144296" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117075" "04214" "00144297" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117076" "04214" "00144298" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117077" "04214" "00144299" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117078" "04214" "00144300" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117079" "04214" "00144301" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117080" "04214" "00144302" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117081" "04214" "00144303" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117082" "04214" "00144304" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117083" "04214" "00144305" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117084" "04214" "00144306" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117085" "04214" "00144307" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117086" "04214" "00144308" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117087" "04214" "00144309" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117088" "04214" "00144310" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117089" "04214" "00144311" "01780" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000117090" "04214" "00144313" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127816" "04214" "00155316" "01243" "Familial, autosomal recessive" "" "...details..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127960" "04214" "00155460" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127961" "04214" "00155461" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127962" "04214" "00155462" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127963" "04214" "00155463" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127964" "04214" "00155464" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127965" "04214" "00155465" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127966" "04214" "00155466" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127967" "04214" "00155467" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127968" "04214" "00155468" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127969" "04214" "00155469" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000127970" "04214" "00155470" "01243" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000138691" "04214" "00173838" "02449" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-38" "retinitis pigmentosa/rod-cone dystrophy" "" "0000138725" "04214" "00173872" "02449" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "RP-38" "retinitis pigmentosa" "" "0000142811" "05468" "00180416" "02555" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Acute anterior uveitis (AAU)" "Uveitis" "" "0000155404" "04214" "00207593" "01244" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000184474" "00198" "00244508" "01807" "Unknown" "" "HP:0000510 (Rod-cone dystrophy)" "" "" "" "" "" "" "" "" "" "" "" "" "0000223167" "00198" "00295602" "01807" "Unknown" "" "Cone/cone-rod dystrophy (HP:0000548)" "" "" "" "" "" "" "" "" "" "" "" "" "0000223469" "00198" "00296002" "01807" "Unknown" "" "Rod-cone dystrophy (HP:0000510)" "" "" "" "" "" "" "" "" "" "" "" "" "0000228767" "00198" "00301666" "01807" "Unknown" "" "Rod-cone dystrophy (HP:0000510)" "" "" "" "" "" "" "" "" "" "" "" "" "0000233833" "04214" "00308406" "00004" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000233935" "04214" "00308507" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233936" "04214" "00308508" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233937" "04214" "00308509" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233938" "04214" "00308510" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000233939" "04214" "00308511" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234064" "04214" "00308636" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000234071" "04214" "00308643" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234072" "04214" "00308644" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234073" "04214" "00308645" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234074" "04214" "00308646" "00004" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234456" "04214" "00309136" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234457" "04214" "00309137" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234458" "04214" "00309138" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234459" "04214" "00309139" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234460" "04214" "00309140" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234461" "04214" "00309141" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234462" "04214" "00309142" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234463" "04214" "00309143" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234464" "04214" "00309144" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234465" "04214" "00309145" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234466" "04214" "00309146" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234467" "04214" "00309147" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "cone–rod dystrophy" "" "0000234468" "04214" "00309148" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234469" "04214" "00309149" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234470" "04214" "00309150" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234471" "04214" "00309151" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234472" "04214" "00309152" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234473" "04214" "00309153" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234474" "04214" "00309154" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234475" "04214" "00309155" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "RAA" "" "0000234476" "04214" "00309156" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234477" "04214" "00309157" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234478" "04214" "00309158" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234479" "04214" "00309159" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234480" "04214" "00309160" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234481" "04214" "00309161" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234482" "04214" "00309162" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234483" "04214" "00309163" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234484" "04214" "00309164" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000234485" "04214" "00309165" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000235038" "04214" "00309725" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000235064" "04214" "00309755" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000235065" "04214" "00309756" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000235066" "04214" "00309757" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000243951" "04214" "00325464" "00006" "Familial, autosomal recessive" "" "retinitis pigmentosa" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000246160" "04214" "00327933" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246181" "04214" "00327954" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246237" "04214" "00328010" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246288" "04214" "00328061" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246314" "04214" "00328087" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000246386" "04214" "00328159" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246394" "04214" "00328167" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246445" "04214" "00328218" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246456" "04214" "00328229" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246493" "04214" "00328266" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246520" "04214" "00328293" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246542" "04214" "00328315" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246550" "04214" "00328323" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000246551" "04214" "00328324" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249441" "04214" "00331247" "00000" "Familial, autosomal recessive" "69y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249442" "04214" "00331248" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249443" "04214" "00331249" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249444" "04214" "00331250" "00000" "Familial, autosomal recessive" "33y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249445" "04214" "00331251" "00000" "Familial, autosomal recessive" "69y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249446" "04214" "00331252" "00000" "Familial, autosomal recessive" "35y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249447" "04214" "00331253" "00000" "Familial, autosomal recessive" "74y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249448" "04214" "00331254" "00000" "Familial, autosomal recessive" "29y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249449" "04214" "00331255" "00000" "Familial, autosomal recessive" "63y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249450" "04214" "00331256" "00000" "Familial, autosomal recessive" "56y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249451" "04214" "00331257" "00000" "Familial, autosomal recessive" "29y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249452" "04214" "00331258" "00000" "Familial, autosomal recessive" "30y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249453" "04214" "00331259" "00000" "Familial, autosomal recessive" "55y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249454" "04214" "00331260" "00000" "Familial, autosomal recessive" "50y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249455" "04214" "00331261" "00000" "Familial, autosomal recessive" "27y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249456" "04214" "00331262" "00000" "Familial, autosomal recessive" "54y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249457" "04214" "00331263" "00000" "Familial, autosomal recessive" "57y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249458" "04214" "00331264" "00000" "Familial, autosomal recessive" "21y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249459" "04214" "00331265" "00000" "Familial, autosomal recessive" "27y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249460" "04214" "00331266" "00000" "Familial, autosomal recessive" "51y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249461" "04214" "00331267" "00000" "Familial, autosomal recessive" "22y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000249895" "05086" "00331703" "00000" "Familial, autosomal recessive" "40y" "normal hearing" "" "30y" "" "" "" "" "" "" "" "" "Usher syndrome, type II" "" "0000250672" "04214" "00332488" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000250673" "04214" "00332489" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000250674" "04214" "00332490" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000250691" "04214" "00332507" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000251586" "04214" "00333399" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "RP" "" "0000251587" "04214" "00333400" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "RP" "" "0000251588" "04214" "00333401" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "RP" "" "0000251589" "04214" "00333402" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "RP" "" "0000251610" "04214" "00333423" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "RP" "" "0000251611" "04214" "00333424" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "RP" "" "0000252009" "04214" "00333824" "00000" "Familial, autosomal recessive" "48y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252010" "04214" "00333825" "00000" "Familial, autosomal recessive" "53y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252011" "04214" "00333826" "00000" "Familial, autosomal recessive" "49y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252012" "04214" "00333827" "00000" "Familial, autosomal recessive" "76y" "clinical category IA1a" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252075" "04214" "00333890" "00000" "Familial, autosomal recessive" "48y" "clinical category IA1ai" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252086" "04214" "00333901" "00000" "Familial, autosomal recessive" "49y" "clinical category IA1aiii" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252505" "04214" "00334416" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252506" "04214" "00334417" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252598" "04214" "00334558" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252600" "04214" "00334560" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252603" "04214" "00334563" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252946" "04214" "00335231" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252960" "04214" "00335245" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000252989" "04214" "00335274" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253050" "04214" "00335336" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253051" "04214" "00335337" "02485" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253362" "04214" "00335416" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253366" "04214" "00335420" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253370" "04214" "00335424" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000253888" "04214" "00335973" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000254277" "04214" "00358979" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000254428" "04214" "00359131" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254446" "04214" "00359149" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254457" "04214" "00359160" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254459" "04214" "00359162" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254461" "04214" "00359164" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254482" "04214" "00359185" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254504" "04214" "00359207" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa or rod-cone dystrophy" "" "0000254625" "04214" "00359329" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000256831" "04214" "00361426" "04036" "Familial, autosomal dominant" "" "visual acuity: OD = 0.2, OS = 0.2. ERG: Not performed." "" "55y" "" "" "Poor vision" "" "" "" "" "" "retinitis pigmentosa" "" "0000257624" "04214" "00362210" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000257626" "04214" "00362212" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000257630" "04214" "00362216" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "con-rod dystrophy" "" "0000257632" "04214" "00362218" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000257648" "04214" "00362234" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000257654" "04214" "00362240" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000257657" "04214" "00362243" "04043" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "ROCD" "" "0000258272" "04214" "00362906" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258273" "04214" "00362907" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000258985" "04214" "00363635" "00000" "Isolated (sporadic)" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "" "0000267907" "04214" "00372628" "00000" "Familial, autosomal dominant" "45y" "see paper; ..." "" "12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267917" "04214" "00372638" "00000" "Isolated (sporadic)" "24y" "see paper; ..." "" "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267924" "04214" "00372645" "00000" "Isolated (sporadic)" "28y" "see paper; ..." "" "13y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267925" "04214" "00372646" "00000" "Familial, autosomal dominant" "22y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267932" "04214" "00372653" "00000" "Familial, autosomal recessive" "34y" "see paper; ..." "" "16y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267934" "04214" "00372655" "00000" "Familial, autosomal recessive" "26y" "see paper; ..." "" "11y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267946" "04214" "00372667" "00000" "Familial, autosomal recessive" "38y" "see paper; ..." "" "7y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267956" "04214" "00372677" "00000" "Familial, autosomal recessive" "3y" "see paper; ..." "" "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267960" "04214" "00372681" "00000" "Familial, X-linked" "26y" "see paper; ..." "" "<10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267962" "04214" "00372683" "00000" "Familial, X-linked" "40y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267966" "04214" "00372687" "00000" "Familial, X-linked" "23y" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267967" "04214" "00372688" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267969" "04214" "00372690" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267972" "04214" "00372693" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267976" "04214" "00372697" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267978" "04214" "00372699" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267979" "04214" "00372700" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267980" "04214" "00372701" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000267998" "04214" "00372719" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268001" "04214" "00372722" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268011" "04214" "00372732" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268012" "04214" "00372733" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268015" "04214" "00372736" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268020" "04214" "00372741" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268024" "04214" "00372745" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268029" "04214" "00372750" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268034" "02440" "00372757" "01164" "Familial, autosomal recessive" "" "retinitis pigmentosa since the age of 30; visual loss on both eyes, bony tubercles, optic atrophy, macular degeneration." "" "" "" "" "" "" "" "" "" "" "30y" "" "0000268641" "04214" "00373365" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000268644" "04214" "00373368" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000269029" "04214" "00373820" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270625" "04214" "00375411" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270630" "04214" "00375416" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270640" "04214" "00375426" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270642" "04214" "00375428" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270643" "04214" "00375429" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270644" "04214" "00375430" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000270649" "04214" "00375435" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271496" "04214" "00376288" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa ( RP)" "" "0000271497" "04214" "00376289" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa ( RP)" "" "0000271521" "04214" "00376313" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "early onset rod cone dystrophy (EO-RCD)" "" "0000271522" "04214" "00376314" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "early onset rod cone dystrophy (EO-RCD)" "" "0000271962" "04214" "00376751" "00000" "Familial, autosomal recessive" "20y" "" "" "" "" "" "" "" "" "" "" "" "Progressive central and peripheral vision loss, abnormal constructed visual field" "" "0000271963" "04214" "00376752" "00000" "Familial, autosomal recessive" "35y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, loss of peripheral vision" "" "0000271964" "04214" "00376753" "00000" "Familial, autosomal recessive" "48y" "" "" "" "" "" "" "" "" "" "" "" "Decreased peripheral vision, photophobia, difficult light-to-dark adaptation, night blindness" "" "0000271965" "04214" "00376754" "00000" "Familial, autosomal recessive" "18y" "" "" "" "" "" "" "" "" "" "" "" "Bone spicule pigmentary clumping in fundus, VA = 20/20–25, peripheral field constriction" "" "0000271966" "04214" "00376755" "00000" "Familial, autosomal recessive" "24y" "" "" "" "" "" "" "" "" "" "" "" "Decreased peripheral vision, night blindness" "" "0000271969" "04214" "00376758" "00000" "Familial, autosomal recessive" "76y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271971" "04214" "00376760" "00000" "Familial, autosomal recessive" "45y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271974" "04214" "00376763" "00000" "Familial, autosomal recessive" "35y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271976" "04214" "00376765" "00000" "Familial, autosomal recessive" "39y" "" "" "" "" "" "" "" "" "" "" "" "Nyctalopia, decreased peripheral vision, history of plaquenil" "" "0000271981" "04214" "00376770" "00000" "Familial, autosomal recessive" "11y" "" "" "" "" "" "" "" "" "" "" "" "Peripheral dystrophy" "" "0000271988" "04214" "00376777" "00000" "Familial, autosomal dominant" "19y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271989" "04214" "00376778" "00000" "Familial, autosomal dominant" "22y" "" "" "" "" "" "" "" "" "" "" "" "Nyctalopia, loss of peripheral vision, progressive pigmentary retinopathy" "" "0000271993" "04214" "00376782" "00000" "Familial, autosomal dominant" "41y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000271994" "04214" "00376783" "00000" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, macular subatrophy, pseudohole" "" "0000271995" "04214" "00376784" "00000" "Familial, X-linked" "5y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272000" "04214" "00376789" "00000" "Unknown" "38y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000272077" "04214" "00376866" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "early-onset retinal dystrophy" "" "0000272400" "04214" "00377242" "00000" "Familial, autosomal recessive" "41y" "see paper" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, type 25 (RP25)" "retinal disease" "" "0000272414" "04214" "00377256" "00000" "Familial, autosomal recessive" "34y" "see paper" "" "10y" "17y" "" "" "" "" "" "" "retinitis pigmentosa, type 25 (RP25)" "retinal disease" "" "0000272415" "04214" "00377257" "00000" "Familial, autosomal recessive" "" "see paper" "" "14y" "15y" "" "" "" "" "" "" "retinitis pigmentosa, type 25 (RP25)" "retinal disease" "" "0000272652" "04214" "00377502" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000272676" "04214" "00377526" "00000" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "retinal disease" "" "0000273081" "04214" "00377935" "00000" "Familial, autosomal recessive" "46y" "" "" "14y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273082" "04214" "00377936" "00000" "Familial, autosomal recessive" "40y" "" "" "15y" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273091" "04214" "00377945" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273092" "04214" "00377946" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273103" "04214" "00377957" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Cone Distrophy" "" "0000273162" "00112" "00378015" "03508" "Familial, autosomal recessive" "" "HP:0032037, HP:0000662, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273167" "00112" "00378021" "03508" "Familial, autosomal recessive" "" "HP:0032037, HP:0000662, HP:0000613, HP:0001133, HP:0000007" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273177" "00112" "00378031" "03508" "Familial, autosomal recessive" "" "HP:0030515, HP:0000662, HP:0000613, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273191" "00112" "00378049" "03508" "Familial, autosomal recessive" "" "HP:0032037, HP:0000662, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273193" "00112" "00378051" "03508" "Familial, autosomal recessive" "" "HP:0032037, HP:0000662, HP:0000613, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273194" "00112" "00378052" "03508" "Familial, autosomal recessive" "" "HP:0032037, HP:0000662, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273207" "00112" "00378065" "03508" "Familial, autosomal recessive" "" "HP:0032122, HP:0000662, HP:0000613, HP:0001133, HP:0000551, HP:0001288, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273209" "00112" "00378067" "03508" "Familial, autosomal recessive" "" "HP:0000662, HP:0000613, HP:0001133, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273212" "00112" "00378070" "03508" "Familial, autosomal recessive" "" "HP:0032037, HP:0000662, HP:0000613, HP:0001133, HP:0000551, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273249" "04214" "00379376" "00000" "Unknown" "39y" "" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273250" "04214" "00379377" "00000" "Unknown" "25y" "" "" "17y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273251" "04214" "00379378" "00000" "Unknown" "42y" "" "" "22y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273407" "00112" "00379534" "03508" "Familial, autosomal recessive" "" "HP:0000662, HP:0000613, HP:0001133, HP:0000551, HP:0001288, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273410" "00112" "00379537" "03508" "Familial, autosomal recessive" "" "HP:0000662, HP:0001133, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273418" "00112" "00379545" "03508" "Familial, autosomal recessive" "" "HP:0000662, HP:0000613, HP:0001133, HP:0032037, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273420" "00112" "00379547" "03508" "Familial, autosomal recessive" "" "HP:0000662, HP:0000613, HP:0001133, HP:0032122, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273477" "00112" "00379633" "03508" "Familial, autosomal recessive" "" "HP:0000662, HP:0000613, HP:0001133, HP:0032037, HP:0000007, HP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273494" "00112" "00379650" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000007,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273512" "00112" "00379668" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000007,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273515" "00112" "00379671" "03508" "Familial, autosomal recessive" "" "HP:0030515,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000007,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273602" "00112" "00379748" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0000510,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273607" "00112" "00379753" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273609" "00112" "00379755" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0000613,\tHP:0001123,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "" "" "0000273617" "00112" "00379763" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273620" "00112" "00379766" "03508" "Familial, autosomal recessive" "" "HP:0030515,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273629" "00112" "00379775" "03508" "Familial, autosomal recessive" "" "HP:0030515,\tHP:0000662,\tHP:0000613,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273650" "00112" "00379795" "03508" "Familial, autosomal recessive" "" "HP:0032037,\tHP:0000662,\tHP:0001133,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000273689" "04214" "00379835" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273690" "04214" "00379836" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa?" "" "0000273691" "04214" "00379837" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000273692" "04214" "00379838" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000274003" "04214" "00380148" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000274013" "00112" "00380158" "03508" "Familial, autosomal recessive" "" "HP:0001141,\tHP:0000662,\tHP:0001133,\tHP:0000551,\tHP:0001288,\tHP:0000365,\tHP:0000510" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000274025" "04214" "00380170" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274026" "04214" "00380171" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274028" "04214" "00380173" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274060" "04214" "00380205" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal dystrophy" "" "0000274864" "04214" "00381013" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000275517" "04214" "00381675" "00000" "Isolated (sporadic)" "" "" "" "28y" "" "" "" "" "" "" "" "" "Autosomal recessive retinitis pigmentosa, arRP" "" "0000275526" "04214" "00381684" "00000" "Familial, autosomal recessive" "" "" "" "5y" "" "" "" "" "" "" "" "" "Leber congenital amaurosis (LCA), early cone-rod dystrophy (CRD)" "" "0000275693" "04214" "00381851" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275694" "04214" "00381852" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275695" "04214" "00381853" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275696" "04214" "00381854" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275697" "04214" "00381855" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275698" "04214" "00381856" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275699" "04214" "00381857" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275700" "04214" "00381858" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275701" "04214" "00381859" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000275702" "04214" "00381860" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000276127" "04214" "00382278" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276128" "04214" "00382279" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276129" "04214" "00382280" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276130" "04214" "00382281" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276131" "04214" "00382282" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276132" "04214" "00382283" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276133" "04214" "00382284" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276134" "04214" "00382285" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276135" "04214" "00382286" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276136" "04214" "00382287" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276137" "04214" "00382288" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276138" "04214" "00382289" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276139" "04214" "00382290" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276140" "04214" "00382291" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276141" "04214" "00382292" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Generalized retinal dystrophy (non-syndromic)" "" "0000276142" "04214" "00382293" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276143" "04214" "00382294" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276144" "04214" "00382295" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276145" "04214" "00382296" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276146" "04214" "00382297" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276147" "04214" "00382298" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276148" "04214" "00382299" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276149" "04214" "00382300" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276150" "04214" "00382301" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276151" "04214" "00382302" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276152" "04214" "00382303" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276153" "04214" "00382304" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276154" "04214" "00382305" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276155" "04214" "00382306" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276268" "04214" "00382419" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "" "0000276313" "04214" "00382464" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276389" "04214" "00382540" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276390" "04214" "00382541" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276391" "04214" "00382542" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000276392" "04214" "00382543" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt Disease" "" "0000276393" "04214" "00382544" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Macular dystrophy unspecified" "" "0000276394" "04214" "00382545" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Generalized retinal dystrophy (non-syndromic)" "" "0000276574" "04214" "00382725" "03840" "Familial, autosomal recessive" "37y" "see paper" "" "5y" "18y" "" "" "" "" "" "" "" "retinal disease" "" "0000276711" "04214" "00382855" "00000" "Familial, autosomal recessive" "62y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000277274" "04214" "00383489" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277275" "04214" "00383490" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277276" "04214" "00383491" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277277" "04214" "00383492" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277526" "04214" "00383741" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277533" "04214" "00383748" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277549" "04214" "00383764" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277571" "04214" "00383786" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277572" "04214" "00383787" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277574" "04214" "00383789" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000277609" "04214" "00383824" "00000" "Familial, autosomal recessive" "33y" "BCVA OD-OS: 20/150-hand movement" "" "" "32y" "" "" "" "" "" "" "" "" "" "0000277627" "04214" "00383842" "00000" "Familial, autosomal recessive" "34y" "BCVA OD-OS: 20/30-20/40" "" "" "23y" "" "" "" "" "" "" "" "" "" "0000277689" "04214" "00383904" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277693" "04214" "00383908" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277709" "04214" "00383924" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277735" "04214" "00383950" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277762" "04214" "00383977" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277793" "04214" "00384008" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277837" "04214" "00384052" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277840" "04214" "00384055" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277844" "04214" "00384059" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277874" "04214" "00384089" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277887" "04214" "00384102" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277906" "04214" "00384121" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277913" "04214" "00384128" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277953" "04214" "00384168" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277958" "04214" "00384173" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277960" "04214" "00384175" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000277967" "04214" "00384182" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000278056" "04214" "00384271" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278068" "04214" "00384283" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000278524" "04214" "00384741" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278525" "04214" "00384742" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278526" "04214" "00384743" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278540" "04214" "00384757" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278541" "04214" "00384758" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278542" "04214" "00384759" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278543" "04214" "00384760" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278544" "04214" "00384761" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa (RP)" "" "0000278971" "04214" "00385175" "00000" "Familial, autosomal recessive" "37y2m" "HP:0001513 Obesity; HP:0000510 Rod-cone dystrophy;" "" "" "" "" "" "" "" "" "" "" "Autosomal Recessive Retinal Dystrophy" "" "0000279191" "04214" "00385395" "00000" "Isolated (sporadic)" "59y" "59" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279193" "04214" "00385397" "00000" "Isolated (sporadic)" "50y" "50" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279201" "04214" "00385405" "00000" "Isolated (sporadic)" "54y" "54" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279515" "04214" "00385702" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279526" "04214" "00385713" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279533" "04214" "00385720" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279541" "04214" "00385728" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000279650" "04214" "00385846" "00000" "Familial, autosomal recessive" "51y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000280029" "04214" "00386226" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000280037" "04214" "00386234" "00000" "Familial, autosomal recessive" "49y" "" "" "" "7y" "" "" "" "" "" "" "Fundus albipunctatus" "" "" "0000280060" "04214" "00386257" "00000" "Familial, autosomal recessive" "39y" "" "" "" "20y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000280077" "04214" "00386274" "00000" "Familial, autosomal recessive" "22y" "" "" "" "5y" "" "" "" "" "" "" "achromatopsia" "" "" "0000280085" "04214" "00386282" "00000" "Familial, autosomal recessive" "48y" "" "" "" "37y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000280086" "04214" "00386283" "00000" "Familial, autosomal recessive" "45y" "" "" "" "34y" "" "" "" "" "" "" "" "" "" "0000280094" "04214" "00386291" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000280105" "04214" "00386302" "00000" "Familial, autosomal recessive" "64y" "" "" "" "18y" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000280367" "04214" "00386567" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280373" "04214" "00386573" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280374" "04214" "00386574" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280388" "04214" "00386588" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280393" "04214" "00386593" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280401" "04214" "00386601" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280409" "04214" "00386609" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280418" "04214" "00386618" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280423" "04214" "00386623" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280424" "04214" "00386624" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280428" "04214" "00386628" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280435" "04214" "00386635" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280445" "04214" "00386645" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280451" "04214" "00386651" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280452" "04214" "00386652" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280469" "04214" "00386669" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280473" "04214" "00386673" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280500" "04214" "00386700" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280512" "04214" "00386712" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280526" "04214" "00386726" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280534" "04214" "00386734" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280536" "04214" "00386736" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280540" "04214" "00386740" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280541" "04214" "00386741" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280558" "04214" "00386758" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280599" "04214" "00386799" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280612" "04214" "00386812" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280625" "04214" "00386825" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280648" "04214" "00386848" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280672" "04214" "00386872" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000280717" "04214" "00386917" "00000" "Familial, autosomal recessive" "47y" "Night blindness for over 40y; decreased visual acuity for about 10y; hearing impairment gradually; bilateral retinal arteriolar attenuation, widespread RPE atrophy; pale optic disc, cataract in both eyes" "" "10y" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000280817" "04214" "00387039" "00000" "Familial, autosomal recessive" "69y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280818" "04214" "00387040" "00000" "Familial, autosomal recessive" "36y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280819" "04214" "00387041" "00000" "Familial, autosomal recessive" "33y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280820" "04214" "00387042" "00000" "Familial, autosomal recessive" "57y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280821" "04214" "00387043" "00000" "Familial, autosomal recessive" "29y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280822" "04214" "00387044" "00000" "Familial, autosomal recessive" "61y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280823" "04214" "00387045" "00000" "Familial, autosomal recessive" "56y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280824" "04214" "00387046" "00000" "Familial, autosomal recessive" "27y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280825" "04214" "00387047" "00000" "Familial, autosomal recessive" "57y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280826" "04214" "00387048" "00000" "Familial, autosomal recessive" "66y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280827" "04214" "00387049" "00000" "Familial, autosomal recessive" "64y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280828" "04214" "00387050" "00000" "Familial, autosomal recessive" "47y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "" "" "0000280953" "04214" "00387390" "00000" "Familial, autosomal recessive" "45y" "posterior subcapsular cataract, peripheral choroidal atrophy, negative family history, BCVA OD/OS: 0.1/0.05" "" "8y" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000280955" "04214" "00387392" "00000" "Familial, autosomal recessive" "72y" "anterior subcapsular cataract, posterior pole choroidal atrophy, negative family history, BCVA OD/OS: HM/HM" "" "7y" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000281192" "04214" "00387629" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Adult retinal dystrophy" "" "0000282030" "04214" "00388478" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy or retinitis pigmentosa (RCD/RP)" "" "0000282032" "04214" "00388480" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy or retinitis pigmentosa (RCD/RP)" "" "0000282040" "04214" "00388488" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy or retinitis pigmentosa (RCD/RP)" "" "0000282056" "04214" "00388504" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "rod-cone dystrophy or retinitis pigmentosa (RCD/RP)" "" "0000282057" "04214" "00388505" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000282082" "04214" "00388542" "00000" "Isolated (sporadic)" "" "Non‐syndrom" "" "" "26y" "" "" "" "" "" "" "Retinitis pigmentosa type 25" "Retinitis pigmentosa" "" "0000282367" "04214" "00388826" "00000" "Familial, autosomal recessive" "51y" "age at genetic diagnosis mentioned" "" "" "48y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282368" "04214" "00388827" "00000" "Familial, autosomal recessive" "79y" "age at genetic diagnosis mentioned" "" "" "77y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282375" "04214" "00388834" "00000" "Familial, autosomal recessive" "76y" "age at genetic diagnosis mentioned" "" "" "73y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282376" "04214" "00388835" "00000" "Familial, autosomal recessive" "84y" "age at genetic diagnosis mentioned" "" "" "81y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282392" "04214" "00388851" "00000" "Familial, autosomal recessive" "67y" "age at genetic diagnosis mentioned" "" "" "64y" "" "" "" "" "" "" "central areolar choroidal dystrophy" "" "" "0000282422" "04214" "00388881" "00000" "Isolated (sporadic)" "53y" "age at genetic diagnosis mentioned" "" "" "49y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000282736" "04214" "00389195" "00000" "Familial, autosomal recessive" "79y" "age at genetic diagnosis mentioned" "" "" "71y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282809" "04214" "00389268" "00000" "Familial, autosomal recessive" "49y" "age at genetic diagnosis mentioned" "" "" "42y" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000282815" "04214" "00389274" "00000" "Familial, autosomal recessive" "42y" "age at genetic diagnosis mentioned" "" "" "35y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282816" "04214" "00389275" "00000" "Familial, autosomal recessive" "39y" "age at genetic diagnosis mentioned" "" "" "31y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282841" "04214" "00389300" "00000" "Familial, autosomal recessive" "61y" "age at genetic diagnosis mentioned" "" "" "54y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282842" "04214" "00389301" "00000" "Familial, autosomal recessive" "65y" "age at genetic diagnosis mentioned" "" "" "58y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282876" "04214" "00389335" "00000" "Familial, autosomal recessive" "55y" "age at genetic diagnosis mentioned" "" "" "47y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282877" "04214" "00389336" "00000" "Familial, autosomal recessive" "51y" "age at genetic diagnosis mentioned" "" "" "44y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282935" "04214" "00389394" "00000" "Familial, autosomal recessive" "53y" "age at genetic diagnosis mentioned" "" "" "47y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282976" "04214" "00389435" "00000" "Familial, autosomal recessive" "52y" "age at genetic diagnosis mentioned" "" "" "48y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282977" "04214" "00389436" "00000" "Familial, autosomal recessive" "49y" "age at genetic diagnosis mentioned" "" "" "45y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000282983" "04214" "00389442" "00000" "Familial, autosomal recessive" "54y" "age at genetic diagnosis mentioned" "" "" "50y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283078" "04214" "00389537" "00000" "Familial, autosomal recessive" "79y" "age at genetic diagnosis mentioned" "" "" "77y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283083" "04214" "00389542" "00000" "Familial, autosomal recessive" "46y" "age at genetic diagnosis mentioned" "" "" "45y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283114" "04214" "00389573" "00000" "Familial, autosomal recessive" "57y" "age at genetic diagnosis mentioned" "" "" "55y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283142" "04214" "00389601" "00000" "Isolated (sporadic)" "46y" "age at genetic diagnosis mentioned" "" "" "41y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283146" "04214" "00389605" "00000" "Familial, autosomal recessive" "33y" "age at genetic diagnosis mentioned" "" "" "32y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283179" "04214" "00389638" "00000" "Familial, autosomal recessive" "19y" "age at genetic diagnosis mentioned" "" "" "18y" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa" "" "" "0000283180" "04214" "00389639" "00000" "Isolated (sporadic)" "23y" "age at genetic diagnosis mentioned" "" "" "18y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283187" "04214" "00389646" "00000" "Isolated (sporadic)" "63y" "age at genetic diagnosis mentioned" "" "" "58y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283224" "04214" "00389683" "00000" "Isolated (sporadic)" "68y" "age at genetic diagnosis mentioned" "" "" "64y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283310" "04214" "00389769" "00000" "Familial, autosomal recessive" "37y" "age at genetic diagnosis mentioned" "" "" "32y" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000283331" "04214" "00389790" "00000" "Isolated (sporadic)" "60y" "age at genetic diagnosis mentioned" "" "" "52y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283344" "04214" "00389803" "00000" "Isolated (sporadic)" "50y" "age at genetic diagnosis mentioned" "" "" "44y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283350" "04214" "00389809" "00000" "Isolated (sporadic)" "31y" "age at genetic diagnosis mentioned" "" "" "24y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283353" "04214" "00389812" "00000" "Isolated (sporadic)" "62y" "age at genetic diagnosis mentioned" "" "" "54y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283368" "04214" "00389827" "00000" "Familial, autosomal recessive" "55y" "age at genetic diagnosis mentioned" "" "" "54y" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000283417" "04214" "00389876" "00000" "Isolated (sporadic)" "56y" "age at genetic diagnosis mentioned" "" "" "54y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283473" "04214" "00389932" "00000" "Isolated (sporadic)" "55y" "age at genetic diagnosis mentioned" "" "" "54y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283475" "04214" "00389934" "00000" "Isolated (sporadic)" "44y" "age at genetic diagnosis mentioned" "" "" "42y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283504" "04214" "00389963" "00000" "Isolated (sporadic)" "46y" "age at genetic diagnosis mentioned" "" "" "44y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283518" "04214" "00389977" "00000" "Isolated (sporadic)" "22y" "age at genetic diagnosis mentioned" "" "" "21y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283551" "04214" "00390010" "00000" "Isolated (sporadic)" "52y" "age at genetic diagnosis mentioned" "" "" "50y" "" "" "" "" "" "" "sporadic retinitis pigmentosa" "" "" "0000283789" "04214" "00390251" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283790" "04214" "00390252" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283791" "04214" "00390253" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283792" "04214" "00390254" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283793" "04214" "00390255" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" "" "0000283794" "04214" "00390256" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283795" "04214" "00390257" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283796" "04214" "00390258" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283797" "04214" "00390259" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000283798" "04214" "00390260" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000284011" "04214" "00390473" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" "" "0000284226" "04214" "00390738" "00000" "Familial, autosomal recessive" "52y" "Visual acuity right eye/left eye: 2/10_2/10, typical rp changes with bone spicule shaped pigment, deposits in the mid periphery, yellowish macular deposits, macular atrophy" "" "10y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000284227" "04214" "00390739" "00000" "Familial, autosomal recessive" "32y" "Visual acuity right eye/left eye: 5/10_5/10_, typical rp changes with bone spicule shaped pigment, deposits in the mid periphery, normal macula" "" "16y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000284296" "04214" "00390808" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "" "0000284668" "04214" "00391227" "00000" "Familial, autosomal recessive" "34y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284670" "04214" "00391229" "00000" "Familial, autosomal recessive" "51y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284671" "04214" "00391230" "00000" "Familial, autosomal recessive" "61y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284672" "04214" "00391231" "00000" "Familial, autosomal recessive" "70y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284674" "04214" "00391233" "00000" "Familial, autosomal recessive" "39y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284676" "04214" "00391235" "00000" "Familial, autosomal recessive" "77y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284679" "04214" "00391238" "00000" "Familial, autosomal recessive" "48y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284680" "04214" "00391239" "00000" "Familial, autosomal recessive" "46y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284681" "04214" "00391240" "00000" "Familial, autosomal recessive" "27y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284684" "04214" "00391243" "00000" "Familial, autosomal recessive" "60y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284685" "04214" "00391244" "00000" "Familial, autosomal recessive" "47y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284686" "04214" "00391245" "00000" "Familial, autosomal recessive" "57y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284687" "04214" "00391246" "00000" "Familial, autosomal recessive" "54y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284689" "04214" "00391248" "00000" "Familial, autosomal recessive" "44y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284701" "04214" "00391260" "00000" "Familial, autosomal recessive" "49y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284703" "04214" "00391262" "00000" "Familial, autosomal recessive" "50y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284704" "04214" "00391263" "00000" "Familial, autosomal recessive" "59y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284708" "04214" "00391267" "00000" "Familial, autosomal recessive" "48y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284713" "04214" "00391272" "00000" "Familial, autosomal recessive" "64y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284714" "04214" "00391273" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284715" "04214" "00391274" "00000" "Familial, autosomal recessive" "46y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284717" "04214" "00391276" "00000" "Familial, autosomal recessive" "47y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284718" "04214" "00391277" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284719" "04214" "00391278" "00000" "Familial, autosomal recessive" "50y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284720" "04214" "00391279" "00000" "Familial, autosomal recessive" "53y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284722" "04214" "00391281" "00000" "Familial, autosomal recessive" "51y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284725" "04214" "00391284" "00000" "Familial, autosomal recessive" "53y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284726" "04214" "00391285" "00000" "Familial, autosomal recessive" "50y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284727" "04214" "00391286" "00000" "Familial, autosomal recessive" "40y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284728" "04214" "00391287" "00000" "Familial, autosomal recessive" "53y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000284729" "04214" "00391288" "00000" "Familial, autosomal recessive" "42y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa" "Retinitis pigmentosa" "" "0000285647" "04214" "00392371" "00000" "Familial, autosomal recessive" "51y" "best corrected visual acuity right/left eye: 0.4/0.4, electroretinograhy responses: extinguished" "" "<5y" "" "" "" "" "" "" "" "Retinitis pigmentosa, autosomal recessive" "Retinitis pigmentosa, autosomal dominant" "" "0000285822" "04214" "00392575" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285825" "04214" "00392578" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285826" "04214" "00392579" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285830" "04214" "00392583" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285847" "04214" "00392600" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285849" "04214" "00392602" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285851" "04214" "00392604" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285899" "04214" "00392652" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285907" "04214" "00392660" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285908" "04214" "00392661" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000285909" "04214" "00392662" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "retinitis pigmentosa" "" "0000286700" "04214" "00393494" "00000" "Familial, autosomal recessive" "37y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286768" "04214" "00393562" "00000" "Isolated (sporadic)" "36y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286775" "04214" "00393569" "00000" "Familial, autosomal recessive" "43y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286790" "04214" "00393584" "00000" "Familial, autosomal recessive" "36y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286796" "04214" "00393590" "00000" "Isolated (sporadic)" "32y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286800" "04214" "00393594" "00000" "Isolated (sporadic)" "42y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000286807" "04214" "00393601" "00000" "Isolated (sporadic)" "45y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286823" "04214" "00393617" "00000" "Familial, autosomal dominant" "42y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000286892" "04214" "00393686" "00000" "Isolated (sporadic)" "39y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286904" "04214" "00393698" "00000" "Familial, autosomal recessive" "51y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000286906" "04214" "00393700" "00000" "Isolated (sporadic)" "24y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000286920" "04214" "00393714" "00000" "Familial, autosomal recessive" "31y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286953" "04214" "00393747" "00000" "Isolated (sporadic)" "43y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000286982" "04214" "00393776" "00000" "Isolated (sporadic)" "36y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000287011" "04214" "00393805" "00000" "Isolated (sporadic)" "66y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287019" "04214" "00393813" "00000" "Familial, autosomal recessive" "45y" "" "" "" "" "" "" "" "" "" "" "" "Cone-rod Dystrophy (CORD)" "" "0000287031" "04214" "00393825" "00000" "Familial, autosomal dominant" "52y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287059" "04214" "00393853" "00000" "Isolated (sporadic)" "39y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287075" "04214" "00393869" "00000" "Familial, autosomal recessive" "55y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287103" "04214" "00393897" "00000" "Isolated (sporadic)" "34y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287108" "04214" "00393902" "00000" "Isolated (sporadic)" "37y" "" "" "" "" "" "" "" "" "" "" "" "Retinitis Pigmentosa (RP)" "" "0000287204" "04214" "00393998" "00000" "Familial, autosomal recessive" "" "SNHL; severity, moderate; onset, adulthood (age 41); evolution" "" "20y" "" "" "" "" "" "" "" "" "Usher syndrome" "" "0000287523" "04214" "00394319" "00000" "Familial, autosomal recessive" "" "RP, ERG consistent with \"\"atypical RP\"\"" "" "20y" "" "" "" "" "" "" "" "retinits pigmentosa" "" "" "0000287524" "04214" "00394320" "00000" "Familial, autosomal recessive" "" "RP, ERG consistent with RP" "" "20y" "" "" "" "" "" "" "" "retinits pigmentosa" "" "" "0000287757" "04214" "00394554" "00000" "Familial, autosomal recessive" "57y" "" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287773" "04214" "00394570" "00000" "Familial, autosomal recessive" "55y" "" "" "15y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287774" "04214" "00394571" "00000" "Familial, autosomal recessive" "44y" "" "" "18y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287775" "04214" "00394572" "00000" "Familial, autosomal recessive" "38y" "" "" "30y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287776" "04214" "00394573" "00000" "Familial, autosomal recessive" "31y" "" "" "16y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287777" "04214" "00394574" "00000" "Familial, autosomal recessive" "56y" "" "" "20y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287778" "04214" "00394575" "00000" "Familial, autosomal recessive" "44y" "" "" "26y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287779" "04214" "00394576" "00000" "Familial, autosomal recessive" "76y" "" "" "45y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287780" "04214" "00394577" "00000" "Familial, autosomal recessive" "60y" "" "" "22y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287781" "04214" "00394578" "00000" "Familial, autosomal recessive" "63y" "" "" "39y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287782" "04214" "00394579" "00000" "Familial, autosomal recessive" "59y" "" "" "42y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287783" "04214" "00394580" "00000" "Familial, autosomal recessive" "77y" "" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287784" "04214" "00394581" "00000" "Familial, autosomal recessive" "54y" "" "" "30y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287785" "04214" "00394582" "00000" "Familial, autosomal recessive" "89y" "" "" "25y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287786" "04214" "00394583" "00000" "Familial, autosomal recessive" "54y" "" "" "23y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287787" "04214" "00394584" "00000" "Familial, autosomal recessive" "68y" "" "" "46y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287788" "04214" "00394585" "00000" "Familial, autosomal recessive" "30y" "" "" "23y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287789" "04214" "00394586" "00000" "Familial, autosomal recessive" "54y" "" "" "20y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287790" "04214" "00394587" "00000" "Familial, autosomal recessive" "72y" "" "" "55y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287791" "04214" "00394588" "00000" "Familial, autosomal recessive" "48y" "" "" "38y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287792" "04214" "00394589" "00000" "Familial, autosomal recessive" "55y" "" "" "8y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287793" "04214" "00394590" "00000" "Familial, autosomal recessive" "67y" "" "" "30y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287794" "04214" "00394591" "00000" "Familial, autosomal recessive" "71y" "" "" "18y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287795" "04214" "00394592" "00000" "Familial, autosomal recessive" "53y" "" "" "17y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287796" "04214" "00394593" "00000" "Familial, autosomal recessive" "71y" "" "" "25y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287797" "04214" "00394594" "00000" "Familial, autosomal recessive" "40y" "" "" "20y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287798" "04214" "00394595" "00000" "Familial, autosomal recessive" "63y" "" "" "10y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287799" "04214" "00394596" "00000" "Familial, autosomal recessive" "65y" "" "" "49y" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000287800" "04214" "00394597" "00000" "Familial, autosomal recessive" "41y" "" "" "" "" "" "" "" "" "" "" "" "Nonsyndromic retinitis pigmentosa" "" "0000288621" "04214" "00395422" "00000" "Familial, autosomal recessive" "34y" "Night blindness, best corrected visual acuity 0.5/0.6" "" "14y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288622" "04214" "00395423" "00000" "Familial, autosomal recessive" "51y" "Night blindness, best corrected visual acuity LP" "" "20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288623" "04214" "00395424" "00000" "Familial, autosomal recessive" "60y" "Night blindness, best corrected visual acuity hand movement/hand movement" "" "20y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288775" "04214" "00395577" "00000" "Familial, autosomal recessive" "" "dyschromatopsia, optic neuropathy, photophobia, posterior subcapsular cataract, rod-cone dystrophy, unilateral deafness (phenotypic finding probably explained by a non-genetic cause)" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288951" "04214" "00395789" "00000" "Unknown" "77y10m" "" "" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288953" "04214" "00395791" "00000" "Unknown" "32y11m" "" "" "30y" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000288961" "04214" "00395799" "00000" "Unknown" "58y2m" "" "" "48y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288973" "04214" "00395811" "00000" "Unknown" "64y2m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288976" "04214" "00395814" "00000" "Unknown" "42y" "" "" "38y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288979" "04214" "00395817" "00000" "Unknown" "54y2m" "" "" "25y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288980" "04214" "00395818" "00000" "Unknown" "41y8m" "" "" "30y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288994" "04214" "00395832" "00000" "Unknown" "59y" "" "" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288995" "04214" "00395833" "00000" "Unknown" "37y1m" "" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288996" "04214" "00395834" "00000" "Unknown" "37y5m" "" "" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288997" "04214" "00395835" "00000" "Unknown" "46y8m" "" "" "28y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000288999" "04214" "00395837" "00000" "Unknown" "55y" "" "" "45y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289000" "04214" "00395838" "00000" "Unknown" "63y2m" "" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289001" "04214" "00395839" "00000" "Unknown" "64y6m" "" "" "45y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289002" "04214" "00395840" "00000" "Unknown" "21y7m" "" "" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289007" "04214" "00395845" "00000" "Unknown" "42y1m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289010" "04214" "00395848" "00000" "Unknown" "70y" "" "" "60y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289046" "04214" "00395884" "00000" "Unknown" "37y4m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289066" "04214" "00395904" "00000" "Unknown" "41y5m" "" "" "12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289075" "04214" "00395913" "00000" "Unknown" "36y6m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289085" "04214" "00395923" "00000" "Unknown" "40y7m" "" "" "37y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289091" "04214" "00395929" "00000" "Unknown" "37y8m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289111" "04214" "00395949" "00000" "Unknown" "71y11m" "" "" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000289126" "04214" "00395964" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "sector retinitis pigmentosa" "" "" "0000289591" "04214" "00396429" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000289624" "04214" "00396463" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000289652" "04214" "00396491" "00000" "Unknown" "46y" "constriction of visual field combinded with normal tension glaucoma" "" "46y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289653" "04214" "00396492" "00000" "Unknown" "41y" "night blindness combined with granular corneal dystrophy" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289654" "04214" "00396493" "00000" "Isolated (sporadic)" "35y" "" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289656" "04214" "00396495" "00000" "Isolated (sporadic)" "26y" "decreased visual acuity" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289659" "04214" "00396498" "00000" "Familial, autosomal recessive" "46y" "night blindness" "" "41y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289661" "04214" "00396500" "00000" "Familial, autosomal recessive" "59y" "" "" "44y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289662" "04214" "00396501" "00000" "Familial, autosomal recessive" "26y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289664" "04214" "00396503" "00000" "Isolated (sporadic)" "53y" "constriction of visual field" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289665" "04214" "00396504" "00000" "Unknown" "63y" "night blindness" "" "12y-18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289666" "04214" "00396505" "00000" "Isolated (sporadic)" "63y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289667" "04214" "00396506" "00000" "Familial, autosomal recessive" "54y" "night blindness" "" "34y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289675" "04214" "00396514" "00000" "Isolated (sporadic)" "22y" "night blindness" "" "15y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289677" "04214" "00396516" "00000" "Isolated (sporadic)" "29y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289678" "04214" "00396517" "00000" "Isolated (sporadic)" "42y" "night blindness" "" "30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289679" "04214" "00396518" "00000" "Isolated (sporadic)" "33y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289680" "04214" "00396519" "00000" "Isolated (sporadic)" "89y" "decreased visual acuity" "" "70y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289684" "04214" "00396523" "00000" "Familial, autosomal recessive" "52y" "decreased visual acuity" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289685" "04214" "00396524" "00000" "Familial, X-linked" "21y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289695" "04214" "00396534" "00000" "Isolated (sporadic)" "41y" "night blindness" "" "39y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289696" "04214" "00396535" "00000" "Isolated (sporadic)" "59y" "normal tension glaucoma" "" "41y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289701" "04214" "00396540" "00000" "Isolated (sporadic)" "31y" "photophibia" "" "30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289703" "04214" "00396542" "00000" "Isolated (sporadic)" "70y" "photophibia combined with normal tension glaucoma" "" "46y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289713" "04214" "00396552" "00000" "Isolated (sporadic)" "58y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289717" "04214" "00396556" "00000" "Isolated (sporadic)" "60y" "night blindness" "" "58y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289723" "04214" "00396562" "00000" "Familial, autosomal recessive" "59y" "night blindness" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289735" "04214" "00396574" "00000" "Isolated (sporadic)" "66y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289739" "04214" "00396578" "00000" "Isolated (sporadic)" "62y" "night blindness" "" "30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289741" "04214" "00396580" "00000" "Familial, autosomal recessive" "55y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289743" "04214" "00396582" "00000" "Familial, autosomal recessive" "71y" "night blindness combined with normal tension glaucoma" "" "68y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289747" "04214" "00396586" "00000" "Familial, autosomal recessive" "57y" "night blindness" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289749" "04214" "00396588" "00000" "Familial, X-linked" "13y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289751" "04214" "00396590" "00000" "Familial, autosomal recessive" "58y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289759" "04214" "00396598" "00000" "Isolated (sporadic)" "61y" "night blindness" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289763" "04214" "00396602" "00000" "Familial, autosomal dominant" "76y" "decreased visual acuity" "" "50y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289765" "04214" "00396604" "00000" "Familial, autosomal recessive" "81y" "night blindness" "" "33y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289767" "04214" "00396606" "00000" "Familial, autosomal recessive" "54y" "night blindness" "" "19y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289769" "04214" "00396608" "00000" "Isolated (sporadic)" "36y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289775" "04214" "00396614" "00000" "Familial, autosomal dominant" "58y" "night blindness" "" "11y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289783" "04214" "00396622" "00000" "Isolated (sporadic)" "32y" "constriction of visual field" "" "30y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289785" "04214" "00396624" "00000" "Isolated (sporadic)" "26y" "constriction of visual field" "" "24y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289791" "04214" "00396630" "00000" "Familial, autosomal recessive" "11y" "decreased visual acuity" "" "6y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289792" "04214" "00396631" "00000" "Isolated (sporadic)" "27y" "night blindness" "" "27y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289793" "04214" "00396632" "00000" "Isolated (sporadic)" "46y" "night blindness" "" "44y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289799" "04214" "00396638" "00000" "Isolated (sporadic)" "56y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289802" "04214" "00396641" "00000" "Isolated (sporadic)" "43y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289804" "04214" "00396643" "00000" "Isolated (sporadic)" "54y" "night blindness" "" "<12y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289805" "04214" "00396644" "00000" "Unknown" "46y" "night blindness conbined with central serous chorioretinopathy" "" "20y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289806" "04214" "00396645" "00000" "Isolated (sporadic)" "63y" "decreased visual acuity" "" "60y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289812" "04214" "00396651" "00000" "Unknown" "70y" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289813" "04214" "00396652" "00000" "Unknown" "40y" "atypical phenotype(dystrophy only in nasal area)" "" "40y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289814" "04214" "00396653" "00000" "Isolated (sporadic)" "68y" "night blindness" "" "59y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000289815" "04214" "00396654" "00000" "Familial, autosomal recessive" "26y" "night blindness; atypical phenotype(without pigmentation)" "" "12y-18y" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000293124" "05415" "00400083" "00000" "Familial, autosomal recessive" "" "progressive night blindness and mild to severe hearing impairment, which indicates the diagnosis of USH2; the fundus abnormalities, electroretinography: flattening in the rod and cone responses; optical coherence tomography: reduced photoreceptor layer thickness" "" "" "" "" "" "" "" "" "" "Usher syndrome type 2" "" "" "0000295023" "04214" "00402260" "00000" "Familial, autosomal recessive" "57y" "age of night blindness onset: 20y, best corrected visual acuity right/left eye: hand movement /no light perception, intraocular lens" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000295032" "04214" "00402269" "00000" "Familial, autosomal recessive" "19y" "age of night blindness onset: 10y" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300531" "04214" "00408415" "00000" "Familial, autosomal recessive" "19y" "night vision impairment; night blindness; photophobia, no cataract, refraction od/os : -1.0/-1.25, best corrected visual acuity right/left eye: 0.3/0.3; visual field: central tubular 10deg d (g ii/4a); central tubular 20deg D (G V/4a); no peripheral fields (G V/4a); fundus: optic discs pale, surrounded by peripapillar retinal pigment epithelium atrophy; moderate attenuation of retinal vessels; rather high cystic macular oedema; peripheral retinal atrophy with retinal pigment dots, but no bone spicule coretinitis pigmentosauscles; large choroidal vessels clearly visible under atrophic retinal pigment epithelium; near infrared reflectance imaging: slightly pale fundus" "" "13y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300532" "04214" "00408416" "00000" "Familial, autosomal recessive" "24y" "night vision impairment; night blindness; photophobia, no cataract, refraction od/os : -2.0 cyl+0.75 ax 150deg/-2.5 cyl+1.25 ax 92deg, best corrected visual acuity right/left eye: 0.3/0.3; visual field: central tubular 15deg D (G II/4); Pericentral ring scotoma from 5deg-15deg; peripheral scotomas (G V/4a); fundus: optic discs pale, surrounded by white temporal cuffs; moderate attenuation of retinal vessels; macular foveal cups very shallow; general chorioretinal atrophy, pigment migration with dots and bone spicule coretinitis pigmentosauscles; large choroidal vessels clearly visible under atrophic retinal pigment epithelium; near infrared reflectance imaging : slightly pale fundus" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000300556" "04214" "00408440" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "early onset rod-cone dystrophy" "" "" "0000300557" "04214" "00408441" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "early onset rod-cone dystrophy" "" "" "0000301618" "04214" "00409501" "00000" "Familial, autosomal recessive" "52y" "right eye: best corrected visual acuity: 20/29; axial length: 24.29; Humphrey field analyzer with the 10-2 SITA standard program, dB: -24.62; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301619" "04214" "00409502" "00000" "Familial, autosomal recessive" "43y" "right eye: best corrected visual acuity: 20/17; axial length: 24.77; Humphrey field analyzer with the 10-2 SITA standard program, dB: -12.92; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301621" "04214" "00409504" "00000" "Familial, autosomal recessive" "45y" "right eye: best corrected visual acuity: 20/13; axial length: 25.55; Humphrey field analyzer with the 10-2 SITA standard program, dB: -0.78; electroretinogram cone flicker, amplitude, uV: 11, latency, ms: 28.8" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301622" "04214" "00409505" "00000" "Familial, autosomal recessive" "59y" "right eye: best corrected visual acuity: 20/13; axial length: 25.3; Humphrey field analyzer with the 10-2 SITA standard program, dB: 0.82; electroretinogram cone flicker, amplitude, uV: 25, latency, ms: 36.6" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301623" "04214" "00409506" "00000" "Familial, autosomal recessive" "58y" "left eye: best corrected visual acuity: 20/400; axial length: 23.1; Humphrey field analyzer with the 10-2 SITA standard program, dB: -23.89; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301626" "04214" "00409509" "00000" "Familial, autosomal recessive" "69y" "right eye: best corrected visual acuity: 20/100; axial length: 23.04; Humphrey field analyzer with the 10-2 SITA standard program, dB: -12.19; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301627" "04214" "00409510" "00000" "Familial, autosomal recessive" "71y" "right eye: best corrected visual acuity: 20/17; axial length: 24.11; Humphrey field analyzer with the 10-2 SITA standard program, dB: -18.43; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301628" "04214" "00409511" "00000" "Familial, autosomal recessive" "47y" "right eye: best corrected visual acuity: 20/133; axial length: 23.08; Humphrey field analyzer with the 10-2 SITA standard program, dB: -31.22; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301629" "04214" "00409512" "00000" "Familial, autosomal recessive" "51y" "right eye: best corrected visual acuity: 20/22; axial length: 23.97; Humphrey field analyzer with the 10-2 SITA standard program, dB: -24.2; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301630" "04214" "00409513" "00000" "Familial, autosomal recessive" "66y" "right eye: best corrected visual acuity: 20/25; axial length: 24.07; Humphrey field analyzer with the 10-2 SITA standard program, dB: -20.35; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301631" "04214" "00409514" "00000" "Familial, autosomal recessive" "31y" "right eye: best corrected visual acuity: 20/13; axial length: 25.56; Humphrey field analyzer with the 10-2 SITA standard program, dB: -0.63; electroretinogram cone flicker, amplitude, uV: 28.6, latency, ms: 34.8" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301636" "04214" "00409519" "00000" "Familial, autosomal recessive" "41y" "left eye: best corrected visual acuity: 20/40; axial length: 25.69; Humphrey field analyzer with the 10-2 SITA standard program, dB: -22.39; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301637" "04214" "00409520" "00000" "Familial, autosomal recessive" "47y" "right eye: best corrected visual acuity: 20/50; axial length: 21.8; Humphrey field analyzer with the 10-2 SITA standard program, dB: -16.44; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301638" "04214" "00409521" "00000" "Familial, autosomal recessive" "66y" "right eye: best corrected visual acuity: 20/222; axial length: 23.21; Humphrey field analyzer with the 10-2 SITA standard program, dB: -31.77; electroretinogram cone flicker, amplitude, uV: extinguished, latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301639" "04214" "00409522" "00000" "Familial, autosomal recessive" "44y" "right eye: best corrected visual acuity: 20/17; axial length: 25.55; Humphrey field analyzer with the 10-2 SITA standard program, dB: -4.93; electroretinogram cone flicker, amplitude, uV: 25, latency, ms: 27.4" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000301640" "04214" "00409523" "00000" "Familial, autosomal recessive" "49y" "right eye: best corrected visual acuity: 20/333; axial length: 22.46; Humphrey field analyzer with the 10-2 SITA standard program, dB: -24.79; electroretinogram cone flicker, amplitude, uV: N.A., latency, ms: extinguished" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303059" "04214" "00410969" "00000" "Familial, autosomal recessive" "13y" "Follow-up duration: 1y; Last exam BCVA: RE 20/20 LE 20/20" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303060" "04214" "00410970" "00000" "Familial, autosomal recessive" "25y" "Follow-up duration: 10y; Last exam BCVA: RE 20/20 LE 20/20" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303061" "04214" "00410971" "00000" "Familial, autosomal recessive" "33y" "Follow-up duration: 15y; Last exam BCVA: RE 20/80 LE 20/500" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303062" "04214" "00410972" "00000" "Familial, autosomal recessive" "46y" "Follow-up duration: 27y; Last exam BCVA: RE 20/50 LE 20/50" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303063" "04214" "00410973" "00000" "Familial, autosomal recessive" "39y" "Follow-up duration: 15y; Last exam BCVA: RE 20/100 LE 20/100" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303064" "04214" "00410974" "00000" "Familial, autosomal recessive" "25y" "Follow-up duration: 1y; Last exam BCVA: RE 20/20 LE 20/20" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303065" "04214" "00410975" "00000" "Familial, autosomal recessive" "46y" "Follow-up duration: 14y; Last exam BCVA: RE 20/50 LE 20/80" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303066" "04214" "00410976" "00000" "Familial, autosomal recessive" "33y" "BCVA: RE 20/30 LE 20/50" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303067" "04214" "00410977" "00000" "Familial, autosomal recessive" "48y" "Follow-up duration: 14y; Last exam BCVA: RE 20/70 LE 20/100" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303068" "04214" "00410978" "00000" "Familial, autosomal recessive" "39y" "Follow-up duration: 3y; Last exam BCVA: RE 20/50 LE 20/50" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303069" "04214" "00410979" "00000" "Familial, autosomal recessive" "38y" "BCVA: RE 20/50 LE 20/60" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303070" "04214" "00410980" "00000" "Familial, autosomal recessive" "46y" "Follow-up duration: 6y; Last exam BCVA: RE 20/25 LE 20/25" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303071" "04214" "00410981" "00000" "Familial, autosomal recessive" "48y" "BCVA: RE 20/32 LE 20/25" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303072" "04214" "00410982" "00000" "Familial, autosomal recessive" "47y" "BCVA: hand motions both eyes" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303073" "04214" "00410983" "00000" "Familial, autosomal recessive" "54y" "Follow-up duration: 3y; Last exam BCVA: RE 20/40 LE 20/30" "" "" "" "" "" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303074" "04214" "00410984" "00000" "Familial, autosomal recessive" "58y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303075" "04214" "00410985" "00000" "Familial, autosomal recessive" "46y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303076" "04214" "00410986" "00000" "Familial, autosomal recessive" "66y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303077" "04214" "00410987" "00000" "Familial, autosomal recessive" "33y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303078" "04214" "00410988" "00000" "Familial, autosomal recessive" "83y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303079" "04214" "00410989" "00000" "Familial, autosomal recessive" "44y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303080" "04214" "00410990" "00000" "Familial, autosomal recessive" "65y" "crescent-shaped ring" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000303081" "04214" "00410991" "00000" "Familial, autosomal recessive" "37y" "typical ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303082" "04214" "00410992" "00000" "Familial, autosomal recessive" "61y" "typical ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303083" "04214" "00410993" "00000" "Familial, autosomal recessive" "28y" "typical ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303084" "04214" "00410994" "00000" "Familial, autosomal recessive" "58y" "no ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303085" "04214" "00410995" "00000" "Familial, autosomal recessive" "54y" "no ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303086" "04214" "00410996" "00000" "Familial, autosomal recessive" "30y" "no ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303087" "04214" "00410997" "00000" "Familial, autosomal recessive" "45y" "no ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303088" "04214" "00410998" "00000" "Familial, autosomal recessive" "70y" "no ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303089" "04214" "00410999" "00000" "Familial, autosomal recessive" "30y" "no ring" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000303090" "04214" "00411000" "00000" "Familial, autosomal recessive" "70y" "BCVA: 20/32; Subcapsular-cataract; RPE atrophy midperiphery involving vascular arcades bone spicules spared macula vascular thinning peripapillary atrophy; Macular profile irregularities, macular ORL preserved, very small cysts in INL" "" "" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303091" "04214" "00411001" "00000" "Familial, autosomal recessive" "70y" "BCVA: 20/30; Subcapsular-cataract; RPE atrophy midperiphery involving vascular arcades bone spicules spared macula vascular thinning peripapillary atrophy; Preserved foveal profile, macular ORL preserved, single cyst in INL" "" "" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303092" "04214" "00411002" "00000" "Familial, autosomal recessive" "40y" "BCVA: 20/30; Subcapsular-cataract; RPE atrophy midperiphery involving vascular arcades bone spicules spared macula vascular thinning peripapillary atrophy; Parafoveal ORL atrophy, epiretinal membrane with irregular macular profile" "" "18y" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303093" "04214" "00411003" "00000" "Familial, autosomal recessive" "33y" "BCVA: 20/20; No-lens-opacity; RPE dystrophy at the midperiphery, few bone spicules, Epiretinal membrane ; Epiretinal membrane, temporal ORL atrophy" "" "22y" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303094" "04214" "00411004" "00000" "Familial, autosomal recessive" "58y" "BCVA: 20/20; Cortical-opacities; RPE atrophy midperiphery involving inferior vascular arcades bone spicules spared macula vascular thinning peripapillary atrophy; ORL atrophy in the temporal region, INL cysts, normal foveal profile" "" "" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303095" "04214" "00411005" "00000" "Familial, autosomal recessive" "59y" "BCVA: RE 20/40 -LE 20/32; Subcapsular-cataract; RPE atrophy midperiphery involving vascular arcades few bone spicules spared macula vascular thinning peripapillary atrophy; ORL atrophy beyond the fovea, small INL cysts" "" "37y" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303096" "04214" "00411006" "00000" "Familial, autosomal recessive" "51y" "BCVA: RE 20/63 - LE 20/40; Subcapsular-cataract; Widespread RPE and choroidal atrophy involving the posterior pole bone spicules vascular thinning spared macula; ORL atrophy beyond the fovea" "" "" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303097" "04214" "00411007" "00000" "Familial, autosomal recessive" "70y" "BCVA: light perception; Widespread choroido-retinal atrophy, macula involved; RPE and neuroepithelium atrophy" "" "23y" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303098" "04214" "00411008" "00000" "Familial, autosomal recessive" "64y" "BCVA: light perception; Subcapsular-cataract; Diffuse choroidoretinal atrophy, macula involved; RPE and neuroepithelium atrophy" "" "30y" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000303099" "04214" "00411009" "00000" "Familial, autosomal recessive" "30y" "BCVA: 20/20; RPE atrophy midperiphery involving vascular arcades bone spicules spared macula vascular thinning; Preserved foveal profile, macular ORL preserved" "" "24y" "" "" "night blindness and progressive constriction of the visual field" "" "" "" "" "" "autosomal recessive retinitis pigmentosa (arRP)" "" "0000306270" "00198" "00414435" "00000" "Familial, autosomal recessive" "53y" "" "" "" "" "" "" "" "" "" "" "Retinitis pigmentosa 25" "" "" "0000310971" "04214" "00419691" "04405" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000311150" "00112" "00419869" "00006" "Familial, autosomal recessive" "23y" "" "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000311151" "00112" "00419870" "00006" "Familial, autosomal recessive" "62y" "" "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000311639" "04214" "00420391" "00000" "Familial, autosomal recessive" "21y7m" "" "" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311643" "04214" "00420395" "00000" "Familial, autosomal recessive" "71y11m" "" "" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311646" "04214" "00420398" "00000" "Familial, autosomal recessive" "37y1m" "" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311655" "04214" "00420407" "00000" "Familial, autosomal recessive" "59y" "" "" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311668" "04214" "00420420" "00000" "Familial, autosomal recessive" "41y8m" "" "" "30y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311691" "04214" "00420443" "00000" "Familial, autosomal recessive" "77y10m" "" "" "50y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311693" "04214" "00420445" "00000" "Familial, autosomal recessive" "70y" "" "" "60y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311698" "04214" "00420450" "00000" "Familial, autosomal recessive" "32y11m" "" "" "30y" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "" "0000311699" "04214" "00420451" "00000" "Familial, autosomal recessive" "58y2m" "" "" "48y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311724" "04214" "00420476" "00000" "Familial, autosomal recessive" "46y8m" "" "" "28y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311727" "04214" "00420479" "00000" "Familial, autosomal recessive" "37y8m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311747" "04214" "00420499" "00000" "Familial, autosomal recessive" "37y5m" "" "" "16y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311748" "04214" "00420500" "00000" "Familial, autosomal recessive" "37y4m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311753" "04214" "00420505" "00000" "Familial, autosomal recessive" "64y6m" "" "" "45y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311766" "04214" "00420518" "00000" "Familial, autosomal recessive" "55y" "" "" "45y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311790" "04214" "00420542" "00000" "Familial, autosomal recessive" "63y2m" "" "" "15y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311793" "04214" "00420545" "00000" "Familial, autosomal recessive" "40y7m" "" "" "37y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311796" "04214" "00420548" "00000" "Familial, autosomal recessive" "36y6m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311804" "04214" "00420556" "00000" "Familial, autosomal recessive" "64y2m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311811" "04214" "00420563" "00000" "Familial, autosomal recessive" "42y" "" "" "38y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311812" "04214" "00420564" "00000" "Familial, autosomal recessive" "54y2m" "" "" "25y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311818" "04214" "00420570" "00000" "Familial, autosomal recessive" "41y5m" "" "" "12y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000311834" "04214" "00420586" "00000" "Familial, autosomal recessive" "42y1m" "" "" "21y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000317058" "04214" "00425888" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "expressed at a lower quantity than wild type" "" "" "" "retinitis pigmentosa" "" "" "0000318051" "04214" "00426913" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" "cone dystrophy" "" "0000320368" "00112" "00429496" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320374" "00112" "00429502" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320384" "00112" "00429512" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320391" "00112" "00429519" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320401" "00112" "00429529" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320417" "00112" "00429545" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320420" "00112" "00429548" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320425" "00112" "00429553" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320426" "00112" "00429554" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320427" "00112" "00429555" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320430" "00112" "00429558" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320437" "00112" "00429565" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320438" "00112" "00429566" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320447" "00112" "00429575" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320448" "00112" "00429576" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320449" "00112" "00429577" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320452" "00112" "00429580" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320454" "00112" "00429582" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320464" "00112" "00429592" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320465" "00112" "00429593" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320469" "00112" "00429597" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320474" "00112" "00429602" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320496" "00112" "00429624" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320498" "00112" "00429626" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320545" "00112" "00429673" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320551" "00112" "00429679" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320555" "00112" "00429683" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320563" "00112" "00429691" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320589" "00112" "00429717" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320606" "00112" "00429734" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320609" "00112" "00429737" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320618" "00112" "00429746" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320643" "00112" "00429771" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320647" "00112" "00429775" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320673" "00112" "00429801" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320678" "00112" "00429806" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320723" "00112" "00429851" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320726" "00112" "00429854" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320776" "00112" "00429904" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320789" "04214" "00429917" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320793" "00112" "00429921" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320806" "00112" "00429934" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320813" "00112" "00429941" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320838" "00112" "00429966" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320850" "00112" "00429978" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320871" "00112" "00429999" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320898" "00112" "00430026" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320915" "00112" "00430043" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320924" "00112" "00430052" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320927" "00112" "00430055" "04436" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320939" "00112" "00430067" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320940" "04214" "00430068" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320945" "00112" "00430073" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320950" "00112" "00430078" "04436" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320961" "00112" "00430089" "04436" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320988" "00112" "00430116" "04436" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000320990" "00112" "00430118" "04436" "Paternal, Y-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000321513" "04214" "00430904" "04091" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000326344" "04214" "00436163" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000326599" "04211" "00436418" "04552" "Familial, autosomal recessive" "20y, 44y" "Reduced visual acuity HP:0007663, Nyctalopia HP:0000662, Peripheral visual field loss HP:0007994, Retinitis pigmentosa HP:0000510" "" "14y" "44y" "" "" "" "" "" "" "" "20y" "" "0000326617" "02156" "00436438" "04552" "Familial, autosomal recessive" "35y" "Reduced visual acuity HP:0007663; Nyctalopia HP:0000662; Peripheral visual field loss HP:0007994; Retinitis pigmentosa HP:0000510" "" "23y" "23y" "" "23y" "" "" "" "" "RP25" "Retinitis pigmentosa" "" "0000328595" "06906" "00438692" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "" "0000331073" "00058" "00441658" "04542" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000331074" "00112" "00441659" "04542" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000333509" "04214" "00444256" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000336168" "00198" "00446969" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336185" "00198" "00446986" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336186" "00198" "00446987" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336192" "00198" "00446993" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336193" "00198" "00446994" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336203" "00198" "00447004" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336219" "00198" "00447020" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336258" "00198" "00447059" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "cone dystrophy" "" "0000336457" "00198" "00447258" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336460" "00198" "00447261" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336465" "00198" "00447266" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336467" "00198" "00447268" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336468" "00198" "00447269" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336471" "00198" "00447272" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336477" "00198" "00447278" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336489" "00198" "00447290" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336504" "00198" "00447305" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336655" "00198" "00447456" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, X-linked" "" "0000336703" "00198" "00447504" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336704" "00198" "00447505" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336707" "00198" "00447508" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336708" "00198" "00447509" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336712" "00198" "00447513" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336714" "00198" "00447515" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, autosomal recessive" "" "0000336793" "00198" "00447594" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336809" "00198" "00447610" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336813" "00198" "00447614" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336819" "00198" "00447620" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336831" "00198" "00447632" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000336901" "00198" "00447702" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336906" "00198" "00447707" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336915" "00198" "00447716" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336917" "00198" "00447718" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000336919" "00198" "00447720" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa, simplex" "" "0000339042" "04214" "00449982" "02230" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "RP25" "retinal disease" "" "0000339895" "04249" "00450840" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000339896" "04249" "00450841" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000339897" "04249" "00450842" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" "" "0000339898" "04249" "00450843" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "Stargardt disease" "" "0000339899" "04249" "00450844" "04405" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "macular dystrophy" "" "0000347428" "04214" "00458998" "00006" "Familial, autosomal recessive" "64y" "see paper; ..., 48y-nyctalopia, visual field defects, photophobia, dyschromatopsia: ERG moderate-severe decreases rod/cone-driven responses" "" "48y" "" "" "" "" "" "" "" "RP25" "nyctalopia" "" "0000347436" "00112" "00459006" "00006" "Familial, autosomal recessive" "32y" "" "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000347437" "00112" "00459007" "00006" "Familial, autosomal recessive" "32y" "see paper; ..., retinitis pigmentosa; 32y-legally blind" "" "" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000348613" "04214" "00461113" "00006" "Familial, autosomal recessive" "" "" "" "27y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348635" "04214" "00461135" "00006" "Familial, autosomal recessive" "" "" "" "20y-29y" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000348637" "04214" "00461137" "00006" "Familial, autosomal recessive" "" "" "" "child" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "0000350871" "02440" "00465319" "04846" "Familial, autosomal recessive" "55" "" "" "" "55" "" "" "" "" "" "" "Retinitis pigmentosa 25" "retinitis pigmentosa" "" "0000352982" "04214" "00467828" "00006" "Familial, autosomal recessive" "34y" "see paper; ..., BVCA right 20/50-, left 20/50-; mild progression cystoid macular edema, peripheral vision, night blindness;" "" "20y" "" "" "" "" "" "" "" "RP25" "retinitis pigmentosa" "" "0000364489" "05412" "00479985" "00006" "Unknown" "72y" "see paper; ..., paracentral scotoma; best-corrected visual acuity 0.10/0.3; ffERG cone dysfunction; pattern dystrophy; bilateral chorioretinal atrophy" "" "60y-70y" "" "" "" "" "" "" "" "" "maculopathy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 1531 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000126" "00000135" "1" "00006" "00006" "2012-07-07 19:04:19" "00006" "2012-07-07 19:12:08" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000000211" "00000210" "1" "00039" "00006" "2012-09-22 11:36:24" "" "" "SEQ" "DNA" "" "" "0000001640" "00001962" "1" "00025" "00006" "2010-03-11 16:36:41" "00025" "2012-04-13 15:18:00" "SEQ" "DNA" "" "" "0000016557" "00016605" "1" "00552" "00552" "2014-05-23 13:12:43" "" "" "SEQ-NG-I" "DNA" "" "" "0000033164" "00033096" "1" "00229" "00229" "2012-02-04 15:20:01" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033177" "00033109" "1" "00229" "00229" "2012-02-04 14:49:23" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033200" "00033132" "1" "00229" "00229" "2012-02-04 14:23:49" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033225" "00033157" "1" "00229" "00229" "2012-02-28 21:21:17" "00006" "2012-05-18 13:59:33" "SEQ;SEQ-NG-S" "DNA" "" "" "0000033417" "00033349" "1" "00039" "00039" "2012-09-18 13:53:39" "" "" "SEQ" "DNA" "" "" "0000038589" "00038358" "1" "01251" "01251" "2015-05-01 22:00:00" "00006" "2015-05-06 09:29:07" "PCR;SEQ;SEQ-NG-S" "DNA" "" "" "0000096328" "00095925" "1" "01769" "01769" "2017-01-25 20:29:31" "" "" "SEQ" "DNA" "WBC" "" "0000100508" "00100104" "1" "01769" "01769" "2017-01-30 20:12:39" "" "" "SEQ" "DNA" "WBC" "" "0000105037" "00104565" "1" "01836" "01836" "2017-05-15 11:35:54" "00006" "2019-03-01 10:54:20" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood" "" "0000105490" "00105016" "1" "01244" "01244" "2017-06-15 11:21:34" "" "" "SEQ-NG-I" "DNA" "Whole blood" "" "0000144693" "00143834" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144694" "00143835" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144695" "00143836" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ;arrayCGH;MLPA" "DNA" "" "" "0000144696" "00143837" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ;arrayCGH;MLPA" "DNA" "" "" "0000144697" "00143838" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ;arrayCGH;MLPA" "DNA" "" "" "0000144698" "00143839" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144699" "00143840" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144700" "00143841" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144701" "00143842" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144702" "00143843" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144703" "00143844" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144704" "00143845" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144705" "00143846" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144706" "00143847" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144707" "00143848" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144708" "00143849" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144709" "00143850" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144710" "00143851" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144711" "00143852" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144712" "00143853" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144713" "00143854" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144714" "00143855" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144715" "00143856" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144716" "00143857" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144717" "00143858" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ;MLPA" "DNA" "" "" "0000144718" "00143859" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ;MLPA" "DNA" "" "" "0000144719" "00143860" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ;MLPA" "DNA" "" "" "0000144720" "00143861" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144721" "00143862" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144722" "00143863" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144723" "00143864" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144724" "00143865" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144725" "00143866" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144726" "00143867" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144727" "00143868" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144728" "00143869" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144729" "00143870" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144730" "00143871" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144731" "00143872" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144732" "00143873" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144733" "00143874" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144734" "00143875" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144735" "00143876" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144736" "00143877" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144737" "00143878" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144738" "00143879" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144739" "00143880" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144740" "00143881" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144741" "00143882" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144742" "00143883" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144743" "00143884" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144744" "00143885" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144745" "00143886" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144746" "00143887" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144747" "00143888" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144748" "00143889" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144749" "00143890" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144750" "00143891" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144751" "00143892" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144752" "00143893" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144753" "00143894" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "MLPA" "DNA" "" "" "0000144754" "00143895" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ" "DNA" "" "" "0000144755" "00143896" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144756" "00143897" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144757" "00143898" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144758" "00143899" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144759" "00143900" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144760" "00143901" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144761" "00143902" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144762" "00143903" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144763" "00143904" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144764" "00143905" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144765" "00143906" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144766" "00143907" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144767" "00143908" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144768" "00143909" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144769" "00143910" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144770" "00143911" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144771" "00143912" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144772" "00143913" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144773" "00143914" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144774" "00143915" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144775" "00143916" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144776" "00143917" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144777" "00143918" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144778" "00143919" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144779" "00143920" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144780" "00143921" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144781" "00143922" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144782" "00143923" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144783" "00143924" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144784" "00143925" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144785" "00143926" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144786" "00143927" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144787" "00143928" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144788" "00143929" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144789" "00143930" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144790" "00143931" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144791" "00143932" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144792" "00143933" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144793" "00143934" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144794" "00143935" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144795" "00143936" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144796" "00143937" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144797" "00143938" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144798" "00143939" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144799" "00143940" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144800" "00143941" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000144801" "00143942" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000144802" "00143943" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000144803" "00143944" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000144806" "00143947" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144807" "00143948" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144808" "00143949" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144809" "00143950" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144810" "00143951" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144811" "00143952" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144812" "00143953" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144813" "00143954" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144814" "00143955" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144815" "00143956" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144816" "00143957" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144817" "00143958" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144818" "00143959" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144819" "00143960" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144820" "00143961" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144821" "00143962" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144822" "00143963" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144823" "00143964" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000144824" "00143965" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000144825" "00143966" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144826" "00143967" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000144827" "00143968" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000144828" "00143969" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000144829" "00143970" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144830" "00143971" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000144831" "00143972" "1" "01780" "00006" "2017-11-28 22:45:32" "00006" "2019-02-14 13:10:47" "PE" "DNA" "" "APEX" "0000144832" "00143973" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144833" "00143974" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144834" "00143975" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144835" "00143976" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ;arrayCGH;MLPA" "DNA" "" "" "0000144836" "00143977" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ;arrayCGH;MLPA" "DNA" "" "" "0000144837" "00143978" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ;arrayCGH;MLPA" "DNA" "" "" "0000144838" "00143979" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000144839" "00143980" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144840" "00143981" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144841" "00143982" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144842" "00143983" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144843" "00143984" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144844" "00143985" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144845" "00143986" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144846" "00143987" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144847" "00143988" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144848" "00143989" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144849" "00143990" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144850" "00143991" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144851" "00143992" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144852" "00143993" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144853" "00143994" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144854" "00143995" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144855" "00143996" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144856" "00143997" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144857" "00143998" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144858" "00143999" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144859" "00144000" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144860" "00144001" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144861" "00144002" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144862" "00144003" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144863" "00144004" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144864" "00144005" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144865" "00144006" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144866" "00144007" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144867" "00144008" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144868" "00144009" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144869" "00144010" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144870" "00144011" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144871" "00144012" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144872" "00144013" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144873" "00144014" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144874" "00144015" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144875" "00144016" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144876" "00144017" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144877" "00144018" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144878" "00144019" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144879" "00144020" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144880" "00144021" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144881" "00144022" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144882" "00144023" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144883" "00144024" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144884" "00144025" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144885" "00144026" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144886" "00144027" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144887" "00144028" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144888" "00144029" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144889" "00144030" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144890" "00144031" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144891" "00144032" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144892" "00144033" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144893" "00144034" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144894" "00144035" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144895" "00144036" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144896" "00144037" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144897" "00144038" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144898" "00144039" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144899" "00144040" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144900" "00144041" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144901" "00144042" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144902" "00144043" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144903" "00144044" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144904" "00144045" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144905" "00144046" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144906" "00144047" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144907" "00144048" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144908" "00144049" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144909" "00144050" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144910" "00144051" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144911" "00144052" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144912" "00144053" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySNP;PCR;SEQ" "DNA" "" "" "0000144913" "00144054" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144914" "00144055" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144915" "00144056" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144916" "00144057" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144917" "00144058" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144918" "00144059" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144919" "00144060" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144920" "00144061" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144921" "00144062" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144922" "00144063" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144923" "00144064" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144924" "00144065" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144925" "00144066" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144926" "00144067" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144927" "00144068" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144928" "00144069" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144929" "00144070" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144930" "00144071" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144931" "00144072" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144932" "00144073" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144933" "00144074" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144934" "00144075" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144935" "00144076" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144936" "00144077" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144937" "00144078" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144938" "00144079" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144939" "00144080" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144940" "00144081" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144941" "00144082" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144942" "00144083" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144943" "00144084" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144944" "00144085" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144945" "00144086" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144946" "00144087" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144947" "00144088" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144948" "00144089" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144949" "00144090" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144950" "00144091" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144951" "00144092" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144952" "00144093" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144953" "00144094" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144954" "00144095" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144955" "00144096" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144956" "00144097" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144957" "00144098" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144958" "00144099" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144959" "00144100" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144960" "00144101" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "MLPA;SEQ" "DNA" "" "" "0000144961" "00144102" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "MLPA;SEQ" "DNA" "" "" "0000144962" "00144103" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000144963" "00144104" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000144964" "00144105" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000144965" "00144106" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ" "DNA" "" "" "0000144966" "00144107" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ" "DNA" "" "" "0000144967" "00144108" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ" "DNA" "" "" "0000144968" "00144109" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "arraySEQ" "DNA" "" "" "0000144969" "00144110" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ-NG-I" "DNA" "" "" "0000144970" "00144111" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144971" "00144112" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144972" "00144113" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144973" "00144114" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144974" "00144115" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144975" "00144116" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144976" "00144117" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144977" "00144118" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144978" "00144119" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144979" "00144120" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144980" "00144121" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144981" "00144122" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144982" "00144123" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144983" "00144124" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144984" "00144125" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144985" "00144126" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144986" "00144127" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144987" "00144128" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144988" "00144129" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144989" "00144130" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144990" "00144131" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144991" "00144132" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144992" "00144133" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144993" "00144134" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144994" "00144135" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144995" "00144136" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144996" "00144137" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144997" "00144138" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144998" "00144139" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000144999" "00144140" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145000" "00144141" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145001" "00144142" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145002" "00144143" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145003" "00144144" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145004" "00144145" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145005" "00144146" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145006" "00144147" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145007" "00144148" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145008" "00144149" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145009" "00144150" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145010" "00144151" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145011" "00144152" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145012" "00144153" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145013" "00144154" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145014" "00144155" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145015" "00144156" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145016" "00144157" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145017" "00144158" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145018" "00144159" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145019" "00144160" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145020" "00144161" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145021" "00144162" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145022" "00144163" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145023" "00144164" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145024" "00144165" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145025" "00144166" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145026" "00144167" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145027" "00144168" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145028" "00144169" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145029" "00144170" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145030" "00144171" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145031" "00144172" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145032" "00144173" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145033" "00144174" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145034" "00144175" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145035" "00144176" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145036" "00144177" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145037" "00144178" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145038" "00144179" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145039" "00144180" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145040" "00144181" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145041" "00144182" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145042" "00144183" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145043" "00144184" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145044" "00144185" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145045" "00144186" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145046" "00144187" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145047" "00144188" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145048" "00144189" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145049" "00144190" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145050" "00144191" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "PCR;SEQ" "DNA" "" "" "0000145051" "00144192" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145052" "00144193" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145053" "00144194" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145054" "00144195" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145055" "00144196" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145056" "00144197" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145057" "00144198" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145058" "00144199" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145059" "00144200" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145060" "00144201" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145061" "00144202" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145062" "00144203" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145063" "00144204" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145064" "00144205" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145065" "00144206" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145066" "00144207" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145067" "00144208" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145068" "00144209" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145069" "00144210" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145070" "00144211" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145071" "00144212" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145072" "00144213" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145073" "00144214" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145074" "00144215" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145075" "00144216" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145076" "00144217" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145077" "00144218" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145078" "00144219" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145079" "00144220" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145080" "00144221" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145081" "00144222" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145082" "00144223" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145083" "00144224" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145084" "00144225" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145085" "00144226" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145086" "00144227" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145087" "00144228" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145088" "00144229" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145089" "00144230" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145090" "00144231" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145091" "00144232" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145092" "00144233" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145093" "00144234" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145094" "00144235" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145095" "00144236" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145096" "00144237" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145097" "00144238" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145098" "00144239" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145099" "00144240" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145100" "00144241" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145101" "00144242" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145102" "00144243" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145103" "00144244" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145104" "00144245" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145107" "00144248" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145108" "00144249" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145109" "00144250" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145110" "00144251" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145111" "00144252" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145112" "00144253" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145113" "00144254" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145114" "00144255" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145115" "00144256" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145116" "00144257" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145117" "00144258" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145118" "00144259" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145119" "00144260" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145120" "00144261" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145121" "00144262" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145122" "00144263" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145123" "00144264" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145124" "00144265" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145125" "00144266" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145126" "00144267" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145127" "00144268" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145128" "00144269" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145129" "00144270" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-S" "DNA" "" "" "0000145130" "00144271" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145131" "00144272" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145132" "00144273" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145133" "00144274" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145134" "00144275" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145135" "00144276" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145136" "00144277" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145137" "00144278" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000145138" "00144279" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145139" "00144280" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145140" "00144281" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145141" "00144282" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145142" "00144283" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145143" "00144284" "1" "01780" "00006" "2017-11-28 22:45:32" "00006" "2019-02-14 13:10:47" "PE" "DNA" "" "APEX" "0000145144" "00144285" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ" "DNA" "" "" "0000145145" "00144286" "1" "01780" "00006" "2017-11-28 22:45:32" "00006" "2019-02-14 13:10:47" "PE" "DNA" "" "APEX" "0000145146" "00144287" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145147" "00144288" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145148" "00144289" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145149" "00144290" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145150" "00144291" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145151" "00144292" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145152" "00144293" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145153" "00144294" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145154" "00144295" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145155" "00144296" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145156" "00144297" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145157" "00144298" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145158" "00144299" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145159" "00144300" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145160" "00144301" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145161" "00144302" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145162" "00144303" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145163" "00144304" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145164" "00144305" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145165" "00144306" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145166" "00144307" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145167" "00144308" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145168" "00144309" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145169" "00144310" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145170" "00144311" "1" "01780" "00006" "2017-11-28 22:45:32" "" "" "SEQ-NG" "DNA" "" "" "0000145171" "00144313" "1" "00006" "00006" "2017-12-08 15:46:47" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000156181" "00155316" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156325" "00155460" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156326" "00155461" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156327" "00155462" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156328" "00155463" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156329" "00155464" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156330" "00155465" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156331" "00155466" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156332" "00155467" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156333" "00155468" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156334" "00155469" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000156335" "00155470" "1" "01243" "01243" "2018-03-18 14:37:15" "" "" "SEQ" "DNA" "" "" "0000174728" "00173838" "1" "02449" "02449" "2018-04-11 18:11:48" "" "" "SEQ" "DNA" "" "" "0000174762" "00173872" "1" "02449" "02449" "2018-04-11 18:11:48" "" "" "SEQ" "DNA" "" "" "0000181353" "00180416" "1" "02555" "00006" "2018-09-07 14:35:38" "" "" "arraySNP" "DNA" "Blood" "" "0000208630" "00207593" "1" "01244" "01244" "2018-11-26 11:35:03" "" "" "SEQ-NG-I" "DNA" "Peripheral blood" "" "0000233815" "00232716" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233816" "00232717" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233817" "00232718" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233818" "00232719" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233819" "00232720" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233820" "00232721" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233821" "00232722" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233822" "00232723" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233823" "00232724" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233824" "00232725" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233825" "00232726" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233826" "00232727" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233827" "00232728" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233828" "00232729" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233829" "00232730" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233830" "00232731" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233831" "00232732" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233832" "00232733" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233833" "00232734" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233834" "00232735" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233835" "00232736" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233836" "00232737" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233837" "00232738" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233838" "00232739" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233839" "00232740" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233840" "00232741" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233841" "00232742" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233842" "00232743" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233843" "00232744" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233844" "00232745" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233845" "00232746" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233846" "00232747" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233847" "00232748" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233848" "00232749" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233849" "00232750" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233850" "00232751" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233851" "00232752" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233852" "00232753" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233853" "00232754" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233854" "00232755" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233855" "00232756" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233856" "00232757" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233857" "00232758" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233858" "00232759" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233859" "00232760" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233860" "00232761" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233861" "00232762" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233862" "00232763" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233863" "00232764" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233864" "00232765" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233865" "00232766" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233866" "00232767" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233867" "00232768" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233868" "00232769" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233869" "00232770" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233870" "00232771" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233871" "00232772" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233872" "00232773" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233873" "00232774" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233874" "00232775" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233875" "00232776" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233876" "00232777" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233877" "00232778" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233878" "00232779" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233879" "00232780" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233880" "00232781" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233881" "00232782" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233882" "00232783" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233883" "00232784" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233884" "00232785" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233885" "00232786" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233886" "00232787" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233887" "00232788" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233888" "00232789" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233889" "00232790" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233890" "00232791" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233891" "00232792" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233892" "00232793" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233893" "00232794" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233894" "00232795" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233895" "00232796" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233896" "00232797" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233897" "00232798" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233898" "00232799" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233899" "00232800" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233900" "00232801" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233901" "00232802" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233902" "00232803" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233903" "00232804" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233904" "00232805" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233905" "00232806" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233906" "00232807" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233907" "00232808" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233908" "00232809" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233909" "00232810" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233910" "00232811" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233911" "00232812" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233912" "00232813" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233913" "00232814" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233914" "00232815" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233915" "00232816" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233916" "00232817" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233917" "00232818" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233918" "00232819" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233919" "00232820" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233920" "00232821" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233921" "00232822" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233922" "00232823" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233923" "00232824" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233924" "00232825" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233925" "00232826" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233926" "00232827" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233927" "00232828" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233928" "00232829" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233929" "00232830" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233930" "00232831" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233931" "00232832" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233932" "00232833" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233933" "00232834" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233934" "00232835" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233935" "00232836" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233936" "00232837" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233937" "00232838" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233938" "00232839" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233939" "00232840" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000233940" "00232841" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234790" "00233691" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234791" "00233692" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234792" "00233693" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234793" "00233694" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234794" "00233695" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234795" "00233696" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234796" "00233697" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234797" "00233698" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234798" "00233699" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234799" "00233700" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234800" "00233701" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234801" "00233702" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234802" "00233703" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234803" "00233704" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234804" "00233705" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234805" "00233706" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234806" "00233707" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234807" "00233708" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234808" "00233709" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234809" "00233710" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234810" "00233711" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234811" "00233712" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234812" "00233713" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234813" "00233714" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234814" "00233715" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234815" "00233716" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234816" "00233717" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234817" "00233718" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234818" "00233719" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234819" "00233720" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000234820" "00233721" "1" "02591" "02591" "2019-05-03 15:11:26" "" "" "SEQ-NG" "DNA" "" "" "0000245619" "00244508" "1" "01807" "01807" "2019-06-28 09:55:58" "" "" "SEQ" "DNA" "" "" "0000295336" "00294168" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295337" "00294169" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295338" "00294170" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295339" "00294171" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295340" "00294172" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296772" "00295602" "1" "01807" "01807" "2020-03-18 10:50:22" "" "" "SEQ" "DNA" "" "" "0000297173" "00296002" "1" "01807" "01807" "2020-04-01 11:10:04" "" "" "SEQ" "DNA" "" "" "0000302791" "00301666" "1" "01807" "01807" "2020-05-20 08:49:01" "" "" "SEQ" "DNA" "" "" "0000306241" "00305112" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000309550" "00308406" "1" "00004" "00006" "2020-08-26 16:56:47" "" "" "SEQ;SEQ-NG" "DNA" "" "123 gene panel" "0000309652" "00308507" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309653" "00308508" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309654" "00308509" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309655" "00308510" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309656" "00308511" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309781" "00308636" "1" "00004" "00006" "2020-08-27 13:01:07" "" "" "SEQ" "DNA" "" "" "0000309788" "00308643" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel" "0000309789" "00308644" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel" "0000309790" "00308645" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel" "0000309791" "00308646" "1" "00004" "00006" "2020-08-27 14:47:58" "" "" "SEQ;SEQ-NG" "DNA" "" "204 gene panel" "0000310281" "00309136" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310282" "00309137" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310283" "00309138" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310284" "00309139" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310285" "00309140" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310286" "00309141" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310287" "00309142" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310288" "00309143" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310289" "00309144" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310290" "00309145" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310291" "00309146" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310292" "00309147" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310293" "00309148" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310294" "00309149" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310295" "00309150" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310296" "00309151" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310297" "00309152" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310298" "00309153" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310299" "00309154" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310300" "00309155" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310301" "00309156" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310302" "00309157" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310303" "00309158" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310304" "00309159" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310305" "00309160" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310306" "00309161" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310307" "00309162" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310308" "00309163" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310309" "00309164" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310310" "00309165" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" "" "0000310870" "00309725" "1" "00006" "00006" "2020-09-01 21:57:59" "00006" "2020-09-02 11:52:04" "SEQ" "DNA" "" "" "0000310900" "00309755" "1" "00006" "00006" "2020-09-02 11:48:31" "" "" "SEQ" "DNA" "" "" "0000310901" "00309756" "1" "00006" "00006" "2020-09-02 11:49:59" "" "" "SEQ" "DNA" "" "" "0000310902" "00309757" "1" "00006" "00006" "2020-09-02 11:50:23" "" "" "SEQ" "DNA" "" "" "0000326675" "00325464" "1" "00006" "00006" "2021-01-03 11:36:11" "" "" "SEQ;SEQ-NG" "DNA" "" "199 gene panel" "0000329148" "00327933" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329169" "00327954" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES" "0000329225" "00328010" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329276" "00328061" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329302" "00328087" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329374" "00328159" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329382" "00328167" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329433" "00328218" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329444" "00328229" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329481" "00328266" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329508" "00328293" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329530" "00328315" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329538" "00328323" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000329539" "00328324" "1" "00000" "00006" "2021-01-27 12:09:59" "" "" "SEQ-NG" "DNA" "" "WES and WGS" "0000332467" "00331247" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332468" "00331248" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332469" "00331249" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332470" "00331250" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332471" "00331251" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332472" "00331252" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332473" "00331253" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332474" "00331254" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332475" "00331255" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332476" "00331256" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332477" "00331257" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332478" "00331258" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332479" "00331259" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332480" "00331260" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332481" "00331261" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332482" "00331262" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332483" "00331263" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332484" "00331264" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332485" "00331265" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332486" "00331266" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332487" "00331267" "1" "00000" "00006" "2021-02-11 10:36:53" "" "" "SEQ;SEQ-NG" "DNA" "" "39-gene panel" "0000332922" "00331703" "1" "00000" "00006" "2021-02-12 13:51:13" "" "" "SEQ-NG" "DNA" "" "" "0000333712" "00332488" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" "" "0000333713" "00332489" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" "" "0000333714" "00332490" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" "" "0000333731" "00332507" "1" "00000" "00006" "2021-02-19 16:33:37" "" "" "SEQ-NG" "DNA" "" "" "0000334624" "00333399" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334625" "00333400" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334626" "00333401" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334627" "00333402" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334648" "00333423" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000334649" "00333424" "1" "00000" "00006" "2021-02-25 11:52:36" "" "" "SEQ;SEQ-NG" "DNA" "" "184-gene panel" "0000335050" "00333824" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335051" "00333825" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335052" "00333826" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335053" "00333827" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335116" "00333890" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335127" "00333901" "1" "00000" "00006" "2021-02-26 16:26:23" "" "" "SEQ-NG" "DNA" "" "" "0000335645" "00334416" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000335646" "00334417" "1" "00000" "00006" "2021-02-28 16:11:14" "" "" "SEQ-NG" "DNA" "" "WES" "0000335787" "00334558" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000335789" "00334560" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000335792" "00334563" "1" "00000" "00006" "2021-03-01 15:50:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000336460" "00335231" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel" "0000336474" "00335245" "1" "00000" "00006" "2021-03-04 14:06:09" "" "" "SEQ-NG" "DNA" "" "212-gene panel" "0000336503" "00335274" "1" "02485" "00006" "2021-03-04 16:18:39" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336565" "00335336" "1" "02485" "00006" "2021-03-04 17:06:33" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336566" "00335337" "1" "02485" "00006" "2021-03-04 17:06:33" "" "" "SEQ-NG" "DNA" "" "68-gene panel" "0000336645" "00335416" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336649" "00335420" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000336653" "00335424" "1" "00000" "00006" "2021-03-05 16:19:42" "" "" "SEQ-NG" "DNA" "" "283-gene panel" "0000337203" "00335973" "1" "00000" "00006" "2021-03-10 17:05:56" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000360216" "00358979" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES" "0000360369" "00359131" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360387" "00359149" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360398" "00359160" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360400" "00359162" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360402" "00359164" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360423" "00359185" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360445" "00359207" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel" "0000360570" "00359329" "1" "00000" "00006" "2021-03-19 13:20:32" "" "" "SEQ-NG" "DNA" "" "105-gene panel" "0000362654" "00361426" "1" "04036" "00006" "2021-04-06 16:50:09" "" "" "PCR;SEQ;SEQ-NG" "DNA" "blood" "WES" "0000363439" "00362210" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000363441" "00362212" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000363445" "00362216" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000363447" "00362218" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000363463" "00362234" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000363469" "00362240" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000363472" "00362243" "1" "04043" "00006" "2021-04-16 13:26:31" "" "" "SEQ-NG" "DNA" "" "" "0000364134" "00362906" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364135" "00362907" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000364863" "00363635" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373860" "00372628" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373870" "00372638" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373877" "00372645" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373878" "00372646" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373885" "00372653" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373887" "00372655" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373899" "00372667" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373909" "00372677" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373913" "00372681" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373915" "00372683" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373919" "00372687" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373920" "00372688" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373922" "00372690" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373925" "00372693" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373929" "00372697" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373931" "00372699" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373932" "00372700" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373933" "00372701" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373951" "00372719" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373954" "00372722" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373964" "00372732" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373965" "00372733" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373968" "00372736" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373973" "00372741" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373977" "00372745" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373982" "00372750" "1" "00000" "00006" "2021-05-10 13:08:15" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000373990" "00372757" "1" "01164" "01164" "2021-05-11 12:57:16" "" "" "SEQ-NG-I" "DNA" "" "" "0000374600" "00373365" "1" "00000" "00006" "2021-05-14 10:24:46" "" "" "PE;SEQ" "DNA" "" "APEX" "0000374603" "00373368" "1" "00000" "00006" "2021-05-14 10:24:46" "" "" "PE;SEQ" "DNA" "" "APEX" "0000375052" "00373820" "1" "00000" "00006" "2021-05-21 12:20:36" "" "" "SEQ-NG" "DNA" "" "WES" "0000376608" "00375411" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376613" "00375416" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376623" "00375426" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376625" "00375428" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376626" "00375429" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376627" "00375430" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000376632" "00375435" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES" "0000377484" "00376288" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377485" "00376289" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377509" "00376313" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377510" "00376314" "1" "00000" "00008" "2021-06-19 02:19:40" "" "" "SEQ-NG" "DNA" "blood" "" "0000377957" "00376751" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377958" "00376752" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377959" "00376753" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377960" "00376754" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377961" "00376755" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377964" "00376758" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377966" "00376760" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377969" "00376763" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377971" "00376765" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377976" "00376770" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377983" "00376777" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377984" "00376778" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377988" "00376782" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377989" "00376783" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377990" "00376784" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000377995" "00376789" "1" "00000" "00006" "2021-06-25 14:31:53" "" "" "SEQ-NG" "DNA" "" "66-gene panel" "0000378071" "00376866" "1" "00000" "00006" "2021-06-25 17:40:07" "" "" "SEQ" "DNA" "" "WES" "0000378447" "00377242" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378461" "00377256" "1" "00000" "03840" "2021-07-16 14:18:12" "00006" "2021-08-06 16:49:30" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378462" "00377257" "1" "00000" "03840" "2021-07-16 14:18:12" "" "" "SEQ" "DNA" "buccal cells" "targeted resequencing using MIPs library prep; 108-gene panel" "0000378705" "00377502" "1" "00000" "03840" "2021-07-22 14:34:00" "" "" "?" "DNA" "" "various screening techniques within publication, not mentioned which particular individual had which techniques: SSCA, DGGE, arraySNP, SEQ-NG, WES" "0000378729" "00377526" "1" "00000" "03840" "2021-07-22 15:35:32" "" "" "SEQ-NG" "DNA" "blood" "Targeted next-generation sequencing, CEP290 intronic variant c.2991 +1655A> G, PCR for RPGRIP1 exon 17 deletion, CCT2, CLUAP1, DTHD1, GDF6, and IFT140 seuqencing, The RPGR exon ORF15 analysis" "0000379139" "00377935" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "arraySNP" "DNA" "blood" "" "0000379140" "00377936" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "arraySNP" "DNA" "blood" "" "0000379149" "00377945" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "blood" "" "0000379150" "00377946" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "blood" "" "0000379161" "00377957" "1" "00000" "00008" "2021-08-02 20:37:33" "" "" "SEQ; SEQ-NG-S" "DNA" "blood" "" "0000379219" "00378015" "1" "03508" "03508" "2021-08-03 03:58:30" "" "" "SEQ-NG-I" "DNA" "" "" "0000379223" "00378021" "1" "03508" "03508" "2021-08-03 05:15:39" "" "" "SEQ-NG-I" "DNA" "" "" "0000379232" "00378031" "1" "03508" "03508" "2021-08-03 09:31:53" "" "" "SEQ-NG-I" "DNA" "" "" "0000379248" "00378049" "1" "03508" "03508" "2021-08-04 03:00:49" "" "" "SEQ-NG-I" "DNA" "" "" "0000379250" "00378051" "1" "03508" "03508" "2021-08-04 03:17:17" "" "" "SEQ-NG-I" "DNA" "" "" "0000379251" "00378052" "1" "03508" "03508" "2021-08-04 03:48:06" "" "" "SEQ-NG-I" "DNA" "" "" "0000379266" "00378065" "1" "03508" "03508" "2021-08-04 08:53:10" "" "" "SEQ-NG-I" "DNA" "" "" "0000379268" "00378067" "1" "03508" "03508" "2021-08-04 09:25:08" "" "" "SEQ-NG-I" "DNA" "" "" "0000379271" "00378070" "1" "03508" "03508" "2021-08-04 10:08:57" "" "" "SEQ-NG-I" "DNA" "" "" "0000380576" "00379376" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380577" "00379377" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380578" "00379378" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "PCR;SEQ; arraySNP" "DNA" "blood" "" "0000380734" "00379534" "1" "03508" "03508" "2021-08-05 04:54:12" "" "" "SEQ-NG-I" "DNA" "" "" "0000380737" "00379537" "1" "03508" "03508" "2021-08-05 08:05:26" "" "" "SEQ-NG-I" "DNA" "" "" "0000380745" "00379545" "1" "03508" "03508" "2021-08-05 09:37:58" "" "" "SEQ-NG-I" "DNA" "" "" "0000380747" "00379547" "1" "03508" "03508" "2021-08-05 10:01:12" "" "" "SEQ-NG-I" "DNA" "" "" "0000380758" "00379559" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000380772" "00379573" "1" "00000" "00008" "2021-08-06 03:44:17" "" "" "SEQ-NG" "DNA" "blood" "" "0000380832" "00379633" "1" "03508" "03508" "2021-08-06 03:59:42" "" "" "SEQ-NG-I" "DNA" "" "" "0000380849" "00379650" "1" "03508" "03508" "2021-08-06 06:53:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000380868" "00379668" "1" "03508" "03508" "2021-08-06 08:43:04" "" "" "SEQ-NG-I" "DNA" "" "" "0000380871" "00379671" "1" "03508" "03508" "2021-08-06 08:58:52" "" "" "SEQ-NG-I" "DNA" "" "" "0000380949" "00379748" "1" "03508" "03508" "2021-08-09 04:03:12" "" "" "SEQ-NG-I" "DNA" "" "" "0000380954" "00379753" "1" "03508" "03508" "2021-08-09 04:30:06" "" "" "SEQ-NG-I" "DNA" "" "" "0000380956" "00379755" "1" "03508" "03508" "2021-08-09 04:41:59" "" "" "SEQ-NG-I" "DNA" "" "" "0000380964" "00379763" "1" "03508" "03508" "2021-08-09 06:34:33" "" "" "SEQ-NG-I" "DNA" "" "" "0000380967" "00379766" "1" "03508" "03508" "2021-08-09 06:50:56" "" "" "SEQ-NG-I" "DNA" "" "" "0000380974" "00379775" "1" "03508" "03508" "2021-08-09 08:33:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000380998" "00379795" "1" "03508" "03508" "2021-08-10 03:39:30" "" "" "SEQ-NG-I" "DNA" "" "" "0000381037" "00379835" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "exome sequencing" "0000381038" "00379836" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381039" "00379837" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381040" "00379838" "1" "00000" "03840" "2021-08-10 08:08:19" "" "" "SEQ-NG" "DNA" "" "panel of 441 hereditary eye disease genes including 291 genes related to IRD" "0000381350" "00380148" "1" "00000" "03840" "2021-08-10 09:47:12" "" "" "SEQ-NG" "DNA" "" "WES" "0000381360" "00380158" "1" "03508" "03508" "2021-08-10 10:56:42" "" "" "SEQ-NG-I" "DNA" "" "" "0000381372" "00380170" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000381373" "00380171" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000381375" "00380173" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000381407" "00380205" "1" "00000" "03840" "2021-08-11 10:47:34" "" "" "SEQ-NG" "DNA" "blood" "" "0000382227" "00381013" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ-NG;SEQp" "DNA" "blood" "targeted exon capture/IROme assay" "0000382891" "00381675" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000382900" "00381684" "1" "00000" "00008" "2021-09-03 05:21:17" "" "" "SEQ-NG-I;SEQ-NG-R;SEQ" "DNA" "blood" "" "0000383067" "00381851" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383068" "00381852" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383069" "00381853" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383070" "00381854" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383071" "00381855" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383072" "00381856" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ-NG" "DNA" "blood" "" "0000383073" "00381857" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383074" "00381858" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383075" "00381859" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383076" "00381860" "1" "00000" "03840" "2021-09-06 14:05:57" "" "" "SEQ" "DNA" "blood" "" "0000383492" "00382278" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383493" "00382279" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383494" "00382280" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383495" "00382281" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383496" "00382282" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383497" "00382283" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383498" "00382284" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383499" "00382285" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383500" "00382286" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383501" "00382287" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383502" "00382288" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383503" "00382289" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383504" "00382290" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383505" "00382291" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383506" "00382292" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383507" "00382293" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383508" "00382294" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383509" "00382295" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383510" "00382296" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383511" "00382297" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383512" "00382298" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383513" "00382299" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383514" "00382300" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383515" "00382301" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383516" "00382302" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383517" "00382303" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383518" "00382304" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383519" "00382305" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383520" "00382306" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383633" "00382419" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383678" "00382464" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383754" "00382540" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383755" "00382541" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383756" "00382542" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383757" "00382543" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383758" "00382544" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383759" "00382545" "1" "00000" "03840" "2021-09-09 12:39:39" "" "" "SEQ-NG-I" "DNA" "blood" "125 genes associated with inherited retinal disorders, see paper supplemental data" "0000383939" "00382725" "1" "03840" "03840" "2021-09-09 15:06:10" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "targeted resequencing using MIPs library prep; 108-gene panel" "0000384071" "00382855" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "SEQ" "DNA" "" "" "0000384714" "00383489" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper" "0000384715" "00383490" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper" "0000384716" "00383491" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper" "0000384717" "00383492" "1" "00000" "03840" "2021-09-29 12:00:07" "" "" "SEQ-NG-I" "DNA" "blood" "204 genes associated with inherited retinal disorders; see paper" "0000384966" "00383741" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000384973" "00383748" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000384989" "00383764" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385011" "00383786" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385012" "00383787" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385014" "00383789" "1" "00000" "03840" "2021-09-29 12:39:39" "" "" "SEQ-NG" "DNA" "" "" "0000385049" "00383824" "1" "00000" "03840" "2021-09-29 12:44:05" "" "" "SEQ" "DNA" "" "retrospective analysis" "0000385067" "00383842" "1" "00000" "03840" "2021-09-29 12:44:05" "" "" "SEQ" "DNA" "" "retrospective analysis" "0000385129" "00383904" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385133" "00383908" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385149" "00383924" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385175" "00383950" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;SEQ" "DNA" "" "" "0000385202" "00383977" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385233" "00384008" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385277" "00384052" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385280" "00384055" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385284" "00384059" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP;MLPA" "DNA" "" "" "0000385314" "00384089" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385327" "00384102" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385346" "00384121" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385353" "00384128" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I;MLPA" "DNA" "" "" "0000385393" "00384168" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "arraySNP" "DNA" "" "" "0000385398" "00384173" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385400" "00384175" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385407" "00384182" "1" "00000" "03840" "2021-09-29 13:11:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000385496" "00384271" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385508" "00384283" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes" "0000385967" "00384741" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385968" "00384742" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385969" "00384743" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385983" "00384757" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385984" "00384758" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385985" "00384759" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385986" "00384760" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000385987" "00384761" "1" "00000" "00008" "2021-10-05 15:28:49" "" "" "arraySEQ;MLPA" "DNA" "" "" "0000386404" "00385175" "1" "00000" "03840" "2021-10-08 17:29:22" "" "" "SEQ-NG-I" "DNA" "" "176 genes panel" "0000386624" "00385395" "1" "00000" "03840" "2021-10-10 19:46:50" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000386626" "00385397" "1" "00000" "03840" "2021-10-10 19:46:50" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000386634" "00385405" "1" "00000" "03840" "2021-10-10 19:46:50" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000386930" "00385702" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 3 containing 78 genes" "0000386941" "00385713" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 1 containing 70 genes" "0000386948" "00385720" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 6 containing 386 genes" "0000386956" "00385728" "1" "00000" "03840" "2021-10-14 15:38:02" "" "" "SEQ-NG" "DNA" "blood" "Panel 2 containing 316 genes" "0000387074" "00385846" "1" "00000" "03840" "2021-10-15 23:06:55" "" "" "SEQ-NG;arrayCGH" "DNA" "blood" "after negative whole exome sequencing" "0000387455" "00386226" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387463" "00386234" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387486" "00386257" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387503" "00386274" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387511" "00386282" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387512" "00386283" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387520" "00386291" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387531" "00386302" "1" "00000" "03840" "2021-10-20 11:58:39" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000387795" "00386567" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387801" "00386573" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387802" "00386574" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387816" "00386588" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387821" "00386593" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387829" "00386601" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387837" "00386609" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387846" "00386618" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387851" "00386623" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387852" "00386624" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387856" "00386628" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387863" "00386635" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387873" "00386645" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387879" "00386651" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387880" "00386652" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387897" "00386669" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387901" "00386673" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387928" "00386700" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387940" "00386712" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387954" "00386726" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387962" "00386734" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387964" "00386736" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;PCRq" "DNA" "blood" "" "0000387968" "00386740" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387969" "00386741" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000387986" "00386758" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388027" "00386799" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388040" "00386812" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388053" "00386825" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388076" "00386848" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388100" "00386872" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000388145" "00386917" "1" "00000" "03840" "2021-10-26 17:11:18" "" "" "SEQ-NG;SEQ" "DNA" "blood" "" "0000388265" "00387039" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388266" "00387040" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388267" "00387041" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388268" "00387042" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388269" "00387043" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388270" "00387044" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388271" "00387045" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388272" "00387046" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388273" "00387047" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388274" "00387048" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388275" "00387049" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388276" "00387050" "1" "00000" "03840" "2021-10-28 13:59:26" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000388616" "00387390" "1" "00000" "03840" "2021-10-29 09:42:54" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000388618" "00387392" "1" "00000" "03840" "2021-10-29 09:42:54" "" "" "SEQ-NG" "DNA" "blood" "targeted NGS with molecular inversion probes: coding exons of 27 genes associated with Joubert syndrome" "0000388855" "00387629" "1" "00000" "03840" "2021-10-29 23:13:01" "" "" "SEQ-NG" "DNA" "blood" "targeted sequencing" "0000389719" "00388478" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000389721" "00388480" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000389729" "00388488" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000389745" "00388504" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000389746" "00388505" "1" "00000" "00008" "2021-11-04 08:27:28" "" "" "SEQ-NG" "DNA" "" "CNV gene panel next-generation sequencing" "0000389784" "00388542" "1" "00000" "03840" "2021-11-04 19:02:37" "" "" "SEQ-NG-I;SEQ" "DNA" "blood;saliva" "targeted sequencing with 1 of 4 panels of OFTALMOgenics probes" "0000390069" "00388826" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390070" "00388827" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390077" "00388834" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390078" "00388835" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390094" "00388851" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390124" "00388881" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390438" "00389195" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET1 targeted sequencing panel - see paper" "0000390511" "00389268" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390517" "00389274" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390518" "00389275" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390543" "00389300" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390544" "00389301" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000390578" "00389335" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000390579" "00389336" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390637" "00389394" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper" "0000390678" "00389435" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper" "0000390679" "00389436" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ" "DNA" "blood" "Sanger sequencing" "0000390685" "00389442" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000390780" "00389537" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390785" "00389542" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390816" "00389573" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000390844" "00389601" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390848" "00389605" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390881" "00389638" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000390882" "00389639" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET5 targeted sequencing panel - see paper" "0000390889" "00389646" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET6 targeted sequencing panel - see paper" "0000390926" "00389683" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET7 targeted sequencing panel - see paper" "0000391012" "00389769" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET4 targeted sequencing panel - see paper" "0000391033" "00389790" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000391046" "00389803" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET3 targeted sequencing panel - see paper" "0000391052" "00389809" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000391055" "00389812" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET2 targeted sequencing panel - see paper" "0000391070" "00389827" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391119" "00389876" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391175" "00389932" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391177" "00389934" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391206" "00389963" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391220" "00389977" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET9 targeted sequencing panel - see paper" "0000391253" "00390010" "1" "00000" "03840" "2021-11-08 10:11:04" "" "" "SEQ-NG" "DNA" "blood" "RET8 targeted sequencing panel - see paper" "0000391492" "00390251" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391493" "00390252" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391494" "00390253" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391495" "00390254" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391496" "00390255" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391497" "00390256" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391498" "00390257" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391499" "00390258" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391500" "00390259" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391501" "00390260" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391714" "00390473" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000391979" "00390738" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000391980" "00390739" "1" "00000" "03840" "2021-11-11 19:27:39" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000392049" "00390808" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "PCR;SEQ-NG;SEQ" "DNA" "blood" "WES" "0000392469" "00391227" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392471" "00391229" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392472" "00391230" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392473" "00391231" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392475" "00391233" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392477" "00391235" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392480" "00391238" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392481" "00391239" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392482" "00391240" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392485" "00391243" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392486" "00391244" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392487" "00391245" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392488" "00391246" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392490" "00391248" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392502" "00391260" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392504" "00391262" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392505" "00391263" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392509" "00391267" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392514" "00391272" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392515" "00391273" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392516" "00391274" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392518" "00391276" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392519" "00391277" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392520" "00391278" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392521" "00391279" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392523" "00391281" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392526" "00391284" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392527" "00391285" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392528" "00391286" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392529" "00391287" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000392530" "00391288" "1" "00000" "03840" "2021-11-15 13:26:54" "" "" "?" "DNA" "" "retrospective study" "0000393613" "00392371" "1" "00000" "03840" "2021-11-22 16:18:49" "" "" "SEQ-NG" "DNA" "blood" "gene panel testing" "0000393822" "00392575" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393825" "00392578" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393826" "00392579" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393830" "00392583" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393847" "00392600" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393849" "00392602" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393851" "00392604" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393899" "00392652" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393907" "00392660" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393908" "00392661" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000393909" "00392662" "1" "00000" "03840" "2021-11-23 15:06:01" "" "" "SEQ-NG-I;SEQ" "DNA" "" "whole exome sequencing" "0000394742" "00393494" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "WES" "0000394810" "00393562" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394817" "00393569" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394832" "00393584" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394838" "00393590" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394842" "00393594" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG;MLPA" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394849" "00393601" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG;MLPA" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394865" "00393617" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394934" "00393686" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394946" "00393698" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394948" "00393700" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG;MLPA" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394962" "00393714" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000394995" "00393747" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395024" "00393776" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395053" "00393805" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395061" "00393813" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395073" "00393825" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG;MLPA" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395101" "00393853" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395117" "00393869" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395145" "00393897" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395150" "00393902" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)" "0000395246" "00393998" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES" "0000395566" "00394319" "1" "00000" "03840" "2021-12-01 10:17:04" "" "" "SEQ-NG" "DNA" "" "retrospective analysis" "0000395567" "00394320" "1" "00000" "03840" "2021-12-01 10:17:04" "" "" "SEQ-NG" "DNA" "" "retrospective analysis" "0000395801" "00394554" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395817" "00394570" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395818" "00394571" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395819" "00394572" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395820" "00394573" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395821" "00394574" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395822" "00394575" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395823" "00394576" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395824" "00394577" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395825" "00394578" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395826" "00394579" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395827" "00394580" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395828" "00394581" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395829" "00394582" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395830" "00394583" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395831" "00394584" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395832" "00394585" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395833" "00394586" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395834" "00394587" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395835" "00394588" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395836" "00394589" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395837" "00394590" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395838" "00394591" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395839" "00394592" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395840" "00394593" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395841" "00394594" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395842" "00394595" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395843" "00394596" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000395844" "00394597" "1" "00000" "00008" "2021-12-02 08:42:19" "" "" "SEQ" "DNA" "" "" "0000396660" "00395422" "1" "00000" "03840" "2021-12-06 14:47:57" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000396661" "00395423" "1" "00000" "03840" "2021-12-06 14:47:57" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000396662" "00395424" "1" "00000" "03840" "2021-12-06 14:47:57" "" "" "SEQ-NG-I" "DNA" "blood" "whole exome sequencing" "0000396815" "00395577" "1" "00000" "03840" "2021-12-08 14:12:08" "" "" "?" "DNA" "" "whole exome sequencing" "0000397028" "00395789" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397030" "00395791" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397038" "00395799" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397050" "00395811" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397053" "00395814" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397056" "00395817" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397057" "00395818" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397071" "00395832" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397072" "00395833" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397073" "00395834" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397074" "00395835" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397076" "00395837" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397077" "00395838" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397078" "00395839" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397079" "00395840" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397084" "00395845" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397087" "00395848" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397123" "00395884" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397143" "00395904" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397152" "00395913" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397162" "00395923" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397168" "00395929" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397188" "00395949" "1" "00000" "03840" "2021-12-09 13:32:39" "" "" "SEQ-NG" "DNA" "blood" "212 inherited retinal disease-related genes" "0000397203" "00395964" "1" "00000" "03840" "2021-12-09 15:06:13" "" "" "SEQ-NG" "DNA" "blood" "retrospective study" "0000397670" "00396429" "1" "00006" "00006" "2021-12-15 14:29:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000397703" "00396463" "1" "00006" "00006" "2021-12-15 16:38:30" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000397734" "00396491" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397735" "00396492" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397736" "00396493" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397738" "00396495" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397741" "00396498" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397743" "00396500" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397744" "00396501" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397746" "00396503" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397747" "00396504" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397748" "00396505" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397749" "00396506" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397757" "00396514" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397759" "00396516" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397760" "00396517" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397761" "00396518" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397762" "00396519" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397766" "00396523" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397767" "00396524" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397777" "00396534" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397778" "00396535" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397783" "00396540" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397785" "00396542" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397795" "00396552" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397799" "00396556" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397805" "00396562" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397817" "00396574" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397821" "00396578" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397823" "00396580" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397825" "00396582" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397829" "00396586" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397831" "00396588" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397833" "00396590" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397841" "00396598" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397845" "00396602" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397847" "00396604" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397849" "00396606" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397851" "00396608" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397857" "00396614" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397865" "00396622" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397867" "00396624" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397873" "00396630" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397874" "00396631" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397875" "00396632" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397881" "00396638" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397884" "00396641" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397886" "00396643" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397887" "00396644" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397888" "00396645" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397894" "00396651" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397895" "00396652" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397896" "00396653" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000397897" "00396654" "1" "00000" "00008" "2021-12-16 13:33:12" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000401326" "00400083" "1" "00000" "03840" "2022-01-24 14:27:52" "" "" "SEQ-NG-I" "DNA" "blood" "Whole exome sequencing" "0000403501" "00402260" "1" "00000" "03840" "2022-02-04 13:28:22" "" "" "SEQ-NG-I" "DNA" "blood" "targeted sequencing" "0000403510" "00402269" "1" "00000" "03840" "2022-02-04 13:28:22" "" "" "SEQ-NG-I" "DNA" "blood" "targeted sequencing" "0000409672" "00408415" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000409673" "00408416" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000409697" "00408440" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000409698" "00408441" "1" "00000" "03840" "2022-04-21 15:58:46" "" "" "SEQ-NG;SEQ" "DNA" "" "targeted gene analysis or a next-generation sequencing-based gene panel" "0000410260" "00408996" "1" "04303" "04303" "2022-04-30 04:15:58" "" "" "SEQ-ON" "DNA" "blood" "WGS" "0000410261" "00408997" "1" "04303" "04303" "2022-04-30 04:37:30" "" "" "SEQ-ON" "DNA" "" "" "0000410765" "00409501" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410766" "00409502" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410768" "00409504" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410769" "00409505" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410770" "00409506" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410773" "00409509" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410774" "00409510" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410775" "00409511" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410776" "00409512" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410777" "00409513" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410778" "00409514" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410783" "00409519" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410784" "00409520" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410785" "00409521" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410786" "00409522" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000410787" "00409523" "1" "00000" "03840" "2022-05-09 20:24:57" "" "" "SEQ" "DNA" "blood" "" "0000412233" "00410969" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412234" "00410970" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412235" "00410971" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ;arrayCGH" "DNA" "" "" "0000412236" "00410972" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412237" "00410973" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG" "DNA" "" "" "0000412238" "00410974" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412239" "00410975" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ;arrayCGH" "DNA" "" "" "0000412240" "00410976" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412241" "00410977" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "WES" "0000412242" "00410978" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412243" "00410979" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412244" "00410980" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412245" "00410981" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG" "DNA" "" "WE" "0000412246" "00410982" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "" "0000412247" "00410983" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "" "WES" "0000412248" "00410984" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412249" "00410985" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412250" "00410986" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412251" "00410987" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412252" "00410988" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412253" "00410989" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412254" "00410990" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412255" "00410991" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412256" "00410992" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412257" "00410993" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412258" "00410994" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412259" "00410995" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412260" "00410996" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412261" "00410997" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412262" "00410998" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412263" "00410999" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral whole blood lymphocytes" "" "0000412264" "00411000" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412265" "00411001" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412266" "00411002" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412267" "00411003" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412268" "00411004" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412269" "00411005" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412270" "00411006" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412271" "00411007" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412272" "00411008" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000412273" "00411009" "1" "00000" "00008" "2022-05-31 18:45:49" "" "" "SEQ-NG;SEQ" "DNA" "peripheral blood leukocytes" "" "0000415715" "00414435" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000420996" "00419691" "1" "04405" "00006" "2022-10-21 12:50:15" "" "" "MIPsm" "DNA" "" "smMIPs 105 iMD/AMD genes" "0000421174" "00419869" "1" "00006" "00006" "2022-10-24 12:05:27" "" "" "SEQ;SEQ-ON;SEQ-NG" "DNA" "" "gene panel" "0000421175" "00419870" "1" "00006" "00006" "2022-10-24 12:22:05" "" "" "SEQ;SEQ-ON;SEQ-NG" "DNA" "" "gene panel" "0000421176" "00419871" "1" "00006" "00006" "2022-10-24 14:31:32" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421177" "00419872" "1" "00006" "00006" "2022-10-24 14:33:53" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421178" "00419873" "1" "00006" "00006" "2022-10-24 14:38:51" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421179" "00419874" "1" "00006" "00006" "2022-10-24 14:42:32" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421180" "00419875" "1" "00006" "00006" "2022-10-24 14:45:33" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421181" "00419876" "1" "00006" "00006" "2022-10-24 14:50:56" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421182" "00419877" "1" "00006" "00006" "2022-10-24 14:53:34" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421183" "00419878" "1" "00006" "00006" "2022-10-24 14:56:25" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421184" "00419879" "1" "00006" "00006" "2022-10-24 14:56:25" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421185" "00419880" "1" "00006" "00006" "2022-10-24 14:56:25" "" "" "SEQ;SEQ-ON" "DNA" "" "" "0000421186" "00419881" "1" "00006" "00006" "2022-10-24 14:56:25" "00006" "2022-10-24 15:12:40" "SEQ;SEQ-ON;SEQ-NG" "DNA" "" "gene panel" "0000421700" "00420391" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421704" "00420395" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421707" "00420398" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421716" "00420407" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421729" "00420420" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421752" "00420443" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421754" "00420445" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421759" "00420450" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421760" "00420451" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421785" "00420476" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421788" "00420479" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421808" "00420499" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421809" "00420500" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421814" "00420505" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421827" "00420518" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421851" "00420542" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421854" "00420545" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421857" "00420548" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421865" "00420556" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421872" "00420563" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421873" "00420564" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421879" "00420570" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000421895" "00420586" "1" "00000" "03840" "2022-11-02 10:32:06" "" "" "SEQ-NG" "DNA" "" "targeted 212 IRD-related genes" "0000427208" "00425888" "1" "00000" "03840" "2022-11-26 12:24:53" "" "" "SEQ-NG;SEQ" "DNA" "blood" "whole-exome sequencing" "0000428233" "00426913" "1" "00000" "03840" "2022-12-03 18:53:15" "" "" "SEQ-NG;SEQ" "DNA" "saliva" "panel-based next generation sequencing" "0000430909" "00429496" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430915" "00429502" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430925" "00429512" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430932" "00429519" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430942" "00429529" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430958" "00429545" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430961" "00429548" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430966" "00429553" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430967" "00429554" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430968" "00429555" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430971" "00429558" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430978" "00429565" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430979" "00429566" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430988" "00429575" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430989" "00429576" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430990" "00429577" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430993" "00429580" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000430995" "00429582" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431005" "00429592" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431006" "00429593" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431010" "00429597" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431015" "00429602" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431037" "00429624" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431039" "00429626" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431086" "00429673" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431092" "00429679" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431096" "00429683" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431104" "00429691" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431130" "00429717" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431147" "00429734" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431150" "00429737" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431159" "00429746" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431184" "00429771" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431188" "00429775" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431214" "00429801" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431219" "00429806" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431264" "00429851" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431267" "00429854" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431317" "00429904" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431330" "00429917" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431334" "00429921" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431347" "00429934" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431354" "00429941" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431379" "00429966" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431391" "00429978" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431412" "00429999" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431439" "00430026" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431456" "00430043" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431465" "00430052" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431468" "00430055" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431480" "00430067" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431481" "00430068" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431486" "00430073" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431491" "00430078" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431502" "00430089" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431529" "00430116" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000431531" "00430118" "1" "04436" "00008" "2023-01-11 18:53:49" "" "" "SEQ" "DNA" "" "RP-LCA smMIPs sequencing" "0000432315" "00430904" "1" "04091" "00006" "2023-01-25 13:11:03" "" "" "SEQ-NG" "DNA" "" "WGS" "0000437646" "00436163" "1" "00006" "00006" "2023-08-30 13:09:16" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000437902" "00436418" "1" "04552" "04552" "2023-09-14 17:23:02" "" "" "SEQ-NG-I" "DNA" "Buccal swab" "Retinal dystrophy panel" "0000437922" "00436438" "1" "04552" "04552" "2023-09-15 20:49:44" "" "" "SEQ-NG-I" "DNA" "BUCCAL SWAB" "" "0000440174" "00438692" "1" "00006" "00006" "2023-10-21 19:20:17" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000443144" "00441658" "1" "04542" "00008" "2023-11-09 09:55:44" "" "" "SEQ-NG" "DNA" "blood" "Published as WGS" "0000443145" "00441659" "1" "04542" "00008" "2023-11-09 09:55:44" "" "" "SEQ-NG" "DNA" "blood" "Published as WGS" "0000445830" "00444256" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000448546" "00446969" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448563" "00446986" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448564" "00446987" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448570" "00446993" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448571" "00446994" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448581" "00447004" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448597" "00447020" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448636" "00447059" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448835" "00447258" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448838" "00447261" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448843" "00447266" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448845" "00447268" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448846" "00447269" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448849" "00447272" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448855" "00447278" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448867" "00447290" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000448882" "00447305" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449033" "00447456" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449081" "00447504" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449082" "00447505" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449085" "00447508" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449086" "00447509" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449090" "00447513" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449092" "00447515" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449171" "00447594" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449187" "00447610" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449191" "00447614" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449197" "00447620" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449209" "00447632" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449279" "00447702" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449284" "00447707" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449293" "00447716" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449295" "00447718" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000449297" "00447720" "1" "00006" "00006" "2024-01-26 10:23:59" "" "" "SEQ-NG" "DNA" "" "WGS" "0000451578" "00449982" "1" "02230" "00006" "2024-05-24 14:55:58" "" "" "SEQ;SEQ-NG" "DNA" "blood" "WGS" "0000452438" "00450840" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452439" "00450841" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452440" "00450842" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452441" "00450843" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452442" "00450844" "1" "04405" "00006" "2024-03-27 11:47:00" "" "" "SEQ;SEQ-NG" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452666" "00451067" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452667" "00451068" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452748" "00451149" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452754" "00451155" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452765" "00451166" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452851" "00451252" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452858" "00451259" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452932" "00451333" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000452947" "00451348" "1" "00006" "00006" "2024-05-31 11:39:36" "" "" "SEQ" "DNA" "" "smMIP-based 105 iMD/AMD genes" "0000460619" "00458998" "1" "00006" "00006" "2024-12-23 14:31:07" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000460627" "00459006" "1" "00006" "00006" "2024-12-23 15:57:05" "" "" "SEQ-NG" "DNA" "" "" "0000460628" "00459007" "1" "00006" "00006" "2024-12-23 16:04:40" "" "" "SEQ-NG" "DNA" "" "" "0000462745" "00461113" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462767" "00461135" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000462769" "00461137" "1" "00006" "00006" "2025-01-31 08:52:59" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000466967" "00465319" "1" "04846" "04846" "2025-05-13 07:53:36" "" "" "SEQ-PB" "DNA" "whole blood" "" "0000469494" "00467828" "1" "00006" "00006" "2025-10-31 22:30:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000481631" "00479985" "1" "00006" "00006" "2026-05-25 15:41:53" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 1376 "{{screeningid}}" "{{geneid}}" "0000000126" "IL36RN" "0000000211" "MKS1" "0000001640" "DHCR7" "0000033164" "AHI1" "0000033164" "EYS" "0000033164" "PDE6B" "0000033177" "CACNA1F" "0000033177" "EYS" "0000033177" "GUCA1B" "0000033177" "PDE6B" "0000033200" "ABCA4" "0000033200" "EYS" "0000033200" "GUCY2D" "0000033225" "EYS" "0000033417" "EYS" "0000038589" "CRB1" "0000038589" "EYS" "0000096328" "EYS" "0000100508" "EYS" "0000105037" "CSNK2B" "0000105037" "EYS" "0000105037" "SLC4A7" "0000105037" "ZNF131" "0000144693" "EYS" "0000144694" "EYS" "0000144695" "EYS" "0000144696" "EYS" "0000144697" "EYS" "0000144698" "EYS" "0000144699" "EYS" "0000144700" "EYS" "0000144701" "EYS" "0000144702" "EYS" "0000144703" "EYS" "0000144704" "EYS" "0000144705" "EYS" "0000144706" "EYS" "0000144707" "EYS" "0000144708" "EYS" "0000144709" "EYS" "0000144710" "EYS" "0000144711" "EYS" "0000144712" "EYS" "0000144713" "EYS" "0000144714" "EYS" "0000144715" "EYS" "0000144716" "EYS" "0000144717" "EYS" "0000144718" "EYS" "0000144719" "EYS" "0000144720" "EYS" "0000144721" "EYS" "0000144722" "EYS" "0000144723" "EYS" "0000144724" "EYS" "0000144725" "EYS" "0000144726" "EYS" "0000144727" "EYS" "0000144728" "EYS" "0000144729" "EYS" "0000144730" "EYS" "0000144731" "EYS" "0000144732" "EYS" "0000144733" "EYS" "0000144734" "EYS" "0000144735" "EYS" "0000144736" "EYS" "0000144737" "EYS" "0000144738" "EYS" "0000144739" "EYS" "0000144740" "EYS" "0000144741" "EYS" "0000144742" "EYS" "0000144743" "EYS" "0000144744" "EYS" "0000144745" "EYS" "0000144746" "EYS" "0000144747" "EYS" "0000144748" "EYS" "0000144749" "EYS" "0000144750" "EYS" "0000144751" "EYS" "0000144752" "EYS" "0000144753" "EYS" "0000144754" "EYS" "0000144755" "EYS" "0000144756" "EYS" "0000144757" "EYS" "0000144758" "EYS" "0000144759" "EYS" "0000144760" "EYS" "0000144761" "EYS" "0000144762" "EYS" "0000144763" "EYS" "0000144764" "EYS" "0000144765" "EYS" "0000144766" "EYS" "0000144767" "EYS" "0000144768" "EYS" "0000144769" "EYS" "0000144770" "EYS" "0000144771" "EYS" "0000144772" "EYS" "0000144773" "EYS" "0000144774" "EYS" "0000144775" "EYS" "0000144776" "EYS" "0000144777" "EYS" "0000144778" "EYS" "0000144779" "EYS" "0000144780" "EYS" "0000144781" "EYS" "0000144782" "EYS" "0000144783" "EYS" "0000144784" "EYS" "0000144785" "EYS" "0000144786" "EYS" "0000144787" "EYS" "0000144788" "EYS" "0000144789" "EYS" "0000144790" "EYS" "0000144791" "EYS" "0000144792" "EYS" "0000144793" "EYS" "0000144794" "EYS" "0000144795" "EYS" "0000144796" "EYS" "0000144797" "EYS" "0000144798" "EYS" "0000144799" "EYS" "0000144800" "EYS" "0000144801" "EYS" "0000144802" "EYS" "0000144803" "EYS" "0000144806" "EYS" "0000144807" "EYS" "0000144808" "EYS" "0000144809" "EYS" "0000144810" "EYS" "0000144811" "EYS" "0000144812" "EYS" "0000144813" "EYS" "0000144814" "EYS" "0000144815" "EYS" "0000144816" "EYS" "0000144817" "EYS" "0000144818" "EYS" "0000144819" "EYS" "0000144820" "EYS" "0000144821" "EYS" "0000144822" "EYS" "0000144823" "EYS" "0000144824" "EYS" "0000144825" "EYS" "0000144826" "EYS" "0000144827" "EYS" "0000144828" "EYS" "0000144829" "EYS" "0000144830" "EYS" "0000144831" "EYS" "0000144832" "EYS" "0000144833" "EYS" "0000144834" "EYS" "0000144835" "EYS" "0000144836" "EYS" "0000144837" "EYS" "0000144838" "EYS" "0000144839" "EYS" "0000144840" "EYS" "0000144841" "EYS" "0000144842" "EYS" "0000144843" "EYS" "0000144844" "EYS" "0000144845" "EYS" "0000144846" "EYS" "0000144847" "EYS" "0000144848" "EYS" "0000144849" "EYS" "0000144850" "EYS" "0000144851" "EYS" "0000144852" "EYS" "0000144853" "EYS" "0000144854" "EYS" "0000144855" "EYS" "0000144856" "EYS" "0000144857" "EYS" "0000144858" "EYS" "0000144859" "EYS" "0000144860" "EYS" "0000144861" "EYS" "0000144862" "EYS" "0000144863" "EYS" "0000144864" "EYS" "0000144865" "EYS" "0000144866" "EYS" "0000144867" "EYS" "0000144868" "EYS" "0000144869" "EYS" "0000144870" "EYS" "0000144871" "EYS" "0000144872" "EYS" "0000144873" "EYS" "0000144874" "EYS" "0000144875" "EYS" "0000144876" "EYS" "0000144877" "EYS" "0000144878" "EYS" "0000144879" "EYS" "0000144880" "EYS" "0000144881" "EYS" "0000144882" "EYS" "0000144883" "EYS" "0000144884" "EYS" "0000144885" "EYS" "0000144886" "EYS" "0000144887" "EYS" "0000144888" "EYS" "0000144889" "EYS" "0000144890" "EYS" "0000144891" "EYS" "0000144892" "EYS" "0000144893" "EYS" "0000144894" "EYS" "0000144895" "EYS" "0000144896" "EYS" "0000144897" "EYS" "0000144898" "EYS" "0000144899" "EYS" "0000144900" "EYS" "0000144901" "EYS" "0000144902" "EYS" "0000144903" "EYS" "0000144904" "EYS" "0000144905" "EYS" "0000144906" "EYS" "0000144907" "EYS" "0000144908" "EYS" "0000144909" "EYS" "0000144910" "EYS" "0000144911" "EYS" "0000144912" "EYS" "0000144913" "EYS" "0000144914" "EYS" "0000144915" "EYS" "0000144916" "EYS" "0000144917" "EYS" "0000144918" "EYS" "0000144919" "EYS" "0000144920" "EYS" "0000144921" "EYS" "0000144922" "EYS" "0000144923" "EYS" "0000144924" "EYS" "0000144925" "EYS" "0000144926" "EYS" "0000144927" "EYS" "0000144928" "EYS" "0000144929" "EYS" "0000144930" "EYS" "0000144931" "EYS" "0000144932" "EYS" "0000144933" "EYS" "0000144934" "EYS" "0000144935" "EYS" "0000144936" "EYS" "0000144937" "EYS" "0000144938" "EYS" "0000144939" "EYS" "0000144940" "EYS" "0000144941" "EYS" "0000144942" "EYS" "0000144943" "EYS" "0000144944" "EYS" "0000144945" "EYS" "0000144946" "EYS" "0000144947" "EYS" "0000144948" "EYS" "0000144949" "EYS" "0000144950" "EYS" "0000144951" "EYS" "0000144952" "EYS" "0000144953" "EYS" "0000144954" "EYS" "0000144955" "EYS" "0000144956" "EYS" "0000144957" "EYS" "0000144958" "EYS" "0000144959" "EYS" "0000144960" "EYS" "0000144961" "EYS" "0000144962" "EYS" "0000144963" "EYS" "0000144964" "EYS" "0000144965" "EYS" "0000144966" "EYS" "0000144967" "EYS" "0000144968" "EYS" "0000144969" "EYS" "0000144970" "EYS" "0000144971" "EYS" "0000144972" "EYS" "0000144973" "EYS" "0000144974" "EYS" "0000144975" "EYS" "0000144976" "EYS" "0000144977" "EYS" "0000144978" "EYS" "0000144979" "EYS" "0000144980" "EYS" "0000144981" "EYS" "0000144982" "EYS" "0000144983" "EYS" "0000144984" "EYS" "0000144985" "EYS" "0000144986" "EYS" "0000144987" "EYS" "0000144988" "EYS" "0000144989" "EYS" "0000144990" "EYS" "0000144991" "EYS" "0000144992" "EYS" "0000144993" "EYS" "0000144994" "EYS" "0000144995" "EYS" "0000144996" "EYS" "0000144997" "EYS" "0000144998" "EYS" "0000144999" "EYS" "0000145000" "EYS" "0000145001" "EYS" "0000145002" "EYS" "0000145003" "EYS" "0000145004" "EYS" "0000145005" "EYS" "0000145006" "EYS" "0000145007" "EYS" "0000145008" "EYS" "0000145009" "EYS" "0000145010" "EYS" "0000145011" "EYS" "0000145012" "EYS" "0000145013" "EYS" "0000145014" "EYS" "0000145015" "EYS" "0000145016" "EYS" "0000145017" "EYS" "0000145018" "EYS" "0000145019" "EYS" "0000145020" "EYS" "0000145021" "EYS" "0000145022" "EYS" "0000145023" "EYS" "0000145024" "EYS" "0000145025" "EYS" "0000145026" "EYS" "0000145027" "EYS" "0000145028" "EYS" "0000145029" "EYS" "0000145030" "EYS" "0000145031" "EYS" "0000145032" "EYS" "0000145033" "EYS" "0000145034" "EYS" "0000145035" "EYS" "0000145036" "EYS" "0000145037" "EYS" "0000145038" "EYS" "0000145039" "EYS" "0000145040" "EYS" "0000145041" "EYS" "0000145042" "EYS" "0000145043" "EYS" "0000145044" "EYS" "0000145045" "EYS" "0000145046" "EYS" "0000145047" "EYS" "0000145048" "EYS" "0000145049" "EYS" "0000145050" "EYS" "0000145051" "EYS" "0000145052" "EYS" "0000145053" "EYS" "0000145054" "EYS" "0000145055" "EYS" "0000145056" "EYS" "0000145057" "EYS" "0000145058" "EYS" "0000145059" "EYS" "0000145060" "EYS" "0000145061" "EYS" "0000145062" "EYS" "0000145063" "EYS" "0000145064" "EYS" "0000145065" "EYS" "0000145066" "EYS" "0000145067" "EYS" "0000145068" "EYS" "0000145069" "EYS" "0000145070" "EYS" "0000145071" "EYS" "0000145072" "EYS" "0000145073" "EYS" "0000145074" "EYS" "0000145075" "EYS" "0000145076" "EYS" "0000145077" "EYS" "0000145078" "EYS" "0000145079" "EYS" "0000145080" "EYS" "0000145081" "EYS" "0000145082" "EYS" "0000145083" "EYS" "0000145084" "EYS" "0000145085" "EYS" "0000145086" "EYS" "0000145087" "EYS" "0000145088" "EYS" "0000145089" "EYS" "0000145090" "EYS" "0000145091" "EYS" "0000145092" "EYS" "0000145093" "EYS" "0000145094" "EYS" "0000145095" "EYS" "0000145096" "EYS" "0000145097" "EYS" "0000145098" "EYS" "0000145099" "EYS" "0000145100" "EYS" "0000145101" "EYS" "0000145102" "EYS" "0000145103" "EYS" "0000145104" "EYS" "0000145107" "EYS" "0000145108" "EYS" "0000145109" "EYS" "0000145110" "EYS" "0000145111" "EYS" "0000145112" "EYS" "0000145113" "EYS" "0000145114" "EYS" "0000145115" "EYS" "0000145116" "EYS" "0000145117" "EYS" "0000145118" "EYS" "0000145119" "EYS" "0000145120" "EYS" "0000145121" "EYS" "0000145122" "EYS" "0000145123" "EYS" "0000145124" "EYS" "0000145125" "EYS" "0000145126" "EYS" "0000145127" "EYS" "0000145128" "EYS" "0000145129" "EYS" "0000145130" "EYS" "0000145131" "EYS" "0000145132" "EYS" "0000145133" "EYS" "0000145134" "EYS" "0000145135" "EYS" "0000145136" "EYS" "0000145137" "EYS" "0000145138" "EYS" "0000145139" "EYS" "0000145140" "EYS" "0000145141" "EYS" "0000145142" "EYS" "0000145143" "EYS" "0000145144" "EYS" "0000145145" "EYS" "0000145146" "EYS" "0000145147" "EYS" "0000145148" "EYS" "0000145149" "EYS" "0000145150" "EYS" "0000145151" "EYS" "0000145152" "EYS" "0000145153" "EYS" "0000145154" "EYS" "0000145155" "EYS" "0000145156" "EYS" "0000145157" "EYS" "0000145158" "EYS" "0000145159" "EYS" "0000145160" "EYS" "0000145161" "EYS" "0000145162" "EYS" "0000145163" "EYS" "0000145164" "EYS" "0000145165" "EYS" "0000145166" "EYS" "0000145167" "EYS" "0000145168" "EYS" "0000145169" "EYS" "0000145170" "EYS" "0000145171" "EYS" "0000145171" "USH2A" "0000156181" "EYS" "0000156325" "EYS" "0000156326" "EYS" "0000156327" "EYS" "0000156328" "EYS" "0000156329" "EYS" "0000156330" "EYS" "0000156331" "EYS" "0000156332" "EYS" "0000156333" "EYS" "0000156334" "EYS" "0000156335" "EYS" "0000174728" "MERTK" "0000174762" "MERTK" "0000181353" "EYS" "0000233815" "EYS" "0000233816" "EYS" "0000233817" "EYS" "0000233818" "EYS" "0000233819" "EYS" "0000233820" "EYS" "0000233821" "EYS" "0000233822" "EYS" "0000233823" "EYS" "0000233824" "EYS" "0000233825" "EYS" "0000233826" "EYS" "0000233827" "EYS" "0000233828" "EYS" "0000233829" "EYS" "0000233830" "EYS" "0000233831" "EYS" "0000233832" "EYS" "0000233833" "EYS" "0000233834" "EYS" "0000233835" "EYS" "0000233836" "EYS" "0000233837" "EYS" "0000233838" "EYS" "0000233839" "EYS" "0000233840" "EYS" "0000233841" "EYS" "0000233842" "EYS" "0000233843" "EYS" "0000233844" "EYS" "0000233845" "EYS" "0000233846" "EYS" "0000233847" "EYS" "0000233848" "EYS" "0000233849" "EYS" "0000233850" "EYS" "0000233851" "EYS" "0000233852" "EYS" "0000233853" "EYS" "0000233854" "EYS" "0000233855" "EYS" "0000233856" "EYS" "0000233857" "EYS" "0000233858" "EYS" "0000233859" "EYS" "0000233860" "EYS" "0000233861" "EYS" "0000233862" "EYS" "0000233863" "EYS" "0000233864" "EYS" "0000233865" "EYS" "0000233866" "EYS" "0000233867" "EYS" "0000233868" "EYS" "0000233869" "EYS" "0000233870" "EYS" "0000233871" "EYS" "0000233872" "EYS" "0000233873" "EYS" "0000233874" "EYS" "0000233875" "EYS" "0000233876" "EYS" "0000233877" "EYS" "0000233878" "EYS" "0000233879" "EYS" "0000233880" "EYS" "0000233881" "EYS" "0000233882" "EYS" "0000233883" "EYS" "0000233884" "EYS" "0000233885" "EYS" "0000233886" "EYS" "0000233887" "EYS" "0000233888" "EYS" "0000233889" "EYS" "0000233890" "EYS" "0000233891" "EYS" "0000233892" "EYS" "0000233893" "EYS" "0000233894" "EYS" "0000233895" "EYS" "0000233896" "EYS" "0000233897" "EYS" "0000233898" "EYS" "0000233899" "EYS" "0000233900" "EYS" "0000233901" "EYS" "0000233902" "EYS" "0000233903" "EYS" "0000233904" "EYS" "0000233905" "EYS" "0000233906" "EYS" "0000233907" "EYS" "0000233908" "EYS" "0000233909" "EYS" "0000233910" "EYS" "0000233911" "EYS" "0000233912" "EYS" "0000233913" "EYS" "0000233914" "EYS" "0000233915" "EYS" "0000233916" "EYS" "0000233917" "EYS" "0000233918" "EYS" "0000233919" "EYS" "0000233920" "EYS" "0000233921" "EYS" "0000233922" "EYS" "0000233923" "EYS" "0000233924" "EYS" "0000233925" "EYS" "0000233926" "EYS" "0000233927" "EYS" "0000233928" "EYS" "0000233929" "EYS" "0000233930" "EYS" "0000233931" "EYS" "0000233932" "EYS" "0000233933" "EYS" "0000233934" "EYS" "0000233935" "EYS" "0000233936" "EYS" "0000233937" "EYS" "0000233938" "EYS" "0000233939" "EYS" "0000233940" "EYS" "0000234790" "EYS" "0000234791" "EYS" "0000234792" "EYS" "0000234793" "EYS" "0000234794" "EYS" "0000234795" "EYS" "0000234796" "EYS" "0000234797" "EYS" "0000234798" "EYS" "0000234799" "EYS" "0000234800" "EYS" "0000234801" "EYS" "0000234802" "EYS" "0000234803" "EYS" "0000234804" "EYS" "0000234805" "EYS" "0000234806" "EYS" "0000234807" "EYS" "0000234808" "EYS" "0000234809" "EYS" "0000234810" "EYS" "0000234811" "EYS" "0000234812" "EYS" "0000234813" "EYS" "0000234814" "EYS" "0000234815" "EYS" "0000234816" "EYS" "0000234817" "EYS" "0000234818" "EYS" "0000234819" "EYS" "0000234820" "EYS" "0000309550" "EYS" "0000309652" "EYS" "0000309653" "EYS" "0000309654" "EYS" "0000309655" "EYS" "0000309656" "EYS" "0000309781" "EYS" "0000309788" "EYS" "0000309789" "EYS" "0000309790" "EYS" "0000309791" "EYS" "0000310281" "EYS" "0000310282" "EYS" "0000310283" "EYS" "0000310284" "EYS" "0000310285" "EYS" "0000310286" "EYS" "0000310287" "EYS" "0000310288" "EYS" "0000310289" "EYS" "0000310290" "EYS" "0000310291" "EYS" "0000310292" "EYS" "0000310293" "EYS" "0000310294" "EYS" "0000310295" "EYS" "0000310296" "EYS" "0000310297" "EYS" "0000310298" "EYS" "0000310299" "EYS" "0000310300" "EYS" "0000310301" "EYS" "0000310302" "EYS" "0000310303" "EYS" "0000310304" "EYS" "0000310305" "EYS" "0000310306" "EYS" "0000310307" "EYS" "0000310308" "EYS" "0000310309" "EYS" "0000310310" "EYS" "0000310870" "EYS" "0000310900" "EYS" "0000310901" "EYS" "0000310902" "EYS" "0000326675" "EYS" "0000329148" "EYS" "0000329169" "EYS" "0000329225" "EYS" "0000329276" "EYS" "0000329302" "EYS" "0000329374" "EYS" "0000329382" "EYS" "0000329433" "EYS" "0000329444" "EYS" "0000329481" "EYS" "0000329508" "EYS" "0000329530" "EYS" "0000329538" "EYS" "0000329539" "EYS" "0000332467" "EYS" "0000332468" "EYS" "0000332469" "EYS" "0000332470" "EYS" "0000332471" "EYS" "0000332472" "EYS" "0000332473" "EYS" "0000332474" "EYS" "0000332475" "EYS" "0000332476" "EYS" "0000332477" "EYS" "0000332478" "EYS" "0000332479" "EYS" "0000332480" "EYS" "0000332481" "EYS" "0000332482" "EYS" "0000332483" "EYS" "0000332484" "EYS" "0000332485" "EYS" "0000332486" "EYS" "0000332487" "EYS" "0000332922" "EYS" "0000333712" "EYS" "0000333713" "EYS" "0000333714" "EYS" "0000333731" "EYS" "0000333731" "MERTK" "0000334624" "EYS" "0000334625" "EYS" "0000334626" "EYS" "0000334627" "EYS" "0000335050" "EYS" "0000335051" "EYS" "0000335052" "EYS" "0000335053" "EYS" "0000335116" "EYS" "0000335127" "EYS" "0000335645" "EYS" "0000335646" "EYS" "0000335787" "EYS" "0000335789" "EYS" "0000335792" "EYS" "0000336460" "EYS" "0000336474" "EYS" "0000336503" "EYS" "0000336565" "EYS" "0000336566" "EYS" "0000336645" "EYS" "0000336649" "EYS" "0000336653" "PDE6B" "0000337203" "EYS" "0000360570" "EYS" "0000362654" "PRPH2" "0000363439" "EYS" "0000363441" "EYS" "0000363445" "EYS" "0000363447" "EYS" "0000363463" "CNGB1" "0000363463" "EYS" "0000363469" "EYS" "0000363472" "EYS" "0000364134" "EYS" "0000364135" "EYS" "0000364863" "EYS" "0000373990" "EYS" "0000375052" "EYS" "0000377484" "EYS" "0000377485" "EYS" "0000377509" "EYS" "0000377510" "EYS" "0000378447" "EYS" "0000378461" "EYS" "0000378462" "EYS" "0000378705" "EYS" "0000379139" "EYS" "0000379140" "EYS" "0000379149" "EYS" "0000379150" "EYS" "0000379161" "DFNB31" "0000380576" "EYS" "0000380577" "EYS" "0000380578" "EYS" "0000380758" "EYS" "0000380772" "EYS" "0000381037" "EYS" "0000381038" "EYS" "0000381039" "EYS" "0000381040" "EYS" "0000381372" "EYS" "0000381373" "EYS" "0000381375" "EYS" "0000381407" "EYS" "0000382227" "EYS" "0000382891" "CNGB1" "0000382900" "EYS" "0000383067" "EYS" "0000383068" "EYS" "0000383069" "EYS" "0000383070" "EYS" "0000383071" "EYS" "0000383072" "EYS" "0000383073" "EYS" "0000383074" "EYS" "0000383075" "EYS" "0000383076" "EYS" "0000383492" "EYS" "0000383493" "EYS" "0000383494" "EYS" "0000383495" "EYS" "0000383496" "EYS" "0000383497" "EYS" "0000383498" "EYS" "0000383499" "EYS" "0000383500" "EYS" "0000383501" "EYS" "0000383502" "EYS" "0000383503" "EYS" "0000383504" "EYS" "0000383505" "EYS" "0000383506" "EYS" "0000383507" "EYS" "0000383508" "EYS" "0000383509" "EYS" "0000383510" "EYS" "0000383511" "EYS" "0000383512" "EYS" "0000383513" "EYS" "0000383514" "EYS" "0000383515" "EYS" "0000383516" "EYS" "0000383517" "EYS" "0000383518" "EYS" "0000383519" "EYS" "0000383520" "EYS" "0000383633" "EYS" "0000383678" "USH2A" "0000383754" "EYS" "0000383755" "EYS" "0000383756" "EYS" "0000383757" "EYS" "0000383758" "EYS" "0000383759" "EYS" "0000383939" "ABCA4" "0000384071" "EYS" "0000384714" "EYS" "0000384715" "EYS" "0000384716" "EYS" "0000384717" "EYS" "0000384966" "EYS" "0000384973" "EYS" "0000384989" "EYS" "0000385011" "EYS" "0000385012" "EYS" "0000385014" "EYS" "0000385129" "EYS" "0000385133" "EYS" "0000385149" "EYS" "0000385175" "EYS" "0000385202" "EYS" "0000385233" "EYS" "0000385277" "EYS" "0000385280" "EYS" "0000385284" "EYS" "0000385314" "EYS" "0000385327" "EYS" "0000385346" "EYS" "0000385353" "EYS" "0000385393" "EYS" "0000385398" "EYS" "0000385400" "EYS" "0000385407" "EYS" "0000385496" "EYS" "0000385508" "EYS" "0000385967" "EYS" "0000385968" "EYS" "0000385969" "EYS" "0000385983" "EYS" "0000385984" "EYS" "0000385985" "EYS" "0000385986" "EYS" "0000385987" "EYS" "0000386404" "EYS" "0000386624" "EYS" "0000386626" "EYS" "0000386634" "EYS" "0000386930" "EYS" "0000386941" "EYS" "0000386948" "EYS" "0000386956" "EYS" "0000387074" "EYS" "0000387455" "ARL2BP" "0000387463" "RDH5" "0000387486" "EYS" "0000387503" "CNGB3" "0000387511" "EYS" "0000387512" "EYS" "0000387520" "CNGB3" "0000387531" "EYS" "0000387795" "EYS" "0000387801" "EYS" "0000387802" "EYS" "0000387816" "EYS" "0000387821" "EYS" "0000387829" "EYS" "0000387837" "EYS" "0000387846" "EYS" "0000387851" "EYS" "0000387852" "EYS" "0000387856" "EYS" "0000387863" "EYS" "0000387873" "EYS" "0000387879" "EYS" "0000387880" "EYS" "0000387897" "EYS" "0000387901" "EYS" "0000387928" "EYS" "0000387940" "EYS" "0000387954" "EYS" "0000387962" "EYS" "0000387964" "EYS" "0000387968" "EYS" "0000387969" "EYS" "0000387986" "EYS" "0000388027" "EYS" "0000388040" "EYS" "0000388053" "EYS" "0000388076" "EYS" "0000388100" "EYS" "0000388145" "USH2A" "0000388265" "EYS" "0000388266" "EYS" "0000388267" "EYS" "0000388268" "EYS" "0000388269" "EYS" "0000388270" "EYS" "0000388271" "EYS" "0000388272" "EYS" "0000388273" "EYS" "0000388274" "EYS" "0000388275" "EYS" "0000388276" "EYS" "0000388855" "EYS" "0000389719" "EYS" "0000389721" "EYS" "0000389729" "EYS" "0000389745" "EYS" "0000389746" "EYS" "0000389784" "EYS" "0000390069" "EYS" "0000390070" "EYS" "0000390077" "EYS" "0000390078" "EYS" "0000390094" "EYS" "0000390124" "EYS" "0000390438" "EYS" "0000390511" "EYS" "0000390517" "EYS" "0000390518" "EYS" "0000390543" "EYS" "0000390544" "EYS" "0000390578" "EYS" "0000390579" "EYS" "0000390637" "EYS" "0000390678" "EYS" "0000390679" "EYS" "0000390685" "EYS" "0000390780" "EYS" "0000390785" "EYS" "0000390816" "EYS" "0000390844" "EYS" "0000390848" "EYS" "0000390881" "EYS" "0000390882" "EYS" "0000390889" "EYS" "0000390926" "EYS" "0000391012" "EYS" "0000391033" "EYS" "0000391046" "EYS" "0000391052" "EYS" "0000391055" "EYS" "0000391070" "EYS" "0000391119" "EYS" "0000391175" "EYS" "0000391177" "EYS" "0000391206" "EYS" "0000391220" "EYS" "0000391253" "EYS" "0000391492" "EYS" "0000391493" "EYS" "0000391494" "EYS" "0000391495" "EYS" "0000391496" "EYS" "0000391497" "EYS" "0000391498" "EYS" "0000391499" "EYS" "0000391500" "EYS" "0000391501" "EYS" "0000391714" "EYS" "0000391979" "EYS" "0000391980" "EYS" "0000392049" "EYS" "0000392469" "EYS" "0000392471" "EYS" "0000392472" "EYS" "0000392473" "EYS" "0000392475" "EYS" "0000392477" "EYS" "0000392480" "EYS" "0000392481" "EYS" "0000392482" "EYS" "0000392485" "EYS" "0000392486" "EYS" "0000392487" "USH2A" "0000392488" "EYS" "0000392490" "EYS" "0000392502" "EYS" "0000392504" "EYS" "0000392505" "EYS" "0000392509" "EYS" "0000392514" "EYS" "0000392515" "EYS" "0000392516" "EYS" "0000392518" "EYS" "0000392519" "EYS" "0000392520" "EYS" "0000392521" "EYS" "0000392523" "EYS" "0000392526" "EYS" "0000392527" "EYS" "0000392528" "EYS" "0000392529" "EYS" "0000392530" "EYS" "0000393613" "EYS" "0000393822" "EYS" "0000393825" "EYS" "0000393826" "EYS" "0000393830" "EYS" "0000393847" "EYS" "0000393849" "EYS" "0000393851" "EYS" "0000393899" "EYS" "0000393907" "EYS" "0000393908" "EYS" "0000393909" "EYS" "0000394742" "EYS" "0000394810" "EYS" "0000394817" "EYS" "0000394832" "EYS" "0000394838" "EYS" "0000394842" "EYS" "0000394849" "EYS" "0000394865" "EYS" "0000394934" "EYS" "0000394946" "EYS" "0000394948" "EYS" "0000394962" "EYS" "0000394995" "EYS" "0000395024" "EYS" "0000395053" "EYS" "0000395061" "EYS" "0000395073" "EYS" "0000395101" "EYS" "0000395117" "EYS" "0000395145" "EYS" "0000395150" "EYS" "0000395246" "EYS" "0000395566" "EYS" "0000395567" "EYS" "0000395801" "CNGB1" "0000395817" "EYS" "0000395818" "EYS" "0000395819" "EYS" "0000395820" "EYS" "0000395821" "EYS" "0000395822" "EYS" "0000395823" "EYS" "0000395824" "EYS" "0000395825" "EYS" "0000395826" "EYS" "0000395827" "EYS" "0000395828" "EYS" "0000395829" "EYS" "0000395830" "EYS" "0000395831" "EYS" "0000395832" "EYS" "0000395833" "EYS" "0000395834" "EYS" "0000395835" "EYS" "0000395836" "EYS" "0000395837" "EYS" "0000395838" "EYS" "0000395839" "EYS" "0000395840" "EYS" "0000395841" "EYS" "0000395842" "EYS" "0000395843" "EYS" "0000395844" "EYS" "0000396660" "EYS" "0000396661" "EYS" "0000396662" "EYS" "0000396815" "EYS" "0000397028" "EYS" "0000397030" "EYS" "0000397038" "EYS" "0000397050" "EYS" "0000397053" "EYS" "0000397056" "EYS" "0000397057" "EYS" "0000397071" "EYS" "0000397072" "EYS" "0000397073" "EYS" "0000397074" "EYS" "0000397076" "EYS" "0000397077" "EYS" "0000397078" "EYS" "0000397079" "EYS" "0000397084" "EYS" "0000397087" "EYS" "0000397123" "EYS" "0000397143" "EYS" "0000397152" "EYS" "0000397162" "EYS" "0000397168" "EYS" "0000397188" "EYS" "0000397203" "EYS" "0000397734" "EYS" "0000397735" "EYS" "0000397736" "EYS" "0000397738" "PDE6B" "0000397741" "EYS" "0000397743" "EYS" "0000397744" "EYS" "0000397746" "RP1L1" "0000397747" "PDE6B" "0000397748" "RPE65" "0000397749" "USH2A" "0000397757" "EYS" "0000397759" "PDE6A" "0000397760" "PRPF31" "0000397761" "EYS" "0000397762" "EYS" "0000397766" "RP1" "0000397767" "RPGR" "0000397777" "EYS" "0000397778" "EYS" "0000397783" "EYS" "0000397785" "EYS" "0000397795" "CNGA1" "0000397799" "EYS" "0000397805" "EYS" "0000397817" "CNGA1" "0000397821" "EYS" "0000397823" "EYS" "0000397825" "EYS" "0000397829" "EYS" "0000397831" "RP2" "0000397833" "USH2A" "0000397841" "SAG" "0000397845" "SNRNP200" "0000397847" "EYS" "0000397849" "EYS" "0000397851" "EYS" "0000397857" "PRPF31" "0000397865" "EYS" "0000397867" "EYS" "0000397873" "TULP1" "0000397874" "EYS" "0000397875" "EYS" "0000397881" "MAK" "0000397884" "USH2A" "0000397886" "FLVCR1" "0000397887" "RHO" "0000397888" "GUCY2D" "0000397894" "SNRNP200" "0000397895" "CNGA1" "0000397896" "ZNF408" "0000397897" "CLN3" "0000401326" "USH2A" "0000403501" "USH2A" "0000403510" "USH2A" "0000409672" "EYS" "0000409673" "EYS" "0000409697" "EYS" "0000409698" "EYS" "0000410260" "EYS" "0000410261" "EYS" "0000410765" "EYS" "0000410766" "EYS" "0000410768" "EYS" "0000410769" "EYS" "0000410770" "EYS" "0000410773" "EYS" "0000410774" "EYS" "0000410775" "EYS" "0000410776" "EYS" "0000410777" "EYS" "0000410778" "EYS" "0000410783" "EYS" "0000410784" "EYS" "0000410785" "EYS" "0000410786" "EYS" "0000410787" "EYS" "0000412233" "EYS" "0000412234" "EYS" "0000412235" "EYS" "0000412236" "EYS" "0000412237" "EYS" "0000412238" "EYS" "0000412239" "EYS" "0000412240" "EYS" "0000412241" "EYS" "0000412242" "EYS" "0000412243" "EYS" "0000412244" "EYS" "0000412245" "EYS" "0000412246" "EYS" "0000412247" "EYS" "0000412248" "EYS" "0000412249" "EYS" "0000412250" "EYS" "0000412251" "EYS" "0000412252" "EYS" "0000412253" "EYS" "0000412254" "EYS" "0000412255" "EYS" "0000412256" "EYS" "0000412257" "EYS" "0000412258" "EYS" "0000412259" "EYS" "0000412260" "EYS" "0000412261" "EYS" "0000412262" "EYS" "0000412263" "EYS" "0000412264" "EYS" "0000412265" "EYS" "0000412266" "EYS" "0000412267" "EYS" "0000412268" "EYS" "0000412269" "EYS" "0000412270" "EYS" "0000412271" "EYS" "0000412272" "EYS" "0000412273" "EYS" "0000415715" "EYS" "0000421176" "EYS" "0000421177" "EYS" "0000421178" "EYS" "0000421179" "EYS" "0000421180" "EYS" "0000421181" "EYS" "0000421182" "EYS" "0000421183" "EYS" "0000421184" "EYS" "0000421185" "EYS" "0000421186" "EYS" "0000421700" "EYS" "0000421704" "EYS" "0000421707" "EYS" "0000421716" "EYS" "0000421729" "EYS" "0000421752" "EYS" "0000421754" "EYS" "0000421759" "EYS" "0000421760" "EYS" "0000421785" "EYS" "0000421788" "EYS" "0000421808" "EYS" "0000421809" "EYS" "0000421814" "EYS" "0000421827" "EYS" "0000421851" "EYS" "0000421854" "EYS" "0000421857" "EYS" "0000421865" "EYS" "0000421872" "EYS" "0000421873" "EYS" "0000421879" "EYS" "0000421895" "EYS" "0000427208" "PRPF31" "0000428233" "KCNV2" "0000430909" "EYS" "0000430915" "EYS" "0000430925" "EYS" "0000430932" "EYS" "0000430942" "EYS" "0000430958" "EYS" "0000430961" "EYS" "0000430966" "EYS" "0000430967" "EYS" "0000430968" "EYS" "0000430971" "EYS" "0000430978" "EYS" "0000430979" "EYS" "0000430988" "EYS" "0000430989" "EYS" "0000430990" "EYS" "0000430993" "EYS" "0000430995" "EYS" "0000431005" "EYS" "0000431006" "EYS" "0000431010" "EYS" "0000431015" "EYS" "0000431037" "EYS" "0000431039" "EYS" "0000431086" "EYS" "0000431092" "EYS" "0000431096" "EYS" "0000431104" "EYS" "0000431130" "EYS" "0000431147" "EYS" "0000431150" "EYS" "0000431159" "EYS" "0000431184" "EYS" "0000431188" "EYS" "0000431214" "EYS" "0000431219" "EYS" "0000431264" "EYS" "0000431267" "EYS" "0000431317" "EYS" "0000431330" "EYS" "0000431334" "EYS" "0000431347" "EYS" "0000431354" "EYS" "0000431379" "EYS" "0000431391" "EYS" "0000431412" "EYS" "0000431439" "EYS" "0000431456" "EYS" "0000431465" "EYS" "0000431468" "EYS" "0000431480" "EYS" "0000431481" "EYS" "0000431486" "EYS" "0000431491" "EYS" "0000431502" "EYS" "0000431529" "EYS" "0000431531" "EYS" "0000437646" "EYS" "0000437902" "EYS" "0000437922" "EYS" "0000443144" "EYS" "0000443145" "EYS" "0000460619" "EYS" "0000460627" "EYS" "0000460628" "EYS" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 2692 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000036426" "3" "50" "6" "64498971" "64498971" "subst" "0.000742922" "00552" "EYS_000007" "g.64498971A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.63789078A>G" "" "VUS" "" "0000059881" "3" "55" "6" "65655758" "65655758" "subst" "0.00115297" "00229" "EYS_000001" "g.65655758T>G" "ExAC: 60, 19750, 0, 0.003038" "{PMID:Neveling 2012:22334370}" "" "Q770P" "" "Germline" "yes" "" "0" "" "" "g.64945865T>G" "" "VUS" "" "0000059883" "1" "11" "6" "65336143" "65336143" "subst" "0.224189" "00229" "EYS_000002" "g.65336143G>A" "ExAC: 3936, 19366, 441, 0.2032" "{PMID:Neveling 2012:22334370}" "" "p.?" "unaffected brother also this variant homozygous" "Germline" "no" "" "0" "" "" "g.64626250G>A" "" "benign" "" "0000059884" "1" "15" "6" "65300869" "65300869" "subst" "0.000837928" "00229" "EYS_000003" "g.65300869G>A" "ExAC: 12, 19406, 0, 0.0006184" "{PMID:Neveling 2012:22334370}" "" "(P1631S)" "predicted benign, disease-related variant in other gene" "Germline" "" "" "0" "" "" "g.64590976G>A" "" "benign" "" "0000059885" "1" "11" "6" "65016998" "65016999" "del" "0" "00229" "EYS_000004" "g.65016998_65016999del" "ExAC: 9866, 18292, 921, 0.5394" "{PMID:Neveling 2012:22334370}" "" "6045-4_6045-3del" "predicted benign" "Germline" "yes" "" "0" "" "" "g.64307105_64307106del" "" "benign" "" "0000059887" "2" "11" "6" "64488001" "64488001" "subst" "0.00556734" "00229" "EYS_000005" "g.64488001T>C" "ExAC: 150, 22014, 0, 0.006814" "{PMID:Neveling 2012:22334370}" "" "" "predicted benign, disease-related variant in other gene" "Germline" "" "" "0" "" "" "g.63778108T>C" "" "benign" "" "0000059888" "11" "90" "6" "66205272" "66205272" "dup" "0" "00039" "EYS_000006" "g.66205272dup" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.65495379dup" "" "pathogenic" "" "0000059889" "2" "90" "6" "66205272" "66205272" "dup" "0" "00039" "EYS_000006" "g.66205272dup" "" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Germline" "" "" "0" "" "" "g.65495379dup" "" "pathogenic" "" "0000066245" "0" "90" "6" "66063346" "66063346" "subst" "0.000513598" "01251" "EYS_000008" "g.66063346G>A" "" "{PMID:Glöckle 2014:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.65353453G>A" "" "pathogenic" "" "0000158321" "3" "90" "6" "64574120" "64574120" "subst" "3.33658E-5" "01769" "EYS_000009" "g.64574120C>G" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "" "" "g.63864227C>G" "" "pathogenic" "" "0000162807" "3" "90" "6" "65016917" "65016917" "subst" "0" "01769" "EYS_000010" "g.65016917C>T" "" "{PMID:Li 2017:28418496}" "" "" "" "Germline" "yes" "" "0" "needs Curator approval" "" "g.64307024C>T" "" "pathogenic" "" "0000170285" "0" "50" "6" "65300290" "65300290" "subst" "0" "01836" "EYS_000011" "g.65300290T>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.64590397T>G" "" "VUS" "" "0000170924" "0" "90" "6" "65655687" "65655687" "subst" "1.35212E-5" "01244" "EYS_000012" "g.65655687G>A" "" "{PMID:de Castro-Miró 2016:28005958}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64945794G>A" "" "pathogenic" "ACMG" "0000170936" "0" "90" "6" "66053930" "66417118" "" "0" "01244" "EYS_000013" "g.(66045040_66053930)_(66417118_?)del" "" "{PMID:de Castro-Miró 2016:28005958}" "" "deletion 10 initial exons" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000235528" "3" "99" "6" "65612315" "65612331" "del" "0" "01780" "EYS_000234" "g.65612315_65612331del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "D904QfsX17" "" "Germline" "yes" "" "0" "" "" "g.64902422_64902438del" "" "pathogenic" "" "0000235529" "3" "99" "6" "65612315" "65612331" "del" "0" "01780" "EYS_000234" "g.65612315_65612331del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "D904QfsX17" "" "Germline" "yes" "" "0" "" "" "g.64902422_64902438del" "" "pathogenic" "" "0000235530" "3" "99" "6" "65550600" "65706998" "del" "0" "01780" "EYS_000225" "g.65550600_65706998del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "S754AfsX6" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.64840707_64997105del" "" "pathogenic" "" "0000235531" "3" "99" "6" "65550600" "65706998" "del" "0" "01780" "EYS_000225" "g.65550600_65706998del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "S754AfsX6" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.64840707_64997105del" "" "pathogenic" "" "0000235532" "3" "99" "6" "65550600" "65706998" "del" "0" "01780" "EYS_000225" "g.65550600_65706998del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "S754AfsX6" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.64840707_64997105del" "" "pathogenic" "" "0000235533" "3" "99" "6" "66005808" "66005808" "del" "0" "01780" "EYS_000251" "g.66005808del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "T657TfsX5" "" "Germline" "yes" "" "0" "" "" "g.65295915del" "" "pathogenic" "" "0000235534" "3" "99" "6" "66005808" "66005808" "del" "0" "01780" "EYS_000251" "g.66005808del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "T657TfsX5" "" "Germline" "yes" "" "0" "" "" "g.65295915del" "" "pathogenic" "" "0000235535" "3" "99" "6" "66005808" "66005808" "del" "0" "01780" "EYS_000251" "g.66005808del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "T657TfsX5" "" "Germline" "yes" "" "0" "" "" "g.65295915del" "" "pathogenic" "" "0000235536" "0" "99" "6" "65767621" "66030608" "del" "0" "01780" "EYS_000247" "g.65767621_66030608del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "R589RfsX5" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.65057728_65320715del" "" "pathogenic" "" "0000235537" "0" "99" "6" "65146137" "65146137" "subst" "0" "01780" "EYS_000161" "g.65146137C>A" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "E1953X" "" "Germline" "yes" "" "0" "" "" "g.64436244C>A" "" "pathogenic" "" "0000235538" "0" "99" "6" "65767621" "66030608" "del" "0" "01780" "EYS_000247" "g.65767621_66030608del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "R589RfsX5" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.65057728_65320715del" "" "pathogenic" "" "0000235539" "0" "99" "6" "65146137" "65146137" "subst" "0" "01780" "EYS_000161" "g.65146137C>A" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "E1953X" "" "Germline" "yes" "" "0" "" "" "g.64436244C>A" "" "pathogenic" "" "0000235540" "0" "99" "6" "65767621" "66030608" "del" "0" "01780" "EYS_000247" "g.65767621_66030608del" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "R589RfsX5" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.65057728_65320715del" "" "pathogenic" "" "0000235541" "0" "99" "6" "65146137" "65146137" "subst" "0" "01780" "EYS_000161" "g.65146137C>A" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "E1953X" "" "Germline" "yes" "" "0" "" "" "g.64436244C>A" "" "pathogenic" "" "0000235542" "3" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "W2640X" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235543" "3" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Abd El-Aziz 2008:18836446}" "" "W2640X" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235544" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Collin 2008:18976725}" "" "p.Tyr3156X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235545" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Collin 2008:18976725}{PMID:Littink 2010:20554613}" "" "p.Tyr3156X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235546" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Collin 2008:18976725}" "" "p.Tyr3156X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235547" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Collin 2008:18976725}" "" "p.Tyr3156X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235548" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Collin 2008:18976725}" "" "p.Tyr3156X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235549" "3" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Collin 2008:18976725}" "" "p.Pro2238ProfsX16" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000235550" "21" "99" "6" "66094318" "66094318" "del" "0" "01780" "EYS_000272" "g.66094318del" "" "{PMID:Jinda 2014:24618324}" "" "1260_1260delG" "" "Germline" "yes" "" "0" "" "" "g.65384425del" "" "pathogenic" "" "0000235551" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Jinda 2014:24618324}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000235552" "3" "75" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Jinda 2014:24618324}" "" "" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000235553" "3" "99" "6" "64436538" "64436538" "subst" "0.000128328" "01780" "EYS_000090" "g.64436538C>A" "ExAC: 1, 19726, 0, 0.00005069" "{PMID:Jinda 2014:24618324}" "" "" "" "Germline" "" "" "0" "" "" "g.63726645C>A" "" "pathogenic (recessive)" "" "0000235554" "3" "99" "6" "64430633" "64430642" "del" "0" "01780" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Kimchi 2018:29276052}, {PMID:Beryozkin 2014:24474277}" "" "p.V3096Kfs*28" "" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic" "" "0000235555" "3" "99" "6" "64430633" "64430642" "del" "0" "01780" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Beryozkin 2014:24474277}, {PMID:Kimchi 2018:29276052}" "" "p.V3096Kfs*28" "" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic" "" "0000235556" "10" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235557" "21" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235558" "10" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235559" "21" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235560" "10" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235561" "21" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235562" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235563" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235564" "0" "55" "6" "66044874" "66044874" "subst" "8.18974E-5" "01780" "EYS_000256" "g.66044874T>C" "ExAC: 11, 120542, 0, 0.00009125" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.R589G" "" "Germline" "" "" "0" "" "" "g.65334981T>C" "" "VUS" "" "0000235565" "0" "99" "6" "64498056" "64498056" "subst" "0" "01780" "EYS_000107" "g.64498056G>C" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.Y2555X" "" "Germline" "" "" "0" "" "" "g.63788163G>C" "" "pathogenic" "" "0000235566" "3" "99" "6" "65523270" "65523270" "subst" "7.06245E-6" "01780" "EYS_000215" "g.65523270C>T" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "NA" "" "Germline" "" "" "0" "" "" "g.64813377C>T" "" "pathogenic" "" "0000235567" "0" "55" "6" "64574102" "64574102" "subst" "0.000184064" "01780" "EYS_000119" "g.64574102C>T" "ExAC: 9, 15944, 0, 0.0005645" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.R2402K" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63864209C>T" "" "VUS" "" "0000235568" "0" "55" "6" "64431498" "64431498" "subst" "0.000908445" "01780" "EYS_000074" "g.64431498G>A" "ExAC: 31, 22252, 0, 0.001393" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.T2831I" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721602G>A" "" "VUS" "" "0000235569" "0" "55" "6" "64430796" "64430796" "subst" "0" "01780" "EYS_000054" "g.64430796C>A" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.W3065L" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63720900C>A" "" "VUS" "" "0000235570" "0" "55" "6" "64487987" "64487987" "subst" "2.63671E-5" "01780" "EYS_000099" "g.64487987G>A" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.R2604C" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778094G>A" "" "VUS" "" "0000235571" "0" "55" "6" "64431498" "64431498" "subst" "0.000908445" "01780" "EYS_000074" "g.64431498G>A" "ExAC: 31, 22252, 0, 0.001393" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.T2831I" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721602G>A" "" "VUS" "" "0000235572" "0" "55" "6" "64472371" "64472371" "subst" "6.62989E-6" "01780" "EYS_000091" "g.64472371C>T" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "p.G2685E" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63762478C>T" "" "VUS" "" "0000235573" "0" "55" "6" "66094276" "66094276" "subst" "0" "01780" "EYS_000271" "g.66094276T>G" "" "{PMID:Abd El-Aziz 2010:20237254}" "" "NA" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65384383T>G" "" "VUS" "" "0000235574" "0" "99" "6" "66044965" "66044965" "subst" "0" "01780" "EYS_000258" "g.66044965C>T" "" "{PMID:Audo 2010:20333770}" "" "p.Trp558X" "" "Germline" "" "" "0" "" "" "g.65335072C>T" "" "pathogenic" "" "0000235575" "0" "55" "6" "65098684" "65098684" "subst" "0.00520568" "01780" "EYS_000156" "g.65098684T>C" "ExAC: 203, 19754, 13, 0.01028" "{PMID:Audo 2010:20333770}" "" "p.Thr1993Ala" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.64388791T>C" "" "VUS" "" "0000235576" "0" "55" "6" "64776324" "64776324" "subst" "0.000336941" "01780" "EYS_000139" "g.64776324G>A" "ExAC: 5, 21630, 0, 0.0002312" "{PMID:Audo 2010:20333770}" "" "p.Ser2211Leu" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.64066431G>A" "" "VUS" "" "0000235577" "0" "33" "6" "64574224" "64574224" "subst" "6.61559E-6" "01780" "EYS_000124" "g.64574224A>G" "" "{PMID:Audo 2010:20333770}" "" "p.Cys2361Cys" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.63864331A>G" "" "likely benign" "" "0000235578" "0" "99" "6" "65532705" "65532705" "subst" "2.00682E-5" "01780" "EYS_000224" "g.65532705A>T" "" "{PMID:Audo 2010:20333770}" "" "p.Cys1001X" "" "Germline" "" "" "0" "" "" "g.64822812A>T" "" "pathogenic" "" "0000235579" "0" "99" "6" "66204555" "66205887" "del" "0" "01780" "EYS_000042" "g.(66200601_66204555)_(66205887_66349670)del" "" "{PMID:Pieras 2011:21519034}" "" "c.-340-?_748+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235580" "3" "99" "6" "65149058" "65149058" "del" "0" "01780" "EYS_000162" "g.65149058del" "ExAC: 2, 14660, 0, 0.0001364" "{PMID:Audo 2010:20333770}" "" "p.Lys1945SerfsX42" "" "Germline" "yes" "" "0" "" "" "g.64439165del" "" "pathogenic" "" "0000235581" "3" "99" "6" "65149058" "65149058" "del" "0" "01780" "EYS_000162" "g.65149058del" "ExAC: 2, 14660, 0, 0.0001364" "{PMID:Audo 2010:20333770}" "" "p.Lys1945SerfsX42" "" "Germline" "yes" "" "0" "" "" "g.64439165del" "" "pathogenic" "" "0000235582" "0" "99" "6" "65336015" "65336015" "del" "0" "01780" "EYS_000211" "g.65336015del" "ExAC: 2, 14660, 0, 0.0001364" "{PMID:Audo 2010:20333770}" "" "p.Gly1190AspfsX39" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64626122del" "" "pathogenic" "" "0000235583" "0" "99" "6" "66044997" "66044997" "subst" "0" "01780" "EYS_000262" "g.66044997G>A" "" "{PMID:Audo 2010:20333770}" "" "p.Gln548X" "" "Germline" "" "" "0" "" "" "g.65335104G>A" "" "pathogenic" "" "0000235584" "0" "93" "6" "66005927" "66005927" "subst" "0.000112112" "01780" "EYS_000253" "g.66005927C>T" "ExAC: 4, 22360, 0, 0.0001789" "{PMID:Audo 2010:20333770}" "" "p.Gly618Ser" "" "Germline" "" "" "0" "" "" "g.65296034C>T" "" "pathogenic" "" "0000235585" "0" "55" "6" "66115146" "66115146" "subst" "0.00181254" "01780" "EYS_000277" "g.66115146C>T" "ExAC: 224, 121232, 0, 0.001848" "{PMID:Audo 2010:20333770}" "" "p.Ser326Asn" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.65405253C>T" "" "VUS" "" "0000235586" "0" "55" "6" "66205023" "66205023" "subst" "0.00114688" "01780" "EYS_000293" "g.66205023G>T" "ExAC: 169, 121294, 2, 0.001393" "{PMID:Audo 2010:20333770}" "" "p.Pro94Gln" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.65495130G>T" "" "VUS" "" "0000235587" "0" "99" "6" "64431578" "64431578" "subst" "0" "01780" "EYS_000081" "g.64431578C>T" "" "{PMID:Audo 2010:20333770}" "" "p.Trp2783X" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721682C>T" "" "pathogenic" "" "0000235588" "21" "99" "6" "65300509" "65300509" "subst" "0" "01780" "EYS_000052" "g.65300509G>A" "" "{PMID:Audo 2010:20333770}" "" "Gln1751X Tyr3059X" "" "Germline" "yes" "" "0" "" "" "g.64590616G>A" "" "pathogenic" "" "0000235589" "11" "99" "6" "65300501" "65300501" "subst" "0" "01780" "EYS_000175" "g.65300501A>T" "" "{PMID:Audo 2010:20333770}" "" "p.Tyr1753X" "" "Germline" "yes" "" "0" "" "" "g.64590608A>T" "" "pathogenic" "" "0000235590" "21" "99" "6" "65300509" "65300509" "subst" "0" "01780" "EYS_000052" "g.65300509G>A" "" "{PMID:Audo 2010:20333770}" "" "Gln1751X + Tyr3059X" "" "Germline" "yes" "" "0" "" "" "g.64590616G>A" "" "pathogenic" "" "0000235591" "11" "99" "6" "65300501" "65300501" "subst" "0" "01780" "EYS_000175" "g.65300501A>T" "" "{PMID:Audo 2010:20333770}" "" "p.Tyr1753X" "" "Germline" "yes" "" "0" "" "" "g.64590608A>T" "" "pathogenic" "" "0000235592" "0" "99" "6" "66204760" "66204760" "del" "0" "01780" "EYS_000286" "g.66204760del" "" "{PMID:Audo 2010:20333770}" "" "p.Cys183AlafsX74" "" "Germline" "yes" "" "0" "" "" "g.65494867del" "" "pathogenic" "" "0000235593" "0" "99" "6" "66063350" "66063511" "del" "0" "01780" "EYS_000034" "g.(66054071_66063350)_(66063511_66094278)del" "" "{PMID:Pieras 2011:21519034}" "" "p.?" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000235594" "0" "99" "6" "66204760" "66204760" "del" "0" "01780" "EYS_000286" "g.66204760del" "" "{PMID:Audo 2010:20333770}" "" "p.Cys183AlafsX74" "" "Germline" "yes" "" "0" "" "" "g.65494867del" "" "pathogenic" "" "0000235595" "0" "99" "6" "66063350" "66063511" "del" "0" "01780" "EYS_000034" "g.(66054071_66063350)_(66063511_66094278)del" "" "{PMID:Pieras 2011:21519034}" "" "p.?" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000235596" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2010:20333770}" "" "p.Asn137ValfsX24" "" "Germline" "" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235597" "11" "99" "6" "64430815" "64430816" "del" "0" "01780" "EYS_000055" "g.64430815_64430816del" "" "{PMID:Audo 2010:20333770}" "" "p.Thr3038IlefsX4" "" "Germline" "yes" "" "0" "" "" "g.63720919_63720920del" "" "pathogenic" "" "0000235598" "21" "99" "6" "64430564" "64430564" "dup" "0" "01780" "EYS_000043" "g.64430564dup" "" "{PMID:Audo 2010:20333770}" "" "p.Asn3123LysfsX3" "" "Germline" "yes" "" "0" "" "" "g.63720668dup" "" "pathogenic" "" "0000235599" "11" "99" "6" "64430815" "64430816" "del" "0" "01780" "EYS_000055" "g.64430815_64430816del" "" "{PMID:Audo 2010:20333770}" "" "p.Thr3038IlefsX4" "" "Germline" "yes" "" "0" "" "" "g.63720919_63720920del" "" "pathogenic" "" "0000235600" "21" "99" "6" "64430564" "64430564" "dup" "0" "01780" "EYS_000043" "g.64430564dup" "" "{PMID:Audo 2010:20333770}" "" "p.Asn3123LysfsX3" "" "Germline" "yes" "" "0" "" "" "g.63720668dup" "" "pathogenic" "" "0000235601" "0" "99" "6" "64709009" "64709009" "del" "0" "01780" "EYS_000135" "g.64709009del" "ExAC: 9, 22488, 0, 0.0004002" "{PMID:Audo 2010:20333770}" "" "p.Pro2265GlnfsX46" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63999116del" "" "pathogenic" "" "0000235602" "0" "99" "6" "65300932" "65300935" "del" "0" "01780" "EYS_000190" "g.65300932_65300935del" "" "{PMID:Audo 2010:20333770}" "" "p.Ser1610PhefsX7" "" "Germline" "yes" "" "0" "" "" "g.64591039_64591042del" "" "pathogenic" "" "0000235603" "0" "99" "6" "64776230" "64776385" "del" "0" "01780" "EYS_000039" "g.(64709077_64776230)_(64776385_64791748)del" "" "{PMID:Pieras 2011:21519034}" "" "c.6572-?_6725+?del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000235604" "3" "99" "6" "66005755" "66006013" "del" "0" "01780" "EYS_000035" "g.(65767621_66005755)_(66006013_66044872)del" "" "{PMID:Audo 2010:20333770}" "" "p.Cys590TyrfsX4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235605" "3" "99" "6" "64776230" "64791896" "del" "0" "01780" "EYS_000040" "g.(64709077_64776230)_(64791896_64940484)del" "" "{PMID:Audo 2010:20333770}" "" "p.Asp2142AlafsX14" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235606" "3" "99" "6" "64776230" "64791896" "del" "0" "01780" "EYS_000040" "g.(64709077_64776230)_(64791896_64940484)del" "" "{PMID:Audo 2010:20333770}" "" "p.Asp2142AlafsX14" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235607" "0" "55" "6" "65532536" "65532536" "dup" "0" "01780" "EYS_000222" "g.65532536dup" "ExAC: 96, 20786, 2, 0.004618" "{PMID:Audo 2010:20333770}" "" "Splice defect?" "" "Germline" "" "" "0" "" "" "g.64822643dup" "" "VUS" "" "0000235608" "0" "55" "6" "65300716" "65300716" "subst" "0.00226467" "01780" "EYS_000183" "g.65300716C>A" "ExAC: 78, 19466, 4, 0.004007" "{PMID:Audo 2010:20333770}" "" "p.Asp1682Tyr" "" "Germline" "" "" "0" "" "" "g.64590823C>A" "" "VUS" "" "0000235609" "0" "55" "6" "65303193" "65303193" "subst" "0.000159674" "01780" "EYS_000209" "g.65303193T>A" "ExAC: 6, 21712, 0, 0.0002763" "{PMID:Audo 2010:20333770}" "" "p.Ile1232Phe" "" "Germline" "" "" "0" "" "" "g.64593300T>A" "" "VUS" "" "0000235610" "0" "55" "6" "65300156" "65300156" "subst" "0" "01780" "EYS_000167" "g.65300156T>A" "" "{PMID:Audo 2010:20333770}" "" "p.Ser1868Ser" "" "Germline" "" "" "0" "" "" "g.64590263T>A" "" "VUS" "" "0000235611" "0" "55" "6" "65300155" "65300155" "subst" "0" "01780" "EYS_000166" "g.65300155G>T" "" "{PMID:Audo 2010:20333770}" "" "p.Leu1869Met" "" "Germline" "" "" "0" "" "" "g.64590262G>T" "" "VUS" "" "0000235612" "0" "55" "6" "66115146" "66115146" "subst" "0.00181254" "01780" "EYS_000277" "g.66115146C>T" "ExAC: 224, 121232, 0, 0.001848" "{PMID:Audo 2010:20333770}" "" "p.Ser326Asn" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.65405253C>T" "" "VUS" "" "0000235613" "0" "55" "6" "65300716" "65300716" "subst" "0.00226467" "01780" "EYS_000183" "g.65300716C>A" "ExAC: 78, 19466, 4, 0.004007" "{PMID:Audo 2010:20333770}" "" "p.Asp1682Tyr" "" "Germline" "" "" "0" "" "" "g.64590823C>A" "" "VUS" "" "0000235614" "0" "33" "6" "65612113" "65612113" "subst" "0.0051041" "01780" "EYS_000233" "g.65612113C>T" "ExAC: 195, 21626, 7, 0.009017" "{PMID:Audo 2010:20333770}" "" "p.Arg913Arg/splice site" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.64902220C>T" "" "likely benign" "" "0000235615" "0" "33" "6" "64694476" "64694476" "subst" "5.97356E-5" "01780" "EYS_000133" "g.64694476G>A" "ExAC: 2, 21698, 0, 0.00009217" "{PMID:Audo 2010:20333770}" "" "p.Phe2285Phe" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.63984583G>A" "" "likely benign" "" "0000235616" "0" "55" "6" "64791754" "64791754" "subst" "0" "01780" "EYS_000142" "g.64791754A>G" "" "{PMID:Audo 2010:20333770}" "" "p.Leu2189Pro" "" "Germline" "" "" "0" "" "" "g.64081861A>G" "" "VUS" "" "0000235617" "0" "55" "6" "64436439" "64436439" "subst" "6.75521E-6" "01780" "EYS_000087" "g.64436439C>G" "" "{PMID:Audo 2010:20333770}" "" "p.Ala2736Pro" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.63726546C>G" "" "VUS" "" "0000235618" "0" "55" "6" "65098702" "65098702" "subst" "6.99203E-6" "01780" "EYS_000157" "g.65098702T>G" "" "{PMID:Audo 2010:20333770}" "" "p.Thr1987Pro" "" "Germline" "" "" "0" "" "" "g.64388809T>G" "" "VUS" "" "0000235619" "0" "55" "6" "64431258" "64431258" "subst" "0" "01780" "EYS_000070" "g.64431258C>T" "" "{PMID:Audo 2010:20333770}" "" "p.Cys2890Tyr" "" "Germline" "" "" "0" "" "" "g.63721362C>T" "" "VUS" "" "0000235620" "0" "55" "6" "64776324" "64776324" "subst" "0.000336941" "01780" "EYS_000139" "g.64776324G>A" "ExAC: 5, 21630, 0, 0.0002312" "{PMID:Audo 2010:20333770}" "" "p.Ser2211Leu" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.64066431G>A" "" "VUS" "" "0000235621" "0" "55" "6" "64431207" "64431207" "subst" "0" "01780" "EYS_000068" "g.64431207C>T" "" "{PMID:Audo 2010:20333770}" "" "p.Gly2907Glu" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721311C>T" "" "VUS" "" "0000235622" "0" "55" "6" "65336056" "65336056" "subst" "0" "01780" "EYS_000213" "g.65336056A>G" "" "{PMID:Audo 2010:20333770}" "" "p.Cys1176Arg" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64626163A>G" "" "VUS" "" "0000235623" "0" "55" "6" "66204550" "66204550" "subst" "0.000185678" "01780" "EYS_000283" "g.66204550T>A" "ExAC: 10, 19780, 0, 0.0005056" "{PMID:Audo 2010:20333770}" "" "unclear" "" "Germline" "" "" "0" "" "" "g.65494657T>A" "" "VUS" "" "0000235624" "0" "55" "6" "65300520" "65300520" "subst" "0.000182014" "01780" "EYS_000177" "g.65300520T>C" "ExAC: 6, 19676, 0, 0.0003049" "{PMID:Audo 2010:20333770}" "" "p.Glu1747Gly" "" "Germline" "" "" "0" "" "" "g.64590627T>C" "" "VUS" "" "0000235625" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Audo 2010:20333770}" "" "p.Cy2139Tyr" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235626" "0" "55" "6" "64431505" "64431505" "subst" "0.00511138" "01780" "EYS_000075" "g.64431505C>T" "ExAC: 218, 22186, 3, 0.009826" "{PMID:Audo 2010:20333770}" "" "p.Ala2808Thr" "" "Germline" "" "" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000235627" "0" "55" "6" "65523385" "65523385" "subst" "0.000498683" "01780" "EYS_000217" "g.65523385G>C" "ExAC: 20, 21082, 0, 0.0009487" "{PMID:Audo 2010:20333770}" "" "p.Thr1110Ser" "" "Germline" "" "" "0" "" "" "g.64813492G>C" "" "VUS" "" "0000235628" "0" "55" "6" "65300716" "65300716" "subst" "0.00226467" "01780" "EYS_000183" "g.65300716C>A" "ExAC: 78, 19466, 4, 0.004007" "{PMID:Audo 2010:20333770}" "" "p.Asp1682Tyr" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590823C>A" "" "VUS" "" "0000235629" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Audo 2010:20333770}" "" "p.Cy2139Tyr" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235630" "0" "55" "6" "65596736" "65596736" "subst" "7.79751E-6" "01780" "EYS_000230" "g.65596736C>A" "" "{PMID:Audo 2010:20333770}" "" "Splice defect?" "" "Germline" "" "" "0" "" "" "g.64886843C>A" "" "VUS" "" "0000235631" "0" "55" "6" "66005755" "66005755" "subst" "0" "01780" "EYS_000249" "g.66005755C>G" "" "{PMID:Audo 2010:20333770}" "" "Splicedefect?" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65295862C>G" "" "VUS" "" "0000235632" "0" "55" "6" "65707500" "65707500" "subst" "0.000801619" "01780" "EYS_000243" "g.65707500T>C" "ExAC: 12, 22320, 0, 0.0005376" "{PMID:Audo 2010:20333770}" "" "p.Asn745Ser" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64997607T>C" "" "VUS" "" "0000235633" "0" "55" "6" "65146108" "65146108" "subst" "0" "01780" "EYS_000159" "g.65146108A>G" "" "{PMID:Audo 2010:20333770}" "" "p.Thr1962Thr,Splice defect?" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64436215A>G" "" "VUS" "" "0000235634" "0" "11" "6" "65336093" "65336093" "subst" "0.000682801" "01780" "EYS_000214" "g.65336093A>T" "ExAC: 7, 19508, 0, 0.0003588" "{PMID:Audo 2010:20333770}" "" "p.Asn1163Lys" "unlikely pathogenic according to authors, not found in affected sibling; unknown variant 2nd allele" "Germline" "no" "" "0" "" "" "g.64626200A>T" "" "benign" "" "0000235635" "0" "11" "6" "65336093" "65336093" "subst" "0.000682801" "01780" "EYS_000214" "g.65336093A>T" "ExAC: 7, 19508, 0, 0.0003588" "{PMID:Audo 2010:20333770}" "" "p.Asn1163Lys" "unlikely pathogenic according to authors, not found in affected sibling; unknown variant 2nd allele" "Germline" "no" "" "0" "" "" "g.64626200A>T" "" "benign" "" "0000235636" "0" "33" "6" "64488060" "64488060" "subst" "0.00143504" "01780" "EYS_000102" "g.64488060A>G" "ExAC: 23, 22032, 0, 0.001044" "{PMID:Audo 2010:20333770}" "" "p.Thr2579Thr" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778167A>G" "" "likely benign" "" "0000235637" "0" "33" "6" "64488060" "64488060" "subst" "0.00143504" "01780" "EYS_000102" "g.64488060A>G" "ExAC: 23, 22032, 0, 0.001044" "{PMID:Audo 2010:20333770}" "" "p.Thr2579Thr" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778167A>G" "" "likely benign" "" "0000235638" "0" "55" "6" "64488001" "64488001" "subst" "0.00556734" "01780" "EYS_000005" "g.64488001T>C" "ExAC: 150, 22014, 0, 0.006814" "{PMID:Audo 2010:20333770}" "" "p.His2599Arg" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778108T>C" "" "VUS" "" "0000235639" "0" "55" "6" "64488001" "64488001" "subst" "0.00556734" "01780" "EYS_000005" "g.64488001T>C" "ExAC: 150, 22014, 0, 0.006814" "{PMID:Audo 2010:20333770}" "" "p.His2599Arg" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778108T>C" "" "VUS" "" "0000235640" "0" "55" "6" "64488001" "64488001" "subst" "0.00556734" "01780" "EYS_000005" "g.64488001T>C" "ExAC: 150, 22014, 0, 0.006814" "{PMID:Audo 2010:20333770}" "" "p.His2599Arg" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778108T>C" "" "VUS" "" "0000235641" "0" "55" "6" "64488001" "64488001" "subst" "0.00556734" "01780" "EYS_000005" "g.64488001T>C" "ExAC: 150, 22014, 0, 0.006814" "{PMID:Audo 2010:20333770}" "" "p.His2599Arg" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778108T>C" "" "VUS" "" "0000235642" "0" "55" "6" "65016935" "65016935" "subst" "0.00172722" "01780" "EYS_000152" "g.65016935A>T" "ExAC: 38, 19604, 0, 0.001938" "{PMID:Audo 2010:20333770}" "" "p.Val2040Asp" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64307042A>T" "" "VUS" "" "0000235643" "0" "55" "6" "65016935" "65016935" "subst" "0.00172722" "01780" "EYS_000152" "g.65016935A>T" "ExAC: 38, 19604, 0, 0.001938" "{PMID:Audo 2010:20333770}" "" "p.Val2040Asp" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64307042A>T" "" "VUS" "" "0000235644" "0" "55" "6" "65016935" "65016935" "subst" "0.00172722" "01780" "EYS_000152" "g.65016935A>T" "ExAC: 38, 19604, 0, 0.001938" "{PMID:Audo 2010:20333770}" "" "p.Val2040Asp" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64307042A>T" "" "VUS" "" "0000235645" "0" "55" "6" "65098684" "65098684" "subst" "0.00520568" "01780" "EYS_000156" "g.65098684T>C" "ExAC: 203, 19754, 13, 0.01028" "{PMID:Audo 2010:20333770}" "" "p.Thr1993Ala" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64388791T>C" "" "VUS" "" "0000235646" "0" "55" "6" "65098684" "65098684" "subst" "0.00520568" "01780" "EYS_000156" "g.65098684T>C" "ExAC: 203, 19754, 13, 0.01028" "{PMID:Audo 2010:20333770}" "" "p.Thr1993Ala" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64388791T>C" "" "VUS" "" "0000235647" "0" "55" "6" "65098666" "65098666" "subst" "4.78953E-5" "01780" "EYS_000155" "g.65098666T>C" "" "{PMID:Audo 2010:20333770}" "" "p.Ile1999Val" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64388773T>C" "" "VUS" "" "0000235648" "0" "55" "6" "66044987" "66044987" "subst" "0" "01780" "EYS_000260" "g.66044987C>A" "" "{PMID:Audo 2010:20333770}" "" "p.Arg551Leu" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65335094C>A" "" "VUS" "" "0000235649" "0" "33" "6" "65622518" "65622518" "subst" "0.000524304" "01780" "EYS_000240" "g.65622518C>T" "ExAC: 23, 21450, 0, 0.001072" "{PMID:Audo 2010:20333770}" "" "p.Val834Ile" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.64912625C>T" "" "likely benign" "" "0000235650" "0" "33" "6" "65612113" "65612113" "subst" "0.0051041" "01780" "EYS_000233" "g.65612113C>T" "ExAC: 195, 21626, 7, 0.009017" "{PMID:Audo 2010:20333770}" "" "p.Arg913Arg/splice site" "unlikely pathogenic according to authors" "Germline" "" "" "0" "" "" "g.64902220C>T" "" "likely benign" "" "0000235651" "0" "33" "6" "65612113" "65612113" "subst" "0.0051041" "01780" "EYS_000233" "g.65612113C>T" "ExAC: 195, 21626, 7, 0.009017" "{PMID:Audo 2010:20333770}" "" "p.Arg913Arg/splice site" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64902220C>T" "" "likely benign" "" "0000235652" "0" "33" "6" "65612113" "65612113" "subst" "0.0051041" "01780" "EYS_000233" "g.65612113C>T" "ExAC: 195, 21626, 7, 0.009017" "{PMID:Audo 2010:20333770}" "" "p.Arg913Arg/splice site" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64902220C>T" "" "likely benign" "" "0000235653" "0" "33" "6" "65612113" "65612113" "subst" "0.0051041" "01780" "EYS_000233" "g.65612113C>T" "ExAC: 195, 21626, 7, 0.009017" "{PMID:Audo 2010:20333770}" "" "p.Arg913Arg/splice site" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64902220C>T" "" "likely benign" "" "0000235654" "0" "55" "6" "65300544" "65300544" "subst" "0" "01780" "EYS_000178" "g.65300544G>A" "" "{PMID:Audo 2010:20333770}" "" "p.Pro1739Leu" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590651G>A" "" "VUS" "" "0000235655" "0" "55" "6" "65149147" "65149147" "subst" "0" "01780" "EYS_000163" "g.65149147T>A" "" "{PMID:Audo 2010:20333770}" "" "p.Ser1915Gly" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64439254T>A" "" "VUS" "" "0000235656" "0" "55" "6" "64431498" "64431498" "subst" "0.000908445" "01780" "EYS_000074" "g.64431498G>A" "ExAC: 31, 22252, 0, 0.001393" "{PMID:Audo 2010:20333770}" "" "p.Thr2810Ile" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721602G>A" "" "VUS" "" "0000235657" "0" "55" "6" "65300775" "65300775" "subst" "0.00211957" "01780" "EYS_000186" "g.65300775T>A" "ExAC: 39, 19306, 0, 0.002020" "{PMID:Audo 2010:20333770}" "" "p.Asp1662Val" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590882T>A" "" "VUS" "" "0000235658" "0" "55" "6" "65300250" "65300250" "subst" "0.00399083" "01780" "EYS_000168" "g.65300250C>G" "ExAC: 96, 19740, 1, 0.004863" "{PMID:Audo 2010:20333770}" "" "p.Trp1837Ser" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590357C>G" "" "VUS" "" "0000235659" "0" "55" "6" "64776324" "64776324" "subst" "0.000336941" "01780" "EYS_000139" "g.64776324G>A" "ExAC: 5, 21630, 0, 0.0002312" "{PMID:Audo 2010:20333770}" "" "p.Ser2211Leu" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64066431G>A" "" "VUS" "" "0000235660" "0" "55" "6" "64436439" "64436439" "subst" "6.75521E-6" "01780" "EYS_000087" "g.64436439C>G" "" "{PMID:Audo 2010:20333770}" "" "p.Ala2736Pro" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63726546C>G" "" "VUS" "" "0000235661" "0" "33" "6" "66200572" "66200572" "subst" "0.00273695" "01780" "EYS_000282" "g.66200572C>T" "ExAC: 417, 119800, 13, 0.003481" "{PMID:Audo 2010:20333770}" "" "p.Gln259Gln" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65490679C>T" "" "likely benign" "" "0000235662" "0" "33" "6" "64776311" "64776311" "subst" "0.000171407" "01780" "EYS_000138" "g.64776311C>A" "ExAC: 5, 21912, 0, 0.0002282" "{PMID:Audo 2010:20333770}" "" "p.Gly2215Gly" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64066418C>A" "" "likely benign" "" "0000235663" "0" "33" "6" "64574125" "64574125" "subst" "0" "01780" "EYS_000121" "g.64574125A>G" "" "{PMID:Audo 2010:20333770}" "" "p.Ile2394Ile" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63864232A>G" "" "likely benign" "" "0000235664" "0" "33" "6" "65300384" "65300384" "subst" "4.73485E-5" "01780" "EYS_000172" "g.65300384T>C" "" "{PMID:Audo 2010:20333770}" "" "p.Ala1792Ala" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590491T>C" "" "likely benign" "" "0000235665" "0" "33" "6" "64498113" "64498113" "subst" "0.000153428" "01780" "EYS_000109" "g.64498113G>A" "ExAC: 1, 21638, 0, 0.00004621" "{PMID:Audo 2010:20333770}" "" "p.Ile2536Ile" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63788220G>A" "" "likely benign" "" "0000235666" "0" "33" "6" "64431215" "64431215" "subst" "0" "01780" "EYS_000069" "g.64431215A>G" "" "{PMID:Audo 2010:20333770}" "" "p.Asp2904Asp" "unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721319A>G" "" "likely benign" "" "0000235667" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235668" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235669" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235670" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235671" "3" "99" "6" "65301398" "65301399" "del" "0" "01780" "EYS_000025" "g.65301398_65301399delinsCT" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "4361_4362CC>AG Ser1454X" "" "Germline" "" "" "0" "" "" "g.64591505_64591506delinsCT" "" "pathogenic" "" "0000235672" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235673" "0" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235674" "0" "99" "6" "66094373" "66094373" "dup" "0" "01780" "EYS_000273" "g.66094373dup" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "p.Asn404LysfsX2" "" "Germline" "" "" "0" "" "" "g.65384480dup" "" "pathogenic" "" "0000235675" "3" "99" "6" "64436492" "64436493" "del" "0" "01780" "EYS_000088" "g.64436492_64436493del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "p.His2719TyrfsX27" "" "Germline" "" "" "0" "" "" "g.63726599_63726600del" "" "pathogenic" "" "0000235676" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235677" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235678" "3" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235679" "0" "99" "6" "65303172" "65303172" "subst" "0" "01780" "EYS_000207" "g.65303172C>A" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "p.Glu1239X" "" "Germline" "" "" "0" "" "" "g.64593279C>A" "" "pathogenic" "" "0000235680" "0" "99" "6" "64436492" "64436493" "del" "0" "01780" "EYS_000088" "g.64436492_64436493del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "p.His2719TyrfsX27" "" "Germline" "" "" "0" "" "" "g.63726599_63726600del" "" "pathogenic" "" "0000235681" "21" "99" "6" "66204898" "66204901" "delins" "0" "01780" "EYS_000290" "g.66204898_66204901delinsAAG" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65495005_65495008delinsAAG" "" "pathogenic" "" "0000235682" "11" "99" "6" "64436492" "64436493" "del" "0" "01780" "EYS_000088" "g.64436492_64436493del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "p.His2719TyrfsX27" "" "Germline" "yes" "" "0" "" "" "g.63726599_63726600del" "" "pathogenic" "" "0000235683" "3" "99" "6" "66044995" "66044995" "del" "0" "01780" "EYS_000261" "g.66044995del" "" "{PMID:Littink 2010:20537394}" "" "p.Q548QfsX60" "" "Germline" "" "" "0" "" "" "g.65335102del" "" "pathogenic" "" "0000235684" "0" "99" "6" "66044995" "66044995" "del" "0" "01780" "EYS_000261" "g.66044995del" "" "{PMID:Littink 2010:20537394}" "" "p.Q548QfsX60" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65335102del" "" "pathogenic" "" "0000235685" "3" "99" "6" "66044995" "66044995" "del" "0" "01780" "EYS_000261" "g.66044995del" "" "{PMID:Littink 2010:20537394}" "" "p.Q548QfsX60" "" "Germline" "" "" "0" "" "" "g.65335102del" "" "pathogenic" "" "0000235686" "0" "99" "6" "66044966" "66044966" "subst" "0.000118405" "01780" "EYS_000259" "g.66044966C>T" "ExAC: 12, 120782, 0, 0.00009935" "{PMID:Littink 2010:20537394}" "" "p.W558X" "" "Germline" "yes" "" "0" "" "" "g.65335073C>T" "" "pathogenic" "" "0000235687" "0" "99" "6" "65612041" "65612041" "subst" "1.34589E-5" "01780" "EYS_000232" "g.65612041G>T" "" "{PMID:Littink 2010:20537394}" "" "p.C937X" "" "Germline" "yes" "" "0" "" "" "g.64902148G>T" "" "pathogenic" "" "0000235688" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Littink 2010:20537394}" "" "p.K1450KfsX3" "" "Germline" "yes" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235689" "0" "99" "6" "64431273" "64431280" "del" "0" "01780" "EYS_000071" "g.64431273_64431280del" "ExAC: 10, 22498, 0, 0.0004445" "{PMID:Littink 2010:20537394}" "" "p.T2904KfsX4" "" "Germline" "yes" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "" "0000235690" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Littink 2010:20537394}" "" "p.K1450KfsX3" "" "Germline" "yes" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235691" "0" "99" "6" "64431273" "64431280" "del" "0" "01780" "EYS_000071" "g.64431273_64431280del" "ExAC: 10, 22498, 0, 0.0004445" "{PMID:Littink 2010:20537394}" "" "p.T2904KfsX4" "" "Germline" "yes" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "" "0000235692" "3" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Littink 2010:20537394}" "" "p.K1450KfsX3" "" "Germline" "yes" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235693" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Littink 2010:20537394}" "" "p.K1450KfsX3" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235694" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Littink 2010:20537394}" "" "p.K1450KfsX3" "Mutation in EYS is not causative in this patient; unlikely pathogenic according to authors; unknown variant 2nd allele" "Germline" "no" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235695" "0" "99" "6" "65301048" "65301048" "subst" "0" "01780" "EYS_000192" "g.65301048G>C" "" "{PMID:Littink 2010:20537394}" "" "p.S1571X" "" "Germline" "" "" "0" "" "" "g.64591155G>C" "" "pathogenic" "" "0000235696" "0" "99" "6" "64709009" "64709009" "del" "0" "01780" "EYS_000135" "g.64709009del" "ExAC: 9, 22488, 0, 0.0004002" "{PMID:Littink 2010:20537394}" "" "p.P2265QfsX46" "" "Germline" "" "" "0" "" "" "g.63999116del" "" "pathogenic" "" "0000235697" "0" "73" "6" "65622518" "65622518" "subst" "0.000524304" "01780" "EYS_000240" "g.65622518C>T" "" "{PMID:Littink 2010:20537394}" "" "p.V834I" "" "Germline" "" "" "0" "" "" "g.64912625C>T" "" "likely pathogenic" "" "0000235698" "0" "99" "6" "66204555" "66205887" "del" "0" "01780" "EYS_000024" "g.(66200601_66204555)_(66205887_66417027)del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235699" "3" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Littink 2010:20537394}" "" "p.P2238PfsX16" "" "Germline" "yes" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000235700" "3" "99" "6" "64709003" "64709004" "del" "0" "01780" "EYS_000134" "g.64709003_64709004del" "" "{PMID:Littink 2010:20537394}" "" "p.Q2267EfsX15" "" "Germline" "yes" "" "0" "" "" "g.63999110_63999111del" "" "pathogenic" "" "0000235701" "3" "99" "6" "64709003" "64709004" "del" "0" "01780" "EYS_000134" "g.64709003_64709004del" "" "{PMID:Littink 2010:20537394}" "" "p.Q2267EfsX15" "" "Germline" "yes" "" "0" "" "" "g.63999110_63999111del" "" "pathogenic" "" "0000235702" "0" "99" "6" "64574212" "64574212" "subst" "1.97881E-5" "01780" "EYS_000123" "g.64574212A>C" "ExAC: 1, 21822, 0, 0.00004583" "{PMID:Littink 2010:20537394}" "" "p.Y2365X" "" "Germline" "yes" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000235703" "0" "99" "6" "64430943" "64430943" "subst" "6.59822E-6" "01780" "EYS_000060" "g.64430943A>T" "" "{PMID:Littink 2010:20537394}" "" "p.I3016N" "" "Germline" "yes" "" "0" "" "" "g.63721047A>T" "" "pathogenic" "" "0000235704" "0" "55" "6" "65301490" "65301490" "subst" "1.35093E-5" "01780" "EYS_000201" "g.65301490T>C" "" "{PMID:Littink 2010:20537394}" "" "p.T1424A" "" "Germline" "" "" "0" "" "" "g.64591597T>C" "" "VUS" "" "0000235705" "0" "55" "6" "65098684" "65098684" "subst" "0.00520568" "01780" "EYS_000156" "g.65098684T>C" "" "{PMID:Littink 2010:20537394}" "" "p.T1993A" "" "Germline" "" "" "0" "" "" "g.64388791T>C" "" "VUS" "" "0000235706" "0" "55" "6" "64431498" "64431498" "subst" "0.000908445" "01780" "EYS_000074" "g.64431498G>A" "" "{PMID:Littink 2010:20537394}" "" "c.8492C>T/p.T2831I" "" "Germline" "" "" "0" "" "" "g.63721602G>A" "" "VUS" "" "0000235707" "0" "55" "6" "65098684" "65098684" "subst" "0.00520568" "01780" "EYS_000156" "g.65098684T>C" "" "{PMID:Littink 2010:20537394}" "" "p.T1993A" "" "Germline" "" "" "0" "" "" "g.64388791T>C" "" "VUS" "" "0000235708" "0" "55" "6" "65303193" "65303193" "subst" "0.000159674" "01780" "EYS_000209" "g.65303193T>A" "" "{PMID:Littink 2010:20537394}" "" "p.I1232F" "" "Germline" "" "" "0" "" "" "g.64593300T>A" "" "VUS" "" "0000235709" "0" "55" "6" "66115146" "66115146" "subst" "0.00181254" "01780" "EYS_000277" "g.66115146C>T" "" "{PMID:Littink 2010:20537394}" "" "p.S326N" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65405253C>T" "" "VUS" "" "0000235710" "0" "55" "6" "66112410" "66112410" "subst" "0.0020327" "01780" "EYS_000276" "g.66112410T>A" "" "{PMID:Littink 2010:20537394}" "" "p.N382I" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65402517T>A" "" "VUS" "" "0000235711" "0" "55" "6" "66063428" "66063428" "subst" "0.000362372" "01780" "EYS_000266" "g.66063428C>T" "" "{PMID:Littink 2010:20537394}" "" "p.C461Y" "" "Germline" "" "" "0" "" "" "g.65353535C>T" "" "VUS" "" "0000235712" "0" "55" "6" "64516100" "64516100" "subst" "0.000125786" "01780" "EYS_000114" "g.64516100G>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "" "" "Germline" "" "" "0" "" "" "g.63806207G>C" "" "VUS" "" "0000235713" "0" "11" "6" "65336093" "65336093" "subst" "0.000682801" "01780" "EYS_000214" "g.65336093A>T" "ExAC: 7, 19508, 0, 0.0003588" "{PMID:Littink 2010:20537394}" "" "p.N1163K" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64626200A>T" "" "benign" "" "0000235714" "0" "55" "6" "65301229" "65301229" "subst" "0" "01780" "EYS_000195" "g.65301229A>G" "ExAC: -" "{PMID:Littink 2010:20537394}" "" "p.S1511P" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64591336A>G" "" "VUS" "" "0000235715" "0" "55" "6" "65300775" "65300775" "subst" "0.00211957" "01780" "EYS_000186" "g.65300775T>A" "ExAC: 39, 19306, 0, 0.002020" "{PMID:Littink 2010:20537394}" "" "p.D1662V" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590882T>A" "" "VUS" "" "0000235716" "0" "55" "6" "65300650" "65300650" "subst" "1.35342E-5" "01780" "EYS_000181" "g.65300650T>A" "ExAC: -" "{PMID:Littink 2010:20537394}" "" "p.I1704L" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590757T>A" "" "VUS" "" "0000235717" "0" "55" "6" "65300359" "65300359" "subst" "0.000141982" "01780" "EYS_000171" "g.65300359C>T" "ExAC: 7, 19664, 0, 0.0003560" "{PMID:Littink 2010:20537394}" "" "p.A1801T" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590466C>T" "" "VUS" "" "0000235718" "0" "55" "6" "65300250" "65300250" "subst" "0.00399083" "01780" "EYS_000168" "g.65300250C>G" "ExAC: 96, 19740, 1, 0.004863" "{PMID:Littink 2010:20537394}" "" "p.W1837S" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590357C>G" "" "VUS" "" "0000235719" "0" "55" "6" "65016866" "65016866" "subst" "0.000179103" "01780" "EYS_000151" "g.65016866C>A" "ExAC: 5, 19436, 1, 0.0002573" "{PMID:Littink 2010:20537394}" "" "p.C2063F" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64306973C>A" "" "VUS" "" "0000235720" "0" "33" "6" "64791868" "64791868" "subst" "0.00249264" "01780" "EYS_000145" "g.64791868T>C" "ExAC: 84, 19658, 2, 0.004273" "{PMID:Littink 2010:20537394}" "" "p.N2151S" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64081975T>C" "" "likely benign" "" "0000235721" "0" "55" "6" "64694367" "64694367" "subst" "0" "01780" "EYS_000130" "g.64694367T>C" "ExAC: -" "{PMID:Littink 2010:20537394}" "" "p.I2321V" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63984474T>C" "" "VUS" "" "0000235722" "0" "55" "6" "64498124" "64498124" "subst" "0.00307587" "01780" "EYS_000110" "g.64498124T>C" "ExAC: 114, 21558, 2, 0.005288" "{PMID:Littink 2010:20537394}" "" "p.K2533E" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63788231T>C" "" "VUS" "" "0000235723" "0" "55" "6" "64488046" "64488046" "subst" "0.000105253" "01780" "EYS_000101" "g.64488046G>C" "ExAC: 3, 22130, 0, 0.0001356" "{PMID:Littink 2010:20537394}" "" "T2584S" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778153G>C" "" "VUS" "" "0000235724" "0" "11" "6" "65300516" "65300516" "subst" "0.102029" "01780" "EYS_000176" "g.65300516T>G" "ExAC: 2027, 19696, 143, 0.1029" "{PMID:Littink 2010:20537394}" "" "p.L1748F" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590623T>G" "" "benign" "" "0000235725" "0" "11" "6" "64498055" "64498055" "subst" "0.094321" "01780" "EYS_000105" "g.64498055T>A" "ExAC: 1688, 21716, 77, 0.07773" "{PMID:Littink 2010:20537394}" "" "p.S2556C" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63788162T>A" "" "benign" "" "0000235726" "0" "55" "6" "64488001" "64488001" "subst" "0.00556734" "01780" "EYS_000005" "g.64488001T>C" "ExAC: 150, 22014, 0, 0.006814" "{PMID:Littink 2010:20537394}" "" "p.H2599R" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63778108T>C" "" "VUS" "" "0000235727" "3" "99" "6" "65300254" "65300254" "subst" "0" "01780" "EYS_000169" "g.65300254C>A" "" "{PMID:Huang 2010:20696082}" "" "p.E1836X" "" "Germline" "yes" "" "0" "" "" "g.64590361C>A" "" "pathogenic" "" "0000235728" "3" "99" "6" "65300254" "65300254" "subst" "0" "01780" "EYS_000169" "g.65300254C>A" "" "{PMID:Huang 2010:20696082}" "" "p.E1836X" "" "Germline" "yes" "" "0" "" "" "g.64590361C>A" "" "pathogenic" "" "0000235729" "3" "99" "6" "65300254" "65300254" "subst" "0" "01780" "EYS_000169" "g.65300254C>A" "" "{PMID:Huang 2010:20696082}" "" "p.E1836X" "" "Germline" "yes" "" "0" "" "" "g.64590361C>A" "" "pathogenic" "" "0000235730" "10" "55" "6" "66031723" "66080549" "del" "0" "01780" "EYS_000254" "g.66031723_66080549del" "" "{PMID:Barragán 2010:21069908}" "" "p.Y433_E533del" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.65321830_65370656del" "" "VUS" "" "0000235731" "21" "99" "6" "64430746" "64430749" "del" "0" "01780" "EYS_000051" "g.64430746_64430749del" "" "{PMID:Barragán 2010:21069908}" "" "c.9178_9181delATAA/p.N3061TfsX3" "" "Germline" "yes" "" "0" "" "" "g.63720850_63720853del" "" "pathogenic" "" "0000235732" "10" "55" "6" "66031723" "66080549" "del" "0" "01780" "EYS_000254" "g.66031723_66080549del" "" "{PMID:Barragán 2010:21069908}" "" "p.Y433_E533del" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.65321830_65370656del" "" "VUS" "" "0000235733" "21" "99" "6" "64430746" "64430749" "del" "0" "01780" "EYS_000051" "g.64430746_64430749del" "" "{PMID:Barragán 2010:21069908}" "" "c.9178_9181delATAA/p.N3061TfsX3" "" "Germline" "yes" "" "0" "" "" "g.63720850_63720853del" "" "pathogenic" "" "0000235734" "10" "55" "6" "66031723" "66080549" "del" "0" "01780" "EYS_000254" "g.66031723_66080549del" "" "{PMID:Barragán 2010:21069908}" "" "p.Y433_E533del" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.65321830_65370656del" "" "VUS" "" "0000235735" "21" "99" "6" "64430746" "64430749" "del" "0" "01780" "EYS_000051" "g.64430746_64430749del" "" "{PMID:Barragán 2010:21069908}" "" "c.9178_9181delATAA/p.N3061TfsX3" "" "Germline" "yes" "" "0" "" "" "g.63720850_63720853del" "" "pathogenic" "" "0000235736" "21" "55" "6" "65707500" "65707500" "subst" "0.000801619" "01780" "EYS_000243" "g.65707500T>C" "ExAC: 12, 22320, 0, 0.0005376" "{PMID:Barragán 2010:21069908}" "" "p.N745S" "" "Germline" "yes" "" "0" "" "" "g.64997607T>C" "" "VUS" "" "0000235737" "11" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Barragán 2010:21069908}" "" "p.W2640X" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235738" "21" "55" "6" "65707500" "65707500" "subst" "0.000801619" "01780" "EYS_000243" "g.65707500T>C" "ExAC: 12, 22320, 0, 0.0005376" "{PMID:Barragán 2010:21069908}" "" "p.N745S" "" "Germline" "yes" "" "0" "" "" "g.64997607T>C" "" "VUS" "" "0000235739" "11" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Barragán 2010:21069908}" "" "p.W2640X" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235740" "3" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Barragán 2010:21069908}" "" "p.I2239SfsX17" "" "Germline" "yes" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000235741" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Barragán 2010:21069908}" "" "p.Y3135X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235742" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Barragán 2010:21069908}" "" "p.Y3135X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235743" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Barragán 2010:21069908}" "" "p.Y3135X" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000235744" "3" "77" "6" "65098611" "65098611" "subst" "2.83214E-5" "01780" "EYS_000154" "g.65098611C>A" "" "{PMID:Barragán 2010:21069908}" "" "p.G2017V" "" "Germline" "yes" "" "0" "" "" "g.64388718C>A" "" "likely pathogenic" "" "0000235745" "21" "55" "6" "64776324" "64776324" "subst" "0.000336941" "01780" "EYS_000139" "g.64776324G>A" "ExAC: 5, 21630, 0, 0.0002312" "{PMID:Barragán 2010:21069908}" "" "p.S2211L" "" "Germline" "yes" "" "0" "" "" "g.64066431G>A" "" "VUS" "" "0000235746" "11" "77" "6" "64431093" "64431093" "subst" "1.98776E-5" "01780" "EYS_000064" "g.64431093C>T" "" "{PMID:Barragán 2010:21069908}" "" "p.G2945E" "" "Germline" "yes" "" "0" "" "" "g.63721197C>T" "" "likely pathogenic" "" "0000235747" "21" "55" "6" "64776324" "64776324" "subst" "0.000336941" "01780" "EYS_000139" "g.64776324G>A" "ExAC: 5, 21630, 0, 0.0002312" "{PMID:Barragán 2010:21069908}" "" "p.S2211L" "" "Germline" "yes" "" "0" "" "" "g.64066431G>A" "" "VUS" "" "0000235748" "11" "77" "6" "64431093" "64431093" "subst" "1.98776E-5" "01780" "EYS_000064" "g.64431093C>T" "" "{PMID:Barragán 2010:21069908}" "" "p.G2945E" "" "Germline" "yes" "" "0" "" "" "g.63721197C>T" "" "likely pathogenic" "" "0000235749" "0" "99" "6" "65301640" "65301640" "subst" "1.34716E-5" "01780" "EYS_000202" "g.65301640G>A" "" "{PMID:Barragán 2010:21069908}" "" "p.R1374X" "" "Germline" "" "" "0" "" "" "g.64591747G>A" "" "pathogenic" "" "0000235750" "0" "99" "6" "64940484" "64940484" "subst" "0" "01780" "EYS_000146" "g.64940484C>A" "" "{PMID:Barragán 2010:21069908}" "" "splice mutation" "" "Germline" "" "" "0" "" "" "g.64230591C>A" "" "pathogenic" "" "0000235751" "0" "99" "6" "65301640" "65301640" "subst" "1.34716E-5" "01780" "EYS_000202" "g.65301640G>A" "" "{PMID:Barragán 2010:21069908}" "" "p.R1374X" "" "Germline" "" "" "0" "" "" "g.64591747G>A" "" "pathogenic" "" "0000235752" "0" "99" "6" "64940484" "64940484" "subst" "0" "01780" "EYS_000146" "g.64940484C>A" "" "{PMID:Barragán 2010:21069908}" "" "splice mutation" "" "Germline" "" "" "0" "" "" "g.64230591C>A" "" "pathogenic" "" "0000235753" "21" "99" "6" "64516133" "64516133" "del" "0" "01780" "EYS_000116" "g.64516133del" "" "{PMID:Barragán 2010:21069908}" "" "p.H2454PfsX8" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63806240del" "" "pathogenic" "" "0000235754" "21" "99" "6" "64516133" "64516133" "del" "0" "01780" "EYS_000116" "g.64516133del" "" "{PMID:Barragán 2010:21069908}" "" "p.H2454PfsX8" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63806240del" "" "pathogenic" "" "0000235755" "21" "99" "6" "64499022" "64499022" "subst" "0.000158554" "01780" "EYS_000111" "g.64499022C>T" "ExAC: 2, 21796, 0, 0.00009176" "{PMID:Barragán 2010:21069908}" "" "p.E2503K" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63789129C>T" "" "pathogenic" "" "0000235756" "3" "55" "6" "66417042" "66417042" "subst" "0" "01780" "EYS_000307" "g.66417042C>G" "" "{PMID:Barragán 2010:21069908}" "" "-" "Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.65707149C>G" "" "VUS" "" "0000235757" "0" "99" "6" "66205225" "66205226" "dup" "0" "01780" "EYS_000298" "g.66205225_66205226dup" "" "{PMID:Barragán 2010:21069908}" "" "p.Q27Rfsx16" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65495332_65495333dup" "" "pathogenic" "" "0000235758" "0" "99" "6" "66034853" "66125931" "del" "0" "01780" "EYS_000255" "g.66034853_66125931del" "" "{PMID:Barragán 2010:21069908}" "" "c.862-10671_1766+10020del/p.G288Dfsx21" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65324960_65416038del" "" "pathogenic" "" "0000235759" "0" "99" "6" "65301309" "65301309" "subst" "4.04073E-5" "01780" "EYS_000196" "g.65301309C>T" "" "{PMID:Barragán 2010:21069908}" "" "p.W1484X" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64591416C>T" "" "pathogenic" "" "0000235760" "0" "55" "6" "65707500" "65707500" "subst" "0.000801619" "01780" "EYS_000243" "g.65707500T>C" "ExAC: 12, 22320, 0, 0.0005376" "{PMID:Barragán 2010:21069908}" "" "p.N745S" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64997607T>C" "" "VUS" "" "0000235761" "0" "55" "6" "65301310" "65301310" "subst" "6.73446E-6" "01780" "EYS_000197" "g.65301310A>G" "" "{PMID:Barragán 2010:21069908}" "" "p.W1484R" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64591417A>G" "" "VUS" "" "0000235762" "0" "55" "6" "66205758" "66205758" "subst" "0" "01780" "EYS_000302" "g.66205758C>T" "" "{PMID:Barragán 2010:21069908}" "" "-" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65495865C>T" "" "VUS" "" "0000235763" "0" "55" "6" "66349687" "66349687" "subst" "0" "01780" "EYS_000303" "g.66349687C>A" "" "{PMID:Barragán 2010:21069908}" "" "-" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65639794C>A" "" "VUS" "" "0000235764" "3" "77" "6" "64431691" "64431691" "subst" "2.80226E-5" "01780" "EYS_000085" "g.64431691C>A" "" "{PMID:Khan 2010:21179430}" "" "p.D2767Y" "" "Germline" "yes" "" "0" "" "" "g.63721795C>A" "" "likely pathogenic" "" "0000235765" "3" "77" "6" "64431691" "64431691" "subst" "2.80226E-5" "01780" "EYS_000085" "g.64431691C>A" "" "{PMID:Khan 2010:21179430}" "" "p.D2767Y" "" "Germline" "yes" "" "0" "" "" "g.63721795C>A" "" "likely pathogenic" "" "0000235766" "3" "77" "6" "64431691" "64431691" "subst" "2.80226E-5" "01780" "EYS_000085" "g.64431691C>A" "" "{PMID:Khan 2010:21179430}" "" "p.D2767Y" "" "Germline" "yes" "" "0" "" "" "g.63721795C>A" "" "likely pathogenic" "" "0000235767" "3" "77" "6" "64431691" "64431691" "subst" "2.80226E-5" "01780" "EYS_000085" "g.64431691C>A" "" "{PMID:Khan 2010:21179430}" "" "p.D2767Y" "" "Germline" "yes" "" "0" "" "" "g.63721795C>A" "" "likely pathogenic" "" "0000235768" "3" "77" "6" "64431691" "64431691" "subst" "2.80226E-5" "01780" "EYS_000085" "g.64431691C>A" "" "{PMID:Khan 2010:21179430}" "" "p.D2767Y" "" "Germline" "yes" "" "0" "" "" "g.63721795C>A" "" "likely pathogenic" "" "0000235769" "3" "77" "6" "64431691" "64431691" "subst" "2.80226E-5" "01780" "EYS_000085" "g.64431691C>A" "" "{PMID:Khan 2010:21179430}" "" "p.D2767Y" "" "Germline" "yes" "" "0" "" "" "g.63721795C>A" "" "likely pathogenic" "" "0000235770" "3" "55" "6" "64430908" "64430908" "subst" "0" "01780" "EYS_000059" "g.64430908C>A" "" "{PMID:Khan 2010:21179430} {PMID:Siemiatkowska 2011:22128245}" "" "p.D3028Y" "" "Germline" "yes" "" "0" "" "" "g.63721012C>A" "" "VUS" "" "0000235771" "3" "55" "6" "64430908" "64430908" "subst" "0" "01780" "EYS_000059" "g.64430908C>A" "" "{PMID:Khan 2010:21179430} {PMID:Siemiatkowska 2011:22128245}" "" "p.D3028Y" "" "Germline" "yes" "" "0" "" "" "g.63721012C>A" "" "VUS" "" "0000235772" "0" "50" "6" "66204555" "66205887" "dup" "0" "01780" "EYS_000032" "g.(66200601_66204555)_(66205887_66349670)dup" "" "{PMID:Pieras 2011:21519034}" "" "340-?_748+?dup" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000235773" "0" "77" "6" "64431093" "64431093" "subst" "1.98776E-5" "01780" "EYS_000064" "g.64431093C>T" "" "{PMID:Pieras 2011:21519034}" "" "p.Gly2945Glu" "" "Germline" "" "" "0" "" "" "g.63721197C>T" "" "likely pathogenic" "" "0000235774" "0" "99" "6" "0" "0" "" "0" "01780" "EYS_000029" "g.(65532716_65596589)_65622637_65655685)del" "" "{PMID:Pieras 2011:21519034}" "" "c.2382-?_2992+? Cys795HisfsX4del" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235775" "3" "99" "6" "65707474" "65767621" "del" "0" "01780" "EYS_000017" "g.(65655808_65707474)_(65767621_66005755)del" "" "{PMID:Pieras 2011:21519034}" "" "p.Gly676GlufsX9del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000235776" "0" "55" "6" "65303192" "65303192" "subst" "8.65029E-5" "01780" "EYS_000208" "g.65303192A>G" "ExAC: 1, 21718, 0, 0.00004604" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "p.I1232T" "" "Germline" "" "" "0" "" "" "g.64593299A>G" "" "VUS" "" "0000235777" "0" "99" "6" "66005755" "66006013" "del" "0" "01780" "EYS_000035" "g.(65767621_66005755)_(66006013_66044872)del" "" "{PMID:Gonzalez-del Pozo 2011:22164218}, {PMID:Bravo-Gil 2016:27032803}" "" "p.C590YfsX4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235778" "0" "99" "6" "66005808" "66005808" "del" "0" "01780" "EYS_000251" "g.66005808del" "" "{PMID:Gonzalez-del Pozo 2011:22164218}, {PMID:Bravo-Gil 2016:27032803}" "" "1971delT S658VfsX4" "" "Germline" "" "" "0" "" "" "g.65295915del" "" "pathogenic" "" "0000235779" "0" "99" "6" "65098735" "65098735" "subst" "2.70699E-5" "01780" "EYS_000158" "g.65098735T>C" "" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "-" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64388842T>C" "" "pathogenic" "" "0000235780" "0" "55" "6" "64472422" "64472422" "subst" "5.96019E-5" "01780" "EYS_000094" "g.64472422C>A" "" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "p.C2668F" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63762529C>A" "" "VUS" "" "0000235781" "0" "55" "6" "66417039" "66417039" "subst" "0" "01780" "EYS_000306" "g.66417039G>A" "" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "c.-459C>T" "Authors classified it as unlikely pathogenic; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65707146G>A" "" "VUS" "" "0000235782" "0" "33" "6" "66005927" "66005927" "subst" "0.000112112" "01780" "EYS_000253" "g.66005927C>T" "ExAC: 4, 22360, 0, 0.0001789" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "p.G618S" "Authors classified it as unlikely pathogenic; unknown variant 2nd allele" "Germline" "no" "" "0" "" "" "g.65296034C>T" "" "likely benign" "" "0000235783" "3" "11" "6" "65767634" "65767634" "subst" "0.243022" "01780" "EYS_000248" "g.65767634G>A" "ExAC: 5333, 21442, 679, 0.2487" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "-" "Authors classified it as unlikely pathogenic" "Germline" "" "" "0" "" "" "g.65057741G>A" "" "benign" "" "0000235784" "0" "55" "6" "64574072" "64574072" "subst" "1.00355E-5" "01780" "EYS_000118" "g.64574072C>T" "" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "-" "Authors classified it as unlikely pathogenic; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63864179C>T" "" "VUS" "" "0000235785" "0" "33" "6" "64498113" "64498113" "subst" "0.000153428" "01780" "EYS_000109" "g.64498113G>A" "ExAC: 1, 21638, 0, 0.00004621" "{PMID:Gonzalez-del Pozo 2011:22164218}" "" "p.I2536I" "Authors classified it as unlikely pathogenic; unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63788220G>A" "" "likely benign" "" "0000235786" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2012:22277662}" "" "p.N137VfsX24" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235787" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2012:22277662}" "" "p.N137VfsX24" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235788" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2012:22277662}" "" "p.N137VfsX24" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235789" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2012:22277662}" "" "p.N137VfsX24" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235790" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2012:22277662}" "" "p.N137VfsX24" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235791" "3" "99" "6" "66204881" "66204896" "del" "0" "01780" "EYS_000291" "g.66204881_66204896del" "" "{PMID:Audo 2012:22277662}" "" "p.N137VfsX24" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495003del" "" "pathogenic" "" "0000235792" "0" "55" "6" "64498124" "64498124" "subst" "0.00307587" "01780" "EYS_000110" "g.64498124T>C" "ExAC: 114, 21558, 2, 0.005288" "{PMID:Audo 2012:22277662}" "" "p.K2533E" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63788231T>C" "" "VUS" "" "0000235793" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235794" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235795" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235796" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235797" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235798" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235799" "3" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235800" "3" "33" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "likely benign" "" "0000235801" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235802" "0" "99" "6" "66094373" "66094373" "dup" "0" "01780" "EYS_000273" "g.66094373dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.N404Kfs*3" "" "Germline" "" "" "0" "" "" "g.65384480dup" "" "pathogenic" "" "0000235803" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235804" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235805" "0" "33" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "likely benign" "" "0000235806" "0" "99" "6" "66054037" "66054045" "delins" "0" "01780" "EYS_000264" "g.66054037_66054045delinsCTTTTCG" "" "{PMID:Iwanami 2012:22302105}" "" "p.V495Efs*13" "" "Germline" "" "" "0" "" "" "g.65344144_65344152delinsCTTTTCG" "" "pathogenic" "" "0000235807" "0" "55" "6" "64694302" "64694303" "delins" "0" "01780" "EYS_000127" "g.64694302_64694303delinsACGAT" "" "{PMID:Iwanami 2012:22302105}" "" "p.L2343Hfs*105" "" "Germline" "" "" "0" "" "" "g.63984409_63984410delinsACGAT" "" "VUS" "" "0000235808" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235809" "0" "99" "6" "64498056" "64498057" "del" "0" "01780" "EYS_000106" "g.64498056_64498057del" "" "{PMID:Iwanami 2012:22302105}" "" "p.Y2555*" "" "Germline" "" "" "0" "" "" "g.63788163_63788164del" "" "pathogenic" "" "0000235810" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235811" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235812" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235813" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235814" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235815" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235816" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235817" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235818" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235819" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235820" "0" "99" "6" "64516211" "64516211" "subst" "0" "01780" "EYS_000117" "g.64516211G>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.S2428*" "" "Germline" "" "" "0" "" "" "g.63806318G>T" "" "pathogenic" "" "0000235821" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235822" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235823" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235824" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Iwanami 2012:22302105}" "" "p.S1653Kfs*2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235825" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.Y2935*" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235826" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.Y2935*" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235827" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235828" "0" "55" "6" "65622490" "65622490" "subst" "2.64557E-5" "01780" "EYS_000237" "g.65622490C>T" "" "{PMID:Iwanami 2012:22302105}" "" "p.G843E" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000235829" "0" "11" "6" "65336093" "65336093" "subst" "0.000682801" "01780" "EYS_000214" "g.65336093A>T" "ExAC: 7, 19508, 0, 0.0003588" "{PMID:Iwanami 2012:22302105}" "" "p.N1163K" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64626200A>T" "" "benign" "" "0000235830" "0" "55" "6" "65303078" "65303078" "subst" "3.33182E-5" "01780" "EYS_000206" "g.65303078A>C" "ExAC: 1, 21706, 0, 0.00004607" "{PMID:Iwanami 2012:22302105}" "" "p.V1270G" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64593185A>C" "" "VUS" "" "0000235831" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235832" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235833" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235834" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235835" "0" "77" "6" "64431639" "64431639" "subst" "0" "01780" "EYS_000082" "g.64431639A>C" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.L2784R" "" "Germline" "yes" "" "0" "" "" "g.63721743A>C" "" "likely pathogenic" "" "0000235836" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235837" "0" "77" "6" "64431639" "64431639" "subst" "0" "01780" "EYS_000082" "g.64431639A>C" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.L2784R" "" "Germline" "yes" "" "0" "" "" "g.63721743A>C" "" "likely pathogenic" "" "0000235838" "21" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Hosono 2012:22363543}" "" "p.Y2956X" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235839" "21" "99" "6" "65622496" "65622496" "dup" "0" "01780" "EYS_000238" "g.65622496dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.Y841X" "" "Germline" "yes" "" "0" "" "" "g.64912603dup" "" "pathogenic" "" "0000235840" "10" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235841" "3" "99" "6" "64791748" "64791896" "del" "0" "01780" "EYS_000041" "g.(64776385_64791748)_(64791896_64940484)del" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.D2142_S2191delinsG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235842" "3" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.Y2956X" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235843" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235844" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235845" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235846" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235847" "0" "55" "6" "64488004" "64488004" "subst" "0" "01780" "EYS_000100" "g.64488004C>T" "" "{PMID:Hosono 2012:22363543} {PMID:Suto 2014:23421333}" "" "p.G2598D" "" "Germline" "" "" "0" "" "" "g.63778111C>T" "" "VUS" "" "0000235848" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235849" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235850" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235851" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235852" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235853" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Hosono 2012:22363543}" "" "p.S1653KfsX2" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235854" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Hosono 2012:22363543}" "" "p.Y2956X" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235855" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Hosono 2012:22363543}" "" "p.Y2956X" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235856" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Hosono 2012:22363543}" "" "p.Y2956X" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235857" "0" "55" "6" "64430718" "64430718" "subst" "0.000316673" "01780" "EYS_000049" "g.64430718A>G" "ExAC: 3, 21946, 0, 0.0001367" "{PMID:Hosono 2012:22363543}" "" "p.I3091T" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63720822A>G" "" "VUS" "" "0000235858" "0" "55" "6" "64431115" "64431115" "subst" "0" "01780" "EYS_000065" "g.64431115G>T" "" "{PMID:Hosono 2012:22363543}" "" "p.L2959M" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721219G>T" "" "VUS" "" "0000235859" "0" "55" "6" "64430718" "64430718" "subst" "0.000316673" "01780" "EYS_000049" "g.64430718A>G" "ExAC: 3, 21946, 0, 0.0001367" "{PMID:Hosono 2012:22363543}" "" "p.I3091T" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63720822A>G" "" "VUS" "" "0000235860" "0" "55" "6" "65146110" "65146110" "subst" "0" "01780" "EYS_000160" "g.65146110T>C" "" "{PMID:Hosono 2012:22363543}" "" "p.T1962A" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64436217T>C" "" "VUS" "" "0000235861" "0" "55" "6" "64430718" "64430718" "subst" "0.000316673" "01780" "EYS_000049" "g.64430718A>G" "ExAC: 3, 21946, 0, 0.0001367" "{PMID:Hosono 2012:22363543}" "" "p.I3091T" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63720822A>G" "" "VUS" "" "0000235862" "0" "55" "6" "65300356" "65300356" "subst" "0" "01780" "EYS_000170" "g.65300356G>A" "" "{PMID:Hosono 2012:22363543}" "" "p.L1802F" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590463G>A" "" "VUS" "" "0000235863" "0" "55" "6" "66205227" "66205227" "subst" "2.84659E-5" "01780" "EYS_000299" "g.66205227C>T" "" "{PMID:Hosono 2012:22363543}" "" "p.R26Q" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65495334C>T" "" "VUS" "" "0000235864" "0" "55" "6" "65596659" "65596659" "subst" "1.33844E-5" "01780" "EYS_000229" "g.65596659A>G" "ExAC: 1, 21698, 0, 0.00004609" "{PMID:Hosono 2012:22363543}" "" "p.C975R" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64886766A>G" "" "VUS" "" "0000235865" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Suto 2014:23421333}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235866" "21" "99" "6" "65300593" "65300593" "dup" "0" "01780" "EYS_000031" "g.65300593dup" "" "{PMID:Nishiguchi 2013:24043777}" "" "p.L1723fs" "" "Germline" "yes" "" "0" "" "" "g.64590700dup" "" "pathogenic" "" "0000235867" "11" "99" "6" "65071177" "65074016" "del" "0" "01780" "EYS_000030" "g.65071177_65074016del;65500101_65500102ins65074211_65502990inv;65500102_65517570delinsTAATGT" "" "{PMID:Nishiguchi 2013:24043777}" "" "inverted duplication ex23-29" "446 kb head-to-head inverted duplication with flanking deletions" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235868" "21" "99" "6" "65300593" "65300593" "dup" "0" "01780" "EYS_000031" "g.65300593dup" "" "{PMID:Nishiguchi 2013:24043777}" "" "p.L1723fs" "" "Germline" "yes" "" "0" "" "" "g.64590700dup" "" "pathogenic" "" "0000235869" "11" "99" "6" "65071177" "65074016" "del" "0" "01780" "EYS_000030" "g.65071177_65074016del;65500101_65500102ins65074211_65502990inv;65500102_65517570delinsTAATGT" "" "{PMID:Nishiguchi 2013:24043777}" "" "inverted duplication ex23-29" "446 kb head-to-head inverted duplication with flanking deletions" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235870" "11" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Katagiri 2014:24652164}" "" "p.Y2935X" "" "Germline" "yes" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235871" "21" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Katagiri 2014:24652164}" "" "p.S1653KfsX2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235872" "21" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Katagiri 2014:25268133}" "" "p.P2238PfsX16" "" "Germline" "yes" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000235873" "11" "99" "6" "64694329" "64694329" "subst" "0" "01780" "EYS_000128" "g.64694329G>T" "" "{PMID:Katagiri 2014:25268133}" "" "p.C2334X" "" "Germline" "yes" "" "0" "" "" "g.63984436G>T" "" "pathogenic" "" "0000235874" "0" "55" "6" "66205163" "66205163" "subst" "0" "01780" "EYS_000296" "g.66205163T>A" "" "{PMID:Katagiri 2014:25268133}" "" "p.E47D" "" "Germline" "" "" "0" "" "" "g.65495270T>A" "" "VUS" "" "0000235875" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Katagiri 2014:25268133}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235876" "0" "99" "6" "65301738" "65301738" "del" "0" "01780" "EYS_000204" "g.65301738del" "" "{PMID:Katagiri 2014:25268133}" "" "p.S1341FfsX11" "" "Germline" "" "" "0" "" "" "g.64591845del" "" "pathogenic" "" "0000235877" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Katagiri 2014:25268133}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235878" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Katagiri 2014:25268133}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235879" "0" "55" "6" "64488004" "64488004" "subst" "0" "01780" "EYS_000100" "g.64488004C>T" "" "{PMID:Oishi 2014:25324289}" "" "p.G2598D" "" "Germline" "" "" "0" "" "" "g.63778111C>T" "" "VUS" "" "0000235880" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235881" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235882" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235883" "3" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Oishi 2014:25324289}" "" "W2640X" "" "Germline" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235884" "3" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Oishi 2014:25324289}" "" "W2640X" "" "Germline" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235885" "0" "55" "6" "64430718" "64430718" "subst" "0.000316673" "01780" "EYS_000049" "g.64430718A>G" "ExAC: 3, 21946, 0, 0.0001367" "{PMID:Oishi 2014:25324289}" "" "I3070T" "" "Germline" "" "" "0" "" "" "g.63720822A>G" "" "VUS" "" "0000235886" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235887" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235888" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235889" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235890" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235891" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235892" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235893" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235894" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235895" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235896" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235897" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235898" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235899" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235900" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235901" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235902" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235903" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235904" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235905" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Oishi 2014:25324289}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235906" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235907" "3" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235908" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235909" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235910" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235911" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235912" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235913" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235914" "3" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235915" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235916" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235917" "3" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Oishi 2014:25324289}" "" "p.W2640*" "" "Germline" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235918" "0" "99" "6" "64694283" "64694283" "del" "0" "01780" "EYS_000126" "g.64694283del" "" "{PMID:Oishi 2014:25324289}" "" "p.C2350fs" "" "Germline" "" "" "0" "" "" "g.63984390del" "" "pathogenic" "" "0000235919" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235920" "0" "99" "6" "64431547" "64431548" "ins" "0" "01780" "EYS_000079" "g.64431547_64431548insCA" "" "{PMID:Oishi 2014:25324289}" "" "p.E2794fs" "" "Germline" "" "" "0" "" "" "g.63721651_63721652insCA" "" "pathogenic" "" "0000235921" "0" "99" "6" "65300558" "65300559" "del" "0" "01780" "EYS_000179" "g.65300558_65300559del" "" "{PMID:Oishi 2014:25324289}" "" "p.1734_1735del" "" "Germline" "" "" "0" "" "" "g.64590665_64590666del" "" "pathogenic" "" "0000235922" "0" "99" "6" "64431547" "64431548" "ins" "0" "01780" "EYS_000079" "g.64431547_64431548insCA" "" "{PMID:Oishi 2014:25324289}" "" "p.E2794fs" "" "Germline" "" "" "0" "" "" "g.63721651_63721652insCA" "" "pathogenic" "" "0000235923" "0" "99" "6" "65300558" "65300559" "del" "0" "01780" "EYS_000179" "g.65300558_65300559del" "" "{PMID:Oishi 2014:25324289}" "" "p.1734_1735del" "" "Germline" "" "" "0" "" "" "g.64590665_64590666del" "" "pathogenic" "" "0000235924" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235925" "0" "99" "6" "66044889" "66044889" "subst" "0" "01780" "EYS_000257" "g.66044889C>A" "" "{PMID:Oishi 2014:25324289}" "" "p.E584*" "" "Germline" "" "" "0" "" "" "g.65334996C>A" "" "pathogenic" "" "0000235926" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235927" "0" "99" "6" "65301359" "65301359" "dup" "0" "01780" "EYS_000198" "g.65301359dup" "" "{PMID:Oishi 2014:25324289}" "" "p.D1468fs" "" "Germline" "" "" "0" "" "" "g.64591466dup" "" "pathogenic" "" "0000235928" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235929" "0" "99" "6" "65300746" "65300746" "subst" "0" "01780" "EYS_000185" "g.65300746G>A" "" "{PMID:Oishi 2014:25324289}" "" "p.Q1672*" "" "Germline" "" "" "0" "" "" "g.64590853G>A" "" "pathogenic" "" "0000235930" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235931" "0" "99" "6" "65301373" "65301373" "del" "0" "01780" "EYS_000200" "g.65301373del" "" "{PMID:Oishi 2014:25324289}" "" "p.R1463fs" "" "Germline" "" "" "0" "" "" "g.64591480del" "" "pathogenic" "" "0000235932" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235933" "0" "99" "6" "64472413" "64472413" "subst" "1.9867E-5" "01780" "EYS_000093" "g.64472413A>T" "" "{PMID:Oishi 2014:25324289}" "" "p.L2671*" "" "Germline" "" "" "0" "" "" "g.63762520A>T" "" "pathogenic" "" "0000235934" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Oishi 2014:25324289}" "" "p.Y2935*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235935" "0" "99" "6" "66063465" "66063465" "subst" "0" "01780" "EYS_000269" "g.66063465T>A" "" "{PMID:Oishi 2014:25324289}" "" "p.K449*" "" "Germline" "" "" "0" "" "" "g.65353572T>A" "" "pathogenic" "" "0000235936" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235937" "0" "99" "6" "64498029" "64498029" "del" "0" "01780" "EYS_000104" "g.64498029del" "" "{PMID:Oishi 2014:25324289}" "" "p.N2565fs" "" "Germline" "" "" "0" "" "" "g.63788136del" "" "pathogenic" "" "0000235938" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Oishi 2014:25324289}" "" "p.S1653KfsX2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235939" "0" "99" "6" "65300746" "65300746" "subst" "0" "01780" "EYS_000185" "g.65300746G>A" "" "{PMID:Oishi 2014:25324289}" "" "p.Q1672*" "" "Germline" "" "" "0" "" "" "g.64590853G>A" "" "pathogenic" "" "0000235940" "0" "55" "6" "66417039" "66417039" "subst" "0" "01780" "EYS_000306" "g.66417039G>A" "" "{PMID:Pierrottet 2014:25366773}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.65707146G>A" "" "VUS" "" "0000235941" "0" "99" "6" "64430626" "64430629" "del" "0" "01780" "EYS_000045" "g.64430626_64430629del" "ExAC: 1, 21416, 0, 0.00004669" "{PMID:Pierrottet 2014:25366773}" "" "p.Thr3100Lysfs*26" "" "Germline" "" "" "0" "" "" "g.63720730_63720733del" "" "pathogenic" "" "0000235942" "0" "55" "6" "65300869" "65300869" "subst" "0.000837928" "01780" "EYS_000003" "g.65300869G>A" "" "{PMID:Pierrottet 2014:25366773}" "" "p.Pro1631Ser" "" "Germline" "" "" "0" "" "" "g.64590976G>A" "" "VUS" "" "0000235943" "0" "77" "6" "64940494" "64940494" "subst" "0" "01780" "EYS_000147" "g.64940494A>G" "" "{PMID:Pierrottet 2014:25366773}" "" "p.Cys2139Arg" "" "Germline" "" "" "0" "" "" "g.64230601A>G" "" "likely pathogenic" "" "0000235944" "3" "55" "6" "64431148" "64431148" "subst" "3.95361E-5" "01780" "EYS_000067" "g.64431148A>G" "ExAC: 1, 22430, 0, 0.00004458" "{PMID:Pierrottet 2014:25366773}" "" "p.Cys2927Arg" "" "Germline" "" "" "0" "" "" "g.63721252A>G" "" "VUS" "" "0000235945" "0" "99" "6" "65707474" "65707474" "subst" "4.60072E-5" "01780" "EYS_000242" "g.65707474C>T" "" "{PMID:Bonilha 2015:25491159}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64997581C>T" "" "pathogenic" "" "0000235946" "0" "99" "6" "65622398" "65622398" "subst" "3.30986E-5" "01780" "EYS_000236" "g.65622398G>A" "" "{PMID:Bonilha 2015:25491159}" "" "p.Q874X" "" "Germline" "yes" "" "0" "" "" "g.64912505G>A" "" "pathogenic" "" "0000235947" "0" "99" "6" "65707474" "65707474" "subst" "4.60072E-5" "01780" "EYS_000242" "g.65707474C>T" "" "{PMID:Bonilha 2015:25491159}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64997581C>T" "" "pathogenic" "" "0000235948" "0" "99" "6" "65622398" "65622398" "subst" "3.30986E-5" "01780" "EYS_000236" "g.65622398G>A" "" "{PMID:Bonilha 2015:25491159}" "" "p.Q874X" "" "Germline" "yes" "" "0" "" "" "g.64912505G>A" "" "pathogenic" "" "0000235949" "0" "99" "6" "65707474" "65707474" "subst" "4.60072E-5" "01780" "EYS_000242" "g.65707474C>T" "" "{PMID:Bonilha 2015:25491159}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64997581C>T" "" "pathogenic" "" "0000235950" "0" "99" "6" "65622398" "65622398" "subst" "3.30986E-5" "01780" "EYS_000236" "g.65622398G>A" "" "{PMID:Bonilha 2015:25491159}" "" "p.Q874X" "" "Germline" "yes" "" "0" "" "" "g.64912505G>A" "" "pathogenic" "" "0000235951" "2" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Bonilha 2015:25491159}" "" "p.I1451Pfs*3" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235952" "1" "99" "6" "65531537" "65612114" "del" "0" "01780" "EYS_000018" "g.(65523471_65531537)_(65612114_65612296)del" "" "{PMID:Bonilha 2015:25491159}" "" "c.2739-?_3244+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000235953" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Bonilha 2015:25491159}" "" "p.I1451Pfs*3" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000235954" "0" "99" "6" "66204814" "66204814" "subst" "8.13054E-6" "01780" "EYS_000288" "g.66204814G>A" "" "{PMID:Chen 2015:25753737}" "" "p.R164*" "" "Germline" "yes" "" "0" "" "" "g.65494921G>A" "" "pathogenic" "" "0000235955" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Chen 2015:25753737}" "" "p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235956" "0" "99" "6" "66204814" "66204814" "subst" "8.13054E-6" "01780" "EYS_000288" "g.66204814G>A" "" "{PMID:Chen 2015:25753737}" "" "p.R164*" "" "Germline" "yes" "" "0" "" "" "g.65494921G>A" "" "pathogenic" "" "0000235957" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Chen 2015:25753737}" "" "p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000235958" "0" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Chen 2015:25753737}" "" "p.W2640*" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235959" "0" "55" "6" "64431066" "64431066" "subst" "0" "01780" "EYS_000062" "g.64431066A>G" "" "{PMID:Chen 2015:25753737}" "" "p.F2954S" "" "Germline" "yes" "" "0" "" "" "g.63721170A>G" "" "VUS" "" "0000235960" "0" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Chen 2015:25753737}" "" "p.W2640*" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235961" "0" "55" "6" "64431066" "64431066" "subst" "0" "01780" "EYS_000062" "g.64431066A>G" "" "{PMID:Chen 2015:25753737}" "" "p.F2954S" "" "Germline" "yes" "" "0" "" "" "g.63721170A>G" "" "VUS" "" "0000235962" "0" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Chen 2015:25753737}" "" "p.W2640*" "" "Germline" "yes" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000235963" "0" "55" "6" "64431066" "64431066" "subst" "0" "01780" "EYS_000062" "g.64431066A>G" "" "{PMID:Chen 2015:25753737}" "" "p.F2954S" "" "Germline" "yes" "" "0" "" "" "g.63721170A>G" "" "VUS" "" "0000235964" "0" "55" "6" "64791757" "64791757" "subst" "0" "01780" "EYS_000143" "g.64791757A>G" "" "{PMID:Arai 2015:26161267}" "" "p.I2188T" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000235965" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235966" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235967" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Arai 2015:26161267}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235968" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235969" "0" "55" "6" "64791757" "64791757" "subst" "0" "01780" "EYS_000143" "g.64791757A>G" "" "{PMID:Arai 2015:26161267}" "" "p.I2188T" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000235970" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Arai 2015:26161267}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235971" "0" "99" "6" "65622496" "65622496" "dup" "0" "01780" "EYS_000238" "g.65622496dup" "" "{PMID:Arai 2015:26161267}" "" "p.Y841fs*" "" "Germline" "" "" "0" "" "" "g.64912603dup" "" "pathogenic" "" "0000235972" "0" "99" "6" "65655687" "65655687" "subst" "1.35212E-5" "01780" "EYS_000012" "g.65655687G>A" "ExAC: 1, 19764, 0, 0.00005060" "{PMID:Arai 2015:26161267}" "" "p.R794*" "" "Germline" "" "" "0" "" "" "g.64945794G>A" "" "pathogenic" "" "0000235973" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235974" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235975" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235976" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235977" "0" "99" "6" "64499118" "64499118" "subst" "0" "01780" "EYS_000113" "g.64499118C>A" "" "{PMID:Arai 2015:26161267}" "" "p. -" "" "Germline" "" "" "0" "" "" "g.63789225C>A" "" "pathogenic" "" "0000235978" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235979" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235980" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235981" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235982" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Arai 2015:26161267}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000235983" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235984" "0" "55" "6" "64791757" "64791757" "subst" "0" "01780" "EYS_000143" "g.64791757A>G" "" "{PMID:Arai 2015:26161267}" "" "p.I2188T" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000235985" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235986" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235987" "0" "77" "6" "64431639" "64431639" "subst" "0" "01780" "EYS_000082" "g.64431639A>C" "" "{PMID:Arai 2015:26161267}" "" "P.L2784R" "" "Germline" "" "" "0" "" "" "g.63721743A>C" "" "likely pathogenic" "" "0000235988" "21" "99" "6" "65300558" "65300559" "del" "0" "01780" "EYS_000179" "g.65300558_65300559del" "" "{PMID:Arai 2015:26161267}" "" "p.F1735Qfs*6" "" "Germline" "yes" "" "0" "" "" "g.64590665_64590666del" "" "pathogenic" "" "0000235989" "11" "99" "6" "64431548" "64431551" "dup" "0" "01780" "EYS_000080" "g.64431548_64431551dup" "" "{PMID:Arai 2015:26161267}" "" "c.8439_8442dup/p.E2815Cfs*19" "" "Germline" "yes" "" "0" "" "" "g.63721652_63721655dup" "" "pathogenic" "" "0000235990" "21" "99" "6" "65300558" "65300559" "del" "0" "01780" "EYS_000179" "g.65300558_65300559del" "" "{PMID:Arai 2015:26161267}" "" "p.F1735Qfs*6" "" "Germline" "yes" "" "0" "" "" "g.64590665_64590666del" "" "pathogenic" "" "0000235991" "11" "99" "6" "64431548" "64431551" "dup" "0" "01780" "EYS_000080" "g.64431548_64431551dup" "" "{PMID:Arai 2015:26161267}" "" "c.8439_8442dup/p.E2815Cfs*19" "" "Germline" "yes" "" "0" "" "" "g.63721652_63721655dup" "" "pathogenic" "" "0000235992" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235993" "0" "55" "6" "64791757" "64791757" "subst" "0" "01780" "EYS_000143" "g.64791757A>G" "" "{PMID:Arai 2015:26161267}" "" "p.I2188T" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000235994" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235995" "0" "55" "6" "64791757" "64791757" "subst" "0" "01780" "EYS_000143" "g.64791757A>G" "" "{PMID:Arai 2015:26161267}" "" "p.I2188T" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000235996" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000235997" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000235998" "0" "55" "6" "66205076" "66205076" "subst" "0" "01780" "EYS_000294" "g.66205076C>G" "" "{PMID:Arai 2015:26161267}" "" "p.Q76H" "" "Germline" "" "" "0" "" "" "g.65495183C>G" "" "VUS" "" "0000235999" "0" "99" "6" "65622496" "65622496" "dup" "0" "01780" "EYS_000238" "g.65622496dup" "" "{PMID:Arai 2015:26161267}" "" "p.Y841fs*" "" "Germline" "" "" "0" "" "" "g.64912603dup" "" "pathogenic" "" "0000236000" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236001" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000236002" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236003" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000236004" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236005" "0" "99" "6" "64472377" "64472377" "subst" "6.62726E-6" "01780" "EYS_000092" "g.64472377G>A" "" "{PMID:Arai 2015:26161267}" "" "p.T2683I" "" "Germline" "" "" "0" "" "" "g.63762484G>A" "" "pathogenic" "" "0000236006" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236007" "0" "99" "6" "64431122" "64431122" "subst" "1.98255E-5" "01780" "EYS_000066" "g.64431122G>T" "" "{PMID:Arai 2015:26161267}" "" "p.Y2956*" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000236008" "0" "99" "6" "65149247" "65149247" "subst" "0" "01780" "EYS_000165" "g.65149247T>C" "" "{PMID:Arai 2015:26161267}" "" "p.-" "" "Germline" "" "" "0" "" "" "g.64439354T>C" "" "pathogenic" "" "0000236009" "0" "77" "6" "64431691" "64431691" "subst" "0" "01780" "EYS_000086" "g.64431691C>G" "" "{PMID:Arai 2015:26161267}" "" "p.D2767H" "" "Germline" "" "" "0" "" "" "g.63721795C>G" "" "likely pathogenic" "" "0000236010" "0" "55" "6" "65767543" "65767543" "subst" "0" "01780" "EYS_000245" "g.65767543C>T" "" "{PMID:Arai 2015:26161267}" "" "c.2101C>T/p.P701S" "" "Germline" "" "" "0" "" "" "g.65057650C>T" "" "VUS" "" "0000236011" "0" "99" "6" "65301206" "65301206" "del" "0" "01780" "EYS_000194" "g.65301206del" "ExAC: 1, 19800, 0, 0.00005051" "{PMID:Arai 2015:26161267}" "" "p.A1520Pfs*30" "" "Germline" "" "" "0" "" "" "g.64591313del" "" "pathogenic" "" "0000236012" "0" "55" "6" "65149248" "65149249" "ins" "0" "01780" "EYS_000028" "g.65149248_65149249insA" "" "{PMID:Arai 2015:26161267}" "" "5645-3_4insT" "" "Germline" "" "" "0" "" "" "g.64439355_64439356insA" "" "VUS" "" "0000236013" "0" "55" "6" "66205269" "66205269" "subst" "5.71074E-5" "01780" "EYS_000301" "g.66205269A>G" "ExAC: 9, 120958, 0, 0.00007441" "{PMID:Arai 2015:26161267}" "" "p.M12T" "" "Germline" "" "" "0" "" "" "g.65495376A>G" "" "VUS" "" "0000236014" "0" "99" "6" "64694436" "64694463" "del" "0" "01780" "EYS_000132" "g.64694436_64694463del" "" "{PMID:Arai 2015:26161267}" "" "2290Qfs*12" "" "Germline" "" "" "0" "" "" "g.63984543_63984570del" "" "pathogenic" "" "0000236015" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236016" "0" "55" "6" "64791757" "64791757" "subst" "0" "01780" "EYS_000143" "g.64791757A>G" "" "{PMID:Arai 2015:26161267}" "" "p.I2188T" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000236017" "0" "55" "6" "64694430" "64694435" "dup" "0" "01780" "EYS_000131" "g.64694430_64694435dup" "" "{PMID:Arai 2015:26161267}" "" "p.G2300_P2301dup" "" "Germline" "" "" "0" "" "" "g.63984537_63984542dup" "" "VUS" "" "0000236018" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Arai 2015:26161267}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000236019" "0" "55" "6" "64694355" "64694355" "subst" "2.63964E-5" "01780" "EYS_000129" "g.64694355G>A" "ExAC: 8066, 22206, 1490, 0.3632" "{PMID:Arai 2015:26161267}" "" "p.R2326Q" "" "Germline" "" "" "0" "" "" "g.63984462G>A" "" "VUS" "" "0000236020" "0" "55" "6" "66205163" "66205163" "subst" "0" "01780" "EYS_000296" "g.66205163T>A" "" "{PMID:Arai 2015:26161267}" "" "p.E47D" "" "Germline" "" "" "0" "" "" "g.65495270T>A" "" "VUS" "" "0000236021" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236022" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236023" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Arai 2015:26161267}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000236024" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Arai 2015:26161267}" "" "p.S1653Kfs*2" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236025" "0" "77" "6" "64431639" "64431639" "subst" "0" "01780" "EYS_000082" "g.64431639A>C" "" "{PMID:Arai 2015:26161267}" "" "p.L2784R" "" "Germline" "" "" "0" "" "" "g.63721743A>C" "" "likely pathogenic" "" "0000236026" "3" "55" "6" "65324688" "65649725" "del" "0" "01780" "EYS_000210" "g.65324688_65649725del" "" "{PMID:Kastner 2015:26720455}" "" "p.fs*" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.64614795_64939832del" "" "VUS" "" "0000236027" "3" "55" "6" "65324688" "65649725" "del" "0" "01780" "EYS_000210" "g.65324688_65649725del" "" "{PMID:Kastner 2015:26720455}" "" "p.fs*" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.64614795_64939832del" "" "VUS" "" "0000236028" "3" "55" "6" "65324688" "65649725" "del" "0" "01780" "EYS_000210" "g.65324688_65649725del" "" "{PMID:Kastner 2015:26720455}" "" "p.fs*" "Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.64614795_64939832del" "" "VUS" "" "0000236029" "21" "55" "6" "64431505" "64431505" "subst" "0.00511138" "01780" "EYS_000075" "g.64431505C>T" "ExAC: 218, 22186, 3, 0.009826" "{PMID:Di 2016:26787102}" "" "p.A2808T" "" "Germline" "yes" "" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000236030" "11" "55" "6" "64487929" "64487929" "subst" "0.000767115" "01780" "EYS_000097" "g.64487929C>T" "ExAC: 31, 21726, 0, 0.001427" "{PMID:Di 2016:26787102}" "" "p.G2623E" "" "Germline" "yes" "" "0" "" "" "g.63778036C>T" "" "VUS" "" "0000236031" "21" "55" "6" "64431505" "64431505" "subst" "0.00511138" "01780" "EYS_000075" "g.64431505C>T" "ExAC: 218, 22186, 3, 0.009826" "{PMID:Di 2016:26787102}" "" "p.A2808T" "" "Germline" "yes" "" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000236032" "11" "55" "6" "64487929" "64487929" "subst" "0.000767115" "01780" "EYS_000097" "g.64487929C>T" "ExAC: 31, 21726, 0, 0.001427" "{PMID:Di 2016:26787102}" "" "p.G2623E" "" "Germline" "yes" "" "0" "" "" "g.63778036C>T" "" "VUS" "" "0000236033" "21" "55" "6" "64431505" "64431505" "subst" "0.00511138" "01780" "EYS_000075" "g.64431505C>T" "ExAC: 218, 22186, 3, 0.009826" "{PMID:Di 2016:26787102}" "" "p.A2808T" "" "Germline" "yes" "" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000236034" "11" "55" "6" "64487929" "64487929" "subst" "0.000767115" "01780" "EYS_000097" "g.64487929C>T" "ExAC: 31, 21726, 0, 0.001427" "{PMID:Di 2016:26787102}" "" "p.G2623E" "" "Germline" "yes" "" "0" "" "" "g.63778036C>T" "" "VUS" "" "0000236035" "3" "55" "6" "66005908" "66005908" "subst" "0.000191031" "01780" "EYS_000252" "g.66005908G>A" "ExAC: 4, 22488, 0, 0.0001779" "{PMID:Di 2016:26787102}" "" "c.1871G>A/p.S624L" "" "Germline" "yes" "" "0" "" "" "g.65296015G>A" "" "VUS" "" "0000236036" "3" "55" "6" "66005908" "66005908" "subst" "0.000191031" "01780" "EYS_000252" "g.66005908G>A" "ExAC: 4, 22488, 0, 0.0001779" "{PMID:Di 2016:26787102}" "" "c.1871G>A/p.S624L" "" "Germline" "yes" "" "0" "" "" "g.65296015G>A" "" "VUS" "" "0000236037" "3" "99" "6" "64431472" "64431472" "del" "0" "01780" "EYS_000073" "g.64431472del" "" "{PMID:Di 2016:26787102}" "" "p.T2819fs" "" "Germline" "" "" "0" "" "" "g.63721576del" "" "pathogenic" "" "0000236038" "0" "33" "6" "65301154" "65301154" "subst" "0.000128107" "01780" "EYS_000193" "g.65301154G>C" "ExAC: 7, 19810, 0, 0.0003534" "{PMID:Di 2016:26787102}" "" "p.Q1536E" "" "Germline" "" "" "0" "" "" "g.64591261G>C" "" "likely benign" "" "0000236039" "0" "55" "6" "65300722" "65300722" "subst" "0.000129629" "01780" "EYS_000184" "g.65300722T>C" "ExAC: 7, 19456, 0, 0.0003598" "{PMID:Di 2016:26787102}" "" "p.N1680D" "" "Germline" "" "" "0" "" "" "g.64590829T>C" "" "VUS" "" "0000236040" "3" "55" "6" "64430868" "64430868" "subst" "1.32693E-5" "01780" "EYS_000057" "g.64430868A>G" "" "{PMID:Di 2016:26787102}" "" "p.I3020T" "" "Germline" "" "" "0" "" "" "g.63720972A>G" "" "VUS" "" "0000236041" "0" "55" "6" "66063392" "66063392" "subst" "1.62894E-5" "01780" "EYS_000265" "g.66063392C>A" "ExAC: 2, 121036, 0, 0.00001652" "{PMID:Di 2016:26787102}" "" "p.G473V" "" "Germline" "" "" "0" "" "" "g.65353499C>A" "" "VUS" "" "0000236042" "0" "33" "6" "65596611" "65596611" "subst" "0.00038643" "01780" "EYS_000227" "g.65596611G>A" "ExAC: 9, 21686, 0, 0.0004150" "{PMID:Di 2016:26787102}" "" "p.L991F" "" "Germline" "" "" "0" "" "" "g.64886718G>A" "" "likely benign" "" "0000236043" "3" "99" "6" "64431539" "64431539" "subst" "0" "01780" "EYS_000078" "g.64431539G>T" "" "{PMID:Di 2016:26787102}" "" "p.Y2796X" "" "Germline" "" "" "0" "" "" "g.63721643G>T" "" "pathogenic" "" "0000236044" "3" "55" "6" "64574120" "64574120" "subst" "0" "01780" "EYS_000120" "g.64574120C>T" "" "{PMID:Di 2016:26787102}" "" "p.C2396S" "" "Germline" "" "" "0" "" "" "g.63864227C>T" "" "VUS" "" "0000236045" "3" "55" "6" "65707474" "65707474" "subst" "4.60072E-5" "01780" "EYS_000242" "g.65707474C>T" "" "{PMID:Di 2016:26787102}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.64997581C>T" "" "VUS" "" "0000236046" "3" "99" "6" "65532684" "65532684" "subst" "0" "01780" "EYS_000223" "g.65532684G>T" "" "{PMID:Di 2016:26787102}" "" "p.C1008X" "" "Germline" "" "" "0" "" "" "g.64822791G>T" "" "pathogenic" "" "0000236047" "0" "99" "6" "65612025" "65612026" "del" "0" "01780" "EYS_000231" "g.65612025_65612026del" "" "{PMID:Perez-Carro 2016:26806561}" "" "p.Val944Glyfs*9" "" "Germline" "yes" "" "0" "" "" "g.64902132_64902133del" "" "pathogenic" "" "0000236048" "0" "99" "6" "65596589" "65596736" "del" "0" "01780" "EYS_000226" "g.(65532716_65596589)_(65596736_65612005)del" "" "{PMID:Perez-Carro 2016:26806561}" "" "del ex19" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000236049" "0" "99" "6" "64430785" "64430785" "dup" "0" "01780" "EYS_000053" "g.64430785dup" "" "{PMID:Perez-Carro 2016:26806561}" "" "9142dupA (Arg3048Lysfs*9)" "is variant description correct?" "Germline" "" "" "0" "" "" "g.63720889dup" "" "pathogenic" "" "0000236050" "0" "99" "6" "65707474" "65767621" "del" "0" "01780" "EYS_000017" "g.(65655808_65707474)_(65767621_66005755)del" "" "{PMID:Perez-Carro 2016:26806561}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000236051" "0" "55" "6" "64431462" "64431462" "subst" "6.57557E-6" "01780" "EYS_000072" "g.64431462T>C" "" "{PMID:Perez-Carro 2016:26806561}" "" "p.Tyr2822Cys" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63721566T>C" "" "VUS" "" "0000236052" "3" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Gu 2016:27375351}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000236053" "20" "55" "6" "64430679" "64430679" "subst" "0" "01780" "EYS_000048" "g.64430679C>T" "" "{PMID:Gu 2016:27375351}" "" "p.G3083D" "" "Germline" "yes" "" "0" "" "" "g.63720783C>T" "" "VUS" "" "0000236054" "11" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "" "{PMID:Gu 2016:27375351}" "" "C2139Y + p.I1698T" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236055" "11" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Gu 2016:27375351}" "" "p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000236056" "21" "99" "6" "64574078" "64574078" "subst" "2.78267E-5" "01780" "EYS_000026" "g.64574078C>T" "" "{PMID:Gu 2016:27375351}" "" "p.A2410Gfs*4" "" "Germline" "yes" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000236057" "0" "99" "6" "64574078" "64574078" "subst" "2.78267E-5" "01780" "EYS_000026" "g.64574078C>T" "" "{PMID:Gu 2016:27375351}" "" "p.A2410Gfs*4" "" "Germline" "yes" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000236058" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Gu 2016:27375351}" "" "p.S1653Kfs*2" "" "Germline" "yes" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236059" "3" "99" "6" "66205272" "66205272" "dup" "0" "01780" "EYS_000006" "g.66205272dup" "ExAC: 3, 120918, 0, 0.00002481" "{PMID:Abu-Safieh 2013:23105016}" "" "p.(Met12Aspfs*14)" "" "Germline" "" "" "0" "" "" "g.65495379dup" "" "pathogenic" "" "0000236060" "3" "77" "6" "65098611" "65098611" "subst" "2.83214E-5" "01780" "EYS_000154" "g.65098611C>A" "" "{PMID:Abu-Safieh 2013:23105016}" "" "p.(Gly2017Val)" "" "Germline" "" "" "0" "" "" "g.64388718C>A" "" "likely pathogenic" "" "0000236061" "3" "77" "6" "65098611" "65098611" "subst" "2.83214E-5" "01780" "EYS_000154" "g.65098611C>A" "" "{PMID:Abu-Safieh 2013:23105016}" "" "p.(Gly2017Val)" "" "Germline" "" "" "0" "" "" "g.64388718C>A" "" "likely pathogenic" "" "0000236062" "0" "99" "6" "65300824" "65300824" "subst" "0" "01780" "EYS_000189" "g.65300824C>A" "" "{PMID:Glöckle 2014:23591405}" "" "p.E1646X" "" "Germline" "" "" "0" "" "" "g.64590931C>A" "" "pathogenic" "" "0000236063" "0" "99" "6" "64940659" "64940659" "subst" "0" "01780" "EYS_000149" "g.64940659G>A" "" "{PMID:Glöckle 2014:23591405}" "" "p.Q2084X" "" "Germline" "" "" "0" "" "" "g.64230766G>A" "" "pathogenic" "" "0000236064" "0" "99" "6" "65300824" "65300824" "subst" "0" "01780" "EYS_000189" "g.65300824C>A" "" "{PMID:Glöckle 2014:23591405}" "" "p.E1646X" "" "Germline" "" "" "0" "" "" "g.64590931C>A" "" "pathogenic" "" "0000236065" "0" "99" "6" "64940659" "64940659" "subst" "0" "01780" "EYS_000149" "g.64940659G>A" "" "{PMID:Glöckle 2014:23591405}" "" "p.Q2084X" "" "Germline" "" "" "0" "" "" "g.64230766G>A" "" "pathogenic" "" "0000236066" "3" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Glöckle 2014:23591405}" "" "p.P2238PfsX16" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000236067" "0" "99" "6" "66205272" "66205272" "dup" "0" "01780" "EYS_000006" "g.66205272dup" "ExAC: 3, 120918, 0, 0.00002481" "{PMID:Glöckle 2014:23591405}" "" "p.L11fsX15" "" "Germline" "" "" "0" "" "" "g.65495379dup" "" "pathogenic" "" "0000236068" "0" "99" "6" "64791748" "64791748" "subst" "7.29192E-6" "01780" "EYS_000141" "g.64791748C>T" "" "{PMID:Glöckle 2014:23591405}" "" "-" "" "Germline" "" "" "0" "" "" "g.64081855C>T" "" "pathogenic" "" "0000236069" "3" "99" "6" "65707540" "65707540" "subst" "0" "01780" "EYS_000244" "g.65707540G>A" "" "{PMID:Glöckle 2014:23591405}" "" "p.Q732X" "" "Germline" "" "" "0" "" "" "g.64997647G>A" "" "pathogenic" "" "0000236070" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Glöckle 2014:23591405}" "" "p.L1450LfsX4" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236071" "0" "99" "6" "64431521" "64431521" "dup" "0" "01780" "EYS_000076" "g.64431521dup" "" "{PMID:Glöckle 2014:23591405}" "" "p.N2803KfsX9" "" "Germline" "" "" "0" "" "" "g.63721625dup" "" "pathogenic" "" "0000236072" "0" "99" "6" "66115193" "66115193" "dup" "0" "01780" "EYS_000278" "g.66115193dup" "" "{PMID:Glöckle 2014:23591405}" "" "p.N311KfsX1" "" "Germline" "" "" "0" "" "" "g.65405300dup" "" "pathogenic" "" "0000236073" "0" "99" "6" "65301715" "65301715" "subst" "0" "01780" "EYS_000203" "g.65301715G>A" "" "{PMID:Glöckle 2014:23591405}" "" "p.R1349X" "" "Germline" "" "" "0" "" "" "g.64591822G>A" "" "pathogenic" "" "0000236074" "3" "99" "6" "65523399" "65523399" "del" "0" "01780" "EYS_000218" "g.65523399del" "" "{PMID:Glöckle 2014:23591405}" "" "p.P1106HfsX67" "" "Germline" "" "" "0" "" "" "g.64813506del" "" "pathogenic" "" "0000236075" "3" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Glöckle 2014:23591405}" "" "p.L1450LfsX4" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236076" "0" "99" "6" "66204814" "66204814" "subst" "8.13054E-6" "01780" "EYS_000288" "g.66204814G>A" "" "{PMID:O\'Sullivan 2012:22581970 }" "" "p.Arg164*" "" "Germline" "" "" "0" "" "" "g.65494921G>A" "" "pathogenic" "" "0000236077" "0" "99" "6" "65531555" "65531555" "subst" "4.40736E-5" "01780" "EYS_000220" "g.65531555A>G" "ExAC: 2, 21356, 0, 0.00009365" "{PMID:O\'Sullivan 2012:22581970 }" "" "p.Cys1076Arg" "" "Germline" "" "" "0" "" "" "g.64821662A>G" "" "pathogenic" "" "0000236078" "0" "99" "6" "64574212" "64574212" "subst" "1.97881E-5" "01780" "EYS_000123" "g.64574212A>C" "" "{PMID:O\'Sullivan 2012:22581970 }" "" "p.Tyr2365*" "" "Germline" "" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000236079" "0" "99" "6" "64430649" "64430650" "dup" "0" "01780" "EYS_000047" "g.64430649_64430650dup" "" "{PMID:O\'Sullivan 2012:22581970 }" "" "p.Arg3094Valfs*4" "" "Germline" "" "" "0" "" "" "g.63720753_63720754dup" "" "pathogenic" "" "0000236085" "3" "95" "6" "65098735" "65098735" "subst" "2.70699E-5" "01780" "EYS_000158" "g.65098735T>C" "" "{PMID:Habibi 2016:27874104}" "" "-" "" "Germline" "yes" "" "0" "" "" "g.64388842T>C" "" "pathogenic (recessive)" "" "0000236086" "3" "95" "6" "65098735" "65098735" "subst" "2.70699E-5" "01780" "EYS_000158" "g.65098735T>C" "" "{PMID:Habibi 2016:27874104}" "" "-" "" "Germline" "yes" "" "0" "" "" "g.64388842T>C" "" "pathogenic (recessive)" "" "0000236087" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236088" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236089" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236090" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236091" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236092" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236093" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236094" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236095" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236096" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236097" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236098" "3" "99" "6" "66115218" "66115218" "dup" "0" "01780" "EYS_000279" "g.66115218dup" "" "{PMID:Hashmi 2017:28419563}" "" "c.910_911insT/p.Trp304LeufsTer8" "" "Germline" "yes" "" "0" "" "" "g.65405325dup" "" "pathogenic" "" "0000236099" "21" "99" "6" "64497997" "64497997" "subst" "0" "01780" "EYS_000103" "g.64497997C>T" "" "{PMID:Gao 2017:28251098}" "" "p.?" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63788104C>T" "" "pathogenic" "" "0000236100" "0" "55" "6" "66204700" "66204700" "subst" "0" "01780" "EYS_000285" "g.66204700A>G" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Cys202Arg" "" "Germline" "" "" "0" "" "" "g.65494807A>G" "" "VUS" "" "0000236101" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Ile1451Profs*3" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236102" "3" "99" "6" "64694275" "64694275" "subst" "0" "01780" "EYS_000125" "g.64694275C>A" "" "{PMID:Eisenberger 2014:24265693}" "" "splice" "" "Germline" "" "" "0" "" "" "g.63984382C>A" "" "pathogenic" "" "0000236103" "21" "99" "6" "65301715" "65301715" "subst" "0" "01780" "EYS_000203" "g.65301715G>A" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Arg1349*" "" "Germline" "yes" "" "0" "" "" "g.64591822G>A" "" "pathogenic" "" "0000236104" "11" "99" "6" "66417029" "66417119" "del" "0" "01780" "EYS_000305" "g.66417029_66417119del" "" "{PMID:Eisenberger 2014:24265693}" "" "deletion exon 1" "" "Germline" "yes" "" "0" "" "" "g.65707136_65707226del" "" "pathogenic" "" "0000236105" "0" "99" "6" "66205241" "66205241" "del" "0" "01780" "EYS_000300" "g.66205241del" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Thr23Hisfs*19" "" "Germline" "" "" "0" "" "" "g.65495348del" "" "pathogenic" "" "0000236106" "0" "99" "6" "66205142" "66205142" "subst" "0" "01780" "EYS_000295" "g.66205142G>T" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Tyr54*" "" "Germline" "" "" "0" "" "" "g.65495249G>T" "" "pathogenic" "" "0000236107" "21" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Ile1451Profs*3" "" "Germline" "yes" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236108" "11" "55" "6" "66417023" "66417023" "subst" "0" "01780" "EYS_000304" "g.66417023C>T" "" "{PMID:Eisenberger 2014:24265693}" "" "splice" "" "Germline" "yes" "" "0" "" "" "g.65707130C>T" "" "VUS" "" "0000236109" "21" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Eisenberger 2014:24265693}" "" "p.Ile1451Profs*3" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236110" "11" "55" "6" "66417023" "66417023" "subst" "0" "01780" "EYS_000304" "g.66417023C>T" "" "{PMID:Eisenberger 2014:24265693}" "" "splice" "" "Germline" "" "" "0" "" "" "g.65707130C>T" "" "VUS" "" "0000236111" "0" "55" "6" "64430559" "64430559" "subst" "0" "01780" "EYS_000044" "g.64430559T>G" "" "{PMID:Huang 2015:25356976}" "" "c.9368A>C, p.N3123T" "" "Germline" "yes" "" "0" "" "" "g.63720663T>G" "" "VUS" "" "0000236112" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Huang 2015:25356976}" "" "c.6416G>A, p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236113" "0" "55" "6" "64776379" "64776379" "subst" "0" "01780" "EYS_000140" "g.64776379C>T" "" "{PMID:Huang 2015:25356976}" "" "c.6557G>A, p.G2186E" "" "Germline" "yes" "" "0" "" "" "g.64066486C>T" "" "VUS" "" "0000236114" "0" "99" "6" "64430741" "64430742" "del" "0" "01780" "EYS_000050" "g.64430741_64430742del" "" "{PMID:Huang 2015:25356976}" "" "c.9186_9187delCA" "" "Germline" "yes" "" "0" "" "" "g.63720845_63720846del" "" "pathogenic" "" "0000236115" "3" "55" "6" "64499037" "64499037" "subst" "4.61894E-5" "01780" "EYS_000112" "g.64499037C>G" "" "{PMID:Huang 2015:25356976}" "" "c.7492G>C, p.A2498P" "" "Germline" "yes" "" "0" "" "" "g.63789144C>G" "" "VUS" "" "0000236116" "0" "55" "6" "64498112" "64498112" "subst" "0.000265873" "01780" "EYS_000108" "g.64498112C>T" "ExAC: 3, 21644, 0, 0.0001386" "{PMID:Huang 2015:25356976}" "" "c.7609G>A, p.A2537T" "" "Germline" "yes" "" "0" "" "" "g.63788219C>T" "" "VUS" "" "0000236117" "0" "55" "6" "64472476" "64472476" "subst" "5.96121E-5" "01780" "EYS_000095" "g.64472476G>A" "ExAC: 1, 21634, 0, 0.00004622" "{PMID:Huang 2015:25356976}" "" "c.7949C>T, p.S2650F" "" "Germline" "yes" "" "0" "" "" "g.63762583G>A" "" "VUS" "" "0000236118" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Huang 2015:25356976}" "" "c.6416G>A, p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236119" "0" "99" "6" "64436500" "64436500" "del" "0" "01780" "EYS_000089" "g.64436500del" "" "{PMID:Huang 2015:25356976}" "" "c.8150delA" "" "Germline" "yes" "" "0" "" "" "g.63726607del" "" "pathogenic" "" "0000236120" "0" "77" "6" "65622508" "65622508" "subst" "0" "01780" "EYS_000239" "g.65622508C>A" "" "{PMID:Huang 2015:25356976}" "" "c.2510G>T, p.C837F" "" "Germline" "yes" "" "0" "" "" "g.64912615C>A" "" "likely pathogenic" "" "0000236121" "0" "99" "6" "64436538" "64436538" "subst" "0.000128328" "01780" "EYS_000090" "g.64436538C>A" "" "{PMID:Huang 2015:25356976}" "" "c.8107G>T, p.E2703X" "" "Germline" "yes" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "" "0000236122" "0" "99" "6" "64472413" "64472413" "subst" "1.9867E-5" "01780" "EYS_000093" "g.64472413A>T" "" "{PMID:Huang 2015:25356976}" "" "c.8012T>A, p.L2671X" "" "Germline" "yes" "" "0" "" "" "g.63762520A>T" "" "pathogenic" "" "0000236123" "0" "99" "6" "66204600" "66204600" "subst" "0" "01780" "EYS_000284" "g.66204600C>T" "" "{PMID:Huang 2015:25356976}" "" "c.704G>A, p.W235X" "" "Germline" "yes" "" "0" "" "" "g.65494707C>T" "" "pathogenic" "" "0000236124" "0" "55" "6" "64499037" "64499037" "subst" "4.61894E-5" "01780" "EYS_000112" "g.64499037C>G" "" "{PMID:Huang 2015:25356976}" "" "c.7492G>C, p.A2498P" "" "Germline" "yes" "" "0" "" "" "g.63789144C>G" "" "VUS" "" "0000236125" "0" "99" "6" "64431682" "64431682" "dup" "0" "01780" "EYS_000084" "g.64431682dup" "" "{PMID:Huang 2015:25356976}" "" "c.8244_8245insT" "" "Germline" "yes" "" "0" "" "" "g.63721786dup" "" "pathogenic" "" "0000236126" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Huang 2015:25356976}" "" "c.6416G>A, p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236127" "0" "99" "6" "64431536" "64431536" "del" "0" "01780" "EYS_000077" "g.64431536del" "" "{PMID:Huang 2015:25356976}" "" "c.8392delG" "" "Germline" "yes" "" "0" "" "" "g.63721640del" "" "pathogenic" "" "0000236128" "0" "11" "6" "65336093" "65336093" "subst" "0.000682801" "01780" "EYS_000214" "g.65336093A>T" "ExAC: 7, 19508, 0, 0.0003588" "{PMID:Huang 2015:25356976}" "" "c.3489T>A, p.N1163K" "" "Germline" "yes" "" "0" "" "" "g.64626200A>T" "" "benign" "" "0000236129" "0" "55" "6" "65612391" "65612391" "subst" "0.000122251" "01780" "EYS_000235" "g.65612391A>G" "ExAC: 1, 22280, 0, 0.00004488" "{PMID:Huang 2015:25356976}" "" "c.2644T>C, p.F882L" "" "Germline" "yes" "" "0" "" "" "g.64902498A>G" "" "VUS" "" "0000236130" "3" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Huang 2015:25356976}" "" "c.6416G>A, p.C2139Y" "" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236131" "3" "99" "6" "66094278" "66200601" "del" "0" "01780" "EYS_000033" "g.(66063511_66094278)_(66200601_66204555)del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.(748+1_749-1)_(1299+1_1300-1)del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" "" "0000236132" "21" "50" "6" "65301854" "65301854" "subst" "0" "01780" "EYS_000021" "g.65301854G>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "[3906C>A;9405T>A]" "" "Germline" "" "" "0" "" "" "g.64591961G>T" "" "VUS" "" "0000236133" "10" "99" "6" "65523270" "65767621" "del" "0" "01780" "EYS_000036" "g.(65336139_65523270)_(65767621_66005755)del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.2024-?_3443+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000236134" "0" "99" "6" "66205201" "66205201" "subst" "0" "01780" "EYS_000297" "g.66205201G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "p.(Gln35*)" "" "Germline" "" "" "0" "" "" "g.65495308G>A" "" "pathogenic" "" "0000236135" "0" "99" "6" "66054031" "66054031" "dup" "0" "01780" "EYS_000263" "g.66054031dup" "" "{PMID:Haer-Wigman 2017:28224992}" "" "p.(Tyr500*)" "" "Germline" "" "" "0" "" "" "g.65344138dup" "" "pathogenic" "" "0000236136" "0" "99" "6" "66112396" "66112396" "del" "0" "01780" "EYS_000275" "g.66112396del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "p.(Lys387fs)" "" "Germline" "" "" "0" "" "" "g.65402503del" "" "pathogenic" "" "0000236137" "0" "50" "6" "65707474" "65707597" "dup" "0" "01780" "EYS_000038" "g.(65655808_65707474)_(65707597_65767506)dup" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.2138-?_2259+?dup" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000236138" "0" "55" "6" "65707500" "65707500" "subst" "0.000801619" "01780" "EYS_000243" "g.65707500T>C" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.2234A>G" "" "Germline" "" "" "0" "" "" "g.64997607T>C" "" "VUS" "" "0000236139" "0" "55" "6" "64940625" "64940625" "subst" "0.000452574" "01780" "EYS_000148" "g.64940625G>A" "ExAC: 7, 19330, 0, 0.0003621" "{PMID:Haer-Wigman 2017:28224992}" "" "c.6284C>T" "" "Germline" "" "" "0" "" "" "g.64230732G>A" "" "VUS" "" "0000236140" "0" "99" "6" "65300592" "65300593" "del" "0" "01780" "EYS_000180" "g.65300592_65300593del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.5167_5168del" "" "Germline" "" "" "0" "" "" "g.64590699_64590700del" "" "pathogenic" "" "0000236141" "0" "50" "6" "65523270" "65523471" "dup" "0" "01780" "EYS_000037" "g.(65336139_65523270)_(65523471_65531537)dup" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.3244-?_3443+?dup" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000236142" "0" "99" "6" "65300592" "65300593" "del" "0" "01780" "EYS_000180" "g.65300592_65300593del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.5167_5168del" "" "Germline" "" "" "0" "" "" "g.64590699_64590700del" "" "pathogenic" "" "0000236143" "0" "99" "6" "64791748" "64791896" "del" "0" "01780" "EYS_000041" "g.(64776385_64791748)_(64791896_64940484)del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.6425-?_6571+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000236144" "0" "77" "6" "66094277" "66094280" "del" "0" "01780" "EYS_000270" "g.66094277_66094280del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.1299+5_1299+8del" "" "Germline" "" "" "0" "" "" "g.65384384_65384387del" "" "likely pathogenic" "" "0000236145" "0" "77" "6" "65098611" "65098611" "subst" "2.83214E-5" "01780" "EYS_000154" "g.65098611C>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.6050G>T" "" "Germline" "" "" "0" "" "" "g.64388718C>A" "" "likely pathogenic" "" "0000236146" "0" "55" "6" "66094396" "66094396" "subst" "0" "01780" "EYS_000274" "g.66094396G>A" "" "{PMID:Haer-Wigman 2017:28224992}" "" "c.1185-3C>T" "" "Germline" "" "" "0" "" "" "g.65384503G>A" "" "VUS" "" "0000236147" "0" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Haer-Wigman 2017:28224992}" "" "p.(Ile2239fs)" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000236148" "3" "99" "6" "64472506" "64472506" "subst" "2.65714E-5" "01780" "EYS_000096" "g.64472506C>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "p.(Trp2640*)" "" "Germline" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000236149" "0" "93" "6" "66115219" "66115219" "subst" "0.00031324" "01780" "EYS_000280" "g.66115219G>A" "ExAC: 37, 121282, 0, 0.0003051" "{PMID:Xu 2014:24938718}" "" "p.L302F" "" "Germline" "" "" "0" "" "" "g.65405326G>A" "" "pathogenic" "" "0000236150" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Xu 2014:24938718}" "" "PC2139Y" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236151" "0" "99" "6" "66094373" "66094373" "dup" "0" "01780" "EYS_000273" "g.66094373dup" "" "{PMID:Xu 2014:24938718}" "" "p.N404Kfs*3" "" "Germline" "" "" "0" "" "" "g.65384480dup" "" "pathogenic" "" "0000236152" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Xu 2014:24938718}" "" "p.C2139Y" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236153" "3" "99" "6" "64516121" "64516121" "dup" "0" "01780" "EYS_000115" "g.64516121dup" "" "{PMID:Xu 2014:24938718}" "" "p.N2459Kfs*2" "" "Germline" "" "" "0" "" "" "g.63806228dup" "" "pathogenic" "" "0000236154" "3" "99" "6" "64694275" "64694275" "subst" "0" "01780" "EYS_000125" "g.64694275C>A" "" "{PMID:Consugar 2015:25412400}" "" "c.7055+1G>T/NA" "" "Germline" "yes" "" "0" "" "" "g.63984382C>A" "" "pathogenic" "" "0000236155" "0" "99" "6" "64709009" "64709009" "del" "0" "01780" "EYS_000135" "g.64709009del" "ExAC: 9, 22488, 0, 0.0004002" "{PMID:Consugar 2015:25412400}" "" "c.6794delC" "" "Germline" "yes" "" "0" "" "" "g.63999116del" "" "pathogenic" "" "0000236156" "0" "99" "6" "65300430" "65300430" "subst" "0" "01780" "EYS_000173" "g.65300430A>T" "" "{PMID:Consugar 2015:25412400}" "" "p.(Leu1777*)" "" "Germline" "yes" "" "0" "" "" "g.64590537A>T" "" "pathogenic" "" "0000236157" "0" "55" "6" "64430943" "64430943" "subst" "6.59822E-6" "01780" "EYS_000060" "g.64430943A>T" "" "{PMID:Ge 2015:26667666}" "" "p.(Ile2995Asn)" "" "Germline" "" "" "0" "" "" "g.63721047A>T" "" "VUS" "" "0000236158" "0" "99" "6" "64574212" "64574212" "subst" "1.97881E-5" "01780" "EYS_000123" "g.64574212A>C" "ExAC: 1, 21822, 0, 0.00004583" "{PMID:Ge 2015:26667666}" "" "p.(Tyr2365*)" "" "Germline" "" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000236159" "0" "75" "6" "65098583" "65098583" "subst" "0" "01780" "EYS_000153" "g.65098583C>A" "" "{PMID:Ge 2015:26667666}" "" "p.(Gln2026His)" "" "Germline" "" "" "0" "" "" "g.64388690C>A" "" "likely pathogenic (recessive)" "" "0000236160" "0" "95" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Ge 2015:26667666}" "" "p.(Cys2139Tyr)" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "pathogenic (recessive)" "" "0000236161" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Ge 2015:26667666}" "" "p.(Ile1451Profs*3)" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236162" "0" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Ge 2015:26667666}" "" "p.(Ile2239Serfs*17)" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000236163" "0" "93" "6" "66115219" "66115219" "subst" "0.00031324" "01780" "EYS_000280" "g.66115219G>A" "ExAC: 37, 121282, 0, 0.0003051" "{PMID:Ge 2015:26667666}" "" "p.(Leu302Phe)" "" "Germline" "" "" "0" "" "" "g.65405326G>A" "" "pathogenic" "" "0000236164" "0" "77" "6" "64431067" "64431067" "subst" "0.000245355" "01780" "EYS_000063" "g.64431067A>G" "" "{PMID:Ge 2015:26667666}" "" "p.(Phe2954Leu)" "" "Germline" "" "" "0" "" "" "g.63721171A>G" "" "likely pathogenic" "" "0000236165" "3" "93" "6" "65523464" "65523464" "subst" "6.85486E-5" "01780" "EYS_000219" "g.65523464T>G" "ExAC: 3, 20352, 0, 0.0001474" "{PMID:Ge 2015:26667666}" "" "p.(Thr1084Pro)" "" "Germline" "" "" "0" "" "" "g.64813571T>G" "" "pathogenic" "" "0000236166" "3" "55" "6" "65301358" "65301358" "subst" "8.77122E-5" "01780" "EYS_000199" "g.65301358C>G" "ExAC: 6, 19768, 0, 0.0003035" "{PMID:Ge 2015:26667666}" "" "p.(Asp1468His)" "" "Germline" "" "" "0" "" "" "g.64591465C>G" "" "VUS" "" "0000236167" "3" "99" "6" "65523270" "65523270" "subst" "2.11873E-5" "01780" "EYS_000216" "g.65523270C>A" "ExAC: 1, 20758, 0, 0.00004817" "{PMID:Ge 2015:26667666}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0000236168" "0" "99" "6" "66044889" "66044889" "subst" "0" "01780" "EYS_000257" "g.66044889C>A" "" "{PMID:Yoon 2015:26155838}" "" "p.E584*" "" "Germline" "" "" "0" "" "" "g.65334996C>A" "" "pathogenic" "" "0000236169" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Yoon 2015:26155838}" "" "4958_4959insA" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236170" "0" "99" "6" "65300804" "65300804" "dup" "0" "01780" "EYS_000187" "g.65300804dup" "" "{PMID:Yoon 2015:26155838}" "" "4958_4959insA (S1653Kfs*2)" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000236171" "0" "77" "6" "64791763" "64791763" "subst" "3.47116E-5" "01780" "EYS_000144" "g.64791763C>T" "" "{PMID:Yoon 2015:26155838}" "" "p.G2186E" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000236172" "3" "50" "6" "65301854" "65301854" "subst" "0" "01780" "EYS_000021" "g.65301854G>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "[His1302Gln; Tyr3135*]" "" "Germline" "" "" "0" "" "" "g.64591961G>T" "" "VUS" "" "0000236173" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "[His1302Gln; Tyr3135*]" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236174" "1" "77" "6" "66094277" "66094280" "del" "0" "01780" "EYS_000270" "g.66094277_66094280del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.65384384_65384387del" "" "likely pathogenic" "" "0000236175" "2" "55" "6" "65098611" "65098611" "subst" "2.83214E-5" "01780" "EYS_000154" "g.65098611C>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gly2017Val)" "" "Germline" "" "" "0" "" "" "g.64388718C>A" "" "VUS" "" "0000236176" "1" "99" "6" "65300805" "65300805" "subst" "6.82408E-6" "01780" "EYS_000188" "g.65300805G>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ser1652*)" "" "Germline" "" "" "0" "" "" "g.64590912G>C" "" "pathogenic" "" "0000236177" "2" "55" "6" "64430943" "64430943" "subst" "6.59822E-6" "01780" "EYS_000060" "g.64430943A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile2995Asn)" "" "Germline" "" "" "0" "" "" "g.63721047A>T" "" "VUS" "" "0000236178" "3" "99" "6" "65523270" "65767621" "del" "0" "01780" "EYS_000036" "g.(65336139_65523270)_(65767621_66005755)del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000236179" "3" "99" "6" "65655759" "65655759" "subst" "0" "01780" "EYS_000241" "g.65655759G>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gln770*)" "" "Germline" "" "" "0" "" "" "g.64945866G>A" "" "pathogenic" "" "0000236180" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr3135*)" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236181" "0" "99" "6" "64431273" "64431280" "del" "0" "01780" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Thr2883Lysfs*4)" "" "Germline" "" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "" "0000236182" "0" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr3135*)" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236183" "0" "99" "6" "64709003" "64709004" "del" "0" "01780" "EYS_000134" "g.64709003_64709004del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gln2267Glufs*15)" "" "Germline" "" "" "0" "" "" "g.63999110_63999111del" "" "pathogenic" "" "0000236184" "0" "99" "6" "64574212" "64574212" "subst" "1.97881E-5" "01780" "EYS_000123" "g.64574212A>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr2365*)" "" "Germline" "" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000236185" "0" "99" "6" "64709003" "64709004" "del" "0" "01780" "EYS_000134" "g.64709003_64709004del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gln2267Glufs*15)" "" "Germline" "" "" "0" "" "" "g.63999110_63999111del" "" "pathogenic" "" "0000236186" "0" "99" "6" "64574212" "64574212" "subst" "1.97881E-5" "01780" "EYS_000123" "g.64574212A>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr2365*)" "" "Germline" "" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000236187" "0" "99" "6" "64709003" "64709004" "del" "0" "01780" "EYS_000134" "g.64709003_64709004del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gln2267Glufs*15)" "" "Germline" "" "" "0" "" "" "g.63999110_63999111del" "" "pathogenic" "" "0000236188" "0" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile2239Serfs*17)" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000236189" "0" "55" "6" "66094399" "66094399" "subst" "4.14952E-6" "01780" "EYS_000027" "g.66094399A>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.65384506A>C" "" "VUS" "" "0000236190" "0" "55" "6" "65303192" "65303192" "subst" "8.65029E-5" "01780" "EYS_000208" "g.65303192A>G" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile1232Thr)" "" "Germline" "" "" "0" "" "" "g.64593299A>G" "" "VUS" "" "0000236191" "0" "55" "6" "64487929" "64487929" "subst" "0.000767115" "01780" "EYS_000097" "g.64487929C>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gly2623Glu)" "" "Germline" "" "" "0" "" "" "g.63778036C>T" "" "VUS" "" "0000236192" "1" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile1451Profs*3)" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236193" "2" "55" "6" "64487986" "64487986" "subst" "1.9778E-5" "01780" "EYS_000098" "g.64487986C>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Arg2604His)" "" "Germline" "" "" "0" "" "" "g.63778093C>T" "" "VUS" "" "0000236194" "0" "99" "6" "65149224" "65149224" "del" "0" "01780" "EYS_000164" "g.65149224del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr1889Leufs*6)" "" "Germline" "" "" "0" "" "" "g.64439331del" "" "pathogenic" "" "0000236195" "0" "99" "6" "65336020" "65336020" "subst" "0" "01780" "EYS_000212" "g.65336020G>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gln1188*)" "" "Germline" "" "" "0" "" "" "g.64626127G>A" "" "pathogenic" "" "0000236196" "3" "99" "6" "64776242" "64776242" "del" "3.94846E-5" "01780" "EYS_000137" "g.64776242del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile2239Serfs*17)" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000236197" "0" "55" "6" "65767603" "65767603" "subst" "0" "01780" "EYS_000246" "g.65767603C>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Asp681Tyr)" "" "Germline" "" "" "0" "" "" "g.65057710C>A" "" "VUS" "" "0000236198" "0" "55" "6" "64574192" "64574192" "subst" "0" "01780" "EYS_000122" "g.64574192A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Phe2372Tyr)" "" "Germline" "" "" "0" "" "" "g.63864299A>T" "" "VUS" "" "0000236199" "1" "99" "6" "66204782" "66204782" "subst" "0" "01780" "EYS_000287" "g.66204782G>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Cys174*)" "" "Germline" "" "" "0" "" "" "g.65494889G>T" "" "pathogenic" "" "0000236200" "2" "99" "6" "65300477" "65300477" "subst" "0" "01780" "EYS_000174" "g.65300477A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr1761*)" "" "Germline" "" "" "0" "" "" "g.64590584A>T" "" "pathogenic" "" "0000236201" "0" "99" "6" "66204850" "66204850" "dup" "0" "01780" "EYS_000289" "g.66204850dup" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Met152Asnfs*37)" "" "Germline" "" "" "0" "" "" "g.65494957dup" "" "pathogenic" "" "0000236202" "0" "55" "6" "64430866" "64430866" "subst" "6.63508E-6" "01780" "EYS_000056" "g.64430866C>G" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ala3021Pro)" "" "Germline" "" "" "0" "" "" "g.63720970C>G" "" "VUS" "" "0000236203" "0" "99" "6" "64430891" "64430891" "del" "0" "01780" "EYS_000058" "g.64430891del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Leu3013Serfs*6)" "" "Germline" "" "" "0" "" "" "g.63720995del" "" "pathogenic" "" "0000236204" "0" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr3135*)" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236205" "0" "99" "6" "65655687" "65655687" "subst" "1.35212E-5" "01780" "EYS_000012" "g.65655687G>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Arg794*)" "" "Germline" "" "" "0" "" "" "g.64945794G>A" "" "pathogenic" "" "0000236206" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile1451Profs*3)" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236207" "1" "55" "6" "66094399" "66094399" "subst" "4.14952E-6" "01780" "EYS_000027" "g.66094399A>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.65384506A>C" "" "VUS" "" "0000236208" "2" "99" "6" "64574078" "64574078" "subst" "2.78267E-5" "01780" "EYS_000026" "g.64574078C>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000236209" "0" "55" "6" "66063461" "66063461" "subst" "1.22153E-5" "01780" "EYS_000268" "g.66063461T>G" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Asn450Thr)" "" "Germline" "" "" "0" "" "" "g.65353568T>G" "" "VUS" "" "0000236210" "0" "55" "6" "65531629" "65531629" "subst" "0" "01780" "EYS_000221" "g.65531629A>G" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.64821736A>G" "" "VUS" "" "0000236211" "3" "55" "6" "64431667" "64431672" "del" "0" "01780" "EYS_000083" "g.64431667_64431672del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Leu2752_Asn2754delinsTyr)" "" "Germline" "" "" "0" "" "" "g.63721771_63721776del" "" "VUS" "" "0000236212" "0" "99" "6" "65301640" "65301640" "subst" "1.34716E-5" "01780" "EYS_000202" "g.65301640G>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Arg1374*)" "" "Germline" "" "" "0" "" "" "g.64591747G>A" "" "pathogenic" "" "0000236213" "0" "99" "6" "65707474" "65767621" "del" "0" "01780" "EYS_000017" "g.(65655808_65707474)_(65767621_66005755)del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000236214" "0" "99" "6" "65301407" "65301413" "del" "0" "01780" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Ile1451Profs*3)" "" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000236215" "0" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr3135*)" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236216" "0" "99" "6" "65016862" "65016862" "subst" "0" "01780" "EYS_000150" "g.65016862C>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.64306969C>T" "" "pathogenic" "" "0000236217" "0" "99" "6" "66204850" "66204850" "dup" "0" "01780" "EYS_000289" "g.66204850dup" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Met152Asnfs*37)" "" "Germline" "" "" "0" "" "" "g.65494957dup" "" "pathogenic" "" "0000236218" "0" "55" "6" "64430908" "64430908" "subst" "0" "01780" "EYS_000059" "g.64430908C>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Asp3007Tyr)" "" "Germline" "" "" "0" "" "" "g.63721012C>A" "" "VUS" "" "0000236219" "0" "99" "6" "65301870" "65301870" "del" "0" "01780" "EYS_000205" "g.65301870del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Thr1297Lysfs*17)" "" "Germline" "" "" "0" "" "" "g.64591977del" "" "pathogenic" "" "0000236220" "0" "99" "6" "64574078" "64574078" "subst" "2.78267E-5" "01780" "EYS_000026" "g.64574078C>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000236221" "0" "55" "6" "65596621" "65596629" "del" "0" "01780" "EYS_000228" "g.65596621_65596629del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Thr985_Gly987del)" "" "Germline" "" "" "0" "" "" "g.64886728_64886736del" "" "VUS" "" "0000236222" "3" "99" "6" "66205272" "66205272" "dup" "0" "01780" "EYS_000006" "g.66205272dup" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Met12Aspfs*14)" "" "Germline" "" "" "0" "" "" "g.65495379dup" "" "pathogenic" "" "0000236223" "0" "55" "6" "66115258" "66115258" "subst" "7.30077E-5" "01780" "EYS_000281" "g.66115258G>C" "ExAC: 6, 120968, 0, 0.00004960" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Pro289Ala)" "" "Germline" "" "" "0" "" "" "g.65405365G>C" "" "VUS" "" "0000236224" "0" "99" "6" "64431034" "64431034" "del" "0" "01780" "EYS_000061" "g.64431034del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Val2944Trpfs*31)" "" "Germline" "" "" "0" "" "" "g.63721138del" "" "pathogenic" "" "0000236225" "0" "55" "6" "66005756" "66005756" "subst" "0" "01780" "EYS_000250" "g.66005756C>G" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Gly675Arg)" "" "Germline" "" "" "0" "" "" "g.65295863C>G" "" "VUS" "" "0000236226" "0" "55" "6" "66205023" "66205023" "subst" "0.00114688" "01780" "EYS_000293" "g.66205023G>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Pro94Gln)" "" "Germline" "" "" "0" "" "" "g.65495130G>T" "" "VUS" "" "0000236227" "0" "99" "6" "64776230" "64776230" "subst" "0" "01780" "EYS_000136" "g.64776230C>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.?" "" "Germline" "" "" "0" "" "" "g.64066337C>T" "" "pathogenic" "" "0000236228" "0" "55" "6" "64940493" "64940493" "subst" "0.000142873" "01780" "EYS_000023" "g.64940493C>T" "ExAC: 1, 18960, 0, 0.00005274" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Cys2139Tyr)" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000236229" "0" "55" "6" "65301012" "65301012" "subst" "0" "01780" "EYS_000191" "g.65301012T>C" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.Tyr1583Cys" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64591119T>C" "" "VUS" "" "0000236230" "0" "55" "6" "66205008" "66205008" "subst" "8.13226E-6" "01780" "EYS_000292" "g.66205008G>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.Pro99Leu" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65495115G>A" "" "VUS" "" "0000236231" "1" "99" "6" "66204782" "66204782" "subst" "0" "01780" "EYS_000287" "g.66204782G>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Cys174*)" "" "Germline" "" "" "0" "" "" "g.65494889G>T" "" "pathogenic" "" "0000236232" "2" "99" "6" "65300477" "65300477" "subst" "0" "01780" "EYS_000174" "g.65300477A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Tyr1761*)" "" "Germline" "" "" "0" "" "" "g.64590584A>T" "" "pathogenic" "" "0000236233" "0" "99" "6" "64694355" "64694355" "subst" "2.63964E-5" "01780" "EYS_000129" "g.64694355G>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Arg2326*)" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.63984462G>A" "" "pathogenic" "" "0000236234" "0" "99" "6" "66063434" "66063434" "del" "0" "01780" "EYS_000267" "g.66063434del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Cys459Serfs*56)" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65353541del" "" "pathogenic" "" "0000236235" "0" "99" "6" "66063434" "66063434" "del" "0" "01780" "EYS_000267" "g.66063434del" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Cys459Serfs*56)" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.65353541del" "" "pathogenic" "" "0000236236" "0" "99" "6" "65300662" "65300662" "subst" "0" "01780" "EYS_000182" "g.65300662T>A" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "p.(Lys1700*)" "unknown variant 2nd allele" "Germline" "" "" "0" "" "" "g.64590769T>A" "" "pathogenic" "" "0000236237" "0" "10" "6" "65300869" "65300869" "subst" "0.000837928" "00006" "EYS_000003" "g.65300869G>A" "" "{PMID:Glöckle 2014:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.64590976G>A" "" "benign" "" "0000236238" "0" "10" "6" "64430725" "64430725" "subst" "1.97934E-5" "00006" "EYS_000014" "g.64430725C>G" "" "{PMID:Glöckle 2014:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.63720829C>G" "" "benign" "" "0000236242" "0" "10" "6" "64499087" "64499087" "subst" "0" "00006" "EYS_000015" "g.64499087C>T" "" "{PMID:Glöckle 2014:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.63789194C>T" "" "benign" "" "0000236243" "0" "10" "6" "64431199" "64431199" "subst" "0" "00006" "EYS_000016" "g.64431199A>C" "" "{PMID:Glöckle 2014:23591405}" "" "" "" "Germline" "" "" "0" "" "" "g.63721303A>C" "" "benign" "" "0000236245" "3" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "[His1302Gln; Tyr3135*]" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236246" "3" "50" "6" "65301854" "65301854" "subst" "0" "01780" "EYS_000021" "g.65301854G>T" "" "{PMID:Messchaert 2018:29159838}, {DOI:Messchaert 2018:10.1002/humu.23371}" "" "[His1302Gln; Tyr3135*]" "" "Germline" "" "" "0" "" "" "g.64591961G>T" "" "VUS" "" "0000236247" "21" "99" "6" "64430522" "64430522" "subst" "1.67165E-5" "01780" "EYS_000020" "g.64430522A>T" "" "{PMID:Haer-Wigman 2017:28224992}" "" "[3906C>A;9405T>A]" "" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000236248" "11" "55" "6" "65300667" "65300667" "subst" "0" "01780" "EYS_000022" "g.65300667A>G" "" "{PMID:Gu 2016:27375351}" "" "C2139Y + p.I1698T" "" "Germline" "" "" "0" "" "" "g.64590774A>G" "" "VUS" "" "0000236341" "21" "50" "6" "64430750" "64430750" "subst" "6.59988E-6" "01780" "EYS_000308" "g.64430750G>C" "" "{PMID:Audo 2010:20333770}" "" "Gln1751X + Tyr3059X" "" "Germline" "yes" "" "0" "" "" "g.63720854G>C" "" "VUS" "" "0000236342" "21" "50" "6" "64430750" "64430750" "subst" "6.59988E-6" "01780" "EYS_000308" "g.64430750G>C" "" "{PMID:Audo 2010:20333770}" "" "Gln1751X + Tyr3059X" "" "Germline" "yes" "" "0" "" "" "g.63720854G>C" "" "VUS" "" "0000236344" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236346" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236347" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236348" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236349" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236350" "1" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236351" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236352" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236353" "3" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000236354" "21" "50" "6" "66204881" "66204895" "del" "0" "01780" "EYS_000309" "g.66204881_66204895del" "" "{PMID:Bandah-Rozenfeld 2010:20375346}" "" "c.403delA,406G>T,410_424del15 (Thr135LeufsX25)" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495002del" "" "VUS" "" "0000246499" "0" "10" "6" "65016981" "65016981" "subst" "0" "02330" "EYS_000323" "g.65016981A>G" "" "" "" "EYS(NM_001292009.2):c.6079-6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307088A>G" "" "benign" "" "0000246515" "0" "30" "6" "64431067" "64431067" "subst" "0.000245355" "02330" "EYS_000063" "g.64431067A>G" "" "" "" "EYS(NM_001292009.2):c.8923T>C (p.F2975L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63721171A>G" "" "likely benign" "" "0000246516" "0" "30" "6" "65300145" "65300145" "subst" "0.000819907" "02330" "EYS_000405" "g.65300145A>G" "" "" "" "EYS(NM_001292009.1):c.5615T>C (p.I1872T), EYS(NM_001292009.2):c.5615T>C (p.I1872T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590252A>G" "" "likely benign" "" "0000246518" "0" "30" "6" "65016935" "65016935" "subst" "0.00172722" "02330" "EYS_000152" "g.65016935A>T" "" "" "" "EYS(NM_001142800.1):c.6119T>A (p.V2040D), EYS(NM_001292009.2):c.6119T>A (p.V2040D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307042A>T" "" "likely benign" "" "0000246525" "0" "70" "6" "65532542" "65532542" "subst" "0" "02330" "EYS_000409" "g.65532542A>G" "" "" "" "EYS(NM_001292009.2):c.3164+2T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64822649A>G" "" "likely pathogenic" "" "0000246541" "0" "50" "6" "66115184" "66115184" "subst" "6.91417E-5" "02330" "EYS_000371" "g.66115184A>C" "" "" "" "EYS(NM_001292009.2):c.939T>G (p.S313R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65405291A>C" "" "VUS" "" "0000247993" "0" "10" "6" "65301504" "65301504" "subst" "0.729456" "02325" "EYS_000337" "g.65301504A>G" "" "" "" "EYS(NM_001142800.1):c.4256T>C (p.L1419S), EYS(NM_001142800.2):c.4256T>C (p.L1419S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591611A>G" "" "benign" "" "0000247995" "0" "10" "6" "65622463" "65622463" "subst" "0.593404" "02325" "EYS_000385" "g.65622463A>G" "" "" "" "EYS(NM_001142800.1):c.2555T>C (p.L852P), EYS(NM_001142800.2):c.2555T>C (p.L852P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64912570A>G" "" "benign" "" "0000253254" "0" "10" "6" "65301504" "65301504" "subst" "0.729456" "01943" "EYS_000337" "g.65301504A>G" "" "" "" "EYS(NM_001142800.1):c.4256T>C (p.L1419S), EYS(NM_001142800.2):c.4256T>C (p.L1419S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591611A>G" "" "benign" "" "0000253256" "0" "10" "6" "65622463" "65622463" "subst" "0.593404" "01943" "EYS_000385" "g.65622463A>G" "" "" "" "EYS(NM_001142800.1):c.2555T>C (p.L852P), EYS(NM_001142800.2):c.2555T>C (p.L852P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64912570A>G" "" "benign" "" "0000254497" "0" "30" "6" "65301408" "65301408" "subst" "0.118167" "01943" "EYS_000335" "g.65301408A>G" "" "" "" "EYS(NM_001142800.1):c.4352T>C (p.I1451T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591515A>G" "" "likely benign" "" "0000254662" "0" "30" "6" "65300431" "65300431" "subst" "2.0287E-5" "01943" "EYS_000329" "g.65300431A>G" "" "" "" "EYS(NM_001142800.1):c.5329T>C (p.L1777=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590538A>G" "" "likely benign" "" "0000255066" "0" "30" "6" "64488060" "64488060" "subst" "0.00143504" "01943" "EYS_000102" "g.64488060A>G" "" "" "" "EYS(NM_001292009.1):c.7737T>C (p.T2579=), EYS(NM_001292009.2):c.7737T>C (p.T2579=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63778167A>G" "" "likely benign" "" "0000255239" "0" "30" "6" "65336009" "65336009" "subst" "0.000378958" "01943" "EYS_000347" "g.65336009A>G" "" "" "" "EYS(NM_001142800.1):c.3568+5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64626116A>G" "" "likely benign" "" "0000255240" "0" "30" "6" "66337320" "66337320" "subst" "0" "01943" "EYS_000376" "g.66337320A>G" "" "" "" "EYS(NM_001142800.1):c.-333+12351T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65627427A>G" "" "likely benign" "" "0000265926" "0" "50" "6" "66112410" "66112410" "subst" "0.0020327" "02330" "EYS_000276" "g.66112410T>A" "" "" "" "EYS(NM_001292009.1):c.1145A>T (p.N382I), EYS(NM_001292009.2):c.1145A>T (p.N382I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65402517T>A" "" "VUS" "" "0000265927" "0" "10" "6" "66045049" "66045049" "subst" "7.7989E-5" "02330" "EYS_000365" "g.66045049C>T" "" "" "" "EYS(NM_001292009.1):c.1600-10G>A, EYS(NM_001292009.2):c.1600-10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335156C>T" "" "benign" "" "0000265928" "0" "10" "6" "66045001" "66045001" "subst" "8.98693E-5" "02330" "EYS_000364" "g.66045001G>A" "" "" "" "EYS(NM_001292009.2):c.1638C>T (p.D546=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335108G>A" "" "benign" "" "0000265929" "0" "90" "6" "66044966" "66044966" "subst" "0.000118405" "02330" "EYS_000259" "g.66044966C>T" "" "" "" "EYS(NM_001292009.1):c.1673G>A (p.W558*), EYS(NM_001292009.2):c.1673G>A (p.W558*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335073C>T" "" "pathogenic" "" "0000265930" "0" "30" "6" "66205288" "66205288" "subst" "2.05021E-5" "02330" "EYS_000375" "g.66205288T>C" "" "" "" "EYS(NM_001292009.2):c.16A>G (p.I6V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495395T>C" "" "likely benign" "" "0000265931" "0" "50" "6" "66044874" "66044874" "subst" "8.18974E-5" "02330" "EYS_000256" "g.66044874T>C" "" "" "" "EYS(NM_001292009.2):c.1765A>G (p.R589G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65334981T>C" "" "VUS" "" "0000265932" "0" "50" "6" "66005948" "66005948" "subst" "0" "02330" "EYS_000361" "g.66005948T>A" "" "" "" "EYS(NM_001292009.2):c.1831A>T (p.N611Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65296055T>A" "" "VUS" "" "0000265933" "0" "10" "6" "66005880" "66005880" "subst" "0.00188933" "02330" "EYS_000359" "g.66005880T>C" "" "" "" "EYS(NM_001292009.1):c.1899A>G (p.Q633=), EYS(NM_001292009.2):c.1899A>G (p.Q633=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295987T>C" "" "benign" "" "0000265934" "0" "10" "6" "66005829" "66005829" "subst" "9.89094E-5" "02330" "EYS_000358" "g.66005829C>T" "" "" "" "EYS(NM_001292009.2):c.1950G>A (p.A650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295936C>T" "" "benign" "" "0000265935" "0" "50" "6" "66005779" "66005779" "subst" "0.000294867" "02330" "EYS_000356" "g.66005779C>T" "" "" "" "EYS(NM_001292009.2):c.2000G>A (p.R667H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295886C>T" "" "VUS" "" "0000265936" "0" "10" "6" "66005750" "66005750" "dup" "0" "02330" "EYS_000354" "g.66005750dup" "" "" "" "EYS(NM_001142800.2):c.2023+15dupT, EYS(NM_001292009.2):c.2023+15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295857dup" "" "benign" "" "0000265937" "0" "10" "6" "66005749" "66005750" "dup" "0" "02330" "EYS_000355" "g.66005749_66005750dup" "" "" "" "EYS(NM_001292009.2):c.2023+14_2023+15dupTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295856_65295857dup" "" "benign" "" "0000265941" "0" "90" "6" "65655759" "65655759" "subst" "0" "02330" "EYS_000241" "g.65655759G>A" "" "" "" "EYS(NM_001292009.2):c.2308C>T (p.Q770*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64945866G>A" "" "pathogenic" "" "0000265942" "0" "30" "6" "65655758" "65655758" "subst" "0.00115297" "02330" "EYS_000001" "g.65655758T>G" "" "" "" "EYS(NM_001292009.2):c.2309A>C (p.Q770P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64945865T>G" "" "likely benign" "" "0000265943" "0" "30" "6" "65622405" "65622405" "subst" "0.002376" "02330" "EYS_000350" "g.65622405G>A" "" "" "" "EYS(NM_001292009.1):c.2613C>T (p.D871=), EYS(NM_001292009.2):c.2613C>T (p.D871=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64912512G>A" "" "likely benign" "" "0000265944" "0" "30" "6" "65612039" "65612039" "subst" "0.000442644" "02330" "EYS_000410" "g.65612039T>C" "" "" "" "EYS(NM_001292009.2):c.2813A>G (p.K938R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64902146T>C" "" "likely benign" "" "0000265945" "0" "50" "6" "65596611" "65596611" "subst" "0.00038643" "02330" "EYS_000227" "g.65596611G>A" "" "" "" "EYS(NM_001142800.1):c.2971C>T (p.L991F), EYS(NM_001292009.2):c.2971C>T (p.L991F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64886718G>A" "" "VUS" "" "0000265946" "0" "10" "6" "66204970" "66204970" "subst" "0.00898744" "02330" "EYS_000373" "g.66204970C>T" "" "" "" "EYS(NM_001142800.1):c.334G>A (p.V112I), EYS(NM_001292009.2):c.334G>A (p.V112I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495077C>T" "" "benign" "" "0000265947" "0" "10" "6" "66204970" "66204970" "subst" "0.000369904" "02330" "EYS_000414" "g.66204970C>G" "" "" "" "EYS(NM_001292009.2):c.334G>C (p.V112L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495077C>G" "" "benign" "" "0000265948" "0" "10" "6" "65336021" "65336021" "subst" "0" "02330" "EYS_000348" "g.65336021G>A" "" "" "" "EYS(NM_001292009.2):c.3561C>T (p.C1187=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64626128G>A" "" "benign" "" "0000265949" "0" "90" "6" "65327310" "65327310" "subst" "0" "02330" "EYS_000346" "g.65327310C>T" "" "" "" "EYS(NM_001292009.2):c.3684+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64617417C>T" "" "pathogenic" "" "0000265950" "0" "30" "6" "65301693" "65301693" "subst" "6.06894E-5" "02330" "EYS_000340" "g.65301693C>T" "" "" "" "EYS(NM_001292009.2):c.4067G>A (p.R1356H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591800C>T" "" "likely benign" "" "0000265951" "0" "90" "6" "65301407" "65301413" "del" "0" "02330" "EYS_000019" "g.65301407_65301413del" "" "" "" "EYS(NM_001142800.1):c.4350_4356delTATAGCT (p.I1451Pfs*3), EYS(NM_001292009.2):c.4350_4356delTATAGCT (p.I1451Pfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000265952" "0" "30" "6" "65301216" "65301216" "subst" "6.73745E-6" "02330" "EYS_000333" "g.65301216C>T" "" "" "" "EYS(NM_001292009.2):c.4544G>A (p.R1515Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591323C>T" "" "likely benign" "" "0000265954" "0" "10" "6" "65301206" "65301206" "subst" "0.000619779" "02330" "EYS_000408" "g.65301206T>G" "" "" "" "EYS(NM_001142800.1):c.4554A>C (p.T1518=), EYS(NM_001292009.2):c.4554A>C (p.T1518=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591313T>G" "" "benign" "" "0000265955" "0" "10" "6" "65300775" "65300775" "subst" "0.00211957" "02330" "EYS_000186" "g.65300775T>A" "" "" "" "EYS(NM_001142800.1):c.4985A>T (p.D1662V), EYS(NM_001292009.2):c.4985A>T (p.D1662V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590882T>A" "" "benign" "" "0000265956" "0" "50" "6" "65300650" "65300650" "subst" "1.35342E-5" "02330" "EYS_000181" "g.65300650T>A" "" "" "" "EYS(NM_001142800.1):c.5110A>T (p.I1704L), EYS(NM_001292009.2):c.5110A>T (p.I1704L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590757T>A" "" "VUS" "" "0000265957" "0" "50" "6" "65300404" "65300404" "subst" "6.76627E-6" "02330" "EYS_000406" "g.65300404C>T" "" "" "" "EYS(NM_001292009.1):c.5356G>A (p.E1786K), EYS(NM_001292009.2):c.5356G>A (p.E1786K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590511C>T" "" "VUS" "" "0000265958" "0" "30" "6" "65149147" "65149147" "subst" "0.0011368" "02330" "EYS_000325" "g.65149147T>C" "" "" "" "EYS(NM_001292009.1):c.5743A>G (p.S1915G), EYS(NM_001292009.2):c.5743A>G (p.S1915G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64439254T>C" "" "likely benign" "" "0000265959" "0" "10" "6" "65016998" "65016999" "del" "0" "02330" "EYS_000004" "g.65016998_65016999del" "" "" "" "EYS(NM_001142800.1):c.6079-4_6079-3delTC, EYS(NM_001142800.1):c.6079-6_6079-5del (p.?), EYS(NM_001292009.2):c.6079-4_6079-3delTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307105_64307106del" "" "benign" "" "0000265960" "0" "10" "6" "65016996" "65016999" "del" "0" "02330" "EYS_000322" "g.65016996_65016999del" "" "" "" "EYS(NM_001142800.1):c.6079-6_6079-3del (p.?), EYS(NM_001292009.2):c.6079-6_6079-3delTCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307103_64307106del" "" "benign" "" "0000265964" "0" "10" "6" "64516210" "64516210" "subst" "7.90181E-5" "02330" "EYS_000319" "g.64516210T>G" "" "" "" "EYS(NM_001292009.2):c.7284A>C (p.S2428=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63806317T>G" "" "benign" "" "0000265965" "0" "10" "6" "64516110" "64516110" "subst" "0" "02330" "EYS_000318" "g.64516110T>C" "" "" "" "EYS(NM_001292009.2):c.7384A>G (p.I2462V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63806217T>C" "" "benign" "" "0000265966" "0" "10" "6" "64498933" "64498933" "subst" "0.00346046" "02330" "EYS_000317" "g.64498933G>A" "" "" "" "EYS(NM_001292009.2):c.7578+18C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63789040G>A" "" "benign" "" "0000265968" "0" "10" "6" "64498113" "64498113" "subst" "0.000153428" "02330" "EYS_000109" "g.64498113G>A" "" "" "" "EYS(NM_001292009.1):c.7608C>T (p.I2536=), EYS(NM_001292009.2):c.7608C>T (p.I2536=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63788220G>A" "" "benign" "" "0000265969" "0" "10" "6" "64498024" "64498024" "subst" "0.00063458" "02330" "EYS_000314" "g.64498024C>T" "" "" "" "EYS(NM_001292009.2):c.7697G>A (p.G2566E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63788131C>T" "" "benign" "" "0000265970" "0" "70" "6" "64436511" "64436515" "del" "0" "02330" "EYS_000400" "g.64436511_64436515del" "" "" "" "EYS(NM_001292009.2):c.8196_8200delCTTTC (p.F2733Cfs*33)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63726618_63726622del" "" "likely pathogenic" "" "0000265972" "0" "50" "6" "64430538" "64430540" "del" "0" "02330" "EYS_000310" "g.64430538_64430540del" "" "" "" "EYS(NM_001292009.2):c.9452_9454delAAG (p.E3151del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63720642_63720644del" "" "VUS" "" "0000265973" "0" "10" "6" "66115146" "66115146" "subst" "0.00181254" "02330" "EYS_000277" "g.66115146C>T" "" "" "" "EYS(NM_001142800.1):c.977G>A (p.S326N), EYS(NM_001292009.2):c.977G>A (p.S326N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65405253C>T" "" "benign" "" "0000265974" "0" "50" "6" "66115135" "66115135" "subst" "0.000497095" "02330" "EYS_000370" "g.66115135C>T" "" "" "" "EYS(NM_001292009.2):c.988G>A (p.E330K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65405242C>T" "" "VUS" "" "0000267933" "0" "10" "6" "66063513" "66063513" "subst" "0.6718" "02325" "EYS_000368" "g.66063513G>A" "" "" "" "EYS(NM_001142800.1):c.1300-3C>T, EYS(NM_001142800.2):c.1300-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65353620G>A" "" "benign" "" "0000267934" "0" "10" "6" "66044927" "66044927" "subst" "0.159695" "02325" "EYS_000363" "g.66044927T>C" "" "" "" "EYS(NM_001142800.1):c.1712A>G (p.Q571R), EYS(NM_001142800.2):c.1712A>G (p.Q571R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335034T>C" "" "benign" "" "0000267935" "0" "10" "6" "66005970" "66005970" "subst" "0.625043" "02325" "EYS_000362" "g.66005970G>A" "" "" "" "EYS(NM_001142800.1):c.1809C>T (p.V603=), EYS(NM_001142800.2):c.1809C>T (p.V603=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65296077G>A" "" "benign" "" "0000267936" "0" "10" "6" "66005888" "66005888" "subst" "0.624768" "02325" "EYS_000360" "g.66005888C>T" "" "" "" "EYS(NM_001142800.1):c.1891G>A (p.G631S), EYS(NM_001142800.2):c.1891G>A (p.G631S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295995C>T" "" "benign" "" "0000267937" "0" "10" "6" "66005750" "66005750" "dup" "0" "02325" "EYS_000354" "g.66005750dup" "" "" "" "EYS(NM_001142800.2):c.2023+15dupT, EYS(NM_001292009.2):c.2023+15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295857dup" "" "benign" "" "0000267938" "0" "10" "6" "65149185" "65149185" "subst" "0.304764" "02325" "EYS_000326" "g.65149185T>A" "" "" "" "EYS(NM_001142800.2):c.5705A>T (p.N1902I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64439292T>A" "" "benign" "" "0000267939" "0" "10" "6" "65016998" "65016999" "del" "0" "02325" "EYS_000004" "g.65016998_65016999del" "" "" "" "EYS(NM_001142800.1):c.6079-4_6079-3delTC, EYS(NM_001142800.1):c.6079-6_6079-5del (p.?), EYS(NM_001292009.2):c.6079-4_6079-3delTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307105_64307106del" "" "benign" "" "0000268945" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "02329" "EYS_000158" "g.65098735T>C" "" "" "" "EYS(NM_001142800.2):c.5928-2A>G, EYS(NM_001292009.1):c.5928-2A>G, EYS(NM_001292009.2):c.5928-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64388842T>C" "" "pathogenic" "" "0000276469" "0" "30" "6" "66358803" "66358803" "subst" "0" "01943" "EYS_000377" "g.66358803T>C" "" "" "" "EYS(NM_001142800.1):c.-447-9018A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65648910T>C" "" "likely benign" "" "0000276470" "0" "10" "6" "66063513" "66063513" "subst" "0.6718" "01943" "EYS_000368" "g.66063513G>A" "" "" "" "EYS(NM_001142800.1):c.1300-3C>T, EYS(NM_001142800.2):c.1300-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65353620G>A" "" "benign" "" "0000276471" "0" "90" "6" "66063434" "66063434" "del" "0" "01943" "EYS_000267" "g.66063434del" "" "" "" "EYS(NM_001142800.1):c.1376delG (p.C459Sfs*56)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65353541del" "" "pathogenic" "" "0000276472" "0" "30" "6" "66063393" "66063393" "subst" "1.62892E-5" "01943" "EYS_000367" "g.66063393C>A" "" "" "" "EYS(NM_001142800.1):c.1417G>T (p.G473C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65353500C>A" "" "likely benign" "" "0000276473" "0" "30" "6" "66053835" "66053835" "subst" "0" "01943" "EYS_000366" "g.66053835T>G" "" "" "" "EYS(NM_001142800.1):c.1599+96A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65343942T>G" "" "likely benign" "" "0000276474" "0" "90" "6" "66044966" "66044966" "subst" "0.000118405" "01943" "EYS_000259" "g.66044966C>T" "" "" "" "EYS(NM_001292009.1):c.1673G>A (p.W558*), EYS(NM_001292009.2):c.1673G>A (p.W558*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335073C>T" "" "pathogenic" "" "0000276475" "0" "30" "6" "66044927" "66044927" "subst" "0.159695" "01943" "EYS_000363" "g.66044927T>C" "" "" "" "EYS(NM_001142800.1):c.1712A>G (p.Q571R), EYS(NM_001142800.2):c.1712A>G (p.Q571R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335034T>C" "" "likely benign" "" "0000276476" "0" "30" "6" "66005970" "66005970" "subst" "0.625043" "01943" "EYS_000362" "g.66005970G>A" "" "" "" "EYS(NM_001142800.1):c.1809C>T (p.V603=), EYS(NM_001142800.2):c.1809C>T (p.V603=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65296077G>A" "" "likely benign" "" "0000276477" "0" "10" "6" "66005888" "66005888" "subst" "0.624768" "01943" "EYS_000360" "g.66005888C>T" "" "" "" "EYS(NM_001142800.1):c.1891G>A (p.G631S), EYS(NM_001142800.2):c.1891G>A (p.G631S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295995C>T" "" "benign" "" "0000276478" "0" "30" "6" "66005794" "66005794" "subst" "0.00322593" "01943" "EYS_000357" "g.66005794C>A" "" "" "" "EYS(NM_001142800.1):c.1985G>T (p.R662M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295901C>A" "" "likely benign" "" "0000276479" "0" "30" "6" "65622567" "65622567" "subst" "0" "01943" "EYS_000411" "g.65622567T>C" "" "" "" "EYS(NM_001142800.1):c.2451A>G (p.P817=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64912674T>C" "" "likely benign" "" "0000276480" "0" "10" "6" "66205023" "66205023" "subst" "0.00114688" "01943" "EYS_000293" "g.66205023G>T" "" "" "" "EYS(NM_001142800.1):c.281C>A (p.P94Q), EYS(NM_001292009.2):c.281C>A (p.P94Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495130G>T" "" "benign" "" "0000276481" "0" "50" "6" "65596611" "65596611" "subst" "0.00038643" "01943" "EYS_000227" "g.65596611G>A" "" "" "" "EYS(NM_001142800.1):c.2971C>T (p.L991F), EYS(NM_001292009.2):c.2971C>T (p.L991F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64886718G>A" "" "VUS" "" "0000276482" "0" "50" "6" "65523464" "65523464" "subst" "0" "01943" "EYS_000349" "g.65523464T>C" "" "" "" "EYS(NM_001142800.1):c.3250A>G (p.T1084A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64813571T>C" "" "VUS" "" "0000276484" "0" "30" "6" "66204970" "66204970" "subst" "0.00898744" "01943" "EYS_000373" "g.66204970C>T" "" "" "" "EYS(NM_001142800.1):c.334G>A (p.V112I), EYS(NM_001292009.2):c.334G>A (p.V112I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495077C>T" "" "likely benign" "" "0000276485" "0" "10" "6" "66204945" "66204945" "subst" "0.208228" "01943" "EYS_000392" "g.66204945G>A" "" "" "" "EYS(NM_001142800.1):c.359C>T (p.T120M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495052G>A" "" "benign" "" "0000276486" "0" "10" "6" "65303100" "65303100" "subst" "0.117188" "01943" "EYS_000345" "g.65303100T>C" "" "" "" "EYS(NM_001142800.1):c.3787A>G (p.I1263V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64593207T>C" "" "benign" "" "0000276487" "0" "10" "6" "65301854" "65301854" "subst" "0.108161" "01943" "EYS_000344" "g.65301854G>A" "" "" "" "EYS(NM_001142800.1):c.3906C>T (p.H1302=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591961G>A" "" "benign" "" "0000276488" "0" "90" "6" "65301811" "65301812" "del" "0" "01943" "EYS_000343" "g.65301811_65301812del" "" "" "" "EYS(NM_001142800.1):c.3951_3952delAC (p.P1318Lfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591918_64591919del" "" "pathogenic" "" "0000276489" "0" "10" "6" "65301787" "65301787" "subst" "0.116824" "01943" "EYS_000342" "g.65301787G>C" "" "" "" "EYS(NM_001142800.1):c.3973C>G (p.Q1325E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591894G>C" "" "benign" "" "0000276490" "0" "10" "6" "65301734" "65301734" "subst" "0.11777" "01943" "EYS_000341" "g.65301734G>A" "" "" "" "EYS(NM_001142800.1):c.4026C>T (p.S1342=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591841G>A" "" "benign" "" "0000276491" "0" "90" "6" "65301715" "65301715" "subst" "0" "01943" "EYS_000203" "g.65301715G>A" "" "" "" "EYS(NM_001142800.1):c.4045C>T (p.R1349*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591822G>A" "" "pathogenic" "" "0000276492" "0" "30" "6" "65301679" "65301679" "subst" "0.118095" "01943" "EYS_000339" "g.65301679T>C" "" "" "" "EYS(NM_001142800.1):c.4081A>G (p.I1361V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591786T>C" "" "likely benign" "" "0000276493" "0" "10" "6" "65301667" "65301667" "subst" "0.00220368" "01943" "EYS_000338" "g.65301667T>C" "" "" "" "EYS(NM_001142800.1):c.4093A>G (p.K1365E), EYS(NM_001292009.2):c.4093A>G (p.K1365E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591774T>C" "" "benign" "" "0000276494" "0" "90" "6" "65301407" "65301413" "del" "0" "01943" "EYS_000019" "g.65301407_65301413del" "" "" "" "EYS(NM_001142800.1):c.4350_4356delTATAGCT (p.I1451Pfs*3), EYS(NM_001292009.2):c.4350_4356delTATAGCT (p.I1451Pfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "" "0000276495" "0" "30" "6" "65301217" "65301217" "subst" "0.118133" "01943" "EYS_000334" "g.65301217G>A" "" "" "" "EYS(NM_001142800.1):c.4543C>T (p.R1515W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591324G>A" "" "likely benign" "" "0000276496" "0" "30" "6" "65301211" "65301211" "subst" "0.11803" "01943" "EYS_000382" "g.65301211T>C" "" "" "" "EYS(NM_001142800.1):c.4549A>G (p.S1517G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591318T>C" "" "likely benign" "" "0000276497" "0" "30" "6" "65301206" "65301206" "subst" "0.000619779" "01943" "EYS_000408" "g.65301206T>G" "" "" "" "EYS(NM_001142800.1):c.4554A>C (p.T1518=), EYS(NM_001292009.2):c.4554A>C (p.T1518=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591313T>G" "" "likely benign" "" "0000276498" "0" "10" "6" "65301167" "65301167" "subst" "0.118045" "01943" "EYS_000332" "g.65301167C>T" "" "" "" "EYS(NM_001142800.1):c.4593G>A (p.E1531=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591274C>T" "" "benign" "" "0000276499" "0" "30" "6" "65301033" "65301033" "subst" "2.02569E-5" "01943" "EYS_000407" "g.65301033T>G" "" "" "" "EYS(NM_001292009.1):c.4727A>C (p.H1576P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591140T>G" "" "likely benign" "" "0000276500" "0" "30" "6" "65300775" "65300775" "subst" "0.00211957" "01943" "EYS_000186" "g.65300775T>A" "" "" "" "EYS(NM_001142800.1):c.4985A>T (p.D1662V), EYS(NM_001292009.2):c.4985A>T (p.D1662V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590882T>A" "" "likely benign" "" "0000276501" "0" "30" "6" "65300769" "65300769" "subst" "0" "01943" "EYS_000330" "g.65300769G>T" "" "" "" "EYS(NM_001142800.1):c.4991C>A (p.T1664N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590876G>T" "" "likely benign" "" "0000276502" "0" "30" "6" "65300769" "65300769" "subst" "0.000232488" "01943" "EYS_000331" "g.65300769G>A" "" "" "" "EYS(NM_001142800.1):c.4991C>T (p.T1664I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590876G>A" "" "likely benign" "" "0000276503" "0" "90" "6" "65300418" "65300441" "del" "0" "01943" "EYS_000328" "g.65300418_65300441del" "" "" "" "EYS(NM_001142800.1):c.5319_5342delTCTGCCACCATTGACAGGCTCAGT (p.N1773_V1781delinsK)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590525_64590548del" "" "pathogenic" "" "0000276504" "0" "10" "6" "65300143" "65300143" "subst" "0.117428" "01943" "EYS_000327" "g.65300143G>C" "" "" "" "EYS(NM_001142800.1):c.5617C>G (p.L1873V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590250G>C" "" "benign" "" "0000276505" "0" "90" "6" "65098734" "65098736" "del" "0" "01943" "EYS_000324" "g.65098734_65098736del" "" "" "" "EYS(NM_001142800.1):c.5928-3_5928-1delCAG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64388841_64388843del" "" "pathogenic" "" "0000276506" "0" "90" "6" "65016977" "65016978" "del" "0" "01943" "EYS_000321" "g.65016977_65016978del" "" "" "" "EYS(NM_001292009.1):c.6079-3_6079-2delCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307084_64307085del" "" "pathogenic" "" "0000276507" "0" "10" "6" "65016998" "65016999" "del" "0" "01943" "EYS_000004" "g.65016998_65016999del" "" "" "" "EYS(NM_001142800.1):c.6079-4_6079-3delTC, EYS(NM_001142800.1):c.6079-6_6079-5del (p.?), EYS(NM_001292009.2):c.6079-4_6079-3delTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307105_64307106del" "" "benign" "" "0000276508" "0" "70" "6" "64776324" "64776324" "subst" "0.000336941" "01943" "EYS_000139" "g.64776324G>A" "" "" "" "EYS(NM_001142800.1):c.6632C>T (p.S2211L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64066431G>A" "" "likely pathogenic" "" "0000276509" "0" "50" "6" "64498055" "64498055" "subst" "6.70322E-6" "01943" "EYS_000315" "g.64498055T>C" "" "" "" "EYS(NM_001142800.1):c.7666A>G (p.S2556G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63788162T>C" "" "VUS" "" "0000276510" "0" "50" "6" "64431505" "64431505" "subst" "0.00511138" "01943" "EYS_000075" "g.64431505C>T" "" "" "" "EYS(NM_001142800.1):c.8422G>A (p.A2808T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000276511" "0" "50" "6" "64430692" "64430692" "subst" "1.32148E-5" "01943" "EYS_000311" "g.64430692G>C" "" "" "" "EYS(NM_001142800.1):c.9235C>G (p.L3079V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63720796G>C" "" "VUS" "" "0000276512" "0" "30" "6" "66115146" "66115146" "subst" "0.00181254" "01943" "EYS_000277" "g.66115146C>T" "" "" "" "EYS(NM_001142800.1):c.977G>A (p.S326N), EYS(NM_001292009.2):c.977G>A (p.S326N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65405253C>T" "" "likely benign" "" "0000331082" "0" "50" "6" "64431066" "64431066" "subst" "3.31565E-5" "01804" "EYS_000312" "g.64431066A>T" "" "" "" "EYS(NM_001142800.1):c.8861T>A (p.(Phe2954Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63721170A>T" "" "VUS" "" "0000331083" "0" "50" "6" "65016996" "65016999" "del" "0" "01804" "EYS_000322" "g.65016996_65016999del" "" "" "" "EYS(NM_001142800.1):c.6079-6_6079-3del (p.?), EYS(NM_001292009.2):c.6079-6_6079-3delTCTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307103_64307106del" "" "VUS" "" "0000331085" "0" "50" "6" "65016998" "65016999" "del" "0" "01804" "EYS_000004" "g.65016998_65016999del" "" "" "" "EYS(NM_001142800.1):c.6079-4_6079-3delTC, EYS(NM_001142800.1):c.6079-6_6079-5del (p.?), EYS(NM_001292009.2):c.6079-4_6079-3delTC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64307105_64307106del" "" "VUS" "" "0000331086" "0" "50" "6" "65301439" "65301439" "subst" "0" "01804" "EYS_000336" "g.65301439G>A" "" "" "" "EYS(NM_001142800.1):c.4321C>T (p.(Gln1441Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591546G>A" "" "VUS" "" "0000338578" "0" "10" "6" "65302990" "65302994" "del" "0" "02327" "EYS_000384" "g.65302990_65302994del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64593097_64593101del" "" "benign" "" "0000338579" "0" "10" "6" "65336143" "65336143" "subst" "0.224189" "02327" "EYS_000002" "g.65336143G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64626250G>A" "" "benign" "" "0000338584" "0" "10" "6" "65767634" "65767634" "subst" "0.243022" "02327" "EYS_000248" "g.65767634G>A" "" "" "" "EYS(NM_001292009.2):c.2024-15_2024-14delTCinsTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65057741G>A" "" "benign" "" "0000338590" "0" "10" "6" "66063513" "66063513" "subst" "0.6718" "02327" "EYS_000368" "g.66063513G>A" "" "" "" "EYS(NM_001142800.1):c.1300-3C>T, EYS(NM_001142800.2):c.1300-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65353620G>A" "" "benign" "" "0000338597" "0" "10" "6" "66417080" "66417080" "subst" "0" "02327" "EYS_000393" "g.66417080T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65707187T>C" "" "benign" "" "0000340358" "0" "10" "6" "65301167" "65301167" "subst" "0.118045" "02327" "EYS_000332" "g.65301167C>T" "" "" "" "EYS(NM_001142800.1):c.4593G>A (p.E1531=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591274C>T" "" "benign" "" "0000340359" "0" "10" "6" "65301734" "65301734" "subst" "0.11777" "02327" "EYS_000341" "g.65301734G>A" "" "" "" "EYS(NM_001142800.1):c.4026C>T (p.S1342=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591841G>A" "" "benign" "" "0000340360" "0" "10" "6" "65301824" "65301824" "subst" "0.113446" "02327" "EYS_000383" "g.65301824T>C" "" "" "" "EYS(NM_001142800.1):c.3936A>G (p.T1312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591931T>C" "" "benign" "" "0000340361" "0" "10" "6" "65301854" "65301854" "subst" "0.108161" "02327" "EYS_000344" "g.65301854G>A" "" "" "" "EYS(NM_001142800.1):c.3906C>T (p.H1302=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591961G>A" "" "benign" "" "0000340366" "0" "10" "6" "66005970" "66005970" "subst" "0.625043" "02327" "EYS_000362" "g.66005970G>A" "" "" "" "EYS(NM_001142800.1):c.1809C>T (p.V603=), EYS(NM_001142800.2):c.1809C>T (p.V603=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65296077G>A" "" "benign" "" "0000340367" "0" "10" "6" "66112409" "66112409" "subst" "0.519806" "02327" "EYS_000390" "g.66112409A>G" "" "" "" "EYS(NM_001142800.2):c.1146T>C (p.N382=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65402516A>G" "" "benign" "" "0000340951" "0" "30" "6" "65300159" "65300159" "subst" "0.00411191" "02327" "EYS_000381" "g.65300159A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590266A>G" "" "likely benign" "" "0000341359" "0" "50" "6" "64430866" "64430866" "subst" "6.63508E-6" "02327" "EYS_000056" "g.64430866C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63720970C>G" "" "VUS" "" "0000341883" "0" "90" "6" "65301640" "65301640" "subst" "1.34716E-5" "02327" "EYS_000202" "g.65301640G>A" "" "" "" "EYS(NM_001292009.2):c.4120C>T (p.R1374*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591747G>A" "" "pathogenic" "" "0000341961" "0" "10" "6" "65301217" "65301217" "subst" "0.118133" "02327" "EYS_000334" "g.65301217G>A" "" "" "" "EYS(NM_001142800.1):c.4543C>T (p.R1515W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591324G>A" "" "benign" "" "0000342333" "0" "90" "6" "64694355" "64694355" "subst" "2.63964E-5" "02327" "EYS_000129" "g.64694355G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63984462G>A" "" "pathogenic" "" "0000342334" "0" "10" "6" "64694354" "64694354" "subst" "0.335267" "02327" "EYS_000378" "g.64694354C>T" "" "" "" "EYS(NM_001142800.1):c.6977G>A (p.R2326Q), EYS(NM_001142800.2):c.6977G>A (p.R2326Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63984461C>T" "" "benign" "" "0000343370" "0" "90" "6" "65655687" "65655687" "subst" "1.35212E-5" "02327" "EYS_000012" "g.65655687G>A" "" "" "" "EYS(NM_001142800.1):c.2380C>T (p.(Arg794*)), EYS(NM_001292009.2):c.2380C>T (p.R794*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64945794G>A" "" "pathogenic" "" "0000343637" "0" "10" "6" "65149185" "65149185" "subst" "0.304764" "02327" "EYS_000326" "g.65149185T>A" "" "" "" "EYS(NM_001142800.2):c.5705A>T (p.N1902I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64439292T>A" "" "benign" "" "0000343761" "0" "50" "6" "66063461" "66063461" "subst" "1.22153E-5" "02327" "EYS_000268" "g.66063461T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65353568T>G" "" "VUS" "" "0000344175" "0" "50" "6" "65767603" "65767603" "subst" "0" "02327" "EYS_000246" "g.65767603C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65057710C>A" "" "VUS" "" "0000344289" "0" "90" "6" "66204782" "66204782" "subst" "0" "02327" "EYS_000287" "g.66204782G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65494889G>T" "" "pathogenic" "" "0000344379" "0" "90" "6" "66112400" "66112400" "subst" "0.000726827" "02327" "EYS_000389" "g.66112400A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65402507A>T" "" "pathogenic" "" "0000344425" "0" "50" "6" "66044979" "66044979" "subst" "0.00021639" "02327" "EYS_000388" "g.66044979A>T" "" "" "" "EYS(NM_001292009.1):c.1660T>A (p.C554S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335086A>T" "" "VUS" "" "0000344513" "0" "90" "6" "65336020" "65336020" "subst" "0" "02327" "EYS_000212" "g.65336020G>A" "" "" "" "EYS(NM_001292009.2):c.3562C>T (p.Q1188*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64626127G>A" "" "pathogenic" "" "0000344540" "0" "10" "6" "65301787" "65301787" "subst" "0.116824" "02327" "EYS_000342" "g.65301787G>C" "" "" "" "EYS(NM_001142800.1):c.3973C>G (p.Q1325E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591894G>C" "" "benign" "" "0000344677" "0" "90" "6" "64709003" "64709004" "del" "0" "02327" "EYS_000134" "g.64709003_64709004del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63999110_63999111del" "" "pathogenic" "" "0000344782" "0" "90" "6" "66205201" "66205201" "subst" "0" "02327" "EYS_000297" "g.66205201G>A" "" "" "" "EYS(NM_001292009.2):c.103C>T (p.Q35*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495308G>A" "" "pathogenic" "" "0000344905" "0" "10" "6" "66044927" "66044927" "subst" "0.159695" "02327" "EYS_000363" "g.66044927T>C" "" "" "" "EYS(NM_001142800.1):c.1712A>G (p.Q571R), EYS(NM_001142800.2):c.1712A>G (p.Q571R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65335034T>C" "" "benign" "" "0000344961" "0" "90" "6" "65655759" "65655759" "subst" "0" "02327" "EYS_000241" "g.65655759G>A" "" "" "" "EYS(NM_001292009.2):c.2308C>T (p.Q770*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64945866G>A" "" "pathogenic" "" "0000345184" "0" "50" "6" "65300520" "65300520" "subst" "0.000182014" "02327" "EYS_000177" "g.65300520T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590627T>C" "" "VUS" "" "0000345505" "0" "10" "6" "66005857" "66005857" "subst" "0.167924" "02327" "EYS_000387" "g.66005857T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65295964T>A" "" "benign" "" "0000345838" "0" "90" "6" "65098611" "65098611" "subst" "2.83214E-5" "02327" "EYS_000154" "g.65098611C>A" "" "" "" "EYS(NM_001292009.2):c.6050G>T (p.G2017V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64388718C>A" "" "pathogenic" "" "0000346371" "0" "50" "6" "65301854" "65301854" "subst" "0" "02327" "EYS_000021" "g.65301854G>T" "" "" "" "EYS(NM_001292009.1):c.3906C>A (p.H1302Q), EYS(NM_001292009.2):c.3906C>A (p.H1302Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591961G>T" "" "VUS" "" "0000346565" "0" "10" "6" "65303100" "65303100" "subst" "0.117188" "02327" "EYS_000345" "g.65303100T>C" "" "" "" "EYS(NM_001142800.1):c.3787A>G (p.I1263V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64593207T>C" "" "benign" "" "0000346573" "0" "10" "6" "65301679" "65301679" "subst" "0.118095" "02327" "EYS_000339" "g.65301679T>C" "" "" "" "EYS(NM_001142800.1):c.4081A>G (p.I1361V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591786T>C" "" "benign" "" "0000346580" "0" "10" "6" "65301408" "65301408" "subst" "0.118167" "02327" "EYS_000335" "g.65301408A>G" "" "" "" "EYS(NM_001142800.1):c.4352T>C (p.I1451T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591515A>G" "" "benign" "" "0000346639" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "02327" "EYS_000137" "g.64776242del" "" "" "" "EYS(NM_001292009.2):c.6714delT (p.I2239Sfs*17)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000346894" "0" "10" "6" "65301504" "65301504" "subst" "0.729456" "02327" "EYS_000337" "g.65301504A>G" "" "" "" "EYS(NM_001142800.1):c.4256T>C (p.L1419S), EYS(NM_001142800.2):c.4256T>C (p.L1419S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591611A>G" "" "benign" "" "0000346944" "0" "90" "6" "65300592" "65300593" "del" "0" "02327" "EYS_000180" "g.65300592_65300593del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590699_64590700del" "" "pathogenic" "" "0000346950" "0" "10" "6" "65300516" "65300516" "subst" "0.102029" "02327" "EYS_000176" "g.65300516T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590623T>G" "" "benign" "" "0000346960" "0" "10" "6" "65300143" "65300143" "subst" "0.117428" "02327" "EYS_000327" "g.65300143G>C" "" "" "" "EYS(NM_001142800.1):c.5617C>G (p.L1873V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590250G>C" "" "benign" "" "0000346967" "0" "90" "6" "65149106" "65149106" "del" "0" "02327" "EYS_000380" "g.65149106del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64439213del" "" "pathogenic" "" "0000347061" "0" "50" "6" "64431667" "64431672" "del" "0" "02327" "EYS_000083" "g.64431667_64431672del" "" "" "" "EYS(NM_001292009.2):c.8318_8323delTAGTAA (p.L2773_N2775delinsY)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63721771_63721776del" "" "VUS" "" "0000347089" "0" "50" "6" "66115219" "66115219" "subst" "0.00031324" "02327" "EYS_000280" "g.66115219G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65405326G>A" "" "VUS" "" "0000347324" "0" "10" "6" "65622463" "65622463" "subst" "0.593404" "02327" "EYS_000385" "g.65622463A>G" "" "" "" "EYS(NM_001142800.1):c.2555T>C (p.L852P), EYS(NM_001142800.2):c.2555T>C (p.L852P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64912570A>G" "" "benign" "" "0000347751" "0" "90" "6" "66204850" "66204850" "dup" "0" "02327" "EYS_000289" "g.66204850dup" "" "" "" "EYS(NM_001292009.1):c.454dupA (p.M152Nfs*37), EYS(NM_001292009.2):c.454dupA (p.M152Nfs*37)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65494957dup" "" "pathogenic" "" "0000347820" "0" "30" "6" "66112491" "66112491" "subst" "0" "02327" "EYS_000391" "g.66112491A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65402598A>T" "" "likely benign" "" "0000347997" "0" "50" "6" "64574192" "64574192" "subst" "0" "02327" "EYS_000122" "g.64574192A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63864299A>T" "" "VUS" "" "0000348007" "0" "30" "6" "64498971" "64498971" "subst" "0.000742922" "02327" "EYS_000007" "g.64498971A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63789078A>G" "" "likely benign" "" "0000348223" "0" "30" "6" "65300869" "65300869" "subst" "0.000837928" "02327" "EYS_000003" "g.65300869G>A" "" "" "" "EYS(NM_001292009.1):c.4891C>T (p.P1631S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590976G>A" "" "likely benign" "" "0000348263" "0" "50" "6" "65098720" "65098720" "subst" "2.434E-5" "02327" "EYS_000379" "g.65098720G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64388827G>A" "" "VUS" "" "0000348632" "0" "50" "6" "66205008" "66205008" "subst" "8.13226E-6" "02327" "EYS_000292" "g.66205008G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495115G>A" "" "VUS" "" "0000348735" "0" "10" "6" "65301211" "65301211" "subst" "0.11803" "02327" "EYS_000382" "g.65301211T>C" "" "" "" "EYS(NM_001142800.1):c.4549A>G (p.S1517G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591318T>C" "" "benign" "" "0000348764" "0" "90" "6" "65300805" "65300805" "subst" "6.82408E-6" "02327" "EYS_000188" "g.65300805G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590912G>C" "" "pathogenic" "" "0000348871" "0" "10" "6" "64498055" "64498055" "subst" "0.094321" "02327" "EYS_000105" "g.64498055T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63788162T>A" "" "benign" "" "0000349258" "0" "10" "6" "66204945" "66204945" "subst" "0.208228" "02327" "EYS_000392" "g.66204945G>A" "" "" "" "EYS(NM_001142800.1):c.359C>T (p.T120M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65495052G>A" "" "benign" "" "0000349750" "0" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "02327" "EYS_000096" "g.64472506C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000349937" "0" "50" "6" "65301012" "65301012" "subst" "0" "02327" "EYS_000191" "g.65301012T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64591119T>C" "" "VUS" "" "0000349954" "0" "90" "6" "65300477" "65300477" "subst" "0" "02327" "EYS_000174" "g.65300477A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64590584A>T" "" "pathogenic" "" "0000349962" "0" "90" "6" "65149224" "65149224" "del" "0" "02327" "EYS_000164" "g.65149224del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64439331del" "" "pathogenic" "" "0000349996" "0" "90" "6" "64574212" "64574212" "subst" "1.97881E-5" "02327" "EYS_000123" "g.64574212A>C" "" "" "" "EYS(NM_001292009.1):c.7095T>G (p.Y2365*), EYS(NM_001292009.2):c.7095T>G (p.Y2365*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000350036" "0" "90" "6" "64430522" "64430522" "subst" "1.67165E-5" "02327" "EYS_000020" "g.64430522A>T" "" "" "" "EYS(NM_001292009.1):c.9468T>A (p.Y3156*), EYS(NM_001292009.2):c.9468T>A (p.Y3156*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "" "0000351317" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "02327" "EYS_000026" "g.64574078C>T" "" "" "" "EYS(NM_001292009.2):c.7228+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000351326" "0" "50" "6" "65531629" "65531629" "subst" "0" "02327" "EYS_000221" "g.65531629A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.64821736A>G" "" "VUS" "" "0000351330" "0" "50" "6" "66094399" "66094399" "subst" "4.14952E-6" "02327" "EYS_000027" "g.66094399A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.65384506A>C" "" "VUS" "" "0000358103" "3" "90" "6" "66204881" "66204901" "del" "0" "01243" "EYS_000395" "g.66204881_66204901delinsAAAAG" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.65494988_65495008delinsAAAAG" "" "pathogenic" "" "0000358247" "3" "90" "6" "64430695" "64430704" "del" "0" "01243" "EYS_000396" "g.64430695_64430704del" "" "Sharon, submitted" "" "NM_001292009.1:c.9286_9295del (Val3096Leufs*28)" "" "Germline" "" "" "0" "" "" "g.63720799_63720808del" "" "pathogenic" "" "0000358248" "21" "90" "6" "64436477" "64436477" "del" "1.349E-5" "01243" "EYS_000397" "g.64436477del" "" "Sharon, submitted" "" "NM_001292009.1:c.8231del (Gln2744Argfs*18)" "" "Germline" "" "" "0" "" "" "g.63726584del" "" "pathogenic" "" "0000358249" "3" "90" "6" "64436492" "64436493" "del" "0" "01243" "EYS_000088" "g.64436492_64436493del" "" "Sharon, submitted" "" "NM_001292009.1:c.8218_8219del (His2740Tyrfs*27)" "" "Germline" "" "" "0" "" "" "g.63726599_63726600del" "" "pathogenic" "" "0000358250" "3" "90" "6" "64436541" "64436541" "del" "0" "01243" "EYS_000394" "g.64436541del" "" "Sharon, submitted" "" "NM_001292009.1:c.8168del (Asn2723Metfs*39)" "" "Germline" "" "" "0" "" "" "g.63726648del" "" "pathogenic" "" "0000358251" "3" "90" "6" "64694355" "64694355" "subst" "2.63964E-5" "01243" "EYS_000129" "g.64694355G>A" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.63984462G>A" "" "pathogenic" "" "0000358252" "3" "90" "6" "65059869" "65136657" "del" "0" "01243" "EYS_000399" "g.65059869_65136657del" "" "Sharon, submitted" "" "ex 29del" "" "Germline" "" "" "0" "" "" "g.64349976_64426764del" "" "pathogenic" "" "0000358253" "3" "90" "6" "65301398" "65301399" "del" "0" "01243" "EYS_000025" "g.65301398_65301399delinsCT" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.64591505_64591506delinsCT" "" "pathogenic" "" "0000358254" "0" "70" "6" "66005927" "66005927" "subst" "0.000112112" "01243" "EYS_000253" "g.66005927C>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.65296034C>T" "" "likely pathogenic" "" "0000358255" "3" "90" "6" "66063502" "66063502" "subst" "4.07282E-6" "01243" "EYS_000398" "g.66063502G>T" "" "Sharon, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.65353609G>T" "" "pathogenic" "" "0000358256" "0" "90" "6" "66094366" "66094366" "dup" "0" "01243" "EYS_000273" "g.66094366dup" "" "Sharon, submitted" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000358257" "3" "90" "6" "66204861" "66204881" "del" "0" "01243" "EYS_000395" "g.66204861_66204881delinsAAAAG" "" "Sharon, submitted" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000358437" "11" "90" "6" "66204861" "66204881" "del" "0" "01243" "EYS_000395" "g.66204861_66204881delinsAAAAG" "" "Sharon, submitted" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000358438" "0" "90" "6" "66053964" "66053966" "del" "0" "01243" "EYS_000412" "g.66053964_66053966del" "" "Sharon, submitted" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000358439" "0" "90" "6" "66204861" "66204881" "del" "0" "01243" "EYS_000395" "g.66204861_66204881delinsAAAAG" "" "Sharon, submitted" "" "" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000405049" "0" "50" "6" "65298551" "65298551" "subst" "0" "02555" "EYS_000415" "g.65298551G>A" "" "{PMID:Brown 2015:25200001}" "" "" "{DB:Uveo3522?snp=rs665873&t=1535717138}" "Germline" "" "rs665873" "0" "" "" "g.64588658G>A" "" "VUS" "" "0000438550" "1" "90" "6" "65655687" "65655687" "subst" "1.35212E-5" "01244" "EYS_000012" "g.65655687G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.64945794G>A" "" "pathogenic" "" "0000438551" "2" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "01244" "EYS_000096" "g.64472506C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000476523" "0" "50" "6" "64430513" "64430513" "subst" "0.000228219" "02591" "EYS_000416" "g.64430513A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs374161234" "0" "" "" "g.63720617A>C" "" "VUS" "" "0000476524" "3" "90" "6" "64430624" "64430625" "del" "0" "02591" "EYS_000417" "g.64430624_64430625del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63720728_63720729del" "" "pathogenic" "" "0000476525" "0" "90" "6" "64430718" "64430718" "subst" "0.000316673" "02591" "EYS_000049" "g.64430718A>G" "6/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs183589498" "0" "" "" "g.63720822A>G" "" "pathogenic" "" "0000476526" "0" "90" "6" "64430741" "64430742" "del" "0" "02591" "EYS_000050" "g.64430741_64430742del" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63720845_63720846del" "" "pathogenic" "" "0000476527" "0" "50" "6" "64430812" "64430812" "subst" "6.62032E-6" "02591" "EYS_000418" "g.64430812A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63720916A>G" "" "VUS" "" "0000476528" "3" "90" "6" "64430868" "64430868" "subst" "1.32693E-5" "02591" "EYS_000057" "g.64430868A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63720972A>G" "" "pathogenic" "" "0000476529" "0" "90" "6" "64431058" "64431058" "del" "0" "02591" "EYS_000419" "g.64431058del" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721162del" "" "pathogenic" "" "0000476530" "0" "90" "6" "64431067" "64431067" "subst" "0.000245355" "02591" "EYS_000063" "g.64431067A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs79036642" "0" "" "" "g.63721171A>G" "" "pathogenic" "" "0000476531" "0" "90" "6" "64431069" "64431069" "subst" "0" "02591" "EYS_000420" "g.64431069G>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721173G>T" "" "pathogenic" "" "0000476532" "0" "90" "6" "64431115" "64431115" "subst" "0" "02591" "EYS_000065" "g.64431115G>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721219G>T" "" "pathogenic" "" "0000476533" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "02591" "EYS_000066" "g.64431122G>T" "64/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000476534" "0" "90" "6" "64431133" "64431136" "del" "0" "02591" "EYS_000421" "g.64431133_64431136del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721237_63721240del" "" "pathogenic" "" "0000476535" "0" "90" "6" "64431239" "64431239" "del" "0" "02591" "EYS_000422" "g.64431239del" "2/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721343del" "" "pathogenic" "" "0000476536" "0" "50" "6" "64431294" "64431294" "subst" "1.97923E-5" "02591" "EYS_000423" "g.64431294G>C" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721398G>C" "" "VUS" "" "0000476537" "3" "90" "6" "64431382" "64431382" "subst" "0" "02591" "EYS_000424" "g.64431382G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721486G>A" "" "pathogenic" "" "0000476538" "0" "50" "6" "64431458" "64431458" "subst" "0" "02591" "EYS_000425" "g.64431458A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721562A>C" "" "VUS" "" "0000476539" "0" "50" "6" "64431505" "64431505" "subst" "0.00511138" "02591" "EYS_000075" "g.64431505C>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs111991705" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000476540" "0" "50" "6" "64431516" "64431516" "subst" "0" "02591" "EYS_000426" "g.64431516A>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721620A>T" "" "VUS" "" "0000476541" "0" "90" "6" "64431626" "64431629" "del" "0" "02591" "EYS_000427" "g.64431626_64431629del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721730_63721733del" "" "pathogenic" "" "0000476542" "0" "50" "6" "64431649" "64431649" "subst" "0" "02591" "EYS_000428" "g.64431649G>A" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721753G>A" "" "VUS" "" "0000476543" "3" "90" "6" "64431659" "64431663" "del" "0" "02591" "EYS_000429" "g.64431659_64431663del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721763_63721767del" "" "pathogenic" "" "0000476544" "0" "90" "6" "64431683" "64431683" "dup" "0" "02591" "EYS_000430" "g.64431683dup" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721787dup" "" "pathogenic" "" "0000476545" "0" "90" "6" "64431691" "64431691" "subst" "0" "02591" "EYS_000086" "g.64431691C>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63721795C>G" "" "pathogenic" "" "0000476546" "0" "90" "6" "64436439" "64436439" "subst" "6.75521E-6" "02591" "EYS_000087" "g.64436439C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63726546C>G" "" "pathogenic" "" "0000476547" "0" "50" "6" "64436463" "64436463" "subst" "0" "02591" "EYS_000431" "g.64436463C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63726570C>T" "" "VUS" "" "0000476548" "0" "90" "6" "64436502" "64436502" "subst" "2.02481E-5" "02591" "EYS_000432" "g.64436502G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63726609G>A" "" "pathogenic" "" "0000476549" "0" "90" "6" "64436511" "64436515" "del" "0" "02591" "EYS_000400" "g.64436511_64436515del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs751629543" "0" "" "" "g.63726618_63726622del" "" "pathogenic" "" "0000476550" "0" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "02591" "EYS_000096" "g.64472506C>T" "8/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236066" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000476551" "0" "50" "6" "64487924" "64487924" "subst" "0" "02591" "EYS_000433" "g.64487924A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63778031A>C" "" "VUS" "" "0000476552" "0" "90" "6" "64487975" "64487975" "subst" "0" "02591" "EYS_000434" "g.64487975G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63778082G>A" "" "pathogenic" "" "0000476553" "0" "90" "6" "64487987" "64487987" "subst" "2.63671E-5" "02591" "EYS_000099" "g.64487987G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63778094G>A" "" "pathogenic" "" "0000476554" "0" "50" "6" "64488071" "64488071" "subst" "0" "02591" "EYS_000435" "g.64488071A>G" "1/1196 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63778178A>G" "" "VUS" "" "0000476555" "0" "90" "6" "64498056" "64498057" "del" "0" "02591" "EYS_000106" "g.64498056_64498057del" "2/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63788163_63788164del" "" "pathogenic" "" "0000476556" "0" "10" "6" "64498055" "64498055" "subst" "0.094321" "02591" "EYS_000105" "g.64498055T>A" "450/1201 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs66462731" "0" "" "" "g.63788162T>A" "" "benign" "" "0000476557" "0" "50" "6" "64498112" "64498112" "subst" "0.000265873" "02591" "EYS_000108" "g.64498112C>T" "4/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs189406424" "0" "" "" "g.63788219C>T" "" "VUS" "" "0000476558" "0" "90" "6" "64499037" "64499037" "subst" "4.61894E-5" "02591" "EYS_000112" "g.64499037C>G" "3/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63789144C>G" "" "pathogenic" "" "0000476559" "0" "50" "6" "64499075" "64499075" "subst" "4.60581E-5" "02591" "EYS_000436" "g.64499075C>T" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs560012389" "0" "" "" "g.63789182C>T" "" "VUS" "" "0000476560" "0" "50" "6" "64499078" "64499078" "subst" "0" "02591" "EYS_000437" "g.64499078T>A" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63789185T>A" "" "VUS" "" "0000476561" "0" "50" "6" "64516100" "64516100" "subst" "0.000125786" "02591" "EYS_000114" "g.64516100G>C" "104/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs145184183" "0" "" "" "g.63806207G>C" "" "VUS" "" "0000476562" "0" "50" "6" "64574193" "64574193" "subst" "0" "02591" "EYS_000438" "g.64574193A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63864300A>G" "" "VUS" "" "0000476563" "0" "50" "6" "64574242" "64574242" "subst" "6.00344E-5" "02591" "EYS_000491" "g.64574242T>G" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs749617474" "0" "" "" "g.63864349T>G" "" "VUS" "" "0000476564" "0" "90" "6" "64694282" "64694282" "del" "0" "02591" "EYS_000439" "g.64694282del" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236069" "0" "" "" "g.63984389del" "" "pathogenic" "" "0000476565" "0" "50" "6" "64694303" "64694303" "subst" "0" "02591" "EYS_000440" "g.64694303A>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63984410A>T" "" "VUS" "" "0000476566" "0" "10" "6" "64694354" "64694354" "subst" "0.335267" "02591" "EYS_000378" "g.64694354C>T" "500/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs4710457" "0" "" "" "g.63984461C>T" "" "benign" "" "0000476567" "0" "50" "6" "64694355" "64694355" "subst" "2.63964E-5" "02591" "EYS_000129" "g.64694355G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63984462G>A" "" "VUS" "" "0000476568" "0" "50" "6" "64694472" "64694472" "subst" "0" "02591" "EYS_000441" "g.64694472C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.63984579C>T" "" "VUS" "" "0000476569" "0" "90" "6" "64776241" "64776241" "del" "0" "02591" "EYS_000442" "g.64776241del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs752953889" "0" "" "" "g.64066348del" "" "pathogenic" "" "0000476570" "0" "50" "6" "64791757" "64791757" "subst" "0" "02591" "EYS_000143" "g.64791757A>G" "20/1198 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000476571" "0" "90" "6" "64791758" "64791758" "subst" "8.31808E-5" "02591" "EYS_000443" "g.64791758T>C" "3/1198 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs184448644" "0" "" "" "g.64081865T>C" "" "pathogenic" "" "0000476572" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "02591" "EYS_000144" "g.64791763C>T" "35/1198 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236068" "0" "" "" "g.64081870C>T" "" "pathogenic" "" "0000476573" "0" "50" "6" "64940499" "64940499" "subst" "8.14797E-5" "02591" "EYS_000444" "g.64940499C>T" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs369090261" "0" "" "" "g.64230606C>T" "" "VUS" "" "0000476574" "0" "50" "6" "64940527" "64940527" "subst" "0" "02591" "EYS_000445" "g.64940527A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64230634A>G" "" "VUS" "" "0000476575" "0" "50" "6" "65016945" "65016945" "subst" "0" "02591" "EYS_000446" "g.65016945A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64307052A>G" "" "VUS" "" "0000476576" "0" "50" "6" "65098635" "65098635" "subst" "0" "02591" "EYS_000447" "g.65098635T>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64388742T>G" "" "VUS" "" "0000476577" "0" "90" "6" "65146159" "65146159" "subst" "0" "02591" "EYS_000448" "g.65146159C>G" "1/1197 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64436266C>G" "" "pathogenic" "" "0000476578" "0" "10" "6" "65149185" "65149185" "subst" "0.304764" "02591" "EYS_000326" "g.65149185T>A" "538/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9353806" "0" "" "" "g.64439292T>A" "" "benign" "" "0000476579" "0" "10" "6" "65300143" "65300143" "subst" "0.117428" "02591" "EYS_000327" "g.65300143G>C" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs16895517" "0" "" "" "g.64590250G>C" "" "benign" "" "0000476580" "0" "10" "6" "65300516" "65300516" "subst" "0.102029" "02591" "EYS_000176" "g.65300516T>G" "118/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs57312007" "0" "" "" "g.64590623T>G" "" "benign" "" "0000476581" "0" "10" "6" "65300775" "65300775" "subst" "0.00211957" "02591" "EYS_000186" "g.65300775T>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs147641443" "0" "" "" "g.64590882T>A" "" "benign" "" "0000476582" "0" "90" "6" "65300802" "65300802" "dup" "0" "02591" "EYS_000449" "g.65300802dup" "145/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236065" "0" "" "" "g.64590909dup" "" "pathogenic" "" "0000476583" "0" "90" "6" "65300863" "65300863" "subst" "5.4076E-5" "02591" "EYS_000450" "g.65300863T>C" "7/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs77523865" "0" "" "" "g.64590970T>C" "" "pathogenic" "" "0000476584" "0" "50" "6" "65301135" "65301135" "subst" "0" "02591" "EYS_000451" "g.65301135T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64591242T>C" "" "VUS" "" "0000476585" "0" "90" "6" "65301202" "65301202" "del" "0" "02591" "EYS_000452" "g.65301202del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs768092887" "0" "" "" "g.64591309del" "" "pathogenic" "" "0000476586" "0" "10" "6" "65301211" "65301211" "subst" "0.11803" "02591" "EYS_000382" "g.65301211T>C" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62415826" "0" "" "" "g.64591318T>C" "" "benign" "" "0000476587" "0" "10" "6" "65301217" "65301217" "subst" "0.118133" "02591" "EYS_000334" "g.65301217G>A" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62415827" "0" "" "" "g.64591324G>A" "" "benign" "" "0000476588" "0" "50" "6" "65301291" "65301291" "subst" "1.3466E-5" "02591" "EYS_000453" "g.65301291G>A" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs752244384" "0" "" "" "g.64591398G>A" "" "VUS" "" "0000476589" "0" "50" "6" "65301367" "65301367" "subst" "6.75137E-6" "02591" "EYS_000454" "g.65301367C>A" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64591474C>A" "" "VUS" "" "0000476590" "0" "50" "6" "65301397" "65301397" "subst" "0.000432789" "02591" "EYS_000455" "g.65301397T>C" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs183144150" "0" "" "" "g.64591504T>C" "" "VUS" "" "0000476591" "0" "10" "6" "65301408" "65301408" "subst" "0.118167" "02591" "EYS_000335" "g.65301408A>G" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62415828" "0" "" "" "g.64591515A>G" "" "benign" "" "0000476592" "0" "10" "6" "65301504" "65301504" "subst" "0.729456" "02591" "EYS_000337" "g.65301504A>G" "467/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs624851" "0" "" "" "g.64591611A>G" "" "benign" "" "0000476593" "0" "10" "6" "65301679" "65301679" "subst" "0.118095" "02591" "EYS_000339" "g.65301679T>C" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17403955" "0" "" "" "g.64591786T>C" "" "benign" "" "0000476594" "0" "90" "6" "65301751" "65301752" "del" "0" "02591" "EYS_000456" "g.65301751_65301752del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64591858_64591859del" "" "pathogenic" "" "0000476595" "0" "10" "6" "65301787" "65301787" "subst" "0.116824" "02591" "EYS_000342" "g.65301787G>C" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs12663622" "0" "" "" "g.64591894G>C" "" "benign" "" "0000476596" "0" "90" "6" "65303078" "65303078" "subst" "3.33182E-5" "02591" "EYS_000206" "g.65303078A>C" "22/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs368856942" "0" "" "" "g.64593185A>C" "" "pathogenic" "" "0000476597" "0" "10" "6" "65303100" "65303100" "subst" "0.117188" "02591" "EYS_000345" "g.65303100T>C" "352/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17404123" "0" "" "" "g.64593207T>C" "" "benign" "" "0000476598" "0" "50" "6" "65327311" "65327311" "subst" "0" "02591" "EYS_000457" "g.65327311C>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64617418C>G" "" "VUS" "" "0000476599" "0" "90" "6" "65327400" "65327400" "subst" "0" "02591" "EYS_000458" "g.65327400C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64617507C>A" "" "pathogenic" "" "0000476600" "0" "50" "6" "65327409" "65327409" "subst" "0.00136458" "02591" "EYS_000459" "g.65327409A>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs374409854" "0" "" "" "g.64617516A>G" "" "VUS" "" "0000476601" "0" "50" "6" "65336049" "65336049" "subst" "0" "02591" "EYS_000460" "g.65336049T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs748132633" "0" "" "" "g.64626156T>C" "" "VUS" "" "0000476602" "0" "50" "6" "65336093" "65336093" "subst" "0.000682801" "02591" "EYS_000214" "g.65336093A>T" "13/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs150951106" "0" "" "" "g.64626200A>T" "" "VUS" "" "0000476603" "0" "10" "6" "65336143" "65336143" "subst" "0.224189" "02591" "EYS_000002" "g.65336143G>A" "537/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9445051" "0" "" "" "g.64626250G>A" "" "benign" "" "0000476604" "0" "50" "6" "65596621" "65596629" "del" "0" "02591" "EYS_000228" "g.65596621_65596629del" "3/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs756068592" "0" "" "" "g.64886728_64886736del" "" "VUS" "" "0000476605" "0" "50" "6" "65596641" "65596641" "subst" "0" "02591" "EYS_000461" "g.65596641A>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64886748A>T" "" "VUS" "" "0000476606" "0" "90" "6" "65596690" "65596690" "subst" "4.6983E-5" "02591" "EYS_000462" "g.65596690T>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs762212630" "0" "" "" "g.64886797T>G" "" "pathogenic" "" "0000476607" "0" "90" "6" "65596696" "65596696" "subst" "4.70285E-5" "02591" "EYS_000463" "g.65596696G>C" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs766153322" "0" "" "" "g.64886803G>C" "" "pathogenic" "" "0000476608" "0" "10" "6" "65622463" "65622463" "subst" "0.593404" "02591" "EYS_000385" "g.65622463A>G" "573/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9294631" "0" "" "" "g.64912570A>G" "" "benign" "" "0000476609" "0" "50" "6" "65622490" "65622490" "subst" "2.64557E-5" "02591" "EYS_000237" "g.65622490C>T" "148/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000476610" "0" "50" "6" "65622491" "65622491" "subst" "0" "02591" "EYS_000464" "g.65622491C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64912598C>T" "" "VUS" "" "0000476611" "0" "50" "6" "65622619" "65622619" "subst" "0" "02591" "EYS_000465" "g.65622619C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64912726C>A" "" "VUS" "" "0000476612" "0" "90" "6" "65655707" "65655707" "del" "0" "02591" "EYS_000466" "g.65655707del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64945814del" "" "pathogenic" "" "0000476613" "0" "90" "6" "65655727" "65655727" "subst" "0" "02591" "EYS_000467" "g.65655727G>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64945834G>T" "" "pathogenic" "" "0000476614" "0" "50" "6" "65655749" "65655749" "subst" "0" "02591" "EYS_000468" "g.65655749T>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64945856T>C" "" "VUS" "" "0000476615" "0" "50" "6" "65707507" "65707507" "subst" "4.6009E-5" "02591" "EYS_000469" "g.65707507C>G" "1/1180 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.64997614C>G" "" "VUS" "" "0000476616" "0" "50" "6" "65767558" "65767558" "subst" "0" "02591" "EYS_000470" "g.65767558A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65057665A>C" "" "VUS" "" "0000476617" "0" "50" "6" "65767599" "65767599" "subst" "0" "02591" "EYS_000471" "g.65767599A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65057706A>G" "" "VUS" "" "0000476618" "0" "10" "6" "66005794" "66005794" "subst" "0.00322593" "02591" "EYS_000357" "g.66005794C>A" "71/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs144430026" "0" "" "" "g.65295901C>A" "" "benign" "" "0000476619" "0" "10" "6" "66005857" "66005857" "subst" "0.167924" "02591" "EYS_000387" "g.66005857T>A" "175/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17411795" "0" "" "" "g.65295964T>A" "" "benign" "" "0000476620" "0" "10" "6" "66005888" "66005888" "subst" "0.624768" "02591" "EYS_000360" "g.66005888C>T" "179/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9342464" "0" "" "" "g.65295995C>T" "" "benign" "" "0000476621" "0" "50" "6" "66042231" "66042231" "subst" "0.0711035" "02591" "EYS_000472" "g.66042231T>G" "13/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs12207746" "0" "" "" "g.65332338T>G" "" "VUS" "" "0000476622" "0" "50" "6" "66044876" "66044876" "subst" "0" "02591" "EYS_000473" "g.66044876G>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65334983G>C" "" "VUS" "" "0000476623" "0" "10" "6" "66044927" "66044927" "subst" "0.159695" "02591" "EYS_000363" "g.66044927T>C" "206/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs61753610" "0" "" "" "g.65335034T>C" "" "benign" "" "0000476624" "0" "90" "6" "66054036" "66054037" "ins" "0" "02591" "EYS_000474" "g.66054036_66054037insCTTT" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65344143_65344144insCTTT" "" "pathogenic" "" "0000476625" "0" "50" "6" "66054039" "66054044" "del" "0" "02591" "EYS_000475" "g.66054039_66054044del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65344146_65344151del" "" "VUS" "" "0000476626" "0" "50" "6" "66054074" "66054074" "dup" "0" "02591" "EYS_000476" "g.66054074dup" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs781415405" "0" "" "" "g.65344181dup" "" "VUS" "" "0000476627" "0" "50" "6" "66063428" "66063428" "subst" "0.000362372" "02591" "EYS_000266" "g.66063428C>T" "98/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs76754818" "0" "" "" "g.65353535C>T" "" "VUS" "" "0000476628" "0" "10" "6" "66063513" "66063513" "subst" "0.6718" "02591" "EYS_000368" "g.66063513G>A" "548/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs1936439" "0" "" "" "g.65353620G>A" "" "benign" "" "0000476629" "0" "90" "6" "66094278" "66094278" "subst" "0" "02591" "EYS_000477" "g.66094278C>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65384385C>A" "" "pathogenic" "" "0000476630" "0" "50" "6" "66094284" "66094284" "subst" "8.23384E-6" "02591" "EYS_000478" "g.66094284A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs576022124" "0" "" "" "g.65384391A>G" "" "VUS" "" "0000476631" "0" "90" "6" "66094366" "66094366" "dup" "0" "02591" "EYS_000273" "g.66094366dup" "5/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs764163418" "0" "" "" "g.65384473dup" "" "pathogenic" "" "0000476632" "0" "50" "6" "66112402" "66112402" "subst" "0" "02591" "EYS_000479" "g.66112402A>C" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65402509A>C" "" "VUS" "" "0000476633" "0" "90" "6" "66115066" "66115066" "subst" "0" "02591" "EYS_000480" "g.66115066C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65405173C>T" "" "pathogenic" "" "0000476634" "0" "50" "6" "66115118" "66115118" "subst" "3.25977E-5" "02591" "EYS_000481" "g.66115118C>A" "22/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs80095433" "0" "" "" "g.65405225C>A" "" "VUS" "" "0000476635" "0" "90" "6" "66115180" "66115180" "del" "0" "02591" "EYS_000482" "g.66115180del" "5/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65405287del" "" "pathogenic" "" "0000476636" "0" "90" "6" "66204672" "66204672" "subst" "0" "02591" "EYS_000483" "g.66204672C>T" "6/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65494779C>T" "" "pathogenic" "" "0000476637" "0" "90" "6" "66204697" "66204697" "subst" "0" "02591" "EYS_000484" "g.66204697G>A" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65494804G>A" "" "pathogenic" "" "0000476638" "0" "50" "6" "66204718" "66204718" "subst" "0.000170741" "02591" "EYS_000485" "g.66204718T>G" "4/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs749038401" "0" "" "" "g.65494825T>G" "" "VUS" "" "0000476639" "0" "50" "6" "66204778" "66204780" "del" "0" "02591" "EYS_000486" "g.66204778_66204780del" "25/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs780433094" "0" "" "" "g.65494885_65494887del" "" "VUS" "" "0000476640" "3" "90" "6" "66204778" "66204778" "subst" "0" "02591" "EYS_000487" "g.66204778C>A" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65494885C>A" "" "pathogenic" "" "0000476641" "0" "90" "6" "66204854" "66204854" "del" "0" "02591" "EYS_000488" "g.66204854del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65494961del" "" "pathogenic" "" "0000476642" "0" "10" "6" "66204945" "66204945" "subst" "0.208228" "02591" "EYS_000392" "g.66204945G>A" "475/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs12193967" "0" "" "" "g.65495052G>A" "" "benign" "" "0000476643" "0" "50" "6" "66204970" "66204970" "subst" "0.000369904" "02591" "EYS_000414" "g.66204970C>G" "5/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs112609906" "0" "" "" "g.65495077C>G" "" "VUS" "" "0000476644" "0" "90" "6" "66205098" "66205098" "del" "0" "02591" "EYS_000489" "g.66205098del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65495205del" "" "pathogenic" "" "0000476645" "0" "90" "6" "66205163" "66205163" "subst" "0" "02591" "EYS_000296" "g.66205163T>A" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs267601099" "0" "" "" "g.65495270T>A" "" "pathogenic" "" "0000476646" "0" "90" "6" "66205189" "66205190" "del" "0" "02591" "EYS_000490" "g.66205189_66205190del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65495296_65495297del" "" "pathogenic" "" "0000476647" "0" "90" "6" "66205227" "66205227" "subst" "2.84659E-5" "02591" "EYS_000299" "g.66205227C>T" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs528733427" "0" "" "" "g.65495334C>T" "" "pathogenic" "" "0000476648" "0" "90" "6" "66205269" "66205269" "subst" "5.71074E-5" "02591" "EYS_000301" "g.66205269A>G" "2/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs755947942" "0" "" "" "g.65495376A>G" "" "pathogenic" "" "0000477498" "3" "90" "6" "64430718" "64430718" "subst" "0.000316673" "02591" "EYS_000049" "g.64430718A>G" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs183589498" "0" "" "" "g.63720822A>G" "" "pathogenic" "" "0000477499" "3" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "02591" "EYS_000066" "g.64431122G>T" "9/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000477500" "3" "10" "6" "64498055" "64498055" "subst" "0.094321" "02591" "EYS_000105" "g.64498055T>A" "143/1201 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs66462731" "0" "" "" "g.63788162T>A" "" "benign" "" "0000477501" "3" "50" "6" "64516100" "64516100" "subst" "0.000125786" "02591" "EYS_000114" "g.64516100G>C" "5/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs145184183" "0" "" "" "g.63806207G>C" "" "VUS" "" "0000477502" "3" "10" "6" "64694354" "64694354" "subst" "0.335267" "02591" "EYS_000378" "g.64694354C>T" "316/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs4710457" "0" "" "" "g.63984461C>T" "" "benign" "" "0000477503" "3" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "02591" "EYS_000144" "g.64791763C>T" "2/1198 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236068" "0" "" "" "g.64081870C>T" "" "pathogenic" "" "0000477504" "3" "10" "6" "65149185" "65149185" "subst" "0.304764" "02591" "EYS_000326" "g.65149185T>A" "237/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9353806" "0" "" "" "g.64439292T>A" "" "benign" "" "0000477505" "3" "10" "6" "65300143" "65300143" "subst" "0.117428" "02591" "EYS_000327" "g.65300143G>C" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs16895517" "0" "" "" "g.64590250G>C" "" "benign" "" "0000477506" "3" "10" "6" "65300516" "65300516" "subst" "0.102029" "02591" "EYS_000176" "g.65300516T>G" "5/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs57312007" "0" "" "" "g.64590623T>G" "" "benign" "" "0000477507" "3" "90" "6" "65300802" "65300802" "dup" "0" "02591" "EYS_000449" "g.65300802dup" "29/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs527236065" "0" "" "" "g.64590909dup" "" "pathogenic" "" "0000477508" "3" "10" "6" "65301211" "65301211" "subst" "0.11803" "02591" "EYS_000382" "g.65301211T>C" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62415826" "0" "" "" "g.64591318T>C" "" "benign" "" "0000477509" "3" "10" "6" "65301217" "65301217" "subst" "0.118133" "02591" "EYS_000334" "g.65301217G>A" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62415827" "0" "" "" "g.64591324G>A" "" "benign" "" "0000477510" "3" "10" "6" "65301408" "65301408" "subst" "0.118167" "02591" "EYS_000335" "g.65301408A>G" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs62415828" "0" "" "" "g.64591515A>G" "" "benign" "" "0000477511" "3" "10" "6" "65301504" "65301504" "subst" "0.729456" "02591" "EYS_000337" "g.65301504A>G" "630/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs624851" "0" "" "" "g.64591611A>G" "" "benign" "" "0000477512" "3" "10" "6" "65301679" "65301679" "subst" "0.118095" "02591" "EYS_000339" "g.65301679T>C" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17403955" "0" "" "" "g.64591786T>C" "" "benign" "" "0000477513" "3" "10" "6" "65301787" "65301787" "subst" "0.116824" "02591" "EYS_000342" "g.65301787G>C" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs12663622" "0" "" "" "g.64591894G>C" "" "benign" "" "0000477514" "3" "10" "6" "65303100" "65303100" "subst" "0.117188" "02591" "EYS_000345" "g.65303100T>C" "65/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17404123" "0" "" "" "g.64593207T>C" "" "benign" "" "0000477515" "3" "10" "6" "65336143" "65336143" "subst" "0.224189" "02591" "EYS_000002" "g.65336143G>A" "148/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9445051" "0" "" "" "g.64626250G>A" "" "benign" "" "0000477516" "3" "10" "6" "65622463" "65622463" "subst" "0.593404" "02591" "EYS_000385" "g.65622463A>G" "279/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9294631" "0" "" "" "g.64912570A>G" "" "benign" "" "0000477517" "3" "50" "6" "65622490" "65622490" "subst" "2.64557E-5" "02591" "EYS_000237" "g.65622490C>T" "19/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "VUS" "" "0000477518" "3" "10" "6" "66005794" "66005794" "subst" "0.00322593" "02591" "EYS_000357" "g.66005794C>A" "3/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs144430026" "0" "" "" "g.65295901C>A" "" "benign" "" "0000477519" "3" "10" "6" "66005857" "66005857" "subst" "0.167924" "02591" "EYS_000387" "g.66005857T>A" "6/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs17411795" "0" "" "" "g.65295964T>A" "" "benign" "" "0000477520" "3" "10" "6" "66005888" "66005888" "subst" "0.624768" "02591" "EYS_000360" "g.66005888C>T" "1017/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs9342464" "0" "" "" "g.65295995C>T" "" "benign" "" "0000477521" "3" "10" "6" "66044927" "66044927" "subst" "0.159695" "02591" "EYS_000363" "g.66044927T>C" "22/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs61753610" "0" "" "" "g.65335034T>C" "" "benign" "" "0000477522" "3" "50" "6" "66063428" "66063428" "subst" "0.000362372" "02591" "EYS_000266" "g.66063428C>T" "7/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs76754818" "0" "" "" "g.65353535C>T" "" "VUS" "" "0000477523" "3" "10" "6" "66063513" "66063513" "subst" "0.6718" "02591" "EYS_000368" "g.66063513G>A" "378/1202 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs1936439" "0" "" "" "g.65353620G>A" "" "benign" "" "0000477524" "3" "90" "6" "66094366" "66094366" "dup" "0" "02591" "EYS_000273" "g.66094366dup" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs764163418" "0" "" "" "g.65384473dup" "" "pathogenic" "" "0000477525" "3" "90" "6" "66115180" "66115180" "del" "0" "02591" "EYS_000482" "g.66115180del" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65405287del" "" "pathogenic" "" "0000477526" "3" "90" "6" "66204672" "66204672" "subst" "0" "02591" "EYS_000483" "g.66204672C>T" "1/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "g.65494779C>T" "" "pathogenic" "" "0000477527" "3" "50" "6" "66204778" "66204780" "del" "0" "02591" "EYS_000486" "g.66204778_66204780del" "1/1203 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs780433094" "0" "" "" "g.65494885_65494887del" "" "VUS" "" "0000477528" "3" "10" "6" "66204945" "66204945" "subst" "0.208228" "02591" "EYS_000392" "g.66204945G>A" "121/1204 cases with retinitis pigmentosa" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "rs12193967" "0" "" "" "g.65495052G>A" "" "benign" "" "0000497789" "0" "90" "6" "64472482" "64472482" "del" "0" "01807" "EYS_000492" "g.64472482del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.63762589del" "" "pathogenic" "" "0000497790" "0" "90" "6" "66204670" "66204670" "subst" "0" "01807" "EYS_000493" "g.66204670G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.65494777G>A" "" "pathogenic" "" "0000529295" "0" "50" "6" "64430535" "64430535" "subst" "5.4019E-5" "02327" "EYS_000494" "g.64430535C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63720639C>G" "" "VUS" "" "0000529296" "0" "10" "6" "64430690" "64430690" "subst" "0.000904947" "01943" "EYS_000495" "g.64430690T>C" "" "" "" "EYS(NM_001292009.1):c.9300A>G (p.L3100=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63720794T>C" "" "benign" "" "0000529297" "0" "90" "6" "64430770" "64430770" "del" "0" "02330" "EYS_000496" "g.64430770del" "" "" "" "EYS(NM_001292009.2):c.9220delC (p.Q3074Rfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63720874del" "" "pathogenic" "" "0000529299" "0" "50" "6" "64430943" "64430943" "subst" "6.59822E-6" "02330" "EYS_000060" "g.64430943A>T" "" "" "" "EYS(NM_001142800.2):c.8984T>A (p.(Ile2995Asn)), EYS(NM_001292009.2):c.9047T>A (p.I3016N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721047A>T" "" "VUS" "" "0000529300" "0" "10" "6" "64431026" "64431026" "subst" "6.62374E-6" "02330" "EYS_000498" "g.64431026G>A" "" "" "" "EYS(NM_001292009.2):c.8964C>T (p.Y2988=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721130G>A" "" "benign" "" "0000529301" "0" "50" "6" "64431228" "64431228" "subst" "0" "02327" "EYS_000499" "g.64431228C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721332C>T" "" "VUS" "" "0000529302" "0" "10" "6" "64431498" "64431498" "subst" "0.000908445" "01943" "EYS_000074" "g.64431498G>A" "" "" "" "EYS(NM_001142800.1):c.8429C>T (p.(Thr2810Ile)), EYS(NM_001292009.1):c.8492C>T (p.T2831I), EYS(NM_001292009.2):c.8492C>T (p.T2831I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721602G>A" "" "benign" "" "0000529303" "0" "90" "6" "64431515" "64431516" "ins" "0" "02329" "EYS_000500" "g.64431515_64431516insGT" "" "" "" "EYS(NM_001142800.2):c.8412_8413insCA (p.T2805Qfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721619_63721620insGT" "" "pathogenic" "" "0000529304" "0" "50" "6" "64436565" "64436565" "subst" "0.000162441" "01943" "EYS_000501" "g.64436565T>C" "" "" "" "EYS(NM_001292009.1):c.8143A>G (p.I2715V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63726672T>C" "" "VUS" "" "0000529305" "0" "50" "6" "64472507" "64472507" "subst" "0" "02327" "EYS_000502" "g.64472507A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63762614A>C" "" "VUS" "" "0000529306" "0" "50" "6" "64487986" "64487986" "subst" "1.9778E-5" "02330" "EYS_000098" "g.64487986C>T" "" "" "" "EYS(NM_001292009.2):c.7811G>A (p.R2604H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63778093C>T" "" "VUS" "" "0000529307" "0" "70" "6" "64487986" "64487986" "subst" "1.9778E-5" "02327" "EYS_000098" "g.64487986C>T" "" "" "" "EYS(NM_001292009.2):c.7811G>A (p.R2604H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63778093C>T" "" "likely pathogenic" "" "0000529308" "0" "30" "6" "64488046" "64488046" "subst" "0.000105253" "01943" "EYS_000101" "g.64488046G>C" "" "" "" "EYS(NM_001292009.1):c.7751C>G (p.T2584S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63778153G>C" "" "likely benign" "" "0000529309" "0" "10" "6" "64488060" "64488060" "subst" "0.00143504" "02330" "EYS_000102" "g.64488060A>G" "" "" "" "EYS(NM_001292009.1):c.7737T>C (p.T2579=), EYS(NM_001292009.2):c.7737T>C (p.T2579=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63778167A>G" "" "benign" "" "0000529310" "0" "30" "6" "64498113" "64498113" "subst" "0.000153428" "01943" "EYS_000109" "g.64498113G>A" "" "" "" "EYS(NM_001292009.1):c.7608C>T (p.I2536=), EYS(NM_001292009.2):c.7608C>T (p.I2536=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63788220G>A" "" "likely benign" "" "0000529311" "0" "10" "6" "64498161" "64498161" "dup" "0" "02330" "EYS_000503" "g.64498161dup" "" "" "" "EYS(NM_001292009.2):c.7579-12dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63788268dup" "" "benign" "" "0000529312" "0" "50" "6" "64516138" "64516138" "subst" "1.32123E-5" "02327" "EYS_000504" "g.64516138G>T" "" "" "" "EYS(NM_001292009.1):c.7356C>A (p.N2452K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63806245G>T" "" "VUS" "" "0000529313" "0" "50" "6" "64574102" "64574102" "subst" "0.000184064" "02330" "EYS_000119" "g.64574102C>T" "" "" "" "EYS(NM_001292009.2):c.7205G>A (p.R2402K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63864209C>T" "" "VUS" "" "0000529315" "0" "90" "6" "64574212" "64574212" "subst" "1.97881E-5" "01943" "EYS_000123" "g.64574212A>C" "" "" "" "EYS(NM_001292009.1):c.7095T>G (p.Y2365*), EYS(NM_001292009.2):c.7095T>G (p.Y2365*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63864319A>C" "" "pathogenic" "" "0000529316" "0" "90" "6" "64694262" "64694285" "del" "0" "02327" "EYS_000505" "g.64694262_64694285del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63984369_63984392del" "" "pathogenic" "" "0000529317" "0" "30" "6" "64694297" "64694297" "subst" "0.000105851" "01943" "EYS_000506" "g.64694297C>T" "" "" "" "EYS(NM_001292009.1):c.7034G>A (p.R2345H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63984404C>T" "" "likely benign" "" "0000529318" "0" "10" "6" "64694325" "64694325" "subst" "0.000871863" "01943" "EYS_000507" "g.64694325C>T" "" "" "" "EYS(NM_001292009.1):c.7006G>A (p.V2336I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63984432C>T" "" "benign" "" "0000529319" "0" "10" "6" "64694354" "64694354" "subst" "0.335267" "01943" "EYS_000378" "g.64694354C>T" "" "" "" "EYS(NM_001142800.1):c.6977G>A (p.R2326Q), EYS(NM_001142800.2):c.6977G>A (p.R2326Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63984461C>T" "" "benign" "" "0000529320" "0" "10" "6" "64694354" "64694354" "subst" "0.335267" "02325" "EYS_000378" "g.64694354C>T" "" "" "" "EYS(NM_001142800.1):c.6977G>A (p.R2326Q), EYS(NM_001142800.2):c.6977G>A (p.R2326Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63984461C>T" "" "benign" "" "0000529321" "0" "10" "6" "64709088" "64709088" "subst" "0.000191568" "02330" "EYS_000508" "g.64709088A>G" "" "" "" "EYS(NM_001292009.2):c.6726-12T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63999195A>G" "" "benign" "" "0000529322" "0" "10" "6" "64776221" "64776221" "subst" "0.00077927" "01943" "EYS_000320" "g.64776221C>T" "" "" "" "EYS(NM_001292009.1):c.6725+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64066328C>T" "" "benign" "" "0000529323" "0" "50" "6" "64776324" "64776324" "subst" "0.000336941" "02327" "EYS_000139" "g.64776324G>A" "" "" "" "EYS(NM_001142800.1):c.6632C>T (p.S2211L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64066431G>A" "" "VUS" "" "0000529324" "0" "30" "6" "64791868" "64791868" "subst" "0.00249264" "02327" "EYS_000145" "g.64791868T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64081975T>C" "" "likely benign" "" "0000529325" "0" "50" "6" "65016935" "65016935" "subst" "0.00172722" "01943" "EYS_000152" "g.65016935A>T" "" "" "" "EYS(NM_001142800.1):c.6119T>A (p.V2040D), EYS(NM_001292009.2):c.6119T>A (p.V2040D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64307042A>T" "" "VUS" "" "0000529328" "0" "50" "6" "65098614" "65098614" "subst" "0" "02330" "EYS_000510" "g.65098614C>T" "" "" "" "EYS(NM_001292009.1):c.6047G>A (p.G2016D), EYS(NM_001292009.2):c.6047G>A (p.G2016D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64388721C>T" "" "VUS" "" "0000529329" "0" "30" "6" "65098636" "65098636" "subst" "0.00152111" "01943" "EYS_000511" "g.65098636T>C" "" "" "" "EYS(NM_001292009.1):c.6025A>G (p.K2009E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64388743T>C" "" "likely benign" "" "0000529330" "0" "50" "6" "65098704" "65098704" "subst" "0" "02327" "EYS_000512" "g.65098704A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64388811A>T" "" "VUS" "" "0000529331" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "02330" "EYS_000158" "g.65098735T>C" "" "" "" "EYS(NM_001142800.2):c.5928-2A>G, EYS(NM_001292009.1):c.5928-2A>G, EYS(NM_001292009.2):c.5928-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64388842T>C" "" "pathogenic" "" "0000529332" "0" "30" "6" "65149196" "65149196" "subst" "0" "01943" "EYS_000513" "g.65149196A>G" "" "" "" "EYS(NM_001142800.1):c.5694T>C (p.N1898=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64439303A>G" "" "likely benign" "" "0000529333" "0" "30" "6" "65300250" "65300250" "subst" "0.00399083" "02330" "EYS_000168" "g.65300250C>G" "" "" "" "EYS(NM_001142800.1):c.5510G>C (p.W1837S), EYS(NM_001292009.2):c.5510G>C (p.W1837S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590357C>G" "" "likely benign" "" "0000529334" "0" "50" "6" "65300250" "65300250" "subst" "0.00399083" "01943" "EYS_000168" "g.65300250C>G" "" "" "" "EYS(NM_001142800.1):c.5510G>C (p.W1837S), EYS(NM_001292009.2):c.5510G>C (p.W1837S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590357C>G" "" "VUS" "" "0000529335" "0" "30" "6" "65300273" "65300273" "subst" "4.0488E-5" "02330" "EYS_000514" "g.65300273T>C" "" "" "" "EYS(NM_001292009.2):c.5487A>G (p.K1829=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590380T>C" "" "likely benign" "" "0000529336" "0" "30" "6" "65300359" "65300359" "subst" "0.000141982" "01943" "EYS_000171" "g.65300359C>T" "" "" "" "EYS(NM_001292009.1):c.5401G>A (p.A1801T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590466C>T" "" "likely benign" "" "0000529337" "0" "30" "6" "65300443" "65300443" "subst" "0" "01943" "EYS_000515" "g.65300443T>A" "" "" "" "EYS(NM_001142800.1):c.5317A>T (p.N1773Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590550T>A" "" "likely benign" "" "0000529338" "0" "30" "6" "65300498" "65300498" "subst" "3.37182E-5" "02330" "EYS_000516" "g.65300498C>T" "" "" "" "EYS(NM_001292009.2):c.5262G>A (p.P1754=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590605C>T" "" "likely benign" "" "0000529339" "0" "50" "6" "65300527" "65300527" "subst" "0.00022245" "02330" "EYS_000517" "g.65300527C>T" "" "" "" "EYS(NM_001292009.2):c.5233G>A (p.D1745N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590634C>T" "" "VUS" "" "0000529340" "0" "90" "6" "65300662" "65300662" "subst" "0" "02327" "EYS_000182" "g.65300662T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590769T>A" "" "pathogenic" "" "0000529341" "0" "50" "6" "65300769" "65300769" "subst" "0.000232488" "02327" "EYS_000331" "g.65300769G>A" "" "" "" "EYS(NM_001142800.1):c.4991C>T (p.T1664I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590876G>A" "" "VUS" "" "0000529342" "0" "50" "6" "65300943" "65300943" "subst" "0" "02327" "EYS_000518" "g.65300943G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64591050G>T" "" "VUS" "" "0000529344" "0" "10" "6" "65301667" "65301667" "subst" "0.00220368" "02330" "EYS_000338" "g.65301667T>C" "" "" "" "EYS(NM_001142800.1):c.4093A>G (p.K1365E), EYS(NM_001292009.2):c.4093A>G (p.K1365E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64591774T>C" "" "benign" "" "0000529345" "0" "10" "6" "65301824" "65301824" "subst" "0.113446" "01943" "EYS_000383" "g.65301824T>C" "" "" "" "EYS(NM_001142800.1):c.3936A>G (p.T1312=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64591931T>C" "" "benign" "" "0000529346" "0" "50" "6" "65301879" "65301879" "subst" "0" "02330" "EYS_000519" "g.65301879G>C" "" "" "" "EYS(NM_001292009.2):c.3881C>G (p.P1294R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64591986G>C" "" "VUS" "" "0000529347" "0" "10" "6" "65303029" "65303029" "subst" "0.000109213" "02330" "EYS_000520" "g.65303029G>A" "" "" "" "EYS(NM_001292009.2):c.3858C>T (p.D1286=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64593136G>A" "" "benign" "" "0000529348" "0" "30" "6" "65303055" "65303055" "subst" "7.42842E-5" "01943" "EYS_000521" "g.65303055C>A" "" "" "" "EYS(NM_001292009.1):c.3832G>T (p.A1278S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64593162C>A" "" "likely benign" "" "0000529349" "0" "30" "6" "65303078" "65303078" "subst" "0" "01943" "EYS_000522" "g.65303078A>T" "" "" "" "EYS(NM_001292009.1):c.3809T>A (p.V1270D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64593185A>T" "" "likely benign" "" "0000529350" "0" "50" "6" "65327409" "65327409" "subst" "0.00136458" "01943" "EYS_000459" "g.65327409A>G" "" "" "" "EYS(NM_001292009.1):c.3586T>C (p.C1196R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64617516A>G" "" "VUS" "" "0000529351" "0" "90" "6" "65336020" "65336020" "subst" "0" "02330" "EYS_000212" "g.65336020G>A" "" "" "" "EYS(NM_001292009.2):c.3562C>T (p.Q1188*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64626127G>A" "" "pathogenic" "" "0000529352" "0" "50" "6" "65336086" "65336086" "subst" "0" "02330" "EYS_000523" "g.65336086A>T" "" "" "" "EYS(NM_001292009.2):c.3496T>A (p.S1166T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64626193A>T" "" "VUS" "" "0000529353" "0" "10" "6" "65523369" "65523369" "subst" "0.00120908" "02330" "EYS_000524" "g.65523369T>C" "" "" "" "EYS(NM_001292009.2):c.3345A>G (p.E1115=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64813476T>C" "" "benign" "" "0000529354" "0" "50" "6" "65596607" "65596607" "subst" "0.000366888" "01943" "EYS_000525" "g.65596607C>A" "" "" "" "EYS(NM_001292009.1):c.2975G>T (p.C992F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64886714C>A" "" "VUS" "" "0000529355" "0" "30" "6" "65596671" "65596671" "subst" "1.33949E-5" "02327" "EYS_000526" "g.65596671T>C" "" "" "" "EYS(NM_001292009.1):c.2911A>G (p.K971E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64886778T>C" "" "likely benign" "" "0000529356" "0" "10" "6" "65612289" "65612289" "subst" "0" "02330" "EYS_000527" "g.65612289T>G" "" "" "" "EYS(NM_001292009.2):c.2738+8A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64902396T>G" "" "benign" "" "0000529357" "0" "50" "6" "65612371" "65612371" "subst" "0" "02330" "EYS_000528" "g.65612371T>G" "" "" "" "EYS(NM_001292009.2):c.2664A>C (p.E888D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64902478T>G" "" "VUS" "" "0000529358" "0" "50" "6" "65622514" "65622514" "subst" "1.9895E-5" "01943" "EYS_000529" "g.65622514C>T" "" "" "" "EYS(NM_001292009.1):c.2504G>A (p.C835Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64912621C>T" "" "VUS" "" "0000529359" "0" "50" "6" "65622518" "65622518" "subst" "0.000524304" "02327" "EYS_000240" "g.65622518C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64912625C>T" "" "VUS" "" "0000529360" "0" "90" "6" "65655687" "65655687" "subst" "1.35212E-5" "01804" "EYS_000012" "g.65655687G>A" "" "" "" "EYS(NM_001142800.1):c.2380C>T (p.(Arg794*)), EYS(NM_001292009.2):c.2380C>T (p.R794*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64945794G>A" "" "pathogenic" "" "0000529361" "0" "70" "6" "65767506" "65767506" "subst" "0.000748443" "02330" "EYS_000530" "g.65767506C>T" "" "" "" "EYS(NM_001142800.2):c.2137+1G>A, EYS(NM_001292009.2):c.2137+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65057613C>T" "" "likely pathogenic" "" "0000529362" "0" "50" "6" "65767576" "65767576" "subst" "8.59152E-5" "02330" "EYS_000531" "g.65767576A>T" "" "" "" "EYS(NM_001292009.2):c.2068T>A (p.C690S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65057683A>T" "" "VUS" "" "0000529363" "0" "50" "6" "65767616" "65767616" "subst" "3.32385E-5" "02330" "EYS_000532" "g.65767616C>T" "" "" "" "EYS(NM_001292009.2):c.2028G>A (p.T676=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65057723C>T" "" "VUS" "" "0000529364" "0" "10" "6" "65767633" "65767634" "ins" "0.19568" "02327" "EYS_000533" "g.65767633_65767634insA" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65057740_65057741insA" "" "benign" "" "0000529365" "0" "10" "6" "65767633" "65767634" "ins" "0.000883773" "02330" "EYS_000534" "g.65767633_65767634insAA" "" "" "" "EYS(NM_001292009.2):c.2024-14_2024-13insTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65057740_65057741insAA" "" "benign" "" "0000529366" "0" "10" "6" "65767643" "65767643" "dup" "0" "02330" "EYS_000535" "g.65767643dup" "" "" "" "EYS(NM_001292009.2):c.2024-15dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65057750dup" "" "benign" "" "0000529367" "0" "10" "6" "66005888" "66005888" "subst" "0.624768" "02327" "EYS_000360" "g.66005888C>T" "" "" "" "EYS(NM_001142800.1):c.1891G>A (p.G631S), EYS(NM_001142800.2):c.1891G>A (p.G631S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65295995C>T" "" "benign" "" "0000529368" "0" "50" "6" "66005927" "66005927" "subst" "0.000112112" "02330" "EYS_000253" "g.66005927C>T" "" "" "" "EYS(NM_001142800.1):c.1852G>A (p.G618S), EYS(NM_001292009.1):c.1852G>A (p.G618S), EYS(NM_001292009.2):c.1852G>A (p.G618S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65296034C>T" "" "VUS" "" "0000529369" "0" "50" "6" "66005927" "66005927" "subst" "0.000112112" "01943" "EYS_000253" "g.66005927C>T" "" "" "" "EYS(NM_001142800.1):c.1852G>A (p.G618S), EYS(NM_001292009.1):c.1852G>A (p.G618S), EYS(NM_001292009.2):c.1852G>A (p.G618S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65296034C>T" "" "VUS" "" "0000529370" "0" "10" "6" "66042295" "66042295" "subst" "0.000256396" "02330" "EYS_000536" "g.66042295C>T" "" "" "" "EYS(NM_001142801.2):c.1782G>A (p.T594=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65332402C>T" "" "benign" "" "0000529371" "0" "50" "6" "66063413" "66063413" "subst" "0.000126225" "02330" "EYS_000537" "g.66063413T>C" "" "" "" "EYS(NM_001292009.2):c.1397A>G (p.H466R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65353520T>C" "" "VUS" "" "0000529372" "0" "30" "6" "66063473" "66063473" "subst" "0" "01804" "EYS_000538" "g.66063473C>G" "" "" "" "EYS(NM_001142800.1):c.1337G>C (p.(Trp446Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65353580C>G" "" "likely benign" "" "0000529373" "0" "70" "6" "66094277" "66094280" "del" "0" "02330" "EYS_000270" "g.66094277_66094280del" "" "" "" "EYS(NM_001292009.2):c.1299+5_1299+8delGTAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65384384_65384387del" "" "likely pathogenic" "" "0000529374" "0" "30" "6" "66094285" "66094285" "subst" "3.70389E-5" "01804" "EYS_000539" "g.66094285T>A" "" "" "" "EYS(NM_001142800.1):c.1293A>T (p.(Arg431Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65384392T>A" "" "likely benign" "" "0000529375" "0" "10" "6" "66094372" "66094372" "subst" "0" "02330" "EYS_000540" "g.66094372T>C" "" "" "" "EYS(NM_001292009.2):c.1206A>G (p.E402=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65384479T>C" "" "benign" "" "0000529376" "0" "10" "6" "66112409" "66112409" "subst" "0.519806" "02325" "EYS_000390" "g.66112409A>G" "" "" "" "EYS(NM_001142800.2):c.1146T>C (p.N382=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65402516A>G" "" "benign" "" "0000529377" "0" "30" "6" "66112410" "66112410" "subst" "0.0020327" "01943" "EYS_000276" "g.66112410T>A" "" "" "" "EYS(NM_001292009.1):c.1145A>T (p.N382I), EYS(NM_001292009.2):c.1145A>T (p.N382I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65402517T>A" "" "likely benign" "" "0000529378" "0" "10" "6" "66112448" "66112448" "subst" "0.00010612" "02330" "EYS_000541" "g.66112448G>A" "" "" "" "EYS(NM_001292009.1):c.1107C>T (p.S369=), EYS(NM_001292009.2):c.1107C>T (p.S369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65402555G>A" "" "benign" "" "0000529379" "0" "10" "6" "66112517" "66112517" "dup" "0" "02330" "EYS_000542" "g.66112517dup" "" "" "" "EYS(NM_001292009.2):c.1057-13dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65402624dup" "" "benign" "" "0000529380" "0" "30" "6" "66115180" "66115180" "subst" "2.84747E-5" "01943" "EYS_000543" "g.66115180C>T" "" "" "" "EYS(NM_001292009.1):c.943G>A (p.A315T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65405287C>T" "" "likely benign" "" "0000529381" "0" "10" "6" "66115270" "66115270" "dup" "0" "02330" "EYS_000544" "g.66115270dup" "" "" "" "EYS(NM_001292009.2):c.863-4dupT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65405377dup" "" "benign" "" "0000529382" "0" "50" "6" "66200518" "66200518" "subst" "6.50893E-5" "01943" "EYS_000545" "g.66200518A>T" "" "" "" "EYS(NM_001292009.1):c.831T>A (p.S277R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65490625A>T" "" "VUS" "" "0000529383" "0" "90" "6" "66204850" "66204850" "dup" "0" "02330" "EYS_000289" "g.66204850dup" "" "" "" "EYS(NM_001292009.1):c.454dupA (p.M152Nfs*37), EYS(NM_001292009.2):c.454dupA (p.M152Nfs*37)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65494957dup" "" "pathogenic" "" "0000529384" "0" "90" "6" "66204850" "66204850" "dup" "0" "01943" "EYS_000289" "g.66204850dup" "" "" "" "EYS(NM_001292009.1):c.454dupA (p.M152Nfs*37), EYS(NM_001292009.2):c.454dupA (p.M152Nfs*37)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65494957dup" "" "pathogenic" "" "0000529385" "0" "50" "6" "66204898" "66204898" "subst" "1.62549E-5" "02330" "EYS_000546" "g.66204898C>A" "" "" "" "EYS(NM_001292009.2):c.406G>T (p.V136F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495005C>A" "" "VUS" "" "0000529386" "0" "30" "6" "66204904" "66204904" "subst" "6.09533E-5" "01943" "EYS_000547" "g.66204904G>A" "" "" "" "EYS(NM_001292009.1):c.400C>T (p.H134Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495011G>A" "" "likely benign" "" "0000529387" "0" "10" "6" "66205023" "66205023" "subst" "0.00114688" "02330" "EYS_000293" "g.66205023G>T" "" "" "" "EYS(NM_001142800.1):c.281C>A (p.P94Q), EYS(NM_001292009.2):c.281C>A (p.P94Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495130G>T" "" "benign" "" "0000529388" "0" "90" "6" "66205201" "66205201" "subst" "0" "02330" "EYS_000297" "g.66205201G>A" "" "" "" "EYS(NM_001292009.2):c.103C>T (p.Q35*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495308G>A" "" "pathogenic" "" "0000529389" "0" "50" "6" "66205247" "66205247" "subst" "4.07024E-6" "02330" "EYS_000548" "g.66205247T>C" "" "" "" "EYS(NM_001292009.2):c.57A>G (p.I19M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495354T>C" "" "VUS" "" "0000529390" "0" "50" "6" "66205269" "66205269" "subst" "5.71074E-5" "02327" "EYS_000301" "g.66205269A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495376A>G" "" "VUS" "" "0000529391" "0" "90" "6" "66205272" "66205272" "dup" "0" "01943" "EYS_000006" "g.66205272dup" "" "" "" "EYS(NM_001142800.1):c.32dupT (p.M12Dfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495379dup" "" "pathogenic" "" "0000529392" "0" "30" "6" "66205285" "66205285" "subst" "0" "01943" "EYS_000549" "g.66205285C>T" "" "" "" "EYS(NM_001292009.1):c.19G>A (p.V7I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65495392C>T" "" "likely benign" "" "0000610409" "0" "90" "6" "64430943" "64430943" "subst" "6.59822E-6" "02327" "EYS_000060" "g.64430943A>T" "" "" "" "EYS(NM_001142800.2):c.8984T>A (p.(Ile2995Asn)), EYS(NM_001292009.2):c.9047T>A (p.I3016N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721047A>T" "" "pathogenic" "" "0000610410" "0" "90" "6" "64431521" "64431521" "dup" "0" "02327" "EYS_000076" "g.64431521dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721625dup" "" "pathogenic" "" "0000610411" "0" "70" "6" "64431600" "64431600" "dup" "0" "02327" "EYS_000550" "g.64431600dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63721704dup" "" "likely pathogenic" "" "0000610412" "0" "30" "6" "64791889" "64791889" "subst" "6.89998E-6" "01943" "EYS_000552" "g.64791889C>A" "" "" "" "EYS(NM_001292009.1):c.6431G>T (p.G2144V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64081996C>A" "" "likely benign" "" "0000610413" "0" "30" "6" "64940501" "64940501" "subst" "0" "02330" "EYS_000553" "g.64940501G>T" "" "" "" "EYS(NM_001292009.2):c.6408C>A (p.G2136=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64230608G>T" "" "likely benign" "" "0000610414" "0" "30" "6" "65146057" "65146057" "subst" "2.38633E-5" "02330" "EYS_000554" "g.65146057A>G" "" "" "" "EYS(NM_001292009.2):c.5927+10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64436164A>G" "" "likely benign" "" "0000610415" "0" "30" "6" "65149043" "65149043" "subst" "2.58138E-5" "02330" "EYS_000555" "g.65149043T>C" "" "" "" "EYS(NM_001292009.2):c.5835+12A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64439150T>C" "" "likely benign" "" "0000610416" "0" "30" "6" "65300735" "65300735" "subst" "6.13865E-5" "01943" "EYS_000557" "g.65300735A>G" "" "" "" "EYS(NM_001292009.1):c.5025T>C (p.S1675=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590842A>G" "" "likely benign" "" "0000610417" "0" "30" "6" "65301528" "65301528" "subst" "0" "01943" "EYS_000558" "g.65301528A>T" "" "" "" "EYS(NM_001292009.1):c.4232T>A (p.F1411Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64591635A>T" "" "likely benign" "" "0000610418" "0" "30" "6" "65336040" "65336040" "subst" "0" "01943" "EYS_000559" "g.65336040T>C" "" "" "" "EYS(NM_001292009.1):c.3542A>G (p.N1181S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64626147T>C" "" "likely benign" "" "0000610419" "0" "30" "6" "65596671" "65596671" "subst" "1.33949E-5" "01943" "EYS_000526" "g.65596671T>C" "" "" "" "EYS(NM_001292009.1):c.2911A>G (p.K971E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64886778T>C" "" "likely benign" "" "0000610420" "0" "30" "6" "65622420" "65622420" "subst" "0.000423454" "02330" "EYS_000560" "g.65622420G>A" "" "" "" "EYS(NM_001292009.1):c.2598C>T (p.C866=), EYS(NM_001292009.2):c.2598C>T (p.C866=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64912527G>A" "" "likely benign" "" "0000610421" "0" "30" "6" "66045049" "66045049" "subst" "7.7989E-5" "01943" "EYS_000365" "g.66045049C>T" "" "" "" "EYS(NM_001292009.1):c.1600-10G>A, EYS(NM_001292009.2):c.1600-10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65335156C>T" "" "likely benign" "" "0000610422" "0" "30" "6" "66063346" "66063346" "subst" "0.000513598" "02330" "EYS_000008" "g.66063346G>A" "" "" "" "EYS(NM_001292009.1):c.1459+5C>T, EYS(NM_001292009.2):c.1459+5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65353453G>A" "" "likely benign" "" "0000621739" "0" "30" "6" "64694370" "64694370" "subst" "0.000158255" "01943" "EYS_000551" "g.64694370T>G" "" "" "" "EYS(NM_001292009.1):c.6961A>C (p.I2321L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.63984477T>G" "" "likely benign" "" "0000621740" "0" "50" "6" "65300616" "65300616" "subst" "0" "01943" "EYS_000556" "g.65300616T>C" "" "" "" "EYS(NM_001292009.1):c.5144A>G (p.E1715G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590723T>C" "" "VUS" "" "0000621741" "0" "90" "6" "66063430" "66063430" "dup" "0" "02330" "EYS_000561" "g.66063430dup" "" "" "" "EYS(NM_001292009.2):c.1380dupC (p.C461Lfs*12)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65353537dup" "" "pathogenic" "" "0000652025" "1" "50" "6" "65612302" "65612302" "subst" "0.0263463" "03575" "EYS_000562" "g.65612302A>G" "237/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 237 heterozygous; {DB:CLININrs75634595}" "Germline" "" "rs75634595" "0" "" "" "g.64902409A>G" "" "VUS" "" "0000652026" "1" "90" "6" "65767589" "65767589" "subst" "0" "03575" "EYS_000563" "g.65767589A>T" "1/2786 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs372354156}" "Germline" "" "rs372354156" "0" "" "" "g.65057696A>T" "" "pathogenic" "" "0000652027" "1" "10" "6" "66005794" "66005794" "subst" "0.00322593" "03575" "EYS_000357" "g.66005794C>A" "10/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "10 heterozygous, no homozygous; {DB:CLININrs144430026}" "Germline" "" "rs144430026" "0" "" "" "g.65295901C>A" "" "benign" "" "0000652028" "1" "90" "6" "66204814" "66204814" "subst" "8.13054E-6" "03575" "EYS_000288" "g.66204814G>A" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs794727631}" "Germline" "" "rs794727631" "0" "" "" "g.65494921G>A" "" "pathogenic" "" "0000652029" "1" "50" "6" "66205761" "66205761" "subst" "0" "03575" "EYS_000564" "g.66205761T>C" "7/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "7 heterozygous, no homozygous; {DB:CLININrs370140172}" "Germline" "" "rs370140172" "0" "" "" "g.65495868T>C" "" "VUS" "" "0000653483" "0" "90" "6" "65016880" "65016880" "subst" "0" "01807" "EYS_000565" "g.65016880A>C" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.64306987A>C" "" "pathogenic" "" "0000655631" "0" "30" "6" "65300145" "65300145" "subst" "0.000819907" "01943" "EYS_000405" "g.65300145A>G" "" "" "" "EYS(NM_001292009.1):c.5615T>C (p.I1872T), EYS(NM_001292009.2):c.5615T>C (p.I1872T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590252A>G" "" "likely benign" "" "0000655632" "0" "30" "6" "65300404" "65300404" "subst" "6.76627E-6" "01943" "EYS_000406" "g.65300404C>T" "" "" "" "EYS(NM_001292009.1):c.5356G>A (p.E1786K), EYS(NM_001292009.2):c.5356G>A (p.E1786K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64590511C>T" "" "likely benign" "" "0000655633" "0" "50" "6" "65336089" "65336089" "subst" "5.99925E-5" "01943" "EYS_000566" "g.65336089A>G" "" "" "" "EYS(NM_001292009.1):c.3493T>C (p.C1165R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64626196A>G" "" "VUS" "" "0000655634" "0" "30" "6" "65622405" "65622405" "subst" "0.002376" "01943" "EYS_000350" "g.65622405G>A" "" "" "" "EYS(NM_001292009.1):c.2613C>T (p.D871=), EYS(NM_001292009.2):c.2613C>T (p.D871=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64912512G>A" "" "likely benign" "" "0000655635" "0" "30" "6" "65622420" "65622420" "subst" "0.000423454" "01943" "EYS_000560" "g.65622420G>A" "" "" "" "EYS(NM_001292009.1):c.2598C>T (p.C866=), EYS(NM_001292009.2):c.2598C>T (p.C866=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.64912527G>A" "" "likely benign" "" "0000655636" "0" "90" "6" "66044998" "66045001" "del" "0" "02330" "EYS_000567" "g.66044998_66045001del" "" "" "" "EYS(NM_001142800.2):c.1641_1644del (p.(Ser547Argfs*62)), EYS(NM_001292009.2):c.1641_1644delTCAG (p.S547Rfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.65335105_65335108del" "" "pathogenic" "" "0000659798" "0" "90" "6" "64431281" "64431282" "del" "0" "01807" "EYS_000568" "g.64431281_64431282del" "" "" "" "8648_8649delCA" "" "Unknown" "" "" "0" "" "" "g.63721385_63721386del" "" "pathogenic" "" "0000659799" "0" "70" "6" "64497997" "64497997" "subst" "0" "01807" "EYS_000103" "g.64497997C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.63788104C>T" "" "likely pathogenic" "" "0000666145" "0" "90" "6" "65149117" "65149117" "subst" "0" "01807" "EYS_000569" "g.65149117G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.64439224G>A" "" "pathogenic" "" "0000669929" "3" "50" "6" "65612302" "65612302" "subst" "0.0263463" "03575" "EYS_000562" "g.65612302A>G" "7/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 7 homozygous; {DB:CLININrs75634595}" "Germline" "" "rs75634595" "0" "" "" "g.64902409A>G" "" "VUS" "" "0000677822" "0" "90" "6" "64430522" "64430522" "subst" "1.67165E-5" "01943" "EYS_000020" "g.64430522A>T" "" "" "" "EYS(NM_001292009.1):c.9468T>A (p.Y3156*), EYS(NM_001292009.2):c.9468T>A (p.Y3156*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000677823" "0" "30" "6" "64430556" "64430556" "subst" "4.20156E-5" "01943" "EYS_000570" "g.64430556A>G" "" "" "" "EYS(NM_001292009.1):c.9434T>C (p.I3145T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677824" "0" "30" "6" "64430742" "64430742" "subst" "0.000145163" "01943" "EYS_000571" "g.64430742T>C" "" "" "" "EYS(NM_001292009.1):c.9248A>G (p.N3083S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677825" "0" "50" "6" "64431636" "64431636" "subst" "0" "02327" "EYS_000572" "g.64431636C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677826" "0" "30" "6" "64436584" "64436584" "subst" "0" "02327" "EYS_000573" "g.64436584G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677827" "0" "30" "6" "64516138" "64516138" "subst" "1.32123E-5" "01943" "EYS_000504" "g.64516138G>T" "" "" "" "EYS(NM_001292009.1):c.7356C>A (p.N2452K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677828" "0" "30" "6" "65146162" "65146162" "subst" "2.82777E-5" "01943" "EYS_000574" "g.65146162T>A" "" "" "" "EYS(NM_001292009.1):c.5836-4A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677829" "0" "30" "6" "65301100" "65301100" "subst" "0" "01943" "EYS_000575" "g.65301100G>C" "" "" "" "EYS(NM_001292009.1):c.4660C>G (p.Q1554E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677830" "0" "90" "6" "65301206" "65301206" "del" "0" "02330" "EYS_000194" "g.65301206del" "" "" "" "EYS(NM_001292009.2):c.4557delA (p.A1520Pfs*30)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000677831" "0" "50" "6" "65301854" "65301854" "subst" "0" "01943" "EYS_000021" "g.65301854G>T" "" "" "" "EYS(NM_001292009.1):c.3906C>A (p.H1302Q), EYS(NM_001292009.2):c.3906C>A (p.H1302Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677832" "0" "50" "6" "65596621" "65596629" "del" "0" "02327" "EYS_000228" "g.65596621_65596629del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000677833" "0" "30" "6" "66005908" "66005908" "subst" "0.000191031" "01943" "EYS_000252" "g.66005908G>A" "" "" "" "EYS(NM_001292009.1):c.1871C>T (p.S624L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677834" "0" "10" "6" "66063331" "66063331" "subst" "0.00361417" "02327" "EYS_000576" "g.66063331A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000677835" "0" "90" "6" "66094373" "66094373" "dup" "0" "02327" "EYS_000273" "g.66094373dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000684415" "1" "70" "6" "66044966" "66044966" "subst" "0.000118405" "00004" "EYS_000259" "g.66044966C>T" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "rs201823777" "0" "" "" "g.65335073C>T" "" "likely pathogenic (recessive)" "" "0000684434" "2" "70" "6" "65707500" "65707500" "subst" "0.000801619" "00004" "EYS_000243" "g.65707500T>C" "" "{PMID:Boulanger-Scemama 2015:26103963}, {PMID:Boulanger-Scemama 2019:31574917}" "" "" "" "Germline" "" "rs201652272" "0" "" "" "g.64997607T>C" "" "likely pathogenic (recessive)" "" "0000684525" "1" "70" "6" "65596607" "65596607" "subst" "0.000366888" "00004" "EYS_000525" "g.65596607C>A" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.64886714C>A" "" "likely pathogenic" "" "0000684526" "1" "70" "6" "65523387" "65523387" "subst" "0" "00004" "EYS_000586" "g.65523387G>T" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.64813494G>T" "" "likely pathogenic" "" "0000684527" "1" "70" "6" "65149088" "65149088" "del" "0" "00004" "EYS_000583" "g.65149088del" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "c.5802delT" "" "Germline" "" "" "0" "" "" "g.64439195del" "" "likely pathogenic" "" "0000684528" "1" "70" "6" "64431273" "64431280" "del" "0" "00004" "EYS_000071" "g.64431273_64431280del" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "NM_001292009.1:c.8711_8718del" "" "Germline" "" "" "0" "" "" "g.63721377_63721384del" "" "likely pathogenic" "" "0000684529" "1" "70" "6" "64430763" "64430764" "del" "0" "00004" "EYS_000578" "g.64430763_64430764del" "1/899 cases" "{PMID:Holtan 2020:31429209}" "" "" "" "Germline" "" "" "0" "" "" "g.63720867_63720868del" "" "likely pathogenic" "" "0000684654" "3" "70" "6" "64431210" "64431217" "del" "0" "00004" "EYS_000579" "g.64431210_64431217del" "3/899 cases" "{PMID:Holtan 2020:31429209}" "" "c.8710_8717del8" "" "Germline" "" "" "0" "" "" "g.63721314_63721321del" "" "likely pathogenic (recessive)" "" "0000684661" "1" "90" "6" "64430559" "64430559" "del" "0" "00004" "EYS_000577" "g.64430559del" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "c.9368delA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000684662" "1" "70" "6" "64791757" "64791757" "subst" "0" "00004" "EYS_000143" "g.64791757A>G" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000684663" "1" "90" "6" "65622496" "65622496" "dup" "0" "00004" "EYS_000238" "g.65622496dup" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "c.2522_2523insA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000684664" "3" "90" "6" "65300803" "65300803" "dup" "0" "00004" "EYS_000187" "g.65300803dup" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "c.4957_4958insA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000684697" "0" "50" "6" "64694306" "64694306" "subst" "0" "00004" "EYS_000580" "g.64694306T>G" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000684698" "0" "70" "6" "64791757" "64791757" "subst" "0" "00004" "EYS_000143" "g.64791757A>G" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000684699" "2" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00004" "EYS_000144" "g.64791763C>T" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000684700" "2" "90" "6" "65622638" "65622638" "subst" "0" "00004" "EYS_000587" "g.65622638T>A" "1/86 cases" "{PMID:Kim 2019:31144483}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000685192" "0" "90" "6" "0" "0" "" "0" "00004" "LAMA2_000000" "g.?" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "c.2138_3443del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685193" "0" "90" "6" "0" "0" "" "0" "00004" "LAMA2_000000" "g.?" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "c.6425_6725del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685194" "0" "90" "6" "65016207" "65030194" "dup" "0" "00004" "EYS_000581" "g.65016207_65030194dup" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685195" "0" "70" "6" "64430535" "64430535" "subst" "5.4019E-5" "00004" "EYS_000494" "g.64430535C>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.9392G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685196" "0" "90" "6" "64430569" "64430578" "del" "0" "00004" "EYS_000397" "g.64430569_64430578del" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.9349_9358del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685197" "0" "90" "6" "64430632" "64430641" "del" "0.000173997" "00004" "EYS_000397" "g.64430632_64430641del" "4/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.9286_9295del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685198" "0" "70" "6" "64431252" "64431252" "subst" "0" "00004" "EYS_000397" "g.64431252G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8675T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685199" "0" "70" "6" "64431604" "64431609" "del" "0" "00004" "EYS_000397" "g.64431604_64431609del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8318_8323del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685200" "0" "90" "6" "64436414" "64436414" "del" "0" "00004" "EYS_000397" "g.64436414del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8231del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685201" "0" "90" "6" "64436415" "64436415" "subst" "0" "00004" "EYS_000397" "g.64436415G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8230C>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685202" "0" "90" "6" "64436426" "64436427" "del" "0" "00004" "EYS_000397" "g.64436426_64436427del" "6/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8218_8219del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685203" "0" "90" "6" "64436477" "64436477" "del" "1.349E-5" "00004" "EYS_000397" "g.64436477del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8168del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685204" "0" "90" "6" "64436477" "64436477" "del" "1.349E-5" "00004" "EYS_000397" "g.64436477del" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.8168del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685205" "0" "90" "6" "0" "0" "" "0" "00004" "LAMA2_000000" "g.?" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "NM_001292009.1:c.749_8296del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685206" "0" "90" "6" "64694355" "64694355" "subst" "2.63964E-5" "00004" "EYS_000129" "g.64694355G>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685207" "0" "90" "6" "65016917" "65016917" "subst" "0" "00004" "EYS_000010" "g.65016917C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685208" "0" "70" "6" "65016935" "65016935" "subst" "0.00172722" "00004" "EYS_000152" "g.65016935A>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685209" "0" "90" "6" "65059867" "65136655" "del" "0" "00004" "EYS_000582" "g.65059867_65136655del" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685210" "0" "90" "6" "65300310" "65300310" "subst" "0" "00004" "EYS_000584" "g.65300310C>T" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685211" "0" "90" "6" "65301398" "65301399" "delins" "0" "00004" "EYS_000025" "g.65301398_65301399delinsCT" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685212" "0" "90" "6" "65303172" "65303172" "subst" "0" "00004" "EYS_000207" "g.65303172C>A" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685213" "0" "90" "6" "65376653" "65743428" "del" "0" "00004" "EYS_000585" "g.65376653_65743428del" "3/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685214" "0" "90" "6" "65707474" "65707474" "subst" "4.60072E-5" "00004" "EYS_000242" "g.65707474C>T" "2/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685215" "0" "90" "6" "65767506" "65767506" "subst" "0.000748443" "00004" "EYS_000530" "g.65767506C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685216" "0" "90" "6" "66005818" "66005818" "dup" "0" "00004" "EYS_000588" "g.66005818dup" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685217" "0" "70" "6" "66005927" "66005927" "subst" "0.000112112" "00004" "EYS_000253" "g.66005927C>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685218" "0" "70" "6" "66053967" "66053969" "del" "1.22562E-5" "00004" "EYS_000412" "g.66053967_66053969del" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000685219" "0" "90" "6" "66063502" "66063502" "subst" "4.07282E-6" "00004" "EYS_000398" "g.66063502G>T" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685220" "0" "90" "6" "66094366" "66094367" "ins" "1.64451E-5" "00004" "EYS_000273" "g.66094366_66094367insT" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "c.1211_1212insA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000685221" "0" "90" "6" "66204881" "66204901" "delins" "0" "00004" "EYS_000395" "g.66204881_66204901delinsAAAAG" "18/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "ACMG" "0000686011" "3" "90" "6" "64430632" "64430641" "del" "0.000173997" "00006" "EYS_000046" "g.64430632_64430641del" "" "{PMID:Kimchi 2018:29276052}" "" "9286_95del10 (Val3096Luefs*28)" "" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic (recessive)" "" "0000686041" "3" "90" "6" "64430633" "64430642" "del" "0" "00006" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Kimchi 2018:29276052}" "" "9286_95del10 (Val3096Luefs*28)" "" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic (recessive)" "" "0000686042" "3" "90" "6" "64430633" "64430642" "del" "0" "00006" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Kimchi 2018:29276052}" "" "9286_95del10 (Val3096Luefs*28)" "" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic (recessive)" "" "0000686043" "3" "90" "6" "64430633" "64430642" "del" "0" "00006" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Kimchi 2018:29276052}" "" "9286_95del10 (Val3096Luefs*28)" "" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic (recessive)" "" "0000689778" "0" "50" "6" "65098611" "65098611" "subst" "2.83214E-5" "02330" "EYS_000154" "g.65098611C>A" "" "" "" "EYS(NM_001292009.2):c.6050G>T (p.G2017V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000710267" "0" "50" "6" "65523464" "65523464" "subst" "6.85486E-5" "00006" "EYS_000219" "g.65523464T>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.64813571T>G" "" "VUS" "" "0000710349" "1" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "00006" "EYS_000216" "g.65523270C>A" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0000710367" "0" "50" "6" "65301358" "65301358" "subst" "8.77122E-5" "00006" "EYS_000199" "g.65301358C>G" "1/143 cases" "{PMID:Zenteno 2020:31736247}" "" "" "" "Germline" "" "" "0" "" "" "g.64591465C>G" "" "VUS" "" "0000713271" "0" "90" "6" "64472431" "64472431" "subst" "0" "00000" "EYS_000595" "g.64472431C>T" "" "{PMID:Carss 2017:28041643}" "" "6:64472431C>T ENST00000503581.1:c.7994G>A (Gly2665Glu)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713292" "3" "90" "6" "66204814" "66204814" "subst" "8.13054E-6" "00000" "EYS_000288" "g.66204814G>A" "" "{PMID:Carss 2017:28041643}" "" "6:66204814G>A ENST00000503581.1:c.490C>T (Arg164Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713348" "0" "90" "6" "64431559" "64431559" "subst" "0" "00000" "EYS_000594" "g.64431559T>C" "" "{PMID:Carss 2017:28041643}" "" "6:64431559T>C ENST00000503581.1:c.8368A>G (Arg2790Gly)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713399" "0" "90" "6" "64431309" "64431309" "subst" "0" "00000" "EYS_000593" "g.64431309T>C" "" "{PMID:Carss 2017:28041643}" "" "6:64431309T>C ENST00000503581.1:c.8618A>G (Asp2873Gly)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713425" "3" "90" "6" "66094367" "66094367" "del" "0" "00000" "EYS_000604" "g.66094367del" "" "{PMID:Carss 2017:28041643}" "" "6:66094366GT>G ENST00000503581.1:c.1211delA (Asn404ThrfsTer17)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713497" "0" "90" "6" "65300419" "65300443" "delins" "0" "00000" "EYS_000601" "g.65300419_65300443delinsA" "" "{PMID:Carss 2017:28041643}" "" "6:65300418ACTGAGCCTGTCAATGGTGGCAGATT>TA ENST00000503581.1:c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA (Asn1773_Val1781delinsTer)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713505" "3" "90" "6" "65098734" "65098736" "del" "0" "00000" "EYS_000324" "g.65098734_65098736del" "" "{PMID:Carss 2017:28041643}" "" "6:65098733CCTG>C ENST00000503581.1:c.5928-3_5928-1delCAG" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713556" "3" "90" "6" "66005779" "66005779" "subst" "0.000294867" "00000" "EYS_000356" "g.66005779C>T" "" "{PMID:Carss 2017:28041643}" "" "6:66005779C>T ENST00000503581.1:c.2000G>A (Arg667His)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713567" "0" "70" "6" "65300250" "65300250" "subst" "0.00399083" "00000" "EYS_000168" "g.65300250C>G" "" "{PMID:Carss 2017:28041643}" "" "6:65300250C>G ENST00000503581.1:c.5510G>C (Trp1837Ser)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000713604" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Carss 2017:28041643}" "" "6:65098735T>C ENST00000503581.1:c.5928-2A>G" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713631" "1" "90" "6" "64475599" "64501270" "del" "0" "00000" "EYS_000591" "g.64475599_64501270del" "" "{PMID:Carss 2017:28041643}, {PMID:Turro 2020:32581362}" "" "chr6:64475599-64501270del" "" "Germline" "" "" "0" "" "" "g.63765706_63791377del" "" "pathogenic (recessive)" "" "0000713653" "0" "90" "6" "64791818" "64791818" "subst" "0" "00000" "EYS_000598" "g.64791818C>A" "" "{PMID:Carss 2017:28041643}" "" "6:64791818C>A ENST00000503581.1:c.6502G>T (Glu2168Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713661" "0" "90" "6" "64791775" "64791775" "del" "0" "00000" "EYS_000597" "g.64791775del" "" "{PMID:Carss 2017:28041643}" "" "6:64791774GT>G ENST00000503581.1:c.6545delA (Asn2182ThrfsTer3)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713662" "1" "90" "6" "64791847" "64791847" "subst" "3.3745E-5" "00000" "EYS_000590" "g.64791847A>G" "" "{PMID:Carss 2017:28041643}, {PMID:Turro 2020:32581362}" "" "6:64791847A>G ENST00000503581.1:c.6473T>C (Leu2158Pro)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713691" "0" "90" "6" "65596606" "65596606" "subst" "0" "00000" "EYS_000603" "g.65596606A>T" "" "{PMID:Carss 2017:28041643}" "" "6:65596606A>T ENST00000503581.1:c.2976T>A (Cys992Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713730" "0" "90" "6" "64574212" "64574212" "subst" "1.97881E-5" "00000" "EYS_000123" "g.64574212A>C" "" "{PMID:Carss 2017:28041643}" "" "6:64574212A>C ENST00000503581.1:c.7095T>G (Tyr2365Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713753" "0" "90" "6" "64694394" "64694394" "subst" "0" "00000" "EYS_000596" "g.64694394G>A" "" "{PMID:Carss 2017:28041643}" "" "6:64694394G>A ENST00000503581.1:c.6937C>T (Gln2313Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713754" "0" "90" "6" "66204691" "66204691" "subst" "0" "00000" "EYS_000605" "g.66204691G>A" "" "{PMID:Carss 2017:28041643}" "" "6:66204691G>A ENST00000503581.1:c.613C>T (Pro205Ser)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713809" "0" "90" "6" "65622398" "65622398" "subst" "3.30986E-5" "00000" "EYS_000236" "g.65622398G>A" "" "{PMID:Carss 2017:28041643}" "" "6:65622398G>A ENST00000503581.1:c.2620C>T (Gln874Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713839" "3" "90" "6" "66115146" "66115146" "subst" "0.00181254" "00000" "EYS_000277" "g.66115146C>T" "" "{PMID:Carss 2017:28041643}" "" "6:66115146C>T ENST00000503581.1:c.977G>A (Ser326Asn)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713848" "0" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Carss 2017:28041643}" "" "6:65301715G>A ENST00000503581.1:c.4045C>T (Arg1349Ter)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000713849" "0" "70" "6" "65303112" "65303112" "subst" "0" "00000" "EYS_000602" "g.65303112G>A" "" "{PMID:Carss 2017:28041643}" "" "6:65303112G>A ENST00000503581.1:c.3775C>T (Gln1259Ter)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000713865" "0" "90" "6" "65300352" "65300352" "subst" "0" "00000" "EYS_000600" "g.65300352G>C" "" "{PMID:Carss 2017:28041643}" "" "6:65300352G>C ENST00000503581.1:c.5408C>G (Ser1803Ter)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713881" "2" "90" "6" "64491812" "64513698" "del" "0" "00000" "EYS_000592" "g.64491812_64513698del" "" "{PMID:Carss 2017:28041643}, {PMID:Turro 2020:32581362}" "" "Deletion 6:64491812-64513698" "" "Germline" "" "" "0" "" "" "g.63781919_63803805del" "" "pathogenic (recessive)" "" "0000713900" "0" "90" "6" "64940586" "64940586" "subst" "2.02514E-5" "00000" "EYS_000599" "g.64940586C>T" "" "{PMID:Carss 2017:28041643}" "" "6:64940586C>T ENST00000503581.1:c.6323G>A (Cys2108Tyr)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000713901" "2" "90" "6" "65602819" "65658187" "del" "0" "00000" "EYS_000589" "g.65602819_65658187del" "" "{PMID:Carss 2017:28041643}, {PMID:Turro 2020:32581362}" "" "chr6:65602819-65658187del" "" "Germline" "" "" "0" "" "" "g.64892926_64948294del" "" "pathogenic (recessive)" "" "0000721034" "0" "50" "6" "64430518" "64430518" "subst" "0" "02327" "EYS_000606" "g.64430518C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721035" "0" "90" "6" "64430825" "64430825" "dup" "0" "02329" "EYS_000497" "g.64430825dup" "" "" "" "EYS(NM_001292009.2):c.9165dupT (p.N3056*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000721036" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "02330" "EYS_000026" "g.64574078C>T" "" "" "" "EYS(NM_001292009.2):c.7228+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000721037" "0" "50" "6" "64574114" "64574114" "subst" "0" "02327" "EYS_000609" "g.64574114C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721038" "0" "90" "6" "64574212" "64574212" "subst" "1.97881E-5" "02329" "EYS_000123" "g.64574212A>C" "" "" "" "EYS(NM_001292009.1):c.7095T>G (p.Y2365*), EYS(NM_001292009.2):c.7095T>G (p.Y2365*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000721039" "0" "30" "6" "65300869" "65300869" "subst" "0.000837928" "01943" "EYS_000003" "g.65300869G>A" "" "" "" "EYS(NM_001292009.1):c.4891C>T (p.P1631S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721040" "0" "30" "6" "65301020" "65301020" "subst" "0" "01943" "EYS_000612" "g.65301020G>C" "" "" "" "EYS(NM_001292009.1):c.4740C>G (p.S1580=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721041" "0" "50" "6" "66044979" "66044979" "subst" "0.00021639" "01943" "EYS_000388" "g.66044979A>T" "" "" "" "EYS(NM_001292009.1):c.1660T>A (p.C554S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000721042" "0" "30" "6" "66054051" "66054051" "subst" "1.63595E-5" "01943" "EYS_000616" "g.66054051G>A" "" "" "" "EYS(NM_001292009.1):c.1479C>T (p.C493=), EYS(NM_001292009.2):c.1479C>T (p.C493=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000721043" "0" "90" "6" "66063367" "66063367" "subst" "0" "02330" "EYS_000617" "g.66063367C>T" "" "" "" "EYS(NM_001292009.2):c.1443G>A (p.W481*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000729722" "3" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236066" "0" "" "" "g.63762613C>T" "" "pathogenic" "" "0000729723" "3" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729724" "1" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000729725" "1" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729726" "3" "90" "6" "65327422" "65327422" "subst" "0" "00000" "EYS_000613" "g.65327422C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "" "0" "" "" "g.64617529C>T" "" "pathogenic" "" "0000729727" "1" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236068" "0" "" "" "g.64081870C>T" "" "pathogenic" "" "0000729728" "1" "90" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>C" "" "pathogenic" "" "0000729729" "3" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729730" "3" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729731" "3" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729732" "1" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729733" "1" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729734" "1" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729735" "1" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000729736" "1" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000729737" "1" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729738" "1" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236067" "0" "" "" "g.63721226G>T" "" "pathogenic" "" "0000729739" "1" "70" "6" "64499078" "64499078" "subst" "0" "00000" "EYS_000437" "g.64499078T>A" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "" "0" "" "" "g.63789185T>A" "" "likely pathogenic" "" "0000729740" "1" "70" "6" "64472524" "64472524" "subst" "0" "00000" "EYS_000608" "g.64472524C>G" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "" "0" "" "" "g.63762631C>G" "" "likely pathogenic" "" "0000729741" "1" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236068" "0" "" "" "g.64081870C>T" "" "pathogenic" "" "0000729742" "1" "90" "6" "65300241" "65300241" "subst" "0" "00000" "EYS_000611" "g.65300241C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "" "0" "" "" "g.64590348C>T" "" "pathogenic" "" "0000729767" "3" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729768" "2" "90" "6" "66005755" "66005755" "subst" "0" "00000" "EYS_000615" "g.66005755C>A" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "" "0" "" "" "g.65295862C>A" "" "pathogenic" "" "0000729769" "2" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729770" "2" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729771" "2" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729772" "2" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729773" "2" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729774" "2" "90" "6" "65098673" "65098673" "subst" "0" "00000" "EYS_000610" "g.65098673G>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "" "0" "" "" "g.64388780G>T" "" "pathogenic" "" "0000729775" "2" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs527236068" "0" "" "" "g.64081870C>T" "" "pathogenic" "" "0000729776" "2" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729777" "2" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729778" "2" "90" "6" "65301738" "65301738" "del" "0" "00000" "EYS_000204" "g.65301738del" "" "{PMID:Maeda 2018:29785639}" "" "c.4022delC" "" "Germline" "" "" "0" "" "" "g.64591845del" "" "pathogenic" "" "0000729779" "3" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Maeda 2018:29785639}" "" "" "" "Germline" "" "rs74419361" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "" "0000729780" "2" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000729781" "2" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Maeda 2018:29785639}" "" "c.4957dupA" "" "Germline" "" "rs527236065" "0" "" "" "g.64590911dup" "" "pathogenic" "" "0000730210" "1" "90" "6" "65655750" "65655750" "dup" "0" "00000" "EYS_000614" "g.65655750dup" "" "{PMID:Sun 2018:29625443}" "" "c.2318dupA" "" "Germline" "" "" "0" "" "" "g.64945857dup" "" "pathogenic" "ACMG" "0000730270" "2" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Sun 2018:29625443}" "" "" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "ACMG" "0000731475" "3" "90" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "pathogenic (recessive)" "" "0000731476" "3" "90" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "pathogenic (recessive)" "" "0000731477" "3" "90" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "pathogenic (recessive)" "" "0000731503" "1" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2018:29068140}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "pathogenic (recessive)" "" "0000731522" "1" "90" "6" "64431273" "64431280" "del" "0" "00006" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Avela 2018:29068140}" "" "" "upstream stop codon same allele" "Germline" "" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic (!)" "" "0000731523" "1" "90" "6" "64431273" "64431280" "del" "0" "00006" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Avela 2018:29068140}" "" "c.8648_8654del8" "upstream stop codon same allele" "Germline" "" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic (!)" "" "0000731525" "1" "90" "6" "64431273" "64431280" "del" "0" "00006" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Avela 2018:29068140}" "" ".8648_8655del8" "upstream stop codon same allele" "Germline" "" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic (!)" "" "0000731526" "1" "90" "6" "64431273" "64431280" "del" "0" "00006" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Avela 2018:29068140}" "" "8648_8655del8" "upstream stop codon same allele" "Germline" "" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic (!)" "" "0000732556" "0" "50" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:Wang 2017:28838317}" "" "IVS14+1G>A" "" "Germline" "" "" "0" "" "" "g.64997581C>T" "" "VUS" "" "0000732557" "0" "90" "6" "64431453" "64431454" "ins" "0" "00000" "EYS_000620" "g.64431453_64431454insA" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.63721557_63721558insA" "" "pathogenic" "" "0000732558" "0" "50" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "VUS" "" "0000732559" "3" "90" "6" "65596607" "65596607" "subst" "0.000366888" "00000" "EYS_000525" "g.65596607C>A" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "rs566917467" "0" "" "" "g.64886714C>A" "" "pathogenic" "" "0000732580" "0" "90" "6" "65016916" "65016916" "subst" "0" "00000" "EYS_000622" "g.65016916C>T" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.64307023C>T" "" "pathogenic" "" "0000732581" "0" "90" "6" "65149212" "65149216" "del" "0" "00000" "EYS_000623" "g.65149212_65149216del" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.64439319_64439323del" "" "pathogenic" "" "0000732591" "0" "90" "6" "65016917" "65016917" "subst" "0" "00000" "EYS_000010" "g.65016917C>T" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.64307024C>T" "" "pathogenic" "" "0000732592" "0" "30" "6" "66112402" "66112402" "subst" "0" "00000" "EYS_000479" "g.66112402A>C" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.65402509A>C" "" "likely benign" "" "0000732593" "0" "70" "6" "64487929" "64487929" "subst" "0.000767115" "00000" "EYS_000097" "g.64487929C>T" "" "{PMID:Wang 2017:28838317}" "" "" "" "Germline" "" "" "0" "" "" "g.63778036C>T" "" "likely pathogenic" "" "0000733059" "1" "70" "6" "66005914" "66005914" "del" "0" "00000" "EYS_000627" "g.66005914del" "" "{PMID:Stone 2017:28559085}" "" "1867delC" "" "Germline" "" "" "0" "" "" "g.65296021del" "" "likely pathogenic" "" "0000733060" "1" "70" "6" "65098673" "65098673" "subst" "0" "00000" "EYS_000610" "g.65098673G>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.64388780G>T" "" "likely pathogenic" "" "0000733061" "1" "70" "6" "66054069" "66054069" "subst" "7.39025E-5" "00000" "EYS_000628" "g.66054069T>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.65344176T>A" "" "likely pathogenic" "" "0000733062" "3" "70" "6" "64574212" "64574212" "subst" "1.97881E-5" "00000" "EYS_000123" "g.64574212A>C" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.63864319A>C" "" "likely pathogenic" "" "0000733125" "1" "70" "6" "64574252" "64574252" "subst" "0" "00000" "EYS_000621" "g.64574252C>G" "" "{PMID:Stone 2017:28559085}" "" "IVS35-1G>C" "" "Germline" "" "" "0" "" "" "g.63864359C>G" "" "likely pathogenic" "" "0000733136" "1" "70" "6" "66138707" "66790596" "del" "0" "00000" "EYS_000619" "g.66138707_66790596del" "" "{PMID:Stone 2017:28559085}" "" "del ex1-4, chr6:66138707-66790596del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000733528" "2" "70" "6" "65300347" "65300347" "subst" "0" "00000" "EYS_000624" "g.65300347G>A" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.64590454G>A" "" "likely pathogenic" "" "0000733529" "2" "70" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Stone 2017:28559085}" "" "230delT" "" "Germline" "" "" "0" "" "" "g.65495181del" "" "likely pathogenic" "" "0000733530" "2" "70" "6" "65300805" "65300805" "subst" "0" "00000" "EYS_000625" "g.65300805G>T" "" "{PMID:Stone 2017:28559085}" "" "" "" "Germline" "" "" "0" "" "" "g.64590912G>T" "" "likely pathogenic" "" "0000733578" "2" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Stone 2017:28559085}" "" "del ex32" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000733584" "2" "70" "6" "66065874" "66194769" "delins" "0" "00000" "EYS_000618" "g.66065874_66194769delinsA" "" "{PMID:Stone 2017:28559085}" "" "del ex5-7, chr6:66065874-66194769delinsA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000734339" "1" "70" "6" "65301515" "65301515" "subst" "0" "00000" "EYS_000626" "g.65301515C>A" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.64591622C>A" "" "likely pathogenic" "" "0000734340" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000734392" "2" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "" "{PMID:Huang 2017:28512305}" "" "" "" "Germline" "" "" "0" "" "" "g.64626200A>T" "" "likely pathogenic" "" "0000734686" "1" "70" "6" "66094318" "66094318" "del" "0" "00000" "EYS_000272" "g.66094318del" "" "{PMID:Jinda 2017:28453600}" "" "1260_1260delG" "" "Germline" "" "" "0" "" "" "g.65384425del" "" "likely pathogenic (recessive)" "" "0000734688" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Jinda 2017:28453600}" "" "" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic (recessive)" "" "0000734691" "3" "70" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "" "{PMID:Jinda 2017:28453600}" "" "" "" "Germline" "" "" "0" "" "" "g.63726645C>A" "" "likely pathogenic (recessive)" "" "0000734698" "2" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Jinda 2017:28453600}" "" "" "" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic (recessive)" "" "0000735835" "3" "70" "6" "65016943" "65016943" "subst" "0" "00000" "EYS_000631" "g.65016943G>T" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "" "" "0" "" "" "g.64307050G>T" "" "likely pathogenic" "" "0000735849" "1" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64591747G>A" "" "likely pathogenic" "" "0000735869" "2" "70" "6" "65300932" "65300935" "del" "0" "00000" "EYS_000190" "g.65300932_65300935del" "" "{PMID:Riera 2017:28181551}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64591039_64591042del" "" "likely pathogenic" "" "0000735899" "3" "70" "6" "66205269" "66205269" "subst" "5.71074E-5" "02485" "EYS_000301" "g.66205269A>G" "" "{PMID:Bravo-Gil 2017:28157192}" "" "" "" "Germline" "" "" "0" "" "" "g.65495376A>G" "" "likely pathogenic" "" "0000735990" "1" "90" "6" "0" "0" "" "0" "02485" "LAMA2_000000" "g.?" "" "{PMID:Bravo-Gil 2017:28157192}" "" "del ex15-19" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000735991" "1" "90" "6" "0" "0" "" "0" "02485" "LAMA2_000000" "g.?" "" "{PMID:Bravo-Gil 2017:28157192}" "" "del ex32-33" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000736090" "1" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.64626200A>T" "" "likely pathogenic" "" "0000736094" "1" "70" "6" "64430513" "64430513" "subst" "0.000228219" "00000" "EYS_000416" "g.64430513A>C" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.63720617A>C" "" "likely pathogenic" "" "0000736131" "2" "70" "6" "66204718" "66204718" "subst" "0.000170741" "00000" "EYS_000485" "g.66204718T>G" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.65494825T>G" "" "likely pathogenic" "" "0000736136" "2" "70" "6" "65531532" "65531532" "subst" "0" "00000" "EYS_000633" "g.65531532A>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.64821639A>T" "" "likely pathogenic" "" "0000736140" "1" "70" "6" "64436549" "64436549" "subst" "6.75548E-6" "00000" "EYS_000630" "g.64436549A>G" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.63726656A>G" "" "likely pathogenic" "" "0000736141" "2" "70" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Huang 2018:29641573}" "" "" "" "Germline" "" "" "0" "" "" "g.64590218C>T" "" "likely pathogenic" "" "0000736833" "1" "50" "6" "64431495" "64431500" "del" "0" "00000" "EYS_000634" "g.64431495_64431500del" "1/486 individuals" "{PMID:Sergouniotis 2016:27628848}" "" "" "no genotypes reported" "Germline" "" "" "0" "" "" "g.63721599_63721604del" "" "VUS" "" "0000759943" "1" "90" "6" "64431277" "64431277" "subst" "0" "00000" "EYS_000635" "g.64431277A>C" "" "{PMID:Tiwari 2016:27353947}" "" "NM_001292009.1:c.8713T>G" "" "Germline" "" "" "0" "" "" "g.63721381A>C" "" "pathogenic (recessive)" "" "0000759964" "2" "90" "6" "64436439" "64436439" "subst" "6.75521E-6" "00000" "EYS_000087" "g.64436439C>G" "" "{PMID:Tiwari 2016:27353947}" "" "NM_001292009.1:c.8269G>C" "" "Germline" "" "" "0" "" "" "g.63726546C>G" "" "pathogenic (recessive)" "" "0000760261" "0" "70" "6" "64430796" "64430796" "subst" "0" "00000" "EYS_000054" "g.64430796C>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.63720900C>A" "" "likely pathogenic" "" "0000760279" "3" "50" "6" "65612025" "65612026" "del" "0" "00000" "EYS_000231" "g.65612025_65612026del" "" "{PMID:Ellingford 2016:27208204}" "" "2826_2827delAT" "" "Germline" "" "" "0" "" "" "g.64902132_64902133del" "" "VUS" "" "0000760290" "3" "70" "6" "65655758" "65655758" "subst" "0.00115297" "00000" "EYS_000001" "g.65655758T>G" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.64945865T>G" "" "likely pathogenic" "" "0000760292" "3" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "VUS" "" "0000760294" "3" "50" "6" "66204814" "66204814" "subst" "8.13054E-6" "00000" "EYS_000288" "g.66204814G>A" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.65494921G>A" "" "VUS" "" "0000760315" "3" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "VUS" "" "0000760337" "3" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.65402507A>T" "" "VUS" "" "0000760476" "0" "50" "6" "65016917" "65016917" "subst" "0" "00000" "EYS_000010" "g.65016917C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.64307024C>T" "" "VUS" "" "0000760602" "3" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Khan 2017:27160483}" "" "" "" "Germline" "" "" "0" "" "" "g.64388842T>C" "" "pathogenic" "" "0000764094" "0" "30" "6" "65172926" "65172926" "subst" "0" "04043" "EYS_000637" "g.65172926G>A" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "" "" "0" "" "" "g.64463033G>A" "" "likely benign" "" "0000764096" "1" "90" "6" "66204881" "66204901" "delins" "0" "04043" "EYS_000395" "g.66204881_66204901delinsAAAAG" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "yes" "" "0" "" "" "g.65494988_65495008delinsAAAAG" "" "pathogenic (recessive)" "" "0000764100" "3" "90" "6" "64430522" "64430522" "subst" "1.67165E-5" "04043" "EYS_000020" "g.64430522A>T" "" "{PMID:Fadaie 2021:34795310}" "" "c.9468T>A (Tyr3156*)" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000764102" "0" "30" "6" "65109964" "65109964" "subst" "0" "04043" "EYS_000636" "g.65109964T>C" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "" "" "0" "" "" "g.64400071T>C" "" "likely benign" "" "0000764118" "0" "30" "6" "66028275" "66028275" "subst" "0" "04043" "EYS_000640" "g.66028275A>T" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "" "" "0" "" "" "g.65318382A>T" "" "likely benign" "" "0000764124" "1" "90" "6" "64430522" "64430522" "subst" "1.67165E-5" "04043" "EYS_000020" "g.64430522A>T" "" "{PMID:Fadaie 2021:34795310}" "" "[3906C>A;9468T>A] 9468T>A (Tyr3156*)" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000764127" "1" "90" "6" "66044979" "66044979" "subst" "0.00021639" "04043" "EYS_000388" "g.66044979A>T" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "no" "" "0" "" "" "g.65335086A>T" "" "pathogenic (recessive)" "" "0000764131" "0" "30" "6" "66058605" "66058605" "subst" "0" "04043" "EYS_000641" "g.66058605A>C" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "" "" "0" "" "" "g.65348712A>C" "" "likely benign" "" "0000764133" "0" "30" "6" "65726040" "65726040" "subst" "0" "04043" "EYS_000639" "g.65726040C>T" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "" "" "0" "" "" "g.65016147C>T" "" "likely benign" "" "0000764140" "2" "90" "6" "66204765" "66204765" "subst" "0" "04043" "EYS_000642" "g.66204765G>T" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "yes" "" "0" "" "" "g.65494872G>T" "" "pathogenic (recessive)" "" "0000764153" "2" "90" "6" "65229204" "65229204" "subst" "0" "04043" "EYS_000638" "g.65229204T>C" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64519311T>C" "" "pathogenic (recessive)" "" "0000764155" "2" "90" "6" "65300716" "65300716" "subst" "0.00226467" "04043" "EYS_000183" "g.65300716C>A" "" "{PMID:Fadaie 2021:34795310}" "" "" "" "Germline" "no" "" "0" "" "" "g.64590823C>A" "" "pathogenic (recessive)" "" "0000764156" "1" "50" "6" "65301854" "65301854" "subst" "0" "04043" "EYS_000021" "g.65301854G>T" "" "{PMID:Fadaie 2021:34795310}" "" "[3906C>A;9468T>A]" "" "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000764896" "3" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2016:26766544}" "" "del ex15-22" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000764897" "3" "70" "6" "65146066" "65146066" "subst" "0" "00000" "EYS_000643" "g.65146066C>A" "" "{PMID:Weisschuh 2016:26766544}" "" "" "" "Germline" "" "" "0" "" "" "g.64436173C>A" "" "likely pathogenic (recessive)" "" "0000765805" "0" "70" "6" "66205129" "66205129" "del" "0" "00000" "EYS_000644" "g.66205129del" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.65495236del" "" "likely pathogenic" "" "0000783293" "2" "70" "6" "65300801" "65300802" "ins" "0" "00000" "EYS_000645" "g.65300801_65300802insT" "" "{PMID:Yoon 2015:26155838}" "" "" "" "Germline" "" "" "0" "" "" "g.64590908_64590909insT" "" "likely pathogenic (recessive)" "" "0000784134" "0" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "3/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs150951106" "0" "" "" "g.64626200A>T" "" "likely pathogenic (recessive)" "" "0000784146" "0" "70" "6" "65300349" "65300349" "subst" "0.00016225" "00000" "EYS_000648" "g.65300349A>G" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64590456A>G" "" "likely pathogenic (recessive)" "" "0000784233" "0" "70" "6" "64498112" "64498112" "subst" "0.000265873" "00000" "EYS_000108" "g.64498112C>T" "4/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs189406424" "0" "" "" "g.63788219C>T" "" "likely pathogenic (recessive)" "" "0000784238" "0" "70" "6" "64498112" "64498112" "subst" "0.000265873" "00000" "EYS_000108" "g.64498112C>T" "4/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs189406424" "0" "" "" "g.63788219C>T" "" "likely pathogenic (recessive)" "" "0000784244" "0" "70" "6" "65301645" "65301645" "subst" "0.000148198" "00000" "EYS_000650" "g.65301645G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64591752G>A" "" "likely pathogenic (recessive)" "" "0000784245" "0" "70" "6" "65336128" "65336128" "subst" "0.000116872" "00000" "EYS_000653" "g.65336128C>T" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64626235C>T" "" "likely pathogenic (recessive)" "" "0000784246" "0" "70" "6" "65301381" "65301381" "subst" "0" "00000" "EYS_000649" "g.65301381A>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64591488A>C" "" "likely pathogenic (recessive)" "" "0000784278" "0" "50" "6" "66005770" "66005770" "subst" "4.75983E-5" "00000" "EYS_000657" "g.66005770A>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.65295877A>T" "" "VUS" "" "0000784286" "0" "50" "6" "66204970" "66204970" "subst" "0.000369904" "00000" "EYS_000414" "g.66204970C>G" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs112609906" "0" "" "" "g.65495077C>G" "" "VUS" "" "0000784290" "0" "50" "6" "64498112" "64498112" "subst" "0.000265873" "00000" "EYS_000108" "g.64498112C>T" "4/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs189406424" "0" "" "" "g.63788219C>T" "" "VUS" "" "0000784295" "0" "50" "6" "65327302" "65327304" "dup" "0" "00000" "EYS_000651" "g.65327302_65327304dup" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "c.3684+7_3684+9dupATT" "" "Germline" "" "" "0" "" "" "g.64617409_64617411dup" "" "VUS" "" "0000784303" "0" "70" "6" "64472476" "64472476" "subst" "5.96121E-5" "00000" "EYS_000095" "g.64472476G>A" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.63762583G>A" "" "likely pathogenic (recessive)" "" "0000784319" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic (recessive)" "" "0000784320" "0" "70" "6" "64498112" "64498112" "subst" "0.000265873" "00000" "EYS_000108" "g.64498112C>T" "4/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs189406424" "0" "" "" "g.63788219C>T" "" "likely pathogenic (recessive)" "" "0000784321" "0" "70" "6" "64472476" "64472476" "subst" "5.96121E-5" "00000" "EYS_000095" "g.64472476G>A" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.63762583G>A" "" "likely pathogenic (recessive)" "" "0000784325" "0" "70" "6" "66005750" "66005750" "dup" "0" "00000" "EYS_000354" "g.66005750dup" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "c.2023+15dupT" "" "Germline" "" "" "0" "" "" "g.65295857dup" "" "likely pathogenic (recessive)" "" "0000784326" "0" "70" "6" "64431505" "64431505" "subst" "0.00511138" "00000" "EYS_000075" "g.64431505C>T" "3/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs111991705" "0" "" "" "g.63721609C>T" "" "likely pathogenic (recessive)" "" "0000784336" "0" "70" "6" "64791758" "64791758" "subst" "8.31808E-5" "00000" "EYS_000443" "g.64791758T>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs184448644" "0" "" "" "g.64081865T>C" "" "likely pathogenic (recessive)" "" "0000784337" "0" "70" "6" "66115255" "66115255" "subst" "6.71941E-5" "00000" "EYS_000659" "g.66115255A>G" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.65405362A>G" "" "likely pathogenic (recessive)" "" "0000784338" "0" "70" "6" "65098596" "65098596" "subst" "7.21615E-6" "00000" "EYS_000646" "g.65098596T>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64388703T>C" "" "likely pathogenic (recessive)" "" "0000784339" "0" "70" "6" "65336128" "65336128" "subst" "0.000116872" "00000" "EYS_000653" "g.65336128C>T" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64626235C>T" "" "likely pathogenic (recessive)" "" "0000784340" "0" "70" "6" "66115255" "66115255" "subst" "6.71941E-5" "00000" "EYS_000659" "g.66115255A>G" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.65405362A>G" "" "likely pathogenic (recessive)" "" "0000784344" "0" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "3/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs150951106" "0" "" "" "g.64626200A>T" "" "likely pathogenic (recessive)" "" "0000784360" "0" "70" "6" "65336021" "65336021" "subst" "0" "00000" "EYS_000652" "g.65336021G>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64626128G>T" "" "likely pathogenic (recessive)" "" "0000784377" "0" "70" "6" "64431505" "64431505" "subst" "0.00511138" "00000" "EYS_000075" "g.64431505C>T" "3/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs111991705" "0" "" "" "g.63721609C>T" "" "likely pathogenic (recessive)" "" "0000784383" "0" "70" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.63864185C>T" "" "likely pathogenic (recessive)" "" "0000784386" "0" "70" "6" "65149215" "65149215" "subst" "1.74923E-5" "00000" "EYS_000647" "g.65149215G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64439322G>A" "" "likely pathogenic (recessive)" "" "0000784400" "0" "70" "6" "66044965" "66044965" "subst" "0" "00000" "EYS_000258" "g.66044965C>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.65335072C>T" "" "likely pathogenic (recessive)" "" "0000784403" "0" "70" "6" "64431505" "64431505" "subst" "0.00511138" "00000" "EYS_000075" "g.64431505C>T" "3/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs111991705" "0" "" "" "g.63721609C>T" "" "likely pathogenic (recessive)" "" "0000784405" "0" "70" "6" "65300349" "65300349" "subst" "0.00016225" "00000" "EYS_000648" "g.65300349A>G" "2/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64590456A>G" "" "likely pathogenic (recessive)" "" "0000784411" "0" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "3/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs150951106" "0" "" "" "g.64626200A>T" "" "likely pathogenic (recessive)" "" "0000784430" "0" "50" "6" "65523421" "65523421" "subst" "4.66685E-5" "00000" "EYS_000654" "g.65523421G>T" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.64813528G>T" "" "VUS" "" "0000784453" "0" "50" "6" "65767617" "65767617" "subst" "0.000286453" "00000" "EYS_000656" "g.65767617G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs199944222" "0" "" "" "g.65057724G>A" "" "VUS" "" "0000784488" "0" "50" "6" "66112447" "66112447" "subst" "1.63232E-5" "00000" "EYS_000658" "g.66112447T>C" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "rs199647597" "0" "" "" "g.65402554T>C" "" "VUS" "" "0000784492" "0" "50" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "NM_001142800.1:c.1849G>A (V617I)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000784498" "0" "50" "6" "65767578" "65767578" "subst" "0" "00000" "EYS_000655" "g.65767578G>A" "1/314 case chromosomes" "{PMID:Xu 2014:24938718}" "" "" "" "Germline" "" "" "0" "" "" "g.65057685G>A" "" "VUS" "" "0000784670" "3" "90" "6" "65707540" "65707540" "subst" "0" "01164" "EYS_000244" "g.65707540G>A" "" "PMID: 23591405" "" "" "ACMG: PVS1, PM3, PM2_SUP" "Germline" "?" "" "" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000785392" "3" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.63762613C>T" "" "pathogenic (recessive)" "" "0000785395" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Van Huet 2015:25999674}" "" "" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic (recessive)" "" "0000786313" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Méndez-Vidal 2014:25494902}" "" "6714delT" "" "Germline" "" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000788373" "0" "50" "6" "65303078" "65303078" "subst" "3.33182E-5" "00000" "EYS_000206" "g.65303078A>C" "" "{PMID:Katagiri 2014:25268133}" "" "T3809G" "" "Germline" "" "" "0" "" "" "g.64593185A>C" "" "VUS" "" "0000788396" "0" "50" "6" "64791757" "64791757" "subst" "0" "00000" "EYS_000143" "g.64791757A>G" "" "{PMID:Katagiri 2014:25268133}" "" "T6563C" "" "Germline" "" "" "0" "" "" "g.64081864A>G" "" "VUS" "" "0000788453" "0" "50" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Katagiri 2014:25268133}" "" "C8805A" "" "Germline" "" "" "0" "" "" "g.63721226G>T" "" "VUS" "" "0000788467" "0" "50" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Katagiri 2014:25268133}" "" "4957_4958insA" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "VUS" "" "0000788476" "0" "50" "6" "65336128" "65336128" "subst" "0.000116872" "00000" "EYS_000653" "g.65336128C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G3454A" "" "Germline" "" "rs371491059" "0" "" "" "g.64626235C>T" "" "VUS" "" "0000788486" "0" "50" "6" "65300335" "65300335" "subst" "6.76032E-6" "00000" "EYS_000660" "g.65300335A>G" "" "{PMID:Katagiri 2014:25268133}" "" "T5425C" "" "Germline" "" "" "0" "" "" "g.64590442A>G" "" "VUS" "" "0000788519" "0" "50" "6" "64430741" "64430742" "del" "0" "00000" "EYS_000050" "g.64430741_64430742del" "" "{PMID:Katagiri 2014:25268133}" "" "" "" "Germline" "" "" "0" "" "" "g.63720845_63720846del" "" "VUS" "" "0000789840" "3" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "c.1155T>A" "Check also: Avela 2018" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000789841" "3" "70" "6" "64431272" "64431279" "del" "0.000790077" "00000" "EYS_000071" "g.64431272_64431279del" "" "{PMID:Avela 2019:31087526}" "" "c.8648_8655del8" "Check also: Avela 2018" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000789842" "3" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "c.1155T>A" "Check also: Avela 2018" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000789843" "3" "70" "6" "64436416" "64436416" "del" "0" "00000" "EYS_000661" "g.64436416del" "" "{PMID:Avela 2019:31087526}" "" "c.8229delA" "Check also: Avela 2018" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000789871" "0" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "c.1155T>A" "Check also: Avela 2018" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000789872" "0" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "c.1155T>A" "Check also: Avela 2018" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790409" "3" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Wang 2014:25097241}" "" "exon 14 del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000790410" "1" "70" "6" "65300160" "65300160" "subst" "0.000446991" "00000" "EYS_000664" "g.65300160G>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64590267G>A" "" "likely pathogenic" "" "0000790411" "1" "70" "6" "65149209" "65149209" "subst" "0" "00000" "EYS_000663" "g.65149209A>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64439316A>G" "" "likely pathogenic" "" "0000790426" "1" "70" "6" "65523270" "65523270" "subst" "2.11873E-5" "00000" "EYS_000216" "g.65523270C>A" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64813377C>A" "" "likely pathogenic" "" "0000790459" "0" "50" "6" "66053934" "66053934" "subst" "0.00662122" "00000" "EYS_000668" "g.66053934T>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs61753611" "0" "" "" "g.65344041T>G" "" "VUS" "" "0000790474" "0" "50" "6" "66112444" "66112444" "subst" "2.04082E-5" "00000" "EYS_000669" "g.66112444G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.65402551G>T" "" "VUS" "" "0000790477" "1" "50" "6" "66044874" "66044874" "subst" "8.18974E-5" "00000" "EYS_000256" "g.66044874T>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.65334981T>C" "" "VUS" "" "0000790487" "2" "50" "6" "64431505" "64431505" "subst" "0.00511138" "00000" "EYS_000075" "g.64431505C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.63721609C>T" "" "VUS" "" "0000790491" "2" "50" "6" "64431148" "64431148" "subst" "3.95361E-5" "00000" "EYS_000067" "g.64431148A>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.63721252A>G" "" "VUS" "" "0000790499" "0" "50" "6" "66053934" "66053934" "subst" "0.00662122" "00000" "EYS_000668" "g.66053934T>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs61753611" "0" "" "" "g.65344041T>G" "" "VUS" "" "0000790508" "0" "50" "6" "65300145" "65300145" "subst" "0.000819907" "00000" "EYS_000405" "g.65300145A>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs201333192" "0" "" "" "g.64590252A>G" "" "VUS" "" "0000790517" "0" "50" "6" "65300548" "65300548" "subst" "6.74291E-6" "00000" "EYS_000666" "g.65300548G>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64590655G>C" "" "VUS" "" "0000790530" "0" "50" "6" "66205023" "66205023" "subst" "0.00114688" "00000" "EYS_000293" "g.66205023G>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs111947397" "0" "" "" "g.65495130G>T" "" "VUS" "" "0000790563" "2" "50" "6" "65622606" "65622606" "subst" "1.01492E-5" "00000" "EYS_000667" "g.65622606C>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64912713C>G" "" "VUS" "" "0000790564" "2" "50" "6" "65523464" "65523464" "subst" "6.85486E-5" "00000" "EYS_000219" "g.65523464T>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64813571T>G" "" "VUS" "" "0000790565" "2" "50" "6" "65301358" "65301358" "subst" "8.77122E-5" "00000" "EYS_000199" "g.65301358C>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64591465C>G" "" "VUS" "" "0000790581" "0" "50" "6" "65655758" "65655758" "subst" "0.00115297" "00000" "EYS_000001" "g.65655758T>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64945865T>G" "" "VUS" "" "0000790584" "0" "50" "6" "65149147" "65149147" "subst" "0.0011368" "00000" "EYS_000325" "g.65149147T>C" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs188093810" "0" "" "" "g.64439254T>C" "" "VUS" "" "0000790592" "0" "50" "6" "66205213" "66205213" "subst" "0.000398351" "00000" "EYS_000670" "g.66205213C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.65495320C>T" "" "VUS" "" "0000790601" "0" "50" "6" "66115146" "66115146" "subst" "0.00181254" "00000" "EYS_000277" "g.66115146C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs112822256" "0" "" "" "g.65405253C>T" "" "VUS" "" "0000790603" "0" "50" "6" "65300425" "65300425" "subst" "0.000223178" "00000" "EYS_000665" "g.65300425C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs186499459" "0" "" "" "g.64590532C>T" "" "VUS" "" "0000790604" "0" "50" "6" "64694325" "64694325" "subst" "0.000871863" "00000" "EYS_000507" "g.64694325C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs74848648" "0" "" "" "g.63984432C>T" "" "VUS" "" "0000790605" "0" "50" "6" "65300250" "65300250" "subst" "0.00399083" "00000" "EYS_000168" "g.65300250C>G" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.64590357C>G" "" "VUS" "" "0000790622" "0" "50" "6" "64431111" "64431111" "subst" "0" "00000" "EYS_000662" "g.64431111C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "" "0" "" "" "g.63721215C>T" "" "VUS" "" "0000790654" "0" "50" "6" "66204970" "66204970" "subst" "0.00898744" "00000" "EYS_000373" "g.66204970C>T" "" "{PMID:Wang 2014:25097241}" "" "" "" "Germline" "" "rs112609906" "0" "" "" "g.65495077C>T" "" "VUS" "" "0000790740" "1" "70" "6" "64430564" "64430564" "dup" "0" "00000" "EYS_000043" "g.64430564dup" "" "{PMID:Coppieters 2014:24625443}" "" "" "" "Germline" "" "" "0" "" "" "g.63720668dup" "" "likely pathogenic" "" "0000791202" "0" "90" "6" "" "" "" "" "00000" "EYS_000671" "g.(64451868_64472354)_(64488073_64497998)" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "" "" "0" "" "" "g.(63741975_63762461)_(63778180_63788105)dup" "" "pathogenic" "ACMG" "0000791216" "1" "90" "6" "66005944" "66005945" "del" "0" "00000" "EYS_000673" "g.66005944_66005945del" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.65296051_65296052del" "" "pathogenic" "ACMG" "0000791217" "1" "90" "6" "66005944" "66005945" "del" "0" "00000" "EYS_000673" "g.66005944_66005945del" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.65296051_65296052del" "" "pathogenic" "ACMG" "0000791254" "0" "90" "6" "65149093" "65149093" "dup" "0" "00000" "EYS_000672" "g.65149093dup" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "" "" "0" "" "" "g.64439200dup" "" "pathogenic" "ACMG" "0000791255" "2" "90" "6" "64430633" "64430642" "del" "0" "00000" "EYS_000046" "g.64430633_64430642del" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic" "ACMG" "0000791256" "2" "90" "6" "64430633" "64430642" "del" "0" "00000" "EYS_000046" "g.64430633_64430642del" "0 (in-house database, ~5000 samples)" "Tracewska 2021, MolVis in press" "" "" "" "Germline" "yes" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic" "ACMG" "0000791554" "3" "70" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "1/258" "{PMID:Martin-Merida 2018:29847639}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64388842T>C" "" "likely pathogenic" "" "0000791582" "0" "70" "6" "66204778" "66204780" "del" "0" "00000" "EYS_000486" "g.66204778_66204780del" "" "{PMID:Hosono 2018:29844330}" "" "c.525_527del" "single heterozygous variant in a recessive gene, probably not causative in the patient" "Germline" "no" "" "0" "" "" "g.65494885_65494887del" "" "likely pathogenic" "ACMG" "0000792221" "3" "90" "6" "64430845" "64430845" "subst" "0" "00000" "EYS_000680" "g.64430845C>A" "" "{PMID: Siemiatkowska 2011:22128245}" "" "c.9082G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792222" "3" "90" "6" "64430845" "64430845" "subst" "0" "00000" "EYS_000680" "g.64430845C>A" "" "{PMID: Siemiatkowska 2011:22128245}" "" "c.9082G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000792246" "3" "90" "6" "66204881" "66204896" "del" "0" "00000" "EYS_000291" "g.66204881_66204896del" "" "{PMID:_Audo-2012:22277662}" "" "c.408_423del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000792247" "3" "90" "6" "66204881" "66204896" "del" "0" "00000" "EYS_000291" "g.66204881_66204896del" "" "{PMID:_Audo-2012:22277662}" "" "c.408_423del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000792270" "0" "90" "6" "64498124" "64498124" "subst" "0.00307587" "00000" "EYS_000110" "g.64498124T>C" "" "{PMID:_Audo-2012:22277662}" "" "c.7597A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000792335" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000792336" "0" "70" "6" "64791757" "64791757" "subst" "0" "03508" "EYS_000143" "g.64791757A>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792341" "3" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000792355" "0" "70" "6" "64940514" "64940514" "subst" "0" "03508" "EYS_000674" "g.64940514A>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792356" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000792378" "0" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "03508" "EYS_000066" "g.64431122G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000792379" "0" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "03508" "EYS_000237" "g.65622490C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792383" "3" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000792385" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "03508" "EYS_000144" "g.64791763C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792405" "0" "70" "6" "65622547" "65622547" "subst" "0" "03508" "EYS_000675" "g.65622547C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792406" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000792408" "0" "70" "6" "64430587" "64430587" "subst" "0" "03508" "EYS_000678" "g.64430587C>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792410" "0" "70" "6" "66094399" "66094399" "subst" "4.14952E-6" "03508" "EYS_000027" "g.66094399A>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000792412" "0" "70" "6" "64430820" "64430821" "ins" "0" "03508" "EYS_000677" "g.64430820_64430821insTATA" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000792413" "0" "70" "6" "64694283" "64694283" "del" "0" "03508" "EYS_000126" "g.64694283del" "" "" "" "7048delT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.63984390del" "" "pathogenic" "ACMG" "0000793721" "3" "50" "6" "64709002" "64709003" "del" "0" "00000" "EYS_000134" "g.64709002_64709003del" "" "{PMID:Collin-2011:21217109}" "" "c.6799_6800del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000793722" "3" "50" "6" "65301404" "65301410" "del" "8.11919E-5" "00000" "EYS_000019" "g.65301404_65301410del" "" "{PMID:Collin-2011:21217109}" "" "c.4350_4356del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000793723" "3" "50" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Collin-2011:21217109}" "" "c.6714del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000793911" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000793912" "0" "70" "6" "66005790" "66005790" "del" "0" "03508" "EYS_000676" "g.66005790del" "" "" "" "1989delA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.65295897del" "" "pathogenic" "ACMG" "0000793917" "0" "70" "6" "65622547" "65622547" "subst" "0" "03508" "EYS_000675" "g.65622547C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000793918" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000793931" "0" "70" "6" "64430964" "64430964" "subst" "0" "03508" "EYS_000679" "g.64430964G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000793932" "0" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "03508" "EYS_000066" "g.64431122G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000793935" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000793949" "1" "70" "6" "66204814" "66204814" "subst" "8.13054E-6" "00000" "EYS_000288" "g.66204814G>A" "" "{PMID:O\'Sullivan-2012:22581970}" "" "c.[490C>T]+[3226T>C]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793950" "2" "70" "6" "65531555" "65531555" "subst" "4.40736E-5" "00000" "EYS_000220" "g.65531555A>G" "" "{PMID:O\'Sullivan-2012:22581970}" "" "c.[490C>T]+[3226T>C]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793966" "1" "70" "6" "64574212" "64574212" "subst" "1.97881E-5" "00000" "EYS_000123" "g.64574212A>C" "" "{PMID:O\'Sullivan-2012:22581970}" "" "c.[7095T>G]+[9277_9278dupGG]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000793967" "2" "70" "6" "64430649" "64430650" "dup" "0" "00000" "EYS_000047" "g.64430649_64430650dupCC" "" "{PMID:O\'Sullivan-2012:22581970}" "" "c.[7095T>G]+[9277_9278dupGG]" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000794035" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000794062" "3" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000794090" "0" "70" "6" "64791757" "64791757" "subst" "0" "03508" "EYS_000143" "g.64791757A>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794091" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "03508" "EYS_000144" "g.64791763C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794096" "0" "70" "6" "65336093" "65336093" "subst" "0.000682801" "03508" "EYS_000214" "g.65336093A>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794097" "0" "70" "6" "66204718" "66204718" "subst" "0.000170741" "03508" "EYS_000485" "g.66204718T>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794194" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "03508" "EYS_000144" "g.64791763C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794195" "0" "70" "6" "66204778" "66204780" "del" "0" "03508" "EYS_000486" "g.66204778_66204780del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.65494885_65494887del" "" "VUS" "ACMG" "0000794201" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "03508" "EYS_000144" "g.64791763C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794203" "0" "70" "6" "64430679" "64430679" "subst" "0" "03508" "EYS_000048" "g.64430679C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794204" "0" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "03508" "EYS_000112" "g.64499037C>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794217" "0" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "03508" "EYS_000112" "g.64499037C>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794218" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "03508" "EYS_000144" "g.64791763C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794222" "3" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000794233" "0" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "03508" "EYS_000066" "g.64431122G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000794234" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "4957dupA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000794259" "0" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "03508" "EYS_000066" "g.64431122G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000794260" "0" "70" "6" "65300804" "65300804" "dup" "0" "03508" "EYS_000187" "g.65300804dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000794319" "3" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_001142800.1:c.6416G>A, NP_001136272.1:p.(Cys2139Tyr), NC_000006.11:g.64940493C>T" "" "Germline" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "ACMG" "0000794320" "3" "90" "6" "65300508" "65300508" "dup" "0" "00000" "EYS_000683" "g.65300508dup" "" "{PMID:Wang 2018:30029497}" "" "NM_001142800.1:c.5254dup, NP_001136272.1:p.(Ile1752AsnfsTer18), NC_000006.11:g.65300508dup" "" "Germline" "?" "" "0" "" "" "g.64590615dup" "" "pathogenic" "ACMG" "0000794321" "0" "90" "6" "64431601" "64431601" "del" "0" "00000" "EYS_000682" "g.64431601del" "" "{PMID:Wang 2018:30029497}" "" "NM_001142800.1:c.8326del, NP_001136272.1:p.(Val2776Ter), NC_000006.11:g.64431601del" "" "Germline" "?" "" "0" "" "" "g.63721705del" "" "pathogenic" "ACMG" "0000794322" "0" "90" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_001142800.1:c.2259+1G>A, NP_001136272.1:p.?, NC_000006.11:g.65707474C>T" "" "Germline" "?" "" "0" "" "" "g.64997581C>T" "" "pathogenic" "ACMG" "0000794323" "0" "90" "6" "64791777" "64791777" "del" "0" "00000" "EYS_000597" "g.64791777del" "" "{PMID:Wang 2018:30029497}" "" "NM_001142800.1:c.6545del, NP_001136272.1:p.(Asn2182ThrfsTer3), NC_000006.11:g.64791777del" "" "Germline" "?" "" "0" "" "" "g.64081884del" "" "pathogenic" "ACMG" "0000794324" "0" "90" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:Wang 2018:30029497}" "" "NM_001142800.1:c.2259+1G>A, NP_001136272.1:p.?, NC_000006.11:g.65707474C>T" "" "Germline" "?" "" "0" "" "" "g.64997581C>T" "" "pathogenic" "ACMG" "0000794751" "3" "90" "6" "66115235" "66115248" "delins" "0" "00000" "EYS_000686" "g.66115235_66115248delinsAAA" "" "{PMID:Patel 2018:30054919}" "" "NM_001142800.1:c.875_888delinsTTT" "" "Germline" "yes" "" "0" "" "" "g.65405342_65405355delinsAAA" "" "pathogenic (recessive)" "ACMG" "0000794770" "0" "70" "6" "66200533" "66200536" "dup" "0" "03508" "EYS_000681" "g.66200533_66200536dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.65490640_65490643dup" "" "pathogenic" "ACMG" "0000794771" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "03508" "EYS_000144" "g.64791763C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "ACMG" "0000794794" "11" "70" "6" "64430522" "64430522" "subst" "1.67165E-5" "00000" "EYS_000020" "g.64430522A>T" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.9405T>A, p.Tyr3135Ter" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "likely pathogenic" "" "0000794795" "21" "70" "6" "66005951" "66005951" "del" "0" "00000" "EYS_000684" "g.66005951del" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.1830del, p.His610GlnfsTer26" "" "Germline" "yes" "" "0" "" "" "g.65296058del" "" "likely pathogenic" "" "0000794796" "11" "70" "6" "66115238" "66115238" "del" "0" "00000" "EYS_000687" "g.66115238del" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.888del, p.Lys296AsnfsTer43" "" "Germline" "yes" "" "0" "" "" "g.65405345del" "" "likely pathogenic" "" "0000794797" "21" "70" "6" "66205290" "66205290" "subst" "4.10489E-6" "00000" "EYS_000689" "g.66205290G>T" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.14C>A, p.Ser5Ter" "" "Germline" "yes" "" "0" "" "" "g.65495397G>T" "" "likely pathogenic" "" "0000794800" "21" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.4045C>T, p.Arg1349Ter" "" "Germline" "yes" "" "0" "" "" "g.64591822G>A" "" "likely pathogenic" "" "0000794801" "11" "70" "6" "64430522" "64430522" "subst" "1.67165E-5" "00000" "EYS_000020" "g.64430522A>T" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.9405T>A, p.Tyr3135Ter" "" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "likely pathogenic" "" "0000794846" "3" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Ezquerra-Inchausti 2018:30337596}" "" "NM_001142800, c.4045C>T, p.Arg1349Ter" "" "Germline" "yes" "" "0" "" "" "g.64591822G>A" "" "likely pathogenic" "" "0000794880" "0" "70" "6" "66200486" "66205304" "del" "0" "03508" "EYS_000688" "g.(66115261_66200486)_(66205304_?)del" "" "" "" "1-?_862+?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(65405368_65490593)_(65495411_?)del" "" "pathogenic" "" "0000794881" "0" "70" "6" "66094278" "66115261" "del" "0" "03508" "EYS_000685" "g.(66063511_66094278)_(66115261_66200486)del" "" "" "" "863-?_1299+?del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(65353618_65384385)_(65405368_65490593)del" "" "pathogenic" "" "0000794885" "0" "70" "6" "66211328" "67272783" "del" "0" "03508" "EYS_000690" "g.66211328_67272783del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG" "0000795943" "0" "70" "6" "64431138" "64431138" "subst" "0.000237458" "00000" "EYS_000691" "g.64431138T>C" "" "{PMID:Schorderet-2013:23484092}" "" "p.EYS-D2930G" "" "Unknown" "?" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000796842" "0" "70" "6" "65300250" "65300250" "subst" "0.00399083" "00000" "EYS_000168" "g.65300250C>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.5510G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796855" "0" "70" "6" "65596696" "65596696" "subst" "4.70285E-5" "00000" "EYS_000463" "g.65596696G>C" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2886C>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796856" "0" "70" "6" "65596690" "65596690" "subst" "4.6983E-5" "00000" "EYS_000462" "g.65596690T>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.2892A>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000796857" "0" "70" "6" "65300250" "65300250" "subst" "0.00399083" "00000" "EYS_000168" "g.65300250C>G" "" "{PMID:Eisenberger-2013:24265693}" "" "c.5510G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000797059" "3" "90" "6" "64791778" "64791781" "del" "0" "00000" "EYS_000697" "g.64791778_64791781del" "" "{PMID:Birtel 2018:30543658}" "" "c.6544_6547delAACA, p.Asn2182Valfs*2" "Homozygous" "Germline" "?" "" "0" "" "" "g.64081885_64081888del" "" "pathogenic" "ACMG" "0000797060" "0" "70" "6" "65301294" "65301301" "dup" "0" "00000" "EYS_000700" "g.65301294_65301301dup" "" "{PMID:Birtel 2018:30543658}" "" "c.4462_4469dupAGCCCCTC, p.Met1491Alafs*12" "Heterozygous" "Germline" "?" "" "0" "" "" "g.64591401_64591408dup" "" "likely pathogenic" "ACMG" "0000797061" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Birtel 2018:30543658}" "" "c.6714delT, p.Ile2239Serfs*17" "Heterozygous" "Germline" "?" "rs752953889" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797062" "0" "90" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.4045C>T, p.Arg1349*" "Heterozygous" "Germline" "yes" "" "0" "" "" "g.64591822G>A" "" "pathogenic" "ACMG" "0000797063" "0" "90" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Birtel 2018:30543658}" "" "c.4350_4356delTATAGCT, p.Ile1451Profs*3" "Heterozygous" "Germline" "?" "rs761238771" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "ACMG" "0000797064" "3" "50" "6" "65146067" "65146067" "subst" "0" "00000" "EYS_000698" "g.65146067C>A" "" "{PMID:Birtel 2018:30543658}" "" "c.5927G>T, p.Arg1976Met" "Homozygous" "Germline" "?" "" "0" "" "" "g.64436174C>A" "" "VUS" "ACMG" "0000797065" "3" "90" "6" "66094276" "66094276" "subst" "0" "00000" "EYS_000271" "g.66094276T>G" "" "{PMID:Birtel 2018:30543658}" "" "c.1299+3A>C, p.Arg437*" "Homozygous" "Germline" "?" "" "0" "" "" "g.65384383T>G" "" "pathogenic" "ACMG" "0000797066" "0" "90" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Birtel 2018:30543658}" "" "c.8648_8655delCATGCAGA, p.Thr2883Lysfs*4" "Heterozygous" "Germline" "?" "rs528919874" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "ACMG" "0000797067" "0" "90" "6" "64431133" "64431136" "del" "0" "00000" "EYS_000421" "g.64431133_64431136del" "" "{PMID:Birtel 2018:30543658}" "" "c.8793_8796delATCA, p.Gln2931Hisfs*43" "Heterozygous" "Germline" "?" "" "0" "" "" "g.63721237_63721240del" "" "pathogenic" "ACMG" "0000797068" "3" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Birtel 2018:30543658}" "" "deletion of exon 34" "Homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG" "0000797140" "0" "70" "6" "65301149" "65301165" "del" "0" "00000" "EYS_000699" "g.65301149_65301165del" "" "{PMID:Birtel 2018:30543658}" "" "c.4597_4613delTCAAGCAACCAGAGACT, p.Ser1533Hisfs*9" "Heterozygous" "Germline" "" "" "0" "" "" "g.64591256_64591272del" "" "likely pathogenic" "ACMG" "0000797141" "0" "50" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Birtel 2018:30543658}" "" "duplication of exon 35" "Heterozygous" "Germline" "" "" "0" "" "" "g.?" "" "VUS" "ACMG" "0000797142" "0" "70" "6" "64487987" "64487987" "subst" "2.63671E-5" "00000" "EYS_000099" "g.64487987G>A" "" "{PMID:Birtel 2018:30543658}" "" "c.7810C>T, p.Arg2640Cys" "Heterozygous" "Germline" "" "rs1015857165" "0" "" "" "g.63778094G>A" "" "likely pathogenic" "ACMG" "0000797143" "0" "50" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Birtel 2018:30543658}" "" "deletion of exon 1" "Heterozygous" "Germline" "" "" "0" "" "" "g.?" "" "VUS" "ACMG" "0000797144" "0" "90" "6" "64431332" "64431332" "del" "0" "00000" "EYS_000694" "g.64431332del" "" "{PMID:Birtel 2018:30543658}" "" "c.8598delA, p.Gly2867Valfs*5" "Heterozygous" "Germline" "" "rs1050742628" "0" "" "" "g.63721436del" "" "pathogenic" "ACMG" "0000797145" "0" "50" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Birtel 2018:30543658}" "" "duplication of exon 29" "Heterozygous" "Germline" "" "" "0" "" "" "g.?" "" "VUS" "ACMG" "0000797146" "0" "50" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Birtel 2018:30543658}" "" "duplication of exon 29" "Heterozygous" "Germline" "" "" "0" "" "" "g.?" "" "VUS" "ACMG" "0000797608" "0" "90" "6" "65300932" "65300935" "del" "0" "00000" "EYS_000190" "g.65300932_65300935del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.4829_4832del, p.(Ser1610Phefs*7)" "" "Germline" "?" "" "0" "" "" "g.64591039_64591042del" "" "pathogenic" "ACMG" "0000797609" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.4829_4832del, p.(Ser1610Phefs*7)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797610" "3" "70" "6" "64431148" "64431148" "subst" "3.95361E-5" "00000" "EYS_000067" "g.64431148A>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8779T>C, p.(Cys2927Arg), c.232del, p.(Cys78Alafs*7)" "" "Germline" "?" "" "0" "" "" "g.63721252A>G" "" "likely pathogenic" "ACMG" "0000797611" "3" "70" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8779T>C, p.(Cys2927Arg), c.232del, p.(Cys78Alafs*7)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "likely pathogenic" "ACMG" "0000797612" "3" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.232del, p.(Cys78Alafs*7)" "homozygous" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797613" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.6714del, p.(Ile2239Serfs*17)" "homozygous" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797614" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.9344T>A, p.(Val3115Asp)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797615" "0" "50" "6" "64430583" "64430583" "subst" "6.75721E-6" "00000" "EYS_000692" "g.64430583A>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.9344T>A, p.(Val3115Asp)" "" "Germline" "?" "" "0" "" "" "g.63720687A>T" "" "VUS" "ACMG" "0000797616" "3" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.232del, p.(Cys78Alafs*7)" "homozygous" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797617" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.9317_9336del, p.(Thr3106Lysfs*13), c.232del, p.(Cys78Alafs*7)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797618" "0" "70" "6" "64430591" "64430610" "del" "0" "00000" "EYS_000693" "g.64430591_64430610del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.9317_9336del, p.(Thr3106Lysfs*13), c.232del, p.(Cys78Alafs*7)" "" "Germline" "?" "" "0" "" "" "g.63720695_63720714del" "" "likely pathogenic" "ACMG" "0000797619" "0" "50" "6" "66005751" "66005751" "subst" "0" "00000" "EYS_000701" "g.66005751C>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.7412-1G>C, p.(?), c.2023+5G>T, p.(?),, pROM1 c.1354dup, p.(Tyr452*)" "" "Germline" "?" "" "0" "" "" "g.65295858C>A" "" "VUS" "ACMG" "0000797621" "0" "70" "6" "64499118" "64499118" "subst" "0" "00000" "EYS_000695" "g.64499118C>G" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.7412-1G>C, p.(?), c.2023+5G>T, p.(?),, pROM1 c.1354dup, p.(Tyr452*)" "" "Germline" "?" "" "0" "" "" "g.63789225C>G" "" "likely pathogenic" "ACMG" "0000797622" "0" "70" "6" "66094373" "66094373" "dup" "0" "00000" "EYS_000273" "g.66094373dup" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.1211dup, p.(Asn404Lysfs*3)" "" "Germline" "?" "" "0" "" "" "g.65384480dup" "" "likely pathogenic" "ACMG" "0000797623" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.1211dup, p.(Asn404Lysfs*3)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797624" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.4957dup, p.(Ser1653Lysfs*2), c.2528G>A, p.(Gly843Glu)" "" "Germline" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "ACMG" "0000797625" "0" "50" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.4957dup, p.(Ser1653Lysfs*2), c.2528G>A, p.(Gly843Glu)" "" "Germline" "?" "" "0" "" "" "g.64912597C>T" "" "VUS" "ACMG" "0000797626" "0" "70" "6" "64472371" "64472371" "subst" "6.62989E-6" "00000" "EYS_000091" "g.64472371C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8054G>A, p.(Gly2685Glu), c.8648_8655del, p.(Thr2883Lysfs*4)" "" "Germline" "?" "" "0" "" "" "g.63762478C>T" "" "likely pathogenic" "ACMG" "0000797627" "0" "90" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8054G>A, p.(Gly2685Glu), c.8648_8655del, p.(Thr2883Lysfs*4)" "" "Germline" "?" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "ACMG" "0000797628" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.4350_4356del, p.(Ile1451Profs*3), c.232del, p.(Cys78Alafs*7), ABCA4 c.6148G>C, p.(Val2050Leu)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797630" "0" "90" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.4350_4356del, p.(Ile1451Profs*3), c.232del, p.(Cys78Alafs*7), ABCA4 c.6148G>C, p.(Val2050Leu)" "" "Germline" "?" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "ACMG" "0000797631" "3" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.232del, p.(Cys78Alafs*7)" "homozygous" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797632" "0" "70" "6" "66115250" "66115250" "subst" "0" "00000" "EYS_000702" "g.66115250A>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.873T>A, p.(Cys291*), c.4957dup, p.(Ser1653Lysfs*2)" "" "Germline" "?" "" "0" "" "" "g.65405357A>T" "" "likely pathogenic" "ACMG" "0000797633" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.873T>A, p.(Cys291*), c.4957dup, p.(Ser1653Lysfs*2)" "" "Germline" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "ACMG" "0000797634" "3" "90" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.(2023+1_2024-1) _(3443+1_3444-1)del, c.(2023+1_2024-1) _(3443+1_3444-1)del TTC8 c.1297C>T, p.(Arg433Trp)" "homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000797636" "3" "90" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.(6078+1_6079-1)_(6191+1_6192-1)dup c.(6078+1_6079-1)_(6191+1_6192-1)dup" "homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000797637" "0" "70" "6" "66204957" "66204957" "del" "0" "00000" "EYS_000703" "g.66204957del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.350del, p.(Asn117Ilefs*14), c.4350_4356del, p.(Ile1451Profs*3), GPR98 c.3430C>T, p.(Arg1144*)" "" "Germline" "?" "" "0" "" "" "g.65495064del" "" "likely pathogenic" "ACMG" "0000797638" "0" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.350del, p.(Asn117Ilefs*14), c.4350_4356del, p.(Ile1451Profs*3), GPR98 c.3430C>T, p.(Arg1144*)" "" "Germline" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "ACMG" "0000797640" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.6714del, p.(Ile2239Serfs*17), ABCA4 c.5908C>T, p.(Leu1970Phe)" "homozygous" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797642" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8648_8655del, p.(Thr2883Lysfs*4), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797643" "0" "90" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8648_8655del, p.(Thr2883Lysfs*4), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "ACMG" "0000797644" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17) c.(2137+1_2138-1) _(2259+1_2260-1) dup" "" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG" "0000797645" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.(2137+1_2138-1), _(2259+1_2260-1), dup" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797646" "0" "90" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.4350_4356del, p.(Ile1451Profs*3), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic" "ACMG" "0000797647" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.4350_4356del, p.(Ile1451Profs*3), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797648" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6591_6594del, p.(Lys2198Serfs*25)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797649" "0" "90" "6" "64776363" "64776366" "del" "0" "00000" "EYS_000696" "g.64776363_64776366del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6591_6594del, p.(Lys2198Serfs*25)" "" "Germline" "?" "" "0" "" "" "g.64066470_64066473del" "" "pathogenic" "ACMG" "0000797650" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17) c.(2641+1_2642-1) _(2846+1_2847-1)del" "" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG" "0000797651" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.(2641+1_2642-1), _(2846+1_2847-1), del" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797652" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797653" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797654" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6591_6594del, p.(Lys2198Serfs*25)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797655" "0" "90" "6" "64776363" "64776366" "del" "0" "00000" "EYS_000696" "g.64776363_64776366del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6591_6594del, p.(Lys2198Serfs*25)" "" "Germline" "?" "" "0" "" "" "g.64066470_64066473del" "" "pathogenic" "ACMG" "0000797656" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.6714del, p.(Ile2239Serfs*17), c.6714del, p.(Ile2239Serfs*17)" "homozygous" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797657" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8648_8655del, p.(Thr2883Lysfs*4), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797658" "0" "90" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.8648_8655del, p.(Thr2883Lysfs*4), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.63721377_63721384del" "" "pathogenic" "ACMG" "0000797659" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000797660" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7), c.6714del, p.(Ile2239Serfs*17)" "" "Germline" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000797661" "0" "50" "6" "66005751" "66005751" "subst" "0" "00000" "EYS_000701" "g.66005751C>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.2023+5G>T, p.(?), c.2137+1G>A, p.(?), CDH23 c.268C>T, p.(Arg90Trp), c.2263C>T, p.(His755Tyr), c.3221A>T, p.(Asp1074Val)" "" "Germline" "?" "" "0" "" "" "g.65295858C>A" "" "VUS" "ACMG" "0000797662" "0" "70" "6" "65767506" "65767506" "subst" "0.000748443" "00000" "EYS_000530" "g.65767506C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.2023+5G>T, p.(?), c.2137+1G>A, p.(?), CDH23 c.268C>T, p.(Arg90Trp), c.2263C>T, p.(His755Tyr), c.3221A>T, p.(Asp1074Val)" "" "Germline" "?" "" "0" "" "" "g.65057613C>T" "" "likely pathogenic" "ACMG" "0000797817" "0" "70" "6" "64431498" "64431498" "subst" "0.000908445" "00000" "EYS_000074" "g.64431498G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "RPE65 c.271C>Tp.(Arg91Trp), c.271C>T, p.(Arg91Trp), EYS c.8429C>T, p.(The2810Ile)" "" "Germline" "?" "" "0" "" "" "g.63721602G>A" "" "likely pathogenic" "ACMG" "0000797897" "0" "70" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Jespersgaar 2019:30718709}" "" "USH2A c.2276G>T, p.(Cys759Phe), c.9799T>C, p.(Cys3267Arg), EYS c.8648_8655del, p.(Thr2883Lysfs*4)" "" "Germline" "?" "" "0" "" "" "g.63721377_63721384del" "" "likely pathogenic" "ACMG" "0000798000" "0" "90" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.232del, p.(Cys78Alafs*7)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.65495181del" "" "pathogenic" "ACMG" "0000798001" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.(6078+1_6079-1) _(6191+1_6192-1)del" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "ACMG" "0000798002" "0" "50" "6" "66115146" "66115146" "subst" "0.00181254" "00000" "EYS_000277" "g.66115146C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.2000G>A, p.(Arg667His), c.977G>A, p.(Ser326Asn)" "" "Germline" "?" "" "0" "" "" "g.65405253C>T" "" "VUS" "ACMG" "0000798003" "0" "50" "6" "66005779" "66005779" "subst" "0.000294867" "00000" "EYS_000356" "g.66005779C>T" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.2000G>A, p.(Arg667His), c.977G>A, p.(Ser326Asn)" "" "Germline" "?" "" "0" "" "" "g.65295886C>T" "" "VUS" "ACMG" "0000798004" "0" "70" "6" "66063346" "66063346" "subst" "0.000513598" "00000" "EYS_000008" "g.66063346G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.1459+5C>T, p.(?)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.65353453G>A" "" "likely pathogenic" "ACMG" "0000798005" "0" "70" "6" "66044874" "66044874" "subst" "8.18974E-5" "00000" "EYS_000256" "g.66044874T>C" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.1765A>G, p.(Arg589Gly)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.65334981T>C" "" "likely pathogenic" "ACMG" "0000798006" "0" "70" "6" "64472476" "64472476" "subst" "5.96121E-5" "00000" "EYS_000095" "g.64472476G>A" "" "{PMID:Jespersgaar 2019:30718709}" "" "EYS c.7949C>T, p.(Ser2650Phe)" "single heterozygous variant (recessive)" "Germline" "?" "" "0" "" "" "g.63762583G>A" "" "likely pathogenic" "ACMG" "0000798327" "0" "70" "6" "64430591" "64430610" "del" "0" "03840" "EYS_000693" "g.64430591_64430610del" "0 (in-house database, ~5000 samples)" "{PMID:Tracewska 2019:31766579}" "" "" "" "Germline" "" "" "0" "" "" "g.63720695_63720714del" "" "likely pathogenic" "ACMG" "0000798501" "3" "90" "6" "64430632" "64430641" "del" "0.000173997" "00000" "EYS_000046" "g.64430632_64430641del" "" "{PMID:Beryozkin-2014:24474277}" "" "c.9286_9295del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000802665" "0" "30" "6" "64436481" "64436481" "subst" "0" "01943" "EYS_000704" "g.64436481A>G" "" "" "" "EYS(NM_001292009.1):c.8227T>C (p.L2743=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802666" "0" "70" "6" "64694275" "64694275" "subst" "0" "02330" "EYS_000125" "g.64694275C>A" "" "" "" "EYS(NM_001292009.2):c.7055+1G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000802667" "0" "50" "6" "65098614" "65098614" "subst" "0" "01943" "EYS_000510" "g.65098614C>T" "" "" "" "EYS(NM_001292009.1):c.6047G>A (p.G2016D), EYS(NM_001292009.2):c.6047G>A (p.G2016D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802668" "0" "30" "6" "65098705" "65098705" "subst" "0" "01943" "EYS_000705" "g.65098705G>A" "" "" "" "EYS(NM_001292009.1):c.5956C>T (p.L1986=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802669" "0" "50" "6" "65149147" "65149147" "subst" "0.0011368" "01943" "EYS_000325" "g.65149147T>C" "" "" "" "EYS(NM_001292009.1):c.5743A>G (p.S1915G), EYS(NM_001292009.2):c.5743A>G (p.S1915G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802670" "0" "50" "6" "65300236" "65300236" "subst" "0" "01943" "EYS_000706" "g.65300236G>T" "" "" "" "EYS(NM_001292009.1):c.5524C>A (p.L1842I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802671" "0" "50" "6" "65622566" "65622566" "subst" "0" "01943" "EYS_000707" "g.65622566A>G" "" "" "" "EYS(NM_001292009.1):c.2452T>C (p.C818R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802672" "0" "50" "6" "65655779" "65655779" "subst" "0" "01943" "EYS_000708" "g.65655779C>A" "" "" "" "EYS(NM_001292009.1):c.2288G>T (p.W763L), EYS(NM_001292009.2):c.2288G>T (p.W763L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802673" "0" "30" "6" "66005880" "66005880" "subst" "0.00188933" "01943" "EYS_000359" "g.66005880T>C" "" "" "" "EYS(NM_001292009.1):c.1899A>G (p.Q633=), EYS(NM_001292009.2):c.1899A>G (p.Q633=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802674" "0" "90" "6" "66044966" "66044966" "subst" "0.000118405" "02329" "EYS_000259" "g.66044966C>T" "" "" "" "EYS(NM_001292009.1):c.1673G>A (p.W558*), EYS(NM_001292009.2):c.1673G>A (p.W558*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000802675" "0" "30" "6" "66054051" "66054051" "subst" "1.63595E-5" "02327" "EYS_000616" "g.66054051G>A" "" "" "" "EYS(NM_001292009.1):c.1479C>T (p.C493=), EYS(NM_001292009.2):c.1479C>T (p.C493=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802676" "0" "50" "6" "66063381" "66063381" "subst" "0.000109953" "01943" "EYS_000709" "g.66063381A>G" "" "" "" "EYS(NM_001292009.1):c.1429T>C (p.F477L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802677" "0" "50" "6" "66200561" "66200561" "subst" "0.000463528" "01943" "EYS_000710" "g.66200561T>C" "" "" "" "EYS(NM_001292009.1):c.788A>G (p.H263R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000811482" "0" "90" "6" "64430564" "64430564" "del" "0" "00000" "EYS_000577" "g.64430564del" "" "{PMID:Kim 2019:31496144}" "" "EYS c.9368delA, p.N3123Tfs" "" "Germline" "?" "" "0" "" "" "g.63720668del" "" "pathogenic" "ACMG" "0000811483" "0" "70" "6" "64791757" "64791757" "subst" "0" "00000" "EYS_000143" "g.64791757A>G" "" "{PMID:Kim 2019:31496144}" "" "EYS c.6563T>C, p.I2188T" "" "Germline" "?" "" "0" "" "" "g.64081864A>G" "" "likely pathogenic" "ACMG" "0000811484" "0" "90" "6" "65622496" "65622496" "dup" "0" "00000" "EYS_000238" "g.65622496dup" "" "{PMID:Kim 2019:31496144}" "" "EYS c.2522_2523insA, p.Y841delinsXYfs" "error in protein variant annotation" "Germline" "?" "" "0" "" "" "g.64912603dup" "" "pathogenic" "ACMG" "0000811485" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Kim 2019:31496144}" "" "EYS c.4957_4958insA, p.S1653delinsKXfs" "error in protein variant annotation" "Germline" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000811518" "0" "50" "6" "64694306" "64694306" "subst" "0" "00000" "EYS_000580" "g.64694306T>G" "" "{PMID:Kim 2019:31496144}" "" "EYS c.7025A>C, p.H2342P" "" "Germline" "?" "" "0" "" "" "g.63984413T>G" "" "VUS" "ACMG" "0000811519" "0" "70" "6" "64791757" "64791757" "subst" "0" "00000" "EYS_000143" "g.64791757A>G" "" "{PMID:Kim 2019:31496144}" "" "EYS c.6563T>C, p.I2188T" "" "Germline" "?" "" "0" "" "" "g.64081864A>G" "" "likely pathogenic" "ACMG" "0000811520" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Kim 2019:31496144}" "" "EYS c.6557G>A, p.G2186E" "" "Germline" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "ACMG" "0000811521" "0" "90" "6" "65622638" "65622638" "subst" "0" "00000" "EYS_000587" "g.65622638T>A" "" "{PMID:Kim 2019:31496144}" "" "EYS c.2382-2A>T, Splice" "" "Germline" "?" "" "0" "" "" "g.64912745T>A" "" "pathogenic" "ACMG" "0000811807" "0" "70" "5" "64472476" "64472476" "subst" "0" "00000" "EYS_000095" "g.64472476G>A" "" "{PMID:Gao 2019:31054281}" "" "c.7949C>T, p.Ser2650Phe" "heterozygous" "Germline" "?" "" "0" "" "" "g.63762583G>A" "" "likely pathogenic" "" "0000811814" "0" "70" "2" "64791757" "64791757" "subst" "0" "00000" "EYS_000143" "g.64791757A>G" "" "{PMID:Gao 2019:31054281}" "" "c.6563T>C, p.Ile2188Thr" "heterozygous" "Germline" "?" "" "0" "" "" "g.64081864A>G" "" "likely pathogenic" "" "0000811830" "0" "70" "2" "64791763" "64791763" "subst" "0" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Gao 2019:31054281}" "" "c.6557G>A, p.Gly2186Glu" "heterozygous" "Germline" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000811852" "0" "70" "15" "66063392" "66063392" "subst" "0" "00000" "EYS_000265" "g.66063392C>A" "" "{PMID:Gao 2019:31054281}" "" "c.1418G>T, p.Gly473Val" "heterozygous" "Germline" "?" "" "0" "" "" "g.65353499C>A" "" "likely pathogenic" "" "0000811853" "0" "70" "1" "64488004" "64488004" "subst" "0" "00000" "EYS_000100" "g.64488004C>T" "" "{PMID:Gao 2019:31054281}" "" "c.7793G>A, p.Gly2598Asp" "heterozygous" "Germline" "?" "" "0" "" "" "g.63778111C>T" "" "likely pathogenic" "" "0000811855" "0" "70" "4" "66005779" "66005779" "subst" "0" "00000" "EYS_000356" "g.66005779C>T" "" "{PMID:Gao 2019:31054281}" "" "c.2000G>A, p.Arg667His" "heterozygous" "Germline" "?" "" "0" "" "" "g.65295886C>T" "" "likely pathogenic" "" "0000811909" "3" "70" "6" "65098611" "65098611" "subst" "2.83214E-5" "00000" "EYS_000154" "g.65098611C>A" "" "{PMID:Hariri 2018:31047384}" "" "p.Asp202Glu:c.606C/A in RP1(homozygous); p.Gly2017Val:c.6050G/T(homozygous) in EYS" "" "Germline" "?" "" "0" "" "" "g.64388718C>A" "" "likely pathogenic" "" "0000811936" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Hariri 2018:31047384}" "" "c.6416G/A (p.C2139Y), c.5644+5G/A" "" "Germline" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000811937" "0" "70" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Hariri 2018:31047384}" "" "c.6416G/A (p.C2139Y), c.5644+5G/A" "" "Germline" "?" "" "0" "" "" "g.64590218C>T" "" "likely pathogenic" "" "0000812006" "0" "70" "6" "66200569" "66200569" "subst" "0" "00000" "EYS_000717" "g.66200569A>T" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.5 c.780T>A p.(Cys260*), Ex.43 c.9299_9302del p.(Thr3100Lysfs*26)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65490676A>T" "" "likely pathogenic" "" "0000812007" "0" "70" "6" "64430626" "64430629" "del" "0" "00000" "EYS_000045" "g.64430626_64430629del" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.5 c.780T>A p.(Cys260*), Ex.43 c.9299_9302del p.(Thr3100Lysfs*26)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63720730_63720733del" "" "likely pathogenic" "" "0000812011" "3" "70" "6" "65612025" "65612026" "del" "0" "00000" "EYS_000231" "g.65612025_65612026del" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.18 c.2826_2827del p.(Val944Glyfs*9), Ex.18 c.2826_2827del p.(Val944Glyfs*9)" "homozygous" "Germline" "yes" "" "0" "" "" "g.64902132_64902133del" "" "likely pathogenic" "" "0000812034" "0" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4045C>T p.(Arg1349*), Ex.43 c.9405T>A p.(Tyr3135*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.64591822G>A" "" "likely pathogenic" "" "0000812035" "0" "70" "6" "64430522" "64430522" "subst" "1.67165E-5" "00000" "EYS_000020" "g.64430522A>T" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4045C>T p.(Arg1349*), Ex.43 c.9405T>A p.(Tyr3135*)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.63720626A>T" "" "likely pathogenic" "" "0000812074" "3" "70" "6" "65098611" "65098611" "subst" "2.83214E-5" "00000" "EYS_000154" "g.65098611C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.29 c.6050G>T p.(Gly2017Val), Ex.29 c.6050G>T p.(Gly2017Val)" "homozygous" "Germline" "yes" "" "0" "" "" "g.64388718C>A" "" "likely pathogenic" "" "0000812118" "3" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4120C>T p.(Arg1374*), Ex.26 c.4120C>T p.(Arg1374*)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64591747G>A" "" "likely pathogenic" "" "0000812169" "0" "70" "6" "65532705" "65532705" "subst" "2.00682E-5" "00000" "EYS_000224" "g.65532705A>T" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.20 c.3003T>A p.(Cys1001*), Ex.43 c.9079dup p.(Arg3027Lysfs*9)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.64822812A>T" "" "likely pathogenic" "" "0000812170" "0" "70" "6" "64430850" "64430850" "dup" "0" "00000" "EYS_000711" "g.64430850dup" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.20 c.3003T>A p.(Cys1001*), Ex.43 c.9079dup p.(Arg3027Lysfs*9)" "compound heterozygous" "Germline" "yes" "" "0" "" "" "g.63720954dup" "" "likely pathogenic" "" "0000812242" "3" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4120C>T p.(Arg1374*), Ex.26 c.4120C>T p.(Arg1374*)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64591747G>A" "" "likely pathogenic" "" "0000812246" "0" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4120C>T p.(Arg1374*), Ex.28 c.5857G>T p.(Glu1953*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64591747G>A" "" "likely pathogenic" "" "0000812247" "0" "70" "6" "65146137" "65146137" "subst" "0" "00000" "EYS_000161" "g.65146137C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4120C>T p.(Arg1374*), Ex.28 c.5857G>T p.(Glu1953*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64436244C>A" "" "likely pathogenic" "" "0000812253" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.32-33 c.(6424+1_6425-1)_(6725+1_6726-1)del, Ex.41 c.7919G>A p.(Trp2640*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000812254" "0" "70" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.32-33 c.(6424+1_6425-1)_(6725+1_6726-1)del, Ex.41 c.7919G>A p.(Trp2640*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63762613C>T" "" "likely pathogenic" "" "0000812298" "0" "70" "6" "66200576" "66200576" "subst" "4.06736E-6" "00000" "EYS_000718" "g.66200576C>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.5 c.773G>T p.(Gly258Val), Ex.26 c.4120C>T p.(Arg1374*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65490683C>A" "" "likely pathogenic" "" "0000812299" "0" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.5 c.773G>T p.(Gly258Val), Ex.26 c.4120C>T p.(Arg1374*)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64591747G>A" "" "likely pathogenic" "" "0000812325" "0" "70" "6" "64776228" "64776228" "del" "0" "00000" "EYS_000714" "g.64776228del" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS IVS33 c.6725+4del p.(?), Ex.43 c.8249T>A p.(Ile2750Asn), USH2A: Ex.63 c.12343C>T p.(Arg4115Cys)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64066335del" "" "likely pathogenic" "" "0000812327" "0" "70" "6" "64431678" "64431678" "subst" "0" "00000" "EYS_000712" "g.64431678A>T" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS IVS33 c.6725+4del p.(?), Ex.43 c.8249T>A p.(Ile2750Asn), USH2A: Ex.63 c.12343C>T p.(Arg4115Cys)" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63721782A>T" "" "likely pathogenic" "" "0000812355" "3" "70" "6" "65596604" "65596604" "del" "0" "00000" "EYS_000716" "g.65596604del" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.19 c.2981del p.(Pro994Leufs*10), Ex.19 c.2981del p.(Pro994Leufs*10)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64886711del" "" "likely pathogenic" "" "0000812366" "0" "70" "6" "65655687" "65655687" "subst" "1.35212E-5" "00000" "EYS_000012" "g.65655687G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.15 c.2380C>T p.(Arg794*), Ex.32-33 c.(6424+1_6425-1)_(6725+1_6726-1)del" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64945794G>A" "" "likely pathogenic" "" "0000812367" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.15 c.2380C>T p.(Arg794*), Ex.32-33 c.(6424+1_6425-1)_(6725+1_6726-1)del" "compound heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000812431" "3" "70" "6" "64488059" "64488065" "del" "0" "00000" "EYS_000713" "g.64488059_64488065del" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.40 c.7736_7742del p.(Thr2579Lysfs*36), Ex.40 c.7736_7742del p.(Thr2579Lysfs*36)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63778166_63778172del" "" "likely pathogenic" "" "0000812438" "3" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4045C>T p.(Arg1349*), Ex.26 c.4045C>T p.(Arg1349*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.64591822G>A" "" "likely pathogenic" "" "0000812440" "3" "70" "6" "65300807" "65300807" "dup" "0" "00000" "EYS_000715" "g.65300807dup" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS Ex.26 c.4953dup p.(Ser1652Ilefs*3), Ex.26 c.4953dup p.(Ser1652Ilefs*3)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590914dup" "" "likely pathogenic" "" "0000812452" "3" "70" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Martin Merida 2019:30902645}" "" "EYS IVS28 c.5928-2A>G p.(?), IVS28 c.5928-2A>G p.(?)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64388842T>C" "" "likely pathogenic" "" "0000812563" "0" "70" "6" "64472413" "64472413" "subst" "1.9867E-5" "00000" "EYS_000093" "g.64472413A>T" "" "{PMID:Wang 2019:31106028}" "" "c.8012A>T, p.(Leu2671*)" "error in annotation: c.8012A>T instead of T>A, compound heterozygous" "Germline" "?" "" "0" "" "" "g.63762520A>T" "" "likely pathogenic" "" "0000812564" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Wang 2019:31106028}" "" "c.6416C>T, p.(Cys2139Tyr)" "error in annotation: c.6416C>T instead of G>A, compound heterozygous" "Germline" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000812579" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Wang 2019:31106028}" "" "c.7228+1C>T, p.?" "error in annotation: c.7228+1C>T instead of G>A, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000812580" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Wang 2019:31106028}" "" "c.6416C>T, p.(Cys2139Tyr)" "error in annotation: c.6416C>T instead of G>A, compound heterozygous" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000813182" "0" "70" "6" "65303192" "65303192" "subst" "8.65029E-5" "00000" "EYS_000208" "g.65303192A>G" "0/200 controls" "{PMID:González-del Pozo-2011:22164218}" "" "c.3695T.C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813183" "0" "70" "6" "66005755" "66006013" "del" "0" "00000" "EYS_000720" "g.66005755_66006013del" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.1767-?_2023+?del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813184" "0" "70" "6" "66005808" "66005808" "del" "0" "00000" "EYS_000251" "g.66005808del" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.1971delT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813185" "0" "70" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "0/200 controls" "{PMID:González-del Pozo-2011:22164218}" "" "c.5928-2A.G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813186" "0" "70" "6" "64472422" "64472422" "subst" "5.96019E-5" "00000" "EYS_000094" "g.64472422C>A" "0/200 controls" "{PMID:González-del Pozo-2011:22164218}" "" "c.8003G.T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000813200" "0" "30" "6" "66417039" "66417039" "subst" "0" "00000" "EYS_000306" "g.66417039G>A" "20/200 controls" "{PMID:González-del Pozo-2011:22164218}" "" "c.-459C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813201" "0" "30" "6" "66005927" "66005927" "subst" "0.000112112" "00000" "EYS_000253" "g.66005927C>T" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.1852G>A" "" "Germline" "no" "" "0" "" "" "" "" "likely benign" "" "0000813202" "3" "30" "6" "65767634" "65767634" "subst" "0.243022" "00000" "EYS_000248" "g.65767634G>A" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.2024-14C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813203" "0" "30" "6" "64574072" "64574072" "subst" "1.00355E-5" "00000" "EYS_000118" "g.64574072C>T" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.7228+7G>A" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813204" "0" "30" "6" "64498113" "64498113" "subst" "0.000153428" "00000" "EYS_000109" "g.64498113G>A" "" "{PMID:González-del Pozo-2011:22164218}" "" "c.7608C>T" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000813901" "0" "70" "6" "64436511" "64436515" "del" "0" "00000" "EYS_000400" "g.64436511_64436515del" "" "{PMID:Jiman 2020:31836858}" "" "EYS;NM_001142800.1;c.[8133_8137del];[8816G>C];p.[(Phe2712Cysfs*33)];[(Cys2939Ser)]" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63726618_63726622del" "" "likely pathogenic" "" "0000813902" "0" "70" "6" "64431111" "64431111" "subst" "0" "00000" "EYS_000719" "g.64431111C>G" "" "{PMID:Jiman 2020:31836858}" "" "EYS;NM_001142800.1;c.[8133_8137del];[8816G>C];p.[(Phe2712Cysfs*33)];[(Cys2939Ser)]" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721215C>G" "" "likely pathogenic" "" "0000814262" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2020:31872526}" "" "EYS:NM_001142800:exon31:c.6416G>A:p.C2139Y" "homozygous" "Germline" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000814264" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2020:31872526}" "" "EYS:NM_001142800:exon31:c.6416G>A:p.C2139Y" "homozygous" "Germline" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000814272" "1" "70" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "" "{PMID:Chen 2020:31872526}" "" "EYS:NM_001142800:exon42:c.8107G>T:p.E2703X" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.63726645C>A" "" "likely pathogenic" "" "0000814299" "2" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "" "{PMID:Chen 2020:31872526}" "" "EYS:NM_001142800:exon23:c.3489T>A:p.N1163K" "compound heterozygous" "Germline" "?" "" "0" "" "" "g.64626200A>T" "" "likely pathogenic" "" "0000814753" "0" "90" "6" "64431382" "64431382" "subst" "0" "00000" "EYS_000424" "g.64431382G>A" "" "{PMID:Dan 2020:31960602}" "" "EYS c.8545C>T, p.(Arg2849*)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63721486G>A" "" "pathogenic" "ACMG" "0000814764" "0" "70" "6" "65596621" "65596629" "del" "0" "00000" "EYS_000228" "g.65596621_65596629del" "" "{PMID:Dan 2020:31960602}" "" "EYS c.2953_2961delACTGATGGA, p.(Thr985_ Gly987del)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64886728_64886736del" "" "likely pathogenic" "ACMG" "0000814771" "0" "90" "6" "65300805" "65300805" "subst" "0" "00000" "EYS_000625" "g.65300805G>T" "" "{PMID:Dan 2020:31960602}" "" "EYS c.4955C>A, p.(Ser1652*)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590912G>T" "" "pathogenic" "ACMG" "0000814779" "0" "70" "6" "64430718" "64430718" "subst" "0.000316673" "00000" "EYS_000049" "g.64430718A>G" "" "{PMID:Dan 2020:31960602}" "" "EYS c.9209T>C, p.(Ile3070Thr)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.63720822A>G" "" "likely pathogenic" "ACMG" "0000814796" "0" "90" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Dan 2020:31960602}" "" "EYS c.5644+5G>A, -" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590218C>T" "" "pathogenic" "ACMG" "0000814802" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Dan 2020:31960602}" "" "EYS c.8805C>A, p.(Tyr2935*)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63721226G>T" "" "pathogenic" "ACMG" "0000814806" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Dan 2020:31960602}" "" "EYS c.6557G>A, p.(Gly2186Glu)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "ACMG" "0000814811" "0" "70" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "" "{PMID:Dan 2020:31960602}" "" "EYS c.3489T>A, p.(Asn1163Lys)" "heterozygous" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.64626200A>T" "" "likely pathogenic" "ACMG" "0000814928" "1" "70" "6" "65603050" "65657245" "del" "0" "00000" "EYS_000722" "g.65603050_65657245del" "" "{PMID:Cho 2020:32000842}" "" "chr6:65603049_65657244del" "Heterozygous" "Unknown" "?" "" "0" "" "" "g.64893157_64947352del" "" "likely pathogenic (recessive)" "" "0000814931" "2" "70" "6" "65506902" "65555980" "del" "0" "00000" "EYS_000721" "g.65506902_65555980del" "" "{PMID:Cho 2020:32000842}" "" "chr6:65506901_65555979del" "Heterozygous" "Unknown" "?" "" "0" "" "" "g.64797009_64846087del" "" "likely pathogenic (recessive)" "" "0000815370" "0" "90" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.C4120T, p.R1374X" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.64591747G>A" "" "pathogenic" "ACMG" "0000815395" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "c.6714del; p.(Ile2239Serfs*17)" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000815396" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.6714delT, p.I2239Sfs*16" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.64066349del" "" "pathogenic" "ACMG" "0000815415" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.5928-2A>G, p.?" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.64388842T>C" "" "pathogenic" "ACMG" "0000815499" "0" "50" "6" "65655758" "65655758" "subst" "0.00115297" "00000" "EYS_000001" "g.65655758T>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.A2309C, p.Q770P" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.64945865T>G" "" "VUS" "ACMG" "0000815518" "0" "90" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 ex. 16-21 del, p.?" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000815536" "0" "50" "6" "64472484" "64472484" "subst" "0" "00000" "EYS_000723" "g.64472484C>G" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.G7941C, p.E2647D" "heterozygous, individual solved, variant non-causal" "Germline" "?" "" "0" "" "" "g.63762591C>G" "" "VUS" "ACMG" "0000815547" "0" "70" "6" "64431093" "64431093" "subst" "1.98776E-5" "00000" "EYS_000064" "g.64431093C>T" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "c.8834G>A; p.(Gly2945Glu)" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.63721197C>T" "" "likely pathogenic" "ACMG" "0000815549" "0" "70" "6" "64431093" "64431093" "subst" "1.98776E-5" "00000" "EYS_000064" "g.64431093C>T" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.G8834A, p.G2945E" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.63721197C>T" "" "likely pathogenic" "ACMG" "0000815553" "0" "90" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 ex. 12 del, p.?" "heterozygous, individual solved, variant causal" "Germline" "yes" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000815608" "0" "50" "6" "64574085" "64574085" "subst" "4.32807E-5" "00000" "EYS_000724" "g.64574085T>C" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 c.A7222G, p.T2408A" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.63864192T>C" "" "VUS" "ACMG" "0000815624" "0" "90" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Rodriguez-Munoz 2020:32036094}" "" "EYS:NM_001142800 ex. 32-33 del, p.?" "heterozygous, individual unsolved, causality of variants unknown" "Germline" "?" "" "0" "" "" "g.?" "" "pathogenic" "ACMG" "0000815953" "0" "70" "6" "64436412" "64436412" "del" "0" "00000" "EYS_000731" "g.64436412del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.8233+1del" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63726519del" "" "likely pathogenic" "" "0000815959" "3" "70" "6" "65707168" "65707908" "del" "0" "00000" "EYS_000749" "g.65707168_65707908del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:65707165_65707905del" "range 120-739 bp in various techniques, homozygous" "Unknown" "?" "" "0" "" "" "g.64997275_64998015del" "" "likely pathogenic" "" "0000815960" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.6714del, p.Ile2239SerfsTer17" "both papers interpret c.6714del as p.Pro2238ProX16, heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000815974" "0" "70" "6" "64791498" "64792145" "del" "0" "00000" "EYS_000736" "g.64791498_64792145del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:64791498_64792145del" "range 646- 11718 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.64081605_64082252del" "" "likely pathogenic" "" "0000815979" "3" "50" "6" "64430583" "64430583" "subst" "6.75721E-6" "00000" "EYS_000692" "g.64430583A>T" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.9344T>A, p.Val3115Asp" "homozygous" "Unknown" "?" "" "0" "" "" "g.63720687A>T" "" "VUS" "" "0000815987" "0" "70" "6" "64487648" "64499367" "dup" "0" "00000" "EYS_000733" "g.64487648_64499367dup" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:64487648_64499367dup" "exons 38-40, 487 coding bases, out of frame, range 11718-11217 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.63777755_63789474dup" "" "likely pathogenic" "" "0000815995" "0" "70" "6" "65532716" "65532716" "subst" "0" "00000" "EYS_000745" "g.65532716C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.2993-1G>A" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64822823C>T" "" "likely pathogenic" "" "0000816004" "3" "70" "6" "64791792" "64791792" "subst" "6.77663E-6" "00000" "EYS_000738" "g.64791792G>T" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.6528C>A, p.Tyr2176Ter" "homozygous" "Unknown" "?" "" "0" "" "" "g.64081899G>T" "" "likely pathogenic" "" "0000816009" "0" "70" "6" "65707500" "65707500" "subst" "0.000801619" "00000" "EYS_000243" "g.65707500T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.2234A>G, p.Asn745Ser" "conflicting in silico model predictions, heterozygous" "Unknown" "?" "" "0" "" "" "g.64997607T>C" "" "likely pathogenic" "" "0000816010" "0" "50" "6" "64430692" "64430692" "subst" "1.32148E-5" "00000" "EYS_000311" "g.64430692G>C" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.9235C>G, p.Leu3079Val" "conflicting in silico model predictions, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720796G>C" "" "VUS" "" "0000816014" "0" "50" "6" "65098583" "65098583" "subst" "0" "00000" "EYS_000153" "g.65098583C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.6078G>T, p.Gln2026His" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64388690C>A" "" "VUS" "" "0000816021" "0" "90" "6" "64430633" "64430642" "del" "0" "00000" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.9286_9295del, p.Val3096LeufsTer28" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic" "" "0000816031" "0" "70" "6" "64791498" "64792145" "del" "0" "00000" "EYS_000736" "g.64791498_64792145del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:64791498_64792145del" "range 145-44366 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.64081605_64082252del" "" "likely pathogenic" "" "0000816037" "0" "70" "6" "66063101" "66063760" "del" "0" "00000" "EYS_000752" "g.66063101_66063760del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:66063101_66063760del" "range 158-659 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.65353208_65353867del" "" "likely pathogenic" "" "0000816038" "0" "50" "6" "64431148" "64431148" "subst" "3.95361E-5" "00000" "EYS_000067" "g.64431148A>G" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.8779T>C, p.Cys2927Arg" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63721252A>G" "" "VUS" "" "0000816055" "0" "70" "6" "64694027" "64694747" "del" "0" "00000" "EYS_000735" "g.64694027_64694747del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:64694025_64694745del" "range 219-719 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.63984134_63984854del" "" "likely pathogenic" "" "0000816059" "3" "70" "6" "64453450" "64617127" "del" "0" "00000" "EYS_000732" "g.64453450_64617127del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:64453450_64617127del" "range 101896-163677 bp in various techniques, homozygous" "Unknown" "?" "" "0" "" "" "g.63743557_63907234del" "" "likely pathogenic" "" "0000816086" "0" "70" "6" "64430633" "64430642" "del" "0" "00000" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.9286_9295del, p.Val3096LeufsTer28" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720737_63720746del" "" "likely pathogenic" "" "0000816098" "0" "70" "6" "65372425" "65689673" "del" "0" "00000" "EYS_000744" "g.65372425_65689673del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:65372425_65689673del" "range 133095-317248 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.64662532_64979780del" "" "likely pathogenic" "" "0000816112" "0" "50" "6" "64436565" "64436565" "subst" "0.000162441" "00000" "EYS_000501" "g.64436565T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.8080A>G, p.Ile2694Val" "conflicting in silico model predictions, heterozygous" "Unknown" "?" "" "0" "" "" "g.63726672T>C" "" "VUS" "" "0000816120" "3" "70" "6" "64436439" "64436439" "subst" "6.75521E-6" "00000" "EYS_000087" "g.64436439C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.8206G>C, p.Ala2736Pro" "homozygous" "Unknown" "?" "" "0" "" "" "g.63726546C>G" "" "likely pathogenic" "" "0000816122" "0" "70" "6" "65549012" "65680006" "del" "0" "00000" "EYS_000746" "g.65549012_65680006del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS chr6:65549011_65680005del" "range 59216-130994 bp in various techniques, heterozygous" "Unknown" "?" "" "0" "" "" "g.64839119_64970113del" "" "likely pathogenic" "" "0000816126" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.6557G>A, p.Gly2186Glu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000816127" "0" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "00000" "EYS_000216" "g.65523270C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.3443+1G>T" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0000816144" "0" "70" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.5644+5G>A" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64590218C>T" "" "likely pathogenic" "" "0000816185" "3" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "00000" "EYS_000216" "g.65523270C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.3443+1G>T" "homozygous" "Unknown" "?" "" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0000816198" "0" "70" "6" "64430768" "64430769" "del" "0" "00000" "EYS_000728" "g.64430768_64430769del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.9159_9160del, p.Gln3053HisfsTer9" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720872_63720873del" "" "likely pathogenic" "" "0000816211" "0" "70" "6" "66044966" "66044966" "subst" "0.000118405" "00000" "EYS_000259" "g.66044966C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.1673G>A, p.Trp558Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.65335073C>T" "" "likely pathogenic" "" "0000816234" "0" "70" "6" "65622398" "65622398" "subst" "3.30986E-5" "00000" "EYS_000236" "g.65622398G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.2620C>T, p.Gln874Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64912505G>A" "" "likely pathogenic" "" "0000816258" "0" "50" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Zampaglione 2020:32037395}" "" "EYS c.8648_8655del, p.Thr2883LysfsTer4" "unsolved" "Unknown" "?" "" "0" "" "" "g.63721377_63721384del" "" "VUS" "" "0000816305" "0" "90" "6" "65532705" "65532705" "subst" "2.00682E-5" "00000" "EYS_000224" "g.65532705A>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.3003T>A, p.Cys1001Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64822812A>T" "" "pathogenic" "" "0000816311" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.6714del, p.Ile2239SerfsTer17" "both papers interpret c.6714del as p.Pro2238ProX16, homozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000816323" "0" "70" "6" "65707540" "65707540" "subst" "0" "00000" "EYS_000244" "g.65707540G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.2194C>T, p.Gln732Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64997647G>A" "" "likely pathogenic" "" "0000816324" "0" "50" "6" "64430583" "64430583" "subst" "6.75721E-6" "00000" "EYS_000692" "g.64430583A>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9344T>A, p.Val3115Asp" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63720687A>T" "" "VUS" "" "0000816331" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.6714delT, p.Ile2239SerfsTer17" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "pathogenic" "" "0000816338" "0" "50" "6" "65301838" "65301838" "subst" "7.48189E-6" "00000" "EYS_000742" "g.65301838T>C" "" "{PMID:Zampaglione 2020:32037395}" "" "c.3922A>G, p.Thr1308Ala" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64591945T>C" "" "VUS" "" "0000816339" "0" "90" "6" "64791778" "64791781" "del" "0" "00000" "EYS_000697" "g.64791778_64791781del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.6544_6547del, p.Asn2182ValfsTer2" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64081885_64081888del" "" "pathogenic" "" "0000816346" "0" "70" "6" "64791792" "64791792" "subst" "6.77663E-6" "00000" "EYS_000738" "g.64791792G>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.6528C>A, p.Tyr2176Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64081899G>T" "" "likely pathogenic" "" "0000816350" "0" "50" "6" "65301295" "65301295" "subst" "6.73265E-6" "00000" "EYS_000741" "g.65301295G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.4465C>T, p.Pro1489Ser" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64591402G>A" "" "VUS" "" "0000816351" "0" "50" "6" "64430796" "64430796" "subst" "0" "00000" "EYS_000054" "g.64430796C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9131G>T, p.Trp3044Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63720900C>A" "" "VUS" "" "0000816355" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.6416G>A, p.Cys2139Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000816364" "3" "90" "6" "64430633" "64430642" "del" "0" "00000" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9286_9295del, p.Val3096LeufsTer28" "Located at end of transcript, homozygous" "Unknown" "?" "" "0" "" "" "g.63720737_63720746del" "" "pathogenic" "" "0000816374" "0" "50" "6" "66044888" "66044888" "subst" "2.04466E-5" "00000" "EYS_000750" "g.66044888T>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.1751A>C, p.Glu584Ala" "heterozygous" "Unknown" "?" "" "0" "" "" "g.65334995T>G" "" "VUS" "" "0000816375" "0" "50" "6" "64430796" "64430796" "subst" "0" "00000" "EYS_000054" "g.64430796C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9131G>T, p.Trp3044Leu" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63720900C>A" "" "VUS" "" "0000816391" "0" "70" "6" "65596618" "65596618" "subst" "0" "00000" "EYS_000748" "g.65596618G>C" "" "{PMID:Zampaglione 2020:32037395}" "" "c.2964C>G, p.Tyr988Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64886725G>C" "" "likely pathogenic" "" "0000816415" "3" "70" "6" "64430633" "64430642" "del" "0" "00000" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9286_9295del, p.Val3096LeufsTer28" "Located at end of transcript, homozygous" "Unknown" "?" "" "0" "" "" "g.63720737_63720746del" "" "likely pathogenic" "" "0000816421" "0" "90" "6" "65532705" "65532705" "subst" "2.00682E-5" "00000" "EYS_000224" "g.65532705A>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.3003T>A, p.Cys1001Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64822812A>T" "" "pathogenic" "" "0000816431" "0" "90" "6" "64430578" "64430578" "dup" "0" "00000" "EYS_000727" "g.64430578dup" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9354dup, p.Gln3119SerfsTer7" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720682dup" "" "pathogenic" "" "0000816437" "0" "70" "6" "64436439" "64436439" "subst" "6.75521E-6" "00000" "EYS_000087" "g.64436439C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.8206G>C, p.Ala2736Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63726546C>G" "" "likely pathogenic" "" "0000816438" "0" "90" "6" "65532705" "65532705" "subst" "2.00682E-5" "00000" "EYS_000224" "g.65532705A>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.3003T>A, p.Cys1001Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64822812A>T" "" "pathogenic" "" "0000816442" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.7492G>C, p.Ala2498Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "" "0000816443" "0" "70" "6" "64431515" "64431515" "dup" "0" "00000" "EYS_000730" "g.64431515dup" "" "{PMID:Zampaglione 2020:32037395}" "" "c.8413dup, p.Thr2805AsnfsTer7" "Located at end of transcript, heterozygous" "Unknown" "?" "" "0" "" "" "g.63721619dup" "" "likely pathogenic" "" "0000816455" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.6416G>A, p.Cys2139Tyr" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000816489" "0" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "00000" "EYS_000216" "g.65523270C>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.3443+1G>T" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0000816499" "0" "70" "6" "65596606" "65596606" "subst" "0" "00000" "EYS_000603" "g.65596606A>T" "" "{PMID:Zampaglione 2020:32037395}" "" "c.2976T>A, p.Cys992Ter" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64886713A>T" "" "likely pathogenic" "" "0000816510" "0" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Zampaglione 2020:32037395}" "" "c.4350_4356del, p.Ile1451ProfsTer3" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "" "0000816523" "0" "50" "6" "64430866" "64430866" "subst" "6.63508E-6" "00000" "EYS_000056" "g.64430866C>G" "" "{PMID:Zampaglione 2020:32037395}" "" "c.9061G>C, p.Ala3021Pro" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63720970C>G" "" "VUS" "" "0000816565" "0" "50" "6" "799631" "799631" "subst" "0" "00000" "EYS_000725" "g.799631C>T" "" "{PMID:Liu 2020:32090030}" "" "c.2530C>T, p.Q844*" "homozygous" "Unknown" "?" "" "0" "" "" "g.64912595G>A" "" "likely pathogenic" "" "0000816725" "1" "70" "6" "65098734" "65098734" "del" "0" "00000" "EYS_000740" "g.65098734del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.5928delG, p.R1976SfsX11" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64388841del" "" "likely pathogenic" "" "0000816726" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.6714del, p.I2239SfsX17" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000816727" "1" "70" "6" "65336027" "65336027" "subst" "0" "00000" "EYS_000743" "g.65336027G>C" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.3555C>G, p.C1185W" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64626134G>C" "" "likely pathogenic" "" "0000816728" "3" "70" "6" "64791792" "64791792" "subst" "6.77663E-6" "00000" "EYS_000738" "g.64791792G>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.6528C>A, p.Y2176X" "homozygous" "Unknown" "?" "" "0" "" "" "g.64081899G>T" "" "likely pathogenic" "" "0000816729" "3" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.4120C>T, p.R1374X" "homozygous" "Unknown" "?" "" "0" "" "" "g.64591747G>A" "" "likely pathogenic" "" "0000816730" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.6714del, p.I2239SerfsX17" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000816731" "1" "70" "6" "66044994" "66044994" "subst" "0" "00000" "EYS_000751" "g.66044994C>A" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.1645G>T, p.E549X" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65335101C>A" "" "likely pathogenic" "" "0000816732" "3" "70" "6" "64498950" "64498950" "subst" "1.32973E-5" "00000" "EYS_000734" "g.64498950C>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.7578+1G>A, p.(?)" "homozygous" "Unknown" "?" "" "0" "" "" "g.63789057C>T" "" "likely pathogenic" "" "0000816733" "1" "70" "6" "64430545" "64430549" "del" "0" "00000" "EYS_000726" "g.64430545_64430549del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.9383_9387del, p.(?)" "no protein change annotation, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63720649_63720653del" "" "likely pathogenic" "" "0000816734" "1" "70" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.8648_8655del, p.T2883KfsX4" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721377_63721384del" "" "likely pathogenic" "" "0000816735" "1" "70" "6" "64472413" "64472413" "subst" "1.9867E-5" "00000" "EYS_000093" "g.64472413A>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.8012T>A, p.L2671X" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63762520A>T" "" "likely pathogenic" "" "0000816736" "1" "70" "6" "64430591" "64430610" "del" "0" "00000" "EYS_000693" "g.64430591_64430610del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.9317_9336del, p.Thr3106KfsX13" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63720695_63720714del" "" "likely pathogenic" "" "0000816830" "2" "70" "6" "66063502" "66063502" "subst" "4.07282E-6" "00000" "EYS_000398" "g.66063502G>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.1308C>A, p.C436X" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65353609G>T" "" "likely pathogenic" "" "0000816831" "2" "70" "6" "66094277" "66094280" "del" "0" "00000" "EYS_000270" "g.66094277_66094280del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.1299+5_1299+8del, p.(?)" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65384384_65384387del" "" "likely pathogenic" "" "0000816832" "2" "70" "6" "64431294" "64431294" "subst" "1.97923E-5" "00000" "EYS_000423" "g.64431294G>C" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.8633C>G, p.A2878G" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721398G>C" "" "likely pathogenic" "" "0000816833" "2" "70" "6" "64430626" "64430629" "del" "0" "00000" "EYS_000045" "g.64430626_64430629del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.9299_9302delCTCA, p.T3100KfsX26" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63720730_63720733del" "" "likely pathogenic" "" "0000816834" "2" "70" "6" "65596589" "65596589" "subst" "0" "00000" "EYS_000747" "g.65596589C>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.2992+1G>A, p.(?)" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64886696C>T" "" "likely pathogenic" "" "0000816835" "2" "70" "6" "64791744" "64791744" "subst" "0" "00000" "EYS_000737" "g.64791744C>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.6571+5G>A, p.(?)" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64081851C>T" "" "likely pathogenic" "" "0000816836" "2" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.1155T>A, p.C385X" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65402507A>T" "" "likely pathogenic" "" "0000816837" "2" "70" "6" "66044998" "66045001" "del" "0" "00000" "EYS_000567" "g.66044998_66045001del" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.1641_1644delTCAG, p.(?)" "no protein change annotation, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65335105_65335108del" "" "likely pathogenic" "" "0000816838" "2" "70" "6" "64430923" "64430923" "subst" "6.60869E-6" "00000" "EYS_000729" "g.64430923G>A" "" "{PMID:Jauregui 2020:32098976}" "" "EYS c.9004C>T, p.Q3002X" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721027G>A" "" "likely pathogenic" "" "0000817314" "0" "90" "6" "63762520" "63762520" "subst" "0" "00000" "EYS_000093" "g.63762520A>T" "" "{PMID:Sun 2020:32100970}" "" "EYS c.8012T > A, p.Leu2671Ter, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.63762520A>T" "" "pathogenic" "ACMG" "0000817332" "0" "90" "6" "64230600" "64230600" "subst" "0" "00000" "EYS_000023" "g.64230600C>T" "" "{PMID:Sun 2020:32100970}" "" "EYS , p.Cys2139Tyr, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "ACMG" "0000817337" "0" "50" "6" "64902203" "64902203" "subst" "0" "00000" "EYS_000739" "g.64902203C>T" "" "{PMID:Sun 2020:32100970}" "" "EYS c.2756G > A, p.Gly919Glu, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.64902203C>T" "" "VUS" "ACMG" "0000817338" "0" "50" "6" "64230606" "64230606" "subst" "0" "00000" "EYS_000444" "g.64230606C>T" "" "{PMID:Sun 2020:32100970}" "" "EYS c.6410G > A, p.Arg2137His, heterozygous" "" "Unknown" "?" "" "0" "" "" "g.64230606C>T" "" "VUS" "ACMG" "0000817634" "1" "70" "6" "65149058" "65149058" "del" "0" "00000" "EYS_000162" "g.65149058del" "" "{PMID:Zanolli 2020:32141364}" "" "EYS c.5834_delA; c.6794_delC" "no protein change given, most probably a different transcript, NM_001300787.1(BEST1):c.172G>C, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64439165del" "" "likely pathogenic" "" "0000817635" "2" "70" "6" "64709009" "64709009" "del" "0" "00000" "EYS_000135" "g.64709009del" "" "{PMID:Zanolli 2020:32141364}" "" "EYS c.5834_delA; c.6794_delC" "no protein change given, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63999116del" "" "likely pathogenic" "" "0000818943" "0" "70" "6" "65612005" "65655808" "del" "0" "00000" "EYS_000757" "g.(65596736_65612005)_(65655808_65707474)del" "" "{PMID:Ellingsford 2018:29074561}" "" "chr6:65612001–65655812" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000818944" "0" "70" "6" "64472371" "64472371" "subst" "6.62989E-6" "00000" "EYS_000091" "g.64472371C>T" "" "{PMID:Ellingsford 2018:29074561}" "" "c.8054G>A p.(Gly2685Glu)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000818947" "3" "70" "6" "64708420" "64712049" "del" "0" "00000" "EYS_000754" "g.64708420_64712049del" "" "{PMID:Ellingsford 2018:29074561}" "" "" "" "Germline" "" "" "0" "" "" "g.63998527_64002156del" "" "likely pathogenic" "" "0000818962" "0" "70" "6" "64791748" "64791896" "del" "0" "00000" "EYS_000755" "g.(64776385_64791748)_(64791896_64940484)del" "" "{PMID:Ellingsford 2018:29074561}" "" "chr6:64791745–64791900" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000818963" "0" "70" "6" "64430866" "64430866" "subst" "6.63508E-6" "00000" "EYS_000056" "g.64430866C>G" "" "{PMID:Ellingsford 2018:29074561}" "" "c.9061G>C p.(Ala3021Pro)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000818980" "3" "70" "6" "65016862" "65016976" "dup" "0" "00000" "EYS_000756" "g.(64940718_65016862)_(65016976_65098582)dup" "" "{PMID:Ellingsford 2018:29074561}" "" "chr6:65016859–65016980" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000818981" "0" "50" "6" "64694275" "64709077" "dup" "0" "00000" "EYS_000753" "g.(64574252_64694275)_(64709077_64776230)dup" "" "{PMID:Ellingsford 2018:29074561}" "" "chr6:64694272–64709081" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000819043" "3" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Dineiro 2020:32483926}" "" "EYS c.5928‐2A" "homozygous" "Germline" "?" "" "0" "" "" "g.64388842T>C" "" "pathogenic" "ACMG" "0000819414" "1" "70" "6" "65146066" "65146066" "subst" "0" "00000" "EYS_000643" "g.65146066C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.5927+1G>T/p.?, variant 2: c.5927+1G>T/p.?" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Germline" "yes" "" "0" "" "" "g.64436173C>A" "" "likely pathogenic" "" "0000819415" "1" "70" "6" "65146066" "65146066" "subst" "0" "00000" "EYS_000643" "g.65146066C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.5927+1G>T/p.?, variant 2: c.5927+1G>T/p.?" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Germline" "yes" "" "0" "" "" "g.64436173C>A" "" "likely pathogenic" "" "0000819422" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6714del/p.I2239Sfs*17, variant 2 :Deletion exon 26-28" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000819423" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6714del/p.I2239Sfs*17, variant 2 :Deletion exon 26-28" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000819439" "1" "70" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.8648_8655del/p.T2883Lfs*4, variant 2: c.7228G>T/p.A2410S" "error in annotation, protein change should bep.(Thr2883Lysfs*4) and not p.(Thr2883Leufs*4), nucleotide variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721377_63721384del" "" "likely pathogenic" "" "0000819469" "1" "70" "6" "66204572" "66204572" "subst" "0" "00000" "EYS_000764" "g.66204572A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.732T>A/p.C244*, variant 2: c.5802dup/p.I1935Yfs*6" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65494679A>T" "" "likely pathogenic" "" "0000819783" "1" "70" "6" "66205272" "66205272" "dup" "0" "00000" "EYS_000006" "g.66205272dup" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.32dup/p.M12Dfs*14, variant 2: c.6571+1G>A/p.?" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65495379dup" "" "likely pathogenic" "" "0000819856" "1" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2: c.4350_4356del/p.I1451Pfs*3" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "" "0000819862" "1" "70" "6" "65300824" "65300824" "subst" "0" "00000" "EYS_000189" "g.65300824C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4936G>T/p.E1646*, variant 2: c.6250C>T/p.Q2084*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590931C>A" "" "likely pathogenic" "" "0000819863" "1" "70" "6" "65300824" "65300824" "subst" "0" "00000" "EYS_000189" "g.65300824C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4936G>T/p.E1646*, variant 2: c.6250C>T/p.Q2084*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590931C>A" "" "likely pathogenic" "" "0000819888" "1" "70" "6" "64430626" "64430629" "del" "0" "00000" "EYS_000045" "g.64430626_64430629del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9299_9302del/p.T3100Kfs*26, variant 2 :Deletion exon 1-5" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63720730_63720733del" "" "likely pathogenic" "" "0000819889" "1" "70" "6" "64430626" "64430629" "del" "0" "00000" "EYS_000045" "g.64430626_64430629del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9299_9302del/p.T3100Kfs*26, variant 2 :Deletion exon 1-5" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63720730_63720733del" "" "likely pathogenic" "" "0000819923" "1" "70" "6" "65707540" "65707540" "subst" "0" "00000" "EYS_000244" "g.65707540G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2194C>T/p.Q732*, variant 2: c.2194C>T/p.Q732*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64997647G>A" "" "likely pathogenic" "" "0000819924" "1" "70" "6" "65707540" "65707540" "subst" "0" "00000" "EYS_000244" "g.65707540G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2194C>T/p.Q732*, variant 2: c.2194C>T/p.Q732*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64997647G>A" "" "likely pathogenic" "" "0000819982" "1" "70" "6" "64430522" "64430522" "subst" "1.67165E-5" "00000" "EYS_000020" "g.64430522A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9405T>A/p.Y3135*, variant 2: c.9405T>A/p.Y3135*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.63720626A>T" "" "likely pathogenic" "" "0000820023" "1" "70" "6" "64431133" "64431136" "del" "0" "00000" "EYS_000421" "g.64431133_64431136del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.8793_8796del/ p.Q2931Hfs*43, variant 2: c.8793_8796del/ p.Q2931Hfs*43" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.63721237_63721240del" "" "likely pathogenic" "" "0000820024" "1" "70" "6" "64431133" "64431136" "del" "0" "00000" "EYS_000421" "g.64431133_64431136del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.8793_8796del/ p.Q2931Hfs*43, variant 2: c.8793_8796del/ p.Q2931Hfs*43" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.63721237_63721240del" "" "likely pathogenic" "" "0000820030" "1" "70" "6" "66044966" "66044966" "subst" "0.000118405" "00000" "EYS_000259" "g.66044966C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.1673G>A/p.W558*, variant 2: c.6174T>G/p.Y2058*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65335073C>T" "" "likely pathogenic" "" "0000820125" "1" "70" "6" "64430535" "64430535" "subst" "5.4019E-5" "00000" "EYS_000494" "g.64430535C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9392G>C/p.G3131A, variant 2: c.9392G>C/p.G3131A" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, possibly solved, homozygous" "Unknown" "?" "" "0" "" "" "g.63720639C>G" "" "likely pathogenic" "" "0000820130" "1" "70" "6" "65531537" "65531537" "subst" "0" "00000" "EYS_000761" "g.65531537C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.3243+1G>A/p.?, variant 2: c.5413C>T/p.Q1805*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64821644C>T" "" "likely pathogenic" "" "0000820161" "1" "70" "6" "64431133" "64431136" "del" "0" "00000" "EYS_000421" "g.64431133_64431136del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.8793_8796del/ p.Q2931Hfs*43, variant 2: c.8793_8796del/ p.Q2931Hfs*43" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.63721237_63721240del" "" "likely pathogenic" "" "0000820189" "1" "70" "6" "65336020" "65336020" "subst" "0" "00000" "EYS_000212" "g.65336020G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.3562C>T/p.Q1188*, variant 2: c.3562C>T/p.Q1188*" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64626127G>A" "" "likely pathogenic" "" "0000820193" "1" "70" "6" "64791778" "64791781" "del" "0" "00000" "EYS_000697" "g.64791778_64791781del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6544_6547del/p.N2182Vfs*2, variant 2: c.6544_6547del/p.N2182Vfs*2" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64081885_64081888del" "" "likely pathogenic" "" "0000820226" "1" "70" "6" "66205241" "66205241" "dup" "0" "00000" "EYS_000765" "g.66205241dup" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.67dup/p.T23Nfs*3, variant 2: c.67dup/p.T23Nfs*3" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.65495348dup" "" "likely pathogenic" "" "0000820227" "1" "70" "6" "66094276" "66094276" "subst" "0" "00000" "EYS_000271" "g.66094276T>G" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1 :1299+3A>C/p.?, variant 2 :1299+3A>C/p.?" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.65384383T>G" "" "likely pathogenic" "" "0000820234" "1" "70" "6" "64487986" "64487986" "subst" "1.9778E-5" "00000" "EYS_000098" "g.64487986C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.7811G>A/p.R2604H, variant 2: c.8834G>A/p.G2945E" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63778093C>T" "" "likely pathogenic" "" "0000820271" "1" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2: c.232del/p.C78Afs*7" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "" "0000820357" "1" "70" "6" "65149224" "65149224" "del" "0" "00000" "EYS_000164" "g.65149224del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.5666del/p.Y1889Lfs*6, variant 2: c.5666del/p.Y1889Lfs*6" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64439331del" "" "likely pathogenic" "" "0000820378" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6714del/p.I2239Sfs*17, variant 2: c.6714del/p.I2239Sfs*17" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000820391" "1" "70" "6" "65622598" "65622598" "del" "0" "00000" "EYS_000763" "g.65622598del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2420del/p.S807Mfs*4, variant 2: c.6714del/p.I2239Sfs*17" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64912705del" "" "likely pathogenic" "" "0000820397" "1" "70" "6" "66063346" "66063346" "subst" "0.000513598" "00000" "EYS_000008" "g.66063346G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.1459+5C>T/p.?, variant 2: c.7442G>A/p.G2481D" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65353453G>A" "" "likely pathogenic" "" "0000820400" "1" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2: c.8408dup/p.N2803Kfs*9" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "" "0000820415" "1" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2 :Deletion exon 9" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "" "0000820464" "1" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6416G>A/p.C2139Y, variant 2: c.6416G>A/p.C2139Y" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000820520" "1" "70" "6" "65301407" "65301413" "del" "0" "00000" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2: c.4350_4356del/p.I1451Pfs*3" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, homozygous" "Unknown" "?" "" "0" "" "" "g.64591514_64591520del" "" "likely pathogenic" "" "0000820522" "1" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4045C>T/p.R1349*, variant 2: c.8035T>G/p.C2679G" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64591822G>A" "" "likely pathogenic" "" "0000820551" "1" "70" "6" "64430535" "64430535" "subst" "5.4019E-5" "00000" "EYS_000494" "g.64430535C>G" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9392G>C/p.G3131A, variant 2 :Deletion exon 25-26" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63720639C>G" "" "likely pathogenic" "" "0000820565" "1" "70" "6" "65767589" "65767589" "subst" "0" "00000" "EYS_000563" "g.65767589A>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2055T>A/p.C685*, variant 2: c.6714del/p.I2239Sfs*17" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65057696A>T" "" "likely pathogenic" "" "0000820598" "1" "70" "6" "65622519" "65622519" "subst" "0" "00000" "EYS_000762" "g.65622519A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2499T>G/p.F833L, variant 2 :Deletion exon 10-26" "error in annotation, variant matches transcript NM_001142800.1 and not the indicated NM_001292009.1, possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64912626A>C" "" "likely pathogenic" "" "0000820640" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6714del/p.I2239Sfs*17, variant 2 :Deletion exon 26-28" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820641" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.6714del/p.I2239Sfs*17, variant 2 :Deletion exon 26-28" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820647" "1" "70" "6" "64574079" "64574079" "subst" "0" "00000" "EYS_000759" "g.64574079C>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.8648_8655del/p.T2883Lfs*4, variant 2: c.7228G>T/p.A2410S" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63864186C>A" "" "likely pathogenic" "" "0000820657" "1" "70" "6" "65149093" "65149093" "dup" "0" "00000" "EYS_000672" "g.65149093dup" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.732T>A/p.C244*, variant 2: c.5802dup/p.I1935Yfs*6" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64439200dup" "" "likely pathogenic" "" "0000820719" "1" "70" "6" "64791748" "64791748" "subst" "7.29192E-6" "00000" "EYS_000141" "g.64791748C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.32dup/p.M12Dfs*14, variant 2: c.6571+1G>A/p.?" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64081855C>T" "" "likely pathogenic" "" "0000820739" "1" "70" "6" "64940659" "64940659" "subst" "0" "00000" "EYS_000149" "g.64940659G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4936G>T/p.E1646*, variant 2: c.6250C>T/p.Q2084*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64230766G>A" "" "likely pathogenic" "" "0000820740" "1" "70" "6" "64940659" "64940659" "subst" "0" "00000" "EYS_000149" "g.64940659G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4936G>T/p.E1646*, variant 2: c.6250C>T/p.Q2084*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64230766G>A" "" "likely pathogenic" "" "0000820750" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9299_9302del/p.T3100Kfs*26, variant 2 :Deletion exon 1-5" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820751" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9299_9302del/p.T3100Kfs*26, variant 2 :Deletion exon 1-5" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820789" "1" "70" "6" "65016880" "65016880" "subst" "0" "00000" "EYS_000565" "g.65016880A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.1673G>A/p.W558*, variant 2: c.6174T>G/p.Y2058*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64306987A>C" "" "likely pathogenic" "" "0000820821" "1" "70" "6" "65300347" "65300347" "subst" "0" "00000" "EYS_000624" "g.65300347G>A" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.3243+1G>A/p.?, variant 2: c.5413C>T/p.Q1805*" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590454G>A" "" "likely pathogenic" "" "0000820847" "1" "70" "6" "64431093" "64431093" "subst" "1.98776E-5" "00000" "EYS_000064" "g.64431093C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.7811G>A/p.R2604H, variant 2: c.8834G>A/p.G2945E" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721197C>T" "" "likely pathogenic" "" "0000820853" "1" "70" "6" "66205074" "66205074" "del" "0" "00000" "EYS_000629" "g.66205074del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2: c.232del/p.C78Afs*7" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65495181del" "" "likely pathogenic" "" "0000820894" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2420del/p.S807Mfs*4, variant 2: c.6714del/p.I2239Sfs*17" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000820896" "1" "70" "6" "64499087" "64499087" "subst" "0" "00000" "EYS_000015" "g.64499087C>T" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.1459+5C>T/p.?, variant 2: c.7442G>A/p.G2481D" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63789194C>T" "" "likely pathogenic" "" "0000820899" "1" "70" "6" "64431521" "64431521" "dup" "0" "00000" "EYS_000076" "g.64431521dup" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2: c.8408dup/p.N2803Kfs*9" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721625dup" "" "likely pathogenic" "" "0000820905" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4350_4356del/p.I1451Pfs*3, variant 2 :Deletion exon 9" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820956" "1" "70" "6" "64472390" "64472390" "subst" "6.6262E-6" "00000" "EYS_000758" "g.64472390A>C" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.4045C>T/p.R1349*, variant 2: c.8035T>G/p.C2679G" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63762497A>C" "" "likely pathogenic" "" "0000820971" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.9392G>C/p.G3131A, variant 2 :Deletion exon 25-26" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000820978" "1" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2055T>A/p.C685*, variant 2: c.6714del/p.I2239Sfs*17" "solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64066349del" "" "likely pathogenic" "" "0000820990" "1" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Weisschuh 2020:32531858}" "" "EYS, variant 1: c.2499T>G/p.F833L, variant 2 :Deletion exon 10-26" "possibly solved, compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000821241" "0" "90" "6" "64574212" "64574212" "subst" "1.97881E-5" "00000" "EYS_000123" "g.64574212A>C" "" "{PMID:Turro 2020:32581362}" "" "EYS c.7095T>G, p.Tyr2365Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000821242" "0" "70" "6" "64694394" "64694394" "subst" "0" "00000" "EYS_000596" "g.64694394G>A" "" "{PMID:Turro 2020:32581362}" "" "EYS c.6937C>T, p.Gln2313Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63984501G>A" "" "likely pathogenic" "" "0000821243" "3" "70" "6" "66094373" "66094373" "del" "0" "00000" "EYS_000604" "g.66094373del" "" "{PMID:Turro 2020:32581362}" "" "EYS c.1211delA, p.Asn404ThrfsTer17" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65384480del" "" "likely pathogenic" "" "0000821244" "0" "90" "6" "65622398" "65622398" "subst" "3.30986E-5" "00000" "EYS_000236" "g.65622398G>A" "" "{PMID:Turro 2020:32581362}" "" "EYS c.2620C>T, p.Gln874Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64912505G>A" "" "pathogenic" "" "0000821245" "3" "70" "6" "65098734" "65098736" "del" "0" "00000" "EYS_000324" "g.65098734_65098736del" "" "{PMID:Turro 2020:32581362}" "" "EYS c.5928-3_5928-1delCAG," "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64388841_64388843del" "" "likely pathogenic" "" "0000821246" "3" "70" "6" "66005779" "66005779" "subst" "0.000294867" "00000" "EYS_000356" "g.66005779C>T" "" "{PMID:Turro 2020:32581362}" "" "EYS c.2000G>A, p.Arg667His" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65295886C>T" "" "likely pathogenic" "" "0000821247" "0" "70" "6" "65303112" "65303112" "subst" "0" "00000" "EYS_000602" "g.65303112G>A" "" "{PMID:Turro 2020:32581362}" "" "EYS c.3775C>T, p.Gln1259Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64593219G>A" "" "likely pathogenic" "" "0000821248" "0" "70" "6" "65300352" "65300352" "subst" "0" "00000" "EYS_000600" "g.65300352G>C" "" "{PMID:Turro 2020:32581362}" "" "EYS c.5408C>G, p.Ser1803Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590459G>C" "" "likely pathogenic" "" "0000821249" "0" "70" "6" "64791818" "64791818" "subst" "0" "00000" "EYS_000598" "g.64791818C>A" "" "{PMID:Turro 2020:32581362}" "" "EYS c.6502G>T, p.Glu2168Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64081925C>A" "" "likely pathogenic" "" "0000821250" "0" "70" "6" "64940586" "64940586" "subst" "2.02514E-5" "00000" "EYS_000599" "g.64940586C>T" "" "{PMID:Turro 2020:32581362}" "" "EYS c.6323G>A, p.Cys2108Tyr" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230693C>T" "" "likely pathogenic" "" "0000821464" "3" "70" "6" "64708420" "64712049" "del" "0" "00000" "EYS_000754" "g.64708420_64712049del" "" "{PMID:Turro 2020:32581362}" "" "chr6:g.64708420_64712049del" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63998527_64002156del" "" "likely pathogenic" "" "0000821550" "0" "70" "6" "64431559" "64431559" "subst" "0" "00000" "EYS_000594" "g.64431559T>C" "" "{PMID:Turro 2020:32581362}" "" "EYS c.8368A>G, p.Arg2790Gly" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63721663T>C" "" "likely pathogenic" "" "0000821551" "0" "70" "6" "65300418" "65300443" "delins" "0" "00000" "EYS_000760" "g.65300418_65300443delinsTA" "" "{PMID:Turro 2020:32581362}" "" "EYS c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA, p.Asn1773_Val1781delinsTer" "heterozygous, error in annotation: protein change should be annotated p.Asn1773* and not p.Asn1773_Val1781delinsTer" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590525_64590550delinsTA" "" "likely pathogenic" "" "0000821552" "3" "70" "6" "66115146" "66115146" "subst" "0.00181254" "00000" "EYS_000277" "g.66115146C>T" "" "{PMID:Turro 2020:32581362}" "" "EYS c.977G>A, p.Ser326Asn" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65405253C>T" "" "likely pathogenic" "" "0000821553" "0" "70" "6" "65301715" "65301715" "subst" "0" "00000" "EYS_000203" "g.65301715G>A" "" "{PMID:Turro 2020:32581362}" "" "EYS c.4045C>T, p.Arg1349Ter" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64591822G>A" "" "likely pathogenic" "" "0000821554" "0" "70" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Turro 2020:32581362}" "" "EYS c.5928-2A>G," "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64388842T>C" "" "likely pathogenic" "" "0000821555" "0" "70" "6" "64756070" "64780034" "del" "0" "00000" "EYS_000397" "g.64756070_64780034del" "" "{PMID:Turro 2020:32581362}" "" "chr6:g.64756070_64780034del" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "" "" "likely pathogenic" "" "0000821556" "0" "70" "6" "64791777" "64791777" "del" "0" "00000" "EYS_000597" "g.64791777del" "" "{PMID:Turro 2020:32581362}" "" "EYS c.6545delA, p.Asn2182ThrfsTer3" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64081884del" "" "likely pathogenic" "" "0000822052" "3" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Habibi 2020:32641690}" "" "EYS c.(1766 + 1_1767-1)_(2023 + 1_2024-1)del, -" "homozygous" "Germline" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000822053" "3" "70" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Habibi 2020:32641690}" "" "EYS c.[5928-2A > G];[5928-2A > G], -" "homozygous" "Germline" "?" "" "0" "" "" "g.64388842T>C" "" "likely pathogenic" "" "0000822143" "3" "90" "6" "65059867" "65136655" "del" "0" "00000" "EYS_000582" "g.65059867_65136655del" "" "{PMID:Khateb-2016:27208209}" "" "c.5928-37922_6078+38716del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000822769" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822771" "0" "70" "6" "216500979" "216500979" "subst" "0" "00000" "EYS_000087" "g.216500979C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ala2736Pro)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.216327637C>T" "" "likely pathogenic" "" "0000822772" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822773" "0" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822775" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2555fs)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000822777" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gly2186Glu)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000822780" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822781" "3" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gly2186Glu)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); homozygous" "Unknown" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000822782" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822785" "0" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Asp498fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000822786" "0" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822787" "0" "70" "6" "216052410" "216052410" "subst" "0" "00000" "EYS_000767" "g.216052410C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gly2799fs)" "error in annotation, p.(Gly2799fs) cannot be EYS mutation since no transcript has Glycine at this position, it is actually an USH2A mutation. Only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.215879068C>T" "" "likely pathogenic" "" "0000822788" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822790" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822802" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822804" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822805" "0" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822809" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822814" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822815" "0" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822816" "3" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gln3101fs)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); homozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000822818" "3" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; homozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822819" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822820" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822821" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822823" "3" "70" "6" "216052273" "216052273" "del" "0" "00000" "EYS_000483" "g.216052273del" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Cys211Tyr)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); homozygous" "Unknown" "?" "" "0" "" "" "g.215878931del" "" "likely pathogenic" "" "0000822826" "3" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; homozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822827" "3" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; homozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822828" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822829" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser1653fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000822830" "0" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822834" "0" "70" "6" "66204697" "66204697" "subst" "0" "00000" "EYS_000484" "g.66204697G>A" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gln203*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65494804G>A" "" "likely pathogenic" "" "0000822835" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gly2186Glu)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000822836" "0" "70" "6" "66094373" "66094373" "dup" "0" "00000" "EYS_000273" "g.66094373dup" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Asn404fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65384480dup" "" "likely pathogenic" "" "0000822838" "0" "70" "6" "66204672" "66204672" "subst" "0" "00000" "EYS_000483" "g.66204672C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Cys211Tyr)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65494779C>T" "" "likely pathogenic" "" "0000822839" "0" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822840" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ala2498Pro)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000822841" "0" "70" "6" "66204672" "66204672" "subst" "0" "00000" "EYS_000483" "g.66204672C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Cys211Tyr)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65494779C>T" "" "likely pathogenic" "" "0000822842" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gly2186Glu)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64081870C>T" "" "likely pathogenic" "" "0000822843" "0" "70" "6" "216246607" "216246607" "subst" "0" "00000" "EYS_000768" "g.216246607G>A" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Arg1870Trp)" "error in annotation, p.(Arg1870Trp) cannot be EYS mutation since no transcript has Arginine at this position, it is actually an USH2A mutation. Only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.216073265G>A" "" "likely pathogenic" "" "0000822844" "0" "70" "6" "64431122" "64431122" "subst" "0" "00000" "EYS_000607" "g.64431122G>C" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Tyr2935*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000822849" "0" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Trp2640*)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.7920G>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63789144C>G" "" "likely pathogenic" "" "0000822850" "0" "70" "6" "66205269" "66205269" "subst" "5.71074E-5" "00000" "EYS_000301" "g.66205269A>G" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Met12Thr)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65495376A>G" "" "likely pathogenic" "" "0000822854" "0" "70" "6" "66205099" "66205100" "ins" "0" "00000" "EYS_000766" "g.66205099_66205100insTGCCAGTTTA" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Ser69fs)" "only protein changes written in the publication; mutation coding DNA extrapolated from other publications and databases; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65495206_65495207insTGCCAGTTTA" "" "likely pathogenic" "" "0000822857" "0" "70" "6" "64431115" "64431115" "subst" "0" "00000" "EYS_000065" "g.64431115G>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Leu2938Met)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of frameshift mutations), c.8805C>A also causes this change; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721219G>T" "" "likely pathogenic" "" "0000822858" "0" "70" "6" "66204672" "66204672" "subst" "0" "00000" "EYS_000483" "g.66204672C>T" "" "{PMID:Koyanagi 2020:32749464}" "" "EYS p.(Gly2186Glu)" "only protein changes written in the publication; Mutalyzer Back Translator used for coding DNA variant (impossible in case of deletions and insertions causing premature stop codon); compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65494779C>T" "" "likely pathogenic" "" "0000824393" "0" "90" "6" "64431649" "64431649" "subst" "0" "00000" "EYS_000428" "g.64431649G>A" "" "{PMID:Xiao-2021:33598457}" "" "EYS c.8278C>T, p.(R2760C)" "" "Unknown" "yes" "" "0" "" "" "g.63721753G>A" "" "pathogenic" "ACMG" "0000824394" "0" "90" "6" "64431123" "64431123" "dup" "0" "00000" "EYS_000770" "g.64431123dup" "" "{PMID:Xiao-2021:33598457}" "" "EYS c.8804_8805insA, p.(Y2935*)" "error in annotation, c.8804_8805insA automapped to c.8804dupA" "Unknown" "yes" "" "0" "" "" "g.63721227dup" "" "pathogenic" "ACMG" "0000824644" "0" "50" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Ma 2021:33691693}" "" "EYS c.G2528A, p.G843E" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64912597C>T" "" "VUS" "ACMG" "0000824647" "0" "30" "6" "64498112" "64498112" "subst" "0.000265873" "00000" "EYS_000108" "g.64498112C>T" "" "{PMID:Ma 2021:33691693}" "" "EYS c.G7609A, p.A2537T" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.63788219C>T" "" "likely benign" "ACMG" "0000824648" "0" "50" "6" "65303078" "65303078" "subst" "3.33182E-5" "00000" "EYS_000206" "g.65303078A>C" "" "{PMID:Ma 2021:33691693}" "" "EYS c.T3809G, p.V1270G" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.64593185A>C" "" "VUS" "ACMG" "0000824652" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824669" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824671" "0" "30" "6" "66115219" "66115219" "subst" "0.00031324" "00000" "EYS_000280" "g.66115219G>A" "" "{PMID:Ma 2021:33691693}" "" "EYS c.C904T, p.L302F" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.65405326G>A" "" "likely benign" "ACMG" "0000824673" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824721" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824729" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as possibly causative, single heterozygous change in a recessive gene, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824730" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824731" "0" "90" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Ma 2021:33691693}" "" "EYS c.4957dupA, p.S1653fs" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "pathogenic" "ACMG" "0000824757" "0" "50" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Ma 2021:33691693}" "" "EYS c.C8868A, p.Y2956X" "different transcript, NM_001292009.1(EYS):c.8868C>A, p.(Tyr2956*); marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "VUS" "ACMG" "0000824766" "0" "50" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Ma 2021:33691693}" "" "EYS c.C8868A, p.Y2956X" "different transcript, NM_001292009.1(EYS):c.8868C>A, p.(Tyr2956*); marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "VUS" "ACMG" "0000824769" "0" "50" "6" "64430886" "64430887" "ins" "0" "00000" "EYS_000769" "g.64430886_64430887insATAT" "" "{PMID:Ma 2021:33691693}" "" "EYS c.9106_9107insTATA, p.N3036_Q3037delinsIX" "different transcript, NM_001292009.1(EYS):c.9106_9107insTATA, p.(Asn3036Ilefs*2); marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720990_63720991insATAT" "" "VUS" "ACMG" "0000824796" "0" "50" "6" "64430624" "64430625" "del" "0" "00000" "EYS_000417" "g.64430624_64430625del" "" "{PMID:Ma 2021:33691693}" "" "EYS c.9365_9366del, p.Q3122fs" "different transcript, NM_001292009.1(EYS):c.9365_9366del, p.(Gln3122Argfs*4); marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720728_63720729del" "" "VUS" "ACMG" "0000824800" "0" "50" "6" "64498982" "64498982" "subst" "0" "00000" "EYS_000771" "g.64498982A>T" "" "{PMID:Ma 2021:33691693}" "" "EYS c.T7547A, p.L2516Q" "marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.63789089A>T" "" "VUS" "ACMG" "0000824801" "0" "30" "6" "64430718" "64430718" "subst" "0.000316673" "00000" "EYS_000049" "g.64430718A>G" "" "{PMID:Ma 2021:33691693}" "" "EYS c.T9272C, p.I3091T" "different transcript, NM_001292009.1(EYS): c.9272T>C, p.(Ile3091Thr); marked as causative, heterozygous" "Unknown" "?" "" "0" "" "" "g.63720822A>G" "" "likely benign" "ACMG" "0000825748" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Liu-2020:33090715}" "" "c.6416G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825849" "0" "70" "6" "64791775" "64791775" "del" "0" "00000" "EYS_000597" "g.64791775del" "" "{PMID:Liu-2020:33090715}" "" "c.6545delA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825850" "0" "70" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:Liu-2020:33090715}" "" "c.2259+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825860" "0" "70" "6" "65655784" "65655787" "del" "0" "00000" "EYS_000800" "g.65655784_65655787del" "" "{PMID:Liu-2020:33090715}" "" "c.2280_2283delATCT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825861" "0" "70" "6" "64431515" "64431516" "ins" "0" "00000" "EYS_000775" "g.64431515_64431516insAA" "" "{PMID:Liu-2020:33090715}" "" "c.8411_8412insTT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825882" "3" "70" "6" "65300506" "65300506" "dup" "0" "00000" "EYS_000683" "g.65300506dup" "" "{PMID:Liu-2020:33090715}" "" "c.5254dupA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825890" "3" "70" "6" "64431618" "64431618" "subst" "1.98138E-5" "00000" "EYS_000776" "g.64431618A>G" "" "{PMID:Liu-2020:33090715}" "" "c.8309T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825896" "0" "70" "6" "66112370" "66115261" "del" "0" "00000" "EYS_000806" "g.66112370_66115261del" "" "{PMID:Liu-2020:33090715}" "" "E6-7del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825897" "0" "70" "6" "65655685" "65767621" "del" "0" "00000" "EYS_000798" "g.65655685_65767621del" "" "{PMID:Liu-2020:33090715}" "" "E13-15del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825906" "0" "70" "6" "66115204" "66115204" "subst" "0" "00000" "EYS_000807" "g.66115204C>A" "" "{PMID:Liu-2020:33090715}" "" "c.919G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825907" "0" "70" "6" "64791748" "64940718" "del" "0" "00000" "EYS_000783" "g.64791748_64940718del" "" "{PMID:Liu-2020:33090715}" "" "E31-32del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825927" "0" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Liu-2020:33090715}" "" "c.8805C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000825928" "0" "70" "6" "66044995" "66044998" "del" "4.08363E-6" "00000" "EYS_000567" "g.66044995_66044998del" "" "{PMID:Liu-2020:33090715}" "" "c.1641_1644delTCAG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826035" "0" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Liu-2020:33090715}" "" "c.8805C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826036" "0" "70" "6" "66044889" "66044889" "subst" "0" "00000" "EYS_000257" "g.66044889C>A" "" "{PMID:Liu-2020:33090715}" "" "c.1750G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826056" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Liu-2020:33090715}" "" "c.6416G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826058" "0" "70" "6" "65301105" "65301105" "subst" "0" "00000" "EYS_000786" "g.65301105A>T" "" "{PMID:Liu-2020:33090715}" "" "c.4655T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826059" "0" "70" "6" "65655685" "65655808" "del" "0" "00000" "EYS_000797" "g.65655685_65655808del" "" "{PMID:Liu-2020:33090715}" "" "E15del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826083" "0" "70" "6" "64431618" "64431618" "subst" "1.98138E-5" "00000" "EYS_000776" "g.64431618A>G" "" "{PMID:Liu-2020:33090715}" "" "c.8309T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826084" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Liu-2020:33090715}" "" "c.6557G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826136" "3" "70" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Liu-2020:33090715}" "" "c.7228+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826179" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Liu-2020:33090715}" "" "c.6557G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826180" "0" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Liu-2020:33090715}" "" "c.7492G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826222" "0" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Liu-2020:33090715}" "" "c.7492G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826223" "0" "70" "6" "65531592" "65531593" "del" "0" "00000" "EYS_000791" "g.65531592_65531593del" "" "{PMID:Liu-2020:33090715}" "" "c.3188_3189delAT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826224" "0" "70" "6" "66115219" "66115219" "subst" "0.00031324" "00000" "EYS_000280" "g.66115219G>A" "" "{PMID:Liu-2020:33090715}" "" "c.904C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000826237" "0" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Liu-2020:33090715}" "" "c.6557G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826238" "0" "70" "6" "64430540" "64430544" "del" "0" "00000" "EYS_000726" "g.64430540_64430544del" "" "{PMID:Liu-2020:33090715}" "" "c.9378_9382delAATTA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826253" "0" "70" "6" "64436502" "64436502" "subst" "2.02481E-5" "00000" "EYS_000432" "g.64436502G>A" "" "{PMID:Liu-2020:33090715}" "" "c.8143C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826254" "0" "70" "6" "65523270" "65707597" "del" "0" "00000" "EYS_000788" "g.65523270_65707597del" "" "{PMID:Liu-2020:33090715}" "" "E14-22del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826295" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Liu-2020:33090715}" "" "c.6416G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826296" "0" "70" "6" "65622532" "65622532" "del" "0" "00000" "EYS_000796" "g.65622532del" "" "{PMID:Liu-2020:33090715}" "" "c.2486delT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826320" "0" "70" "6" "64431505" "64431505" "subst" "0.00511138" "00000" "EYS_000075" "g.64431505C>T" "" "{PMID:Liu-2020:33090715}" "" "c.8422G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826321" "0" "70" "6" "65655780" "65655780" "subst" "6.75055E-6" "00000" "EYS_000799" "g.65655780A>G" "" "{PMID:Liu-2020:33090715}" "" "c.2287T>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826366" "0" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Liu-2020:33090715}" "" "c.7492G>C" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826367" "0" "70" "6" "64776385" "64776386" "delins" "0" "00000" "EYS_000782" "g.64776385_64776386delinsA" "" "{PMID:Liu-2020:33090715}" "" "c.6572-2_6572-1delAGinsT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826375" "0" "70" "6" "64431601" "64431601" "del" "0" "00000" "EYS_000682" "g.64431601del" "" "{PMID:Liu-2020:33090715}" "" "c.8326delG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826376" "0" "70" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Liu-2020:33090715}" "" "c.7228+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000826504" "0" "90" "6" "65336015" "65336015" "del" "0" "00000" "EYS_000211" "g.65336015del" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.3567delA" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000826505" "0" "90" "6" "64431148" "64431148" "subst" "3.95361E-5" "00000" "EYS_000067" "g.64431148A>G" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.8779T>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000826933" "0" "90" "6" "65622398" "65622398" "subst" "3.30986E-5" "00000" "EYS_000236" "g.65622398G>A" "" "{PMID:Thorsteinsson 2021:33851411}" "" "EYS c.2620C>T, p.Gln874*" "heterozygous, causality unknown" "Unknown" "?" "" "0" "" "" "g.64912505G>A" "" "pathogenic" "" "0000826934" "0" "70" "6" "64776230" "64776230" "subst" "0" "00000" "EYS_000781" "g.64776230C>G" "" "{PMID:Thorsteinsson 2021:33851411}" "" "EYS c.6725+1G>C, interferes with splicing" "heterozygous" "Unknown" "?" "" "0" "" "" "g.64066337C>G" "" "likely pathogenic" "" "0000826935" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Thorsteinsson 2021:33851411}" "" "EYS c.7228+1G>A, interferes with splicing" "heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000827209" "0" "50" "6" "65532577" "65532577" "subst" "0" "00000" "EYS_000793" "g.65532577T>C" "" "{PMID:Colombo-2020:33576794}" "" "c.3131A>G" "" "Germline" "" "rs985352881" "0" "" "" "" "" "VUS" "" "0000827210" "0" "90" "6" "65767506" "65767506" "subst" "0.000748443" "00000" "EYS_000530" "g.65767506C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.2137+1G>A" "" "Germline" "" "rs199740930" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827234" "0" "90" "6" "65523442" "65767509" "del" "0" "00000" "EYS_000790" "g.65523442_65767509del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2023+177_2135)_(3272_3568+132)del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827235" "0" "90" "6" "65523442" "65707529" "del" "0" "00000" "EYS_000789" "g.65523442_65707529del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2135_2205)_(3272_3568+132)del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827236" "0" "90" "6" "65523270" "65707597" "del" "0" "00000" "EYS_000788" "g.65523270_65707597del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2137+1_2138-1)_(3443+1_3444-1)del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827237" "0" "90" "6" "65596589" "65622637" "del" "0" "00000" "EYS_000795" "g.65596589_65622637del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2381+1_2382-1)_(2992+1_2993-1)del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827238" "0" "90" "6" "64791792" "64791792" "subst" "6.77663E-6" "00000" "EYS_000738" "g.64791792G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.6528C>A" "" "Germline" "yes" "rs797045089" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827239" "0" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "00000" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Colombo-2020:33576794}" "" "c.9299_9302del" "" "Germline" "" "rs769824975" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827240" "0" "90" "6" "65532716" "65655685" "del" "0" "00000" "EYS_000794" "g.65532716_65655685del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2381+?)_(c.2993-?)del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827241" "0" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "00000" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Colombo-2020:33576794}" "" "c.9299_9302del" "" "Germline" "" "rs769824975" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827242" "0" "90" "6" "64431358" "64431358" "subst" "0" "00000" "EYS_000774" "g.64431358C>A" "" "{PMID:Colombo-2020:33576794}" "" "c.8569G>T" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827243" "0" "90" "6" "65532543" "65532543" "subst" "0" "00000" "EYS_000792" "g.65532543C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.3164+1G>A" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827244" "0" "90" "6" "65016902" "65016902" "del" "0" "00000" "EYS_000784" "g.65016902del" "" "{PMID:Colombo-2020:33576794}" "" "c.6152del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827245" "0" "70" "6" "64436486" "64436486" "subst" "0" "00000" "EYS_000778" "g.64436486A>G" "" "{PMID:Colombo-2020:33576794}" "" "c.8159T>C" "" "Germline" "" "rs756985941" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827246" "0" "50" "6" "64574169" "64574169" "subst" "1.322E-5" "00000" "EYS_000779" "g.64574169A>G" "" "{PMID:Colombo-2020:33576794}" "" "c.7138T>C" "" "Germline" "yes" "rs1344785031" "0" "" "" "" "" "VUS" "" "0000827247" "0" "70" "6" "64431148" "64431148" "subst" "3.95361E-5" "00000" "EYS_000067" "g.64431148A>G" "" "{PMID:Colombo-2020:33576794}" "" "c.8779T>C" "" "Germline" "" "rs373203896" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827248" "0" "50" "6" "65300869" "65300869" "subst" "0.000837928" "00000" "EYS_000003" "g.65300869G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.4891C>T" "" "Germline" "yes" "rs200935518" "0" "" "" "" "" "VUS" "" "0000827249" "0" "70" "6" "64940494" "64940494" "subst" "0" "00000" "EYS_000147" "g.64940494A>G" "" "{PMID:Colombo-2020:33576794}" "" "c.6415T>C" "" "Germline" "" "rs1378663182" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827250" "0" "90" "6" "65523442" "65707529" "del" "0" "00000" "EYS_000789" "g.65523442_65707529del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2135_2205)_(3272_3568+132)del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827251" "0" "70" "6" "64694424" "64708966" "dup" "0" "00000" "EYS_000780" "g.64694424_64708966dup" "" "{PMID:Colombo-2020:33576794}" "" "c.(6725+28_6834+2)_(6907_7197)dup" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827252" "0" "90" "6" "65016930" "65016930" "subst" "0" "00000" "EYS_000785" "g.65016930C>A" "" "{PMID:Colombo-2020:33576794}" "" "c.6124G>T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827253" "0" "50" "6" "64436441" "64436441" "subst" "0" "00000" "EYS_000777" "g.64436441T>C" "" "{PMID:Colombo-2020:33576794}" "" "c.8204A>G" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000827254" "0" "90" "6" "66205272" "66205272" "dup" "0" "00000" "EYS_000006" "g.66205272dup" "" "{PMID:Colombo-2020:33576794}" "" "c.32dup" "" "Germline" "" "rs779372264" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827255" "3" "50" "6" "65596611" "65596611" "subst" "0.00038643" "00000" "EYS_000227" "g.65596611G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.2971C>T" "" "Germline" "" "rs201819948" "0" "" "" "" "" "VUS" "" "0000827256" "0" "90" "6" "66005755" "66005755" "subst" "0" "00000" "EYS_000249" "g.66005755C>G" "" "{PMID:Colombo-2020:33576794}" "" "c.2023+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827257" "0" "50" "6" "65300869" "65300869" "subst" "0.000837928" "00000" "EYS_000003" "g.65300869G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.4891C>T" "" "Germline" "" "rs200935518" "0" "" "" "" "" "VUS" "" "0000827258" "0" "90" "6" "64436477" "64436477" "del" "1.349E-5" "00000" "EYS_000397" "g.64436477del" "" "{PMID:Colombo-2020:33576794}" "" "c.8168del" "" "Germline" "" "rs1168101857" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827259" "0" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "00000" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Colombo-2020:33576794}" "" "c.9299_9302del" "" "Germline" "" "rs769824975" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827260" "0" "50" "6" "65098614" "65098614" "subst" "0" "00000" "EYS_000510" "g.65098614C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.6047G>A" "" "Germline" "" "rs886061672" "0" "" "" "" "" "VUS" "" "0000827261" "0" "70" "6" "66044950" "66044951" "del" "0" "00000" "EYS_000804" "g.66044950_66044951del" "" "{PMID:Colombo-2020:33576794}" "" "c.1688_1689del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827262" "0" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "00000" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Colombo-2020:33576794}" "" "c.9299_9302del" "" "Germline" "" "rs769824975" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827263" "0" "50" "6" "66417039" "66417039" "subst" "0" "00000" "EYS_000306" "g.66417039G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.-459C>T" "" "Germline" "" "rs144371265" "0" "" "" "" "" "VUS" "" "0000827264" "0" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "00000" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Colombo-2020:33576794}" "" "c.9299_9302del" "" "Germline" "" "rs769824975" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827265" "0" "90" "6" "64430577" "64430590" "del" "0" "00000" "EYS_000773" "g.64430577_64430590del" "" "{PMID:Colombo-2020:33576794}" "" "c.9337_9350del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827266" "0" "90" "6" "64431382" "64431382" "subst" "0" "00000" "EYS_000424" "g.64431382G>A" "" "{PMID:Colombo-2020:33576794}" "" "c.8545C>T" "" "Germline" "" "rs1326635278" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827267" "3" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:Colombo-2020:33576794}" "" "c.5928-2A>G" "" "Germline" "" "rs181169439" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827268" "3" "50" "6" "65523266" "65523266" "subst" "0" "00000" "EYS_000787" "g.65523266C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.3443+5G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000827269" "3" "50" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.5644+5G>A" "" "Germline" "" "rs794727412" "0" "" "" "" "" "VUS" "" "0000827270" "3" "90" "6" "66005755" "66005755" "subst" "0" "00000" "EYS_000249" "g.66005755C>G" "" "{PMID:Colombo-2020:33576794}" "" "c.2023+1G>C" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827271" "3" "90" "6" "65707529" "65767509" "del" "0" "00000" "EYS_000803" "g.65707529_65767509del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2023+177_2135)_(2205_2351)del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827272" "3" "90" "6" "64472482" "64472482" "del" "0" "00000" "EYS_000492" "g.64472482del" "" "{PMID:Colombo-2020:33576794}" "" "c.7943del" "" "Germline" "" "rs1477705832" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827273" "3" "90" "6" "65655808" "65767506" "del" "0" "00000" "EYS_000801" "g.65655808_65767506del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2137+?)_(2260-?)del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827274" "3" "70" "6" "66053968" "66053969" "ins" "0" "00000" "EYS_000805" "g.66053968_66053969insTATA" "" "{PMID:Colombo-2020:33576794}" "" "c.1561_1562insTATA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000827275" "3" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "" "{PMID:Colombo-2020:33576794}" "" "c.6714del" "" "Germline" "" "rs752953889" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827276" "3" "90" "6" "64791792" "64791792" "subst" "6.77663E-6" "00000" "EYS_000738" "g.64791792G>T" "" "{PMID:Colombo-2020:33576794}" "" "c.6528C>A" "" "Germline" "" "rs797045089" "0" "" "" "" "" "pathogenic (recessive)" "" "0000827277" "3" "50" "6" "64430535" "64430535" "subst" "0" "00000" "EYS_000772" "g.64430535C>T" "" "{PMID:Colombo-2020:33576794}" "" "c.9392G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000827278" "3" "90" "6" "65707474" "65767621" "del" "0" "00000" "EYS_000802" "g.65707474_65767621del" "" "{PMID:Colombo-2020:33576794}" "" "c.(2023+1_2024-1)_(2259+1_2260-1)del" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000828311" "3" "70" "6" "65016880" "65016880" "subst" "0" "00000" "EYS_000565" "g.65016880A>C" "" "{PMID:Shen 2021:34130719}" "" "EYS c.6174 T > G, p.Y2058X" "homozygous, no ACMG classification" "Germline" "yes" "" "0" "" "" "g.64306987A>C" "" "likely pathogenic" "" "0000828312" "3" "70" "6" "65016880" "65016880" "subst" "0" "00000" "EYS_000565" "g.65016880A>C" "" "{PMID:Shen 2021:34130719}" "" "EYS c.6174 T > G, p.Y2058X" "homozygous, no ACMG classification" "Germline" "yes" "" "0" "" "" "g.64306987A>C" "" "likely pathogenic" "" "0000828313" "3" "70" "6" "65016880" "65016880" "subst" "0" "00000" "EYS_000565" "g.65016880A>C" "" "{PMID:Shen 2021:34130719}" "" "EYS c.6174 T > G, p.Y2058X" "homozygous, no ACMG classification" "Germline" "yes" "" "0" "" "" "g.64306987A>C" "" "likely pathogenic" "" "0000828500" "3" "50" "6" "64430979" "64430979" "subst" "0" "00000" "EYS_000810" "g.64430979G>T" "" "{PMID:Perea-Romero 2021:34448047}" "" "EYS, c.8948C>A, p.Ser2983Tyr, homozygous" "" "Germline" "yes" "" "0" "" "" "g.63721083G>T" "" "VUS" "ACMG" "0000828774" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.334G>C(;)7228+1G>A, V1: c.7228+1G>A," "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000828776" "0" "90" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "" "{PMID:Chen 2021:43360855}" "" "EYS c.3489T>A(;)8107G>T, V1: c.8107G>T, (p.Glu2703Ter)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "ACMG" "0000828784" "0" "70" "6" "64430843" "64430844" "ins" "0" "00000" "EYS_000808" "g.64430843_64430844insT" "" "{PMID:Chen 2021:43360855}" "" "EYS c.4365_4366insTTCT(;)9083_9084insA, V1: c.9083_9084insA, (p.Ser3029LeufsTer7)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63720947_63720948insT" "" "likely pathogenic" "ACMG" "0000828796" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)5304_5314del, V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "ACMG" "0000828799" "0" "50" "6" "65612391" "65612391" "subst" "0.000122251" "00000" "EYS_000235" "g.65612391A>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.2644T>C(;)5411T>C, V1: c.2644T>C, (p.Phe882Leu)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64902498A>G" "" "VUS" "ACMG" "0000828802" "0" "90" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "" "{PMID:Chen 2021:43360855}" "" "EYS c.5644+5G>A(;)8107G>T, V1: c.8107G>T, (p.Glu2703Ter)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "ACMG" "0000828803" "1" "70" "6" "65300768" "65300769" "ins" "0" "00000" "EYS_000813" "g.65300768_65300769insTCTT" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[4991_4992insAAGA];[8107G>T], V1: c.4991_4992insAAGA, (p.Cys1665ArgfsTer19)" "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64590875_64590876insTCTT" "" "likely pathogenic" "ACMG" "0000828817" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7228+1G>A, V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828818" "1" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[7228+1G>A], V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "ACMG" "0000828819" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7228+1G>A, V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "ACMG" "0000828820" "1" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[7228+1G>A], V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828822" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7492G>C, V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828823" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7492G>C, V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828824" "0" "90" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "" "{PMID:Chen 2021:43360855}" "" "EYS c.7492G>C(;)8107G>T, V1: c.8107G>T, (p.Glu2703Ter)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "ACMG" "0000828825" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.7228+1G>A(;)8012T>A, V1: c.7228+1G>A," "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000828830" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)9073G>A, V1: c.6416G>A, (p.Cys2139Tyr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828833" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[?], V1: c.6416G>A, (p.Cys2139Tyr)" "single heterozygous variant in a recessive disease: a variant on the other allele is expected but not yet identified" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828869" "0" "50" "6" "64431618" "64431618" "subst" "1.98138E-5" "00000" "EYS_000776" "g.64431618A>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[8309T>C];[?], V1: c.8309T>C, (p.Leu2770Pro)" "single heterozygous variant in a recessive disease: a variant on the other allele is expected but not yet identified" "Unknown" "?" "" "0" "" "" "g.63721722A>G" "" "VUS" "ACMG" "0000828889" "3" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[7228+1G>A];[7228+1G>A], V1: c.7228+1G>A," "homozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000828898" "3" "70" "6" "64431328" "64431328" "del" "0" "00000" "EYS_000811" "g.64431328del" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[8600del];[8600del], V1: c.8600delG, (p.Gly2867ValfsTer5)" "homozygous" "Unknown" "?" "" "0" "" "" "g.63721432del" "" "likely pathogenic" "ACMG" "0000828908" "0" "50" "6" "64430718" "64430718" "subst" "0.000316673" "00000" "EYS_000049" "g.64430718A>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[9209T>C];[?], V1: c.9209T>C, (p.Ile3070Thr)" "single heterozygous variant in a recessive disease: a variant on the other allele is expected but not yet identified" "Unknown" "?" "" "0" "" "" "g.63720822A>G" "" "VUS" "ACMG" "0000828914" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[6416G>A], V1: c.6416G>A, (p.Cys2139Tyr)" "homozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828934" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[6416G>A], V1: c.6416G>A, (p.Cys2139Tyr)" "homozygous" "Unknown" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "ACMG" "0000828979" "0" "50" "6" "66204970" "66204970" "subst" "0.000369904" "00000" "EYS_000414" "g.66204970C>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.334G>C(;)7228+1G>A, V2: c.334G>C, (p.Val112Leu)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.65495077C>G" "" "VUS" "ACMG" "0000828981" "0" "90" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.3489T>A(;)8107G>T, V2: c.3489T>A, (p.Asn1163Lys)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64626200A>T" "" "pathogenic" "ACMG" "0000828989" "0" "70" "6" "65301394" "65301395" "ins" "0" "00000" "EYS_000814" "g.65301394_65301395insAGAA" "" "{PMID:Chen 2021:43360855}" "" "EYS c.4365_4366insTTCT(;)9083_9084insA, V2: c.4365_4366insTTCT, (p.Ser1456PhefsTer9)" "error in annotation: protein change should be p.(Ser1456PhefsTer2) and not p.(Ser1456PhefsTer9), alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64591501_64591502insAGAA" "" "likely pathogenic" "ACMG" "0000829001" "0" "90" "6" "65300449" "65300459" "del" "0" "00000" "EYS_000812" "g.65300449_65300459del" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)5304_5314del, V2: c.5304_5314del, (p.Asn1768LysfsTer2)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64590556_64590566del" "" "pathogenic" "ACMG" "0000829004" "0" "50" "6" "65300349" "65300349" "subst" "0.00016225" "00000" "EYS_000648" "g.65300349A>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.2644T>C(;)5411T>C, V2: c.5411T>C, (p.Ile1804Thr)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64590456A>G" "" "VUS" "ACMG" "0000829007" "0" "50" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.5644+5G>A(;)8107G>T, V2: c.5644+5G>A," "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64590218C>T" "" "VUS" "ACMG" "0000829008" "2" "50" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[4991_4992insAAGA];[8107G>T], V2: c.5644+5G>A," "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.64590218C>T" "" "VUS" "ACMG" "0000829022" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7228+1G>A, V2: c.7228+1G>A," "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000829023" "2" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[7228+1G>A], V2: c.7228+1G>A," "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000829024" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7228+1G>A, V2: c.7228+1G>A," "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000829025" "2" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.[6416G>A];[7228+1G>A], V2: c.7228+1G>A," "alleles in trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "ACMG" "0000829027" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7492G>C, V2: c.7492G>C, (p.Ala2498Pro)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "ACMG" "0000829028" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)7492G>C, V2: c.7492G>C, (p.Ala2498Pro)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "ACMG" "0000829029" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "" "{PMID:Chen 2021:43360855}" "" "EYS c.7492G>C(;)8107G>T, V2: c.7492G>C, (p.Ala2498Pro)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "ACMG" "0000829030" "0" "90" "6" "64472413" "64472413" "subst" "1.9867E-5" "00000" "EYS_000093" "g.64472413A>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.7228+1G>A(;)8012T>A, V2: c.8012T>A, (p.Leu2671Ter)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63762520A>T" "" "pathogenic" "ACMG" "0000829035" "0" "50" "6" "64430854" "64430854" "subst" "0" "00000" "EYS_000809" "g.64430854C>T" "" "{PMID:Chen 2021:43360855}" "" "EYS c.6416G>A(;)9073G>A, V2: c.9073G>A, (p.Gly3025Arg)" "alleles in cis or trans; heterozygous" "Unknown" "?" "" "0" "" "" "g.63720958C>T" "" "VUS" "ACMG" "0000829052" "0" "70" "6" "64709009" "64709009" "del" "0" "00000" "EYS_000135" "g.64709009del" "" "{PMID:Georgiou 2021:32795431}" "" "EYS c.6794delC, p.Pro2265Glnfs*" "" "Unknown" "?" "" "0" "" "" "g.63999116del" "" "likely pathogenic" "" "0000829074" "0" "70" "6" "64431649" "64431649" "subst" "0" "00000" "EYS_000428" "g.64431649G>A" "" "{PMID:Georgiou 2021:32795431}" "" "EYS c.8278C>T, p.Arg2760Cys" "" "Unknown" "?" "" "0" "" "" "g.63721753G>A" "" "likely pathogenic" "" "0000829718" "1" "90" "6" "64574212" "64574212" "subst" "1.97881E-5" "00006" "EYS_000123" "g.64574212A>C" "" "{PMID:Ellingford 2016:26872967}" "" "" "" "Germline" "" "" "0" "" "" "g.63864319A>C" "" "pathogenic" "" "0000829733" "2" "70" "6" "64430649" "64430650" "dup" "0" "00006" "EYS_000047" "g.64430649_64430650dup" "" "{PMID:Ellingford 2016:26872967}" "" "c.9277_9278dupGG" "" "Germline" "" "" "0" "" "" "g.63720753_63720754dup" "" "likely pathogenic" "" "0000829766" "1" "70" "6" "65655685" "65655808" "del" "0" "00006" "EYS_000820" "g.(?_65655685)_(65655808_65707474)del" "" "{PMID:Ellingford 2017:28378820}" "" "g.65612002_65655812del" "" "Germline" "" "" "0" "" "" "g.(?_64945792)_(64945915_64997581)del" "" "likely pathogenic" "" "0000829812" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829813" "0" "90" "6" "64431067" "64431067" "subst" "0.000245355" "00000" "EYS_000063" "g.64431067A>G" "" "{PMID:Numa-2020:33247286}" "" "c.8860T>C:p.F2954L" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829814" "3" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829815" "0" "90" "6" "65303078" "65303078" "subst" "3.33182E-5" "00000" "EYS_000206" "g.65303078A>C" "" "{PMID:Numa-2020:33247286}" "" "c.3809T>G:p.V1270G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829816" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829817" "0" "90" "6" "64431659" "64431659" "del" "0" "00000" "EYS_000816" "g.64431659del" "" "{PMID:Numa-2020:33247286}" "" "c.8268delC:p.S2756fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829818" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829819" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829822" "3" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829824" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829825" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829826" "3" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829827" "0" "90" "6" "66044889" "66044889" "subst" "0" "00000" "EYS_000257" "g.66044889C>A" "" "{PMID:Numa-2020:33247286}" "" "c.1750G>T:p.E584X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829828" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829829" "3" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829830" "3" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Numa-2020:33247286}" "" "c.7919G>A:p.W2640X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829838" "3" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Numa-2020:33247286}" "" "c.7919G>A:p.W2640X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829841" "3" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829842" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829843" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829844" "3" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829845" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829846" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829850" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829851" "0" "90" "6" "64431277" "64431277" "subst" "0" "00000" "EYS_000815" "g.64431277A>G" "" "{PMID:Numa-2020:33247286}" "" "c.8650T>C:p.C2884R" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829852" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829853" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829868" "3" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829869" "3" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829874" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829875" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829876" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829877" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829883" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829884" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829885" "0" "90" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "" "{PMID:Numa-2020:33247286}" "" "c.3489T>A:p.N1163K" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829886" "0" "90" "6" "65303078" "65303078" "subst" "3.33182E-5" "00000" "EYS_000206" "g.65303078A>C" "" "{PMID:Numa-2020:33247286}" "" "c.3809T>G:p.V1270G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829888" "3" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829894" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829895" "0" "90" "6" "65596696" "65596696" "subst" "4.70285E-5" "00000" "EYS_000463" "g.65596696G>C" "" "{PMID:Numa-2020:33247286}" "" "c.2886C>G:p.F962L" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829896" "0" "90" "6" "65596690" "65596690" "subst" "4.6983E-5" "00000" "EYS_000462" "g.65596690T>G" "" "{PMID:Numa-2020:33247286}" "" "c.2892A>C:p.E964D" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829898" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829899" "0" "90" "6" "64436411" "64436574" "del" "0" "00000" "EYS_000817" "g.64436411_64436574del" "" "{PMID:Numa-2020:33247286}" "" "gross deletion including exon42**" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829900" "0" "90" "6" "65300863" "65300863" "subst" "5.4076E-5" "00000" "EYS_000450" "g.65300863T>C" "" "{PMID:Numa-2020:33247286}" "" "c.4897A>G:p.K1633E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829901" "0" "90" "6" "64498112" "64498112" "subst" "0.000265873" "00000" "EYS_000108" "g.64498112C>T" "" "{PMID:Numa-2020:33247286}" "" "c.7609G>A:p.A2537T" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829902" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829903" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829905" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829906" "0" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Numa-2020:33247286}" "" "c.7919G>A:p.W2640X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829907" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829908" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829909" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829910" "0" "90" "6" "64498055" "64498056" "del" "0" "00000" "EYS_000106" "g.64498055_64498056del" "" "{PMID:Numa-2020:33247286}" "" "c.7665_7666del:p.2555_2556del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829912" "0" "90" "6" "65655687" "65655687" "subst" "1.35212E-5" "00000" "EYS_000012" "g.65655687G>A" "" "{PMID:Numa-2020:33247286}" "" "c.2380C>T:p.R794X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829913" "0" "90" "6" "64431655" "64431659" "del" "6.60677E-6" "00000" "EYS_000429" "g.64431655_64431659del" "" "{PMID:Numa-2020:33247286}" "" "c.8268_8272del:p.2756_2758del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829914" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829915" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829916" "3" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Numa-2020:33247286}" "" "c.7919G>A:p.W2640X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829917" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829918" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829919" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829920" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829921" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829922" "0" "90" "6" "65146147" "65146147" "subst" "0" "00000" "EYS_000819" "g.65146147G>T" "" "{PMID:Numa-2020:33247286}" "" "c.5847C>A:p.Y1949X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829927" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829928" "0" "90" "6" "64498108" "64498108" "del" "0" "00000" "EYS_000818" "g.64498108del" "" "{PMID:Numa-2020:33247286}" "" "c.7613delC:p.P2538fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829929" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829930" "0" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Numa-2020:33247286}" "" "c.7919G>A:p.W2640X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829934" "3" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829935" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829936" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829937" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829938" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829942" "3" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829943" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829944" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829945" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829946" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829947" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829948" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829949" "3" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829955" "3" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829956" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829957" "0" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Numa-2020:33247286}" "" "c.8805C>A:p.Y2935X" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829958" "0" "90" "6" "65300803" "65300803" "dup" "0" "00000" "EYS_000187" "g.65300803dup" "" "{PMID:Numa-2020:33247286}" "" "c.4957dupA:p.S1653fs" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829959" "0" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00000" "EYS_000144" "g.64791763C>T" "" "{PMID:Numa-2020:33247286}" "" "c.6557G>A:p.G2186E" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829964" "0" "90" "6" "65622490" "65622490" "subst" "2.64557E-5" "00000" "EYS_000237" "g.65622490C>T" "" "{PMID:Numa-2020:33247286}" "" "c.2528G>A:p.G843E" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000829965" "0" "50" "6" "66204777" "66204779" "del" "0.000121924" "00000" "EYS_000486" "g.66204777_66204779del" "" "{PMID:Numa-2020:33247286}" "" "c.525_527del:p.175_176del" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000829976" "0" "50" "6" "64791757" "64791757" "subst" "0" "00000" "EYS_000143" "g.64791757A>G" "" "{PMID:Numa-2020:33247286}" "" "c.6563T>C:p.I2188T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000829977" "0" "50" "6" "64791757" "64791757" "subst" "0" "00000" "EYS_000143" "g.64791757A>G" "" "{PMID:Numa-2020:33247286}" "" "c.6563T>C:p.I2188T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000834544" "0" "50" "6" "65596602" "65596602" "subst" "6.13229E-5" "00000" "EYS_000821" "g.65596602G>C" "" "{PMID:Ng 2019:30948794}" "" "EYS c.2980C>G, p.P994A" "heterozygous" "Germline" "no" "" "0" "" "" "g.64886709G>C" "" "VUS" "" "0000838946" "2" "50" "6" "65146099" "65146099" "subst" "0" "00000" "EYS_000823" "g.65146099C>G" "" "{PMID:Zhu 2021:32675063}" "" "EYS c.5895G>C, (p.V1965V)" "" "Germline" "yes" "" "0" "" "" "g.64436206C>G" "" "VUS" "ACMG" "0000838947" "1" "50" "6" "64430797" "64430797" "subst" "0" "00000" "EYS_000822" "g.64430797A>G" "" "{PMID:Zhu 2021:32675063}" "" "EYS c.9130T>C, p.W3044R)" "" "Germline" "yes" "" "0" "" "" "g.63720901A>G" "" "VUS" "ACMG" "0000838959" "2" "50" "6" "64431067" "64431067" "subst" "0.000245355" "00000" "EYS_000063" "g.64431067A>G" "" "{PMID:Zhu 2021:32675063}" "" "EYS c.8860A>G, (p.F2954L)" "error in annotation, variant reference (A) does not agree with reference sequence (T); probably a reverse complement error (from genomic annotation); should be c.8860T>C and not c.8860A>G" "Germline" "yes" "" "0" "" "" "g.63721171A>G" "" "VUS" "ACMG" "0000838960" "1" "90" "6" "64430626" "64430629" "del" "0" "00000" "EYS_000045" "g.64430626_64430629del" "" "{PMID:Zhu 2021:32675063}" "" "EYS c.9299_9302delCTCA, p.(Tyr3100Lysfs)" "" "Germline" "yes" "" "0" "" "" "g.63720730_63720733del" "" "pathogenic" "ACMG" "0000846876" "3" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "EYS c.1155T>A , p.(Cys385Ter)" "homozygous" "Germline" "yes" "" "0" "" "" "g.65402507A>T" "" "likely pathogenic" "" "0000846877" "1" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "EYS c.1155T>A , p.(Cys385Ter)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.65402507A>T" "" "likely pathogenic" "" "0000846901" "0" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "EYS c.1155T>A , p.(Cys385Ter)" "single heterozygous variant in a recessive disease" "Germline" "yes" "" "0" "" "" "g.65402507A>T" "" "VUS" "" "0000846902" "0" "50" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:Avela 2019:31087526}" "" "EYS c.1155T>A , p.(Cys385Ter)" "single heterozygous variant in a recessive disease" "Germline" "yes" "" "0" "" "" "g.65402507A>T" "" "VUS" "" "0000846928" "3" "70" "6" "64431273" "64431280" "del" "0" "00000" "EYS_000071" "g.64431273_64431280del" "" "{PMID:Avela 2019:31087526}" "" "EYS c.8648_8655del8" "no protein annotation; homozygous" "Germline" "yes" "" "0" "" "" "g.63721377_63721384del" "" "likely pathogenic" "" "0000846929" "2" "70" "6" "64436417" "64436417" "del" "0" "00000" "EYS_000661" "g.64436417del" "" "{PMID:Avela 2019:31087526}" "" "EYS c.8229delA" "no protein annotation; heterozygous" "Germline" "yes" "" "0" "" "" "g.63726524del" "" "likely pathogenic" "" "0000847538" "0" "70" "6" "65133061" "65508850" "delins" "0" "04303" "EYS_000824" "g.65133061_65508850delinsATGA" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.64423168_64798957delinsATGA" "" "likely pathogenic (recessive)" "ACMG" "0000847539" "0" "70" "6" "64652645" "65047715" "delins" "0" "04303" "EYS_000825" "g.64652645_65047715delinsATTATG" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.63942752_64337822delinsATTATG" "" "pathogenic (recessive)" "ACMG" "0000851268" "0" "50" "6" "64516089" "64516089" "subst" "0" "02330" "EYS_000828" "g.64516089C>T" "" "" "" "EYS(NM_001292009.2):c.7405G>A (p.G2469S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851269" "0" "70" "6" "65229204" "65229204" "subst" "0" "02327" "EYS_000638" "g.65229204T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000851270" "0" "10" "6" "65229223" "65229223" "subst" "0" "02327" "EYS_000829" "g.65229223G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000851271" "0" "50" "6" "65300844" "65300844" "subst" "0" "02327" "EYS_000831" "g.65300844G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851272" "0" "50" "6" "66042305" "66042305" "subst" "3.37751E-5" "01943" "EYS_000833" "g.66042305A>C" "" "" "" "EYS(NM_001142801.1):c.1772T>G (p.I591S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851273" "0" "30" "6" "66054051" "66054051" "subst" "1.63595E-5" "02330" "EYS_000616" "g.66054051G>A" "" "" "" "EYS(NM_001292009.1):c.1479C>T (p.C493=), EYS(NM_001292009.2):c.1479C>T (p.C493=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851274" "0" "50" "6" "66063346" "66063346" "subst" "0.000513598" "01943" "EYS_000008" "g.66063346G>A" "" "" "" "EYS(NM_001292009.1):c.1459+5C>T, EYS(NM_001292009.2):c.1459+5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851275" "0" "30" "6" "66112448" "66112448" "subst" "0.00010612" "01943" "EYS_000541" "g.66112448G>A" "" "" "" "EYS(NM_001292009.1):c.1107C>T (p.S369=), EYS(NM_001292009.2):c.1107C>T (p.S369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860472" "0" "50" "6" "64430546" "64430546" "subst" "2.18052E-5" "01943" "EYS_000826" "g.64430546A>C" "" "" "" "EYS(NM_001292009.1):c.9444T>G (p.I3148M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860473" "0" "90" "6" "64430633" "64430642" "del" "0" "02330" "EYS_000046" "g.64430633_64430642del" "" "" "" "EYS(NM_001292009.2):c.9349_9358delGTAAATATCG (p.V3117Lfs*28)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000860474" "0" "30" "6" "64451848" "64451848" "subst" "0" "02330" "EYS_000827" "g.64451848A>G" "" "" "" "EYS(NM_001292009.2):c.8092T>C (p.L2698=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860475" "0" "30" "6" "64940625" "64940625" "subst" "0.000452574" "01943" "EYS_000148" "g.64940625G>A" "" "" "" "EYS(NM_001292009.1):c.6284C>T (p.P2095L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860476" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "01943" "EYS_000158" "g.65098735T>C" "" "" "" "EYS(NM_001142800.2):c.5928-2A>G, EYS(NM_001292009.1):c.5928-2A>G, EYS(NM_001292009.2):c.5928-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000860477" "0" "90" "6" "65300834" "65300855" "dup" "0" "02327" "EYS_000830" "g.65300834_65300855dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000860478" "0" "30" "6" "66042297" "66042297" "subst" "4.72462E-5" "01943" "EYS_000832" "g.66042297T>A" "" "" "" "EYS(NM_001142801.1):c.1780A>T (p.T594S), EYS(NM_001142801.2):c.1780A>T (p.(Thr594Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867620" "1" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867621" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867623" "1" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867624" "1" "70" "6" "64488004" "64488004" "subst" "0" "00000" "EYS_000100" "g.64488004C>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.7793G>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63778111C>T" "" "likely pathogenic" "" "0000867625" "1" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867628" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867629" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867630" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867631" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867632" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867633" "1" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867638" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867639" "3" "70" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.7919G>A" "homozygous" "Unknown" "?" "" "0" "" "" "g.63762613C>T" "" "likely pathogenic" "" "0000867640" "3" "70" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.7919G>A" "homozygous" "Unknown" "?" "" "0" "" "" "g.63762613C>T" "" "likely pathogenic" "" "0000867641" "3" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "homozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867642" "3" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "homozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867645" "2" "70" "6" "66063465" "66063465" "subst" "0" "00000" "EYS_000269" "g.66063465T>A" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.1345A>T" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65353572T>A" "" "likely pathogenic" "" "0000867646" "2" "70" "6" "66044889" "66044889" "subst" "0" "00000" "EYS_000257" "g.66044889C>A" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.1750G>T" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.65334996C>A" "" "likely pathogenic" "" "0000867648" "2" "70" "6" "0" "0" "" "0" "00000" "LAMA2_000000" "g.?" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4402_4403ins" "error in annotation - no inserted nucleotides written; compound heterozygous" "Unknown" "?" "" "0" "" "" "g.?" "" "likely pathogenic" "" "0000867649" "2" "70" "6" "65300804" "65300804" "dup" "0" "00000" "EYS_000187" "g.65300804dup" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.4957dupA" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590911dup" "" "likely pathogenic" "" "0000867650" "2" "70" "6" "65300746" "65300746" "subst" "0" "00000" "EYS_000185" "g.65300746G>A" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.5014C>T" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.64590853G>A" "" "likely pathogenic" "" "0000867653" "2" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867654" "2" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867655" "2" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867656" "2" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867657" "2" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000867658" "2" "70" "6" "64431122" "64431122" "subst" "1.98255E-5" "00000" "EYS_000066" "g.64431122G>T" "" "{PMID:Hirashima 2017:28763560}" "" "EYS c.8805C>A" "compound heterozygous" "Unknown" "?" "" "0" "" "" "g.63721226G>T" "" "likely pathogenic" "" "0000869502" "1" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.1155T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869503" "2" "70" "6" "64431272" "64431279" "del" "0.000790077" "00000" "EYS_000071" "g.64431272_64431279del" "" "{PMID:McGuigan 2017:28704921}" "" "c.8648_8655delCATGCAGA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869504" "3" "70" "6" "65767506" "65767506" "subst" "0.000748443" "00000" "EYS_000530" "g.65767506C>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.2137+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869505" "1" "70" "6" "66204814" "66204814" "subst" "8.13054E-6" "00000" "EYS_000288" "g.66204814G>A" "" "{PMID:McGuigan 2017:28704921}" "" "c.490C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869506" "2" "70" "6" "65602869" "65657244" "del" "0" "00000" "EYS_000843" "g.65602869_65657244del" "" "{PMID:McGuigan 2017:28704921}" "" "c.2260-1437_2847-6134del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869507" "1" "70" "6" "65300928" "65300931" "del" "0" "00000" "EYS_000190" "g.65300928_65300931del" "" "{PMID:McGuigan 2017:28704921}" "" "c.4829_4832delCATT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869508" "2" "70" "6" "65098735" "65098735" "subst" "2.70699E-5" "00000" "EYS_000158" "g.65098735T>C" "" "{PMID:McGuigan 2017:28704921}" "" "c.5928-2A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869509" "1" "70" "6" "64472506" "64472506" "subst" "2.65714E-5" "00000" "EYS_000096" "g.64472506C>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.7919G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869510" "2" "70" "6" "64431515" "64431516" "ins" "0" "00000" "EYS_000775" "g.64431515_64431516insAA" "" "{PMID:McGuigan 2017:28704921}" "" "c.8411_8412insTT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869511" "3" "70" "6" "66205272" "66205272" "dup" "0" "00000" "EYS_000006" "g.66205272dup" "" "{PMID:McGuigan 2017:28704921}" "" "c.32dupT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869512" "1" "70" "6" "64430632" "64430641" "del" "0.000173997" "00000" "EYS_000046" "g.64430632_64430641del" "" "{PMID:McGuigan 2017:28704921}" "" "c.9286_9295delGTAAATATCG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869513" "2" "70" "6" "65544728" "65696936" "del" "0" "00000" "EYS_000841" "g.65544728_65696936del" "" "{PMID:McGuigan 2017:28704921}" "" "c.2259+10539_2993-12013del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869514" "1" "70" "6" "66204814" "66204814" "subst" "8.13054E-6" "00000" "EYS_000288" "g.66204814G>A" "" "{PMID:McGuigan 2017:28704921}" "" "c.490C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869515" "2" "70" "6" "65612025" "65612026" "del" "0" "00000" "EYS_000231" "g.65612025_65612026del" "" "{PMID:McGuigan 2017:28704921}" "" "c.2826_2827delAT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869516" "3" "70" "6" "65596693" "65596693" "subst" "6.71889E-6" "00000" "EYS_000842" "g.65596693A>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.2889T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869517" "3" "70" "6" "66005755" "66006013" "del" "0" "00000" "EYS_000720" "g.66005755_66006013del" "" "{PMID:McGuigan 2017:28704921}" "" "c.(1766+1_17671)_(2023+1_2024-1)del" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869518" "1" "70" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.2259+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869519" "2" "70" "6" "64431585" "64431589" "delins" "0" "00000" "EYS_000835" "g.64431585_64431589delinsTATAGTTTATAGTTTATAGTTTATAGTTTATAGTTTATAGTTTATAGTTATAGTTTATA" "" "{PMID:McGuigan 2017:28704921}" "" "c.8338_8342delinsTATAAACTATAACTATAAACTATAAACTATAAACTATAAACTATAAACTATAAACTATA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869520" "3" "70" "6" "64791792" "64791792" "subst" "6.77663E-6" "00000" "EYS_000738" "g.64791792G>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.6528C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869521" "1" "70" "6" "64431519" "64431519" "dup" "0" "00000" "EYS_000076" "g.64431519dup" "" "{PMID:McGuigan 2017:28704921}" "" "c.8408dupA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869522" "2" "70" "6" "65149056" "65149056" "del" "2.33367E-5" "00000" "EYS_000162" "g.65149056del" "" "{PMID:McGuigan 2017:28704921}" "" "c.5834delA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869523" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "" "{PMID:McGuigan 2017:28704921}" "" "c.6416G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869524" "3" "70" "6" "64430632" "64430641" "del" "0.000173997" "00000" "EYS_000046" "g.64430632_64430641del" "" "{PMID:McGuigan 2017:28704921}" "" "c.9286_9295delGTAAATATCG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000869525" "0" "70" "6" "64430540" "64430544" "del" "0" "00000" "EYS_000726" "g.64430540_64430544del" "" "{PMID:Sengillio 2018:29550188}" "" "c.9383_9387delAATTA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869526" "0" "70" "6" "64791744" "64791744" "subst" "0" "00000" "EYS_000737" "g.64791744C>T" "0.00001486" "{PMID:Sengillio 2018:29550188}" "" "c.6571+5G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869527" "0" "70" "6" "64472413" "64472413" "subst" "1.9867E-5" "00000" "EYS_000093" "g.64472413A>T" "0.00001987" "{PMID:Sengillio 2018:29550188}" "" "c.8012T>A" "" "Germline" "" "rs527236076" "0" "" "" "" "" "likely pathogenic" "" "0000869528" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "0.0001" "{PMID:Sengillio 2018:29550188}" "" "c.6416G>A" "" "Germline" "" "rs749909863" "0" "" "" "" "" "likely pathogenic" "" "0000869529" "0" "70" "6" "66044995" "66044998" "del" "4.08363E-6" "00000" "EYS_000567" "g.66044995_66044998del" "0.000004084" "{PMID:Sengillio 2018:29550188}" "" "c.1641_1644delTCAG" "" "Germline" "" "rs752504462" "0" "" "" "" "" "likely pathogenic" "" "0000869530" "3" "70" "6" "66112400" "66112400" "subst" "0.000726827" "00000" "EYS_000389" "g.66112400A>T" "0.0007" "{PMID:Sengillio 2018:29550188}" "" "c.1155T>A" "" "Germline" "" "rs143994166" "0" "" "" "" "" "likely pathogenic" "" "0000869531" "0" "70" "6" "64431272" "64431279" "del" "0.000790077" "00000" "EYS_000071" "g.64431272_64431279del" "0.0008" "{PMID:Sengillio 2018:29550188}" "" "c.8648_8655delCATGCAGA" "" "Germline" "" "rs528919874" "0" "" "" "" "" "likely pathogenic" "" "0000869532" "0" "70" "6" "65336027" "65336027" "subst" "0" "00000" "EYS_000743" "g.65336027G>C" "" "{PMID:Sengillio 2018:29550188}" "" "c.3555C>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869533" "0" "70" "6" "64436534" "64436534" "subst" "4.05214E-5" "00000" "EYS_000836" "g.64436534A>C" "0.00004052" "{PMID:Sengillio 2018:29550188}" "" "c.8111T>G" "" "Germline" "" "rs779983752" "0" "" "" "" "" "likely pathogenic" "" "0000869534" "3" "70" "6" "64430632" "64430641" "del" "0.000173997" "00000" "EYS_000046" "g.64430632_64430641del" "0.0002" "{PMID:Sengillio 2018:29550188}" "" "c.9286_9295delGTAAATATCG" "" "Germline" "" "rs770748359" "0" "" "" "" "" "likely pathogenic" "" "0000869535" "0" "70" "6" "64431514" "64431514" "dup" "0" "00000" "EYS_000730" "g.64431514dup" "" "{PMID:Sengillio 2018:29550188}" "" "c.8413dupA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869536" "0" "70" "6" "65523270" "65523270" "subst" "2.11873E-5" "00000" "EYS_000216" "g.65523270C>A" "0.00002119" "{PMID:Sengillio 2018:29550188}" "" "c.3443+1G>T" "" "Germline" "" "rs373441420" "0" "" "" "" "" "likely pathogenic" "" "0000869537" "0" "70" "6" "64436534" "64436534" "subst" "4.05214E-5" "00000" "EYS_000836" "g.64436534A>C" "0.00004052" "{PMID:Sengillio 2018:29550188}" "" "c.8111T>G" "" "Germline" "" "rs779983752" "0" "" "" "" "" "likely pathogenic" "" "0000869538" "0" "70" "6" "64430591" "64430610" "del" "0" "00000" "EYS_000693" "g.64430591_64430610del" "0.00000672" "{PMID:Sengillio 2018:29550188}" "" "c.9317_9336del20" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869539" "0" "70" "6" "66005818" "66005818" "dup" "0" "00000" "EYS_000588" "g.66005818dup" "0.000006599" "{PMID:Sengillio 2018:29550188}" "" "c.1961_1962insA" "" "Germline" "" "rs749103801" "0" "" "" "" "" "likely pathogenic" "" "0000869540" "0" "70" "6" "65142898" "65150442" "dup" "0" "00000" "EYS_000839" "g.65142898_65150442dup" "" "{PMID:Sengillio 2018:29550188}" "" "c.5645-1197-c.5927+3169dup" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869541" "0" "70" "6" "64776242" "64776242" "del" "3.94846E-5" "00000" "EYS_000137" "g.64776242del" "0.00003948" "{PMID:Sengillio 2018:29550188}" "" "c.6714delT" "" "Germline" "" "rs752953889" "0" "" "" "" "" "likely pathogenic" "" "0000869542" "0" "70" "6" "64430625" "64430628" "del" "4.01461E-5" "00000" "EYS_000045" "g.64430625_64430628del" "0.00004015" "{PMID:Sengillio 2018:29550188}" "" "c.9299_9302delCTCA" "" "Germline" "" "rs769824975" "0" "" "" "" "" "likely pathogenic" "" "0000869543" "3" "70" "6" "64498950" "64498950" "subst" "1.32973E-5" "00000" "EYS_000734" "g.64498950C>T" "0.0000133" "{PMID:Sengillio 2018:29550188}" "" "c.7578+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869544" "0" "70" "6" "66044994" "66044994" "subst" "0" "00000" "EYS_000751" "g.66044994C>A" "" "{PMID:Sengillio 2018:29550188}" "" "c.1645G>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869545" "0" "70" "6" "65596589" "65596589" "subst" "0" "00000" "EYS_000747" "g.65596589C>T" "" "{PMID:Sengillio 2018:29550188}" "" "c.2992+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869546" "3" "70" "6" "64709008" "64709008" "del" "0.000177121" "00000" "EYS_000135" "g.64709008del" "0.0002" "{PMID:Sengillio 2018:29550188}" "" "c.6794delC" "" "Germline" "" "rs758109813" "0" "" "" "" "" "likely pathogenic" "" "0000869547" "3" "70" "6" "65523270" "65523270" "subst" "2.11873E-5" "00000" "EYS_000216" "g.65523270C>A" "0.00002119" "{PMID:Sengillio 2018:29550188}" "" "c.3443+1G>T" "" "Germline" "" "rs373441420" "0" "" "" "" "" "likely pathogenic" "" "0000869548" "3" "70" "6" "65523464" "65523464" "subst" "6.85486E-5" "00000" "EYS_000219" "g.65523464T>G" "0.00006855" "{PMID:Sengillio 2018:29550188}" "" "c.3250A>C" "" "Germline" "" "rs778646190" "0" "" "" "" "" "likely pathogenic" "" "0000869549" "3" "70" "6" "65301358" "65301358" "subst" "8.77122E-5" "00000" "EYS_000199" "g.65301358C>G" "0.00008771" "{PMID:Sengillio 2018:29550188}" "" "c.4402G>C" "" "Germline" "" "rs778752557" "0" "" "" "" "" "likely pathogenic" "" "0000869550" "0" "70" "6" "66115140" "66115156" "del" "0" "00000" "EYS_000847" "g.66115140_66115156del" "" "{PMID:Sengillio 2018:29550188}" "" "c.963_979delAAAAGGATCTTCCAGCC" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869551" "0" "70" "6" "64709008" "64709008" "del" "0.000177121" "00000" "EYS_000135" "g.64709008del" "0.0002" "{PMID:Sengillio 2018:29550188}" "" "c.6794delC" "" "Germline" "" "rs758109813" "0" "" "" "" "" "likely pathogenic" "" "0000869552" "0" "70" "6" "66063502" "66063502" "subst" "4.07282E-6" "00000" "EYS_000398" "g.66063502G>T" "0.000004073" "{PMID:Sengillio 2018:29550188}" "" "c.1308C>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869553" "0" "70" "6" "65098733" "65098733" "del" "0" "00000" "EYS_000740" "g.65098733del" "" "{PMID:Sengillio 2018:29550188}" "" "c.5928delG" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869554" "3" "70" "6" "65301640" "65301640" "subst" "1.34716E-5" "00000" "EYS_000202" "g.65301640G>A" "0.00001347" "{PMID:Sengillio 2018:29550188}" "" "c.4120C>T" "" "Germline" "" "rs928803207" "0" "" "" "" "" "likely pathogenic" "" "0000869555" "3" "90" "6" "66044953" "66044957" "del" "0" "00000" "EYS_000845" "g.66044953_66044957del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.1682_1686del (p.Asn561Ilefs*7)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869556" "0" "30" "6" "65098685" "65098685" "subst" "0" "00000" "EYS_000838" "g.65098685A>T" "" "{PMID:Mucciolo 2018:30153090}" "" "c.5976T>A (p. Asn1992Lys)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000869557" "3" "90" "6" "66044953" "66044957" "del" "0" "00000" "EYS_000845" "g.66044953_66044957del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.1682_1686del (p.Asn561Ilefs*7)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869558" "0" "30" "6" "65098685" "65098685" "subst" "0" "00000" "EYS_000838" "g.65098685A>T" "" "{PMID:Mucciolo 2018:30153090}" "" "c.5976T>A (p.Asn1992Lys)" "" "Germline" "" "" "0" "" "" "" "" "likely benign" "" "0000869559" "3" "50" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:Mucciolo 2018:30153090}" "" "c.2259+1G>A (p.?)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000869560" "0" "50" "6" "66205272" "66205272" "dup" "0" "00000" "EYS_000006" "g.66205272dup" "" "{PMID:Mucciolo 2018:30153090}" "" "c.32dup (p. Met12Aspfs*14)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000869561" "0" "90" "6" "64940708" "64940711" "del" "0" "00000" "EYS_000837" "g.64940708_64940711del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.6198_6201del (p. Gln2066Hisfs*16)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869562" "0" "90" "6" "64436508" "64436512" "del" "6.07337E-5" "00000" "EYS_000400" "g.64436508_64436512del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.8133_8137del (p.Phe2712Cysfs*33)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869563" "0" "90" "6" "64430540" "64430544" "del" "0" "00000" "EYS_000726" "g.64430540_64430544del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.9383_9387del (p.Lys3128Argfs*7)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869564" "0" "90" "6" "65301608" "65301608" "del" "0" "00000" "EYS_000840" "g.65301608del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.4152del (p. Pro1385Leufs*14)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869565" "0" "50" "6" "65301508" "65523398" "del" "0" "00000" "EYS_000397" "g.65301508_65523398del" "" "{PMID:Mucciolo 2018:30153090}" "" "c.3317-?_4251+?" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000869566" "3" "50" "6" "65707474" "65707474" "subst" "4.60072E-5" "00000" "EYS_000242" "g.65707474C>T" "" "{PMID:Mucciolo 2018:30153090}" "" "c.2259+1G>A" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000869567" "3" "90" "6" "65622476" "65622476" "subst" "0" "00000" "EYS_000844" "g.65622476G>A" "" "{PMID:Mucciolo 2018:30153090}" "" "c.2542C>T (p.Gln848*)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869568" "0" "90" "6" "65622476" "65622476" "subst" "0" "00000" "EYS_000844" "g.65622476G>A" "" "{PMID:Mucciolo 2018:30153090}" "" "c.2542C>T (p.Gln848*)" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000869569" "0" "70" "6" "64430749" "64430749" "subst" "0" "00000" "EYS_000834" "g.64430749T>G" "" "{PMID:Mucciolo 2018:30153090}" "" "c.9178A>C (p.Ile3060Leu)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869570" "0" "70" "6" "66112370" "66112370" "subst" "0" "00000" "EYS_000846" "g.66112370C>T" "" "{PMID:Mucciolo 2018:30153090}" "" "c.1184+1G>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000869571" "0" "50" "6" "66044874" "66044874" "subst" "8.18974E-5" "00000" "EYS_000256" "g.66044874T>C" "" "{PMID:Mucciolo 2018:30153090}" "" "c.1765A>G (p.Arg589Gly)" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000873584" "0" "70" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "202" "{PMID:Sun 2018:30076350}" "" "EYS(NM_001142800.1):c.8545C>T (p.R2849*)/c.5644+5G>A" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590218C>T" "" "likely pathogenic" "" "0000873585" "0" "70" "6" "64431382" "64431382" "subst" "0" "00000" "EYS_000424" "g.64431382G>A" "202" "{PMID:Sun 2018:30076350}" "" "EYS(NM_001142800.1):c.8545C>T (p.R2849*)/c.5644+5G>A" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63721486G>A" "" "likely pathogenic" "" "0000881453" "2" "90" "6" "65532684" "65532684" "subst" "0" "04405" "EYS_000223" "g.65532684G>T" "" "{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}" "" "" "" "Germline" "" "" "0" "" "" "g.64822791G>T" "" "pathogenic" "ACMG" "0000881464" "1" "50" "6" "66417023" "66417023" "subst" "0" "04405" "EYS_000304" "g.66417023C>T" "" "{PMID:Hitti-Malin 2022:36259723}, {DOI:Hitti-Malin 2022:10.1002/humu.24489}" "" "" "" "Germline" "" "" "0" "" "" "g.65707130C>T" "" "VUS" "ACMG" "0000881787" "1" "90" "6" "64791763" "64791763" "subst" "3.47116E-5" "00006" "EYS_000144" "g.64791763C>T" "" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000881788" "2" "70" "6" "65133061" "65508850" "delins" "0" "00006" "EYS_000824" "g.65133061_65508850delinsATGA" "" "{PMID:Sano 2022:35710107}" "" "del ex23-28" "" "Germline" "" "" "0" "" "" "g.64423168_64798957delinsATGA" "" "likely pathogenic" "" "0000881789" "1" "90" "6" "64431069" "64431069" "subst" "0" "00006" "EYS_000420" "g.64431069G>T" "" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000881790" "2" "70" "6" "64652645" "65047715" "delins" "0" "00006" "EYS_000825" "g.64652645_65047715delinsATTATG" "" "{PMID:Sano 2022:35710107}" "" "del ex30-35" "" "Germline" "" "" "0" "" "" "g.63942752_64337822delinsATTATG" "" "likely pathogenic" "" "0000881791" "0" "30" "6" "64667008" "64668347" "del" "0" "00006" "EYS_000848" "g.64667008_64668347del" "0.14 in house" "" "" "" "" "Germline" "" "" "0" "" "" "g.63957115_63958454del" "" "likely benign" "" "0000881792" "0" "30" "6" "65711006" "65715713" "del" "0" "00006" "EYS_000849" "g.65711006_65715713del" "0.21 in house" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65001113_65005820del" "" "likely benign" "" "0000881793" "0" "30" "6" "66260037" "66262031" "del" "0" "00006" "EYS_000850" "g.66260037_66262031del" "0.81 in house" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65550144_65552138del" "" "likely benign" "" "0000881794" "0" "30" "6" "66399046" "66404687" "del" "0" "00006" "EYS_000851" "g.66399046_66404687del" "0.31 in house" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65689153_65694794del" "" "likely benign" "" "0000881795" "0" "30" "6" "66163966" "66163967" "ins" "0" "00006" "EYS_000852" "g.66163966_66163967insN[305]" "0.17 in house" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65454073_65454074insN[305]" "" "likely benign" "" "0000881796" "0" "30" "6" "65006432" "65006525" "del" "0" "00006" "EYS_000853" "g.65006432_65006525del" "" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.64296539_64296632del" "" "likely benign" "" "0000881797" "0" "30" "6" "65914875" "65914937" "del" "0" "00006" "EYS_000854" "g.65914875_65914937del" "" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65204982_65205044del" "" "likely benign" "" "0000881798" "0" "30" "6" "66274854" "66275177" "del" "0" "00006" "EYS_000855" "g.66274854_66275177del" "0.80 in house" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65564961_65565284del" "" "likely benign" "" "0000881799" "0" "30" "6" "65005305" "65005306" "ins" "0" "00006" "EYS_000856" "g.65005305_65005306insN[118]" "0.27in house" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" ":g.64295412_64295413insN[118]" "" "likely benign" "" "0000881800" "0" "30" "6" "65988221" "65988222" "ins" "0" "00006" "EYS_000857" "g.65988221_65988222insN[59]" "" "{PMID:Sano 2022:35710107}" "" "" "" "Germline" "" "" "0" "" "" "g.65278328_65278329insN[59]" "" "likely benign" "" "0000881801" "1" "30" "6" "65300804" "65300804" "dup" "0" "00006" "EYS_000187" "g.65300804dup" "" "{PMID:Koyanagi 2019:31213501}, {DOI:Koyanagi 2019:10.1136/jmedgenet-2018-105691}" "" "4957dupA" "" "Germline" "" "" "0" "" "" "g.64590911dup" "" "likely benign" "" "0000887373" "0" "90" "6" "64430522" "64430522" "subst" "1.67165E-5" "02330" "EYS_000020" "g.64430522A>T" "" "" "" "EYS(NM_001292009.1):c.9468T>A (p.Y3156*), EYS(NM_001292009.2):c.9468T>A (p.Y3156*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000887374" "0" "70" "6" "64430550" "64430553" "del" "0" "02330" "EYS_000858" "g.64430550_64430553del" "" "" "" "EYS(NM_001292009.2):c.9439_9442delCTAA (p.I3148Nfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000887375" "0" "10" "6" "64431498" "64431498" "subst" "0.000908445" "02330" "EYS_000074" "g.64431498G>A" "" "" "" "EYS(NM_001142800.1):c.8429C>T (p.(Thr2810Ile)), EYS(NM_001292009.1):c.8492C>T (p.T2831I), EYS(NM_001292009.2):c.8492C>T (p.T2831I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000887376" "0" "50" "6" "64472476" "64472476" "subst" "5.96121E-5" "02330" "EYS_000095" "g.64472476G>A" "" "" "" "EYS(NM_001292009.2):c.7949C>T (p.S2650F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887377" "0" "50" "6" "64487987" "64487987" "subst" "2.63671E-5" "02327" "EYS_000099" "g.64487987G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887378" "0" "50" "6" "64498112" "64498112" "subst" "0.000265873" "02330" "EYS_000108" "g.64498112C>T" "" "" "" "EYS(NM_001292009.2):c.7609G>A (p.A2537T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887379" "0" "30" "6" "64516125" "64516125" "subst" "0.000357001" "02330" "EYS_000859" "g.64516125G>A" "" "" "" "EYS(NM_001292009.2):c.7369C>T (p.L2457=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887380" "0" "30" "6" "64694476" "64694476" "subst" "5.97356E-5" "02330" "EYS_000133" "g.64694476G>A" "" "" "" "EYS(NM_001292009.2):c.6855C>T (p.F2285=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887381" "0" "30" "6" "64940515" "64940515" "subst" "0.00127034" "02330" "EYS_000860" "g.64940515G>A" "" "" "" "EYS(NM_001292009.2):c.6394C>T (p.L2132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887382" "0" "50" "6" "65149152" "65149152" "subst" "0" "02327" "EYS_000861" "g.65149152G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887383" "0" "30" "6" "66112357" "66112357" "subst" "0.00176809" "02330" "EYS_000862" "g.66112357A>G" "" "" "" "EYS(NM_001292009.2):c.1184+14T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887384" "0" "30" "6" "66349752" "66349752" "subst" "0" "02327" "EYS_000863" "g.66349752C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000896444" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.7228+1G>A(;)8012T>A; p.?" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896445" "0" "90" "6" "64472413" "64472413" "subst" "1.9867E-5" "00000" "EYS_000093" "g.64472413A>T" "Taiwan Biobank: 0.000989; GnomAD_exome_East: 0.000184; GnomAD_All: 0.0000128" "{PMID:Chen 2021:33608557}" "" "EYS c.7228+1G>A(;)8012T>A; p.(Leu2671Ter)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63762520A>T" "" "pathogenic" "" "0000896452" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[6416G>A]; p.(Cys2139Tyr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896456" "1" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[7228+1G>A]; p.(Cys2139Tyr)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "" "0000896457" "2" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[7228+1G>A]; p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896470" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7228+1G>A; p.(Cys2139Tyr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896471" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7228+1G>A; p.?" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896492" "1" "70" "6" "65300768" "65300769" "ins" "0" "00000" "EYS_000813" "g.65300768_65300769insTCTT" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "EYS c.[4991_4992insAAGA];[8107G>T]; p.(Cys1665ArgfsTer19)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.64590875_64590876insTCTT" "" "likely pathogenic" "" "0000896493" "2" "50" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "Taiwan Biobank: 0.000659; GnomAD_exome_East: 0.000509; GnomAD_All: 0.0000379" "{PMID:Chen 2021:33608557}" "" "EYS c.[4991_4992insAAGA];[8107G>T]; p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.64590218C>T" "" "VUS" "" "0000896528" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.334G>C(;)7228+1G>A; p.?" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896529" "0" "50" "6" "66204970" "66204970" "subst" "0.000369904" "00000" "EYS_000414" "g.66204970C>G" "Taiwan Biobank: 0.003955; GnomAD_exome_East: 0.005; GnomAD_All: 0.000386" "{PMID:Chen 2021:33608557}" "" "EYS c.334G>C(;)7228+1G>A; p.(Val112Leu)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.65495077C>G" "" "VUS" "" "0000896532" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[?]; p.(Cys2139Tyr)" "heterozygous; single variant in a recessive gene, no second allele found" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896538" "0" "90" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00202; GnomAD_All: 0.000143" "{PMID:Chen 2021:33608557}" "" "EYS c.3489T>A(;)8107G>T; p.(Glu2703Ter)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "" "0000896539" "0" "90" "6" "65336093" "65336093" "subst" "0.000682801" "00000" "EYS_000214" "g.65336093A>T" "Taiwan Biobank: 0.012195; GnomAD_exome_East: 0.00851; GnomAD_All: 0.000709" "{PMID:Chen 2021:33608557}" "" "EYS c.3489T>A(;)8107G>T; p.(Asn1163Lys)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64626200A>T" "" "pathogenic" "" "0000896540" "0" "70" "6" "64430843" "64430844" "ins" "0" "00000" "EYS_000808" "g.64430843_64430844insT" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "EYS c.4365_4366insTTCT(;)9083_9084insA; p.(Ser3029LeufsTer7)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63720947_63720948insT" "" "likely pathogenic" "" "0000896541" "0" "70" "6" "65301394" "65301395" "ins" "0" "00000" "EYS_000814" "g.65301394_65301395insAGAA" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "EYS c.4365_4366insTTCT(;)9083_9084insA; p.(Ser1456PhefsTer9" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64591501_64591502insAGAA" "" "likely pathogenic" "" "0000896579" "1" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[7228+1G>A]; p.(Cys2139Tyr)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896580" "2" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[7228+1G>A]; p.?" "heterozygous" "Germline" "yes" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896584" "3" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.[6416G>A];[6416G>A]; p.(Cys2139Tyr)" "homozygous" "Germline" "yes" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896609" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7228+1G>A; p.(Cys2139Tyr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "" "0000896610" "0" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7228+1G>A; p.?" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896611" "0" "50" "6" "64431618" "64431618" "subst" "1.98138E-5" "00000" "EYS_000776" "g.64431618A>G" "Taiwan Biobank: 0; GnomAD_exome_East: 0.000367; GnomAD_All: 0.0000255" "{PMID:Chen 2021:33608557}" "" "EYS c.[8309T>C];[?]; p.(Leu2770Pro)" "heterozygous; single variant in a recessive gene, no second allele found" "Germline" "yes" "" "0" "" "" "g.63721722A>G" "" "VUS" "" "0000896619" "0" "90" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00202; GnomAD_All: 0.000143" "{PMID:Chen 2021:33608557}" "" "EYS c.7492G>C(;)8107G>T; p.(Glu2703Ter)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "" "0000896620" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "Taiwan Biobank: 0.00033; GnomAD_exome_East: 0.000642; GnomAD_All: 0.0000446" "{PMID:Chen 2021:33608557}" "" "EYS c.7492G>C(;)8107G>T; p.(Ala2498Pro)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "" "0000896635" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7492G>C; p.(Cys2139Tyr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896636" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "Taiwan Biobank: 0.00033; GnomAD_exome_East: 0.000642; GnomAD_All: 0.0000446" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7492G>C; p.(Ala2498Pro)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "" "0000896668" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7492G>C; p.(Cys2139Tyr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896669" "0" "50" "6" "64499037" "64499037" "subst" "4.61894E-5" "00000" "EYS_000112" "g.64499037C>G" "Taiwan Biobank: 0.00033; GnomAD_exome_East: 0.000642; GnomAD_All: 0.0000446" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)7492G>C; p.(Ala2498Pro)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63789144C>G" "" "VUS" "" "0000896673" "0" "50" "6" "64430718" "64430718" "subst" "0.000316673" "00000" "EYS_000049" "g.64430718A>G" "Taiwan Biobank: 0.001983; GnomAD_exome_East: 0.00394; GnomAD_All: 0.000318" "{PMID:Chen 2021:33608557}" "" "EYS c.[9209T>C];[?]; p.(Ile3070Thr)" "heterozygous; single variant in a recessive gene, no second allele found" "Germline" "yes" "" "0" "" "" "g.63720822A>G" "" "VUS" "" "0000896677" "3" "70" "6" "64431328" "64431328" "del" "0" "00000" "EYS_000811" "g.64431328del" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "EYS c.[8600del];[8600del]; p.(Gly2867ValfsTer5)" "homozygous" "Germline" "yes" "" "0" "" "" "g.63721432del" "" "likely pathogenic" "" "0000896687" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)5304_5314del; p.(Cys2139Tyr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230600C>T" "" "pathogenic" "" "0000896688" "0" "90" "6" "65300449" "65300459" "del" "0" "00000" "EYS_000812" "g.65300449_65300459del" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)5304_5314del; p.(Asn1768LysfsTer2)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590556_64590566del" "" "pathogenic" "" "0000896698" "0" "50" "6" "65612391" "65612391" "subst" "0.000122251" "00000" "EYS_000235" "g.65612391A>G" "Taiwan Biobank: 0.001321; GnomAD_exome_East: 0.00172; GnomAD_All: 0.000118" "{PMID:Chen 2021:33608557}" "" "EYS c.2644T>C(;)5411T>C; p.(Phe882Leu)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64902498A>G" "" "VUS" "" "0000896699" "0" "50" "6" "65300349" "65300349" "subst" "0.00016225" "00000" "EYS_000648" "g.65300349A>G" "Taiwan Biobank: 0.000989; GnomAD_exome_East: 0.0022; GnomAD_All: 0.000157" "{PMID:Chen 2021:33608557}" "" "EYS c.2644T>C(;)5411T>C; p.(Ile1804Thr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590456A>G" "" "VUS" "" "0000896700" "0" "90" "6" "64436538" "64436538" "subst" "0.000128328" "00000" "EYS_000090" "g.64436538C>A" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00202; GnomAD_All: 0.000143" "{PMID:Chen 2021:33608557}" "" "EYS c.5644+5G>A(;)8107G>T; p.(Glu2703Ter)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63726645C>A" "" "pathogenic" "" "0000896701" "0" "50" "6" "65300111" "65300111" "subst" "3.16086E-5" "00000" "EYS_000632" "g.65300111C>T" "Taiwan Biobank: 0.000659; GnomAD_exome_East: 0.000509; GnomAD_All: 0.0000379" "{PMID:Chen 2021:33608557}" "" "EYS c.5644+5G>A(;)8107G>T; p.?" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64590218C>T" "" "VUS" "" "0000896710" "3" "90" "6" "64574078" "64574078" "subst" "2.78267E-5" "00000" "EYS_000026" "g.64574078C>T" "Taiwan Biobank: 0.001318; GnomAD_exome_East: 0.000337; GnomAD_All: 0.0000267" "{PMID:Chen 2021:33608557}" "" "EYS c.[7228+1G>A];[7228+1G>A]; p.?" "homozygous" "Germline" "yes" "" "0" "" "" "g.63864185C>T" "" "pathogenic" "" "0000896732" "0" "70" "6" "64940493" "64940493" "subst" "0.000142873" "00000" "EYS_000023" "g.64940493C>T" "Taiwan Biobank: 0.002966; GnomAD_exome_East: 0.00166; GnomAD_All: 0.000144" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)9073G>A; p.(Cys2139Tyr)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64230600C>T" "" "likely pathogenic" "" "0000896733" "0" "50" "6" "64430854" "64430854" "subst" "0" "00000" "EYS_000809" "g.64430854C>T" "Taiwan Biobank: 0; GnomAD_exome_East: 0; GnomAD_All: 0" "{PMID:Chen 2021:33608557}" "" "EYS c.6416G>A(;)9073G>A; p.(Gly3025Arg)" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.63720958C>T" "" "VUS" "" "0000903138" "0" "70" "6" "65596584" "65596590" "delins" "0" "03779" "EYS_000865" "g.65596584_65596590delinsTG" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000904505" "0" "90" "6" "64498042" "64498042" "subst" "1.34474E-5" "00000" "EYS_000864" "g.64498042G>A" "" "{PMID:Xiao 2017:29260190}" "" "NM_001142800:exon39:c.C7679T:p.P2560L" "heterozygous" "Germline" "no" "" "0" "" "" "g.63788149G>A" "" "pathogenic (dominant)" "" "0000905891" "0" "50" "6" "65612113" "65612113" "subst" "0" "00000" "EYS_000866" "g.65612113C>A" "" "{PMID:Zhu 2022:35456422}" "" "EYS c.2739G>T, p.(Arg913Ser)" "heterozygous, probably non-causal incidental finding" "Germline/De novo (untested)" "?" "" "0" "" "" "g.64902220C>A" "" "VUS" "ACMG" "0000912558" "0" "90" "6" "64499118" "64499118" "subst" "0" "02327" "EYS_000695" "g.64499118C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000912559" "0" "70" "6" "65767506" "65767506" "subst" "0.000748443" "02325" "EYS_000530" "g.65767506C>T" "" "" "" "EYS(NM_001142800.2):c.2137+1G>A, EYS(NM_001292009.2):c.2137+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000912560" "0" "30" "6" "65767635" "65767635" "subst" "0" "02330" "EYS_000882" "g.65767635A>G" "" "" "" "EYS(NM_001292009.2):c.2024-15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915798" "1" "90" "6" "65301404" "65301410" "del" "8.11919E-5" "04436" "EYS_000019" "g.65301404_65301410del" "" "{PMID:Panneman 2023:36819107}" "" "c.4350_4356del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915799" "2" "70" "6" "65098581" "65098581" "subst" "0" "04436" "EYS_000878" "g.65098581A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.6078+2T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915806" "3" "90" "6" "66204814" "66204814" "subst" "8.13054E-6" "04436" "EYS_000288" "g.66204814G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.490C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915818" "1" "50" "6" "64487986" "64487986" "subst" "1.9778E-5" "04436" "EYS_000098" "g.64487986C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.7811G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000915819" "2" "70" "6" "64430943" "64430943" "subst" "6.59822E-6" "04436" "EYS_000060" "g.64430943A>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8984T>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915828" "1" "90" "6" "65622398" "65622398" "subst" "3.30986E-5" "04436" "EYS_000236" "g.65622398G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2620C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915829" "2" "90" "6" "65301404" "65301410" "del" "8.11919E-5" "04436" "EYS_000019" "g.65301404_65301410del" "" "{PMID:Panneman 2023:36819107}" "" "c.4350_4356del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915845" "1" "90" "6" "65622398" "65622398" "subst" "3.30986E-5" "04436" "EYS_000236" "g.65622398G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2620C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915846" "2" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "04436" "EYS_000137" "g.64776242del" "" "{PMID:Panneman 2023:36819107}" "" "c.6714del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915866" "1" "70" "6" "65622488" "65622488" "subst" "0" "04436" "EYS_000725" "g.65622488G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2530C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915867" "2" "90" "6" "64940493" "64940493" "subst" "0.000142873" "04436" "EYS_000023" "g.64940493C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.6416G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915871" "1" "70" "6" "64516100" "64516100" "subst" "0.000125786" "04436" "EYS_000114" "g.64516100G>C" "" "{PMID:Panneman 2023:36819107}" "" "c.7394C>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915872" "2" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "04436" "EYS_000066" "g.64431122G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8805C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915880" "1" "90" "6" "65300803" "65300803" "dup" "0" "04436" "EYS_000187" "g.65300803dup" "" "{PMID:Panneman 2023:36819107}" "" "c.4957dup" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915881" "2" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "04436" "EYS_000144" "g.64791763C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.6557G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915882" "3" "50" "6" "66204672" "66204672" "subst" "0" "04436" "EYS_000483" "g.66204672C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.632G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000915883" "1" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "04436" "EYS_000237" "g.65622490C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2528G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915884" "2" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "04436" "EYS_000066" "g.64431122G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8805C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915887" "3" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "04436" "EYS_000237" "g.65622490C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2528G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915895" "3" "90" "6" "65300803" "65300803" "dup" "0" "04436" "EYS_000187" "g.65300803dup" "" "{PMID:Panneman 2023:36819107}" "" "c.4957dup" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915896" "3" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "04436" "EYS_000066" "g.64431122G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8805C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915906" "1" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "04436" "EYS_000237" "g.65622490C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2528G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915907" "2" "70" "6" "65303078" "65303078" "subst" "3.33182E-5" "04436" "EYS_000206" "g.65303078A>C" "" "{PMID:Panneman 2023:36819107}" "" "c.3809T>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915908" "1" "50" "6" "66204672" "66204672" "subst" "0" "04436" "EYS_000483" "g.66204672C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.632G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000915909" "2" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "04436" "EYS_000237" "g.65622490C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2528G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915910" "1" "70" "6" "66204777" "66204779" "del" "0.000121924" "04436" "EYS_000486" "g.66204777_66204779del" "" "{PMID:Panneman 2023:36819107}" "" "c.525_527del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915911" "2" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "04436" "EYS_000066" "g.64431122G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8805C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915915" "1" "70" "6" "64791763" "64791763" "subst" "3.47116E-5" "04436" "EYS_000144" "g.64791763C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.6557G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915916" "2" "90" "6" "64472506" "64472506" "subst" "2.65714E-5" "04436" "EYS_000096" "g.64472506C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.7919G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915919" "1" "70" "6" "66204777" "66204779" "del" "0.000121924" "04436" "EYS_000486" "g.66204777_66204779del" "" "{PMID:Panneman 2023:36819107}" "" "c.525_527del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915920" "2" "90" "6" "64431131" "64431134" "del" "0" "04436" "EYS_000421" "g.64431131_64431134del" "" "{PMID:Panneman 2023:36819107}" "" "c.8793_8796del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915934" "3" "90" "6" "64431122" "64431122" "subst" "1.98255E-5" "04436" "EYS_000066" "g.64431122G>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8805C>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915935" "3" "90" "6" "65300803" "65300803" "dup" "0" "04436" "EYS_000187" "g.65300803dup" "" "{PMID:Panneman 2023:36819107}" "" "c.4957dup" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915939" "3" "70" "6" "64791757" "64791757" "subst" "0" "04436" "EYS_000143" "g.64791757A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.6563T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915945" "3" "70" "6" "0" "0" "" "0" "04436" "LAMA2_000000" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(2381+1_2382-1)_(3243+1_3244-1)del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000915978" "1" "90" "6" "65301748" "65301749" "del" "0" "04436" "EYS_000456" "g.65301748_65301749del" "" "{PMID:Panneman 2023:36819107}" "" "c.4011_4012del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915979" "2" "90" "6" "64709008" "64709008" "del" "0.000177121" "04436" "EYS_000135" "g.64709008del" "" "{PMID:Panneman 2023:36819107}" "" "c.6794del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915981" "3" "90" "6" "65098734" "65098736" "del" "0" "04436" "EYS_000324" "g.65098734_65098736del" "" "{PMID:Panneman 2023:36819107}" "" "c.5928-3_5928-1del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916043" "1" "70" "6" "65532667" "65532667" "dup" "0" "04436" "EYS_000880" "g.65532667dup" "" "{PMID:Panneman 2023:36819107}" "" "c.3041dup" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916044" "2" "50" "6" "64431085" "64431085" "subst" "0" "04436" "EYS_000869" "g.64431085A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.8842T>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916052" "1" "90" "6" "65531602" "65531603" "del" "0" "04436" "EYS_000879" "g.65531602_65531603del" "" "{PMID:Panneman 2023:36819107}" "" "c.3178_3179del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916053" "2" "90" "6" "64436508" "64436512" "del" "6.07337E-5" "04436" "EYS_000400" "g.64436508_64436512del" "" "{PMID:Panneman 2023:36819107}" "" "c.8133_8137del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916059" "3" "90" "6" "66094367" "66094367" "del" "0" "04436" "EYS_000604" "g.66094367del" "" "{PMID:Panneman 2023:36819107}" "" "c.1211del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916069" "1" "90" "6" "65303112" "65303112" "subst" "0" "04436" "EYS_000602" "g.65303112G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.3775C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916070" "2" "70" "6" "64791847" "64791847" "subst" "3.3745E-5" "04436" "EYS_000590" "g.64791847A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.6473T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916104" "1" "50" "6" "66205269" "66205269" "subst" "5.71074E-5" "04436" "EYS_000301" "g.66205269A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.35T>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916105" "2" "70" "6" "64430496" "64430496" "dup" "0" "04436" "EYS_000867" "g.64430496dup" "" "{PMID:Panneman 2023:36819107}" "" "c.9431dup" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916133" "1" "70" "6" "0" "0" "" "0" "04436" "LAMA2_000000" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(7723+1_7724-1)_(7898+1_7899-1)del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916134" "2" "70" "6" "64431296" "64431299" "del" "0" "04436" "EYS_000870" "g.64431296_64431299del" "" "{PMID:Panneman 2023:36819107}" "" "c.8628_8631del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916137" "1" "50" "6" "64472371" "64472371" "subst" "6.62989E-6" "04436" "EYS_000091" "g.64472371C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8054G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916138" "2" "70" "6" "64431093" "64431093" "subst" "1.98776E-5" "04436" "EYS_000064" "g.64431093C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.8834G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916151" "1" "90" "6" "65149088" "65149088" "dup" "0" "04436" "EYS_000672" "g.65149088dup" "" "{PMID:Panneman 2023:36819107}" "" "c.5802dup" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916152" "2" "70" "6" "64472382" "64472382" "dup" "0" "04436" "EYS_000872" "g.64472382dup" "" "{PMID:Panneman 2023:36819107}" "" "c.8043dup" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916193" "1" "70" "6" "65622638" "65622638" "subst" "0" "04436" "EYS_000587" "g.65622638T>A" "" "{PMID:Panneman 2023:36819107}" "" "c.2382-2A>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916194" "2" "50" "6" "64499084" "64499084" "subst" "0" "04436" "EYS_000875" "g.64499084A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.7445T>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916200" "3" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "04436" "EYS_000158" "g.65098735T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.5928-2A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916244" "1" "70" "6" "66205191" "66205191" "subst" "0" "04436" "EYS_000885" "g.66205191G>C" "" "{PMID:Panneman 2023:36819107}" "" "c.113C>G" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916245" "2" "90" "6" "65301404" "65301410" "del" "8.11919E-5" "04436" "EYS_000019" "g.65301404_65301410del" "" "{PMID:Panneman 2023:36819107}" "" "c.4350_4356del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916253" "1" "90" "6" "65612025" "65612026" "del" "0" "04436" "EYS_000231" "g.65612025_65612026del" "" "{PMID:Panneman 2023:36819107}" "" "c.2826_2827del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916254" "2" "70" "6" "65098611" "65098611" "subst" "2.83214E-5" "04436" "EYS_000154" "g.65098611C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.6050G>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916324" "1" "70" "6" "65532542" "65532542" "subst" "0" "04436" "EYS_000409" "g.65532542A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.3164+2T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916325" "2" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "04436" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Panneman 2023:36819107}" "" "c.9299_9302del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916330" "1" "70" "6" "64776333" "64776333" "subst" "6.61463E-6" "04436" "EYS_000877" "g.64776333C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.6623G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916331" "2" "70" "6" "64430577" "64430590" "del" "0" "04436" "EYS_000773" "g.64430577_64430590del" "" "{PMID:Panneman 2023:36819107}" "" "c.9337_9350del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916407" "1" "50" "6" "64487987" "64487987" "subst" "2.63671E-5" "04436" "EYS_000099" "g.64487987G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.7810C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916408" "2" "70" "6" "64430942" "64430945" "del" "6.59927E-6" "04436" "EYS_000868" "g.64430942_64430945del" "" "{PMID:Panneman 2023:36819107}" "" "c.8982_8985del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916425" "1" "90" "6" "64709008" "64709008" "del" "0.000177121" "04436" "EYS_000135" "g.64709008del" "" "{PMID:Panneman 2023:36819107}" "" "c.6794del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916426" "2" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "04436" "EYS_000216" "g.65523270C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.3443+1G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916430" "1" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "04436" "EYS_000137" "g.64776242del" "" "{PMID:Panneman 2023:36819107}" "" "c.6714del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916431" "2" "70" "6" "64709002" "64709003" "del" "0" "04436" "EYS_000134" "g.64709002_64709003del" "" "{PMID:Panneman 2023:36819107}" "" "c.6799_6800del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916451" "3" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "04436" "EYS_000158" "g.65098735T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.5928-2A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916461" "1" "90" "6" "65300803" "65300803" "dup" "0" "04436" "EYS_000187" "g.65300803dup" "" "{PMID:Panneman 2023:36819107}" "" "c.4957dup" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916462" "2" "70" "6" "64499037" "64499037" "subst" "4.61894E-5" "04436" "EYS_000112" "g.64499037C>G" "" "{PMID:Panneman 2023:36819107}" "" "c.7492G>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916501" "1" "50" "6" "65655686" "65655686" "subst" "3.37961E-5" "04436" "EYS_000881" "g.65655686C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2381G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916502" "1" "50" "6" "65098702" "65098702" "subst" "6.99203E-6" "04436" "EYS_000157" "g.65098702T>G" "" "{PMID:Panneman 2023:36819107}" "" "c.5959A>C" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916503" "2" "50" "6" "64776324" "64776324" "subst" "0.000336941" "04436" "EYS_000139" "g.64776324G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.6632C>T" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916519" "3" "50" "6" "64694411" "64694411" "subst" "0" "04436" "EYS_000876" "g.64694411C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.6920G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916549" "3" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "04436" "EYS_000158" "g.65098735T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.5928-2A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916596" "1" "90" "6" "65301640" "65301640" "subst" "1.34716E-5" "04436" "EYS_000202" "g.65301640G>A" "" "{PMID:Panneman 2023:36819107}" "" "c.4120C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916597" "2" "70" "6" "64430868" "64430868" "subst" "1.32693E-5" "04436" "EYS_000057" "g.64430868A>G" "" "{PMID:Panneman 2023:36819107}" "" "c.9059T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916623" "1" "90" "6" "64709008" "64709008" "del" "0.000177121" "04436" "EYS_000135" "g.64709008del" "" "{PMID:Panneman 2023:36819107}" "" "c.6794del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916624" "2" "50" "6" "64487932" "64487932" "subst" "0" "04436" "EYS_000873" "g.64487932C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.7865G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916636" "1" "50" "6" "65149147" "65149147" "subst" "0.0011368" "04436" "EYS_000325" "g.65149147T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.5743A>G" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916637" "1" "90" "6" "64940493" "64940493" "subst" "0.000142873" "04436" "EYS_000023" "g.64940493C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.6416G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916638" "2" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "04436" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Panneman 2023:36819107}" "" "c.9299_9302del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916642" "3" "90" "6" "65531537" "65531537" "subst" "0" "04436" "EYS_000761" "g.65531537C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.3243+1G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916657" "3" "90" "6" "65523464" "65523464" "subst" "6.85486E-5" "04436" "EYS_000219" "g.65523464T>G" "" "{PMID:Panneman 2023:36819107}" "" "c.[3250A>C;3443+1G>T;4402G>C]" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916658" "3" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "04436" "EYS_000216" "g.65523270C>A" "" "{PMID:Panneman 2023:36819107}" "" "c.[3250A>C;3443+1G>T;4402G>C]" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916659" "3" "90" "6" "65301358" "65301358" "subst" "8.77122E-5" "04436" "EYS_000199" "g.65301358C>G" "" "{PMID:Panneman 2023:36819107}" "" "c.[3250A>C;3443+1G>T;4402G>C]" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916660" "3" "90" "6" "64436508" "64436512" "del" "6.07337E-5" "04436" "EYS_000400" "g.64436508_64436512del" "" "{PMID:Panneman 2023:36819107}" "" "c.8133_8137del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916667" "1" "50" "6" "65149147" "65149147" "subst" "0.0011368" "04436" "EYS_000325" "g.65149147T>C" "" "{PMID:Panneman 2023:36819107}" "" "c.5743A>G" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916668" "1" "90" "6" "64431516" "64431516" "dup" "0" "04436" "EYS_000871" "g.64431516dup" "" "{PMID:Panneman 2023:36819107}" "" "c.8411dup" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916669" "2" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "04436" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Panneman 2023:36819107}" "" "c.9299_9302del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916675" "1" "50" "6" "66005751" "66005751" "subst" "0" "04436" "EYS_000883" "g.66005751C>T" "" "{PMID:Panneman 2023:36819107}" "" "c.2023+5G>A" "" "Unknown" "" "" "0" "" "" "" "" "VUS" "" "0000916676" "2" "90" "6" "64487995" "64487999" "del" "0" "04436" "EYS_000874" "g.64487995_64487999del" "" "{PMID:Panneman 2023:36819107}" "" "c.7798_7802del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916692" "3" "90" "6" "64430625" "64430628" "del" "4.01461E-5" "04436" "EYS_000045" "g.64430625_64430628del" "" "{PMID:Panneman 2023:36819107}" "" "c.9299_9302del" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000916730" "3" "70" "6" "0" "0" "" "0" "04436" "LAMA2_000000" "g.?" "" "{PMID:Panneman 2023:36819107}" "" "c.(5927+1_5928-1)_(6078+1_6079-1)del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000916733" "3" "90" "6" "66005797" "66005797" "subst" "0" "04436" "EYS_000884" "g.66005797A>T" "" "{PMID:Panneman 2023:36819107}" "" "c.1982T>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000917725" "1" "70" "6" "65622491" "65622491" "subst" "0" "04091" "EYS_000464" "g.65622491C>T" "" "{PMID:Reurink 2023:36785559}, {DOI:Reurink 2023:10.1016/j.xhgg.2023.100181}" "" "" "" "Germline" "" "" "0" "" "" "g.64912598C>T" "" "likely pathogenic" "ACMG" "0000917806" "2" "50" "6" "66368069" "66428817" "del" "0" "04091" "EYS_000886" "g.66368069_66428817del" "" "{PMID:Reurink 2023:36785559}, {DOI:Reurink 2023:10.1016/j.xhgg.2023.100181}" "" "" "" "Germline" "" "" "0" "" "" "g.65658176_65718924del" "" "VUS" "ACMG" "0000924549" "0" "30" "6" "64430699" "64430699" "subst" "6.60336E-6" "02330" "EYS_000887" "g.64430699A>G" "" "" "" "EYS(NM_001292009.2):c.9291T>C (p.F3097=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924550" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "02327" "EYS_000158" "g.65098735T>C" "" "" "" "EYS(NM_001142800.2):c.5928-2A>G, EYS(NM_001292009.1):c.5928-2A>G, EYS(NM_001292009.2):c.5928-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000924551" "0" "90" "6" "65301640" "65301640" "subst" "1.34716E-5" "02330" "EYS_000202" "g.65301640G>A" "" "" "" "EYS(NM_001292009.2):c.4120C>T (p.R1374*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000924552" "0" "50" "6" "65301854" "65301854" "subst" "0" "02330" "EYS_000021" "g.65301854G>T" "" "" "" "EYS(NM_001292009.1):c.3906C>A (p.H1302Q), EYS(NM_001292009.2):c.3906C>A (p.H1302Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924553" "0" "90" "6" "65532705" "65532705" "subst" "2.00682E-5" "02327" "EYS_000224" "g.65532705A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000924554" "0" "70" "6" "65767506" "65767506" "subst" "0.000748443" "02329" "EYS_000530" "g.65767506C>T" "" "" "" "EYS(NM_001142800.2):c.2137+1G>A, EYS(NM_001292009.2):c.2137+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000929217" "0" "90" "6" "64430770" "64430770" "del" "0" "02327" "EYS_000496" "g.64430770del" "" "" "" "EYS(NM_001292009.2):c.9220delC (p.Q3074Rfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000929218" "0" "90" "6" "64431321" "64431321" "subst" "1.98313E-5" "02327" "EYS_000888" "g.64431321G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000929219" "0" "50" "6" "64431621" "64431621" "subst" "0" "02327" "EYS_000889" "g.64431621A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929220" "0" "30" "6" "64791906" "64791910" "dup" "0" "02330" "EYS_000890" "g.64791906_64791910dup" "" "" "" "EYS(NM_001292009.2):c.6425-15_6425-11dupCATTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929221" "0" "10" "6" "65300716" "65300716" "subst" "0.00226467" "02327" "EYS_000183" "g.65300716C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000929222" "0" "10" "6" "65612113" "65612113" "subst" "0.0051041" "02327" "EYS_000233" "g.65612113C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000929223" "0" "90" "6" "65612114" "65612114" "subst" "0" "02327" "EYS_000891" "g.65612114C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000929224" "0" "50" "6" "66053960" "66053960" "subst" "0" "02327" "EYS_000892" "g.66053960A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000932989" "21" "90" "6" "65622579" "65622579" "subst" "0" "00006" "EYS_000893" "g.65622579G>T" "" "{PMID:Dai 2023:37643323}" "" "" "" "Germline" "yes" "" "0" "" "" "g.64912686G>T" "" "likely pathogenic (recessive)" "" "0000932990" "11" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00006" "EYS_000137" "g.64776242del" "" "{PMID:Dai 2023:37643323}" "" "6714delT" "" "Germline" "yes" "" "0" "" "" "g.64066349del" "" "pathogenic (recessive)" "" "0000933349" "0" "90" "6" "65301640" "65301640" "subst" "1.34716E-5" "04552" "EYS_000202" "g.65301640G>A" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "rs928803207" "0" "" "" "" "{CV:550268}" "pathogenic" "ACMG" "0000933350" "0" "90" "6" "65016977" "65016977" "subst" "0" "04552" "EYS_000509" "g.65016977T>C" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "" "0" "" "" "NM_001142800.2:c.6079-2A>G" "{CV:855169}" "pathogenic" "ACMG" "0000933359" "0" "90" "6" "65767506" "65767506" "subst" "0.000748443" "03779" "EYS_000530" "g.65767506C>T" "" "" "" "" "" "Unknown" "" "rs199740930" "0" "" "" "" "" "pathogenic" "" "0000933386" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "04552" "EYS_000158" "g.65098735T>C" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "rs181169439" "0" "" "" "" "{CV:166891}" "pathogenic" "ACMG" "0000933387" "0" "90" "6" "64709009" "64709009" "del" "0" "04552" "EYS_000135" "g.64709009del" "" "Villafuerte-de la Cruz RA, et al., 2023. Submitted" "" "" "" "Germline" "yes" "rs758109813" "0" "" "" "g.63999116del" "{CV:48390}" "pathogenic" "ACMG" "0000936332" "0" "50" "6" "65301130" "65301130" "subst" "0" "00006" "EYS_000894" "g.65301130G>A" "" "{PMID:Hamdan 2017:29100083}" "" "NM_001292009:c.C4630T (Q1544X)" "" "De novo" "" "" "0" "" "" "" "" "VUS" "" "0000944532" "3" "70" "6" "65696114" "65723251" "del" "0" "04542" "EYS_000896" "g.65696114_65723251del" "" "{PMID:De Bruijn 2022:36524988}" "" "" "" "Germline" "" "" "0" "" "" "g.64986218_65013355del" "" "likely pathogenic (recessive)" "" "0000944533" "0" "70" "6" "65098586" "65098736" "del" "0" "04542" "EYS_000895" "g.65098586_65098736del" "" "{PMID:De Bruijn 2022:36524988}" "" "" "" "Germline" "" "" "0" "" "" "g.64388690_64388840del" "" "likely pathogenic" "" "0000948736" "0" "50" "6" "65146161" "65146161" "subst" "7.06175E-6" "02327" "EYS_000897" "g.65146161G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948737" "0" "30" "6" "65622465" "65622465" "subst" "7.93409E-5" "02330" "EYS_000898" "g.65622465G>A" "" "" "" "EYS(NM_001292009.2):c.2553C>T (p.N851=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948738" "0" "30" "6" "66005907" "66005907" "subst" "0.000105403" "02330" "EYS_000899" "g.66005907C>T" "" "" "" "EYS(NM_001292009.2):c.1872G>A (p.S624=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948739" "0" "30" "6" "66204614" "66204614" "subst" "4.2155E-6" "02330" "EYS_000900" "g.66204614A>G" "" "" "" "EYS(NM_001292009.2):c.690T>C (p.N230=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000954015" "1" "70" "6" "64431122" "64431122" "subst" "0" "00006" "EYS_000607" "g.64431122G>C" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.63721226G>C" "" "likely pathogenic" "" "0000954082" "2" "50" "6" "64429876" "64436574" "dup" "0" "00006" "EYS_000901" "g.(?_64429876)_(64436574_64472353)dup" "" "{PMID:Moon 2021:35052368}" "" "dup ex42-43" "" "Germline" "" "" "0" "" "" "g.(?_63719980)_(63726681_63762460)dup" "" "VUS" "" "0000958032" "0" "90" "6" "66044966" "66044966" "subst" "0.000118405" "00006" "EYS_000259" "g.66044966C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.65335073C>T" "522342" "pathogenic (recessive)" "ACMG" "0000958049" "0" "90" "6" "66204670" "66204670" "subst" "0" "00006" "EYS_000493" "g.66204670G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.65494777G>A" "986886" "pathogenic (recessive)" "ACMG" "0000958050" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00006" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5_STRONG" "Germline" "" "" "0" "" "" "g.64066349del" "357699" "pathogenic (recessive)" "ACMG" "0000958056" "3" "90" "6" "65767506" "65767506" "subst" "0.000748443" "00006" "EYS_000530" "g.65767506C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.65057613C>T" "421249" "pathogenic (recessive)" "ACMG" "0000958057" "3" "70" "6" "65984399" "66026738" "delins" "0" "00006" "EYS_000920" "g.65984399_66026738delinsAGATCA" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.65274506_65316845delinsAGATCA" "" "likely pathogenic (recessive)" "ACMG" "0000958067" "3" "90" "6" "66204814" "66204814" "subst" "8.13054E-6" "00006" "EYS_000288" "g.66204814G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.65494921G>A" "" "pathogenic (recessive)" "ACMG" "0000958083" "0" "90" "6" "65301407" "65301413" "del" "0" "00006" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_MODERATE, PP5_STRONG, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "195936" "pathogenic (recessive)" "ACMG" "0000958321" "0" "70" "6" "65707500" "65707500" "subst" "0.000801619" "00006" "EYS_000243" "g.65707500T>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5_STRONG, BP4" "Germline" "" "" "0" "" "" "g.64997607T>C" "194357" "likely pathogenic (recessive)" "ACMG" "0000958324" "0" "70" "6" "66203993" "66218725" "del" "0" "00006" "EYS_000922" "g.66203993_66218725del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.65494100_65508832del" "" "likely pathogenic (recessive)" "ACMG" "0000958329" "11" "70" "6" "65922918" "66006755" "delins" "0" "00006" "EYS_000919" "g.65922918_66006755delinsGTTTTCTTTTTA" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.65213025_65296862delinsGTTTTCTTTTTA" "" "likely pathogenic (recessive)" "ACMG" "0000958331" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "00006" "EYS_000137" "g.64776242del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5_STRONG" "Germline" "" "" "0" "" "" "g.64066349del" "357699" "pathogenic (recessive)" "ACMG" "0000958332" "3" "70" "6" "64430943" "64430943" "subst" "6.59822E-6" "00006" "EYS_000060" "g.64430943A>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.63721047A>T" "939428" "likely pathogenic (recessive)" "ACMG" "0000958335" "11" "70" "6" "65312052" "65367354" "dup" "0" "00006" "EYS_000914" "g.65312052_65367354dup" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64602159_64657461dup" "" "likely pathogenic (recessive)" "ACMG" "0000958341" "0" "90" "6" "64497997" "64497997" "subst" "0" "00006" "EYS_000103" "g.64497997C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.63788104C>T" "986903" "pathogenic (recessive)" "ACMG" "0000958353" "21" "90" "6" "65301715" "65301715" "subst" "0" "00006" "EYS_000203" "g.65301715G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.64591822G>A" "438197" "pathogenic (recessive)" "ACMG" "0000958368" "0" "90" "6" "65301407" "65301413" "del" "0" "00006" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "195936" "pathogenic (recessive)" "ACMG" "0000958429" "0" "90" "6" "65016880" "65016880" "subst" "0" "00006" "EYS_000565" "g.65016880A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.64306987A>C" "" "pathogenic (recessive)" "ACMG" "0000958443" "0" "90" "6" "64472482" "64472482" "del" "0" "00006" "EYS_000492" "g.64472482del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PVS1, PP5_STRONG" "Germline" "" "" "0" "" "" "g.63762589del" "" "pathogenic (recessive)" "ACMG" "0000958444" "0" "70" "6" "66093196" "66151198" "delins" "0" "00006" "EYS_000921" "g.66093196_66151198delinsAACTTTTACT" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.65383303_65441305delinsAACTTTTACT" "" "likely pathogenic (recessive)" "ACMG" "0000958468" "0" "90" "6" "65016861" "65016861" "subst" "0" "00006" "EYS_000911" "g.65016861A>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.64306968A>G" "865983" "pathogenic (recessive)" "ACMG" "0000958489" "0" "70" "6" "64430509" "64430509" "subst" "0" "00006" "EYS_000906" "g.64430509G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG" "Germline" "" "" "0" "" "" "g.63720613G>A" "" "likely pathogenic (recessive)" "ACMG" "0000958604" "0" "90" "6" "66204814" "66204814" "subst" "8.13054E-6" "00006" "EYS_000288" "g.66204814G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.65494921G>A" "" "pathogenic (recessive)" "ACMG" "0000958605" "0" "90" "6" "64430633" "64430642" "del" "0" "00006" "EYS_000046" "g.64430633_64430642del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.63720737_63720746del" "289906" "pathogenic (recessive)" "ACMG" "0000958608" "0" "70" "6" "65994850" "67582755" "delins" "0" "00006" "EYS_000902" "g.65994850_67582755delinsT" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.65284957_66872862delinsT" "" "likely pathogenic (recessive)" "ACMG" "0000958609" "0" "50" "6" "65655780" "65655780" "subst" "0" "00006" "EYS_000918" "g.65655780A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2" "Germline" "" "" "0" "" "" "g.64945887A>C" "" "VUS" "ACMG" "0000958615" "21" "70" "6" "64832337" "64839052" "delins" "0" "00006" "EYS_000903" "g.64832337_64839052delins64914341_64945399inv" "" "{PMID:Weisschuh 2024:37734845}" "" "dup ex31" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64122444_64129159delins64204448_64235506inv" "" "likely pathogenic (recessive)" "ACMG" "0000958619" "0" "70" "6" "64430943" "64430943" "subst" "6.59822E-6" "00006" "EYS_000060" "g.64430943A>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.63721047A>T" "939428" "likely pathogenic (recessive)" "ACMG" "0000958624" "21" "70" "6" "65647741" "65658294" "delins" "0" "00006" "EYS_000904" "g.65647741_65658294delins[65653992_65654056inv;CAATTTTGTAT]" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64937848_64948401delins[64944099_64944163inv;CAATTTTGTAT]" "" "likely pathogenic (recessive)" "ACMG" "0000958629" "0" "70" "6" "64431281" "64431282" "del" "0" "00006" "EYS_000568" "g.64431281_64431282del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.63721385_63721386del" "" "likely pathogenic (recessive)" "ACMG" "0000958638" "11" "90" "6" "65301407" "65301413" "del" "0" "00006" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic (recessive)" "ACMG" "0000958656" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00006" "EYS_000023" "g.64940493C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5, PP5_STRONG" "Germline" "" "" "0" "" "" "g.64230600C>T" "189230" "pathogenic (recessive)" "ACMG" "0000958848" "3" "50" "6" "65622641" "65622641" "subst" "0" "00006" "EYS_000917" "g.65622641A>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.64912748A>T" "" "VUS" "ACMG" "0000958849" "0" "90" "6" "66204814" "66204814" "subst" "8.13054E-6" "00006" "EYS_000288" "g.66204814G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5" "Germline" "" "" "0" "" "" "g.65494921G>A" "" "pathogenic (recessive)" "ACMG" "0000958852" "0" "70" "6" "64430550" "64430553" "del" "0" "00006" "EYS_000858" "g.64430550_64430553del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.63720654_63720657del" "" "likely pathogenic (recessive)" "ACMG" "0000958853" "0" "70" "6" "65300962" "65300974" "del" "0" "00006" "EYS_000913" "g.65300962_65300974del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64591069_64591081del" "" "likely pathogenic (recessive)" "ACMG" "0000958859" "0" "70" "6" "65596734" "65596734" "del" "0" "00006" "EYS_000916" "g.65596734del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64886841del" "" "likely pathogenic (recessive)" "ACMG" "0000958938" "11" "70" "6" "65500496" "65687405" "del" "0" "00006" "EYS_000915" "g.65500496_65687405del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64790603_64977512del" "" "likely pathogenic (recessive)" "ACMG" "0000958954" "0" "70" "6" "65149117" "65149117" "subst" "0" "00006" "EYS_000569" "g.65149117G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64439224G>A" "" "likely pathogenic (recessive)" "ACMG" "0000958964" "3" "50" "6" "64487990" "64487990" "subst" "0" "00006" "EYS_000909" "g.64487990C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.63778097C>T" "" "VUS" "ACMG" "0000959046" "0" "90" "6" "64431521" "64431521" "dup" "0" "00006" "EYS_000076" "g.64431521dup" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.63721625dup" "" "pathogenic (recessive)" "ACMG" "0000959051" "0" "90" "6" "65301407" "65301413" "del" "0" "00006" "EYS_000019" "g.65301407_65301413del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.64591514_64591520del" "" "pathogenic (recessive)" "ACMG" "0000959060" "0" "70" "6" "64430545" "64430549" "del" "0" "00006" "EYS_000726" "g.64430545_64430549del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.63720649_63720653del" "" "likely pathogenic (recessive)" "ACMG" "0000959064" "0" "50" "6" "66189835" "67841160" "inv" "0" "00006" "EYS_000905" "g.66189835_67841160inv" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.65479942_67131267inv" "" "VUS" "ACMG" "0000959256" "0" "70" "6" "65300674" "65300674" "subst" "0" "00006" "EYS_000912" "g.65300674C>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.64590781C>A" "" "likely pathogenic (recessive)" "ACMG" "0000959283" "0" "50" "6" "65098704" "65098704" "subst" "0" "00006" "EYS_000512" "g.65098704A>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.64388811A>T" "" "VUS" "ACMG" "0000959284" "0" "50" "6" "64431066" "64431066" "subst" "3.31565E-5" "00006" "EYS_000312" "g.64431066A>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.63721170A>T" "" "VUS" "ACMG" "0000959286" "0" "50" "6" "64430517" "64430517" "subst" "0" "00006" "EYS_000907" "g.64430517C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.63720621C>T" "" "VUS" "ACMG" "0000959287" "0" "50" "6" "64487986" "64487986" "subst" "1.9778E-5" "00006" "EYS_000098" "g.64487986C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.63778093C>T" "" "VUS" "ACMG" "0000959295" "0" "90" "6" "65098735" "65098735" "subst" "2.70699E-5" "00006" "EYS_000158" "g.65098735T>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1, PP5, PS4_MODERATE" "Germline" "" "" "0" "" "" "g.64388842T>C" "" "pathogenic (recessive)" "ACMG" "0000959299" "0" "50" "6" "64430874" "64430874" "subst" "0" "00006" "EYS_000908" "g.64430874A>C" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.63720978A>C" "" "VUS" "ACMG" "0000959374" "21" "50" "6" "64436439" "64436439" "subst" "6.75521E-6" "00006" "EYS_000087" "g.64436439C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PM3" "Germline" "" "" "0" "" "" "g.63726546C>G" "" "VUS" "ACMG" "0000959393" "0" "50" "6" "64487987" "64487987" "subst" "2.63671E-5" "00006" "EYS_000099" "g.64487987G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.63778094G>A" "" "VUS" "ACMG" "0000959399" "0" "50" "6" "65767576" "65767576" "subst" "8.59152E-5" "00006" "EYS_000531" "g.65767576A>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2" "Germline" "" "" "0" "" "" "g.65057683A>T" "" "VUS" "ACMG" "0000959400" "0" "50" "6" "64940646" "64940646" "subst" "0" "00006" "EYS_000910" "g.64940646G>A" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2" "Germline" "" "" "0" "" "" "g.64230753G>A" "" "VUS" "ACMG" "0000959427" "11" "90" "6" "65767506" "65767506" "subst" "0.000748443" "00006" "EYS_000530" "g.65767506C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.65057613C>T" "" "pathogenic (recessive)" "ACMG" "0000959474" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "00006" "EYS_000023" "g.64940493C>T" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PM5, PP5_STRONG; no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.64230600C>T" "" "pathogenic (recessive)" "ACMG" "0000964194" "0" "50" "6" "64431456" "64431456" "subst" "0" "02327" "EYS_000923" "g.64431456C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964198" "0" "90" "6" "64776242" "64776242" "del" "3.94846E-5" "02330" "EYS_000137" "g.64776242del" "" "" "" "EYS(NM_001292009.2):c.6714delT (p.I2239Sfs*17)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000964199" "0" "30" "6" "65016935" "65016935" "subst" "0.00172722" "02327" "EYS_000152" "g.65016935A>T" "" "" "" "EYS(NM_001142800.1):c.6119T>A (p.V2040D), EYS(NM_001292009.2):c.6119T>A (p.V2040D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964206" "0" "50" "6" "65300775" "65300775" "subst" "0.00211957" "02327" "EYS_000186" "g.65300775T>A" "" "" "" "EYS(NM_001142800.1):c.4985A>T (p.D1662V), EYS(NM_001292009.2):c.4985A>T (p.D1662V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964207" "0" "50" "6" "65336089" "65336089" "subst" "5.99925E-5" "02327" "EYS_000566" "g.65336089A>G" "" "" "" "EYS(NM_001292009.1):c.3493T>C (p.C1165R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964208" "0" "90" "6" "65532717" "65532717" "subst" "0" "02327" "EYS_000924" "g.65532717T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000964209" "0" "50" "6" "65655686" "65655686" "subst" "3.37961E-5" "02327" "EYS_000881" "g.65655686C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964210" "0" "10" "6" "65707577" "65707577" "subst" "0.00529884" "02327" "EYS_000925" "g.65707577G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000964211" "0" "30" "6" "65767634" "65767634" "subst" "0.243022" "02330" "EYS_000248" "g.65767634G>A" "" "" "" "EYS(NM_001292009.2):c.2024-15_2024-14delTCinsTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964212" "0" "30" "6" "65767643" "65767643" "del" "0" "02330" "EYS_000926" "g.65767643del" "" "" "" "EYS(NM_001292009.2):c.2024-15delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000964215" "0" "50" "6" "66005927" "66005927" "subst" "0.000112112" "02327" "EYS_000253" "g.66005927C>T" "" "" "" "EYS(NM_001142800.1):c.1852G>A (p.G618S), EYS(NM_001292009.1):c.1852G>A (p.G618S), EYS(NM_001292009.2):c.1852G>A (p.G618S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000964216" "0" "50" "6" "66044874" "66044874" "subst" "8.18974E-5" "02327" "EYS_000256" "g.66044874T>C" "" "" "" "EYS(NM_001292009.2):c.1765A>G (p.R589G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000977314" "0" "90" "6" "64430943" "64430943" "subst" "6.59822E-6" "01804" "EYS_000060" "g.64430943A>T" "" "" "" "EYS(NM_001142800.2):c.8984T>A (p.(Ile2995Asn)), EYS(NM_001292009.2):c.9047T>A (p.I3016N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000985483" "0" "90" "6" "64791792" "64791792" "subst" "6.77663E-6" "02230" "EYS_000738" "g.64791792G>T" "" "{PMID:Zeuli 2024:38816995}" "" "" "" "Germline" "" "" "0" "" "" "g.64081899G>T" "" "pathogenic (recessive)" "" "0000985494" "0" "70" "6" "65365985" "65746917" "del" "0" "02230" "EYS_000927" "g.65365985_65746917del" "" "{PMID:Zeuli 2024:38816995}" "" "" "" "Germline" "" "" "0" "" "" "g.64656092_65037024del" "" "likely pathogenic (recessive)" "" "0000986421" "1" "50" "6" "65300769" "65300769" "subst" "0.000232488" "04405" "EYS_000331" "g.65300769G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.64590876G>A" "" "VUS" "ACMG" "0000986422" "1" "50" "6" "65532581" "65532581" "subst" "0" "04405" "EYS_000932" "g.65532581C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.64822688C>T" "" "VUS" "ACMG" "0000986423" "3" "50" "6" "64472518" "64472518" "subst" "0" "04405" "EYS_000930" "g.64472518C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.63762625C>T" "" "VUS" "ACMG" "0000986424" "3" "50" "6" "64472375" "64472375" "subst" "0" "04405" "EYS_000929" "g.64472375T>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.63762482T>G" "" "VUS" "ACMG" "0000986425" "1" "90" "6" "65301398" "65301399" "delins" "0" "04405" "EYS_000025" "g.65301398_65301399delinsCT" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.64591505_64591506delinsCT" "" "pathogenic" "ACMG" "0000986924" "2" "50" "6" "64776324" "64776324" "subst" "0.000336941" "04405" "EYS_000139" "g.64776324G>A" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.64066431G>A" "" "VUS" "ACMG" "0000986925" "2" "50" "6" "64430754" "64430754" "subst" "0" "04405" "EYS_000928" "g.64430754G>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "9236C>A (Ala3058Asp)" "" "Germline" "" "" "0" "" "" "g.63720858G>T" "" "VUS" "ACMG" "0000986926" "2" "50" "6" "64472518" "64472518" "subst" "0" "04405" "EYS_000930" "g.64472518C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "" "Germline" "" "" "0" "" "" "g.63762625C>T" "" "VUS" "ACMG" "0000987011" "0" "70" "6" "64498977" "64498977" "del" "0" "00006" "EYS_000931" "g.64498977del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.63789084del" "" "likely pathogenic" "ACMG" "0000987099" "0" "70" "6" "65622490" "65622490" "subst" "2.64557E-5" "00006" "EYS_000237" "g.65622490C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.64912597C>T" "" "likely pathogenic" "ACMG" "0000987196" "0" "90" "6" "66044966" "66044966" "subst" "0.000118405" "00006" "EYS_000259" "g.66044966C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.65335073C>T" "" "pathogenic" "ACMG" "0000987277" "0" "90" "6" "64430522" "64430522" "subst" "1.67165E-5" "00006" "EYS_000020" "g.64430522A>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "case unsolved" "Germline" "" "" "0" "" "" "g.63720626A>T" "" "pathogenic" "ACMG" "0000987292" "0" "70" "6" "64431111" "64431111" "subst" "0" "00006" "EYS_000662" "g.64431111C>T" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "c.8879G>A (Cys2960Tyr)" "case unsolved" "Germline" "" "" "0" "" "" "g.63721215C>T" "" "likely pathogenic" "ACMG" "0000987305" "0" "70" "6" "66115167" "66115167" "del" "0" "00006" "EYS_000933" "g.66115167del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.65405274del" "" "likely pathogenic" "ACMG" "0000987318" "0" "70" "6" "64431148" "64431148" "subst" "3.95361E-5" "00006" "EYS_000067" "g.64431148A>G" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.63721252A>G" "" "likely pathogenic" "ACMG" "0000987322" "0" "90" "6" "64430626" "64430629" "del" "0" "00006" "EYS_000045" "g.64430626_64430629del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.63720730_63720733del" "" "pathogenic" "ACMG" "0000987333" "0" "90" "6" "64436477" "64436477" "del" "1.349E-5" "00006" "EYS_000397" "g.64436477del" "" "{PMID:Hitti-Malin 2024:38540785}, {DOI:Hitti-Malin 2024:10.3390/biom14030367}" "" "" "no variant 2nd chromosome, case unsolved" "Germline" "" "" "0" "" "" "g.63726584del" "" "pathogenic" "ACMG" "0000995844" "0" "30" "6" "64431498" "64431498" "subst" "0.000908445" "01804" "EYS_000074" "g.64431498G>A" "" "" "" "EYS(NM_001142800.1):c.8429C>T (p.(Thr2810Ile)), EYS(NM_001292009.1):c.8492C>T (p.T2831I), EYS(NM_001292009.2):c.8492C>T (p.T2831I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995845" "0" "30" "6" "64487908" "64487908" "subst" "0" "01804" "EYS_000934" "g.64487908G>C" "" "" "" "EYS(NM_001142800.1):c.7889C>G (p.(Thr2630Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995846" "0" "50" "6" "65622422" "65622422" "subst" "5.29199E-5" "01804" "EYS_000935" "g.65622422A>G" "" "" "" "EYS(NM_001142800.1):c.2596T>C (p.(Cys866Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995847" "0" "30" "6" "65707491" "65707491" "subst" "0" "01804" "EYS_000936" "g.65707491C>A" "" "" "" "EYS(NM_001142800.1):c.2243G>T (p.(Cys748Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014230" "0" "50" "6" "64431667" "64431672" "del" "0" "02330" "EYS_000083" "g.64431667_64431672del" "" "" "" "EYS(NM_001292009.2):c.8318_8323delTAGTAA (p.L2773_N2775delinsY)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014231" "0" "50" "6" "65655779" "65655779" "subst" "0" "02330" "EYS_000708" "g.65655779C>A" "" "" "" "EYS(NM_001292009.1):c.2288G>T (p.W763L), EYS(NM_001292009.2):c.2288G>T (p.W763L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001019629" "1" "90" "6" "66205272" "66205272" "dup" "0" "00006" "EYS_000006" "g.66205272dup" "" "{PMID:Jimenez 2022:36362148}" "" "32_33insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.65495379dup" "" "pathogenic (recessive)" "" "0001019630" "2" "90" "6" "66205209" "66205209" "subst" "0" "00006" "EYS_000937" "g.66205209C>A" "" "{PMID:Jimenez 2022:36362148}" "" "9036delT (W32L)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.65495316C>A" "" "pathogenic (recessive)" "" "0001019642" "21" "90" "6" "65301105" "65301105" "subst" "0" "00006" "EYS_000786" "g.65301105A>T" "" "{PMID:Wen 2023:36811936}" "" "" "" "Germline" "" "" "0" "" "" "g.64591212A>T" "" "pathogenic (recessive)" "" "0001019643" "11" "90" "6" "65330269" "65337653" "del" "0" "00006" "EYS_000938" "g.65330269_65337653del" "" "{PMID:Wen 2023:36811936}" "" "" "" "Germline" "" "" "0" "" "" "g.64620376_64627760del" "" "pathogenic (recessive)" "" "0001019644" "1" "90" "6" "64430562" "64430565" "del" "0" "00006" "EYS_000939" "g.64430562_64430565del" "" "{PMID:Wen 2023:36811936}" "" "" "" "Germline" "" "" "0" "" "" ".63720666_63720669del" "" "pathogenic (recessive)" "" "0001019645" "2" "90" "6" "66390149" "66509197" "del" "0" "00006" "EYS_000940" "g.66390149_66509197del" "" "{PMID:Wen 2023:36811936}" "" "" "" "Germline" "" "" "0" "" "" "g.65680256_65799304del" "" "pathogenic (recessive)" "" "0001022296" "1" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "00006" "EYS_000216" "g.65523270C>A" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs373441420" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0001022318" "3" "90" "6" "65523270" "65523270" "subst" "2.11873E-5" "00006" "EYS_000216" "g.65523270C>A" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs373441420" "0" "" "" "g.64813377C>A" "" "pathogenic" "" "0001022320" "3" "90" "6" "64709009" "64709009" "del" "0" "00006" "EYS_000135" "g.64709009del" "" "{PMID:Midgley 2024:39676705}" "" "6794delC" "" "Germline" "" "rs758109813" "0" "" "" "g.63999116del" "" "pathogenic" "" "0001022347" "2" "90" "6" "64791778" "64791781" "del" "0" "00006" "EYS_000697" "g.64791778_64791781del" "" "{PMID:Midgley 2024:39676705}" "" "" "" "Germline" "" "rs1488052513" "0" "" "" "g.64081885_64081888del" "" "pathogenic" "" "0001025250" "0" "50" "6" "64430492" "64430495" "del" "0" "02327" "EYS_000941" "g.64430492_64430495del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025251" "0" "50" "6" "65300650" "65300650" "subst" "1.35342E-5" "01943" "EYS_000181" "g.65300650T>A" "" "" "" "EYS(NM_001142800.1):c.5110A>T (p.I1704L), EYS(NM_001292009.2):c.5110A>T (p.I1704L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035866" "0" "50" "6" "64516241" "64516241" "subst" "0" "02330" "EYS_000942" "g.64516241A>G" "" "" "" "EYS(NM_001292009.2):c.7253T>C (p.F2418S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035867" "0" "90" "6" "64940493" "64940493" "subst" "0.000142873" "02330" "EYS_000023" "g.64940493C>T" "" "" "" "EYS(NM_001292009.2):c.6416G>A (p.C2139Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001035868" "0" "90" "6" "65655687" "65655687" "subst" "1.35212E-5" "02330" "EYS_000012" "g.65655687G>A" "" "" "" "EYS(NM_001142800.1):c.2380C>T (p.(Arg794*)), EYS(NM_001292009.2):c.2380C>T (p.R794*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001035869" "0" "90" "6" "66044966" "66044966" "subst" "0.000118405" "02327" "EYS_000259" "g.66044966C>T" "" "" "" "EYS(NM_001292009.1):c.1673G>A (p.W558*), EYS(NM_001292009.2):c.1673G>A (p.W558*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001035870" "0" "90" "6" "66044998" "66045001" "del" "0" "01804" "EYS_000567" "g.66044998_66045001del" "" "" "" "EYS(NM_001142800.2):c.1641_1644del (p.(Ser547Argfs*62)), EYS(NM_001292009.2):c.1641_1644delTCAG (p.S547Rfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001035871" "0" "70" "6" "66045011" "66045014" "del" "0" "01804" "EYS_000943" "g.66045011_66045014del" "" "" "" "EYS(NM_001142800.2):c.1628_1631del (p.(Ser543Lysfs*66))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001044618" "3" "70" "6" "65315721" "65328741" "del" "0" "04846" "EYS_000944" "g.65315721_65328741del" "" "" "" "g.65315718_65328738del" "" "Germline" "" "" "0" "" "" "g.64605828_64618848del" "" "likely pathogenic (recessive)" "ACMG" "0001049832" "1" "70" "6" "65704184" "65704184" "subst" "0" "00006" "EYS_000945" "g.65704184C>A" "" "{PMID:Hussain 2023:36833373}" "" "effect on splicing predictedf rom mini-gene splicing assay" "" "Germline" "" "" "0" "" "" "g.64994291C>A" "" "likely pathogenic (recessive)" "" "0001049838" "2" "70" "6" "66205089" "66205089" "del" "0" "00006" "EYS_000947" "g.66205089del" "" "{PMID:Hussain 2023:36833373}" "" "" "" "Germline" "" "" "0" "" "" "g.65495196del" "" "likely pathogenic (recessive)" "" "0001052404" "0" "50" "6" "66042297" "66042297" "subst" "4.72462E-5" "01804" "EYS_000832" "g.66042297T>A" "" "" "" "EYS(NM_001142801.1):c.1780A>T (p.T594S), EYS(NM_001142801.2):c.1780A>T (p.(Thr594Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052405" "0" "50" "6" "66063346" "66063346" "subst" "0.000513598" "02327" "EYS_000008" "g.66063346G>A" "" "" "" "EYS(NM_001292009.1):c.1459+5C>T, EYS(NM_001292009.2):c.1459+5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052406" "0" "30" "6" "66115097" "66115097" "subst" "0" "02327" "EYS_000946" "g.66115097C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001064570" "0" "30" "6" "65016935" "65016935" "subst" "0.00172722" "02325" "EYS_000152" "g.65016935A>T" "" "" "" "EYS(NM_001142800.1):c.6119T>A (p.V2040D), EYS(NM_001292009.2):c.6119T>A (p.V2040D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001064571" "0" "50" "6" "66005927" "66005927" "subst" "0.000112112" "02325" "EYS_000253" "g.66005927C>T" "" "" "" "EYS(NM_001142800.1):c.1852G>A (p.G618S), EYS(NM_001292009.1):c.1852G>A (p.G618S), EYS(NM_001292009.2):c.1852G>A (p.G618S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001078205" "1" "90" "6" "64472482" "64472482" "del" "0" "00006" "EYS_000492" "g.64472482del" "" "{PMID:Van Vooren 2024:40985799}" "" "" "" "Germline" "" "" "0" "" "" "g.63762589del" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes EYS ## Count = 2692 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000036426" "00007329" "50" "7558" "0" "7558" "0" "c.7558T>C" "r.(?)" "p.(Phe2520Leu)" "38" "0000059881" "00007329" "55" "2309" "0" "2309" "0" "c.2309A>C" "r.(?)" "p.(Gln770Pro)" "15" "0000059883" "00007329" "11" "3444" "-5" "3444" "-5" "c.3444-5C>T" "r.(?)" "p.(=)" "22i" "0000059884" "00007329" "15" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "26" "0000059885" "00007329" "11" "6079" "-4" "6079" "-3" "c.6079-4_6079-3del" "r.(?)" "p.(=)" "29i" "0000059887" "00007329" "11" "7796" "0" "7796" "0" "c.7796A>G" "r.(?)" "p.(His2599arg)" "40" "0000059888" "00007329" "90" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000059889" "00007329" "90" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000066245" "00007329" "90" "1459" "5" "1459" "5" "c.1459+5C>T" "r.spl?" "p.(?)" "9i" "0000158321" "00007329" "90" "7187" "0" "7187" "0" "c.7187G>C" "r.(?)" "p.(Cys2396Ser)" "36" "0000162807" "00007329" "90" "6137" "0" "6137" "0" "c.6137G>A" "r.(?)" "p.(Trp2046*)" "30" "0000170285" "00007329" "50" "5470" "0" "5470" "0" "c.5470A>C" "r.(?)" "p.(Met1824Leu)" "" "0000170924" "00007329" "90" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794*)" "15" "0000170936" "00007329" "90" "-538" "0" "1599" "1" "c.(?_-538)_(1599+1_1600-1)del" "r.0?" "p.0?" "_1_10i" "0000235528" "00007329" "99" "2710" "0" "2726" "0" "c.2710_2726del" "r.(?)" "p.(Asp904Glnfs*17)" "17" "0000235529" "00007329" "99" "2710" "0" "2726" "0" "c.2710_2726del" "r.(?)" "p.(Asp904Glnfs*17)" "17" "0000235530" "00007329" "99" "2260" "-51191" "2992" "45990" "c.2260-51191_2992+45990del" "r.(?)" "p.(Ser754Alafs*6)" "14i_19i" "0000235531" "00007329" "99" "2260" "-51191" "2992" "45990" "c.2260-51191_2992+45990del" "r.(?)" "p.(Ser754Alafs*6)" "14i_19i" "0000235532" "00007329" "99" "2260" "-51191" "2992" "45990" "c.2260-51191_2992+45990del" "r.(?)" "p.(Ser754Alafs*6)" "14i_19i" "0000235533" "00007329" "99" "1971" "0" "1971" "0" "c.1971del" "r.(?)" "p.(Ser658Valfs*4)" "12" "0000235534" "00007329" "99" "1971" "0" "1971" "0" "c.1971del" "r.(?)" "p.(Ser658Valfs*4)" "12" "0000235535" "00007329" "99" "1971" "0" "1971" "0" "c.1971del" "r.(?)" "p.(Ser658Valfs*4)" "12" "0000235536" "00007329" "99" "1767" "-24596" "2023" "238135" "c.1767-24596_2023+238135del" "r.(?)" "p.(Cys590Tyrfs*4)" "11i_12i" "0000235537" "00007329" "99" "5857" "0" "5857" "0" "c.5857G>T" "r.(?)" "p.(Glu1953*)" "28" "0000235538" "00007329" "99" "1767" "-24596" "2023" "238135" "c.1767-24596_2023+238135del" "r.(?)" "p.(Cys590Tyrfs*4)" "11i_12i" "0000235539" "00007329" "99" "5857" "0" "5857" "0" "c.5857G>T" "r.(?)" "p.(Glu1953*)" "28" "0000235540" "00007329" "99" "1767" "-24596" "2023" "238135" "c.1767-24596_2023+238135del" "r.(?)" "p.(Cys590Tyrfs*4)" "11i_12i" "0000235541" "00007329" "99" "5857" "0" "5857" "0" "c.5857G>T" "r.(?)" "p.(Glu1953*)" "28" "0000235542" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235543" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235544" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235545" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235546" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235547" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235548" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235549" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000235550" "00007329" "99" "1260" "0" "1260" "0" "c.1260del" "r.(?)" "p.(Asn421Metfs*8)" "8" "0000235551" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235552" "00007329" "75" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235553" "00007329" "99" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "42" "0000235554" "00007329" "99" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000235555" "00007329" "99" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000235556" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235557" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235558" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235559" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235560" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235561" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235562" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235563" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235564" "00007329" "55" "1765" "0" "1765" "0" "c.1765A>G" "r.(?)" "p.(Arg589Gly)" "11" "0000235565" "00007329" "99" "7665" "0" "7665" "0" "c.7665C>G" "r.(?)" "p.(Tyr2555*)" "39" "0000235566" "00007329" "99" "3443" "1" "3443" "1" "c.3443+1G>A" "r.(?)" "p.?" "22i" "0000235567" "00007329" "55" "7205" "0" "7205" "0" "c.7205G>A" "r.(?)" "p.(Arg2402Lys)" "36" "0000235568" "00007329" "55" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "43" "0000235569" "00007329" "55" "9131" "0" "9131" "0" "c.9131G>T" "r.(?)" "p.(Trp3044Leu)" "43" "0000235570" "00007329" "55" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Cys)" "40" "0000235571" "00007329" "55" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "43" "0000235572" "00007329" "55" "8054" "0" "8054" "0" "c.8054G>A" "r.(?)" "p.(Gly2685Glu)" "41" "0000235573" "00007329" "55" "1299" "3" "1299" "3" "c.1299+3A>C" "r.spl?" "p.?" "8i" "0000235574" "00007329" "99" "1674" "0" "1674" "0" "c.1674G>A" "r.(?)" "p.(Trp558*)" "11" "0000235575" "00007329" "55" "5977" "0" "5977" "0" "c.5977A>G" "r.(?)" "p.(Thr1993Ala)" "29" "0000235576" "00007329" "55" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000235577" "00007329" "33" "7083" "0" "7083" "0" "c.7083T>C" "r.(?)" "p.(Cys2361=)" "36" "0000235578" "00007329" "99" "3003" "0" "3003" "0" "c.3003T>A" "r.(?)" "p.(Cys1001*)" "20" "0000235579" "00007329" "99" "-332" "-1" "748" "1" "c.(-333+1_-332-1)_(748+1_749-1)del" "r.?" "p.?" "2i_4i" "0000235580" "00007329" "99" "5834" "0" "5834" "0" "c.5834del" "r.(?)" "p.(Lys1945Serfs*42)" "27" "0000235581" "00007329" "99" "5834" "0" "5834" "0" "c.5834del" "r.(?)" "p.(Lys1945Serfs*42)" "27" "0000235582" "00007329" "99" "3567" "0" "3567" "0" "c.3567del" "r.(?)" "p.(Gly1190Aspfs*39)" "23" "0000235583" "00007329" "99" "1642" "0" "1642" "0" "c.1642C>T" "r.(?)" "p.(Gln548*)" "11" "0000235584" "00007329" "93" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "12" "0000235585" "00007329" "55" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "6" "0000235586" "00007329" "55" "281" "0" "281" "0" "c.281C>A" "r.(?)" "p.(Pro94Gln)" "4" "0000235587" "00007329" "99" "8349" "0" "8349" "0" "c.8349G>A" "r.(?)" "p.(Trp2783*)" "43" "0000235588" "00007329" "99" "5251" "0" "5251" "0" "c.5251C>T" "r.(?)" "p.(Gln1751*)" "26" "0000235589" "00007329" "99" "5259" "0" "5259" "0" "c.5259T>A" "r.(?)" "p.(Tyr1753*)" "26" "0000235590" "00007329" "99" "5251" "0" "5251" "0" "c.5251C>T" "r.(?)" "p.(Gln1751*)" "26" "0000235591" "00007329" "99" "5259" "0" "5259" "0" "c.5259T>A" "r.(?)" "p.(Tyr1753*)" "26" "0000235592" "00007329" "99" "547" "0" "547" "0" "c.547del" "r.(?)" "p.(Cys183Alafs*74)" "4" "0000235593" "00007329" "99" "1300" "-1" "1459" "1" "c.(1299+1_1300-1)_(1459+1_1460-1)del" "r.?" "p.?" "8i_9i" "0000235594" "00007329" "99" "547" "0" "547" "0" "c.547del" "r.(?)" "p.(Cys183Alafs*74)" "4" "0000235595" "00007329" "99" "1300" "-1" "1459" "1" "c.(1299+1_1300-1)_(1459+1_1460-1)del" "r.(?)" "p.?" "8i_9i" "0000235596" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235597" "00007329" "99" "9113" "0" "9114" "0" "c.9113_9114del" "r.(?)" "p.(Thr3038Ilefs*4)" "43" "0000235598" "00007329" "99" "9368" "0" "9368" "0" "c.9368dup" "r.(?)" "p.(Asn3123Lysfs*3)" "43" "0000235599" "00007329" "99" "9113" "0" "9114" "0" "c.9113_9114del" "r.(?)" "p.(Thr3038Ilefs*4)" "43" "0000235600" "00007329" "99" "9368" "0" "9368" "0" "c.9368dup" "r.(?)" "p.(Asn3123Lysfs*3)" "43" "0000235601" "00007329" "99" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000235602" "00007329" "99" "4829" "0" "4832" "0" "c.4829_4832del" "r.(?)" "p.(Ser1610Phefs*7)" "26" "0000235603" "00007329" "99" "6572" "-1" "6725" "1" "c.(6571+1_6572-1)_(6725+1_6726-1)del" "r.?" "p.(Ser2191Thrfs*14)" "32i_33i" "0000235604" "00007329" "99" "1767" "-1" "2023" "1" "c.(1766+1_1767-1)_(2023+1_2024-1)del" "r.?" "p.(Cys590Tyrfs*4)" "11i_12i" "0000235605" "00007329" "99" "6425" "-1" "6725" "1" "c.(6424+1_6425-1)_(6725+1_6726-1)del" "r.?" "p.(Asp2142Alafs*14)" "31i_33i" "0000235606" "00007329" "99" "6425" "-1" "6725" "1" "c.(6424+1_6425-1)_(6725+1_6726-1)del" "r.(?)" "p.(Asp2142Alafs*14)" "31i_33i" "0000235607" "00007329" "55" "3164" "15" "3164" "15" "c.3164+15dup" "r.(?)" "p.(=)" "20i" "0000235608" "00007329" "55" "5044" "0" "5044" "0" "c.5044G>T" "r.(?)" "p.(Asp1682Tyr)" "26" "0000235609" "00007329" "55" "3694" "0" "3694" "0" "c.3694A>T" "r.(?)" "p.(Ile1232Phe)" "25" "0000235610" "00007329" "55" "5604" "0" "5604" "0" "c.5604A>T" "r.(?)" "p.(Ser1868=)" "26" "0000235611" "00007329" "55" "5605" "0" "5605" "0" "c.5605C>A" "r.(?)" "p.(Leu1869Met)" "26" "0000235612" "00007329" "55" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "6" "0000235613" "00007329" "55" "5044" "0" "5044" "0" "c.5044G>T" "r.(?)" "p.(Asp1682Tyr)" "26" "0000235614" "00007329" "33" "2739" "0" "2739" "0" "c.2739G>A" "r.(?)" "p.(Arg913=)" "18" "0000235615" "00007329" "33" "6855" "0" "6855" "0" "c.6855C>T" "r.(?)" "p.(Phe2285=)" "35" "0000235616" "00007329" "55" "6566" "0" "6566" "0" "c.6566T>C" "r.(?)" "p.(Leu2189Pro)" "32" "0000235617" "00007329" "55" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "42" "0000235618" "00007329" "55" "5959" "0" "5959" "0" "c.5959A>C" "r.(?)" "p.(Thr1987Pro)" "29" "0000235619" "00007329" "55" "8669" "0" "8669" "0" "c.8669G>A" "r.(?)" "p.(Cys2890Tyr)" "43" "0000235620" "00007329" "55" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000235621" "00007329" "55" "8720" "0" "8720" "0" "c.8720G>A" "r.(?)" "p.(Gly2907Glu)" "43" "0000235622" "00007329" "55" "3526" "0" "3526" "0" "c.3526T>C" "r.(?)" "p.(Cys1176Arg)" "23" "0000235623" "00007329" "55" "748" "6" "748" "6" "c.748+6A>T" "r.spl?" "p.(=)" "4i" "0000235624" "00007329" "55" "5240" "0" "5240" "0" "c.5240A>G" "r.(?)" "p.(Glu1747Gly)" "26" "0000235625" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235626" "00007329" "55" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "43" "0000235627" "00007329" "55" "3329" "0" "3329" "0" "c.3329C>G" "r.(?)" "p.(Thr1110Ser)" "22" "0000235628" "00007329" "55" "5044" "0" "5044" "0" "c.5044G>T" "r.(?)" "p.(Asp1682Tyr)" "26" "0000235629" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235630" "00007329" "55" "2847" "-1" "2847" "-1" "c.2847-1G>T" "r.(?)" "p.?" "18i" "0000235631" "00007329" "55" "2023" "1" "2023" "1" "c.2023+1G>C" "r.(?)" "p.?" "12i" "0000235632" "00007329" "55" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "14" "0000235633" "00007329" "55" "5886" "0" "5886" "0" "c.5886T>C" "r.(?)" "p.(Thr1962=)" "28" "0000235634" "00007329" "11" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000235635" "00007329" "11" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000235636" "00007329" "33" "7737" "0" "7737" "0" "c.7737T>C" "r.(?)" "p.(Thr2579=)" "40" "0000235637" "00007329" "33" "7737" "0" "7737" "0" "c.7737T>C" "r.(?)" "p.(Thr2579=)" "40" "0000235638" "00007329" "55" "7796" "0" "7796" "0" "c.7796A>G" "r.(?)" "p.(His2599Arg)" "40" "0000235639" "00007329" "55" "7796" "0" "7796" "0" "c.7796A>G" "r.(?)" "p.(His2599Arg)" "40" "0000235640" "00007329" "55" "7796" "0" "7796" "0" "c.7796A>G" "r.(?)" "p.(His2599Arg)" "40" "0000235641" "00007329" "55" "7796" "0" "7796" "0" "c.7796A>G" "r.(?)" "p.(His2599Arg)" "40" "0000235642" "00007329" "55" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "30" "0000235643" "00007329" "55" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "30" "0000235644" "00007329" "55" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "30" "0000235645" "00007329" "55" "5977" "0" "5977" "0" "c.5977A>G" "r.(?)" "p.(Thr1993Ala)" "29" "0000235646" "00007329" "55" "5977" "0" "5977" "0" "c.5977A>G" "r.(?)" "p.(Thr1993Ala)" "29" "0000235647" "00007329" "55" "5995" "0" "5995" "0" "c.5995A>G" "r.(?)" "p.(Ile1999Val)" "29" "0000235648" "00007329" "55" "1652" "0" "1652" "0" "c.1652G>T" "r.(?)" "p.(Arg551Leu)" "11" "0000235649" "00007329" "33" "2500" "0" "2500" "0" "c.2500G>A" "r.(?)" "p.(Val834Ile)" "16" "0000235650" "00007329" "33" "2739" "0" "2739" "0" "c.2739G>A" "r.spl" "p.(Arg913=)" "18" "0000235651" "00007329" "33" "2739" "0" "2739" "0" "c.2739G>A" "r.spl" "p.(Arg913=)" "18" "0000235652" "00007329" "33" "2739" "0" "2739" "0" "c.2739G>A" "r.spl" "p.(Arg913=)" "18" "0000235653" "00007329" "33" "2739" "0" "2739" "0" "c.2739G>A" "r.spl" "p.(Arg913=)" "18" "0000235654" "00007329" "55" "5216" "0" "5216" "0" "c.5216C>T" "r.(?)" "p.(Pro1739Leu)" "26" "0000235655" "00007329" "55" "5743" "0" "5743" "0" "c.5743A>T" "r.(?)" "p.(Ser1915Gly)" "27" "0000235656" "00007329" "55" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "43" "0000235657" "00007329" "55" "4985" "0" "4985" "0" "c.4985A>T" "r.(?)" "p.(Asp1662Val)" "26" "0000235658" "00007329" "55" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "26" "0000235659" "00007329" "55" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000235660" "00007329" "55" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "42" "0000235661" "00007329" "33" "777" "0" "777" "0" "c.777G>A" "r.(?)" "p.(=)" "5" "0000235662" "00007329" "33" "6645" "0" "6645" "0" "c.6645G>T" "r.(?)" "p.(=)" "33" "0000235663" "00007329" "33" "7182" "0" "7182" "0" "c.7182T>C" "r.(?)" "p.(=)" "36" "0000235664" "00007329" "33" "5376" "0" "5376" "0" "c.5376A>G" "r.(?)" "p.(=)" "26" "0000235665" "00007329" "33" "7608" "0" "7608" "0" "c.7608C>T" "r.(?)" "p.(=)" "39" "0000235666" "00007329" "33" "8712" "0" "8712" "0" "c.8712T>C" "r.(?)" "p.(=)" "43" "0000235667" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235668" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235669" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235670" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235671" "00007329" "99" "4361" "0" "4362" "0" "c.4361_4362delinsAG" "r.(?)" "p.(Ser1454*)" "26" "0000235672" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235673" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235674" "00007329" "99" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*3)" "8" "0000235675" "00007329" "99" "8155" "0" "8156" "0" "c.8155_8156del" "r.(?)" "p.(His2719Tyrfs*27)" "42" "0000235676" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235677" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235678" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235679" "00007329" "99" "3715" "0" "3715" "0" "c.3715G>T" "r.(?)" "p.(Glu1239*)" "25" "0000235680" "00007329" "99" "8155" "0" "8156" "0" "c.8155_8156del" "r.(?)" "p.(His2719Tyrfs*27)" "42" "0000235681" "00007329" "99" "403" "0" "406" "0" "c.403_406delinsCTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000235682" "00007329" "99" "8155" "0" "8156" "0" "c.8155_8156del" "r.(?)" "p.(His2719Tyrfs*27)" "42" "0000235683" "00007329" "99" "1645" "0" "1645" "0" "c.1645del" "r.(?)" "p.(Glu549Asnfs*61)" "11" "0000235684" "00007329" "99" "1645" "0" "1645" "0" "c.1645del" "r.(?)" "p.(Glu549Asnfs*61)" "11" "0000235685" "00007329" "99" "1645" "0" "1645" "0" "c.1645del" "r.(?)" "p.(Glu549Asnfs*61)" "11" "0000235686" "00007329" "99" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558*)" "11" "0000235687" "00007329" "99" "2811" "0" "2811" "0" "c.2811C>A" "r.(?)" "p.(Cys937*)" "18" "0000235688" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235689" "00007329" "99" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000235690" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235691" "00007329" "99" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000235692" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235693" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235694" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235695" "00007329" "99" "4712" "0" "4712" "0" "c.4712C>G" "r.(?)" "p.(Ser1571*)" "26" "0000235696" "00007329" "99" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000235697" "00007329" "73" "2500" "0" "2500" "0" "c.2500G>A" "r.(?)" "p.(Val834Ile)" "16" "0000235698" "00007329" "99" "-332" "-1" "748" "1" "c.(-448+1_-332-1)_(748+1_749-1)del" "r.(?)" "p.?" "1i_4i" "0000235699" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000235700" "00007329" "99" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000235701" "00007329" "99" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000235702" "00007329" "99" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "36" "0000235703" "00007329" "99" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "43" "0000235704" "00007329" "55" "4270" "0" "4270" "0" "c.4270A>G" "r.(?)" "p.(Thr1424Ala)" "26" "0000235705" "00007329" "55" "5977" "0" "5977" "0" "c.5977A>G" "r.(?)" "p.(Thr1993Ala)" "29" "0000235706" "00007329" "55" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "43" "0000235707" "00007329" "55" "5977" "0" "5977" "0" "c.5977A>G" "r.(?)" "p.(Thr1993Ala)" "29" "0000235708" "00007329" "55" "3694" "0" "3694" "0" "c.3694A>T" "r.(?)" "p.(Ile1232Phe)" "25" "0000235709" "00007329" "55" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "6" "0000235710" "00007329" "55" "1145" "0" "1145" "0" "c.1145A>T" "r.(?)" "p.(Asn382Ile)" "7" "0000235711" "00007329" "55" "1382" "0" "1382" "0" "c.1382G>A" "r.(?)" "p.(Cys461Tyr)" "9" "0000235712" "00007329" "55" "7394" "0" "7394" "0" "c.7394C>G" "r.(?)" "p.(Thr2465Ser)" "37" "0000235713" "00007329" "11" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000235714" "00007329" "55" "4531" "0" "4531" "0" "c.4531T>C" "r.(?)" "p.(Ser1511Pro)" "26" "0000235715" "00007329" "55" "4985" "0" "4985" "0" "c.4985A>T" "r.(?)" "p.(Asp1662Val)" "26" "0000235716" "00007329" "55" "5110" "0" "5110" "0" "c.5110A>T" "r.(?)" "p.(Ile1704Leu)" "26" "0000235717" "00007329" "55" "5401" "0" "5401" "0" "c.5401G>A" "r.(?)" "p.(Ala1801Thr)" "26" "0000235718" "00007329" "55" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "26" "0000235719" "00007329" "55" "6188" "0" "6188" "0" "c.6188G>T" "r.(?)" "p.(Cys2063Phe)" "30" "0000235720" "00007329" "33" "6452" "0" "6452" "0" "c.6452A>G" "r.(?)" "p.(Asn2151Ser)" "32" "0000235721" "00007329" "55" "6964" "0" "6964" "0" "c.6964A>G" "r.(?)" "p.(Ile2322Val)" "35" "0000235722" "00007329" "55" "7597" "0" "7597" "0" "c.7597A>G" "r.(?)" "p.(Lys2533Glu)" "39" "0000235723" "00007329" "55" "7751" "0" "7751" "0" "c.7751C>G" "r.(?)" "p.(Thr2584Ser)" "40" "0000235724" "00007329" "11" "5244" "0" "5244" "0" "c.5244A>C" "r.(?)" "p.(Leu1748Phe)" "26" "0000235725" "00007329" "11" "7666" "0" "7666" "0" "c.7666A>T" "r.(?)" "p.(Ser2556Cys)" "39" "0000235726" "00007329" "55" "7796" "0" "7796" "0" "c.7796A>G" "r.(?)" "p.(His2599Arg)" "40" "0000235727" "00007329" "99" "5506" "0" "5506" "0" "c.5506G>T" "r.(?)" "p.(Glu1836*)" "26" "0000235728" "00007329" "99" "5506" "0" "5506" "0" "c.5506G>T" "r.(?)" "p.(Glu1836*)" "26" "0000235729" "00007329" "99" "5506" "0" "5506" "0" "c.5506G>T" "r.(?)" "p.(Glu1836*)" "26" "0000235730" "00007329" "55" "1300" "-17039" "1599" "22208" "c.1300-17039_1599+22208del" "r.(?)" "p.(Tyr433_Glu533del)" "8i_10i" "0000235731" "00007329" "99" "9182" "0" "9185" "0" "c.9182_9185del" "r.(?)" "p.(Asn3061Thrfs*3)" "43" "0000235732" "00007329" "55" "1300" "-17039" "1599" "22208" "c.1300-17039_1599+22208del" "r.(?)" "p.(Tyr433_Glu533del)" "8i_10i" "0000235733" "00007329" "99" "9182" "0" "9185" "0" "c.9182_9185del" "r.(?)" "p.(Asn3061Thrfs*3)" "43" "0000235734" "00007329" "55" "1300" "-17039" "1599" "22208" "c.1300-17039_1599+22208del" "r.(?)" "p.(Tyr433_Glu533del)" "8i_10i" "0000235735" "00007329" "99" "9182" "0" "9185" "0" "c.9182_9185del" "r.(?)" "p.(Asn3061Thrfs*3)" "43" "0000235736" "00007329" "55" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "14" "0000235737" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235738" "00007329" "55" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "14" "0000235739" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235740" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000235741" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235742" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235743" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000235744" "00007329" "77" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000235745" "00007329" "55" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000235746" "00007329" "77" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "43" "0000235747" "00007329" "55" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000235748" "00007329" "77" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "43" "0000235749" "00007329" "99" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000235750" "00007329" "99" "6424" "1" "6424" "1" "c.6424+1G>T" "r.(?)" "p.?" "31i" "0000235751" "00007329" "99" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000235752" "00007329" "99" "6424" "1" "6424" "1" "c.6424+1G>T" "r.(?)" "p.?" "31i" "0000235753" "00007329" "99" "7361" "0" "7361" "0" "c.7361del" "r.(?)" "p.(His2454Pro*8)" "37" "0000235754" "00007329" "99" "7361" "0" "7361" "0" "c.7361del" "r.(?)" "p.(His2454Pro*8)" "37" "0000235755" "00007329" "99" "7507" "0" "7507" "0" "c.7507G>A" "r.(?)" "p.(Glu2503Lys)" "38" "0000235756" "00007329" "55" "-462" "0" "-462" "0" "c.-462G>C" "r.(?)" "p.?" "1" "0000235757" "00007329" "99" "78" "0" "79" "0" "c.78_79dup" "r.(?)" "p.(Gln27Argfs*16)" "4" "0000235758" "00007329" "99" "863" "-10671" "1766" "10020" "c.863-10671_1766+10020del" "r.(?)" "p.(Gly288Aspfs*21)" "5i_11i" "0000235759" "00007329" "99" "4451" "0" "4451" "0" "c.4451G>A" "r.(?)" "p.(Trp1484*)" "26" "0000235760" "00007329" "55" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "14" "0000235761" "00007329" "55" "4450" "0" "4450" "0" "c.4450T>C" "r.(?)" "p.(Trp1484Arg)" "26" "0000235762" "00007329" "55" "-204" "0" "-204" "0" "c.-204G>A" "r.(?)" "p.(=)" "3" "0000235763" "00007329" "55" "-349" "0" "-349" "0" "c.-349G>T" "r.(?)" "p.(=)" "2" "0000235764" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>T" "r.(?)" "p.(Asp2746Tyr)" "43" "0000235765" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>T" "r.(?)" "p.(Asp2746Tyr)" "43" "0000235766" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>T" "r.(?)" "p.(Asp2746Tyr)" "43" "0000235767" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>T" "r.(?)" "p.(Asp2746Tyr)" "43" "0000235768" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>T" "r.(?)" "p.(Asp2746Tyr)" "43" "0000235769" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>T" "r.(?)" "p.(Asp2746Tyr)" "43" "0000235770" "00007329" "55" "9019" "0" "9019" "0" "c.9019G>T" "r.(?)" "p.(Asp3007Tyr)" "43" "0000235771" "00007329" "55" "9019" "0" "9019" "0" "c.9019G>T" "r.(?)" "p.(Asp3007Tyr)" "43" "0000235772" "00007329" "50" "-332" "-1" "748" "1" "c.(-333+1_-332-1)_(748+1_749-1)dup" "r.?" "p.?" "2i_4i" "0000235773" "00007329" "77" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "43" "0000235774" "00007329" "99" "2382" "-1" "2992" "1" "c.(2381+1_2382-1)_(2992+1_2993-1)del" "r.?" "p.(Cys795Hisfs*4)" "15i_19i" "0000235775" "00007329" "99" "2024" "-1" "2259" "1" "c.(2023+1_2024-1)_(2259+1_2260-1)del" "r.?" "p.(Gly675Glufs*9)" "12i_14i" "0000235776" "00007329" "55" "3695" "0" "3695" "0" "c.3695T>C" "r.(?)" "p.(Ile1232Thr)" "25" "0000235777" "00007329" "99" "1767" "-1" "2023" "1" "c.(1766+1_1767-1)_(2023+1_2024-1)del" "r.(?)" "p.(Cys590Tyrfs*4)" "11i_12i" "0000235778" "00007329" "99" "1971" "0" "1971" "0" "c.1971del" "r.(?)" "p.(Ser658Valfs*4)" "12" "0000235779" "00007329" "99" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.(?)" "p.?" "28i" "0000235780" "00007329" "55" "8003" "0" "8003" "0" "c.8003G>T" "r.(?)" "p.(Cys2668Phe)" "41" "0000235781" "00007329" "55" "-459" "0" "-459" "0" "c.-459C>T" "r.(?)" "p.(=)" "1" "0000235782" "00007329" "33" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "12" "0000235783" "00007329" "11" "2024" "-14" "2024" "-14" "c.2024-14C>T" "r.(?)" "p.(=)" "12i" "0000235784" "00007329" "55" "7228" "7" "7228" "7" "c.7228+7G>A" "r.(?)" "p.(=)" "36i" "0000235785" "00007329" "33" "7608" "0" "7608" "0" "c.7608C>T" "r.(?)" "p.(Ile2536=)" "39" "0000235786" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235787" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235788" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235789" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235790" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235791" "00007329" "99" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000235792" "00007329" "55" "7597" "0" "7597" "0" "c.7597A>G" "r.(?)" "p.(Lys2533Glu)" "39" "0000235793" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235794" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235795" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235796" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235797" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235798" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235799" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235800" "00007329" "33" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235801" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235802" "00007329" "99" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*3)" "8" "0000235803" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235804" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235805" "00007329" "33" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235806" "00007329" "99" "1485" "0" "1493" "0" "c.1485_1493delinsCGAAAAG" "r.(?)" "p.(Val495Glufs*13)" "10" "0000235807" "00007329" "55" "7028" "0" "7029" "0" "c.7028_7029delinsATCGT" "r.(?)" "p.(Leu2343delinsHisArg)" "35" "0000235808" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235809" "00007329" "99" "7665" "0" "7666" "0" "c.7665_7666del" "r.(?)" "p.(Tyr2555*)" "39" "0000235810" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235811" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235812" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235813" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235814" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235815" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235816" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235817" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235818" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235819" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235820" "00007329" "99" "7283" "0" "7283" "0" "c.7283C>A" "r.(?)" "p.(Ser2428*)" "37" "0000235821" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235822" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235823" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235824" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235825" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235826" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235827" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235828" "00007329" "55" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000235829" "00007329" "11" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000235830" "00007329" "55" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "25" "0000235831" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235832" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235833" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235834" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235835" "00007329" "77" "8288" "0" "8288" "0" "c.8288T>G" "r.(?)" "p.(Leu2763Arg)" "43" "0000235836" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235837" "00007329" "77" "8288" "0" "8288" "0" "c.8288T>G" "r.(?)" "p.(Leu2763Arg)" "43" "0000235838" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235839" "00007329" "99" "2522" "0" "2522" "0" "c.2522dup" "r.(?)" "p.(Tyr841*)" "16" "0000235840" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235841" "00007329" "99" "6425" "-1" "6571" "1" "c.(6424+1_6425-1)_(6571+1_6572-1)del" "r.?" "p.(Asp2142_Ser2191delinsGly)" "31i_32i" "0000235842" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235843" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235844" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235845" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235846" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235847" "00007329" "55" "7793" "0" "7793" "0" "c.7793G>A" "r.(?)" "p.(Gly2598Asp)" "40" "0000235848" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235849" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235850" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235851" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235852" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235853" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235854" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235855" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235856" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235857" "00007329" "55" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "43" "0000235858" "00007329" "55" "8812" "0" "8812" "0" "c.8812C>A" "r.(?)" "p.(Leu2938Met)" "43" "0000235859" "00007329" "55" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "43" "0000235860" "00007329" "55" "5884" "0" "5884" "0" "c.5884A>G" "r.(?)" "p.(Thr1962Ala)" "28" "0000235861" "00007329" "55" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "43" "0000235862" "00007329" "55" "5404" "0" "5404" "0" "c.5404C>T" "r.(?)" "p.(Leu1802Phe)" "26" "0000235863" "00007329" "55" "77" "0" "77" "0" "c.77G>A" "r.(?)" "p.(Arg26Gln)" "4" "0000235864" "00007329" "55" "2923" "0" "2923" "0" "c.2923T>C" "r.(?)" "p.(Cys975Arg)" "19" "0000235865" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235866" "00007329" "99" "5168" "0" "5168" "0" "c.5168dup" "r.(?)" "p.(Leu1723Phefs*7)" "26" "0000235867" "00007329" "99" "3443" "5701" "3443" "23169" "c.3443+5701_3443+23169delinsACATTA;3443+23169_3443+23170ins3443+20281_6078+24372inv;6078+24567_6078+27406del" "r.?" "p.?" "22i_29i" "0000235868" "00007329" "99" "5168" "0" "5168" "0" "c.5168dup" "r.(?)" "p.(Leu1723Phefs*7)" "26" "0000235869" "00007329" "99" "3443" "5701" "3443" "23169" "c.3443+5701_3443+23169delinsACATTA;3443+23169_3443+23170ins3443+20281_6078+24372inv;6078+24567_6078+27406del" "r.?" "p.?" "22i_29i" "0000235870" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235871" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235872" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000235873" "00007329" "99" "7002" "0" "7002" "0" "c.7002C>A" "r.(?)" "p.(Cys2344*)" "35" "0000235874" "00007329" "55" "141" "0" "141" "0" "c.141A>T" "r.(?)" "p.(Glu47Asp)" "4" "0000235875" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235876" "00007329" "99" "4022" "0" "4022" "0" "c.4022del" "r.(?)" "p.(Ser1341Phefs*11)" "26" "0000235877" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235878" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235879" "00007329" "55" "7793" "0" "7793" "0" "c.7793G>A" "r.(?)" "p.(Gly2598Asp)" "40" "0000235880" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235881" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235882" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235883" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235884" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235885" "00007329" "55" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "43" "0000235886" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235887" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235888" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235889" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235890" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235891" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235892" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235893" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235894" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235895" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235896" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235897" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235898" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235899" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235900" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235901" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235902" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235903" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235904" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235905" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235906" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235907" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235908" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235909" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235910" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235911" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235912" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235913" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235914" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235915" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235916" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235917" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235918" "00007329" "99" "7048" "0" "7048" "0" "c.7048del" "r.(?)" "p.(Cys2350Alafs*97)" "35" "0000235919" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235920" "00007329" "99" "8379" "0" "8380" "0" "c.8379_8380insTG" "r.(?)" "p.(Glu2794Trpfs*7)" "43" "0000235921" "00007329" "99" "5202" "0" "5203" "0" "c.5202_5203del" "r.(?)" "p.(Phe1735Glnfs*6)" "26" "0000235922" "00007329" "99" "8379" "0" "8380" "0" "c.8379_8380insTG" "r.(?)" "p.(Glu2794Trpfs*7)" "43" "0000235923" "00007329" "99" "5202" "0" "5203" "0" "c.5202_5203del" "r.(?)" "p.(Phe1735Glnfs*6)" "26" "0000235924" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235925" "00007329" "99" "1750" "0" "1750" "0" "c.1750G>T" "r.(?)" "p.(Glu584*)" "11" "0000235926" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235927" "00007329" "99" "4402" "0" "4402" "0" "c.4402dup" "r.(?)" "p.(Asp1468Glyfs*3)" "26" "0000235928" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235929" "00007329" "99" "5014" "0" "5014" "0" "c.5014C>T" "r.(?)" "p.(Gln1672*)" "26" "0000235930" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235931" "00007329" "99" "4387" "0" "4387" "0" "c.4387del" "r.(?)" "p.(Arg1463Glyfs*15)" "26" "0000235932" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235933" "00007329" "99" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "41" "0000235934" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235935" "00007329" "99" "1345" "0" "1345" "0" "c.1345A>T" "r.(?)" "p.(Lys449*)" "9" "0000235936" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235937" "00007329" "99" "7694" "0" "7694" "0" "c.7694del" "r.(?)" "p.(Asn2565Metfs*52)" "39" "0000235938" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235939" "00007329" "99" "5014" "0" "5014" "0" "c.5014C>T" "r.(?)" "p.(Gln1672*)" "26" "0000235940" "00007329" "55" "-459" "0" "-459" "0" "c.-459C>T" "r.(?)" "p.(=)" "1" "0000235941" "00007329" "99" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000235942" "00007329" "55" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "27" "0000235943" "00007329" "77" "6415" "0" "6415" "0" "c.6415T>C" "r.(?)" "p.(Cys2139Arg)" "31" "0000235944" "00007329" "55" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "43" "0000235945" "00007329" "99" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000235946" "00007329" "99" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Tyr874*)" "16" "0000235947" "00007329" "99" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000235948" "00007329" "99" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Tyr874*)" "16" "0000235949" "00007329" "99" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000235950" "00007329" "99" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Tyr874*)" "16" "0000235951" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235952" "00007329" "99" "2739" "-1" "3243" "1" "c.(2738+1_2739-1)_(3243+1_3244-1)del" "r.?" "p.?" "17i_21i" "0000235953" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000235954" "00007329" "99" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "4" "0000235955" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235956" "00007329" "99" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg14*)" "4" "0000235957" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000235958" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235959" "00007329" "55" "8861" "0" "8861" "0" "c.8861T>C" "r.(?)" "p.(Phe2954Ser)" "43" "0000235960" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235961" "00007329" "55" "8861" "0" "8861" "0" "c.8861T>C" "r.(?)" "p.(Phe2954Ser)" "43" "0000235962" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000235963" "00007329" "55" "8861" "0" "8861" "0" "c.8861T>C" "r.(?)" "p.(Phe2954Ser)" "43" "0000235964" "00007329" "55" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000235965" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235966" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235967" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235968" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235969" "00007329" "55" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000235970" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235971" "00007329" "99" "2522" "0" "2522" "0" "c.2522dup" "r.(?)" "p.(Tyr841*)" "16" "0000235972" "00007329" "99" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794*)" "15" "0000235973" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235974" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235975" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235976" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235977" "00007329" "99" "7412" "-1" "7412" "-1" "c.7412-1G>T" "r.(?)" "p.?" "37i" "0000235978" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235979" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235980" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235981" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235982" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000235983" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235984" "00007329" "55" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000235985" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235986" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235987" "00007329" "77" "8288" "0" "8288" "0" "c.8288T>G" "r.(?)" "p.(Leu2763Arg)" "43" "0000235988" "00007329" "99" "5202" "0" "5203" "0" "c.5202_5203del" "r.(?)" "p.(Phe1735Glnfs*6)" "26" "0000235989" "00007329" "99" "8376" "0" "8379" "0" "c.8376_8379dup" "r.(?)" "p.(Glu2794Cysfs*19)" "43" "0000235990" "00007329" "99" "5202" "0" "5203" "0" "c.5202_5203del" "r.(?)" "p.(Phe1735Glnfs*6)" "26" "0000235991" "00007329" "99" "8376" "0" "8379" "0" "c.8376_8379dup" "r.(?)" "p.(Glu2794Cysfs*19)" "43" "0000235992" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235993" "00007329" "55" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000235994" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235995" "00007329" "55" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000235996" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000235997" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000235998" "00007329" "55" "228" "0" "228" "0" "c.228G>C" "r.(?)" "p.(Gln76His)" "4" "0000235999" "00007329" "99" "2522" "0" "2522" "0" "c.2522dup" "r.(?)" "p.(Tyr841*)" "16" "0000236000" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236001" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000236002" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236003" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000236004" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236005" "00007329" "99" "8048" "0" "8048" "0" "c.8048C>T" "r.(?)" "p.(Thr2683Ile)" "41" "0000236006" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236007" "00007329" "99" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000236008" "00007329" "99" "5645" "-2" "5645" "-2" "c.5645-2A>G" "r.(?)" "p.?" "26i" "0000236009" "00007329" "77" "8236" "0" "8236" "0" "c.8236G>C" "r.(?)" "p.(Asp2746His)" "43" "0000236010" "00007329" "55" "2101" "0" "2101" "0" "c.2101G>A" "r.(?)" "p.(Pro701Ser)" "13" "0000236011" "00007329" "99" "4557" "0" "4557" "0" "c.4557del" "r.(?)" "p.(Ala1520Profs*30)" "26" "0000236012" "00007329" "55" "5645" "-4" "5645" "-3" "c.5645-4_5645-3insT" "r.spl?" "p.?" "26i" "0000236013" "00007329" "55" "35" "0" "35" "0" "c.35T>C" "r.(?)" "p.(Met12Thr)" "4" "0000236014" "00007329" "99" "6869" "0" "6896" "0" "c.6869_6896del" "r.(?)" "p.(Pro2290Glnfs*12)" "35" "0000236015" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236016" "00007329" "55" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000236017" "00007329" "55" "6897" "0" "6902" "0" "c.6897_6902dup" "r.(?)" "p.(Gly2300_Pro2301dup)" "35" "0000236018" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000236019" "00007329" "55" "6976" "0" "6976" "0" "c.6976C>T" "r.(?)" "p.(Arg2326Gln)" "35" "0000236020" "00007329" "55" "141" "0" "141" "0" "c.141A>T" "r.(?)" "p.(Glu47Asp)" "4" "0000236021" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236022" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236023" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000236024" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236025" "00007329" "77" "8288" "0" "8288" "0" "c.8288T>G" "r.(?)" "p.(Leu2763Arg)" "43" "0000236026" "00007329" "55" "2381" "5961" "5644" "-24572" "c.2381+5961_5644-24572del" "r.(?)" "p.?" "15i_26i" "0000236027" "00007329" "55" "2381" "5961" "5644" "-24572" "c.2381+5961_5644-24572del" "r.(?)" "p.?" "15i_26i" "0000236028" "00007329" "55" "2381" "5961" "5644" "-24572" "c.2381+5961_5644-24572del" "r.(?)" "p.?" "15i_26i" "0000236029" "00007329" "55" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "43" "0000236030" "00007329" "55" "7868" "0" "7868" "0" "c.7868G>A" "r.(?)" "p.(Gly2623Glu)" "40" "0000236031" "00007329" "55" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "43" "0000236032" "00007329" "55" "7868" "0" "7868" "0" "c.7868G>A" "r.(?)" "p.(Gly2623Glu)" "40" "0000236033" "00007329" "55" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "43" "0000236034" "00007329" "55" "7868" "0" "7868" "0" "c.7868G>A" "r.(?)" "p.(Gly2623Glu)" "40" "0000236035" "00007329" "55" "1871" "0" "1871" "0" "c.1871C>T" "r.(?)" "p.(Ser624Leu)" "12" "0000236036" "00007329" "55" "1871" "0" "1871" "0" "c.1871C>T" "r.(?)" "p.(Ser624Leu)" "12" "0000236037" "00007329" "99" "8455" "0" "8455" "0" "c.8455del" "r.(?)" "p.(Thr2819Glnfs*11)" "43" "0000236038" "00007329" "33" "4606" "0" "4606" "0" "c.4606C>G" "r.(?)" "p.(Gln1536Glu)" "26" "0000236039" "00007329" "55" "5038" "0" "5038" "0" "c.5038A>G" "r.(?)" "p.(Asn1680Asp)" "26" "0000236040" "00007329" "55" "9059" "0" "9059" "0" "c.9059T>C" "r.(?)" "p.(Ile3020Thr)" "43" "0000236041" "00007329" "55" "1418" "0" "1418" "0" "c.1418G>T" "r.(?)" "p.(Gly473Val)" "9" "0000236042" "00007329" "33" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Leu991Phe)" "19" "0000236043" "00007329" "99" "8388" "0" "8388" "0" "c.8388C>A" "r.(?)" "p.(Tyr2796*)" "43" "0000236044" "00007329" "55" "7187" "0" "7187" "0" "c.7187G>A" "r.(?)" "p.(Cys2396Ser)" "36" "0000236045" "00007329" "55" "2259" "1" "2259" "1" "c.2259+1G>A" "r.(?)" "p.?" "14i" "0000236046" "00007329" "99" "3024" "0" "3024" "0" "c.3024C>A" "r.(?)" "p.(Cys1008*)" "20" "0000236047" "00007329" "99" "2826" "0" "2827" "0" "c.2826_2827del" "r.(?)" "p.(Val944Glyfs*9)" "18" "0000236048" "00007329" "99" "2847" "-1" "2992" "1" "c.(2846+1_2847-1)_(2992+1_2993-1)del" "r.(2847_2992del)" "p.(Phe950Hisfs*4)" "18i_19i" "0000236049" "00007329" "99" "9142" "0" "9142" "0" "c.9142dup" "r.(?)" "p.(Val3048Glyfs*15)" "43" "0000236050" "00007329" "99" "2024" "-1" "2259" "1" "c.(2023+1_2024-1)_(2259+1_2260-1)del" "r.(?)" "p.(Gly675Glufs*9)" "12i_14i" "0000236051" "00007329" "55" "8465" "0" "8465" "0" "c.8465A>G" "r.(?)" "p.(Tyr2822Cys)" "43" "0000236052" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000236053" "00007329" "55" "9248" "0" "9248" "0" "c.9248G>A" "r.(?)" "p.(Gly3083Asp)" "43" "0000236054" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236055" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000236056" "00007329" "99" "7228" "1" "7228" "1" "c.7228+1G>A" "r.(?)" "p.?" "36i" "0000236057" "00007329" "99" "7228" "1" "7228" "1" "c.7228+1G>A" "r.(?)" "p.?" "36i" "0000236058" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236059" "00007329" "99" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000236060" "00007329" "77" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000236061" "00007329" "77" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000236062" "00007329" "99" "4936" "0" "4936" "0" "c.4936G>T" "r.(?)" "p.(Glu1646*)" "26" "0000236063" "00007329" "99" "6250" "0" "6250" "0" "c.6250C>T" "r.(?)" "p.(Gln2084*)" "31" "0000236064" "00007329" "99" "4936" "0" "4936" "0" "c.4936G>T" "r.(?)" "p.(Glu1646*)" "26" "0000236065" "00007329" "99" "6250" "0" "6250" "0" "c.6250C>T" "r.(?)" "p.(Gln2084*)" "31" "0000236066" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000236067" "00007329" "99" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000236068" "00007329" "99" "6571" "1" "6571" "1" "c.6571+1G>A" "r.spl?" "p.?" "32i" "0000236069" "00007329" "99" "2194" "0" "2194" "0" "c.2194C>T" "r.(?)" "p.(Gln732*)" "14" "0000236070" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236071" "00007329" "99" "8408" "0" "8408" "0" "c.8408dup" "r.(?)" "p.(Asn2803Lysfs*9)" "43" "0000236072" "00007329" "99" "932" "0" "932" "0" "c.932dup" "r.(?)" "p.(Asn311Lysfs*2)" "6" "0000236073" "00007329" "99" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "26" "0000236074" "00007329" "99" "3317" "0" "3317" "0" "c.3317del" "r.(?)" "p.(Pro1106Hisfs*57)" "22" "0000236075" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236076" "00007329" "99" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "4" "0000236077" "00007329" "99" "3226" "0" "3226" "0" "c.3226T>C" "r.(?)" "p.(Cys1076Arg)" "21" "0000236078" "00007329" "99" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "36" "0000236079" "00007329" "99" "9277" "0" "9278" "0" "c.9277_9278dup" "r.(?)" "p.(Arg3094Valfs*4)" "43" "0000236085" "00007329" "95" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.?" "28i" "0000236086" "00007329" "95" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.?" "28i" "0000236087" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236088" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236089" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236090" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236091" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236092" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236093" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236094" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236095" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236096" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236097" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236098" "00007329" "99" "910" "0" "910" "0" "c.910dup" "r.(?)" "p.(Trp304Leufs*9)" "6" "0000236099" "00007329" "99" "7723" "1" "7723" "1" "c.7723+1G>A" "r.(?)" "p.?" "39i" "0000236100" "00007329" "55" "604" "0" "604" "0" "c.604T>C" "r.(?)" "p.(Cys202Arg)" "4" "0000236101" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236102" "00007329" "99" "7055" "1" "7055" "1" "c.7055+1G>T" "r.(?)" "p.?" "35i" "0000236103" "00007329" "99" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "26" "0000236104" "00007329" "99" "-538" "0" "-448" "0" "c.-538_-448del" "r.(?)" "p.(=)" "1" "0000236105" "00007329" "99" "67" "0" "67" "0" "c.67del" "r.(?)" "p.(Thr23Hisfs*19)" "4" "0000236106" "00007329" "99" "162" "0" "162" "0" "c.162C>A" "r.(?)" "p.(Tyr54*)" "4" "0000236107" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236108" "00007329" "55" "-448" "5" "-448" "5" "c.-448+5G>A" "r.(?)" "p.?" "1i" "0000236109" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236110" "00007329" "55" "-448" "5" "-448" "5" "c.-448+5G>A" "r.(?)" "p.?" "1i" "0000236111" "00007329" "55" "9368" "0" "9368" "0" "c.9368A>C" "r.(?)" "p.(Asn3123Thr)" "43" "0000236112" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236113" "00007329" "55" "6577" "0" "6577" "0" "c.6577G>A" "r.(?)" "p.(Gly2193Arg)" "33" "0000236114" "00007329" "99" "9186" "0" "9187" "0" "c.9186_9187del" "r.(?)" "p.(Asn3062Lysfs*9)" "43" "0000236115" "00007329" "55" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "38" "0000236116" "00007329" "55" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "39" "0000236117" "00007329" "55" "7949" "0" "7949" "0" "c.7949C>T" "r.(?)" "p.(Ser2650Phe)" "41" "0000236118" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236119" "00007329" "99" "8150" "0" "8150" "0" "c.8150del" "r.(?)" "p.(Lys2717Argfs*24)" "42" "0000236120" "00007329" "77" "2510" "0" "2510" "0" "c.2510G>T" "r.(?)" "p.(Cys837Phe)" "16" "0000236121" "00007329" "99" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "42" "0000236122" "00007329" "99" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "41" "0000236123" "00007329" "99" "704" "0" "704" "0" "c.704G>A" "r.(?)" "p.(Trp235*)" "4" "0000236124" "00007329" "55" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "38" "0000236125" "00007329" "99" "8245" "0" "8245" "0" "c.8245dup" "r.(?)" "p.(Cys2749Leufs*7)" "43" "0000236126" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236127" "00007329" "99" "8392" "0" "8392" "0" "c.8392del" "r.(?)" "p.(Asp2798Ilefs*2)" "43" "0000236128" "00007329" "11" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000236129" "00007329" "55" "2644" "0" "2644" "0" "c.2644T>C" "r.(?)" "p.(Phe882Leu)" "17" "0000236130" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236131" "00007329" "99" "749" "-1" "1299" "1" "c.(748+1_749-1)_(1299+1_1300-1)del" "r.?" "p.?" "4i_8i" "0000236132" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "26" "0000236133" "00007329" "99" "2024" "-1" "3443" "1" "c.(2023+1_2024-1)_(3443+1_3444-1)del" "r.?" "p.?" "12i_22i" "0000236134" "00007329" "99" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Gln35*)" "4" "0000236135" "00007329" "99" "1499" "0" "1499" "0" "c.1499dup" "r.(?)" "p.(Tyr500*)" "10" "0000236136" "00007329" "99" "1161" "0" "1161" "0" "c.1161del" "r.(?)" "p.(Lys387Asnfs*34)" "7" "0000236137" "00007329" "50" "2138" "-1" "2259" "1" "c.(2137+1_2138-1)_(2259+1_2260-1)dup" "r.?" "p.?" "14" "0000236138" "00007329" "55" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "14" "0000236139" "00007329" "55" "6284" "0" "6284" "0" "c.6284C>T" "r.(?)" "p.(Pro2095Leu)" "31" "0000236140" "00007329" "99" "5167" "0" "5168" "0" "c.5167_5168del" "r.(?)" "p.(Leu1723Glyfs*6)" "26" "0000236141" "00007329" "50" "3244" "-1" "3443" "1" "c.(3243+1_3244-1)_(3443+1_3444-1)dup" "r.?" "p.?" "21i_22i" "0000236142" "00007329" "99" "5167" "0" "5168" "0" "c.5167_5168del" "r.(?)" "p.(Leu1723Glyfs*6)" "26" "0000236143" "00007329" "99" "6425" "-1" "6571" "1" "c.(6424+1_6425-1)_(6571+1_6572-1)del" "r.?" "p.?" "31i_32i" "0000236144" "00007329" "77" "1299" "5" "1299" "8" "c.1299+5_1299+8del" "r.spl?" "p.?" "8i" "0000236145" "00007329" "77" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000236146" "00007329" "55" "1185" "-3" "1185" "-3" "c.1185-3C>T" "r.(?)" "p.?" "7i" "0000236147" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000236148" "00007329" "99" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000236149" "00007329" "93" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Leu302Phe)" "6" "0000236150" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236151" "00007329" "99" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*3)" "8" "0000236152" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236153" "00007329" "99" "7376" "0" "7376" "0" "c.7376dup" "r.(?)" "p.(Asn2459Lysfs*2)" "37" "0000236154" "00007329" "99" "7055" "1" "7055" "1" "c.7055+1G>T" "r.(?)" "p.?" "35i" "0000236155" "00007329" "99" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000236156" "00007329" "99" "5330" "0" "5330" "0" "c.5330T>A" "r.(?)" "p.(Leu1777*)" "26" "0000236157" "00007329" "55" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "43" "0000236158" "00007329" "99" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "36" "0000236159" "00007329" "75" "6078" "0" "6078" "0" "c.6078G>T" "r.(?)" "p.(Gln2026His)" "29" "0000236160" "00007329" "95" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236161" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236162" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000236163" "00007329" "93" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Leu302Phe)" "6" "0000236164" "00007329" "77" "8860" "0" "8860" "0" "c.8860T>C" "r.(?)" "p.(Phe2954Leu)" "43" "0000236165" "00007329" "93" "3250" "0" "3250" "0" "c.3250A>C" "r.(?)" "p.(Thr1084Pro)" "22" "0000236166" "00007329" "55" "4402" "0" "4402" "0" "c.4402G>C" "r.(?)" "p.(Asp1468His)" "26" "0000236167" "00007329" "99" "3443" "1" "3443" "1" "c.3443+1G>T" "r.(?)" "p.?" "22i" "0000236168" "00007329" "99" "1750" "0" "1750" "0" "c.1750G>T" "r.(?)" "p.(Glu584*)" "11" "0000236169" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236170" "00007329" "99" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000236171" "00007329" "77" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000236172" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "26" "0000236173" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236174" "00007329" "77" "1299" "5" "1299" "8" "c.1299+5_1299+8del" "r.spl?" "p.?" "8i" "0000236175" "00007329" "55" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000236176" "00007329" "99" "4955" "0" "4955" "0" "c.4955C>G" "r.(?)" "p.(Ser1652*)" "26" "0000236177" "00007329" "55" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "43" "0000236178" "00007329" "99" "2024" "-1" "3443" "1" "c.(2023+1_2024-1)_(3443+1_3444-1)del" "r.?" "p.?" "12i_22i" "0000236179" "00007329" "99" "2308" "0" "2308" "0" "c.2308C>T" "r.(?)" "p.(Gln770*)" "15" "0000236180" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236181" "00007329" "99" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000236182" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236183" "00007329" "99" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000236184" "00007329" "99" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "36" "0000236185" "00007329" "99" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000236186" "00007329" "99" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "36" "0000236187" "00007329" "99" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000236188" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000236189" "00007329" "55" "1185" "-6" "1185" "-6" "c.1185-6T>G" "r.(?)" "p.(=)" "7i" "0000236190" "00007329" "55" "3695" "0" "3695" "0" "c.3695T>C" "r.(?)" "p.(Ile1232Thr)" "25" "0000236191" "00007329" "55" "7868" "0" "7868" "0" "c.7868G>A" "r.(?)" "p.(Gly2623Glu)" "40" "0000236192" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236193" "00007329" "55" "7811" "0" "7811" "0" "c.7811G>A" "r.(?)" "p.(Arg2604His)" "40" "0000236194" "00007329" "99" "5666" "0" "5666" "0" "c.5666del" "r.(?)" "p.(Tyr1889Leufs*6)" "27" "0000236195" "00007329" "99" "3562" "0" "3562" "0" "c.3562C>T" "r.(?)" "p.(Gln1188*)" "23" "0000236196" "00007329" "99" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000236197" "00007329" "55" "2041" "0" "2041" "0" "c.2041G>T" "r.(?)" "p.(Asp681Tyr)" "13" "0000236198" "00007329" "55" "7115" "0" "7115" "0" "c.7115T>A" "r.(?)" "p.(Phe2372Tyr)" "36" "0000236199" "00007329" "99" "522" "0" "522" "0" "c.522C>A" "r.(?)" "p.(Cys174*)" "4" "0000236200" "00007329" "99" "5283" "0" "5283" "0" "c.5283T>A" "r.(?)" "p.(Tyr1761*)" "26" "0000236201" "00007329" "99" "454" "0" "454" "0" "c.454dup" "r.(?)" "p.(Met152Asnfs*37)" "4" "0000236202" "00007329" "55" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Ala3021Pro)" "43" "0000236203" "00007329" "99" "9036" "0" "9036" "0" "c.9036del" "r.(?)" "p.(Leu3013Serfs*6)" "43" "0000236204" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236205" "00007329" "99" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794*)" "15" "0000236206" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236207" "00007329" "55" "1185" "-6" "1185" "-6" "c.1185-6T>G" "r.spl?" "p.(=)" "7i" "0000236208" "00007329" "99" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "36i" "0000236209" "00007329" "55" "1349" "0" "1349" "0" "c.1349A>C" "r.(?)" "p.(Asn450Thr)" "9" "0000236210" "00007329" "55" "3165" "-13" "3165" "-13" "c.3165-13T>C" "r.(?)" "p.(=)" "20i" "0000236211" "00007329" "55" "8255" "0" "8260" "0" "c.8255_8260del" "r.(?)" "p.(Leu2752_Asn2754delinsTyr)" "43" "0000236212" "00007329" "99" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000236213" "00007329" "99" "2024" "-1" "2259" "1" "c.(2023+1_2024-1)_(2259+1_2260-1)del" "r.?" "p.?" "12i_14i" "0000236214" "00007329" "99" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000236215" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236216" "00007329" "99" "6191" "1" "6191" "1" "c.6191+1G>A" "r.(?)" "p.?" "30i" "0000236217" "00007329" "99" "454" "0" "454" "0" "c.454dup" "r.(?)" "p.(Met152Asnfs*37)" "4" "0000236218" "00007329" "55" "9019" "0" "9019" "0" "c.9019G>T" "r.(?)" "p.(Asp3007Tyr)" "43" "0000236219" "00007329" "99" "3890" "0" "3890" "0" "c.3890del" "r.(?)" "p.(Thr1297Lysfs*17)" "26" "0000236220" "00007329" "99" "7228" "1" "7228" "1" "c.7228+1G>A" "r.(?)" "p.?" "36i" "0000236221" "00007329" "55" "2953" "0" "2961" "0" "c.2953_2961del" "r.(?)" "p.(Thr985_Gly987del)" "19" "0000236222" "00007329" "99" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000236223" "00007329" "55" "865" "0" "865" "0" "c.865C>G" "r.(?)" "p.(Pro289Ala)" "6" "0000236224" "00007329" "99" "8893" "0" "8893" "0" "c.8893del" "r.(?)" "p.(Val2944Trpfs*31)" "43" "0000236225" "00007329" "55" "2023" "0" "2023" "0" "c.2023G>C" "r.(?)" "p.(Gly675Arg)" "12" "0000236226" "00007329" "55" "281" "0" "281" "0" "c.281C>A" "r.(?)" "p.(Pro94Gln)" "4" "0000236227" "00007329" "99" "6725" "1" "6725" "1" "c.6725+1G>A" "r.(?)" "p.?" "33i" "0000236228" "00007329" "55" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000236229" "00007329" "55" "4748" "0" "4748" "0" "c.4748A>G" "r.(?)" "p.Tyr1583Cys" "26" "0000236230" "00007329" "55" "296" "0" "296" "0" "c.296C>T" "r.(?)" "p.Pro99Leu" "4" "0000236231" "00007329" "99" "522" "0" "522" "0" "c.522C>A" "r.(?)" "p.(Cys174*)" "4" "0000236232" "00007329" "99" "5283" "0" "5283" "0" "c.5283T>A" "r.(?)" "p.(Tyr1761*)" "26" "0000236233" "00007329" "99" "6976" "0" "6976" "0" "c.6976C>T" "r.(?)" "p.(Arg2326*)" "35" "0000236234" "00007329" "99" "1376" "0" "1376" "0" "c.1376del" "r.(?)" "p.(Cys459Serfs*56)" "9" "0000236235" "00007329" "99" "1376" "0" "1376" "0" "c.1376del" "r.(?)" "p.(Cys459Serfs*56)" "9" "0000236236" "00007329" "99" "5098" "0" "5098" "0" "c.5098A>T" "r.(?)" "p.(Lys1700*)" "26" "0000236237" "00007329" "10" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "26" "0000236238" "00007329" "10" "9202" "0" "9202" "0" "c.9202G>C" "r.(?)" "p.(Glu3068Gln)" "43" "0000236242" "00007329" "10" "7442" "0" "7442" "0" "c.7442G>A" "r.(?)" "p.(Gly2481Asp)" "38" "0000236243" "00007329" "10" "8728" "0" "8728" "0" "c.8728T>G" "r.(?)" "p.(Cys2910Gly)" "43" "0000236245" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236246" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "26" "0000236247" "00007329" "99" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000236248" "00007329" "55" "5093" "0" "5093" "0" "c.5093T>C" "r.(?)" "p.(Ile1698Thr)" "26" "0000236341" "00007329" "50" "9177" "0" "9177" "0" "c.9177C>G" "r.(?)" "p.(Tyr3059*)" "43" "0000236342" "00007329" "50" "9177" "0" "9177" "0" "c.9177C>G" "r.(?)" "p.(Tyr3059*)" "43" "0000236344" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236346" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236347" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236348" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236349" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236350" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236351" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236352" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236353" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000236354" "00007329" "50" "410" "0" "424" "0" "c.410_424del" "r.(?)" "p.(Asn137_Leu141del)" "4" "0000246499" "00007329" "10" "6079" "-6" "6079" "-6" "c.6079-6T>C" "r.(=)" "p.(=)" "" "0000246515" "00007329" "30" "8860" "0" "8860" "0" "c.8860T>C" "r.(?)" "p.(Phe2954Leu)" "" "0000246516" "00007329" "30" "5615" "0" "5615" "0" "c.5615T>C" "r.(?)" "p.(Ile1872Thr)" "" "0000246518" "00007329" "30" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "" "0000246525" "00007329" "70" "3164" "2" "3164" "2" "c.3164+2T>C" "r.spl?" "p.?" "" "0000246541" "00007329" "50" "939" "0" "939" "0" "c.939T>G" "r.(?)" "p.(Ser313Arg)" "" "0000247993" "00007329" "10" "4256" "0" "4256" "0" "c.4256T>C" "r.(?)" "p.(Leu1419Ser)" "" "0000247995" "00007329" "10" "2555" "0" "2555" "0" "c.2555T>C" "r.(?)" "p.(Leu852Pro)" "" "0000253254" "00007329" "10" "4256" "0" "4256" "0" "c.4256T>C" "r.(?)" "p.(Leu1419Ser)" "" "0000253256" "00007329" "10" "2555" "0" "2555" "0" "c.2555T>C" "r.(?)" "p.(Leu852Pro)" "" "0000254497" "00007329" "30" "4352" "0" "4352" "0" "c.4352T>C" "r.(?)" "p.(Ile1451Thr)" "" "0000254662" "00007329" "30" "5329" "0" "5329" "0" "c.5329T>C" "r.(?)" "p.(Leu1777=)" "" "0000255066" "00007329" "30" "7737" "0" "7737" "0" "c.7737T>C" "r.(?)" "p.(Thr2579=)" "" "0000255239" "00007329" "30" "3568" "5" "3568" "5" "c.3568+5T>C" "r.spl?" "p.?" "" "0000255240" "00007329" "30" "-333" "12351" "-333" "12351" "c.-333+12351T>C" "r.(=)" "p.(=)" "" "0000265926" "00007329" "50" "1145" "0" "1145" "0" "c.1145A>T" "r.(?)" "p.(Asn382Ile)" "" "0000265927" "00007329" "10" "1600" "-10" "1600" "-10" "c.1600-10G>A" "r.(=)" "p.(=)" "" "0000265928" "00007329" "10" "1638" "0" "1638" "0" "c.1638C>T" "r.(?)" "p.(Asp546=)" "" "0000265929" "00007329" "90" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558Ter)" "" "0000265930" "00007329" "30" "16" "0" "16" "0" "c.16A>G" "r.(?)" "p.(Ile6Val)" "" "0000265931" "00007329" "50" "1765" "0" "1765" "0" "c.1765A>G" "r.(?)" "p.(Arg589Gly)" "" "0000265932" "00007329" "50" "1831" "0" "1831" "0" "c.1831A>T" "r.(?)" "p.(Asn611Tyr)" "" "0000265933" "00007329" "10" "1899" "0" "1899" "0" "c.1899A>G" "r.(?)" "p.(Gln633=)" "" "0000265934" "00007329" "10" "1950" "0" "1950" "0" "c.1950G>A" "r.(?)" "p.(Ala650=)" "" "0000265935" "00007329" "50" "2000" "0" "2000" "0" "c.2000G>A" "r.(?)" "p.(Arg667His)" "" "0000265936" "00007329" "10" "2023" "15" "2023" "15" "c.2023+15dup" "r.(=)" "p.(=)" "" "0000265937" "00007329" "10" "2023" "14" "2023" "15" "c.2023+14_2023+15dup" "r.(=)" "p.(=)" "" "0000265941" "00007329" "90" "2308" "0" "2308" "0" "c.2308C>T" "r.(?)" "p.(Gln770Ter)" "" "0000265942" "00007329" "30" "2309" "0" "2309" "0" "c.2309A>C" "r.(?)" "p.(Gln770Pro)" "" "0000265943" "00007329" "30" "2613" "0" "2613" "0" "c.2613C>T" "r.(?)" "p.(Asp871=)" "" "0000265944" "00007329" "30" "2813" "0" "2813" "0" "c.2813A>G" "r.(?)" "p.(Lys938Arg)" "" "0000265945" "00007329" "50" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Leu991Phe)" "" "0000265946" "00007329" "10" "334" "0" "334" "0" "c.334G>A" "r.(?)" "p.(Val112Ile)" "" "0000265947" "00007329" "10" "334" "0" "334" "0" "c.334G>C" "r.(?)" "p.(Val112Leu)" "" "0000265948" "00007329" "10" "3561" "0" "3561" "0" "c.3561C>T" "r.(?)" "p.(Cys1187=)" "" "0000265949" "00007329" "90" "3684" "1" "3684" "1" "c.3684+1G>A" "r.spl?" "p.?" "" "0000265950" "00007329" "30" "4067" "0" "4067" "0" "c.4067G>A" "r.(?)" "p.(Arg1356His)" "" "0000265951" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451ProfsTer3)" "" "0000265952" "00007329" "30" "4544" "0" "4544" "0" "c.4544G>A" "r.(?)" "p.(Arg1515Gln)" "" "0000265954" "00007329" "10" "4554" "0" "4554" "0" "c.4554A>C" "r.(?)" "p.(Thr1518=)" "" "0000265955" "00007329" "10" "4985" "0" "4985" "0" "c.4985A>T" "r.(?)" "p.(Asp1662Val)" "" "0000265956" "00007329" "50" "5110" "0" "5110" "0" "c.5110A>T" "r.(?)" "p.(Ile1704Leu)" "" "0000265957" "00007329" "50" "5356" "0" "5356" "0" "c.5356G>A" "r.(?)" "p.(Glu1786Lys)" "" "0000265958" "00007329" "30" "5743" "0" "5743" "0" "c.5743A>G" "r.(?)" "p.(Ser1915Gly)" "" "0000265959" "00007329" "10" "6079" "-4" "6079" "-3" "c.6079-4_6079-3del" "r.spl?" "p.?" "" "0000265960" "00007329" "10" "6079" "-6" "6079" "-3" "c.6079-6_6079-3del" "r.spl?" "p.?" "" "0000265964" "00007329" "10" "7284" "0" "7284" "0" "c.7284A>C" "r.(?)" "p.(Ser2428=)" "" "0000265965" "00007329" "10" "7384" "0" "7384" "0" "c.7384A>G" "r.(?)" "p.(Ile2462Val)" "" "0000265966" "00007329" "10" "7578" "18" "7578" "18" "c.7578+18C>T" "r.(=)" "p.(=)" "" "0000265968" "00007329" "10" "7608" "0" "7608" "0" "c.7608C>T" "r.(?)" "p.(Ile2536=)" "" "0000265969" "00007329" "10" "7697" "0" "7697" "0" "c.7697G>A" "r.(?)" "p.(Gly2566Glu)" "" "0000265970" "00007329" "70" "8133" "0" "8137" "0" "c.8133_8137del" "r.(?)" "p.(Phe2712CysfsTer33)" "" "0000265972" "00007329" "50" "9389" "0" "9391" "0" "c.9389_9391del" "r.(?)" "p.(Glu3130del)" "" "0000265973" "00007329" "10" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "" "0000265974" "00007329" "50" "988" "0" "988" "0" "c.988G>A" "r.(?)" "p.(Glu330Lys)" "" "0000267933" "00007329" "10" "1300" "-3" "1300" "-3" "c.1300-3C>T" "r.spl?" "p.?" "" "0000267934" "00007329" "10" "1712" "0" "1712" "0" "c.1712A>G" "r.(?)" "p.(Gln571Arg)" "" "0000267935" "00007329" "10" "1809" "0" "1809" "0" "c.1809C>T" "r.(?)" "p.(Val603=)" "" "0000267936" "00007329" "10" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Gly631Ser)" "" "0000267937" "00007329" "10" "2023" "15" "2023" "15" "c.2023+15dup" "r.(=)" "p.(=)" "" "0000267938" "00007329" "10" "5705" "0" "5705" "0" "c.5705A>T" "r.(?)" "p.(Asn1902Ile)" "" "0000267939" "00007329" "10" "6079" "-4" "6079" "-3" "c.6079-4_6079-3del" "r.spl?" "p.?" "" "0000268945" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "" "0000276469" "00007329" "30" "-447" "-9018" "-447" "-9018" "c.-447-9018A>G" "r.(=)" "p.(=)" "" "0000276470" "00007329" "10" "1300" "-3" "1300" "-3" "c.1300-3C>T" "r.spl?" "p.?" "" "0000276471" "00007329" "90" "1376" "0" "1376" "0" "c.1376del" "r.(?)" "p.(Cys459SerfsTer56)" "" "0000276472" "00007329" "30" "1417" "0" "1417" "0" "c.1417G>T" "r.(?)" "p.(Gly473Cys)" "" "0000276473" "00007329" "30" "1599" "96" "1599" "96" "c.1599+96A>C" "r.(=)" "p.(=)" "" "0000276474" "00007329" "90" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558Ter)" "" "0000276475" "00007329" "30" "1712" "0" "1712" "0" "c.1712A>G" "r.(?)" "p.(Gln571Arg)" "" "0000276476" "00007329" "30" "1809" "0" "1809" "0" "c.1809C>T" "r.(?)" "p.(Val603=)" "" "0000276477" "00007329" "10" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Gly631Ser)" "" "0000276478" "00007329" "30" "1985" "0" "1985" "0" "c.1985G>T" "r.(?)" "p.(Arg662Met)" "" "0000276479" "00007329" "30" "2451" "0" "2451" "0" "c.2451A>G" "r.(?)" "p.(Pro817=)" "" "0000276480" "00007329" "10" "281" "0" "281" "0" "c.281C>A" "r.(?)" "p.(Pro94Gln)" "" "0000276481" "00007329" "50" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Leu991Phe)" "" "0000276482" "00007329" "50" "3250" "0" "3250" "0" "c.3250A>G" "r.(?)" "p.(Thr1084Ala)" "" "0000276484" "00007329" "30" "334" "0" "334" "0" "c.334G>A" "r.(?)" "p.(Val112Ile)" "" "0000276485" "00007329" "10" "359" "0" "359" "0" "c.359C>T" "r.(?)" "p.(Thr120Met)" "" "0000276486" "00007329" "10" "3787" "0" "3787" "0" "c.3787A>G" "r.(?)" "p.(Ile1263Val)" "" "0000276487" "00007329" "10" "3906" "0" "3906" "0" "c.3906C>T" "r.(?)" "p.(His1302=)" "" "0000276488" "00007329" "90" "3951" "0" "3952" "0" "c.3951_3952del" "r.(?)" "p.(Pro1318LeufsTer13)" "" "0000276489" "00007329" "10" "3973" "0" "3973" "0" "c.3973C>G" "r.(?)" "p.(Gln1325Glu)" "" "0000276490" "00007329" "10" "4026" "0" "4026" "0" "c.4026C>T" "r.(?)" "p.(Ser1342=)" "" "0000276491" "00007329" "90" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349Ter)" "" "0000276492" "00007329" "30" "4081" "0" "4081" "0" "c.4081A>G" "r.(?)" "p.(Ile1361Val)" "" "0000276493" "00007329" "10" "4093" "0" "4093" "0" "c.4093A>G" "r.(?)" "p.(Lys1365Glu)" "" "0000276494" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451ProfsTer3)" "" "0000276495" "00007329" "30" "4543" "0" "4543" "0" "c.4543C>T" "r.(?)" "p.(Arg1515Trp)" "" "0000276496" "00007329" "30" "4549" "0" "4549" "0" "c.4549A>G" "r.(?)" "p.(Ser1517Gly)" "" "0000276497" "00007329" "30" "4554" "0" "4554" "0" "c.4554A>C" "r.(?)" "p.(Thr1518=)" "" "0000276498" "00007329" "10" "4593" "0" "4593" "0" "c.4593G>A" "r.(?)" "p.(Glu1531=)" "" "0000276499" "00007329" "30" "4727" "0" "4727" "0" "c.4727A>C" "r.(?)" "p.(His1576Pro)" "" "0000276500" "00007329" "30" "4985" "0" "4985" "0" "c.4985A>T" "r.(?)" "p.(Asp1662Val)" "" "0000276501" "00007329" "30" "4991" "0" "4991" "0" "c.4991C>A" "r.(?)" "p.(Thr1664Asn)" "" "0000276502" "00007329" "30" "4991" "0" "4991" "0" "c.4991C>T" "r.(?)" "p.(Thr1664Ile)" "" "0000276503" "00007329" "90" "5319" "0" "5342" "0" "c.5319_5342del" "r.(?)" "p.(Asn1773_Val1781delinsLys)" "" "0000276504" "00007329" "10" "5617" "0" "5617" "0" "c.5617C>G" "r.(?)" "p.(Leu1873Val)" "" "0000276505" "00007329" "90" "5928" "-3" "5928" "-1" "c.5928-3_5928-1del" "r.spl?" "p.?" "" "0000276506" "00007329" "90" "6079" "-3" "6079" "-2" "c.6079-3_6079-2del" "r.spl?" "p.?" "" "0000276507" "00007329" "10" "6079" "-4" "6079" "-3" "c.6079-4_6079-3del" "r.spl?" "p.?" "" "0000276508" "00007329" "70" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "" "0000276509" "00007329" "50" "7666" "0" "7666" "0" "c.7666A>G" "r.(?)" "p.(Ser2556Gly)" "" "0000276510" "00007329" "50" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "" "0000276511" "00007329" "50" "9235" "0" "9235" "0" "c.9235C>G" "r.(?)" "p.(Leu3079Val)" "" "0000276512" "00007329" "30" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "" "0000331082" "00007329" "50" "8861" "0" "8861" "0" "c.8861T>A" "r.(?)" "p.(Phe2954Tyr)" "" "0000331083" "00007329" "50" "6079" "-6" "6079" "-3" "c.6079-6_6079-3del" "r.spl?" "p.?" "" "0000331085" "00007329" "50" "6079" "-4" "6079" "-3" "c.6079-4_6079-3del" "r.spl?" "p.?" "" "0000331086" "00007329" "50" "4321" "0" "4321" "0" "c.4321C>T" "r.(?)" "p.(Gln1441Ter)" "" "0000338578" "00007329" "10" "3877" "18" "3877" "22" "c.3877+18_3877+22del" "r.(=)" "p.(=)" "" "0000338579" "00007329" "10" "3444" "-5" "3444" "-5" "c.3444-5C>T" "r.spl?" "p.?" "" "0000338584" "00007329" "10" "2024" "-14" "2024" "-14" "c.2024-14C>T" "r.(=)" "p.(=)" "" "0000338590" "00007329" "10" "1300" "-3" "1300" "-3" "c.1300-3C>T" "r.spl?" "p.?" "" "0000338597" "00007329" "10" "-500" "0" "-500" "0" "c.-500A>G" "r.(?)" "p.(=)" "" "0000340358" "00007329" "10" "4593" "0" "4593" "0" "c.4593G>A" "r.(?)" "p.(Glu1531=)" "" "0000340359" "00007329" "10" "4026" "0" "4026" "0" "c.4026C>T" "r.(?)" "p.(Ser1342=)" "" "0000340360" "00007329" "10" "3936" "0" "3936" "0" "c.3936A>G" "r.(?)" "p.(Thr1312=)" "" "0000340361" "00007329" "10" "3906" "0" "3906" "0" "c.3906C>T" "r.(?)" "p.(His1302=)" "" "0000340366" "00007329" "10" "1809" "0" "1809" "0" "c.1809C>T" "r.(?)" "p.(Val603=)" "" "0000340367" "00007329" "10" "1146" "0" "1146" "0" "c.1146T>C" "r.(?)" "p.(Asn382=)" "" "0000340951" "00007329" "30" "5601" "0" "5601" "0" "c.5601T>C" "r.(?)" "p.(Ser1867=)" "" "0000341359" "00007329" "50" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Ala3021Pro)" "" "0000341883" "00007329" "90" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374Ter)" "" "0000341961" "00007329" "10" "4543" "0" "4543" "0" "c.4543C>T" "r.(?)" "p.(Arg1515Trp)" "" "0000342333" "00007329" "90" "6976" "0" "6976" "0" "c.6976C>T" "r.(?)" "p.(Arg2326Ter)" "" "0000342334" "00007329" "10" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0000343370" "00007329" "90" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794Ter)" "" "0000343637" "00007329" "10" "5705" "0" "5705" "0" "c.5705A>T" "r.(?)" "p.(Asn1902Ile)" "" "0000343761" "00007329" "50" "1349" "0" "1349" "0" "c.1349A>C" "r.(?)" "p.(Asn450Thr)" "" "0000344175" "00007329" "50" "2041" "0" "2041" "0" "c.2041G>T" "r.(?)" "p.(Asp681Tyr)" "" "0000344289" "00007329" "90" "522" "0" "522" "0" "c.522C>A" "r.(?)" "p.(Cys174Ter)" "" "0000344379" "00007329" "90" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385Ter)" "" "0000344425" "00007329" "50" "1660" "0" "1660" "0" "c.1660T>A" "r.(?)" "p.(Cys554Ser)" "" "0000344513" "00007329" "90" "3562" "0" "3562" "0" "c.3562C>T" "r.(?)" "p.(Gln1188Ter)" "" "0000344540" "00007329" "10" "3973" "0" "3973" "0" "c.3973C>G" "r.(?)" "p.(Gln1325Glu)" "" "0000344677" "00007329" "90" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267GlufsTer15)" "" "0000344782" "00007329" "90" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Gln35Ter)" "" "0000344905" "00007329" "10" "1712" "0" "1712" "0" "c.1712A>G" "r.(?)" "p.(Gln571Arg)" "" "0000344961" "00007329" "90" "2308" "0" "2308" "0" "c.2308C>T" "r.(?)" "p.(Gln770Ter)" "" "0000345184" "00007329" "50" "5240" "0" "5240" "0" "c.5240A>G" "r.(?)" "p.(Glu1747Gly)" "" "0000345505" "00007329" "10" "1922" "0" "1922" "0" "c.1922A>T" "r.(?)" "p.(Glu641Val)" "" "0000345838" "00007329" "90" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "" "0000346371" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "" "0000346565" "00007329" "10" "3787" "0" "3787" "0" "c.3787A>G" "r.(?)" "p.(Ile1263Val)" "" "0000346573" "00007329" "10" "4081" "0" "4081" "0" "c.4081A>G" "r.(?)" "p.(Ile1361Val)" "" "0000346580" "00007329" "10" "4352" "0" "4352" "0" "c.4352T>C" "r.(?)" "p.(Ile1451Thr)" "" "0000346639" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239SerfsTer17)" "" "0000346894" "00007329" "10" "4256" "0" "4256" "0" "c.4256T>C" "r.(?)" "p.(Leu1419Ser)" "" "0000346944" "00007329" "90" "5167" "0" "5168" "0" "c.5167_5168del" "r.(?)" "p.(Leu1723GlyfsTer6)" "" "0000346950" "00007329" "10" "5244" "0" "5244" "0" "c.5244A>C" "r.(?)" "p.(Leu1748Phe)" "" "0000346960" "00007329" "10" "5617" "0" "5617" "0" "c.5617C>G" "r.(?)" "p.(Leu1873Val)" "" "0000346967" "00007329" "90" "5786" "0" "5786" "0" "c.5786del" "r.(?)" "p.(Leu1929Ter)" "" "0000347061" "00007329" "50" "8255" "0" "8260" "0" "c.8255_8260del" "r.(?)" "p.(Leu2752_Asn2754delinsTyr)" "" "0000347089" "00007329" "50" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Leu302Phe)" "" "0000347324" "00007329" "10" "2555" "0" "2555" "0" "c.2555T>C" "r.(?)" "p.(Leu852Pro)" "" "0000347751" "00007329" "90" "454" "0" "454" "0" "c.454dup" "r.(?)" "p.(Met152AsnfsTer37)" "" "0000347820" "00007329" "30" "1064" "0" "1064" "0" "c.1064T>A" "r.(?)" "p.(Met355Lys)" "" "0000347997" "00007329" "50" "7115" "0" "7115" "0" "c.7115T>A" "r.(?)" "p.(Phe2372Tyr)" "" "0000348007" "00007329" "30" "7558" "0" "7558" "0" "c.7558T>C" "r.(?)" "p.(Phe2520Leu)" "" "0000348223" "00007329" "30" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "" "0000348263" "00007329" "50" "5941" "0" "5941" "0" "c.5941C>T" "r.(?)" "p.(Pro1981Ser)" "" "0000348632" "00007329" "50" "296" "0" "296" "0" "c.296C>T" "r.(?)" "p.(Pro99Leu)" "" "0000348735" "00007329" "10" "4549" "0" "4549" "0" "c.4549A>G" "r.(?)" "p.(Ser1517Gly)" "" "0000348764" "00007329" "90" "4955" "0" "4955" "0" "c.4955C>G" "r.(?)" "p.(Ser1652Ter)" "" "0000348871" "00007329" "10" "7666" "0" "7666" "0" "c.7666A>T" "r.(?)" "p.(Ser2556Cys)" "" "0000349258" "00007329" "10" "359" "0" "359" "0" "c.359C>T" "r.(?)" "p.(Thr120Met)" "" "0000349750" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640Ter)" "" "0000349937" "00007329" "50" "4748" "0" "4748" "0" "c.4748A>G" "r.(?)" "p.(Tyr1583Cys)" "" "0000349954" "00007329" "90" "5283" "0" "5283" "0" "c.5283T>A" "r.(?)" "p.(Tyr1761Ter)" "" "0000349962" "00007329" "90" "5666" "0" "5666" "0" "c.5666del" "r.(?)" "p.(Tyr1889LeufsTer6)" "" "0000349996" "00007329" "90" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365Ter)" "" "0000350036" "00007329" "90" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135Ter)" "" "0000351317" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl?" "p.?" "" "0000351326" "00007329" "50" "3165" "-13" "3165" "-13" "c.3165-13T>C" "r.(=)" "p.(=)" "" "0000351330" "00007329" "50" "1185" "-6" "1185" "-6" "c.1185-6T>G" "r.(=)" "p.(=)" "" "0000358103" "00007329" "90" "403" "0" "423" "0" "c.403_423delinsCTTTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000358247" "00007329" "90" "9223" "0" "9232" "0" "c.9223_9232del" "r.(?)" "p.(Asn3075Leufs*2)" "44" "0000358248" "00007329" "90" "8168" "0" "8168" "0" "c.8168del" "r.(?)" "p.(Gln2723Argfs*18)" "" "0000358249" "00007329" "90" "8155" "0" "8156" "0" "c.8155_8156del" "r.(?)" "p.(His2719Tyrfs*27)" "" "0000358250" "00007329" "90" "8105" "0" "8105" "0" "c.8105del" "r.(?)" "p.(Asn2702Metfs*39)" "" "0000358251" "00007329" "90" "6976" "0" "6976" "0" "c.6976C>T" "r.(?)" "p.(Arg2326*)" "35" "0000358252" "00007329" "90" "5927" "9412" "6078" "38716" "c.5927+9412_6078+38716del" "r.?" "p.?" "28i_29i" "0000358253" "00007329" "90" "4361" "0" "4362" "0" "c.4361_4362delinsAG" "r.(?)" "p.(Ser1454*)" "26" "0000358254" "00007329" "70" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "11" "0000358255" "00007329" "90" "1308" "0" "1308" "0" "c.1308C>A" "r.(?)" "p.(Cys436*)" "9" "0000358256" "00007329" "90" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*2)" "8" "0000358257" "00007329" "90" "403" "0" "423" "0" "c.403_423delinsCTTTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000358437" "00007329" "90" "403" "0" "423" "0" "c.403_423delinsCTTTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000358438" "00007329" "90" "1561" "0" "1563" "0" "c.1561_1563del" "r.(?)" "p.(Asn521del)" "10" "0000358439" "00007329" "90" "403" "0" "423" "0" "c.403_423delinsCTTTT" "r.(?)" "p.(Thr135Leufs*26)" "4" "0000405049" "00007329" "00" "5644" "1565" "5644" "1565" "c.5644+1565C>T" "r.(=)" "p.(=)" "" "0000438550" "00007329" "90" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794*)" "" "0000438551" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000476523" "00007329" "50" "9414" "0" "9414" "0" "c.9414T>G" "r.(?)" "p.(Asp3138Glu)" "" "0000476524" "00007329" "90" "9302" "0" "9303" "0" "c.9302_9303del" "r.(?)" "p.(Gln3101Argfs*4)" "" "0000476525" "00007329" "90" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "" "0000476526" "00007329" "90" "9186" "0" "9187" "0" "c.9186_9187del" "r.(?)" "p.(Asn3062Lysfs*9)" "" "0000476527" "00007329" "50" "9115" "0" "9115" "0" "c.9115T>C" "r.(?)" "p.(Phe3039Leu)" "" "0000476528" "00007329" "90" "9059" "0" "9059" "0" "c.9059T>C" "r.(?)" "p.(Ile3020Thr)" "" "0000476529" "00007329" "90" "8869" "0" "8869" "0" "c.8869del" "r.(?)" "p.(Ala2957Glnfs*18)" "" "0000476530" "00007329" "90" "8860" "0" "8860" "0" "c.8860T>C" "r.(?)" "p.(Phe2954Leu)" "" "0000476531" "00007329" "90" "8858" "0" "8858" "0" "c.8858C>A" "r.(?)" "p.(Ser2953*)" "" "0000476532" "00007329" "90" "8812" "0" "8812" "0" "c.8812C>A" "r.(?)" "p.(Leu2938Met)" "" "0000476533" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000476534" "00007329" "90" "8793" "0" "8796" "0" "c.8793_8796del" "r.(?)" "p.(Gln2931Hisfs*43)" "" "0000476535" "00007329" "90" "8692" "0" "8692" "0" "c.8692del" "r.(?)" "p.(Ser2898Leufs*20)" "" "0000476536" "00007329" "50" "8633" "0" "8633" "0" "c.8633C>G" "r.(?)" "p.(Ala2878Gly)" "" "0000476537" "00007329" "90" "8545" "0" "8545" "0" "c.8545C>T" "r.(?)" "p.(Arg2849*)" "" "0000476538" "00007329" "50" "8469" "0" "8469" "0" "c.8469T>G" "r.(?)" "p.(Ile2823Met)" "" "0000476539" "00007329" "50" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "" "0000476540" "00007329" "50" "8411" "0" "8411" "0" "c.8411T>A" "r.(?)" "p.(Val2804Glu)" "" "0000476541" "00007329" "90" "8299" "0" "8302" "0" "c.8299_8302del" "r.(?)" "p.(Thr2767Serfs*3)" "" "0000476542" "00007329" "50" "8278" "0" "8278" "0" "c.8278C>T" "r.(?)" "p.(Arg2760Cys)" "" "0000476543" "00007329" "90" "8268" "0" "8272" "0" "c.8268_8272del" "r.(?)" "p.(Val2757Thrfs*53)" "" "0000476544" "00007329" "90" "8244" "0" "8244" "0" "c.8244dup" "r.(?)" "p.(Cys2749Metfs*7)" "" "0000476545" "00007329" "90" "8236" "0" "8236" "0" "c.8236G>C" "r.(?)" "p.(Asp2746His)" "" "0000476546" "00007329" "90" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "" "0000476547" "00007329" "50" "8182" "0" "8182" "0" "c.8182G>A" "r.(?)" "p.(Ala2728Thr)" "" "0000476548" "00007329" "90" "8143" "0" "8143" "0" "c.8143C>T" "r.(?)" "p.(Arg2715*)" "" "0000476549" "00007329" "90" "8133" "0" "8137" "0" "c.8133_8137del" "r.(?)" "p.(Phe2712Cysfs*33)" "" "0000476550" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "" "0000476551" "00007329" "50" "7873" "0" "7873" "0" "c.7873T>G" "r.(?)" "p.(Cys2625Gly)" "" "0000476552" "00007329" "90" "7822" "0" "7822" "0" "c.7822C>T" "r.(?)" "p.(Gln2608*)" "" "0000476553" "00007329" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Cys)" "" "0000476554" "00007329" "50" "7726" "0" "7726" "0" "c.7726T>C" "r.(?)" "p.(Cys2576Arg)" "" "0000476555" "00007329" "90" "7665" "0" "7666" "0" "c.7665_7666del" "r.(?)" "p.(Tyr2555*)" "" "0000476556" "00007329" "10" "7666" "0" "7666" "0" "c.7666A>T" "r.(?)" "p.(Ser2556Cys)" "" "0000476557" "00007329" "50" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000476558" "00007329" "90" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000476559" "00007329" "50" "7454" "0" "7454" "0" "c.7454G>A" "r.(?)" "p.(Gly2485Asp)" "" "0000476560" "00007329" "50" "7451" "0" "7451" "0" "c.7451A>T" "r.(?)" "p.(Asn2484Ile)" "" "0000476561" "00007329" "50" "7394" "0" "7394" "0" "c.7394C>G" "r.(?)" "p.(Thr2465Ser)" "" "0000476562" "00007329" "50" "7114" "0" "7114" "0" "c.7114T>C" "r.(?)" "p.(Phe2372Leu)" "" "0000476563" "00007329" "50" "7065" "0" "7065" "0" "c.7065A>C" "r.(?)" "p.(Glu2355Asp)" "" "0000476564" "00007329" "90" "7049" "0" "7049" "0" "c.7049del" "r.(?)" "p.(Cys2350Serfs*97)" "" "0000476565" "00007329" "50" "7028" "0" "7028" "0" "c.7028T>A" "r.(?)" "p.(Leu2343Gln)" "" "0000476566" "00007329" "10" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0000476567" "00007329" "50" "6976" "0" "6976" "0" "c.6976C>T" "r.(?)" "p.(Arg2326*)" "" "0000476568" "00007329" "50" "6859" "0" "6859" "0" "c.6859G>A" "r.(?)" "p.(Gly2287Ser)" "" "0000476569" "00007329" "90" "6715" "0" "6715" "0" "c.6715del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000476570" "00007329" "50" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000476571" "00007329" "90" "6562" "0" "6562" "0" "c.6562A>G" "r.(?)" "p.(Ile2188Val)" "" "0000476572" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000476573" "00007329" "50" "6410" "0" "6410" "0" "c.6410G>A" "r.(?)" "p.(Arg2137His)" "" "0000476574" "00007329" "50" "6382" "0" "6382" "0" "c.6382T>C" "r.(?)" "p.(Cys2128Arg)" "" "0000476575" "00007329" "50" "6109" "0" "6109" "0" "c.6109T>C" "r.(?)" "p.(Cys2037Arg)" "" "0000476576" "00007329" "50" "6026" "0" "6026" "0" "c.6026A>C" "r.(?)" "p.(Lys2009Thr)" "" "0000476577" "00007329" "90" "5836" "-1" "5836" "-1" "c.5836-1G>C" "r.spl?" "p.?" "" "0000476578" "00007329" "10" "5705" "0" "5705" "0" "c.5705A>T" "r.(?)" "p.(Asn1902Ile)" "" "0000476579" "00007329" "10" "5617" "0" "5617" "0" "c.5617C>G" "r.(?)" "p.(Leu1873Val)" "" "0000476580" "00007329" "10" "5244" "0" "5244" "0" "c.5244A>C" "r.(?)" "p.(Leu1748Phe)" "" "0000476581" "00007329" "10" "4985" "0" "4985" "0" "c.4985A>T" "r.(?)" "p.(Asp1662Val)" "" "0000476582" "00007329" "90" "4958" "0" "4958" "0" "c.4958dup" "r.(?)" "p.(Ser1653Argfs*2)" "" "0000476583" "00007329" "90" "4897" "0" "4897" "0" "c.4897A>G" "r.(?)" "p.(Lys1633Glu)" "" "0000476584" "00007329" "50" "4625" "0" "4625" "0" "c.4625A>G" "r.(?)" "p.(Lys1542Arg)" "" "0000476585" "00007329" "90" "4558" "0" "4558" "0" "c.4558del" "r.(?)" "p.(Ala1520Profs*30)" "" "0000476586" "00007329" "10" "4549" "0" "4549" "0" "c.4549A>G" "r.(?)" "p.(Ser1517Gly)" "" "0000476587" "00007329" "10" "4543" "0" "4543" "0" "c.4543C>T" "r.(?)" "p.(Arg1515Trp)" "" "0000476588" "00007329" "50" "4469" "0" "4469" "0" "c.4469C>T" "r.(?)" "p.(Ser1490Leu)" "" "0000476589" "00007329" "50" "4393" "0" "4393" "0" "c.4393G>T" "r.(?)" "p.(Ala1465Ser)" "" "0000476590" "00007329" "50" "4363" "0" "4363" "0" "c.4363A>G" "r.(?)" "p.(Ile1455Val)" "" "0000476591" "00007329" "10" "4352" "0" "4352" "0" "c.4352T>C" "r.(?)" "p.(Ile1451Thr)" "" "0000476592" "00007329" "10" "4256" "0" "4256" "0" "c.4256T>C" "r.(?)" "p.(Leu1419Ser)" "" "0000476593" "00007329" "10" "4081" "0" "4081" "0" "c.4081A>G" "r.(?)" "p.(Ile1361Val)" "" "0000476594" "00007329" "90" "4011" "0" "4012" "0" "c.4011_4012del" "r.(?)" "p.(His1337Glnfs*20)" "" "0000476595" "00007329" "10" "3973" "0" "3973" "0" "c.3973C>G" "r.(?)" "p.(Gln1325Glu)" "" "0000476596" "00007329" "90" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "" "0000476597" "00007329" "10" "3787" "0" "3787" "0" "c.3787A>G" "r.(?)" "p.(Ile1263Val)" "" "0000476598" "00007329" "50" "3684" "0" "3684" "0" "c.3684G>C" "r.(?)" "p.(Met1228Ile)" "" "0000476599" "00007329" "90" "3595" "0" "3595" "0" "c.3595G>T" "r.(?)" "p.(Glu1199*)" "" "0000476600" "00007329" "50" "3586" "0" "3586" "0" "c.3586T>C" "r.(?)" "p.(Cys1196Arg)" "" "0000476601" "00007329" "50" "3533" "0" "3533" "0" "c.3533A>G" "r.(?)" "p.(Asp1178Gly)" "" "0000476602" "00007329" "50" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000476603" "00007329" "10" "3444" "-5" "3444" "-5" "c.3444-5C>T" "r.spl?" "p.?" "" "0000476604" "00007329" "50" "2953" "0" "2961" "0" "c.2953_2961del" "r.(?)" "p.(Thr985_Gly987del)" "" "0000476605" "00007329" "50" "2941" "0" "2941" "0" "c.2941T>A" "r.(?)" "p.(Cys981Ser)" "" "0000476606" "00007329" "90" "2892" "0" "2892" "0" "c.2892A>C" "r.(?)" "p.(Glu964Asp)" "" "0000476607" "00007329" "90" "2886" "0" "2886" "0" "c.2886C>G" "r.(?)" "p.(Phe962Leu)" "" "0000476608" "00007329" "10" "2555" "0" "2555" "0" "c.2555T>C" "r.(?)" "p.(Leu852Pro)" "" "0000476609" "00007329" "50" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000476610" "00007329" "50" "2527" "0" "2527" "0" "c.2527G>A" "r.(?)" "p.(Gly843Arg)" "" "0000476611" "00007329" "50" "2399" "0" "2399" "0" "c.2399G>T" "r.(?)" "p.(Gly800Val)" "" "0000476612" "00007329" "90" "2360" "0" "2360" "0" "c.2360del" "r.(?)" "p.(Thr787Metfs*24)" "" "0000476613" "00007329" "90" "2340" "0" "2340" "0" "c.2340C>A" "r.(?)" "p.(Cys780*)" "" "0000476614" "00007329" "50" "2318" "0" "2318" "0" "c.2318A>G" "r.(?)" "p.(Asn773Ser)" "" "0000476615" "00007329" "50" "2227" "0" "2227" "0" "c.2227G>C" "r.(?)" "p.(Glu743Gln)" "" "0000476616" "00007329" "50" "2086" "0" "2086" "0" "c.2086T>G" "r.(?)" "p.(Cys696Gly)" "" "0000476617" "00007329" "50" "2045" "0" "2045" "0" "c.2045T>C" "r.(?)" "p.(Ile682Thr)" "" "0000476618" "00007329" "10" "1985" "0" "1985" "0" "c.1985G>T" "r.(?)" "p.(Arg662Met)" "" "0000476619" "00007329" "10" "1922" "0" "1922" "0" "c.1922A>T" "r.(?)" "p.(Glu641Val)" "" "0000476620" "00007329" "10" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Gly631Ser)" "" "0000476621" "00007329" "50" "1766" "2642" "1766" "2642" "c.1766+2642A>C" "r.(=)" "p.(=)" "" "0000476622" "00007329" "50" "1763" "0" "1763" "0" "c.1763C>G" "r.(?)" "p.(Pro588Arg)" "" "0000476623" "00007329" "10" "1712" "0" "1712" "0" "c.1712A>G" "r.(?)" "p.(Gln571Arg)" "" "0000476624" "00007329" "90" "1493" "0" "1494" "0" "c.1493_1494insAAAG" "r.(?)" "p.(Asp498Glufs*13)" "" "0000476625" "00007329" "50" "1487" "0" "1492" "0" "c.1487_1492del" "r.(?)" "p.(Val496_Ile497del)" "" "0000476626" "00007329" "50" "1460" "-2" "1460" "-2" "c.1460-2dup" "r.spl?" "p.?" "" "0000476627" "00007329" "50" "1382" "0" "1382" "0" "c.1382G>A" "r.(?)" "p.(Cys461Tyr)" "" "0000476628" "00007329" "10" "1300" "-3" "1300" "-3" "c.1300-3C>T" "r.spl?" "p.?" "" "0000476629" "00007329" "90" "1299" "1" "1299" "1" "c.1299+1G>T" "r.spl?" "p.?" "" "0000476630" "00007329" "50" "1294" "0" "1294" "0" "c.1294T>C" "r.(?)" "p.(Phe432Leu)" "" "0000476631" "00007329" "90" "1212" "0" "1212" "0" "c.1212dup" "r.(?)" "p.(Cys405Leufs*2)" "" "0000476632" "00007329" "50" "1153" "0" "1153" "0" "c.1153T>G" "r.(?)" "p.(Cys385Gly)" "" "0000476633" "00007329" "90" "1056" "1" "1056" "1" "c.1056+1G>A" "r.spl?" "p.?" "" "0000476634" "00007329" "50" "1005" "0" "1005" "0" "c.1005G>T" "r.(?)" "p.(Glu335Asp)" "" "0000476635" "00007329" "90" "943" "0" "943" "0" "c.943del" "r.(?)" "p.(Ala315Leufs*24)" "" "0000476636" "00007329" "90" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "" "0000476637" "00007329" "90" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Gln203*)" "" "0000476638" "00007329" "50" "586" "0" "586" "0" "c.586A>C" "r.(?)" "p.(Lys196Gln)" "" "0000476639" "00007329" "50" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "" "0000476640" "00007329" "90" "526" "0" "526" "0" "c.526G>T" "r.(?)" "p.(Glu176*)" "" "0000476641" "00007329" "90" "450" "0" "450" "0" "c.450del" "r.(?)" "p.(Val151Leufs*15)" "" "0000476642" "00007329" "10" "359" "0" "359" "0" "c.359C>T" "r.(?)" "p.(Thr120Met)" "" "0000476643" "00007329" "50" "334" "0" "334" "0" "c.334G>C" "r.(?)" "p.(Val112Leu)" "" "0000476644" "00007329" "90" "206" "0" "206" "0" "c.206del" "r.(?)" "p.(Ser69*)" "" "0000476645" "00007329" "90" "141" "0" "141" "0" "c.141A>T" "r.(?)" "p.(Glu47Asp)" "" "0000476646" "00007329" "90" "116" "0" "117" "0" "c.116_117del" "r.(?)" "p.(Tyr39Cysfs*26)" "" "0000476647" "00007329" "90" "77" "0" "77" "0" "c.77G>A" "r.(?)" "p.(Arg26Gln)" "" "0000476648" "00007329" "90" "35" "0" "35" "0" "c.35T>C" "r.(?)" "p.(Met12Thr)" "" "0000477498" "00007329" "90" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "" "0000477499" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000477500" "00007329" "10" "7666" "0" "7666" "0" "c.7666A>T" "r.(?)" "p.(Ser2556Cys)" "" "0000477501" "00007329" "50" "7394" "0" "7394" "0" "c.7394C>G" "r.(?)" "p.(Thr2465Ser)" "" "0000477502" "00007329" "10" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0000477503" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000477504" "00007329" "10" "5705" "0" "5705" "0" "c.5705A>T" "r.(?)" "p.(Asn1902Ile)" "" "0000477505" "00007329" "10" "5617" "0" "5617" "0" "c.5617C>G" "r.(?)" "p.(Leu1873Val)" "" "0000477506" "00007329" "10" "5244" "0" "5244" "0" "c.5244A>C" "r.(?)" "p.(Leu1748Phe)" "" "0000477507" "00007329" "90" "4958" "0" "4958" "0" "c.4958dup" "r.(?)" "p.(Ser1653Argfs*2)" "" "0000477508" "00007329" "10" "4549" "0" "4549" "0" "c.4549A>G" "r.(?)" "p.(Ser1517Gly)" "" "0000477509" "00007329" "10" "4543" "0" "4543" "0" "c.4543C>T" "r.(?)" "p.(Arg1515Trp)" "" "0000477510" "00007329" "10" "4352" "0" "4352" "0" "c.4352T>C" "r.(?)" "p.(Ile1451Thr)" "" "0000477511" "00007329" "10" "4256" "0" "4256" "0" "c.4256T>C" "r.(?)" "p.(Leu1419Ser)" "" "0000477512" "00007329" "10" "4081" "0" "4081" "0" "c.4081A>G" "r.(?)" "p.(Ile1361Val)" "" "0000477513" "00007329" "10" "3973" "0" "3973" "0" "c.3973C>G" "r.(?)" "p.(Gln1325Glu)" "" "0000477514" "00007329" "10" "3787" "0" "3787" "0" "c.3787A>G" "r.(?)" "p.(Ile1263Val)" "" "0000477515" "00007329" "10" "3444" "-5" "3444" "-5" "c.3444-5C>T" "r.spl?" "p.?" "" "0000477516" "00007329" "10" "2555" "0" "2555" "0" "c.2555T>C" "r.(?)" "p.(Leu852Pro)" "" "0000477517" "00007329" "50" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000477518" "00007329" "10" "1985" "0" "1985" "0" "c.1985G>T" "r.(?)" "p.(Arg662Met)" "" "0000477519" "00007329" "10" "1922" "0" "1922" "0" "c.1922A>T" "r.(?)" "p.(Glu641Val)" "" "0000477520" "00007329" "10" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Gly631Ser)" "" "0000477521" "00007329" "10" "1712" "0" "1712" "0" "c.1712A>G" "r.(?)" "p.(Gln571Arg)" "" "0000477522" "00007329" "50" "1382" "0" "1382" "0" "c.1382G>A" "r.(?)" "p.(Cys461Tyr)" "" "0000477523" "00007329" "10" "1300" "-3" "1300" "-3" "c.1300-3C>T" "r.spl?" "p.?" "" "0000477524" "00007329" "90" "1212" "0" "1212" "0" "c.1212dup" "r.(?)" "p.(Cys405Leufs*2)" "" "0000477525" "00007329" "90" "943" "0" "943" "0" "c.943del" "r.(?)" "p.(Ala315Leufs*24)" "" "0000477526" "00007329" "90" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "" "0000477527" "00007329" "50" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "" "0000477528" "00007329" "10" "359" "0" "359" "0" "c.359C>T" "r.(?)" "p.(Thr120Met)" "" "0000497789" "00007329" "90" "7943" "0" "7943" "0" "c.7943del" "r.(?)" "p.(Thr2648Lysfs*34)" "" "0000497790" "00007329" "90" "634" "0" "634" "0" "c.634C>T" "r.(?)" "p.(Gln212*)" "" "0000529295" "00007329" "50" "9392" "0" "9392" "0" "c.9392G>C" "r.(?)" "p.(Gly3131Ala)" "" "0000529296" "00007329" "10" "9237" "0" "9237" "0" "c.9237A>G" "r.(?)" "p.(Leu3079=)" "" "0000529297" "00007329" "90" "9157" "0" "9157" "0" "c.9157del" "r.(?)" "p.(Gln3053ArgfsTer8)" "" "0000529299" "00007329" "50" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "" "0000529300" "00007329" "10" "8901" "0" "8901" "0" "c.8901C>T" "r.(?)" "p.(Tyr2967=)" "" "0000529301" "00007329" "50" "8699" "0" "8699" "0" "c.8699G>A" "r.(?)" "p.(Arg2900Lys)" "" "0000529302" "00007329" "10" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "" "0000529303" "00007329" "90" "8412" "0" "8413" "0" "c.8412_8413insCA" "r.(?)" "p.(Thr2805GlnfsTer9)" "" "0000529304" "00007329" "50" "8080" "0" "8080" "0" "c.8080A>G" "r.(?)" "p.(Ile2694Val)" "" "0000529305" "00007329" "50" "7918" "0" "7918" "0" "c.7918T>G" "r.(?)" "p.(Trp2640Gly)" "" "0000529306" "00007329" "50" "7811" "0" "7811" "0" "c.7811G>A" "r.(?)" "p.(Arg2604His)" "" "0000529307" "00007329" "70" "7811" "0" "7811" "0" "c.7811G>A" "r.(?)" "p.(Arg2604His)" "" "0000529308" "00007329" "30" "7751" "0" "7751" "0" "c.7751C>G" "r.(?)" "p.(Thr2584Ser)" "" "0000529309" "00007329" "10" "7737" "0" "7737" "0" "c.7737T>C" "r.(?)" "p.(Thr2579=)" "" "0000529310" "00007329" "30" "7608" "0" "7608" "0" "c.7608C>T" "r.(?)" "p.(Ile2536=)" "" "0000529311" "00007329" "10" "7579" "-12" "7579" "-12" "c.7579-12dup" "r.(=)" "p.(=)" "" "0000529312" "00007329" "50" "7356" "0" "7356" "0" "c.7356C>A" "r.(?)" "p.(Asn2452Lys)" "" "0000529313" "00007329" "50" "7205" "0" "7205" "0" "c.7205G>A" "r.(?)" "p.(Arg2402Lys)" "" "0000529315" "00007329" "90" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365Ter)" "" "0000529316" "00007329" "90" "7050" "0" "7055" "18" "c.7050_7055+18del" "r.spl?" "p.?" "" "0000529317" "00007329" "30" "7034" "0" "7034" "0" "c.7034G>A" "r.(?)" "p.(Arg2345His)" "" "0000529318" "00007329" "10" "7006" "0" "7006" "0" "c.7006G>A" "r.(?)" "p.(Val2336Ile)" "" "0000529319" "00007329" "10" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0000529320" "00007329" "10" "6977" "0" "6977" "0" "c.6977G>A" "r.(?)" "p.(Arg2326Gln)" "" "0000529321" "00007329" "10" "6726" "-12" "6726" "-12" "c.6726-12T>C" "r.(=)" "p.(=)" "" "0000529322" "00007329" "10" "6725" "10" "6725" "10" "c.6725+10G>A" "r.(=)" "p.(=)" "" "0000529323" "00007329" "50" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "" "0000529324" "00007329" "30" "6452" "0" "6452" "0" "c.6452A>G" "r.(?)" "p.(Asn2151Ser)" "" "0000529325" "00007329" "50" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "" "0000529328" "00007329" "50" "6047" "0" "6047" "0" "c.6047G>A" "r.(?)" "p.(Gly2016Asp)" "" "0000529329" "00007329" "30" "6025" "0" "6025" "0" "c.6025A>G" "r.(?)" "p.(Lys2009Glu)" "" "0000529330" "00007329" "50" "5957" "0" "5957" "0" "c.5957T>A" "r.(?)" "p.(Leu1986Gln)" "" "0000529331" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "" "0000529332" "00007329" "30" "5694" "0" "5694" "0" "c.5694T>C" "r.(?)" "p.(Asn1898=)" "" "0000529333" "00007329" "30" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "" "0000529334" "00007329" "50" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "" "0000529335" "00007329" "30" "5487" "0" "5487" "0" "c.5487A>G" "r.(?)" "p.(Lys1829=)" "" "0000529336" "00007329" "30" "5401" "0" "5401" "0" "c.5401G>A" "r.(?)" "p.(Ala1801Thr)" "" "0000529337" "00007329" "30" "5317" "0" "5317" "0" "c.5317A>T" "r.(?)" "p.(Asn1773Tyr)" "" "0000529338" "00007329" "30" "5262" "0" "5262" "0" "c.5262G>A" "r.(?)" "p.(Pro1754=)" "" "0000529339" "00007329" "50" "5233" "0" "5233" "0" "c.5233G>A" "r.(?)" "p.(Asp1745Asn)" "" "0000529340" "00007329" "90" "5098" "0" "5098" "0" "c.5098A>T" "r.(?)" "p.(Lys1700Ter)" "" "0000529341" "00007329" "50" "4991" "0" "4991" "0" "c.4991C>T" "r.(?)" "p.(Thr1664Ile)" "" "0000529342" "00007329" "50" "4817" "0" "4817" "0" "c.4817C>A" "r.(?)" "p.(Thr1606Asn)" "" "0000529344" "00007329" "10" "4093" "0" "4093" "0" "c.4093A>G" "r.(?)" "p.(Lys1365Glu)" "" "0000529345" "00007329" "10" "3936" "0" "3936" "0" "c.3936A>G" "r.(?)" "p.(Thr1312=)" "" "0000529346" "00007329" "50" "3881" "0" "3881" "0" "c.3881C>G" "r.(?)" "p.(Pro1294Arg)" "" "0000529347" "00007329" "10" "3858" "0" "3858" "0" "c.3858C>T" "r.(?)" "p.(Asp1286=)" "" "0000529348" "00007329" "30" "3832" "0" "3832" "0" "c.3832G>T" "r.(?)" "p.(Ala1278Ser)" "" "0000529349" "00007329" "30" "3809" "0" "3809" "0" "c.3809T>A" "r.(?)" "p.(Val1270Asp)" "" "0000529350" "00007329" "50" "3586" "0" "3586" "0" "c.3586T>C" "r.(?)" "p.(Cys1196Arg)" "" "0000529351" "00007329" "90" "3562" "0" "3562" "0" "c.3562C>T" "r.(?)" "p.(Gln1188Ter)" "" "0000529352" "00007329" "50" "3496" "0" "3496" "0" "c.3496T>A" "r.(?)" "p.(Ser1166Thr)" "" "0000529353" "00007329" "10" "3345" "0" "3345" "0" "c.3345A>G" "r.(?)" "p.(Glu1115=)" "" "0000529354" "00007329" "50" "2975" "0" "2975" "0" "c.2975G>T" "r.(?)" "p.(Cys992Phe)" "" "0000529355" "00007329" "30" "2911" "0" "2911" "0" "c.2911A>G" "r.(?)" "p.(Lys971Glu)" "" "0000529356" "00007329" "10" "2738" "8" "2738" "8" "c.2738+8A>C" "r.(=)" "p.(=)" "" "0000529357" "00007329" "50" "2664" "0" "2664" "0" "c.2664A>C" "r.(?)" "p.(Glu888Asp)" "" "0000529358" "00007329" "50" "2504" "0" "2504" "0" "c.2504G>A" "r.(?)" "p.(Cys835Tyr)" "" "0000529359" "00007329" "50" "2500" "0" "2500" "0" "c.2500G>A" "r.(?)" "p.(Val834Ile)" "" "0000529360" "00007329" "90" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794Ter)" "" "0000529361" "00007329" "70" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl?" "p.?" "" "0000529362" "00007329" "50" "2068" "0" "2068" "0" "c.2068T>A" "r.(?)" "p.(Cys690Ser)" "" "0000529363" "00007329" "50" "2028" "0" "2028" "0" "c.2028G>A" "r.(?)" "p.(Thr676=)" "" "0000529364" "00007329" "10" "2024" "-14" "2024" "-13" "c.2024-14_2024-13insT" "r.(=)" "p.(=)" "" "0000529365" "00007329" "10" "2024" "-14" "2024" "-13" "c.2024-14_2024-13insTT" "r.(=)" "p.(=)" "" "0000529366" "00007329" "10" "2024" "-15" "2024" "-15" "c.2024-15dup" "r.(=)" "p.(=)" "" "0000529367" "00007329" "10" "1891" "0" "1891" "0" "c.1891G>A" "r.(?)" "p.(Gly631Ser)" "" "0000529368" "00007329" "50" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "" "0000529369" "00007329" "50" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "" "0000529370" "00007329" "10" "1766" "2578" "1766" "2578" "c.1766+2578G>A" "r.(=)" "p.(=)" "" "0000529371" "00007329" "50" "1397" "0" "1397" "0" "c.1397A>G" "r.(?)" "p.(His466Arg)" "" "0000529372" "00007329" "30" "1337" "0" "1337" "0" "c.1337G>C" "r.(?)" "p.(Trp446Ser)" "" "0000529373" "00007329" "70" "1299" "5" "1299" "8" "c.1299+5_1299+8del" "r.spl?" "p.?" "" "0000529374" "00007329" "30" "1293" "0" "1293" "0" "c.1293A>T" "r.(?)" "p.(Arg431Ser)" "" "0000529375" "00007329" "10" "1206" "0" "1206" "0" "c.1206A>G" "r.(?)" "p.(Glu402=)" "" "0000529376" "00007329" "10" "1146" "0" "1146" "0" "c.1146T>C" "r.(?)" "p.(Asn382=)" "" "0000529377" "00007329" "30" "1145" "0" "1145" "0" "c.1145A>T" "r.(?)" "p.(Asn382Ile)" "" "0000529378" "00007329" "10" "1107" "0" "1107" "0" "c.1107C>T" "r.(?)" "p.(Ser369=)" "" "0000529379" "00007329" "10" "1057" "-13" "1057" "-13" "c.1057-13dup" "r.(=)" "p.(=)" "" "0000529380" "00007329" "30" "943" "0" "943" "0" "c.943G>A" "r.(?)" "p.(Ala315Thr)" "" "0000529381" "00007329" "10" "863" "-4" "863" "-4" "c.863-4dup" "r.spl?" "p.?" "" "0000529382" "00007329" "50" "831" "0" "831" "0" "c.831T>A" "r.(?)" "p.(Ser277Arg)" "" "0000529383" "00007329" "90" "454" "0" "454" "0" "c.454dup" "r.(?)" "p.(Met152AsnfsTer37)" "" "0000529384" "00007329" "90" "454" "0" "454" "0" "c.454dup" "r.(?)" "p.(Met152AsnfsTer37)" "" "0000529385" "00007329" "50" "406" "0" "406" "0" "c.406G>T" "r.(?)" "p.(Val136Phe)" "" "0000529386" "00007329" "30" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(His134Tyr)" "" "0000529387" "00007329" "10" "281" "0" "281" "0" "c.281C>A" "r.(?)" "p.(Pro94Gln)" "" "0000529388" "00007329" "90" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Gln35Ter)" "" "0000529389" "00007329" "50" "57" "0" "57" "0" "c.57A>G" "r.(?)" "p.(Ile19Met)" "" "0000529390" "00007329" "50" "35" "0" "35" "0" "c.35T>C" "r.(?)" "p.(Met12Thr)" "" "0000529391" "00007329" "90" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12AspfsTer14)" "" "0000529392" "00007329" "30" "19" "0" "19" "0" "c.19G>A" "r.(?)" "p.(Val7Ile)" "" "0000610409" "00007329" "90" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "" "0000610410" "00007329" "90" "8408" "0" "8408" "0" "c.8408dup" "r.(?)" "p.(Asn2803LysfsTer9)" "" "0000610411" "00007329" "70" "8327" "0" "8327" "0" "c.8327dup" "r.(?)" "p.(Thr2777AsnfsTer35)" "" "0000610412" "00007329" "30" "6431" "0" "6431" "0" "c.6431G>T" "r.(?)" "p.(Gly2144Val)" "" "0000610413" "00007329" "30" "6408" "0" "6408" "0" "c.6408C>A" "r.(?)" "p.(Gly2136=)" "" "0000610414" "00007329" "30" "5927" "10" "5927" "10" "c.5927+10T>C" "r.(=)" "p.(=)" "" "0000610415" "00007329" "30" "5835" "12" "5835" "12" "c.5835+12A>G" "r.(=)" "p.(=)" "" "0000610416" "00007329" "30" "5025" "0" "5025" "0" "c.5025T>C" "r.(?)" "p.(Ser1675=)" "" "0000610417" "00007329" "30" "4232" "0" "4232" "0" "c.4232T>A" "r.(?)" "p.(Phe1411Tyr)" "" "0000610418" "00007329" "30" "3542" "0" "3542" "0" "c.3542A>G" "r.(?)" "p.(Asn1181Ser)" "" "0000610419" "00007329" "30" "2911" "0" "2911" "0" "c.2911A>G" "r.(?)" "p.(Lys971Glu)" "" "0000610420" "00007329" "30" "2598" "0" "2598" "0" "c.2598C>T" "r.(?)" "p.(Cys866=)" "" "0000610421" "00007329" "30" "1600" "-10" "1600" "-10" "c.1600-10G>A" "r.(=)" "p.(=)" "" "0000610422" "00007329" "30" "1459" "5" "1459" "5" "c.1459+5C>T" "r.spl?" "p.?" "" "0000621739" "00007329" "30" "6961" "0" "6961" "0" "c.6961A>C" "r.(?)" "p.(Ile2321Leu)" "" "0000621740" "00007329" "50" "5144" "0" "5144" "0" "c.5144A>G" "r.(?)" "p.(Glu1715Gly)" "" "0000621741" "00007329" "90" "1380" "0" "1380" "0" "c.1380dup" "r.(?)" "p.(Cys461LeufsTer12)" "" "0000652025" "00007329" "50" "2733" "0" "2733" "0" "c.2733T>C" "r.(=)" "p.(=)" "" "0000652026" "00007329" "90" "2055" "0" "2055" "0" "c.2055T>A" "r.(?)" "p.(Cys685*)" "" "0000652027" "00007329" "10" "1985" "0" "1985" "0" "c.1985G>T" "r.(?)" "p.(Arg662Met)" "" "0000652028" "00007329" "90" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "" "0000652029" "00007329" "50" "-207" "0" "-207" "0" "c.-207A>G" "r.(=)" "p.(=)" "" "0000653483" "00007329" "90" "6174" "0" "6174" "0" "c.6174T>G" "r.(?)" "p.(Tyr2058*)" "" "0000655631" "00007329" "30" "5615" "0" "5615" "0" "c.5615T>C" "r.(?)" "p.(Ile1872Thr)" "" "0000655632" "00007329" "30" "5356" "0" "5356" "0" "c.5356G>A" "r.(?)" "p.(Glu1786Lys)" "" "0000655633" "00007329" "50" "3493" "0" "3493" "0" "c.3493T>C" "r.(?)" "p.(Cys1165Arg)" "" "0000655634" "00007329" "30" "2613" "0" "2613" "0" "c.2613C>T" "r.(?)" "p.(Asp871=)" "" "0000655635" "00007329" "30" "2598" "0" "2598" "0" "c.2598C>T" "r.(?)" "p.(Cys866=)" "" "0000655636" "00007329" "90" "1641" "0" "1644" "0" "c.1641_1644del" "r.(?)" "p.(Ser547ArgfsTer62)" "" "0000659798" "00007329" "90" "8648" "0" "8649" "0" "c.8648_8649del" "r.(?)" "p.(Thr2883Metfs*6)" "" "0000659799" "00007329" "70" "7723" "1" "7723" "1" "c.7723+1G>A" "r.spl" "p.?" "" "0000666145" "00007329" "90" "5773" "0" "5773" "0" "c.5773C>T" "r.(?)" "p.(Gln1925*)" "" "0000669929" "00007329" "50" "2733" "0" "2733" "0" "c.2733T>C" "r.(=)" "p.(=)" "" "0000677822" "00007329" "90" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135Ter)" "" "0000677823" "00007329" "30" "9371" "0" "9371" "0" "c.9371T>C" "r.(?)" "p.(Ile3124Thr)" "" "0000677824" "00007329" "30" "9185" "0" "9185" "0" "c.9185A>G" "r.(?)" "p.(Asn3062Ser)" "" "0000677825" "00007329" "50" "8291" "0" "8291" "0" "c.8291G>T" "r.(?)" "p.(Gly2764Val)" "" "0000677826" "00007329" "30" "8072" "-11" "8072" "-11" "c.8072-11C>T" "r.(=)" "p.(=)" "" "0000677827" "00007329" "30" "7356" "0" "7356" "0" "c.7356C>A" "r.(?)" "p.(Asn2452Lys)" "" "0000677828" "00007329" "30" "5836" "-4" "5836" "-4" "c.5836-4A>T" "r.spl?" "p.?" "" "0000677829" "00007329" "30" "4660" "0" "4660" "0" "c.4660C>G" "r.(?)" "p.(Gln1554Glu)" "" "0000677830" "00007329" "90" "4557" "0" "4557" "0" "c.4557del" "r.(?)" "p.(Ala1520ProfsTer30)" "" "0000677831" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "" "0000677832" "00007329" "50" "2953" "0" "2961" "0" "c.2953_2961del" "r.(?)" "p.(Thr985_Gly987del)" "" "0000677833" "00007329" "30" "1871" "0" "1871" "0" "c.1871C>T" "r.(?)" "p.(Ser624Leu)" "" "0000677834" "00007329" "10" "1459" "20" "1459" "20" "c.1459+20T>A" "r.(=)" "p.(=)" "" "0000677835" "00007329" "90" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404LysfsTer3)" "" "0000684415" "00007329" "70" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558*)" "11" "0000684434" "00007329" "70" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "14" "0000684525" "00007329" "70" "2975" "0" "2975" "0" "c.2975G>T" "r.(?)" "p.(Cys992Phe)" "" "0000684526" "00007329" "70" "3327" "0" "3327" "0" "c.3327C>A" "r.(?)" "p.(Tyr1109*)" "" "0000684527" "00007329" "70" "5802" "0" "5802" "0" "c.5802del" "r.(?)" "p.(Phe1934Leufs*11)" "" "0000684528" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000684529" "00007329" "70" "9163" "0" "9164" "0" "c.9163_9164del" "r.(?)" "p.(Leu3055Tyrfs*7)" "" "0000684654" "00007329" "70" "8710" "0" "8717" "0" "c.8710_8717del" "r.(?)" "p.(Asp2904Trpfs*5)" "" "0000684661" "00007329" "90" "9368" "0" "9368" "0" "c.9368del" "r.(?)" "p.(Asn3123Thrfs*4)" "" "0000684662" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000684663" "00007329" "90" "2522" "0" "2522" "0" "c.2522dup" "r.(?)" "p.(Tyr841*)" "" "0000684664" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000684697" "00007329" "50" "7025" "0" "7025" "0" "c.7025A>C" "r.(?)" "p.(His2342Pro)" "" "0000684698" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000684699" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000684700" "00007329" "90" "2382" "-2" "2382" "-2" "c.2382-2A>T" "r.spl" "p.?" "" "0000685192" "00007329" "90" "2138" "-1" "3443" "1" "c.(2137+1_2138-1)_(3443+1_3444-1)del" "r.?" "p.(Val713Aspfs*15)" "" "0000685193" "00007329" "90" "6425" "1" "6725" "1" "c.(6424-1_6425+1)_(6725+1_6726-1)del" "r.?" "p.(Asp2142Alafs*14)" "" "0000685194" "00007329" "90" "6079" "0" "6191" "0" "c.6079_6191dup" "r.?" "p.(Ser2065Cysfs*12)" "" "0000685195" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Gly3131Ala)" "" "0000685196" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Val3117Leufs*28)" "" "0000685197" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Asn3096Leufs*2)" "" "0000685198" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Val2892Ala)" "" "0000685199" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Leu2773_Asn2775delinsTyr)" "" "0000685200" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Gln2744Argfs*18)" "" "0000685201" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Gln2744*)" "" "0000685202" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(His2740Tyrfs*27)" "" "0000685203" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Asn2723Metfs*39)" "" "0000685204" "00007329" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Asn2723Metfs*39)" "" "0000685205" "00007329" "90" "0" "0" "0" "0" "c.?" "r.?" "p.(Lys251_Gly2766del)" "" "0000685206" "00007329" "90" "6976" "0" "6976" "0" "c.6976C>T" "r.(?)" "p.(Arg2326*)" "" "0000685207" "00007329" "90" "6137" "0" "6137" "0" "c.6137G>A" "r.(?)" "p.(Trp2046*)" "" "0000685208" "00007329" "70" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "" "0000685209" "00007329" "90" "5928" "0" "6078" "0" "c.5928_6078del" "r.?" "p.(Gln1977Cysfs*12)" "" "0000685210" "00007329" "90" "5450" "0" "5450" "0" "c.5450G>A" "r.(?)" "p.(Trp1817*)" "" "0000685211" "00007329" "90" "4361" "0" "4362" "0" "c.4361_4362delinsAG" "r.(?)" "p.(Ser1454*)" "" "0000685212" "00007329" "90" "3715" "0" "3715" "0" "c.3715G>T" "r.(?)" "p.(Glu1239*)" "" "0000685213" "00007329" "90" "2138" "0" "3443" "0" "c.2138_3443del" "r.?" "p.(Val713Aspfs*15)" "" "0000685214" "00007329" "90" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl" "p.?" "" "0000685215" "00007329" "90" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl" "p.?" "" "0000685216" "00007329" "90" "1961" "0" "1961" "0" "c.1961dup" "r.(?)" "p.(Asn654Lysfs*5)" "" "0000685217" "00007329" "70" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "" "0000685218" "00007329" "70" "1561" "0" "1563" "0" "c.1561_1563del" "r.(?)" "p.(Asn521del)" "" "0000685219" "00007329" "90" "1308" "0" "1308" "0" "c.1308C>A" "r.(?)" "p.(Cys436*)" "" "0000685220" "00007329" "90" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*3)" "" "0000685221" "00007329" "90" "403" "0" "423" "0" "c.403_423delinsCTTTT" "r.(?)" "p.(Thr135Leufs*26)" "" "0000686011" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "" "0000686041" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000686042" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000686043" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000689778" "00007329" "50" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "" "0000710267" "00007329" "50" "3250" "0" "3250" "0" "c.3250A>C" "r.(?)" "p.(Thr1084Pro)" "" "0000710349" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.?" "" "0000710367" "00007329" "50" "4402" "0" "4402" "0" "c.4402G>C" "r.(?)" "p.(Asp1468His)" "" "0000713271" "00007329" "90" "7994" "0" "7994" "0" "c.7994G>A" "r.(?)" "p.(Gly2665Glu)" "" "0000713292" "00007329" "90" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "" "0000713348" "00007329" "90" "8368" "0" "8368" "0" "c.8368A>G" "r.(?)" "p.(Arg2790Gly)" "" "0000713399" "00007329" "90" "8618" "0" "8618" "0" "c.8618A>G" "r.(?)" "p.(Asp2873Gly)" "" "0000713425" "00007329" "90" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Asn404Thrfs*17)" "" "0000713497" "00007329" "90" "5317" "0" "5341" "0" "c.5317_5341delinsT" "r.(?)" "p.(Asn1773_Val1781delinsLeu)" "" "0000713505" "00007329" "90" "5928" "-3" "5928" "-1" "c.5928-3_5928-1del" "r.spl?" "p.?" "" "0000713556" "00007329" "90" "2000" "0" "2000" "0" "c.2000G>A" "r.(?)" "p.(Arg667His)" "" "0000713567" "00007329" "70" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "" "0000713604" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "" "0000713631" "00007329" "90" "7412" "-2153" "7899" "-3073" "c.7412-2153_7899-3073del" "r.(?)" "p.(Gly2471Alafs*49)" "37i_40i" "0000713653" "00007329" "90" "6502" "0" "6502" "0" "c.6502G>T" "r.(?)" "p.(Glu2168*)" "" "0000713661" "00007329" "90" "6545" "0" "6545" "0" "c.6545del" "r.(?)" "p.(Asn2182Thrfs*3)" "" "0000713662" "00007329" "90" "6473" "0" "6473" "0" "c.6473T>C" "r.(?)" "p.(Leu2158Pro)" "" "0000713691" "00007329" "90" "2976" "0" "2976" "0" "c.2976T>A" "r.(?)" "p.(Cys992*)" "" "0000713730" "00007329" "90" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "" "0000713753" "00007329" "90" "6937" "0" "6937" "0" "c.6937C>T" "r.(?)" "p.(Gln2313*)" "" "0000713754" "00007329" "90" "613" "0" "613" "0" "c.613C>T" "r.(?)" "p.(Pro205Ser)" "" "0000713809" "00007329" "90" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Gln874*)" "" "0000713839" "00007329" "90" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "" "0000713848" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "" "0000713849" "00007329" "70" "3775" "0" "3775" "0" "c.3775C>T" "r.(?)" "p.(Gln1259*)" "" "0000713865" "00007329" "90" "5408" "0" "5408" "0" "c.5408C>G" "r.(?)" "p.(Ser1803*)" "" "0000713881" "00007329" "90" "7411" "2385" "7724" "-3739" "c.7411+2385_7724-3739del" "r.(?)" "p.(Leu2472_Gly2575del)" "37i_39i" "0000713900" "00007329" "90" "6323" "0" "6323" "0" "c.6323G>A" "r.(?)" "p.(Cys2108Tyr)" "" "0000713901" "00007329" "90" "2260" "-2380" "2847" "-6084" "c.2260-2380_2847-6084del" "r.(?)" "p.(Ser754Ilefs*4)" "14i_18i" "0000721034" "00007329" "50" "9409" "0" "9409" "0" "c.9409G>A" "r.(?)" "p.(Gly3137Arg)" "" "0000721035" "00007329" "90" "9102" "0" "9102" "0" "c.9102dup" "r.(?)" "p.(Asn3035Ter)" "" "0000721036" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl?" "p.?" "" "0000721037" "00007329" "50" "7193" "0" "7193" "0" "c.7193G>A" "r.(?)" "p.(Cys2398Tyr)" "" "0000721038" "00007329" "90" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365Ter)" "" "0000721039" "00007329" "30" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "" "0000721040" "00007329" "30" "4740" "0" "4740" "0" "c.4740C>G" "r.(?)" "p.(Ser1580=)" "" "0000721041" "00007329" "50" "1660" "0" "1660" "0" "c.1660T>A" "r.(?)" "p.(Cys554Ser)" "" "0000721042" "00007329" "30" "1479" "0" "1479" "0" "c.1479C>T" "r.(?)" "p.(Cys493=)" "" "0000721043" "00007329" "90" "1443" "0" "1443" "0" "c.1443G>A" "r.(?)" "p.(Trp481*)" "" "0000729722" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "" "0000729723" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729724" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000729725" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729726" "00007329" "90" "3573" "0" "3573" "0" "c.3573G>A" "r.(?)" "p.(Trp1191*)" "" "0000729727" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000729728" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000729729" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729730" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729731" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729732" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729733" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729734" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729735" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000729736" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000729737" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729738" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000729739" "00007329" "70" "7451" "0" "7451" "0" "c.7451A>T" "r.(?)" "p.(Asn2484Ile)" "" "0000729740" "00007329" "70" "7901" "0" "7901" "0" "c.7901G>C" "r.(?)" "p.(Cys2634Ser)" "" "0000729741" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000729742" "00007329" "90" "5519" "0" "5519" "0" "c.5519G>A" "r.(?)" "p.(Trp1840*)" "" "0000729767" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729768" "00007329" "90" "2023" "1" "2023" "1" "c.2023+1G>T" "r.spl" "p.?" "" "0000729769" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729770" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729771" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729772" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729773" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729774" "00007329" "90" "5988" "0" "5988" "0" "c.5988C>A" "r.(?)" "p.(Cys1996*)" "" "0000729775" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000729776" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729777" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729778" "00007329" "90" "4022" "0" "4022" "0" "c.4022del" "r.(?)" "p.(Ser1341Phefs*11)" "" "0000729779" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000729780" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000729781" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000730210" "00007329" "90" "2318" "0" "2318" "0" "c.2318dup" "r.(?)" "p.(Asn773Lysfs*2)" "" "0000730270" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000731475" "00007329" "90" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000731476" "00007329" "90" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000731477" "00007329" "90" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000731503" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000731522" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "-" "" "0000731523" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000731525" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "-" "" "0000731526" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000732556" "00007329" "50" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl" "p.?" "" "0000732557" "00007329" "90" "8473" "0" "8474" "0" "c.8473_8474insT" "r.(?)" "p.(Gly2825Valfs*16)" "" "0000732558" "00007329" "50" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000732559" "00007329" "90" "2975" "0" "2975" "0" "c.2975G>T" "r.(?)" "p.(Cys992Phe)" "" "0000732580" "00007329" "90" "6138" "0" "6138" "0" "c.6138G>A" "r.(?)" "p.(Trp2046*)" "" "0000732581" "00007329" "90" "5677" "0" "5681" "0" "c.5677_5681del" "r.(?)" "p.(Tyr1893Argfs*12)" "" "0000732591" "00007329" "90" "6137" "0" "6137" "0" "c.6137G>A" "r.(?)" "p.(Trp2046*)" "" "0000732592" "00007329" "30" "1153" "0" "1153" "0" "c.1153T>G" "r.(?)" "p.(Cys385Gly)" "" "0000732593" "00007329" "70" "7868" "0" "7868" "0" "c.7868G>A" "r.(?)" "p.(Gly2623Glu)" "" "0000733059" "00007329" "70" "1867" "0" "1867" "0" "c.1867del" "r.(?)" "p.(Leu623Phefs*20)" "" "0000733060" "00007329" "70" "5988" "0" "5988" "0" "c.5988C>A" "r.(?)" "p.(Cys1996*)" "" "0000733061" "00007329" "70" "1461" "0" "1461" "0" "c.1461A>T" "r.(?)" "p.(Gly487=)" "" "0000733062" "00007329" "70" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "" "0000733125" "00007329" "70" "7056" "-1" "7056" "-1" "c.7056-1G>C" "r.spl" "p.?" "" "0000733136" "00007329" "70" "0" "0" "0" "0" "c.-538_863-23447{0}" "r.0?" "p.0?" "" "0000733528" "00007329" "70" "5413" "0" "5413" "0" "c.5413C>T" "r.(?)" "p.(Gln1805*)" "" "0000733529" "00007329" "70" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000733530" "00007329" "70" "4955" "0" "4955" "0" "c.4955C>A" "r.(?)" "p.(Ser1652*)" "" "0000733578" "00007329" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000733584" "00007329" "70" "862" "5718" "1300" "-2364" "c.862+5718_1300-2364delinsT" "r.?" "p.?" "" "0000734339" "00007329" "70" "4245" "0" "4245" "0" "c.4245G>T" "r.(?)" "p.(Gln1415His)" "" "0000734340" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000734392" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000734686" "00007329" "70" "1260" "0" "1260" "0" "c.1260_1260del" "r.(?)" "p.(Asn421Metfs*8)" "" "0000734688" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000734691" "00007329" "70" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "" "0000734698" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000735835" "00007329" "70" "6111" "0" "6111" "0" "c.6111C>A" "r.(?)" "p.(Cys2037Ter)" "" "0000735849" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374Ter)" "" "0000735869" "00007329" "70" "4829" "0" "4832" "0" "c.4829_4832del" "r.(?)" "p.(Ser1610PhefsTer7)" "" "0000735899" "00007329" "70" "35" "0" "35" "0" "c.35T>C" "r.(?)" "p.(Met12Thr)" "" "0000735990" "00007329" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "14i_19i" "0000735991" "00007329" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "31i_33i" "0000736090" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000736094" "00007329" "70" "9414" "0" "9414" "0" "c.9414T>G" "r.(?)" "p.(Asp3138Glu)" "" "0000736131" "00007329" "70" "586" "0" "586" "0" "c.586A>C" "r.(?)" "p.(Lys196Gln)" "" "0000736136" "00007329" "70" "3243" "6" "3243" "6" "c.3243+6T>A" "r.spl" "p.?" "" "0000736140" "00007329" "70" "8096" "0" "8096" "0" "c.8096T>C" "r.(?)" "p.(Phe2699Ser)" "" "0000736141" "00007329" "70" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl" "p.?" "" "0000736833" "00007329" "50" "8427" "0" "8432" "0" "c.8427_8432del" "r.(?)" "p.(Thr2810_Lys2811del)" "" "0000759943" "00007329" "90" "8650" "0" "8650" "0" "c.8650T>G" "r.(?)" "p.(Cys2884Gly)" "" "0000759964" "00007329" "90" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "" "0000760261" "00007329" "70" "9131" "0" "9131" "0" "c.9131G>T" "r.(?)" "p.(Trp3044Leu)" "" "0000760279" "00007329" "50" "2826" "0" "2827" "0" "c.2826_2827del" "r.(?)" "p.(Val944Glyfs*9)" "" "0000760290" "00007329" "70" "2309" "0" "2309" "0" "c.2309A>C" "r.(?)" "p.(Gln770Pro)" "" "0000760292" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000760294" "00007329" "50" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "" "0000760315" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000760337" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000760476" "00007329" "50" "6137" "0" "6137" "0" "c.6137G>A" "r.(?)" "p.(Trp2046*)" "" "0000760602" "00007329" "90" "" "0" "" "0" "c.5928‐2A>G" "r.spl" "p.?" "" "0000764094" "00007329" "30" "5645" "-23681" "5645" "-23681" "c.5645-23681C>T" "r.?" "p.?" "26i" "0000764096" "00007329" "90" "403" "0" "423" "0" "c.403_423delinsCTTTT" "r.403_423delinscuuuu" "p.(Thr135Leufs*26)" "4" "0000764100" "00007329" "90" "9405" "0" "9405" "0" "c.9405T>A" "r.9405u>a" "p.(Tyr3135*)" "43" "0000764102" "00007329" "30" "5928" "-11231" "5928" "-11231" "c.5928-11231A>G" "r.?" "p.?" "28i" "0000764118" "00007329" "30" "1766" "16598" "1766" "16598" "c.1766+16598T>A" "r.?" "p.?" "11i" "0000764124" "00007329" "90" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "" "0000764127" "00007329" "90" "1660" "0" "1660" "0" "c.1660T>A" "r.1660u>a" "p.(Cys554Ser)" "11" "0000764131" "00007329" "30" "1460" "-4535" "1460" "-4535" "c.1460-4535T>G" "r.?" "p.?" "9i" "0000764133" "00007329" "30" "2138" "-18444" "2138" "-18444" "c.2138-18444G>A" "r.=" "p.(=)" "13i" "0000764140" "00007329" "90" "539" "0" "539" "0" "c.539C>A" "r.539c>a" "p.(Ser180*)" "4" "0000764153" "00007329" "90" "5644" "70912" "5644" "70912" "c.5644+70912A>G" "r.5644_5645ins[5644+70913_5644+71016]" "p.(Asp1882Glyfs*18)" "26i" "0000764155" "00007329" "90" "5044" "0" "5044" "0" "c.5044G>T" "r.5044g>u" "p.(Asp1682Tyr)" "26" "0000764156" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "" "0000764896" "00007329" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000764897" "00007329" "70" "5927" "1" "5927" "1" "c.5927+1G>T" "r.spl" "p.?" "" "0000765805" "00007329" "70" "179" "0" "179" "0" "c.179del" "r.(?)" "p.(Leu60TrpfsTer3)" "" "0000783293" "00007329" "70" "4958" "0" "4959" "0" "c.4958_4959insA" "r.(?)" "p.(Ser1653ArgfsTer2)" "26" "0000784134" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000784146" "00007329" "70" "5411" "0" "5411" "0" "c.5411T>C" "r.(?)" "p.(Ile1804Thr)" "" "0000784233" "00007329" "70" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000784238" "00007329" "70" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000784244" "00007329" "70" "4115" "0" "4115" "0" "c.4115C>T" "r.(?)" "p.(Pro1372Leu)" "" "0000784245" "00007329" "70" "3454" "0" "3454" "0" "c.3454G>A" "r.(?)" "p.(Gly1152Arg)" "" "0000784246" "00007329" "70" "4379" "0" "4379" "0" "c.4379T>G" "r.(?)" "p.(Val1460Gly)" "" "0000784278" "00007329" "50" "2009" "0" "2009" "0" "c.2009T>A" "r.(?)" "p.(Val670Asp)" "" "0000784286" "00007329" "50" "334" "0" "334" "0" "c.334G>C" "r.(?)" "p.(Val112Leu)" "" "0000784290" "00007329" "50" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000784295" "00007329" "50" "3684" "7" "3684" "9" "c.3684+7_3684+9dup" "r.(=)" "p.(=)" "" "0000784303" "00007329" "70" "7949" "0" "7949" "0" "c.7949C>T" "r.(?)" "p.(Ser2650Phe)" "" "0000784319" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000784320" "00007329" "70" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000784321" "00007329" "70" "7949" "0" "7949" "0" "c.7949C>T" "r.(?)" "p.(Ser2650Phe)" "" "0000784325" "00007329" "70" "2023" "15" "2023" "15" "c.2023+15dup" "r.(=)" "p.(=)" "" "0000784326" "00007329" "70" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "" "0000784336" "00007329" "70" "6562" "0" "6562" "0" "c.6562A>G" "r.(?)" "p.(Ile2188Val)" "" "0000784337" "00007329" "70" "868" "0" "868" "0" "c.868T>C" "r.(?)" "p.(Phe290Leu)" "" "0000784338" "00007329" "70" "6065" "0" "6065" "0" "c.6065A>G" "r.(?)" "p.(His2022Arg)" "" "0000784339" "00007329" "70" "3454" "0" "3454" "0" "c.3454G>A" "r.(?)" "p.(Gly1152Arg)" "" "0000784340" "00007329" "70" "868" "0" "868" "0" "c.868T>C" "r.(?)" "p.(Phe290Leu)" "" "0000784344" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000784360" "00007329" "70" "3561" "0" "3561" "0" "c.3561C>A" "r.(?)" "p.(Cys1187Ter)" "" "0000784377" "00007329" "70" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "" "0000784383" "00007329" "70" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000784386" "00007329" "70" "5675" "0" "5675" "0" "c.5675C>T" "r.(?)" "p.(Ser1892Phe)" "" "0000784400" "00007329" "70" "1674" "0" "1674" "0" "c.1674G>A" "r.(?)" "p.(Trp558Ter)" "" "0000784403" "00007329" "70" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "" "0000784405" "00007329" "70" "5411" "0" "5411" "0" "c.5411T>C" "r.(?)" "p.(Ile1804Thr)" "" "0000784411" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000784430" "00007329" "50" "3293" "0" "3293" "0" "c.3293C>A" "r.(?)" "p.(Ala1098Glu)" "" "0000784453" "00007329" "50" "2027" "0" "2027" "0" "c.2027C>T" "r.(?)" "p.(Thr676Met)" "" "0000784488" "00007329" "50" "1108" "0" "1108" "0" "c.1108A>G" "r.(?)" "p.(Ile370Val)" "" "0000784492" "00007329" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000784498" "00007329" "50" "2066" "0" "2066" "0" "c.2066C>T" "r.(?)" "p.(Pro689Leu)" "" "0000784670" "00007329" "90" "2194" "0" "2194" "0" "c.2194C>T" "r.(?)" "p.(Gln732*)" "" "0000785392" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640Ter)" "" "0000785395" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239SerfsTer17)" "" "0000786313" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239SerfsTer17)" "" "0000788373" "00007329" "50" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "25" "0000788396" "00007329" "50" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000788453" "00007329" "50" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935Ter)" "43" "0000788467" "00007329" "50" "495" "0" "495" "0" "c.495dup" "r.(?)" "p.(Ser1653LysfsTer2)" "26" "0000788476" "00007329" "50" "3454" "0" "3454" "0" "c.3454G>A" "r.(?)" "p.(Gly1152Arg)" "23" "0000788486" "00007329" "50" "5425" "0" "5425" "0" "c.5425T>C" "r.(?)" "p.(Ser1809Pro)" "26" "0000788519" "00007329" "50" "9186" "0" "9187" "0" "c.9186_9187del" "r.(?)" "p.(Asn3062LysfsTer9)" "43" "0000789840" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "7" "0000789841" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000789842" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "7" "0000789843" "00007329" "70" "8229" "0" "8229" "0" "c.8229del" "r.(?)" "p.(Gln2743Hisfs*10)" "42" "0000789871" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "7" "0000789872" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "7" "0000790409" "00007329" "70" "0" "0" "0" "0" "c.?" "r.?" "p.?" "" "0000790410" "00007329" "70" "5600" "0" "5600" "0" "c.5600C>T" "r.(?)" "p.(Ser1867Phe)" "" "0000790411" "00007329" "70" "5681" "0" "5681" "0" "c.5681T>C" "r.(?)" "p.(Leu1894Pro)" "" "0000790426" "00007329" "70" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.?" "" "0000790459" "00007329" "50" "1596" "0" "1596" "0" "c.1596A>C" "r.(?)" "p.(Lys532Asn)" "" "0000790474" "00007329" "50" "1111" "0" "1111" "0" "c.1111C>A" "r.(?)" "p.(Gln371Lys)" "" "0000790477" "00007329" "50" "1765" "0" "1765" "0" "c.1765A>G" "r.(?)" "p.(Arg589Gly)" "" "0000790487" "00007329" "50" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "" "0000790491" "00007329" "50" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "" "0000790499" "00007329" "50" "1596" "0" "1596" "0" "c.1596A>C" "r.(?)" "p.(Lys532Asn)" "" "0000790508" "00007329" "50" "5615" "0" "5615" "0" "c.5615T>C" "r.(?)" "p.(Ile1872Thr)" "" "0000790517" "00007329" "50" "5212" "0" "5212" "0" "c.5212C>G" "r.(?)" "p.(His1738Asp)" "" "0000790530" "00007329" "50" "281" "0" "281" "0" "c.281C>A" "r.(?)" "p.(Pro94Gln)" "" "0000790563" "00007329" "50" "2412" "0" "2412" "0" "c.2412G>C" "r.(?)" "p.(Gln804His)" "" "0000790564" "00007329" "50" "3250" "0" "3250" "0" "c.3250A>C" "r.(?)" "p.(Thr1084Pro)" "" "0000790565" "00007329" "50" "4402" "0" "4402" "0" "c.4402G>C" "r.(?)" "p.(Asp1468His)" "" "0000790581" "00007329" "50" "2309" "0" "2309" "0" "c.2309A>C" "r.(?)" "p.(Gln770Pro)" "" "0000790584" "00007329" "50" "5743" "0" "5743" "0" "c.5743A>G" "r.(?)" "p.(Ser1915Gly)" "" "0000790592" "00007329" "50" "91" "0" "91" "0" "c.91G>A" "r.(?)" "p.(Glu31Lys)" "" "0000790601" "00007329" "50" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "" "0000790603" "00007329" "50" "5335" "0" "5335" "0" "c.5335G>A" "r.(?)" "p.(Gly1779Ser)" "" "0000790604" "00007329" "50" "7006" "0" "7006" "0" "c.7006G>A" "r.(?)" "p.(Val2336Ile)" "" "0000790605" "00007329" "50" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "" "0000790622" "00007329" "50" "8816" "0" "8816" "0" "c.8816G>A" "r.(?)" "p.(Cys2939Tyr)" "" "0000790654" "00007329" "50" "334" "0" "334" "0" "c.334G>A" "r.(?)" "p.(Val112Ile)" "" "0000790740" "00007329" "70" "9368" "0" "9368" "0" "c.9368dup" "r.(?)" "p.(Asn3123LysfsTer3)" "" "0000791202" "00007329" "90" "7724" "-1" "8071" "1" "c.(7723+1_7724-1)_(8071+1_8072-1)dup" "r.(?)" "p.(?)" "39i-41" "0000791216" "00007329" "90" "1836" "0" "1837" "0" "c.1836_1837del" "r.(?)" "p.(His612Glnfs*16)" "12" "0000791217" "00007329" "90" "1836" "0" "1837" "0" "c.1836_1837del" "r.(?)" "p.(His612Glnfs*16)" "12" "0000791254" "00007329" "90" "5802" "0" "5802" "0" "c.5802dup" "r.spl" "p.(Ile1935Tyrfs*6)" "27" "0000791255" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.spl" "p.(Val3096Leufs*28)" "44" "0000791256" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.spl" "p.(Val3096Leufs*28)" "44" "0000791554" "00007329" "70" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.(?)" "28i" "0000791582" "00007329" "70" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "4" "0000792221" "00007329" "90" "9082" "0" "9082" "0" "c.9082G>T" "r.(?)" "p.?" "43" "0000792222" "00007329" "90" "9082" "0" "9082" "0" "c.9082G>T" "r.(?)" "p.?" "43" "0000792246" "00007329" "90" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000792247" "00007329" "90" "408" "0" "423" "0" "c.408_423del" "r.(?)" "p.(Asn137Valfs*24)" "4" "0000792270" "00007329" "90" "7597" "0" "7597" "0" "c.7597A>G" "r.(?)" "p.(Lys2533Glu)" "39" "0000792335" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000792336" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000792341" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000792355" "00007329" "70" "6395" "0" "6395" "0" "c.6395T>C" "r.(?)" "p.(Leu2132Pro)" "" "0000792356" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000792378" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000792379" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000792383" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000792385" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000792405" "00007329" "70" "2471" "0" "2471" "0" "c.2471G>A" "r.(?)" "p.(Cys824Tyr)" "" "0000792406" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000792408" "00007329" "70" "9340" "0" "9340" "0" "c.9340G>C" "r.(?)" "p.(Asp3114His)" "" "0000792410" "00007329" "70" "1185" "-6" "1185" "-6" "c.1185-6T>G" "r.(=)" "p.(=)" "" "0000792412" "00007329" "70" "9106" "0" "9107" "0" "c.9106_9107insTATA" "r.(?)" "p.(Asn3036Ilefs*2)" "" "0000792413" "00007329" "70" "7048" "0" "7048" "0" "c.7048del" "r.(?)" "p.(Cys2350Alafs*97)" "" "0000793721" "00007329" "50" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000793722" "00007329" "50" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000793723" "00007329" "50" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000793911" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000793912" "00007329" "70" "1989" "0" "1989" "0" "c.1989del" "r.(?)" "p.(Tyr664Ilefs*19)" "" "0000793917" "00007329" "70" "2471" "0" "2471" "0" "c.2471G>A" "r.(?)" "p.(Cys824Tyr)" "" "0000793918" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000793931" "00007329" "70" "8963" "0" "8963" "0" "c.8963C>T" "r.(?)" "p.(Thr2988Ile)" "" "0000793932" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000793935" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000793949" "00007329" "70" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "4" "0000793950" "00007329" "70" "3226" "0" "3226" "0" "c.3226T>C" "r.(?)" "p.(Cys1076Arg)" "21" "0000793966" "00007329" "70" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "36" "0000793967" "00007329" "70" "9277" "0" "9278" "0" "c.9277_9278dup" "r.(?)" "p.(Arg3094Valfs*4)" "43" "0000794035" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000794062" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000794090" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000794091" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000794096" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000794097" "00007329" "70" "586" "0" "586" "0" "c.586A>C" "r.(?)" "p.(Lys196Gln)" "" "0000794194" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000794195" "00007329" "70" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "" "0000794201" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000794203" "00007329" "70" "9248" "0" "9248" "0" "c.9248G>A" "r.(?)" "p.(Gly3083Asp)" "" "0000794204" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000794217" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000794218" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000794222" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000794233" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000794234" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000794259" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000794260" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000794319" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000794320" "00007329" "90" "5254" "0" "5254" "0" "c.5254dup" "r.(?)" "p.(Ile1752Asnfs*18)" "26" "0000794321" "00007329" "90" "8326" "0" "8326" "0" "c.8326del" "r.(?)" "p.(Val2776*)" "43" "0000794322" "00007329" "90" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl" "p.?" "14i" "0000794323" "00007329" "90" "6545" "0" "6545" "0" "c.6545del" "r.(?)" "p.(Asn2182Thrfs*3)" "32" "0000794324" "00007329" "90" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl" "p.?" "14i" "0000794751" "00007329" "90" "875" "0" "888" "0" "c.875_888delinsTTT" "r.(?)" "p.(Glu292ValfsTer17)" "" "0000794770" "00007329" "70" "813" "0" "816" "0" "c.813_816dup" "r.(?)" "p.(Ile273Glnfs*6)" "" "0000794771" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000794794" "00007329" "70" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "" "0000794795" "00007329" "70" "1830" "0" "1830" "0" "c.1830del" "r.(?)" "p.(Asn611Thrfs*32)" "" "0000794796" "00007329" "70" "888" "0" "888" "0" "c.888del" "r.(?)" "p.(Lys296Asnfs*43)" "" "0000794797" "00007329" "70" "14" "0" "14" "0" "c.14C>A" "r.(?)" "p.(Ser5*)" "" "0000794800" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "" "0000794801" "00007329" "70" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "" "0000794846" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "" "0000794880" "00007329" "70" "-1" "0" "862" "1" "c.(?_-1)_(862+1_863-1)del" "r.?" "p.?" "" "0000794881" "00007329" "70" "863" "-1" "1299" "1" "c.(862+1_863-1)_(1299+1_1300-1)del" "r.spl?" "p.?" "" "0000794885" "00007329" "70" "0" "0" "0" "0" "c.-538_-332-5442{0}" "r.0?" "p.0?" "" "0000795943" "00007329" "70" "8789" "0" "8789" "0" "c.8789A>G" "r.(?)" "p.(Asp2930Gly)" "43" "0000796842" "00007329" "70" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "26" "0000796855" "00007329" "70" "2886" "0" "2886" "0" "c.2886C>G" "r.(?)" "p.(Phe962Leu)" "19" "0000796856" "00007329" "70" "2892" "0" "2892" "0" "c.2892A>C" "r.(?)" "p.(Glu964Asp)" "19" "0000796857" "00007329" "70" "5510" "0" "5510" "0" "c.5510G>C" "r.(?)" "p.(Trp1837Ser)" "26" "0000797059" "00007329" "90" "6544" "0" "6547" "0" "c.6544_6547del" "r.(?)" "p.(Asn2182Valfs*2)" "32" "0000797060" "00007329" "70" "4462" "0" "4469" "0" "c.4462_4469dup" "r.(?)" "p.(Met1491Alafs*12)" "26" "0000797061" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000797062" "00007329" "90" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "26" "0000797063" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000797064" "00007329" "50" "5927" "0" "5927" "0" "c.5927G>T" "r.(?)" "p.(Arg1976Met)" "28" "0000797065" "00007329" "90" "1299" "3" "1299" "3" "c.1299+3A>C" "r.spl?" "p.(?)" "8i" "0000797066" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000797067" "00007329" "90" "8793" "0" "8796" "0" "c.8793_8796del" "r.(?)" "p.(Gln2931Hisfs*43)" "43" "0000797068" "00007329" "70" "6726" "-1" "6834" "1" "c.(6725+1_6726-1)_(6834+1_6835-1)del" "r.(?)" "p.(?)" "34" "0000797140" "00007329" "70" "4597" "0" "4613" "0" "c.4597_4613del" "r.(?)" "p.(Ser1533Hisfs*9)" "26" "0000797141" "00007329" "50" "6835" "-1" "7055" "1" "c.(6834+1_6835-1)_(7055+1_7056-1)dup" "r.(?)" "p.(?)" "35" "0000797142" "00007329" "70" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Cys)" "40" "0000797143" "00007329" "50" "-539" "-1" "-448" "1" "c.(?_-539-1)_(-448+1_-447-1)del" "r.(?)" "p.(?)" "1" "0000797144" "00007329" "90" "8598" "0" "8598" "0" "c.8598del" "r.(?)" "p.(Gly2867Valfs*5)" "43" "0000797145" "00007329" "50" "5928" "-1" "6078" "1" "c.(5927+1_5928-1)_(6078+1_6079-1)dup" "r.(?)" "p.(?)" "29" "0000797146" "00007329" "50" "5928" "-1" "6078" "1" "c.(5927+1_5928-1)_(6078+1_6079-1)dup" "r.(?)" "p.(?)" "29" "0000797608" "00007329" "90" "4829" "0" "4832" "0" "c.4829_4832del" "r.(?)" "p.(Ser1610Phefs*7)" "" "0000797609" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797610" "00007329" "70" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "" "0000797611" "00007329" "70" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797612" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797613" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797614" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797615" "00007329" "50" "9344" "0" "9344" "0" "c.9344T>A" "r.(?)" "p.(Val3115Asp)" "" "0000797616" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797617" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797618" "00007329" "70" "9317" "0" "9336" "0" "c.9317_9336del" "r.(?)" "p.(Thr3106Lysfs*13)" "" "0000797619" "00007329" "50" "2023" "5" "2023" "5" "c.2023+5G>T" "r.spl?" "p.(?)" "" "0000797621" "00007329" "70" "7412" "-1" "7412" "-1" "c.7412-1G>C" "r.spl" "p.(?)" "" "0000797622" "00007329" "70" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*3)" "" "0000797623" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797624" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000797625" "00007329" "50" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000797626" "00007329" "70" "8054" "0" "8054" "0" "c.8054G>A" "r.(?)" "p.(Gly2685Glu)" "" "0000797627" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000797628" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797630" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000797631" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797632" "00007329" "70" "873" "0" "873" "0" "c.873T>A" "r.(?)" "p.(Cys291*)" "" "0000797633" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000797634" "00007329" "90" "2024" "-1" "3443" "1" "c.(2023+1_2024-1)_(3443+1_3444-1)del" "r.(?)" "p.(?)" "" "0000797636" "00007329" "90" "6079" "-1" "6191" "1" "c.(6078+1_6079-1)_(6191+1_6192-1)dup" "r.(?)" "p.(?)" "" "0000797637" "00007329" "70" "350" "0" "350" "0" "c.350del" "r.(?)" "p.(Asn117Ilefs*14)" "" "0000797638" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000797640" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797642" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797643" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000797644" "00007329" "70" "2138" "-1" "2259" "1" "c.(2137+1_2138-1)_(2259+1_2260-1)dup" "r.(?)" "p.(?)" "" "0000797645" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797646" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000797647" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797648" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797649" "00007329" "90" "6591" "0" "6594" "0" "c.6591_6594del" "r.(?)" "p.(Lys2198Serfs*25)" "" "0000797650" "00007329" "70" "2642" "-1" "2846" "1" "c.(2641+1_2642-1)_(2846+1_2847-1)del" "r.(?)" "p.(?)" "" "0000797651" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797652" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797653" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797654" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797655" "00007329" "90" "6591" "0" "6594" "0" "c.6591_6594del" "r.(?)" "p.(Lys2198Serfs*25)" "" "0000797656" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797657" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797658" "00007329" "90" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000797659" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000797660" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000797661" "00007329" "50" "2023" "5" "2023" "5" "c.2023+5G>T" "r.spl?" "p.(?)" "" "0000797662" "00007329" "70" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl" "p.(?)" "" "0000797817" "00007329" "70" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "" "0000797897" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000798000" "00007329" "90" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000798001" "00007329" "70" "6079" "-1" "6191" "1" "c.(6078+1_6079-1)_(6191+1_6192-1)del" "r.(?)" "p.(?)" "" "0000798002" "00007329" "50" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "" "0000798003" "00007329" "50" "2000" "0" "2000" "0" "c.2000G>A" "r.(?)" "p.(Arg667His)" "" "0000798004" "00007329" "70" "1459" "5" "1459" "5" "c.1459+5C>T" "r.spl?" "p.(?)" "" "0000798005" "00007329" "70" "1765" "0" "1765" "0" "c.1765A>G" "r.(?)" "p.(Arg589Gly)" "" "0000798006" "00007329" "70" "7949" "0" "7949" "0" "c.7949C>T" "r.(?)" "p.(Ser2650Phe)" "" "0000798327" "00007329" "70" "9380" "0" "9399" "0" "c.9380_9399del" "r.(?)" "p.(Thr3127fs*13)" "44" "0000798501" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000802665" "00007329" "30" "8164" "0" "8164" "0" "c.8164T>C" "r.(?)" "p.(Leu2722=)" "" "0000802666" "00007329" "70" "7055" "1" "7055" "1" "c.7055+1G>T" "r.spl?" "p.?" "" "0000802667" "00007329" "50" "6047" "0" "6047" "0" "c.6047G>A" "r.(?)" "p.(Gly2016Asp)" "" "0000802668" "00007329" "30" "5956" "0" "5956" "0" "c.5956C>T" "r.(?)" "p.(Leu1986=)" "" "0000802669" "00007329" "50" "5743" "0" "5743" "0" "c.5743A>G" "r.(?)" "p.(Ser1915Gly)" "" "0000802670" "00007329" "50" "5524" "0" "5524" "0" "c.5524C>A" "r.(?)" "p.(Leu1842Ile)" "" "0000802671" "00007329" "50" "2452" "0" "2452" "0" "c.2452T>C" "r.(?)" "p.(Cys818Arg)" "" "0000802672" "00007329" "50" "2288" "0" "2288" "0" "c.2288G>T" "r.(?)" "p.(Trp763Leu)" "" "0000802673" "00007329" "30" "1899" "0" "1899" "0" "c.1899A>G" "r.(?)" "p.(Gln633=)" "" "0000802674" "00007329" "90" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558Ter)" "" "0000802675" "00007329" "30" "1479" "0" "1479" "0" "c.1479C>T" "r.(?)" "p.(Cys493=)" "" "0000802676" "00007329" "50" "1429" "0" "1429" "0" "c.1429T>C" "r.(?)" "p.(Phe477Leu)" "" "0000802677" "00007329" "50" "788" "0" "788" "0" "c.788A>G" "r.(?)" "p.(His263Arg)" "" "0000811482" "00007329" "90" "9368" "0" "9368" "0" "c.9368del" "r.(?)" "p.(Asn3123ThrfsTer4)" "" "0000811483" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000811484" "00007329" "90" "2522" "0" "2522" "0" "c.2522dup" "r.(?)" "p.(Tyr841Ter)" "" "0000811485" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000811518" "00007329" "50" "7025" "0" "7025" "0" "c.7025A>C" "r.(?)" "p.(His2342Pro)" "" "0000811519" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000811520" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000811521" "00007329" "90" "2382" "-2" "2382" "-2" "c.2382-2A>T" "r.spl" "p.(?)" "" "0000811807" "00007329" "70" "7949" "0" "7949" "0" "c.7949C>T" "r.(?)" "p.(Ser2650Phe)" "" "0000811814" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "" "0000811830" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000811852" "00007329" "70" "1418" "0" "1418" "0" "c.1418G>T" "r.(?)" "p.(Gly473Val)" "" "0000811853" "00007329" "70" "7793" "0" "7793" "0" "c.7793G>A" "r.(?)" "p.(Gly2598Asp)" "" "0000811855" "00007329" "70" "2000" "0" "2000" "0" "c.2000G>A" "r.(?)" "p.(Arg667His)" "" "0000811909" "00007329" "70" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "" "0000811936" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000811937" "00007329" "70" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl?" "p.(?)" "" "0000812006" "00007329" "70" "780" "0" "780" "0" "c.780T>A" "r.(?)" "p.(Cys260*)" "5" "0000812007" "00007329" "70" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000812011" "00007329" "70" "2826" "0" "2827" "0" "c.2826_2827del" "r.(?)" "p.(Val944Glyfs*9)" "18" "0000812034" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "26" "0000812035" "00007329" "70" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "43" "0000812074" "00007329" "70" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000812118" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000812169" "00007329" "70" "3003" "0" "3003" "0" "c.3003T>A" "r.(?)" "p.(Cys1001*)" "20" "0000812170" "00007329" "70" "9079" "0" "9079" "0" "c.9079dup" "r.(?)" "p.(Arg3027Lysfs*9)" "43" "0000812242" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000812246" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000812247" "00007329" "70" "5857" "0" "5857" "0" "c.5857G>T" "r.(?)" "p.(Glu1953*)" "28" "0000812253" "00007329" "70" "6425" "-1" "6725" "1" "c.(6424+1_6425-1)_(6725+1_6726-1)del" "r.(?)" "p.(?)" "_32_33_" "0000812254" "00007329" "70" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000812298" "00007329" "70" "773" "0" "773" "0" "c.773G>T" "r.(?)" "p.(Gly258Val)" "5" "0000812299" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000812325" "00007329" "70" "6725" "4" "6725" "4" "c.6725+4del" "r.(?)" "p.(?)" "33i" "0000812327" "00007329" "70" "8249" "0" "8249" "0" "c.8249T>A" "r.(?)" "p.(Ile2750Asn)" "43" "0000812355" "00007329" "70" "2981" "0" "2981" "0" "c.2981del" "r.(?)" "p.(Pro994Leufs*10)" "19" "0000812366" "00007329" "70" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794*)" "15" "0000812367" "00007329" "70" "6425" "-1" "6725" "1" "c.(6424+1_6425-1)_(6725+1_6726-1)del" "r.(?)" "p.(?)" "_32_33_" "0000812431" "00007329" "70" "7736" "0" "7742" "0" "c.7736_7742del" "r.(?)" "p.(Thr2579Lysfs*36)" "40" "0000812438" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "26" "0000812440" "00007329" "70" "4953" "0" "4953" "0" "c.4953dup" "r.(?)" "p.(Ser1652Ilefs*3)" "26" "0000812452" "00007329" "70" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.(?)" "p.(?)" "28i" "0000812563" "00007329" "70" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "" "0000812564" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000812579" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000812580" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000813182" "00007329" "70" "3695" "0" "3695" "0" "c.3695T>C" "r.(?)" "p.(Ile1232Thr)" "25" "0000813183" "00007329" "70" "1767" "-1" "2023" "1" "c.(?_1767-1)_(2023+1_?)del" "r.spl?" "p.?" "11i_12i" "0000813184" "00007329" "70" "1971" "0" "1971" "0" "c.1971del" "r.(?)" "p.(Ser658Valfs*4)" "12" "0000813185" "00007329" "70" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "28i" "0000813186" "00007329" "70" "8003" "0" "8003" "0" "c.8003G>T" "r.(?)" "p.(Cys2668Phe)" "41" "0000813200" "00007329" "30" "-459" "0" "-459" "0" "c.-459C>T" "r.(=)" "p.(=)" "1" "0000813201" "00007329" "30" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "12" "0000813202" "00007329" "30" "2024" "-14" "2024" "-14" "c.2024-14C>T" "r.(=)" "p.(=)" "12i" "0000813203" "00007329" "30" "7228" "7" "7228" "7" "c.7228+7G>A" "r.(=)" "p.(=)" "36i" "0000813204" "00007329" "30" "7608" "0" "7608" "0" "c.7608C>T" "r.(=)" "p.(=)" "39" "0000813901" "00007329" "70" "8133" "0" "8137" "0" "c.8133_8137del" "r.(?)" "p.(Phe2712Cysfs*33)" "" "0000813902" "00007329" "70" "8816" "0" "8816" "0" "c.8816G>C" "r.(?)" "p.(Cys2939Ser)" "" "0000814262" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000814264" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000814272" "00007329" "70" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "42" "0000814299" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000814753" "00007329" "90" "8545" "0" "8545" "0" "c.8545C>T" "r.(?)" "p.(Arg2849*)" "43" "0000814764" "00007329" "70" "2953" "0" "2961" "0" "c.2953_2961del" "r.(?)" "p.(Thr985_Gly987del)" "19" "0000814771" "00007329" "90" "4955" "0" "4955" "0" "c.4955C>A" "r.(?)" "p.(Ser1652*)" "26" "0000814779" "00007329" "70" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "43" "0000814796" "00007329" "90" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl" "p.(?)" "26i" "0000814802" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000814806" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000814811" "00007329" "70" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000814928" "00007329" "70" "2260" "-1437" "2847" "-6314" "c.2260-1437_2847-6314del" "r.(?)" "p.(?)" "_15_18_" "0000814931" "00007329" "70" "2993" "-23264" "3443" "16370" "c.2993-23264_3443+16370del" "r.(?)" "p.(?)" "_20_22_" "0000815370" "00007329" "90" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374Ter)" "" "0000815395" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000815396" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000815415" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.(?)" "" "0000815499" "00007329" "50" "2309" "0" "2309" "0" "c.2309A>C" "r.(?)" "p.(Gln770Pro)" "" "0000815518" "00007329" "90" "2381" "1" "3243" "-1" "c.(2381+1_2381-1)_(3243+1_3243-1)del" "r.spl" "p.(?)" "" "0000815536" "00007329" "50" "7941" "0" "7941" "0" "c.7941G>C" "r.(?)" "p.(Glu2647Asp)" "" "0000815547" "00007329" "70" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "" "0000815549" "00007329" "70" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "" "0000815553" "00007329" "90" "1766" "1" "2023" "-1" "c.(1766+1_1766-1)_(2023+1_2023-1)del" "r.spl" "p.(?)" "" "0000815608" "00007329" "50" "7222" "0" "7222" "0" "c.7222A>G" "r.(?)" "p.(Thr2408Ala)" "" "0000815624" "00007329" "90" "6424" "1" "6725" "-1" "c.(6424+1_6424-1)_(6725+1_6725-1)del" "r.spl" "p.(?)" "" "0000815953" "00007329" "70" "8233" "1" "8233" "1" "c.8233+1del" "r.spl" "p.(?)" "" "0000815959" "00007329" "70" "2138" "-308" "2259" "311" "c.2138-308_2259+311del" "r.spl" "p.(?)" "" "0000815960" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000815974" "00007329" "70" "6425" "-250" "6571" "251" "c.6425-250_6571+251del" "r.spl" "p.(?)" "" "0000815979" "00007329" "50" "9344" "0" "9344" "0" "c.9344T>A" "r.(?)" "p.(Val3115Asp)" "" "0000815987" "00007329" "70" "7412" "-250" "7898" "251" "c.7412-250_7898+251dup" "r.spl" "p.(?)" "" "0000815995" "00007329" "70" "2993" "-1" "2993" "-1" "c.2993-1G>A" "r.spl" "p.(?)" "" "0000816004" "00007329" "70" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176*)" "" "0000816009" "00007329" "70" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "" "0000816010" "00007329" "50" "9235" "0" "9235" "0" "c.9235C>G" "r.(?)" "p.(Leu3079Val)" "" "0000816014" "00007329" "50" "6078" "0" "6078" "0" "c.6078G>T" "r.(?)" "p.(Gln2026His)" "" "0000816021" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "" "0000816031" "00007329" "70" "6425" "-250" "6571" "251" "c.6425-250_6571+251del" "r.spl" "p.(?)" "" "0000816037" "00007329" "70" "1300" "-249" "1459" "251" "c.1300-249_1459+251del" "r.spl" "p.(?)" "" "0000816038" "00007329" "50" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "" "0000816055" "00007329" "70" "6835" "-249" "7055" "251" "c.6835-249_7055+251del" "r.spl" "p.(?)" "" "0000816059" "00007329" "70" "7056" "-42876" "8072" "-16877" "c.7056-42876_8072-16877del" "r.spl" "p.(?)" "" "0000816086" "00007329" "70" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "" "0000816098" "00007329" "70" "2259" "17802" "3444" "-36287" "c.2259+17802_3444-36287del" "r.spl" "p.(?)" "" "0000816112" "00007329" "50" "8080" "0" "8080" "0" "c.8080A>G" "r.(?)" "p.(Ile2694Val)" "" "0000816120" "00007329" "70" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "" "0000816122" "00007329" "70" "2260" "-24198" "2993" "-16296" "c.2260-24198_2993-16296del" "r.spl" "p.(?)" "" "0000816126" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000816127" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.(?)" "" "0000816144" "00007329" "70" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl" "p.(?)" "" "0000816185" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.(?)" "" "0000816198" "00007329" "70" "9159" "0" "9160" "0" "c.9159_9160del" "r.(?)" "p.(Gln3053Hisfs*9)" "" "0000816211" "00007329" "70" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558*)" "" "0000816234" "00007329" "70" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Gln874*)" "" "0000816258" "00007329" "50" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000816305" "00007329" "90" "3003" "0" "3003" "0" "c.3003T>A" "r.(?)" "p.(Cys1001*)" "" "0000816311" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000816323" "00007329" "70" "2194" "0" "2194" "0" "c.2194C>T" "r.(?)" "p.(Gln732*)" "" "0000816324" "00007329" "50" "9344" "0" "9344" "0" "c.9344T>A" "r.(?)" "p.(Val3115Asp)" "" "0000816331" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000816338" "00007329" "50" "3922" "0" "3922" "0" "c.3922A>G" "r.(?)" "p.(Thr1308Ala)" "" "0000816339" "00007329" "90" "6544" "0" "6547" "0" "c.6544_6547del" "r.(?)" "p.(Asn2182Valfs*2)" "" "0000816346" "00007329" "70" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176*)" "" "0000816350" "00007329" "50" "4465" "0" "4465" "0" "c.4465C>T" "r.(?)" "p.(Pro1489Ser)" "" "0000816351" "00007329" "50" "9131" "0" "9131" "0" "c.9131G>T" "r.(?)" "p.(Trp3044Leu)" "" "0000816355" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000816364" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "" "0000816374" "00007329" "50" "1751" "0" "1751" "0" "c.1751A>C" "r.(?)" "p.(Glu584Ala)" "" "0000816375" "00007329" "50" "9131" "0" "9131" "0" "c.9131G>T" "r.(?)" "p.(Trp3044Leu)" "" "0000816391" "00007329" "70" "2964" "0" "2964" "0" "c.2964C>G" "r.(?)" "p.(Tyr988*)" "" "0000816415" "00007329" "70" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "" "0000816421" "00007329" "90" "3003" "0" "3003" "0" "c.3003T>A" "r.(?)" "p.(Cys1001*)" "" "0000816431" "00007329" "90" "9354" "0" "9354" "0" "c.9354dup" "r.(?)" "p.(Gln3119Serfs*7)" "" "0000816437" "00007329" "70" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "" "0000816438" "00007329" "90" "3003" "0" "3003" "0" "c.3003T>A" "r.(?)" "p.(Cys1001*)" "" "0000816442" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000816443" "00007329" "70" "8413" "0" "8413" "0" "c.8413dup" "r.(?)" "p.(Thr2805Asnfs*7)" "" "0000816455" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000816489" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.(?)" "" "0000816499" "00007329" "70" "2976" "0" "2976" "0" "c.2976T>A" "r.(?)" "p.(Cys992*)" "" "0000816510" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000816523" "00007329" "50" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Ala3021Pro)" "" "0000816565" "00007329" "70" "2530" "0" "2530" "0" "c.2530C>T" "r.(?)" "p.(Gln844*)" "16" "0000816725" "00007329" "70" "5928" "0" "5928" "0" "c.5928del" "r.(?)" "p.(Arg1976Serfs*11)" "" "0000816726" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000816727" "00007329" "70" "3555" "0" "3555" "0" "c.3555C>G" "r.(?)" "p.(Cys1185Trp)" "" "0000816728" "00007329" "70" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176*)" "" "0000816729" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "" "0000816730" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000816731" "00007329" "70" "1645" "0" "1645" "0" "c.1645G>T" "r.(?)" "p.(Glu549*)" "" "0000816732" "00007329" "70" "7578" "1" "7578" "1" "c.7578+1G>A" "r.(?)" "p.(?)" "" "0000816733" "00007329" "70" "9383" "0" "9387" "0" "c.9383_9387del" "r.(?)" "p.(Lys3128Argfs*7)" "" "0000816734" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000816735" "00007329" "70" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "" "0000816736" "00007329" "70" "9317" "0" "9336" "0" "c.9317_9336del" "r.(?)" "p.(Thr3106Lysfs*13)" "" "0000816830" "00007329" "70" "1308" "0" "1308" "0" "c.1308C>A" "r.(?)" "p.(Cys436*)" "" "0000816831" "00007329" "70" "1299" "5" "1299" "8" "c.1299+5_1299+8del" "r.(?)" "p.(?)" "" "0000816832" "00007329" "70" "8633" "0" "8633" "0" "c.8633C>G" "r.(?)" "p.(Ala2878Gly)" "" "0000816833" "00007329" "70" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "" "0000816834" "00007329" "70" "2992" "1" "2992" "1" "c.2992+1G>A" "r.(?)" "p.(?)" "" "0000816835" "00007329" "70" "6571" "5" "6571" "5" "c.6571+5G>A" "r.(?)" "p.(?)" "" "0000816836" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000816837" "00007329" "70" "1641" "0" "1644" "0" "c.1641_1644del" "r.(?)" "p.(Ser547Argfs*62)" "" "0000816838" "00007329" "70" "9004" "0" "9004" "0" "c.9004C>T" "r.(?)" "p.(Gln3002*)" "" "0000817314" "00007329" "90" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "41" "0000817332" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000817337" "00007329" "50" "2756" "0" "2756" "0" "c.2756G>A" "r.(?)" "p.(Gly919Glu)" "18" "0000817338" "00007329" "50" "6410" "0" "6410" "0" "c.6410G>A" "r.(?)" "p.(Arg2137His)" "31" "0000817634" "00007329" "70" "5834" "0" "5834" "0" "c.5834del" "r.(?)" "NP_001136272.1" "" "0000817635" "00007329" "70" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265GlnfsTer46)" "" "0000818943" "00007329" "70" "2260" "-1" "2846" "1" "c.(2259+1_2260-1)_(2846+1_2847-1)del" "r.spl?" "p.?" "14i_18i" "0000818944" "00007329" "70" "8054" "0" "8054" "0" "c.8054G>A" "r.(?)" "p.(Gly2685Glu)" "41" "0000818947" "00007329" "70" "6726" "-2973" "6834" "548" "c.6726-2973_6834+548del" "r.(?)" "p.(Tyr2243Hisfs*32)" "33i_34i" "0000818962" "00007329" "70" "6425" "-1" "6571" "1" "c.(6424+1_6425-1)_(6571+1_6572-1)del" "r.?" "p.?" "31i_32i" "0000818963" "00007329" "70" "9061" "0" "9061" "0" "c.9061G>C" "r.(?)" "p.(Ala3021Pro)" "43" "0000818980" "00007329" "70" "6079" "-1" "6191" "1" "c.(6078+1_6079-1)_(6191+1_6192-1)dup" "r.?" "p.?" "29i_30i" "0000818981" "00007329" "50" "6726" "-1" "7055" "1" "c.(6725+1_6726-1)_(7055+1_7056-1)dup" "r.?" "p.?" "33i_35i" "0000819043" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.(?)" "" "0000819414" "00007329" "70" "5927" "1" "5927" "1" "c.5927+1G>T" "r.spl" "p.(?)" "" "0000819415" "00007329" "70" "5927" "1" "5927" "1" "c.5927+1G>T" "r.spl" "p.(?)" "" "0000819422" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000819423" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000819439" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000819469" "00007329" "70" "732" "0" "732" "0" "c.732T>A" "r.(?)" "p.(Cys244*)" "" "0000819783" "00007329" "70" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "" "0000819856" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000819862" "00007329" "70" "4936" "0" "4936" "0" "c.4936G>T" "r.(?)" "p.(Glu1646*)" "" "0000819863" "00007329" "70" "4936" "0" "4936" "0" "c.4936G>T" "r.(?)" "p.(Glu1646*)" "" "0000819888" "00007329" "70" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "" "0000819889" "00007329" "70" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "" "0000819923" "00007329" "70" "2194" "0" "2194" "0" "c.2194C>T" "r.(?)" "p.(Gln732*)" "" "0000819924" "00007329" "70" "2194" "0" "2194" "0" "c.2194C>T" "r.(?)" "p.(Gln732*)" "" "0000819982" "00007329" "70" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135*)" "" "0000820023" "00007329" "70" "8793" "0" "8796" "0" "c.8793_8796del" "r.(?)" "p.(Gln2931Hisfs*43)" "" "0000820024" "00007329" "70" "8793" "0" "8796" "0" "c.8793_8796del" "r.(?)" "p.(Gln2931Hisfs*43)" "" "0000820030" "00007329" "70" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558*)" "" "0000820125" "00007329" "70" "9392" "0" "9392" "0" "c.9392G>C" "r.(?)" "p.(Gly3131Ala)" "" "0000820130" "00007329" "70" "3243" "1" "3243" "1" "c.3243+1G>A" "r.spl" "p.(?)" "" "0000820161" "00007329" "70" "8793" "0" "8796" "0" "c.8793_8796del" "r.(?)" "p.(Gln2931Hisfs*43)" "" "0000820189" "00007329" "70" "3562" "0" "3562" "0" "c.3562C>T" "r.(?)" "p.(Gln1188*)" "" "0000820193" "00007329" "70" "6544" "0" "6547" "0" "c.6544_6547del" "r.(?)" "p.(Asn2182Valfs*2)" "" "0000820226" "00007329" "70" "67" "0" "67" "0" "c.67dup" "r.(?)" "p.(Thr23Asnfs*3)" "" "0000820227" "00007329" "70" "1299" "3" "1299" "3" "c.1299+3A>C" "r.spl?" "p.(?)" "" "0000820234" "00007329" "70" "7811" "0" "7811" "0" "c.7811G>A" "r.(?)" "p.(Arg2604His)" "" "0000820271" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000820357" "00007329" "70" "5666" "0" "5666" "0" "c.5666del" "r.(?)" "p.(Tyr1889Leufs*6)" "" "0000820378" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000820391" "00007329" "70" "2420" "0" "2420" "0" "c.2420del" "r.(?)" "p.(Ser807Metfs*4)" "" "0000820397" "00007329" "70" "1459" "5" "1459" "5" "c.1459+5C>T" "r.spl?" "p.(?)" "" "0000820400" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000820415" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000820464" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000820520" "00007329" "70" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "" "0000820522" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "" "0000820551" "00007329" "70" "9392" "0" "9392" "0" "c.9392G>C" "r.(?)" "p.(Gly3131Ala)" "" "0000820565" "00007329" "70" "2055" "0" "2055" "0" "c.2055T>A" "r.(?)" "p.(Cys685*)" "" "0000820598" "00007329" "70" "2499" "0" "2499" "0" "c.2499T>G" "r.(?)" "p.(Phe833Leu)" "" "0000820640" "00007329" "70" "3878" "-1" "5927" "1" "c.(3877+1_3878-1)_(5927+1_5928-1)del" "r.spl" "p.(?)" "" "0000820641" "00007329" "70" "3878" "-1" "5927" "1" "c.(3877+1_3878-1)_(5927+1_5928-1)del" "r.spl" "p.(?)" "" "0000820647" "00007329" "70" "7228" "0" "7228" "0" "c.7228G>T" "r.(?)" "p.(Ala2410Ser)" "" "0000820657" "00007329" "70" "5802" "0" "5802" "0" "c.5802dup" "r.(?)" "p.(Ile1935Tyrfs*6)" "" "0000820719" "00007329" "70" "6571" "1" "6571" "1" "c.6571+1G>A" "r.spl" "p.(?)" "" "0000820739" "00007329" "70" "6250" "0" "6250" "0" "c.6250C>T" "r.(?)" "p.(Gln2084*)" "" "0000820740" "00007329" "70" "6250" "0" "6250" "0" "c.6250C>T" "r.(?)" "p.(Gln2084*)" "" "0000820750" "00007329" "70" "-538" "0" "862" "1" "c.(?_-538)_(862+1_863-1)del" "r.spl" "p.(?)" "" "0000820751" "00007329" "70" "-538" "0" "862" "1" "c.(?_-538)_(862+1_863-1)del" "r.spl" "p.(?)" "" "0000820789" "00007329" "70" "6174" "0" "6174" "0" "c.6174T>G" "r.(?)" "p.(Tyr2058*)" "" "0000820821" "00007329" "70" "5413" "0" "5413" "0" "c.5413C>T" "r.(?)" "p.(Gln1805*)" "" "0000820847" "00007329" "70" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "" "0000820853" "00007329" "70" "232" "0" "232" "0" "c.232del" "r.(?)" "p.(Cys78Alafs*7)" "" "0000820894" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000820896" "00007329" "70" "7442" "0" "7442" "0" "c.7442G>A" "r.(?)" "p.(Gly2481Asp)" "" "0000820899" "00007329" "70" "8408" "0" "8408" "0" "c.8408dup" "r.(?)" "p.(Asn2803Lysfs*9)" "" "0000820905" "00007329" "70" "1300" "-1" "1459" "1" "c.(1299+1_1300-1)_(1459+1_1460-1)del" "r.spl" "p.(?)" "" "0000820956" "00007329" "70" "8035" "0" "8035" "0" "c.8035T>G" "r.(?)" "p.(Cys2679Gly)" "" "0000820971" "00007329" "70" "3685" "-1" "5644" "1" "c.(3684+1_3685-1)_(5644+1_5645-1)del" "r.spl" "p.(?)" "" "0000820978" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000820990" "00007329" "70" "1460" "-1" "5644" "1" "c.(1459+1_1460-1)_(5644+1_5645-1)del" "r.spl" "p.(?)" "" "0000821241" "00007329" "90" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365*)" "" "0000821242" "00007329" "70" "6937" "0" "6937" "0" "c.6937C>T" "r.(?)" "p.(Gln2313*)" "" "0000821243" "00007329" "70" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Asn404Thrfs*17)" "" "0000821244" "00007329" "90" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Gln874*)" "" "0000821245" "00007329" "70" "5928" "-3" "5928" "-1" "c.5928-3_5928-1del" "r.spl" "p.(?)" "" "0000821246" "00007329" "70" "2000" "0" "2000" "0" "c.2000G>A" "r.(?)" "p.(Arg667His)" "" "0000821247" "00007329" "70" "3775" "0" "3775" "0" "c.3775C>T" "r.(?)" "p.(Gln1259*)" "" "0000821248" "00007329" "70" "5408" "0" "5408" "0" "c.5408C>G" "r.(?)" "p.(Ser1803*)" "" "0000821249" "00007329" "70" "6502" "0" "6502" "0" "c.6502G>T" "r.(?)" "p.(Glu2168*)" "" "0000821250" "00007329" "70" "6323" "0" "6323" "0" "c.6323G>A" "r.(?)" "p.(Cys2108Tyr)" "" "0000821464" "00007329" "70" "6726" "-2973" "6834" "548" "c.6726-2973_6834+548del" "r.(?)" "p.(Tyr2243Hisfs*32)" "33i_34i" "0000821550" "00007329" "70" "8368" "0" "8368" "0" "c.8368A>G" "r.(?)" "p.(Arg2790Gly)" "" "0000821551" "00007329" "70" "5317" "0" "5342" "0" "c.5317_5342delinsTA" "r.(?)" "p.(Asn1773*)" "" "0000821552" "00007329" "70" "977" "0" "977" "0" "c.977G>A" "r.(?)" "p.(Ser326Asn)" "" "0000821553" "00007329" "70" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349*)" "" "0000821554" "00007329" "70" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.(?)" "" "0000821555" "00007329" "70" "0" "0" "0" "0" "c.?" "r.0?" "p.0?" "" "0000821556" "00007329" "70" "6545" "0" "6545" "0" "c.6545del" "r.(?)" "p.(Asn2182Thrfs*3)" "" "0000822052" "00007329" "70" "1767" "-1" "2023" "1" "c.(1766+1_1767-1)_(2023+1_2024-1)del" "r.spl" "p.(?)" "" "0000822053" "00007329" "70" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.(?)" "p.(?)" "" "0000822143" "00007329" "90" "5928" "-37922" "6078" "38716" "c.5928-37922_6078+38716del" "r.(?)" "p.(Gln1977Cysfs*12)" "28i_29i" "0000822769" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822771" "00007329" "70" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "" "0000822772" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822773" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822775" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Tyr2555fs)" "" "0000822777" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000822780" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822781" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000822782" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822785" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Asp498fs)" "" "0000822786" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822787" "00007329" "70" "8391" "0" "8391" "0" "c.8391del" "r.(?)" "p.(Gly2799Valfs*31)" "" "0000822788" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822790" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822802" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822804" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822805" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822809" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822814" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822815" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822816" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Gln3101fs)" "" "0000822818" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822819" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822820" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822821" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822823" "00007329" "70" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "" "0000822826" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822827" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822828" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822829" "00007329" "70" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000822830" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822834" "00007329" "70" "607" "0" "607" "0" "c.607C>T" "r.(?)" "p.(Gln203*)" "" "0000822835" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000822836" "00007329" "70" "1211" "0" "1211" "0" "c.1211dup" "r.(?)" "p.(Asn404Lysfs*3)" "" "0000822838" "00007329" "70" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "" "0000822839" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822840" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000822841" "00007329" "70" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "" "0000822842" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000822843" "00007329" "70" "5608" "0" "5608" "0" "c.5608C>T" "r.(?)" "p.(Arg1870Trp)" "" "0000822844" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935*)" "" "0000822849" "00007329" "70" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "" "0000822850" "00007329" "70" "35" "0" "35" "0" "c.35T>C" "r.(?)" "p.(Met12Thr)" "" "0000822854" "00007329" "70" "205" "0" "206" "0" "c.205_206insAAACTGGCAT" "r.(?)" "p.(Ser69*)" "" "0000822857" "00007329" "70" "8812" "0" "8812" "0" "c.8812C>A" "r.(?)" "p.(Leu2938Met)" "" "0000822858" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000824393" "00007329" "90" "8278" "0" "8278" "0" "c.8278C>T" "r.(?)" "p.(Arg2760Cys)" "43" "0000824394" "00007329" "90" "8804" "0" "8804" "0" "c.8804dup" "r.(?)" "p.(Tyr2935*)" "43" "0000824644" "00007329" "50" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000824647" "00007329" "30" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000824648" "00007329" "50" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "" "0000824652" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824669" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824671" "00007329" "30" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Leu302Phe)" "" "0000824673" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824721" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824729" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824730" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824731" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653LysfsTer2)" "" "0000824757" "00007329" "50" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935Ter)" "" "0000824766" "00007329" "50" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935Ter)" "" "0000824769" "00007329" "50" "9043" "0" "9044" "0" "c.9043_9044insTATA" "r.(?)" "p.(Asn3015IlefsTer2)" "" "0000824796" "00007329" "50" "9302" "0" "9303" "0" "c.9302_9303del" "r.(?)" "p.(Gln3101ArgfsTer4)" "" "0000824800" "00007329" "50" "7547" "0" "7547" "0" "c.7547T>A" "r.(?)" "p.(Leu2516Gln)" "" "0000824801" "00007329" "30" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "" "0000825748" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000825849" "00007329" "70" "6545" "0" "6545" "0" "c.6545del" "r.(?)" "p.(Asn2182Thrfs*3)" "32" "0000825850" "00007329" "70" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000825860" "00007329" "70" "2280" "0" "2283" "0" "c.2280_2283del" "r.(?)" "p.(Ser761Ilefs*16)" "15" "0000825861" "00007329" "70" "8411" "0" "8412" "0" "c.8411_8412insTT" "r.(?)" "p.(Thr2805*)" "43" "0000825882" "00007329" "70" "5254" "0" "5254" "0" "c.5254dup" "r.(?)" "p.(Ile1752Asnfs*18)" "26" "0000825890" "00007329" "70" "8309" "0" "8309" "0" "c.8309T>C" "r.(?)" "p.(Leu2770Pro)" "43" "0000825896" "00007329" "70" "863" "-1" "1184" "1" "c.863-1_1184+1del" "r.spl?" "p.?" "5i_7i" "0000825897" "00007329" "70" "2024" "-1" "2381" "1" "c.2024-1_2381+1del" "r.spl?" "p.?" "12i_15i" "0000825906" "00007329" "70" "919" "0" "919" "0" "c.919G>T" "r.(?)" "p.(Gly307*)" "6" "0000825907" "00007329" "70" "6192" "-1" "6571" "1" "c.6192-1_6571+1del" "r.spl?" "p.?" "30i_32i" "0000825927" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000825928" "00007329" "70" "1641" "0" "1644" "0" "c.1641_1644del" "r.(?)" "p.(Ser547Argfs*62)" "11" "0000826035" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000826036" "00007329" "70" "1750" "0" "1750" "0" "c.1750G>T" "r.(?)" "p.(Glu584*)" "11" "0000826056" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000826058" "00007329" "70" "4655" "0" "4655" "0" "c.4655T>A" "r.(?)" "p.(Leu1552*)" "26" "0000826059" "00007329" "70" "2260" "-1" "2381" "1" "c.2260-1_2381+1del" "r.spl?" "p.?" "14i_15i" "0000826083" "00007329" "70" "8309" "0" "8309" "0" "c.8309T>C" "r.(?)" "p.(Leu2770Pro)" "43" "0000826084" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000826136" "00007329" "70" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl?" "p.?" "36i" "0000826179" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000826180" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "38" "0000826222" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "38" "0000826223" "00007329" "70" "3188" "0" "3189" "0" "c.3188_3189del" "r.(?)" "p.(Tyr1063Serfs*5)" "21" "0000826224" "00007329" "70" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Leu302Phe)" "6" "0000826237" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000826238" "00007329" "70" "9383" "0" "9387" "0" "c.9383_9387del" "r.(?)" "p.(Lys3128Argfs*7)" "43" "0000826253" "00007329" "70" "8143" "0" "8143" "0" "c.8143C>T" "r.(?)" "p.(Arg2715*)" "42" "0000826254" "00007329" "70" "2138" "-1" "3443" "1" "c.2138-1_3443+1del" "r.spl?" "p.?" "13i_22i" "0000826295" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000826296" "00007329" "70" "2486" "0" "2486" "0" "c.2486del" "r.(?)" "p.(Ile829Thrfs*39)" "16" "0000826320" "00007329" "70" "8422" "0" "8422" "0" "c.8422G>A" "r.(?)" "p.(Ala2808Thr)" "43" "0000826321" "00007329" "70" "2287" "0" "2287" "0" "c.2287T>C" "r.(?)" "p.(Trp763Arg)" "15" "0000826366" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "38" "0000826367" "00007329" "70" "6572" "-2" "6572" "-1" "c.6572-2_6572-1delAGinsT" "r.spl?" "p.?" "32i" "0000826375" "00007329" "70" "8326" "0" "8326" "0" "c.8326del" "r.(?)" "p.(Val2776*)" "43" "0000826376" "00007329" "70" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl?" "p.?" "36i" "0000826504" "00007329" "90" "3567" "0" "3567" "0" "c.3567del" "r.(?)" "p.(Gly1190Aspfs*39)" "23" "0000826505" "00007329" "90" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "43" "0000826933" "00007329" "90" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Gln874*)" "" "0000826934" "00007329" "70" "6725" "1" "6725" "1" "c.6725+1G>C" "r.spl" "p.(?)" "" "0000826935" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000827209" "00007329" "50" "3131" "0" "3131" "0" "c.3131A>G" "r.(?)" "p.(Asn1044Ser)" "20" "0000827210" "00007329" "90" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl?" "p.?" "13i" "0000827234" "00007329" "90" "2135" "0" "3272" "0" "c.2135_3272del" "r.(?)" "p.(Val713Alafs*71)" "13_22" "0000827235" "00007329" "90" "2205" "0" "3272" "0" "c.2205_3272del" "r.(?)" "p.(Asp735_Asn1090del)" "14_22" "0000827236" "00007329" "90" "2138" "-1" "3443" "1" "c.2138-1_3443+1del" "r.spl?" "p.?" "13i_22i" "0000827237" "00007329" "90" "2382" "-1" "2992" "1" "c.2382-1_2992+1del" "r.spl?" "p.?" "15i_19i" "0000827238" "00007329" "90" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176*)" "32" "0000827239" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000827240" "00007329" "90" "2381" "1" "2993" "-1" "c.2381+1_2993-1del" "r.spl?" "p.?" "15i_19i" "0000827241" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000827242" "00007329" "90" "8569" "0" "8569" "0" "c.8569G>T" "r.(?)" "p.(Glu2857*)" "43" "0000827243" "00007329" "90" "3164" "1" "3164" "1" "c.3164+1G>A" "r.spl?" "p.?" "20i" "0000827244" "00007329" "90" "6152" "0" "6152" "0" "c.6152del" "r.(?)" "p.(Pro2051Hisfs*5)" "30" "0000827245" "00007329" "70" "8159" "0" "8159" "0" "c.8159T>C" "r.(?)" "p.(Ile2720Thr)" "42" "0000827246" "00007329" "50" "7138" "0" "7138" "0" "c.7138T>C" "r.(?)" "p.(Cys2380Arg)" "36" "0000827247" "00007329" "70" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "43" "0000827248" "00007329" "50" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "26" "0000827249" "00007329" "70" "6415" "0" "6415" "0" "c.6415T>C" "r.(?)" "p.(Cys2139Arg)" "31" "0000827250" "00007329" "90" "2205" "0" "3272" "0" "c.2205_3272del" "r.(?)" "p.(Asp735_Asn1090del)" "14_22" "0000827251" "00007329" "70" "6834" "2" "6907" "0" "c.6834+2_6907dup" "r.spl?" "p.?" "34i_35" "0000827252" "00007329" "90" "6124" "0" "6124" "0" "c.6124G>T" "r.(?)" "p.(Glu2042*)" "30" "0000827253" "00007329" "50" "8204" "0" "8204" "0" "c.8204A>G" "r.(?)" "p.(Tyr2735Cys)" "42" "0000827254" "00007329" "90" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000827255" "00007329" "50" "2971" "0" "2971" "0" "c.2971C>T" "r.(?)" "p.(Leu991Phe)" "19" "0000827256" "00007329" "90" "2023" "1" "2023" "1" "c.2023+1G>C" "r.spl?" "p.?" "12i" "0000827257" "00007329" "50" "4891" "0" "4891" "0" "c.4891C>T" "r.(?)" "p.(Pro1631Ser)" "26" "0000827258" "00007329" "90" "8168" "0" "8168" "0" "c.8168del" "r.(?)" "p.(Gln2723Argfs*18)" "42" "0000827259" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000827260" "00007329" "50" "6047" "0" "6047" "0" "c.6047G>A" "r.(?)" "p.(Gly2016Asp)" "29" "0000827261" "00007329" "70" "1688" "0" "1689" "0" "c.1688_1689del" "r.(?)" "p.(Tyr563Serfs*6)" "11" "0000827262" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000827263" "00007329" "50" "-459" "0" "-459" "0" "c.-459C>T" "r.(=)" "p.(=)" "1" "0000827264" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000827265" "00007329" "90" "9337" "0" "9350" "0" "c.9337_9350del" "r.(?)" "p.(Lys3113Phefs*8)" "43" "0000827266" "00007329" "90" "8545" "0" "8545" "0" "c.8545C>T" "r.(?)" "p.(Arg2849*)" "43" "0000827267" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "28i" "0000827268" "00007329" "50" "3443" "5" "3443" "5" "c.3443+5G>A" "r.spl?" "p.?" "22i" "0000827269" "00007329" "50" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl?" "p.?" "26i" "0000827270" "00007329" "90" "2023" "1" "2023" "1" "c.2023+1G>C" "r.spl?" "p.?" "12i" "0000827271" "00007329" "90" "2135" "0" "2205" "0" "c.2135_2205del" "r.(?)" "p.(Lys712Argfs*8)" "13_14" "0000827272" "00007329" "90" "7943" "0" "7943" "0" "c.7943del" "r.(?)" "p.(Thr2648Lysfs*34)" "41" "0000827273" "00007329" "90" "2137" "1" "2260" "-1" "c.2137+1_2260-1del" "r.spl?" "p.?" "13i_14i" "0000827274" "00007329" "70" "1561" "0" "1562" "0" "c.1561_1562insTATA" "r.(?)" "p.(Asn521Ilefs*2)" "10" "0000827275" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000827276" "00007329" "90" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176*)" "32" "0000827277" "00007329" "50" "9392" "0" "9392" "0" "c.9392G>A" "r.(?)" "p.(Gly3131Glu)" "43" "0000827278" "00007329" "90" "2024" "-1" "2259" "1" "c.2024-1_2259+1del" "r.spl?" "p.?" "12i_14i" "0000828311" "00007329" "70" "6174" "0" "6174" "0" "c.6174T>G" "r.(?)" "p.(Tyr2058*)" "" "0000828312" "00007329" "70" "6174" "0" "6174" "0" "c.6174T>G" "r.(?)" "p.(Tyr2058*)" "" "0000828313" "00007329" "70" "6174" "0" "6174" "0" "c.6174T>G" "r.(?)" "p.(Tyr2058*)" "" "0000828500" "00007329" "50" "8948" "0" "8948" "0" "c.8948C>A" "r.(?)" "p.(Ser2983Tyr)" "" "0000828774" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000828776" "00007329" "90" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "" "0000828784" "00007329" "70" "9083" "0" "9084" "0" "c.9083_9084insA" "r.(?)" "p.(Ser3029Leufs*7)" "" "0000828796" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828799" "00007329" "50" "2644" "0" "2644" "0" "c.2644T>C" "r.(?)" "p.(Phe882Leu)" "" "0000828802" "00007329" "90" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "" "0000828803" "00007329" "70" "4991" "0" "4992" "0" "c.4991_4992insAAGA" "r.(?)" "p.(Cys1665Argfs*19)" "" "0000828817" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828818" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828819" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828820" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828822" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828823" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828824" "00007329" "90" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703*)" "" "0000828825" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000828830" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828833" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828869" "00007329" "50" "8309" "0" "8309" "0" "c.8309T>C" "r.(?)" "p.(Leu2770Pro)" "" "0000828889" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000828898" "00007329" "70" "8600" "0" "8600" "0" "c.8600del" "r.(?)" "p.(Gly2867Valfs*5)" "" "0000828908" "00007329" "50" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "" "0000828914" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828934" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000828979" "00007329" "50" "334" "0" "334" "0" "c.334G>C" "r.(?)" "p.(Val112Leu)" "" "0000828981" "00007329" "90" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000828989" "00007329" "70" "4365" "0" "4366" "0" "c.4365_4366insTTCT" "r.(?)" "p.(Ser1456Phefs*2)" "" "0000829001" "00007329" "90" "5304" "0" "5314" "0" "c.5304_5314del" "r.(?)" "p.(Asn1768Lysfs*2)" "" "0000829004" "00007329" "50" "5411" "0" "5411" "0" "c.5411T>C" "r.(?)" "p.(Ile1804Thr)" "" "0000829007" "00007329" "50" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl?" "p.(?)" "" "0000829008" "00007329" "50" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl?" "p.(?)" "" "0000829022" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000829023" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000829024" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000829025" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.(?)" "" "0000829027" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000829028" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000829029" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000829030" "00007329" "90" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "" "0000829035" "00007329" "50" "9073" "0" "9073" "0" "c.9073G>A" "r.(?)" "p.(Gly3025Arg)" "" "0000829052" "00007329" "70" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "" "0000829074" "00007329" "70" "8278" "0" "8278" "0" "c.8278C>T" "r.(?)" "p.(Arg2760Cys)" "" "0000829718" "00007329" "90" "7095" "0" "7095" "0" "c.7095T>G" "r.(?)" "p.(Tyr2365Ter)" "" "0000829733" "00007329" "70" "9277" "0" "9278" "0" "c.9277_9278dup" "r.(?)" "p.(Arg3094ValfsTer4)" "" "0000829766" "00007329" "70" "2260" "-1" "2381" "1" "c.(2259+1_2260-1)_(2381+1_?)del" "r.?" "p.?" "" "0000829812" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829813" "00007329" "90" "8860" "0" "8860" "0" "c.8860T>C" "r.(?)" "p.(Phe2954Leu)" "43" "0000829814" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829815" "00007329" "90" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "25" "0000829816" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829817" "00007329" "90" "8268" "0" "8268" "0" "c.8268del" "r.(?)" "p.(Val2757Phefs*14)" "43" "0000829818" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829819" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829822" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829824" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829825" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829826" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829827" "00007329" "90" "1750" "0" "1750" "0" "c.1750G>T" "r.(?)" "p.(Glu584*)" "11" "0000829828" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829829" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829830" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000829838" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000829841" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829842" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829843" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829844" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829845" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829846" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829850" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829851" "00007329" "90" "8650" "0" "8650" "0" "c.8650T>C" "r.(?)" "p.(Cys2884Arg)" "43" "0000829852" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829853" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829868" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829869" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829874" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829875" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829876" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829877" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829883" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829884" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829885" "00007329" "90" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "23" "0000829886" "00007329" "90" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "25" "0000829888" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829894" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829895" "00007329" "90" "2886" "0" "2886" "0" "c.2886C>G" "r.(?)" "p.(Phe962Leu)" "19" "0000829896" "00007329" "90" "2892" "0" "2892" "0" "c.2892A>C" "r.(?)" "p.(Glu964Asp)" "19" "0000829898" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829899" "00007329" "90" "8072" "-1" "8233" "1" "c.8072-1_8233+1del" "r.spl?" "p.?" "41i_42i" "0000829900" "00007329" "90" "4897" "0" "4897" "0" "c.4897A>G" "r.(?)" "p.(Lys1633Glu)" "26" "0000829901" "00007329" "90" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "39" "0000829902" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829903" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829905" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829906" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000829907" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829908" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829909" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829910" "00007329" "90" "7665" "0" "7666" "0" "c.7665_7666del" "r.(?)" "p.(Tyr2555*)" "39" "0000829912" "00007329" "90" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794*)" "15" "0000829913" "00007329" "90" "8268" "0" "8272" "0" "c.8268_8272del" "r.(?)" "p.(Val2757Thrfs*53)" "43" "0000829914" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829915" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829916" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000829917" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829918" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829919" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829920" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829921" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829922" "00007329" "90" "5847" "0" "5847" "0" "c.5847C>A" "r.(?)" "p.(Tyr1949*)" "28" "0000829927" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829928" "00007329" "90" "7613" "0" "7613" "0" "c.7613del" "r.(?)" "p.(Pro2538Glnfs*15)" "39" "0000829929" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829930" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000829934" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829935" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829936" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829937" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829938" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829942" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829943" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829944" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829945" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829946" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829947" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829948" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829949" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829955" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829956" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829957" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000829958" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000829959" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000829964" "00007329" "90" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000829965" "00007329" "50" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "4" "0000829976" "00007329" "50" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000829977" "00007329" "50" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000834544" "00007329" "50" "2980" "0" "2980" "0" "c.2980C>G" "r.(?)" "p.(Pro994Ala)" "" "0000838946" "00007329" "50" "5895" "0" "5895" "0" "c.5895G>C" "r.spl?" "p.(Val1965=)" "" "0000838947" "00007329" "50" "9130" "0" "9130" "0" "c.9130T>C" "r.(?)" "p.(Trp3044Arg)" "" "0000838959" "00007329" "50" "8860" "0" "8860" "0" "c.8860T>C" "r.(?)" "p.(Phe2954Leu)" "" "0000838960" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302delCTCA" "r.spl" "p.(Thr3100Lysfs*26)" "" "0000846876" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000846877" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000846901" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000846902" "00007329" "50" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "" "0000846928" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "" "0000846929" "00007329" "70" "8229" "0" "8229" "0" "c.8229del" "r.(?)" "p.(Gln2743Hisfs*10)" "" "0000847538" "00007329" "70" "3443" "14421" "5927" "13006" "c.3443+14421_5927+13006delinsTCAT" "r.?" "p.0?" "" "0000847539" "00007329" "70" "6079" "-30740" "7055" "41631" "c.6079-30740_7055+41631delinsCATAAT" "r.?" "p.0?" "" "0000851268" "00007329" "50" "7405" "0" "7405" "0" "c.7405G>A" "r.(?)" "p.(Gly2469Ser)" "" "0000851269" "00007329" "70" "5644" "70912" "5644" "70912" "c.5644+70912A>G" "r.(=)" "p.(=)" "" "0000851270" "00007329" "10" "5644" "70893" "5644" "70893" "c.5644+70893C>T" "r.(=)" "p.(=)" "" "0000851271" "00007329" "50" "4916" "0" "4916" "0" "c.4916C>T" "r.(?)" "p.(Thr1639Ile)" "" "0000851272" "00007329" "50" "1766" "2568" "1766" "2568" "c.1766+2568T>G" "r.(=)" "p.(=)" "" "0000851273" "00007329" "30" "1479" "0" "1479" "0" "c.1479C>T" "r.(?)" "p.(Cys493=)" "" "0000851274" "00007329" "50" "1459" "5" "1459" "5" "c.1459+5C>T" "r.spl?" "p.?" "" "0000851275" "00007329" "30" "1107" "0" "1107" "0" "c.1107C>T" "r.(?)" "p.(Ser369=)" "" "0000860472" "00007329" "50" "9381" "0" "9381" "0" "c.9381T>G" "r.(?)" "p.(Ile3127Met)" "" "0000860473" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "" "0000860474" "00007329" "30" "8072" "-15275" "8072" "-15275" "c.8072-15275T>C" "r.(=)" "p.(=)" "" "0000860475" "00007329" "30" "6284" "0" "6284" "0" "c.6284C>T" "r.(?)" "p.(Pro2095Leu)" "" "0000860476" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "" "0000860477" "00007329" "90" "4906" "0" "4927" "0" "c.4906_4927dup" "r.(?)" "p.(Ser1643Cysfs*19)" "" "0000860478" "00007329" "30" "1766" "2576" "1766" "2576" "c.1766+2576A>T" "r.(=)" "p.(=)" "" "0000867620" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867621" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867623" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867624" "00007329" "70" "7793" "0" "7793" "0" "c.7793G>A" "r.(?)" "p.(Gly2598Asp)" "" "0000867625" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867628" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867629" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867630" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867631" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867632" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867633" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867638" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867639" "00007329" "70" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "" "0000867640" "00007329" "70" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "" "0000867641" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867642" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867645" "00007329" "70" "1345" "0" "1345" "0" "c.1345A>T" "r.(?)" "p.(Lys449*)" "" "0000867646" "00007329" "70" "1750" "0" "1750" "0" "c.1750G>T" "r.(?)" "p.(Glu584*)" "" "0000867648" "00007329" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "" "0000867649" "00007329" "70" "4957" "0" "4957" "0" "c.4957dupA" "r.(?)" "p.(Ser1653Lysfs*2)" "" "0000867650" "00007329" "70" "5014" "0" "5014" "0" "c.5014C>T" "r.(?)" "p.(Gln1672*)" "" "0000867653" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867654" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867655" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867656" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867657" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000867658" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "" "0000869502" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "7" "0000869503" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000869504" "00007329" "70" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl?" "p.?" "13i" "0000869505" "00007329" "70" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "4" "0000869506" "00007329" "70" "2260" "-1437" "2847" "-6134" "c.2260-1437_2847-6134del" "r.(?)" "p.(Ser754Ilefs*4)" "14i_18i" "0000869507" "00007329" "70" "4829" "0" "4832" "0" "c.4829_4832del" "r.(?)" "p.(Ser1610Phefs*7)" "26" "0000869508" "00007329" "70" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "28i" "0000869509" "00007329" "70" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000869510" "00007329" "70" "8411" "0" "8412" "0" "c.8411_8412insTT" "r.(?)" "p.(Thr2805*)" "43" "0000869511" "00007329" "70" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000869512" "00007329" "70" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000869513" "00007329" "70" "2259" "10539" "2993" "-12013" "c.2259+10539_2993-12013del" "r.(?)" "p.(Ser754Alafs*6)" "14i_19i" "0000869514" "00007329" "70" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "4" "0000869515" "00007329" "70" "2826" "0" "2827" "0" "c.2826_2827del" "r.(?)" "p.(Val944Glyfs*9)" "18" "0000869516" "00007329" "70" "2889" "0" "2889" "0" "c.2889T>A" "r.(?)" "p.(Cys963*)" "19" "0000869517" "00007329" "70" "1767" "-1" "2023" "1" "c.(1766+1_1767-1)_(2023+1_2024-1)del" "r.spl?" "p.?" "11i_12i" "0000869518" "00007329" "70" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000869519" "00007329" "70" "8338" "0" "8342" "0" "c.8338_8342delinsTATAAACTATAACTATAAACTATAAACTATAAACTATAAACTATAAACTATAAACTATA" "r.(?)" "p.(Gly2780_Thr3144delinsTyrLysLeu)" "43" "0000869520" "00007329" "70" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176*)" "32" "0000869521" "00007329" "70" "8408" "0" "8408" "0" "c.8408dup" "r.(?)" "p.(Asn2803Lysfs*9)" "43" "0000869522" "00007329" "70" "5834" "0" "5834" "0" "c.5834del" "r.(?)" "p.(Lys1945Serfs*42)" "27" "0000869523" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000869524" "00007329" "70" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000869525" "00007329" "70" "9383" "0" "9387" "0" "c.9383_9387del" "r.(?)" "p.(Lys3128Argfs*7)" "43" "0000869526" "00007329" "70" "6571" "5" "6571" "5" "c.6571+5G>A" "r.spl?" "p.?" "32i" "0000869527" "00007329" "70" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671*)" "41" "0000869528" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000869529" "00007329" "70" "1641" "0" "1644" "0" "c.1641_1644del" "r.(?)" "p.(Ser547Argfs*62)" "11" "0000869530" "00007329" "70" "1155" "0" "1155" "0" "c.1155T>A" "r.(?)" "p.(Cys385*)" "7" "0000869531" "00007329" "70" "8648" "0" "8655" "0" "c.8648_8655del" "r.(?)" "p.(Thr2883Lysfs*4)" "43" "0000869532" "00007329" "70" "3555" "0" "3555" "0" "c.3555C>G" "r.(?)" "p.(Cys1185Trp)" "23" "0000869533" "00007329" "70" "8111" "0" "8111" "0" "c.8111T>G" "r.(?)" "p.(Leu2704*)" "42" "0000869534" "00007329" "70" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096Leufs*28)" "43" "0000869535" "00007329" "70" "8413" "0" "8413" "0" "c.8413dup" "r.(?)" "p.(Thr2805Asnfs*7)" "43" "0000869536" "00007329" "70" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl?" "p.?" "22i" "0000869537" "00007329" "70" "8111" "0" "8111" "0" "c.8111T>G" "r.(?)" "p.(Leu2704*)" "42" "0000869538" "00007329" "70" "9317" "0" "9336" "0" "c.9317_9336del" "r.(?)" "p.(Thr3106Lysfs*13)" "43" "0000869539" "00007329" "70" "1961" "0" "1961" "0" "c.1961dup" "r.(?)" "p.(Asn654Lysfs*5)" "12" "0000869540" "00007329" "70" "5645" "-1197" "5927" "3169" "c.5645-1197_5927+3169dup" "r.?" "p.?" "26i_28i" "0000869541" "00007329" "70" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000869542" "00007329" "70" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000869543" "00007329" "70" "7578" "1" "7578" "1" "c.7578+1G>A" "r.spl?" "p.?" "38i" "0000869544" "00007329" "70" "1645" "0" "1645" "0" "c.1645G>T" "r.(?)" "p.(Glu549*)" "11" "0000869545" "00007329" "70" "2992" "1" "2992" "1" "c.2992+1G>A" "r.spl?" "p.?" "19i" "0000869546" "00007329" "70" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000869547" "00007329" "70" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl?" "p.?" "22i" "0000869548" "00007329" "70" "3250" "0" "3250" "0" "c.3250A>C" "r.(?)" "p.(Thr1084Pro)" "22" "0000869549" "00007329" "70" "4402" "0" "4402" "0" "c.4402G>C" "r.(?)" "p.(Asp1468His)" "26" "0000869550" "00007329" "70" "967" "0" "983" "0" "c.967_983del" "r.(?)" "p.(Gly323Trpfs*2)" "6" "0000869551" "00007329" "70" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000869552" "00007329" "70" "1308" "0" "1308" "0" "c.1308C>A" "r.(?)" "p.(Cys436*)" "9" "0000869553" "00007329" "70" "5928" "0" "5928" "0" "c.5928del" "r.(?)" "p.(Arg1976Serfs*11)" "29" "0000869554" "00007329" "70" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000869555" "00007329" "90" "1682" "0" "1686" "0" "c.1682_1686del" "r.(?)" "p.(Asn561Ilefs*7)" "11" "0000869556" "00007329" "30" "5976" "0" "5976" "0" "c.5976T>A" "r.(?)" "p.(Asn1992Lys)" "29" "0000869557" "00007329" "90" "1682" "0" "1686" "0" "c.1682_1686del" "r.(?)" "p.(Asn561Ilefs*7)" "11" "0000869558" "00007329" "30" "5976" "0" "5976" "0" "c.5976T>A" "r.(?)" "p.(Asn1992Lys)" "29" "0000869559" "00007329" "50" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000869560" "00007329" "50" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "4" "0000869561" "00007329" "90" "6198" "0" "6201" "0" "c.6198_6201del" "r.(?)" "p.(Gln2066Hisfs*16)" "31" "0000869562" "00007329" "90" "8133" "0" "8137" "0" "c.8133_8137del" "r.(?)" "p.(Phe2712Cysfs*33)" "42" "0000869563" "00007329" "90" "9383" "0" "9387" "0" "c.9383_9387del" "r.(?)" "p.(Lys3128Argfs*7)" "43" "0000869564" "00007329" "90" "4152" "0" "4152" "0" "c.4152del" "r.(?)" "p.(Pro1385Leufs*14)" "26" "0000869565" "00007329" "50" "0" "0" "0" "0" "c.?" "r.spl?" "p.?" "22_26" "0000869566" "00007329" "50" "2259" "1" "2259" "1" "c.2259+1G>A" "r.spl?" "p.?" "14i" "0000869567" "00007329" "90" "2542" "0" "2542" "0" "c.2542C>T" "r.(?)" "p.(Gln848*)" "16" "0000869568" "00007329" "90" "2542" "0" "2542" "0" "c.2542C>T" "r.(?)" "p.(Gln848*)" "16" "0000869569" "00007329" "70" "9178" "0" "9178" "0" "c.9178A>C" "r.(?)" "p.(Ile3060Leu)" "43" "0000869570" "00007329" "70" "1184" "1" "1184" "1" "c.1184+1G>A" "r.spl?" "p.?" "7i" "0000869571" "00007329" "50" "1765" "0" "1765" "0" "c.1765A>G" "r.(?)" "p.(Arg589Gly)" "11" "0000873584" "00007329" "70" "5644" "5" "5644" "5" "c.5644+5G>A" "r.(?)" "p.(?)" "" "0000873585" "00007329" "70" "8545" "0" "8545" "0" "c.8545C>T" "r.(?)" "p.(Arg2849*)" "" "0000881453" "00007329" "90" "3024" "0" "3024" "0" "c.3024C>A" "r.(?)" "p.(Cys1008*)" "" "0000881464" "00007329" "50" "-448" "5" "-448" "5" "c.-448+5G>A" "r.spl" "p.?" "" "0000881787" "00007329" "90" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "" "0000881788" "00007329" "70" "3443" "14421" "5927" "13006" "c.3443+14421_5927+13006delinsTCAT" "r.?" "p.?" "22i_28i" "0000881789" "00007329" "90" "8858" "0" "8858" "0" "c.8858C>A" "r.(?)" "p.(Ser2953*)" "" "0000881790" "00007329" "70" "6079" "-30740" "7055" "41631" "c.6079-30740_7055+41631delinsCATAAT" "r.?" "p.?" "29i_35i" "0000881791" "00007329" "30" "7055" "25929" "7055" "27268" "c.7055+25929_7055+27268del" "r.(?)" "p.(=)" "35i" "0000881792" "00007329" "30" "2138" "-8117" "2138" "-3410" "c.2138-8117_2138-3410del" "r.(?)" "p.(=)" "13i" "0000881793" "00007329" "30" "-332" "-56145" "-332" "-54151" "c.-332-56145_-332-54151del" "r.(?)" "p.(=)" "2i" "0000881794" "00007329" "30" "-448" "12341" "-448" "17982" "c.-448+12341_-448+17982del" "r.(?)" "p.(=)" "1i" "0000881795" "00007329" "30" "862" "36520" "862" "36521" "c.862+36520_862+36521insN[305]" "r.(=)" "p.(=)" "5i" "0000881796" "00007329" "30" "6191" "10338" "6191" "10431" "c.6191+10338_6191+10431del" "r.(?)" "p.(=)" "30i" "0000881797" "00007329" "30" "2023" "90819" "2023" "90881" "c.2023+90819_2023+90881del" "r.(?)" "p.(=)" "1i" "0000881798" "00007329" "30" "-332" "-69291" "-332" "-68968" "c.-332-69291_-332-68968del" "r.(?)" "p.(=)" "2i" "0000881799" "00007329" "30" "6191" "11557" "6191" "11558" "c.6191+11557_6191+11558insN[118]" "r.(?)" "p.(=)" "30i" "0000881800" "00007329" "30" "2023" "17534" "2023" "17535" "c.2023+17534_2023+17535insN[59]" "r.(?)" "p.(=)" "12i" "0000881801" "00007329" "30" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "2i" "0000887373" "00007329" "90" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135Ter)" "" "0000887374" "00007329" "70" "9376" "0" "9379" "0" "c.9376_9379del" "r.(?)" "p.(Ile3127Asnfs*2)" "" "0000887375" "00007329" "10" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "" "0000887376" "00007329" "50" "7949" "0" "7949" "0" "c.7949C>T" "r.(?)" "p.(Ser2650Phe)" "" "0000887377" "00007329" "50" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Cys)" "" "0000887378" "00007329" "50" "7609" "0" "7609" "0" "c.7609G>A" "r.(?)" "p.(Ala2537Thr)" "" "0000887379" "00007329" "30" "7369" "0" "7369" "0" "c.7369C>T" "r.(?)" "p.(Leu2457=)" "" "0000887380" "00007329" "30" "6855" "0" "6855" "0" "c.6855C>T" "r.(?)" "p.(Phe2285=)" "" "0000887381" "00007329" "30" "6394" "0" "6394" "0" "c.6394C>T" "r.(?)" "p.(Leu2132=)" "" "0000887382" "00007329" "50" "5738" "0" "5738" "0" "c.5738C>A" "r.(?)" "p.(Thr1913Asn)" "" "0000887383" "00007329" "30" "1184" "14" "1184" "14" "c.1184+14T>C" "r.(=)" "p.(=)" "" "0000887384" "00007329" "30" "-414" "0" "-414" "0" "c.-414G>A" "r.(?)" "p.(=)" "" "0000896444" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896445" "00007329" "90" "8012" "0" "8012" "0" "c.8012T>A" "r.(?)" "p.(Leu2671Ter)" "" "0000896452" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896456" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896457" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896470" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896471" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896492" "00007329" "70" "4991" "0" "4992" "0" "c.4991_4992insAAGA" "r.(?)" "p.(Cys1665ArgfsTer19)" "" "0000896493" "00007329" "50" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl?" "p.?" "" "0000896528" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896529" "00007329" "50" "334" "0" "334" "0" "c.334G>C" "r.(?)" "p.(Val112Leu)" "" "0000896532" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896538" "00007329" "90" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703Ter)" "" "0000896539" "00007329" "90" "3489" "0" "3489" "0" "c.3489T>A" "r.(?)" "p.(Asn1163Lys)" "" "0000896540" "00007329" "70" "9083" "0" "9084" "0" "c.9083_9084insA" "r.(?)" "p.(Ser3029LeufsTer7)" "" "0000896541" "00007329" "70" "4365" "0" "4366" "0" "c.4365_4366insTTCT" "r.(?)" "p.(Ser1456PhefsTer2)" "" "0000896579" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896580" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896584" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896609" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896610" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896611" "00007329" "50" "8309" "0" "8309" "0" "c.8309T>C" "r.(?)" "p.(Leu2770Pro)" "" "0000896619" "00007329" "90" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703Ter)" "" "0000896620" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000896635" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896636" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000896668" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896669" "00007329" "50" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "" "0000896673" "00007329" "50" "9209" "0" "9209" "0" "c.9209T>C" "r.(?)" "p.(Ile3070Thr)" "" "0000896677" "00007329" "70" "8600" "0" "8600" "0" "c.8600delG" "r.(?)" "p.(Gly2867ValfsTer5)" "" "0000896687" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896688" "00007329" "90" "5304" "0" "5314" "0" "c.5304_5314del" "r.(?)" "p.(Asn1768LysfsTer2)" "" "0000896698" "00007329" "50" "2644" "0" "2644" "0" "c.2644T>C" "r.(?)" "p.(Phe882Leu)" "" "0000896699" "00007329" "50" "5411" "0" "5411" "0" "c.5411T>C" "r.(?)" "p.(Ile1804Thr)" "" "0000896700" "00007329" "90" "8107" "0" "8107" "0" "c.8107G>T" "r.(?)" "p.(Glu2703Ter)" "" "0000896701" "00007329" "50" "5644" "5" "5644" "5" "c.5644+5G>A" "r.spl?" "p.?" "" "0000896710" "00007329" "90" "7228" "1" "7228" "1" "c.7228+1G>A" "r.spl" "p.?" "" "0000896732" "00007329" "70" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000896733" "00007329" "50" "9073" "0" "9073" "0" "c.9073G>A" "r.(?)" "p.(Gly3025Arg)" "" "0000903138" "00007329" "70" "2992" "0" "2992" "6" "c.2992_2992+6delinsCA" "r.(?)" "p.(?)" "" "0000904505" "00007329" "90" "7679" "0" "7679" "0" "c.7679C>T" "r.(?)" "p.(Pro2560Leu)" "" "0000905891" "00007329" "50" "2739" "0" "2739" "0" "c.2739G>T" "r.(?)" "p.(Arg913Ser)" "" "0000912558" "00007329" "90" "7412" "-1" "7412" "-1" "c.7412-1G>C" "r.spl?" "p.?" "" "0000912559" "00007329" "70" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl?" "p.?" "" "0000912560" "00007329" "30" "2024" "-15" "2024" "-15" "c.2024-15T>C" "r.(=)" "p.(=)" "" "0000915798" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000915799" "00007329" "70" "6078" "2" "6078" "2" "c.6078+2T>C" "r.spl?" "p.(?)" "29i" "0000915806" "00007329" "90" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164*)" "4" "0000915818" "00007329" "50" "7811" "0" "7811" "0" "c.7811G>A" "r.(?)" "p.(Arg2604His)" "40" "0000915819" "00007329" "70" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "43" "0000915828" "00007329" "90" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Gln874*)" "16" "0000915829" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000915845" "00007329" "90" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Gln874*)" "16" "0000915846" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000915866" "00007329" "70" "2530" "0" "2530" "0" "c.2530C>T" "r.(?)" "p.(Gln844*)" "16" "0000915867" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000915871" "00007329" "70" "7394" "0" "7394" "0" "c.7394C>G" "r.(?)" "p.(Thr2465Ser)" "37" "0000915872" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000915880" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000915881" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000915882" "00007329" "50" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "4" "0000915883" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000915884" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000915887" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000915895" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000915896" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000915906" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000915907" "00007329" "70" "3809" "0" "3809" "0" "c.3809T>G" "r.(?)" "p.(Val1270Gly)" "25" "0000915908" "00007329" "50" "632" "0" "632" "0" "c.632G>A" "r.(?)" "p.(Cys211Tyr)" "4" "0000915909" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "16" "0000915910" "00007329" "70" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "4" "0000915911" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000915915" "00007329" "70" "6557" "0" "6557" "0" "c.6557G>A" "r.(?)" "p.(Gly2186Glu)" "32" "0000915916" "00007329" "90" "7919" "0" "7919" "0" "c.7919G>A" "r.(?)" "p.(Trp2640*)" "41" "0000915919" "00007329" "70" "525" "0" "527" "0" "c.525_527del" "r.(?)" "p.(Glu176del)" "4" "0000915920" "00007329" "90" "8793" "0" "8796" "0" "c.8793_8796del" "r.(?)" "p.(Gln2931Hisfs*43)" "43" "0000915934" "00007329" "90" "8805" "0" "8805" "0" "c.8805C>A" "r.(?)" "p.(Tyr2935*)" "43" "0000915935" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000915939" "00007329" "70" "6563" "0" "6563" "0" "c.6563T>C" "r.(?)" "p.(Ile2188Thr)" "32" "0000915945" "00007329" "70" "2382" "-1" "3243" "1" "c.(2381+1_2382-1)_(3243+1_3244-1)del" "r.?" "p.(Cys795Thrfs*8)" "" "0000915978" "00007329" "90" "4011" "0" "4012" "0" "c.4011_4012del" "r.(?)" "p.(His1337Glnfs*20)" "26" "0000915979" "00007329" "90" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000915981" "00007329" "90" "5928" "-3" "5928" "-1" "c.5928-3_5928-1del" "r.spl?" "p.(?)" "28i" "0000916043" "00007329" "70" "3041" "0" "3041" "0" "c.3041dup" "r.(?)" "p.(His1015Profs*2)" "20" "0000916044" "00007329" "50" "8842" "0" "8842" "0" "c.8842T>C" "r.(?)" "p.(Cys2948Arg)" "43" "0000916052" "00007329" "90" "3178" "0" "3179" "0" "c.3178_3179del" "r.(?)" "p.(Ile1060*)" "21" "0000916053" "00007329" "90" "8133" "0" "8137" "0" "c.8133_8137del" "r.(?)" "p.(Phe2712Cysfs*33)" "42" "0000916059" "00007329" "90" "1211" "0" "1211" "0" "c.1211del" "r.(?)" "p.(Asn404Thrfs*17)" "8" "0000916069" "00007329" "90" "3775" "0" "3775" "0" "c.3775C>T" "r.(?)" "p.(Gln1259*)" "25" "0000916070" "00007329" "70" "6473" "0" "6473" "0" "c.6473T>C" "r.(?)" "p.(Leu2158Pro)" "32" "0000916104" "00007329" "50" "35" "0" "35" "0" "c.35T>C" "r.(?)" "p.(Met12Thr)" "4" "0000916105" "00007329" "70" "9431" "0" "9431" "0" "c.9431dup" "r.(?)" "p.(Asn3144Lysfs*3)" "43" "0000916133" "00007329" "70" "7724" "-1" "7898" "1" "c.(7723+1_7724-1)_(7898+1_7899-1)del" "r.?" "p.(Gly2575Alafs*49)" "" "0000916134" "00007329" "70" "8628" "0" "8631" "0" "c.8628_8631del" "r.(?)" "p.(Asn2876Lysfs*5)" "43" "0000916137" "00007329" "50" "8054" "0" "8054" "0" "c.8054G>A" "r.(?)" "p.(Gly2685Glu)" "41" "0000916138" "00007329" "70" "8834" "0" "8834" "0" "c.8834G>A" "r.(?)" "p.(Gly2945Glu)" "43" "0000916151" "00007329" "90" "5802" "0" "5802" "0" "c.5802dup" "r.(?)" "p.(Ile1935Tyrfs*6)" "27" "0000916152" "00007329" "70" "8043" "0" "8043" "0" "c.8043dup" "r.(?)" "p.(Gly2682Argfs*8)" "41" "0000916193" "00007329" "70" "2382" "-2" "2382" "-2" "c.2382-2A>T" "r.spl?" "p.(?)" "15i" "0000916194" "00007329" "50" "7445" "0" "7445" "0" "c.7445T>C" "r.(?)" "p.(Leu2482Pro)" "38" "0000916200" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.(?)" "28i" "0000916244" "00007329" "70" "113" "0" "113" "0" "c.113C>G" "r.(?)" "p.(Ser38*)" "4" "0000916245" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451Profs*3)" "26" "0000916253" "00007329" "90" "2826" "0" "2827" "0" "c.2826_2827del" "r.(?)" "p.(Val944Glyfs*9)" "18" "0000916254" "00007329" "70" "6050" "0" "6050" "0" "c.6050G>T" "r.(?)" "p.(Gly2017Val)" "29" "0000916324" "00007329" "70" "3164" "2" "3164" "2" "c.3164+2T>C" "r.spl?" "p.(?)" "20i" "0000916325" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000916330" "00007329" "70" "6623" "0" "6623" "0" "c.6623G>A" "r.(?)" "p.(Gly2208Glu)" "33" "0000916331" "00007329" "70" "9337" "0" "9350" "0" "c.9337_9350del" "r.(?)" "p.(Lys3113Phefs*8)" "43" "0000916407" "00007329" "50" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Cys)" "40" "0000916408" "00007329" "70" "8982" "0" "8985" "0" "c.8982_8985del" "r.(?)" "p.(Ile2995Tyrfs*5)" "43" "0000916425" "00007329" "90" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000916426" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl?" "p.(?)" "22i" "0000916430" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "33" "0000916431" "00007329" "70" "6799" "0" "6800" "0" "c.6799_6800del" "r.(?)" "p.(Gln2267Glufs*15)" "34" "0000916451" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.(?)" "28i" "0000916461" "00007329" "90" "4957" "0" "4957" "0" "c.4957dup" "r.(?)" "p.(Ser1653Lysfs*2)" "26" "0000916462" "00007329" "70" "7492" "0" "7492" "0" "c.7492G>C" "r.(?)" "p.(Ala2498Pro)" "38" "0000916501" "00007329" "50" "2381" "0" "2381" "0" "c.2381G>A" "r.(?)" "p.(Arg794Gln)" "15" "0000916502" "00007329" "50" "5959" "0" "5959" "0" "c.5959A>C" "r.(?)" "p.(Thr1987Pro)" "29" "0000916503" "00007329" "50" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000916519" "00007329" "50" "6920" "0" "6920" "0" "c.6920G>A" "r.(?)" "p.(Gly2307Asp)" "35" "0000916549" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.(?)" "28i" "0000916596" "00007329" "90" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "26" "0000916597" "00007329" "70" "9059" "0" "9059" "0" "c.9059T>C" "r.(?)" "p.(Ile3020Thr)" "43" "0000916623" "00007329" "90" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "34" "0000916624" "00007329" "50" "7865" "0" "7865" "0" "c.7865G>A" "r.(?)" "p.(Gly2622Asp)" "40" "0000916636" "00007329" "50" "5743" "0" "5743" "0" "c.5743A>G" "r.(?)" "p.(Ser1915Gly)" "27" "0000916637" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "31" "0000916638" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000916642" "00007329" "90" "3243" "1" "3243" "1" "c.3243+1G>A" "r.spl?" "p.(?)" "21i" "0000916657" "00007329" "90" "3250" "0" "3250" "0" "c.[3250A>C;3443+1G>T;4402G>C]" "r.(?)" "p.[(Thr1084Pro);(?);(Asp1468His)]" "22" "0000916658" "00007329" "90" "3250" "0" "3250" "0" "c.[3250A>C;3443+1G>T;4402G>C]" "r.spl?" "p.[(Thr1084Pro);(?);(Asp1468His)]" "22i" "0000916659" "00007329" "90" "3250" "0" "3250" "0" "c.[3250A>C;3443+1G>T;4402G>C]" "r.(?)" "p.[(Thr1084Pro);(?);(Asp1468His)]" "26" "0000916660" "00007329" "90" "8133" "0" "8137" "0" "c.8133_8137del" "r.(?)" "p.(Phe2712Cysfs*33)" "42" "0000916667" "00007329" "50" "5743" "0" "5743" "0" "c.5743A>G" "r.(?)" "p.(Ser1915Gly)" "27" "0000916668" "00007329" "90" "8411" "0" "8411" "0" "c.8411dup" "r.(?)" "p.(Thr2805Asnfs*7)" "43" "0000916669" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000916675" "00007329" "50" "2023" "5" "2023" "5" "c.2023+5G>A" "r.spl?" "p.(?)" "12i" "0000916676" "00007329" "90" "7798" "0" "7802" "0" "c.7798_7802del" "r.(?)" "p.(Pro2600Cysfs*30)" "40" "0000916692" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100Lysfs*26)" "43" "0000916730" "00007329" "70" "5928" "-1" "6078" "1" "c.(5927+1_5928-1)_(6078+1_6079-1)del" "r.?" "p.(Gln1977Cysfs*12)" "" "0000916733" "00007329" "90" "1982" "0" "1982" "0" "c.1982T>A" "r.(?)" "p.(Leu661*)" "12" "0000917725" "00007329" "70" "2527" "0" "2527" "0" "c.2527G>A" "r.(2527g>a)" "p.(Gly843Arg)" "16" "0000917806" "00007329" "50" "-12233" "0" "-447" "-18280" "c.-12233_-447-18280del" "r.?" "p.?" "_1_1i" "0000924549" "00007329" "30" "9228" "0" "9228" "0" "c.9228T>C" "r.(?)" "p.(Phe3076=)" "" "0000924550" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl?" "p.?" "" "0000924551" "00007329" "90" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374Ter)" "" "0000924552" "00007329" "50" "3906" "0" "3906" "0" "c.3906C>A" "r.(?)" "p.(His1302Gln)" "" "0000924553" "00007329" "90" "3003" "0" "3003" "0" "c.3003T>A" "r.(?)" "p.(Cys1001*)" "" "0000924554" "00007329" "70" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl?" "p.?" "" "0000929217" "00007329" "90" "9157" "0" "9157" "0" "c.9157del" "r.(?)" "p.(Gln3053ArgfsTer8)" "" "0000929218" "00007329" "90" "8606" "0" "8606" "0" "c.8606C>G" "r.(?)" "p.(Ser2869*)" "" "0000929219" "00007329" "50" "8306" "0" "8306" "0" "c.8306T>C" "r.(?)" "p.(Ile2769Thr)" "" "0000929220" "00007329" "30" "6425" "-15" "6425" "-11" "c.6425-15_6425-11dup" "r.(=)" "p.(=)" "" "0000929221" "00007329" "10" "5044" "0" "5044" "0" "c.5044G>T" "r.(?)" "p.(Asp1682Tyr)" "" "0000929222" "00007329" "10" "2739" "0" "2739" "0" "c.2739G>A" "r.(?)" "p.(=)" "" "0000929223" "00007329" "90" "2739" "-1" "2739" "-1" "c.2739-1G>A" "r.spl?" "p.?" "" "0000929224" "00007329" "50" "1570" "0" "1570" "0" "c.1570T>C" "r.(?)" "p.(Cys524Arg)" "" "0000932989" "00007329" "90" "2439" "0" "2439" "0" "c.2439C>A" "r.(?)" "p.(Cys813*)" "" "0000932990" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239Serfs*17)" "" "0000933349" "00007329" "90" "4120" "0" "4120" "0" "c.4120C>T" "r.(?)" "p.(Arg1374*)" "" "0000933350" "00007329" "90" "6079" "-2" "6079" "-2" "c.6079-2A>G" "r.spl" "p.?" "" "0000933359" "00007329" "90" "2137" "1" "2137" "1" "c.2137+1G>A" "r.(?)" "p.(?)" "" "0000933386" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.?" "" "0000933387" "00007329" "90" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265Glnfs*46)" "" "0000936332" "00007329" "50" "4630" "0" "4630" "0" "c.4630C>T" "r.(?)" "p.(Gln1544*)" "" "0000944532" "00007329" "70" "2138" "-15652" "2259" "11364" "c.2138-15652_2259+11364del" "r.(?)" "p.(Val713Glufs*9)" "13i_14i" "0000944533" "00007329" "70" "5928" "0" "6078" "0" "c.5928_6078del" "r.spl?" "p.(Gln1977Cysfs*12)" "28i_29i" "0000948736" "00007329" "50" "5836" "-3" "5836" "-3" "c.5836-3C>T" "r.spl?" "p.?" "" "0000948737" "00007329" "30" "2553" "0" "2553" "0" "c.2553C>T" "r.(?)" "p.(=)" "" "0000948738" "00007329" "30" "1872" "0" "1872" "0" "c.1872G>A" "r.(?)" "p.(=)" "" "0000948739" "00007329" "30" "690" "0" "690" "0" "c.690T>C" "r.(?)" "p.(=)" "" "0000954015" "00007329" "70" "8805" "0" "8805" "0" "c.8805C>G" "r.(?)" "p.(Tyr2935Ter)" "" "0000954082" "00007329" "50" "0" "0" "0" "0" "c.(8071+1_8072-1)_*616{2}" "r.?" "p.?" "4i1i_43_" "0000958032" "00007329" "90" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558Ter)" "" "0000958049" "00007329" "90" "634" "0" "634" "0" "c.634C>T" "r.(?)" "p.(Gln212Ter)" "" "0000958050" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239SerfsTer17)" "" "0000958056" "00007329" "90" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl" "p.?" "" "0000958057" "00007329" "70" "1766" "18135" "2023" "21357" "c.1766+18135_2023+21357delinsTGATCT" "r.?" "p.?" "" "0000958067" "00007329" "90" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164Ter)" "" "0000958083" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451ProfsTer3)" "" "0000958321" "00007329" "70" "2234" "0" "2234" "0" "c.2234A>G" "r.(?)" "p.(Asn745Ser)" "" "0000958324" "00007329" "70" "-332" "-12833" "748" "569" "c.-332-12833_748+569del" "r.0?" "p.0?" "" "0000958329" "00007329" "70" "1767" "-743" "2023" "82838" "c.1767-743_2023+82838delinsTAAAAAGAAAAC" "r.?" "p.?" "" "0000958331" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239SerfsTer17)" "" "0000958332" "00007329" "70" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "" "0000958335" "00007329" "70" "3444" "-31214" "3685" "-8848" "c.3444-31214_3685-8848dup" "r.?" "p.?" "" "0000958341" "00007329" "90" "7723" "1" "7723" "1" "c.7723+1G>A" "r.spl" "p.?" "" "0000958353" "00007329" "90" "4045" "0" "4045" "0" "c.4045C>T" "r.(?)" "p.(Arg1349Ter)" "" "0000958368" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451ProfsTer3)" "" "0000958429" "00007329" "90" "6174" "0" "6174" "0" "c.6174T>G" "r.(?)" "p.(Tyr2058Ter)" "" "0000958443" "00007329" "90" "7943" "0" "7943" "0" "c.7943del" "r.(?)" "p.(Thr2648LysfsTer34)" "" "0000958444" "00007329" "70" "863" "-35938" "1299" "1083" "c.863-35938_1299+1083delinsAGTAAAAGTT" "r.?" "p.?" "" "0000958468" "00007329" "90" "6191" "2" "6191" "2" "c.6191+2T>C" "r.spl" "p.?" "" "0000958489" "00007329" "70" "9418" "0" "9418" "0" "c.9418C>T" "r.(?)" "p.(Gln3140Ter)" "" "0000958604" "00007329" "90" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164Ter)" "" "0000958605" "00007329" "90" "9286" "0" "9295" "0" "c.9286_9295del" "r.(?)" "p.(Val3096LeufsTer28)" "" "0000958608" "00007329" "70" "0" "0" "0" "0" "c.-538_2023+10906{0}" "r.0?" "p.0?" "_1_12i" "0000958609" "00007329" "50" "2287" "0" "2287" "0" "c.2287T>G" "r.(?)" "p.(Trp763Gly)" "" "0000958615" "00007329" "70" "6425" "-47157" "6425" "-40442" "c.6425-47157_6425-40442delins6192-4682_6424+26144inv" "r.?" "p.?" "30i_31i" "0000958619" "00007329" "70" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "" "0000958624" "00007329" "70" "2260" "-2487" "2381" "7945" "c.2260-2487_2381+7945delins[ATACAAAATTG;2381+1630_2381+1694inv]" "r.?" "p.?" "14i_15i" "0000958629" "00007329" "70" "8648" "0" "8649" "0" "c.8648_8649del" "r.(?)" "p.(Thr2883MetfsTer6)" "" "0000958638" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451ProfsTer3)" "" "0000958656" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000958848" "00007329" "50" "2382" "-5" "2382" "-5" "c.2382-5T>A" "r.spl?" "p.?" "" "0000958849" "00007329" "90" "490" "0" "490" "0" "c.490C>T" "r.(?)" "p.(Arg164Ter)" "" "0000958852" "00007329" "70" "9376" "0" "9379" "0" "c.9376_9379del" "r.(?)" "p.(Ile3127AsnfsTer2)" "" "0000958853" "00007329" "70" "4789" "0" "4801" "0" "c.4789_4801del" "r.(?)" "p.(Tyr1597GlufsTer17)" "" "0000958859" "00007329" "70" "2854" "0" "2854" "0" "c.2854del" "r.(?)" "p.(Cys952ValfsTer16)" "" "0000958938" "00007329" "70" "2259" "20073" "3443" "22778" "c.2259+20073_3443+22778del" "r.?" "p.?" "" "0000958954" "00007329" "70" "5773" "0" "5773" "0" "c.5773C>T" "r.(?)" "p.(Gln1925Ter)" "" "0000958964" "00007329" "50" "7807" "0" "7807" "0" "c.7807G>A" "r.(?)" "p.(Gly2603Arg)" "" "0000959046" "00007329" "90" "8408" "0" "8408" "0" "c.8408dup" "r.(?)" "p.(Asn2803LysfsTer9)" "" "0000959051" "00007329" "90" "4350" "0" "4356" "0" "c.4350_4356del" "r.(?)" "p.(Ile1451ProfsTer3)" "" "0000959060" "00007329" "70" "9383" "0" "9387" "0" "c.9383_9387del" "r.(?)" "p.(Lys3128ArgfsTer7)" "" "0000959064" "00007329" "50" "0" "0" "0" "0" "c.-538_862+10652{1}inv" "r.?" "p.?" "_1_5i" "0000959256" "00007329" "70" "5086" "0" "5086" "0" "c.5086G>T" "r.(?)" "p.(Glu1696Ter)" "" "0000959283" "00007329" "50" "5957" "0" "5957" "0" "c.5957T>A" "r.(?)" "p.(Leu1986Gln)" "" "0000959284" "00007329" "50" "8861" "0" "8861" "0" "c.8861T>A" "r.(?)" "p.(Phe2954Tyr)" "" "0000959286" "00007329" "50" "9410" "0" "9410" "0" "c.9410G>A" "r.(?)" "p.(Gly3137Glu)" "" "0000959287" "00007329" "50" "7811" "0" "7811" "0" "c.7811G>A" "r.(?)" "p.(Arg2604His)" "" "0000959295" "00007329" "90" "5928" "-2" "5928" "-2" "c.5928-2A>G" "r.spl" "p.?" "" "0000959299" "00007329" "50" "9053" "0" "9053" "0" "c.9053T>G" "r.(?)" "p.(Leu3018Trp)" "" "0000959374" "00007329" "50" "8206" "0" "8206" "0" "c.8206G>C" "r.(?)" "p.(Ala2736Pro)" "" "0000959393" "00007329" "50" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Cys)" "" "0000959399" "00007329" "50" "2068" "0" "2068" "0" "c.2068T>A" "r.(?)" "p.(Cys690Ser)" "" "0000959400" "00007329" "50" "6263" "0" "6263" "0" "c.6263C>T" "r.(?)" "p.(Thr2088Ile)" "" "0000959427" "00007329" "90" "2137" "1" "2137" "1" "c.2137+1G>A" "r.spl" "p.?" "" "0000959474" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0000964194" "00007329" "50" "8471" "0" "8471" "0" "c.8471G>A" "r.(?)" "p.(Gly2824Glu)" "" "0000964198" "00007329" "90" "6714" "0" "6714" "0" "c.6714del" "r.(?)" "p.(Ile2239SerfsTer17)" "" "0000964199" "00007329" "30" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "" "0000964206" "00007329" "50" "4985" "0" "4985" "0" "c.4985A>T" "r.(?)" "p.(Asp1662Val)" "" "0000964207" "00007329" "50" "3493" "0" "3493" "0" "c.3493T>C" "r.(?)" "p.(Cys1165Arg)" "" "0000964208" "00007329" "90" "2993" "-2" "2993" "-2" "c.2993-2A>G" "r.spl?" "p.?" "" "0000964209" "00007329" "50" "2381" "0" "2381" "0" "c.2381G>A" "r.(?)" "p.(Arg794Gln)" "" "0000964210" "00007329" "10" "2157" "0" "2157" "0" "c.2157C>T" "r.(?)" "p.(=)" "" "0000964211" "00007329" "30" "2024" "-14" "2024" "-14" "c.2024-14C>T" "r.(=)" "p.(=)" "" "0000964212" "00007329" "30" "2024" "-15" "2024" "-15" "c.2024-15del" "r.(=)" "p.(=)" "" "0000964215" "00007329" "50" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "" "0000964216" "00007329" "50" "1765" "0" "1765" "0" "c.1765A>G" "r.(?)" "p.(Arg589Gly)" "" "0000977314" "00007329" "90" "8984" "0" "8984" "0" "c.8984T>A" "r.(?)" "p.(Ile2995Asn)" "" "0000985483" "00007329" "90" "6528" "0" "6528" "0" "c.6528C>A" "r.(?)" "p.(Tyr2176Ter)" "" "0000985494" "00007329" "70" "2137" "20590" "3444" "-29847" "c.2137+20590_3444-29847del" "r.?" "p.(Val713AspfsTer14)" "" "0000986421" "00007329" "50" "4991" "0" "4991" "0" "c.4991C>T" "r.(?)" "p.(Thr1664Ile)" "26" "0000986422" "00007329" "50" "3127" "0" "3127" "0" "c.3127G>A" "r.(?)" "p.(Ala1043Thr)" "20" "0000986423" "00007329" "50" "7907" "0" "7907" "0" "c.7907G>A" "r.(?)" "p.(Cys2636Tyr)" "41" "0000986424" "00007329" "50" "8050" "0" "8050" "0" "c.8050A>C" "r.(?)" "p.(Thr2684Pro)" "41" "0000986425" "00007329" "90" "4361" "0" "4362" "0" "c.4361_4362delinsAG" "r.(?)" "p.(Ser1454Ter)" "26" "0000986924" "00007329" "50" "6632" "0" "6632" "0" "c.6632C>T" "r.(?)" "p.(Ser2211Leu)" "33" "0000986925" "00007329" "50" "9173" "0" "9173" "0" "c.9173C>A" "r.(?)" "p.(Ala3058Asp)" "44" "0000986926" "00007329" "50" "7907" "0" "7907" "0" "c.7907G>A" "r.(?)" "p.(Cys2636Tyr)" "41" "0000987011" "00007329" "70" "7553" "0" "7553" "0" "c.7553del" "r.(?)" "p.(Lys2518SerfsTer8)" "" "0000987099" "00007329" "70" "2528" "0" "2528" "0" "c.2528G>A" "r.(?)" "p.(Gly843Glu)" "" "0000987196" "00007329" "90" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558Ter)" "" "0000987277" "00007329" "90" "9405" "0" "9405" "0" "c.9405T>A" "r.(?)" "p.(Tyr3135Ter)" "" "0000987292" "00007329" "70" "8816" "0" "8816" "0" "c.8816G>A" "r.(?)" "p.(Cys2939Tyr)" "" "0000987305" "00007329" "70" "957" "0" "957" "0" "c.957del" "r.(?)" "p.(Glu319AspfsTer20)" "" "0000987318" "00007329" "70" "8779" "0" "8779" "0" "c.8779T>C" "r.(?)" "p.(Cys2927Arg)" "" "0000987322" "00007329" "90" "9299" "0" "9302" "0" "c.9299_9302del" "r.(?)" "p.(Thr3100LysfsTer26)" "" "0000987333" "00007329" "90" "8168" "0" "8168" "0" "c.8168del" "r.(?)" "p.(Gln2723ArgfsTer18)" "" "0000995844" "00007329" "30" "8429" "0" "8429" "0" "c.8429C>T" "r.(?)" "p.(Thr2810Ile)" "" "0000995845" "00007329" "30" "7889" "0" "7889" "0" "c.7889C>G" "r.(?)" "p.(Thr2630Ser)" "" "0000995846" "00007329" "50" "2596" "0" "2596" "0" "c.2596T>C" "r.(?)" "p.(Cys866Arg)" "" "0000995847" "00007329" "30" "2243" "0" "2243" "0" "c.2243G>T" "r.(?)" "p.(Cys748Phe)" "" "0001014230" "00007329" "50" "8255" "0" "8260" "0" "c.8255_8260del" "r.(?)" "p.(Leu2752_Asn2754delinsTyr)" "" "0001014231" "00007329" "50" "2288" "0" "2288" "0" "c.2288G>T" "r.(?)" "p.(Trp763Leu)" "" "0001019629" "00007329" "90" "32" "0" "32" "0" "c.32dup" "r.(?)" "p.(Met12Aspfs*14)" "" "0001019630" "00007329" "90" "95" "0" "95" "0" "c.95G>T" "r.(?)" "p.(Trp32Leu)" "" "0001019642" "00007329" "90" "4655" "0" "4655" "0" "c.4655T>A" "r.(?)" "p.(Leu1552*)" "" "0001019643" "00007329" "90" "3444" "-1514" "3569" "-2842" "c.3444-1514_3569-2842del" "r.(?)" "p.(Cys1149Metfs*7)" "21i_22i" "0001019644" "00007329" "90" "9362" "0" "9365" "0" "c.9362_9365del" "r.(?)" "p.(Pro3121Glnfs*5)" "" "0001019645" "00007329" "90" "-92617" "0" "-448" "26879" "c.-92617_-448+26879del" "r.0?" "p.0?" "_1_1i" "0001022296" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.?" "" "0001022318" "00007329" "90" "3443" "1" "3443" "1" "c.3443+1G>T" "r.spl" "p.?" "" "0001022320" "00007329" "90" "6794" "0" "6794" "0" "c.6794del" "r.(?)" "p.(Pro2265GlnfsTer46)" "" "0001022347" "00007329" "90" "6544" "0" "6547" "0" "c.6544_6547del" "r.(?)" "p.(Asn2182ValfsTer2)" "" "0001025250" "00007329" "50" "9432" "0" "9435" "0" "c.9432_9435del" "r.(?)" "p.(*3145Leuext*38)" "" "0001025251" "00007329" "50" "5110" "0" "5110" "0" "c.5110A>T" "r.(?)" "p.(Ile1704Leu)" "" "0001035866" "00007329" "50" "7253" "0" "7253" "0" "c.7253T>C" "r.(?)" "p.(Phe2418Ser)" "" "0001035867" "00007329" "90" "6416" "0" "6416" "0" "c.6416G>A" "r.(?)" "p.(Cys2139Tyr)" "" "0001035868" "00007329" "90" "2380" "0" "2380" "0" "c.2380C>T" "r.(?)" "p.(Arg794Ter)" "" "0001035869" "00007329" "90" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Trp558Ter)" "" "0001035870" "00007329" "90" "1641" "0" "1644" "0" "c.1641_1644del" "r.(?)" "p.(Ser547ArgfsTer62)" "" "0001035871" "00007329" "70" "1628" "0" "1631" "0" "c.1628_1631del" "r.(?)" "p.(Ser543Lysfs*66)" "" "0001044618" "00007329" "70" "3569" "-1312" "3684" "11593" "c.3569-1312_3684+11593del" "r.?" "p.?" "23i_24i" "0001049832" "00007329" "70" "2259" "3291" "2259" "3291" "c.2259+3291G>T" "r.(2259_2260ins[2259+3231_2259+3289])" "p.?" "" "0001049838" "00007329" "70" "216" "0" "216" "0" "c.216delA" "r.spl" "p.(Ala73LeufsTer12)" "" "0001052404" "00007329" "50" "1766" "2576" "1766" "2576" "c.1766+2576A>T" "r.(=)" "p.(=)" "" "0001052405" "00007329" "50" "1459" "5" "1459" "5" "c.1459+5C>T" "r.spl?" "p.?" "" "0001052406" "00007329" "30" "1026" "0" "1026" "0" "c.1026G>A" "r.(?)" "p.(=)" "" "0001064570" "00007329" "30" "6119" "0" "6119" "0" "c.6119T>A" "r.(?)" "p.(Val2040Asp)" "" "0001064571" "00007329" "50" "1852" "0" "1852" "0" "c.1852G>A" "r.(?)" "p.(Gly618Ser)" "" "0001078205" "00007329" "90" "7943" "0" "7943" "0" "c.7943del" "r.(?)" "p.(Thr2648LysfsTer34)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 2280 "{{screeningid}}" "{{variantid}}" "0000000126" "0000783293" "0000000211" "0000790459" "0000001640" "0000235838" "0000016557" "0000036426" "0000033164" "0000059884" "0000033164" "0000059887" "0000033177" "0000059885" "0000033200" "0000059883" "0000033225" "0000059881" "0000033417" "0000059888" "0000033417" "0000059889" "0000038589" "0000066245" "0000038589" "0000236242" "0000038589" "0000236243" "0000096328" "0000158321" "0000100508" "0000162807" "0000105037" "0000170285" "0000105490" "0000170924" "0000105490" "0000170936" "0000144693" "0000235528" "0000144694" "0000235529" "0000144695" "0000235530" "0000144696" "0000235531" "0000144697" "0000235532" "0000144698" "0000235533" "0000144699" "0000235534" "0000144700" "0000235535" "0000144701" "0000235542" "0000144702" "0000235543" "0000144703" "0000235544" "0000144704" "0000235545" "0000144705" "0000235546" "0000144706" "0000235547" "0000144707" "0000235548" "0000144708" "0000235549" "0000144709" "0000235552" "0000144710" "0000235553" "0000144711" "0000235554" "0000144712" "0000235555" "0000144713" "0000235566" "0000144714" "0000235580" "0000144715" "0000235581" "0000144716" "0000235596" "0000144717" "0000235604" "0000144718" "0000235605" "0000144719" "0000235606" "0000144720" "0000235667" "0000144720" "0000236344" "0000144721" "0000235668" "0000144721" "0000236346" "0000144722" "0000235669" "0000144722" "0000236347" "0000144723" "0000235670" "0000144723" "0000236348" "0000144724" "0000235671" "0000144725" "0000235672" "0000144725" "0000236349" "0000144726" "0000235675" "0000144727" "0000235676" "0000144727" "0000236351" "0000144728" "0000235677" "0000144728" "0000236352" "0000144729" "0000235678" "0000144729" "0000236353" "0000144730" "0000235683" "0000144731" "0000235685" "0000144732" "0000235692" "0000144733" "0000235699" "0000144734" "0000235700" "0000144735" "0000235701" "0000144736" "0000235727" "0000144737" "0000235728" "0000144738" "0000235729" "0000144739" "0000235740" "0000144740" "0000235741" "0000144741" "0000235742" "0000144742" "0000235743" "0000144743" "0000235744" "0000144744" "0000235756" "0000144745" "0000235764" "0000144746" "0000235765" "0000144747" "0000235766" "0000144748" "0000235767" "0000144749" "0000235768" "0000144750" "0000235769" "0000144751" "0000235770" "0000144752" "0000235771" "0000144753" "0000235775" "0000144754" "0000235783" "0000144755" "0000235786" "0000144756" "0000235787" "0000144757" "0000235788" "0000144758" "0000235789" "0000144759" "0000235790" "0000144760" "0000235791" "0000144761" "0000235793" "0000144762" "0000235794" "0000144763" "0000235795" "0000144764" "0000235796" "0000144765" "0000235797" "0000144766" "0000235798" "0000144767" "0000235831" "0000144768" "0000235832" "0000144769" "0000235833" "0000144770" "0000235841" "0000144771" "0000235842" "0000144772" "0000235845" "0000144773" "0000235865" "0000144774" "0000235878" "0000144775" "0000235881" "0000144776" "0000235882" "0000144777" "0000235883" "0000144778" "0000235884" "0000144779" "0000235887" "0000144780" "0000235894" "0000144781" "0000235907" "0000144782" "0000235914" "0000144783" "0000235917" "0000144784" "0000235944" "0000144785" "0000236026" "0000144786" "0000236027" "0000144787" "0000236028" "0000144788" "0000236035" "0000144789" "0000236036" "0000144790" "0000236037" "0000144791" "0000236040" "0000144792" "0000236043" "0000144793" "0000236044" "0000144794" "0000236045" "0000144795" "0000236046" "0000144796" "0000236052" "0000144797" "0000236059" "0000144798" "0000236060" "0000144799" "0000236061" "0000144800" "0000236066" "0000144801" "0000236069" "0000144802" "0000236074" "0000144803" "0000236075" "0000144806" "0000236085" "0000144807" "0000236086" "0000144808" "0000236087" "0000144809" "0000236088" "0000144810" "0000236089" "0000144811" "0000236090" "0000144812" "0000236091" "0000144813" "0000236092" "0000144814" "0000236093" "0000144815" "0000236094" "0000144816" "0000236095" "0000144817" "0000236096" "0000144818" "0000236097" "0000144819" "0000236098" "0000144820" "0000236102" "0000144821" "0000236115" "0000144822" "0000236130" "0000144823" "0000236131" "0000144824" "0000236148" "0000144825" "0000236153" "0000144826" "0000236154" "0000144827" "0000236172" "0000144827" "0000236245" "0000144828" "0000236173" "0000144828" "0000236246" "0000144829" "0000236178" "0000144830" "0000236179" "0000144831" "0000236180" "0000144832" "0000236196" "0000144833" "0000236211" "0000144834" "0000236222" "0000144835" "0000235536" "0000144835" "0000235537" "0000144836" "0000235538" "0000144836" "0000235539" "0000144837" "0000235540" "0000144837" "0000235541" "0000144838" "0000235550" "0000144838" "0000235551" "0000144839" "0000235556" "0000144839" "0000235557" "0000144840" "0000235558" "0000144840" "0000235559" "0000144841" "0000235560" "0000144841" "0000235561" "0000144842" "0000235562" "0000144842" "0000235563" "0000144843" "0000235564" "0000144843" "0000235565" "0000144844" "0000235567" "0000144845" "0000235568" "0000144846" "0000235569" "0000144847" "0000235570" "0000144848" "0000235571" "0000144849" "0000235572" "0000144850" "0000235573" "0000144851" "0000235574" "0000144851" "0000235575" "0000144851" "0000235576" "0000144851" "0000235577" "0000144852" "0000235578" "0000144852" "0000235579" "0000144853" "0000235582" "0000144854" "0000235583" "0000144854" "0000235584" "0000144854" "0000235585" "0000144854" "0000235586" "0000144855" "0000235587" "0000144856" "0000235588" "0000144856" "0000235589" "0000144856" "0000236341" "0000144857" "0000235590" "0000144857" "0000235591" "0000144857" "0000236342" "0000144858" "0000235592" "0000144858" "0000235593" "0000144859" "0000235594" "0000144859" "0000235595" "0000144860" "0000235597" "0000144860" "0000235598" "0000144861" "0000235599" "0000144861" "0000235600" "0000144862" "0000235601" "0000144863" "0000235602" "0000144863" "0000235603" "0000144864" "0000235607" "0000144864" "0000235608" "0000144865" "0000235609" "0000144865" "0000235610" "0000144865" "0000235611" "0000144865" "0000235612" "0000144866" "0000235613" "0000144866" "0000235614" "0000144866" "0000235615" "0000144867" "0000235616" "0000144867" "0000235617" "0000144868" "0000235618" "0000144868" "0000235619" "0000144868" "0000235620" "0000144869" "0000235621" "0000144870" "0000235622" "0000144871" "0000235623" "0000144871" "0000235624" "0000144872" "0000235625" "0000144873" "0000235626" "0000144873" "0000235627" "0000144874" "0000235628" "0000144875" "0000235629" "0000144875" "0000235630" "0000144876" "0000235631" "0000144877" "0000235632" "0000144878" "0000235633" "0000144879" "0000235634" "0000144880" "0000235635" "0000144881" "0000235636" "0000144882" "0000235637" "0000144883" "0000235638" "0000144884" "0000235639" "0000144885" "0000235640" "0000144886" "0000235641" "0000144887" "0000235642" "0000144888" "0000235643" "0000144889" "0000235644" "0000144890" "0000235645" "0000144891" "0000235646" "0000144891" "0000235647" "0000144892" "0000235648" "0000144893" "0000235649" "0000144893" "0000235650" "0000144894" "0000235651" "0000144895" "0000235652" "0000144896" "0000235653" "0000144897" "0000235654" "0000144898" "0000235655" "0000144899" "0000235656" "0000144900" "0000235657" "0000144901" "0000235658" "0000144902" "0000235659" "0000144903" "0000235660" "0000144904" "0000235661" "0000144905" "0000235662" "0000144906" "0000235663" "0000144907" "0000235664" "0000144908" "0000235665" "0000144909" "0000235666" "0000144910" "0000235673" "0000144910" "0000235674" "0000144910" "0000236350" "0000144911" "0000235679" "0000144911" "0000235680" "0000144912" "0000235681" "0000144912" "0000235682" "0000144912" "0000236354" "0000144913" "0000235684" "0000144914" "0000235686" "0000144914" "0000235687" "0000144915" "0000235688" "0000144915" "0000235689" "0000144916" "0000235690" "0000144916" "0000235691" "0000144917" "0000235693" "0000144918" "0000235694" "0000144919" "0000235695" "0000144920" "0000235696" "0000144920" "0000235697" "0000144920" "0000235698" "0000144921" "0000235702" "0000144921" "0000235703" "0000144922" "0000235704" "0000144922" "0000235705" "0000144922" "0000235706" "0000144923" "0000235707" "0000144923" "0000235708" "0000144924" "0000235709" "0000144925" "0000235710" "0000144926" "0000235711" "0000144926" "0000235712" "0000144927" "0000235713" "0000144928" "0000235714" "0000144929" "0000235715" "0000144930" "0000235716" "0000144931" "0000235717" "0000144932" "0000235718" "0000144933" "0000235719" "0000144934" "0000235720" "0000144935" "0000235721" "0000144936" "0000235722" "0000144937" "0000235723" "0000144938" "0000235724" "0000144939" "0000235725" "0000144940" "0000235726" "0000144941" "0000235730" "0000144941" "0000235731" "0000144942" "0000235732" "0000144942" "0000235733" "0000144943" "0000235734" "0000144943" "0000235735" "0000144944" "0000235736" "0000144944" "0000235737" "0000144945" "0000235738" "0000144945" "0000235739" "0000144946" "0000235745" "0000144946" "0000235746" "0000144947" "0000235747" "0000144947" "0000235748" "0000144948" "0000235749" "0000144948" "0000235750" "0000144949" "0000235751" "0000144949" "0000235752" "0000144950" "0000235753" "0000144951" "0000235754" "0000144952" "0000235755" "0000144953" "0000235757" "0000144954" "0000235758" "0000144955" "0000235759" "0000144956" "0000235760" "0000144957" "0000235761" "0000144958" "0000235762" "0000144959" "0000235763" "0000144960" "0000235772" "0000144960" "0000235773" "0000144961" "0000235774" "0000144962" "0000235776" "0000144962" "0000235777" "0000144962" "0000235778" "0000144963" "0000235779" "0000144964" "0000235780" "0000144965" "0000235781" "0000144966" "0000235782" "0000144967" "0000235784" "0000144968" "0000235785" "0000144969" "0000235792" "0000144970" "0000235799" "0000144970" "0000235800" "0000144971" "0000235801" "0000144971" "0000235802" "0000144972" "0000235803" "0000144972" "0000235804" "0000144972" "0000235805" "0000144973" "0000235806" "0000144973" "0000235807" "0000144974" "0000235808" "0000144974" "0000235809" "0000144975" "0000235810" "0000144975" "0000235811" "0000144976" "0000235812" "0000144976" "0000235813" "0000144977" "0000235814" "0000144977" "0000235815" "0000144978" "0000235816" "0000144978" "0000235817" "0000144979" "0000235818" "0000144979" "0000235819" "0000144980" "0000235820" "0000144980" "0000235821" "0000144981" "0000235822" "0000144982" "0000235823" "0000144983" "0000235824" "0000144984" "0000235825" "0000144985" "0000235826" "0000144986" "0000235827" "0000144987" "0000235828" "0000144988" "0000235829" "0000144989" "0000235830" "0000144990" "0000235834" "0000144990" "0000235835" "0000144991" "0000235836" "0000144991" "0000235837" "0000144992" "0000235839" "0000144992" "0000235840" "0000144993" "0000235843" "0000144993" "0000235844" "0000144994" "0000235846" "0000144994" "0000235847" "0000144995" "0000235848" "0000144996" "0000235849" "0000144997" "0000235850" "0000144998" "0000235851" "0000144999" "0000235852" "0000145000" "0000235853" "0000145001" "0000235854" "0000145002" "0000235855" "0000145003" "0000235856" "0000145004" "0000235857" "0000145005" "0000235858" "0000145006" "0000235859" "0000145007" "0000235860" "0000145008" "0000235861" "0000145009" "0000235862" "0000145010" "0000235863" "0000145011" "0000235864" "0000145012" "0000235866" "0000145012" "0000235867" "0000145013" "0000235868" "0000145013" "0000235869" "0000145014" "0000235870" "0000145014" "0000235871" "0000145015" "0000235872" "0000145015" "0000235873" "0000145016" "0000235874" "0000145016" "0000235875" "0000145017" "0000235876" "0000145017" "0000235877" "0000145018" "0000235879" "0000145018" "0000235880" "0000145019" "0000235885" "0000145019" "0000235886" "0000145020" "0000235888" "0000145020" "0000235889" "0000145021" "0000235890" "0000145021" "0000235891" "0000145022" "0000235892" "0000145022" "0000235893" "0000145023" "0000235895" "0000145023" "0000235896" "0000145024" "0000235897" "0000145024" "0000235898" "0000145025" "0000235899" "0000145025" "0000235900" "0000145026" "0000235901" "0000145026" "0000235902" "0000145027" "0000235903" "0000145027" "0000235904" "0000145028" "0000235905" "0000145028" "0000235906" "0000145029" "0000235908" "0000145029" "0000235909" "0000145030" "0000235910" "0000145030" "0000235911" "0000145031" "0000235912" "0000145031" "0000235913" "0000145032" "0000235915" "0000145032" "0000235916" "0000145033" "0000235918" "0000145033" "0000235919" "0000145034" "0000235920" "0000145034" "0000235921" "0000145035" "0000235922" "0000145035" "0000235923" "0000145036" "0000235924" "0000145036" "0000235925" "0000145037" "0000235926" "0000145037" "0000235927" "0000145038" "0000235928" "0000145038" "0000235929" "0000145039" "0000235930" "0000145039" "0000235931" "0000145040" "0000235932" "0000145040" "0000235933" "0000145041" "0000235934" "0000145041" "0000235935" "0000145042" "0000235936" "0000145042" "0000235937" "0000145043" "0000235938" "0000145043" "0000235939" "0000145044" "0000235940" "0000145044" "0000235941" "0000145045" "0000235942" "0000145045" "0000235943" "0000145046" "0000235945" "0000145046" "0000235946" "0000145047" "0000235947" "0000145047" "0000235948" "0000145048" "0000235949" "0000145048" "0000235950" "0000145049" "0000235951" "0000145049" "0000235952" "0000145050" "0000235953" "0000145051" "0000235954" "0000145051" "0000235955" "0000145052" "0000235956" "0000145052" "0000235957" "0000145053" "0000235958" "0000145053" "0000235959" "0000145054" "0000235960" "0000145054" "0000235961" "0000145055" "0000235962" "0000145055" "0000235963" "0000145056" "0000235964" "0000145056" "0000235965" "0000145057" "0000235966" "0000145057" "0000235967" "0000145058" "0000235968" "0000145058" "0000235969" "0000145059" "0000235970" "0000145059" "0000235971" "0000145060" "0000235972" "0000145060" "0000235973" "0000145061" "0000235974" "0000145061" "0000235975" "0000145062" "0000235976" "0000145062" "0000235977" "0000145063" "0000235978" "0000145063" "0000235979" "0000145064" "0000235980" "0000145064" "0000235981" "0000145065" "0000235982" "0000145065" "0000235983" "0000145066" "0000235984" "0000145066" "0000235985" "0000145067" "0000235986" "0000145067" "0000235987" "0000145068" "0000235988" "0000145068" "0000235989" "0000145069" "0000235990" "0000145069" "0000235991" "0000145070" "0000235992" "0000145070" "0000235993" "0000145071" "0000235994" "0000145071" "0000235995" "0000145072" "0000235996" "0000145072" "0000235997" "0000145073" "0000235998" "0000145073" "0000235999" "0000145074" "0000236000" "0000145074" "0000236001" "0000145075" "0000236002" "0000145075" "0000236003" "0000145076" "0000236004" "0000145076" "0000236005" "0000145077" "0000236006" "0000145077" "0000236007" "0000145078" "0000236008" "0000145078" "0000236009" "0000145079" "0000236010" "0000145079" "0000236011" "0000145080" "0000236012" "0000145080" "0000236013" "0000145081" "0000236014" "0000145081" "0000236015" "0000145082" "0000236016" "0000145082" "0000236017" "0000145083" "0000236018" "0000145083" "0000236019" "0000145084" "0000236020" "0000145084" "0000236021" "0000145085" "0000236022" "0000145085" "0000236023" "0000145086" "0000236024" "0000145086" "0000236025" "0000145087" "0000236029" "0000145087" "0000236030" "0000145088" "0000236031" "0000145088" "0000236032" "0000145089" "0000236033" "0000145089" "0000236034" "0000145090" "0000236038" "0000145090" "0000236039" "0000145091" "0000236041" "0000145091" "0000236042" "0000145092" "0000236047" "0000145092" "0000236048" "0000145093" "0000236049" "0000145093" "0000236050" "0000145094" "0000236051" "0000145095" "0000236053" "0000145095" "0000236054" "0000145095" "0000236248" "0000145096" "0000236055" "0000145096" "0000236056" "0000145097" "0000236057" "0000145097" "0000236058" "0000145098" "0000236062" "0000145098" "0000236063" "0000145099" "0000236064" "0000145099" "0000236065" "0000145100" "0000236067" "0000145100" "0000236068" "0000145101" "0000236070" "0000145101" "0000236071" "0000145102" "0000236072" "0000145102" "0000236073" "0000145103" "0000236076" "0000145103" "0000236077" "0000145104" "0000236078" "0000145104" "0000236079" "0000145107" "0000236099" "0000145108" "0000236100" "0000145108" "0000236101" "0000145109" "0000236103" "0000145109" "0000236104" "0000145110" "0000236105" "0000145110" "0000236106" "0000145111" "0000236107" "0000145111" "0000236108" "0000145112" "0000236109" "0000145112" "0000236110" "0000145113" "0000236111" "0000145113" "0000236112" "0000145114" "0000236113" "0000145114" "0000236114" "0000145115" "0000236116" "0000145115" "0000236117" "0000145116" "0000236118" "0000145116" "0000236119" "0000145117" "0000236120" "0000145117" "0000236121" "0000145118" "0000236122" "0000145118" "0000236123" "0000145119" "0000236124" "0000145119" "0000236125" "0000145120" "0000236126" "0000145120" "0000236127" "0000145121" "0000236128" "0000145121" "0000236129" "0000145122" "0000236132" "0000145122" "0000236133" "0000145122" "0000236247" "0000145123" "0000236134" "0000145123" "0000236135" "0000145124" "0000236136" "0000145124" "0000236137" "0000145125" "0000236138" "0000145125" "0000236139" "0000145126" "0000236140" "0000145126" "0000236141" "0000145127" "0000236142" "0000145127" "0000236143" "0000145128" "0000236144" "0000145128" "0000236145" "0000145129" "0000236146" "0000145129" "0000236147" "0000145130" "0000236149" "0000145130" "0000236150" "0000145131" "0000236151" "0000145131" "0000236152" "0000145132" "0000236155" "0000145132" "0000236156" "0000145133" "0000236157" "0000145133" "0000236158" "0000145134" "0000236159" "0000145134" "0000236160" "0000145135" "0000236161" "0000145135" "0000236162" "0000145136" "0000236163" "0000145136" "0000236164" "0000145136" "0000236165" "0000145137" "0000236166" "0000145137" "0000236167" "0000145138" "0000236168" "0000145138" "0000236169" "0000145139" "0000236170" "0000145139" "0000236171" "0000145140" "0000236174" "0000145140" "0000236175" "0000145141" "0000236176" "0000145141" "0000236177" "0000145142" "0000236181" "0000145142" "0000236182" "0000145143" "0000236183" "0000145143" "0000236184" "0000145144" "0000236185" "0000145144" "0000236186" "0000145145" "0000236187" "0000145145" "0000236188" "0000145146" "0000236189" "0000145146" "0000236190" "0000145146" "0000236191" "0000145147" "0000236192" "0000145147" "0000236193" "0000145148" "0000236194" "0000145148" "0000236195" "0000145149" "0000236197" "0000145149" "0000236198" "0000145150" "0000236199" "0000145150" "0000236200" "0000145151" "0000236201" "0000145151" "0000236202" "0000145152" "0000236203" "0000145152" "0000236204" "0000145153" "0000236205" "0000145153" "0000236206" "0000145154" "0000236207" "0000145154" "0000236208" "0000145155" "0000236209" "0000145155" "0000236210" "0000145156" "0000236212" "0000145156" "0000236213" "0000145157" "0000236214" "0000145157" "0000236215" "0000145158" "0000236216" "0000145158" "0000236217" "0000145159" "0000236218" "0000145159" "0000236219" "0000145160" "0000236220" "0000145160" "0000236221" "0000145161" "0000236223" "0000145161" "0000236224" "0000145162" "0000236225" "0000145162" "0000236226" "0000145163" "0000236227" "0000145163" "0000236228" "0000145164" "0000236229" "0000145165" "0000236230" "0000145166" "0000236231" "0000145166" "0000236232" "0000145167" "0000236233" "0000145168" "0000236234" "0000145169" "0000236235" "0000145170" "0000236236" "0000145171" "0000236237" "0000145171" "0000236238" "0000156181" "0000358103" "0000156325" "0000358247" "0000156326" "0000358248" "0000156326" "0000358437" "0000156327" "0000358249" "0000156328" "0000358250" "0000156329" "0000358251" "0000156330" "0000358252" "0000156331" "0000358253" "0000156332" "0000358254" "0000156332" "0000358438" "0000156333" "0000358255" "0000156334" "0000358256" "0000156334" "0000358439" "0000156335" "0000358257" "0000174728" "0000790654" "0000174762" "0000784134" "0000181353" "0000405049" "0000208630" "0000438550" "0000208630" "0000438551" "0000233815" "0000476523" "0000233816" "0000476524" "0000233817" "0000476525" "0000233818" "0000476526" "0000233819" "0000476527" "0000233820" "0000476528" "0000233821" "0000476529" "0000233822" "0000476530" "0000233823" "0000476531" "0000233824" "0000476532" "0000233825" "0000476533" "0000233826" "0000476534" "0000233827" "0000476535" "0000233828" "0000476536" "0000233829" "0000476537" "0000233830" "0000476538" "0000233831" "0000476539" "0000233832" "0000476540" "0000233833" "0000476541" "0000233834" "0000476542" "0000233835" "0000476543" "0000233836" "0000476544" "0000233837" "0000476545" "0000233838" "0000476546" "0000233839" "0000476547" "0000233840" "0000476548" "0000233841" "0000476549" "0000233842" "0000476550" "0000233843" "0000476551" "0000233844" "0000476552" "0000233845" "0000476553" "0000233846" "0000476554" "0000233847" "0000476555" "0000233848" "0000476556" "0000233849" "0000476557" "0000233850" "0000476558" "0000233851" "0000476559" "0000233852" "0000476560" "0000233853" "0000476561" "0000233854" "0000476562" "0000233855" "0000476563" "0000233856" "0000476564" "0000233857" "0000476565" "0000233858" "0000476566" "0000233859" "0000476567" "0000233860" "0000476568" "0000233861" "0000476569" "0000233862" "0000476570" "0000233863" "0000476571" "0000233864" "0000476572" "0000233865" "0000476573" "0000233866" "0000476574" "0000233867" "0000476575" "0000233868" "0000476576" "0000233869" "0000476577" "0000233870" "0000476578" "0000233871" "0000476579" "0000233872" "0000476580" "0000233873" "0000476581" "0000233874" "0000476582" "0000233875" "0000476583" "0000233876" "0000476584" "0000233877" "0000476585" "0000233878" "0000476586" "0000233879" "0000476587" "0000233880" "0000476588" "0000233881" "0000476589" "0000233882" "0000476590" "0000233883" "0000476591" "0000233884" "0000476592" "0000233885" "0000476593" "0000233886" "0000476594" "0000233887" "0000476595" "0000233888" "0000476596" "0000233889" "0000476597" "0000233890" "0000476598" "0000233891" "0000476599" "0000233892" "0000476600" "0000233893" "0000476601" "0000233894" "0000476602" "0000233895" "0000476603" "0000233896" "0000476604" "0000233897" "0000476605" "0000233898" "0000476606" "0000233899" "0000476607" "0000233900" "0000476608" "0000233901" "0000476609" "0000233902" "0000476610" "0000233903" "0000476611" "0000233904" "0000476612" "0000233905" "0000476613" "0000233906" "0000476614" "0000233907" "0000476615" "0000233908" "0000476616" "0000233909" "0000476617" "0000233910" "0000476618" "0000233911" "0000476619" "0000233912" "0000476620" "0000233913" "0000476621" "0000233914" "0000476622" "0000233915" "0000476623" "0000233916" "0000476624" "0000233917" "0000476625" "0000233918" "0000476626" "0000233919" "0000476627" "0000233920" "0000476628" "0000233921" "0000476629" "0000233922" "0000476630" "0000233923" "0000476631" "0000233924" "0000476632" "0000233925" "0000476633" "0000233926" "0000476634" "0000233927" "0000476635" "0000233928" "0000476636" "0000233929" "0000476637" "0000233930" "0000476638" "0000233931" "0000476639" "0000233932" "0000476640" "0000233933" "0000476641" "0000233934" "0000476642" "0000233935" "0000476643" "0000233936" "0000476644" "0000233937" "0000476645" "0000233938" "0000476646" "0000233939" "0000476647" "0000233940" "0000476648" "0000234790" "0000477498" "0000234791" "0000477499" "0000234792" "0000477500" "0000234793" "0000477501" "0000234794" "0000477502" "0000234795" "0000477503" "0000234796" "0000477504" "0000234797" "0000477505" "0000234798" "0000477506" "0000234799" "0000477507" "0000234800" "0000477508" "0000234801" "0000477509" "0000234802" "0000477510" "0000234803" "0000477511" "0000234804" "0000477512" "0000234805" "0000477513" "0000234806" "0000477514" "0000234807" "0000477515" "0000234808" "0000477516" "0000234809" "0000477517" "0000234810" "0000477518" "0000234811" "0000477519" "0000234812" "0000477520" "0000234813" "0000477521" "0000234814" "0000477522" "0000234815" "0000477523" "0000234816" "0000477524" "0000234817" "0000477525" "0000234818" "0000477526" "0000234819" "0000477527" "0000234820" "0000477528" "0000245619" "0000497789" "0000245619" "0000497790" "0000295336" "0000652025" "0000295337" "0000652026" "0000295338" "0000652027" "0000295339" "0000652028" "0000295340" "0000652029" "0000296772" "0000653483" "0000297173" "0000659798" "0000297173" "0000659799" "0000302791" "0000666145" "0000306241" "0000669929" "0000309550" "0000684415" "0000309550" "0000684434" "0000309652" "0000684525" "0000309653" "0000684526" "0000309654" "0000684527" "0000309655" "0000684528" "0000309656" "0000684529" "0000309781" "0000684654" "0000309788" "0000684661" "0000309788" "0000684697" "0000309788" "0000684698" "0000309789" "0000684662" "0000309789" "0000684699" "0000309790" "0000684663" "0000309790" "0000684700" "0000309791" "0000684664" "0000310281" "0000685192" "0000310282" "0000685193" "0000310283" "0000685194" "0000310284" "0000685195" "0000310285" "0000685196" "0000310286" "0000685197" "0000310287" "0000685198" "0000310288" "0000685199" "0000310289" "0000685200" "0000310290" "0000685201" "0000310291" "0000685202" "0000310292" "0000685203" "0000310293" "0000685204" "0000310294" "0000685205" "0000310295" "0000685206" "0000310296" "0000685207" "0000310297" "0000685208" "0000310298" "0000685209" "0000310299" "0000685210" "0000310300" "0000685211" "0000310301" "0000685212" "0000310302" "0000685213" "0000310303" "0000685214" "0000310304" "0000685215" "0000310305" "0000685216" "0000310306" "0000685217" "0000310307" "0000685218" "0000310308" "0000685219" "0000310309" "0000685220" "0000310310" "0000685221" "0000310870" "0000686011" "0000310900" "0000686041" "0000310901" "0000686042" "0000310902" "0000686043" "0000326675" "0000710267" "0000326675" "0000710349" "0000326675" "0000710367" "0000329148" "0000713271" "0000329148" "0000713691" "0000329169" "0000713292" "0000329225" "0000713348" "0000329225" "0000713730" "0000329276" "0000713399" "0000329276" "0000713753" "0000329276" "0000713754" "0000329302" "0000713425" "0000329374" "0000713497" "0000329374" "0000713809" "0000329382" "0000713505" "0000329433" "0000713556" "0000329433" "0000713839" "0000329444" "0000713567" "0000329444" "0000713848" "0000329444" "0000713849" "0000329481" "0000713604" "0000329481" "0000713865" "0000329508" "0000713631" "0000329508" "0000713881" "0000329530" "0000713653" "0000329538" "0000713661" "0000329538" "0000713900" "0000329539" "0000713662" "0000329539" "0000713901" "0000332467" "0000729722" "0000332468" "0000729723" "0000332469" "0000729724" "0000332469" "0000729767" "0000332470" "0000729725" "0000332470" "0000729768" "0000332471" "0000729726" "0000332472" "0000729727" "0000332472" "0000729769" "0000332473" "0000729728" "0000332473" "0000729770" "0000332474" "0000729729" "0000332475" "0000729730" "0000332476" "0000729731" "0000332477" "0000729732" "0000332477" "0000729771" "0000332478" "0000729733" "0000332478" "0000729772" "0000332479" "0000729734" "0000332479" "0000729773" "0000332480" "0000729735" "0000332480" "0000729774" "0000332481" "0000729736" "0000332481" "0000729775" "0000332482" "0000729737" "0000332482" "0000729776" "0000332483" "0000729738" "0000332483" "0000729777" "0000332484" "0000729739" "0000332484" "0000729778" "0000332485" "0000729740" "0000332485" "0000729779" "0000332486" "0000729741" "0000332486" "0000729780" "0000332487" "0000729742" "0000332487" "0000729781" "0000332922" "0000730210" "0000332922" "0000730270" "0000333712" "0000731475" "0000333712" "0000731525" "0000333713" "0000731476" "0000333713" "0000731526" "0000333714" "0000731477" "0000333714" "0000731522" "0000333731" "0000731503" "0000333731" "0000731523" "0000334624" "0000732556" "0000334624" "0000732591" "0000334625" "0000732557" "0000334625" "0000732592" "0000334626" "0000732558" "0000334626" "0000732593" "0000334627" "0000732559" "0000334648" "0000732580" "0000334649" "0000732581" "0000335050" "0000733059" "0000335050" "0000733528" "0000335051" "0000733060" "0000335051" "0000733529" "0000335052" "0000733061" "0000335052" "0000733530" "0000335053" "0000733062" "0000335116" "0000733125" "0000335116" "0000733578" "0000335127" "0000733136" "0000335127" "0000733584" "0000335645" "0000734339" "0000335645" "0000734392" "0000335646" "0000734340" "0000335787" "0000734686" "0000335787" "0000734698" "0000335789" "0000734688" "0000335792" "0000734691" "0000336460" "0000735835" "0000336474" "0000735849" "0000336474" "0000735869" "0000336503" "0000735899" "0000336565" "0000735990" "0000336566" "0000735991" "0000336645" "0000736090" "0000336645" "0000736131" "0000336649" "0000736094" "0000336649" "0000736136" "0000336653" "0000736140" "0000336653" "0000736141" "0000337203" "0000736833" "0000360216" "0000759943" "0000360216" "0000759964" "0000360369" "0000760261" "0000360369" "0000760476" "0000360387" "0000760279" "0000360398" "0000760290" "0000360400" "0000760292" "0000360402" "0000760294" "0000360423" "0000760315" "0000360445" "0000760337" "0000360570" "0000760602" "0000362654" "0000784146" "0000363439" "0000764094" "0000363441" "0000764096" "0000363441" "0000764140" "0000363445" "0000764100" "0000363447" "0000764102" "0000363463" "0000764118" "0000363463" "0000764131" "0000363463" "0000764133" "0000363469" "0000764124" "0000363469" "0000764153" "0000363469" "0000764156" "0000363472" "0000764127" "0000363472" "0000764155" "0000364134" "0000764896" "0000364135" "0000764897" "0000364863" "0000765805" "0000373860" "0000784405" "0000373870" "0000784325" "0000373870" "0000784326" "0000373877" "0000784319" "0000373877" "0000784320" "0000373878" "0000784400" "0000373885" "0000784411" "0000373887" "0000784386" "0000373899" "0000784344" "0000373909" "0000784377" "0000373913" "0000784498" "0000373915" "0000784339" "0000373915" "0000784340" "0000373919" "0000784383" "0000373920" "0000784233" "0000373920" "0000784303" "0000373922" "0000784360" "0000373925" "0000784238" "0000373925" "0000784321" "0000373929" "0000784403" "0000373931" "0000784244" "0000373931" "0000784336" "0000373932" "0000784245" "0000373932" "0000784337" "0000373933" "0000784246" "0000373933" "0000784338" "0000373951" "0000784488" "0000373954" "0000784492" "0000373964" "0000784430" "0000373965" "0000784278" "0000373968" "0000784453" "0000373973" "0000784286" "0000373977" "0000784290" "0000373982" "0000784295" "0000373990" "0000784670" "0000374600" "0000785392" "0000374603" "0000785395" "0000375052" "0000786313" "0000376608" "0000788373" "0000376613" "0000788396" "0000376623" "0000788453" "0000376625" "0000788467" "0000376626" "0000788476" "0000376627" "0000788486" "0000376632" "0000788519" "0000377484" "0000789840" "0000377484" "0000789841" "0000377485" "0000789842" "0000377485" "0000789843" "0000377509" "0000789871" "0000377510" "0000789872" "0000377957" "0000790474" "0000377958" "0000790477" "0000377959" "0000790409" "0000377960" "0000790410" "0000377960" "0000790487" "0000377961" "0000790411" "0000377961" "0000790491" "0000377964" "0000790499" "0000377966" "0000790508" "0000377969" "0000790517" "0000377971" "0000790530" "0000377976" "0000790426" "0000377976" "0000790563" "0000377976" "0000790564" "0000377976" "0000790565" "0000377983" "0000790581" "0000377984" "0000790584" "0000377988" "0000790592" "0000377989" "0000790601" "0000377989" "0000790603" "0000377989" "0000790604" "0000377990" "0000790605" "0000377995" "0000790622" "0000378071" "0000790740" "0000378447" "0000791202" "0000378447" "0000791254" "0000378461" "0000791216" "0000378461" "0000791255" "0000378462" "0000791217" "0000378462" "0000791256" "0000378705" "0000791554" "0000378729" "0000791582" "0000379139" "0000792221" "0000379140" "0000792222" "0000379149" "0000792246" "0000379150" "0000792247" "0000379161" "0000792270" "0000379219" "0000792335" "0000379219" "0000792336" "0000379223" "0000792341" "0000379232" "0000792355" "0000379232" "0000792356" "0000379248" "0000792378" "0000379248" "0000792379" "0000379250" "0000792383" "0000379251" "0000792385" "0000379266" "0000792405" "0000379266" "0000792406" "0000379268" "0000792408" "0000379268" "0000792410" "0000379271" "0000792412" "0000379271" "0000792413" "0000380576" "0000793721" "0000380577" "0000793722" "0000380578" "0000793723" "0000380734" "0000793911" "0000380734" "0000793912" "0000380737" "0000793917" "0000380737" "0000793918" "0000380745" "0000793931" "0000380745" "0000793932" "0000380747" "0000793935" "0000380747" "0000794880" "0000380758" "0000793949" "0000380758" "0000793950" "0000380772" "0000793966" "0000380772" "0000793967" "0000380832" "0000794035" "0000380832" "0000794881" "0000380849" "0000794062" "0000380868" "0000794090" "0000380868" "0000794091" "0000380871" "0000794096" "0000380871" "0000794097" "0000380949" "0000794194" "0000380949" "0000794195" "0000380954" "0000794201" "0000380954" "0000794885" "0000380956" "0000794203" "0000380956" "0000794204" "0000380964" "0000794217" "0000380964" "0000794218" "0000380967" "0000794222" "0000380974" "0000794233" "0000380974" "0000794234" "0000380998" "0000794259" "0000380998" "0000794260" "0000381037" "0000794319" "0000381038" "0000794320" "0000381039" "0000794321" "0000381039" "0000794322" "0000381040" "0000794323" "0000381040" "0000794324" "0000381350" "0000794751" "0000381360" "0000794770" "0000381360" "0000794771" "0000381372" "0000794794" "0000381372" "0000794795" "0000381373" "0000794796" "0000381373" "0000794797" "0000381375" "0000794800" "0000381375" "0000794801" "0000381407" "0000794846" "0000382227" "0000795943" "0000382891" "0000796842" "0000382900" "0000796855" "0000382900" "0000796856" "0000382900" "0000796857" "0000383067" "0000797059" "0000383068" "0000797060" "0000383068" "0000797140" "0000383068" "0000797141" "0000383069" "0000797061" "0000383069" "0000797142" "0000383070" "0000797062" "0000383070" "0000797143" "0000383071" "0000797063" "0000383071" "0000797144" "0000383072" "0000797064" "0000383073" "0000797065" "0000383074" "0000797066" "0000383074" "0000797145" "0000383075" "0000797067" "0000383075" "0000797146" "0000383076" "0000797068" "0000383492" "0000797608" "0000383492" "0000797609" "0000383493" "0000797610" "0000383493" "0000797611" "0000383494" "0000797612" "0000383495" "0000797613" "0000383496" "0000797614" "0000383496" "0000797615" "0000383497" "0000797616" "0000383498" "0000797617" "0000383498" "0000797618" "0000383499" "0000797619" "0000383499" "0000797621" "0000383500" "0000797622" "0000383500" "0000797623" "0000383501" "0000797624" "0000383501" "0000797625" "0000383502" "0000797626" "0000383502" "0000797627" "0000383503" "0000797628" "0000383503" "0000797630" "0000383504" "0000797631" "0000383505" "0000797632" "0000383505" "0000797633" "0000383506" "0000797634" "0000383507" "0000797636" "0000383508" "0000797637" "0000383508" "0000797638" "0000383509" "0000797640" "0000383510" "0000797642" "0000383510" "0000797643" "0000383511" "0000797644" "0000383511" "0000797645" "0000383512" "0000797646" "0000383512" "0000797647" "0000383513" "0000797648" "0000383513" "0000797649" "0000383514" "0000797650" "0000383514" "0000797651" "0000383515" "0000797652" "0000383515" "0000797653" "0000383516" "0000797654" "0000383516" "0000797655" "0000383517" "0000797656" "0000383518" "0000797657" "0000383518" "0000797658" "0000383519" "0000797659" "0000383519" "0000797660" "0000383520" "0000797661" "0000383520" "0000797662" "0000383633" "0000797817" "0000383678" "0000797897" "0000383754" "0000798000" "0000383755" "0000798001" "0000383756" "0000798002" "0000383756" "0000798003" "0000383757" "0000798004" "0000383758" "0000798005" "0000383759" "0000798006" "0000383939" "0000798327" "0000384071" "0000798501" "0000384714" "0000811482" "0000384714" "0000811518" "0000384714" "0000811519" "0000384715" "0000811483" "0000384715" "0000811520" "0000384716" "0000811484" "0000384716" "0000811521" "0000384717" "0000811485" "0000384966" "0000811807" "0000384973" "0000811814" "0000384989" "0000811830" "0000385011" "0000811852" "0000385012" "0000811853" "0000385014" "0000811855" "0000385049" "0000811909" "0000385067" "0000811936" "0000385067" "0000811937" "0000385129" "0000812006" "0000385129" "0000812007" "0000385133" "0000812011" "0000385149" "0000812034" "0000385149" "0000812035" "0000385175" "0000812074" "0000385202" "0000812118" "0000385233" "0000812169" "0000385233" "0000812170" "0000385277" "0000812242" "0000385280" "0000812246" "0000385280" "0000812247" "0000385284" "0000812253" "0000385284" "0000812254" "0000385314" "0000812298" "0000385314" "0000812299" "0000385327" "0000812325" "0000385327" "0000812327" "0000385346" "0000812355" "0000385353" "0000812366" "0000385353" "0000812367" "0000385393" "0000812431" "0000385398" "0000812438" "0000385400" "0000812440" "0000385407" "0000812452" "0000385496" "0000812563" "0000385496" "0000812564" "0000385508" "0000812579" "0000385508" "0000812580" "0000385967" "0000813182" "0000385967" "0000813183" "0000385967" "0000813184" "0000385968" "0000813185" "0000385969" "0000813186" "0000385983" "0000813200" "0000385984" "0000813201" "0000385985" "0000813202" "0000385986" "0000813203" "0000385987" "0000813204" "0000386404" "0000813901" "0000386404" "0000813902" "0000386624" "0000814262" "0000386626" "0000814264" "0000386634" "0000814272" "0000386634" "0000814299" "0000386930" "0000814753" "0000386930" "0000814796" "0000386941" "0000814764" "0000386941" "0000814802" "0000386948" "0000814771" "0000386948" "0000814806" "0000386956" "0000814779" "0000386956" "0000814811" "0000387074" "0000814928" "0000387074" "0000814931" "0000387455" "0000815608" "0000387463" "0000815499" "0000387486" "0000815370" "0000387486" "0000815518" "0000387503" "0000815536" "0000387511" "0000815395" "0000387511" "0000815547" "0000387512" "0000815396" "0000387512" "0000815549" "0000387520" "0000815624" "0000387531" "0000815415" "0000387531" "0000815553" "0000387795" "0000815953" "0000387795" "0000816305" "0000387801" "0000815959" "0000387802" "0000815960" "0000387802" "0000816311" "0000387816" "0000815974" "0000387816" "0000816323" "0000387821" "0000815979" "0000387821" "0000816324" "0000387829" "0000815987" "0000387829" "0000816331" "0000387837" "0000815995" "0000387837" "0000816338" "0000387837" "0000816339" "0000387846" "0000816004" "0000387846" "0000816346" "0000387851" "0000816009" "0000387851" "0000816350" "0000387852" "0000816010" "0000387852" "0000816351" "0000387856" "0000816014" "0000387856" "0000816355" "0000387863" "0000816021" "0000387863" "0000816364" "0000387873" "0000816031" "0000387879" "0000816037" "0000387879" "0000816374" "0000387880" "0000816038" "0000387880" "0000816375" "0000387897" "0000816055" "0000387897" "0000816391" "0000387901" "0000816059" "0000387928" "0000816086" "0000387928" "0000816415" "0000387940" "0000816098" "0000387940" "0000816421" "0000387954" "0000816112" "0000387954" "0000816431" "0000387962" "0000816120" "0000387962" "0000816437" "0000387964" "0000816122" "0000387964" "0000816438" "0000387968" "0000816126" "0000387968" "0000816442" "0000387969" "0000816127" "0000387969" "0000816443" "0000387986" "0000816144" "0000387986" "0000816455" "0000388027" "0000816185" "0000388027" "0000816489" "0000388040" "0000816198" "0000388040" "0000816499" "0000388053" "0000816211" "0000388053" "0000816510" "0000388076" "0000816234" "0000388076" "0000816523" "0000388100" "0000816258" "0000388145" "0000816565" "0000388265" "0000816725" "0000388265" "0000816830" "0000388266" "0000816726" "0000388266" "0000816831" "0000388267" "0000816727" "0000388267" "0000816832" "0000388268" "0000816728" "0000388269" "0000816729" "0000388270" "0000816730" "0000388270" "0000816833" "0000388271" "0000816731" "0000388271" "0000816834" "0000388272" "0000816732" "0000388273" "0000816733" "0000388273" "0000816835" "0000388274" "0000816734" "0000388274" "0000816836" "0000388275" "0000816735" "0000388275" "0000816837" "0000388276" "0000816736" "0000388276" "0000816838" "0000388616" "0000817314" "0000388616" "0000817332" "0000388618" "0000817337" "0000388618" "0000817338" "0000388855" "0000817634" "0000388855" "0000817635" "0000389719" "0000818943" "0000389719" "0000818944" "0000389721" "0000818947" "0000389729" "0000818962" "0000389729" "0000818963" "0000389745" "0000818980" "0000389746" "0000818981" "0000389784" "0000819043" "0000390069" "0000819414" "0000390070" "0000819415" "0000390077" "0000819422" "0000390077" "0000820640" "0000390078" "0000819423" "0000390078" "0000820641" "0000390094" "0000819439" "0000390094" "0000820647" "0000390124" "0000819469" "0000390124" "0000820657" "0000390438" "0000819783" "0000390438" "0000820719" "0000390511" "0000819856" "0000390517" "0000819862" "0000390517" "0000820739" "0000390518" "0000819863" "0000390518" "0000820740" "0000390543" "0000819888" "0000390543" "0000820750" "0000390544" "0000819889" "0000390544" "0000820751" "0000390578" "0000819923" "0000390579" "0000819924" "0000390637" "0000819982" "0000390678" "0000820023" "0000390679" "0000820024" "0000390685" "0000820030" "0000390685" "0000820789" "0000390780" "0000820125" "0000390785" "0000820130" "0000390785" "0000820821" "0000390816" "0000820161" "0000390844" "0000820189" "0000390848" "0000820193" "0000390881" "0000820226" "0000390882" "0000820227" "0000390889" "0000820234" "0000390889" "0000820847" "0000390926" "0000820271" "0000390926" "0000820853" "0000391012" "0000820357" "0000391033" "0000820378" "0000391046" "0000820391" "0000391046" "0000820894" "0000391052" "0000820397" "0000391052" "0000820896" "0000391055" "0000820400" "0000391055" "0000820899" "0000391070" "0000820415" "0000391070" "0000820905" "0000391119" "0000820464" "0000391175" "0000820520" "0000391177" "0000820522" "0000391177" "0000820956" "0000391206" "0000820551" "0000391206" "0000820971" "0000391220" "0000820565" "0000391220" "0000820978" "0000391253" "0000820598" "0000391253" "0000820990" "0000391492" "0000821241" "0000391492" "0000821550" "0000391493" "0000821242" "0000391494" "0000821243" "0000391495" "0000821244" "0000391495" "0000821551" "0000391496" "0000821245" "0000391497" "0000821246" "0000391497" "0000821552" "0000391498" "0000821247" "0000391498" "0000821553" "0000391499" "0000821248" "0000391499" "0000821554" "0000391500" "0000821249" "0000391500" "0000821555" "0000391501" "0000821250" "0000391501" "0000821556" "0000391714" "0000821464" "0000391979" "0000822052" "0000391980" "0000822053" "0000392049" "0000822143" "0000392469" "0000822769" "0000392471" "0000822771" "0000392471" "0000822834" "0000392472" "0000822772" "0000392472" "0000822835" "0000392473" "0000822773" "0000392473" "0000822836" "0000392475" "0000822775" "0000392475" "0000822838" "0000392477" "0000822777" "0000392477" "0000822839" "0000392480" "0000822780" "0000392480" "0000822840" "0000392481" "0000822781" "0000392482" "0000822782" "0000392485" "0000822785" "0000392485" "0000822841" "0000392486" "0000822786" "0000392486" "0000822842" "0000392487" "0000822787" "0000392487" "0000822843" "0000392488" "0000822788" "0000392488" "0000822844" "0000392490" "0000822790" "0000392502" "0000822802" "0000392502" "0000822849" "0000392504" "0000822804" "0000392505" "0000822805" "0000392505" "0000822850" "0000392509" "0000822809" "0000392514" "0000822814" "0000392515" "0000822815" "0000392515" "0000822854" "0000392516" "0000822816" "0000392518" "0000822818" "0000392519" "0000822819" "0000392520" "0000822820" "0000392521" "0000822821" "0000392523" "0000822823" "0000392523" "0000822857" "0000392526" "0000822826" "0000392527" "0000822827" "0000392528" "0000822828" "0000392529" "0000822829" "0000392530" "0000822830" "0000392530" "0000822858" "0000393613" "0000824393" "0000393613" "0000824394" "0000393822" "0000824644" "0000393825" "0000824647" "0000393826" "0000824648" "0000393830" "0000824652" "0000393830" "0000824757" "0000393847" "0000824669" "0000393847" "0000824766" "0000393849" "0000824671" "0000393851" "0000824673" "0000393851" "0000824769" "0000393899" "0000824721" "0000393899" "0000824796" "0000393907" "0000824729" "0000393908" "0000824730" "0000393908" "0000824800" "0000393909" "0000824731" "0000393909" "0000824801" "0000394742" "0000825748" "0000394810" "0000825849" "0000394810" "0000825850" "0000394817" "0000825860" "0000394817" "0000825861" "0000394832" "0000825882" "0000394838" "0000825890" "0000394842" "0000825896" "0000394842" "0000825897" "0000394849" "0000825906" "0000394849" "0000825907" "0000394865" "0000825927" "0000394865" "0000825928" "0000394934" "0000826035" "0000394934" "0000826036" "0000394946" "0000826056" "0000394948" "0000826058" "0000394948" "0000826059" "0000394962" "0000826083" "0000394962" "0000826084" "0000394995" "0000826136" "0000395024" "0000826179" "0000395024" "0000826180" "0000395053" "0000826222" "0000395053" "0000826223" "0000395053" "0000826224" "0000395061" "0000826237" "0000395061" "0000826238" "0000395073" "0000826253" "0000395073" "0000826254" "0000395101" "0000826295" "0000395101" "0000826296" "0000395117" "0000826320" "0000395117" "0000826321" "0000395145" "0000826366" "0000395145" "0000826367" "0000395150" "0000826375" "0000395150" "0000826376" "0000395246" "0000826504" "0000395246" "0000826505" "0000395566" "0000826933" "0000395567" "0000826934" "0000395567" "0000826935" "0000395801" "0000827209" "0000395801" "0000827210" "0000395817" "0000827234" "0000395817" "0000827235" "0000395818" "0000827236" "0000395818" "0000827237" "0000395819" "0000827238" "0000395819" "0000827239" "0000395820" "0000827240" "0000395820" "0000827241" "0000395821" "0000827242" "0000395821" "0000827243" "0000395822" "0000827244" "0000395822" "0000827245" "0000395823" "0000827246" "0000395823" "0000827247" "0000395824" "0000827248" "0000395824" "0000827249" "0000395825" "0000827250" "0000395825" "0000827251" "0000395826" "0000827252" "0000395826" "0000827253" "0000395827" "0000827254" "0000395827" "0000827255" "0000395828" "0000827256" "0000395828" "0000827257" "0000395828" "0000827258" "0000395829" "0000827259" "0000395829" "0000827260" "0000395830" "0000827261" "0000395830" "0000827262" "0000395831" "0000827263" "0000395831" "0000827264" "0000395832" "0000827265" "0000395832" "0000827266" "0000395833" "0000827267" "0000395834" "0000827268" "0000395835" "0000827269" "0000395836" "0000827270" "0000395837" "0000827271" "0000395838" "0000827272" "0000395839" "0000827273" "0000395840" "0000827274" "0000395841" "0000827275" "0000395842" "0000827276" "0000395843" "0000827277" "0000395844" "0000827278" "0000396660" "0000828311" "0000396661" "0000828312" "0000396662" "0000828313" "0000396815" "0000828500" "0000397028" "0000828774" "0000397028" "0000828979" "0000397030" "0000828776" "0000397030" "0000828981" "0000397038" "0000828784" "0000397038" "0000828989" "0000397050" "0000828796" "0000397050" "0000829001" "0000397053" "0000828799" "0000397053" "0000829004" "0000397056" "0000828802" "0000397056" "0000829007" "0000397057" "0000828803" "0000397057" "0000829008" "0000397071" "0000828817" "0000397071" "0000829022" "0000397072" "0000828818" "0000397072" "0000829023" "0000397073" "0000828819" "0000397073" "0000829024" "0000397074" "0000828820" "0000397074" "0000829025" "0000397076" "0000828822" "0000397076" "0000829027" "0000397077" "0000828823" "0000397077" "0000829028" "0000397078" "0000828824" "0000397078" "0000829029" "0000397079" "0000828825" "0000397079" "0000829030" "0000397084" "0000828830" "0000397084" "0000829035" "0000397087" "0000828833" "0000397123" "0000828869" "0000397143" "0000828889" "0000397152" "0000828898" "0000397162" "0000828908" "0000397168" "0000828914" "0000397188" "0000828934" "0000397203" "0000829052" "0000397203" "0000829074" "0000397670" "0000829718" "0000397670" "0000829733" "0000397703" "0000829766" "0000397734" "0000829812" "0000397734" "0000829813" "0000397735" "0000829814" "0000397736" "0000829815" "0000397736" "0000829816" "0000397736" "0000829817" "0000397738" "0000829818" "0000397738" "0000829819" "0000397741" "0000829822" "0000397743" "0000829824" "0000397743" "0000829825" "0000397744" "0000829826" "0000397746" "0000829827" "0000397746" "0000829828" "0000397747" "0000829964" "0000397747" "0000829965" "0000397748" "0000829829" "0000397749" "0000829830" "0000397757" "0000829838" "0000397759" "0000829841" "0000397760" "0000829842" "0000397760" "0000829843" "0000397761" "0000829844" "0000397762" "0000829845" "0000397762" "0000829846" "0000397766" "0000829850" "0000397766" "0000829851" "0000397767" "0000829852" "0000397767" "0000829853" "0000397777" "0000829868" "0000397778" "0000829869" "0000397783" "0000829874" "0000397783" "0000829875" "0000397785" "0000829876" "0000397785" "0000829877" "0000397795" "0000829883" "0000397795" "0000829884" "0000397799" "0000829885" "0000397799" "0000829886" "0000397805" "0000829888" "0000397817" "0000829894" "0000397817" "0000829895" "0000397817" "0000829896" "0000397821" "0000829898" "0000397821" "0000829899" "0000397823" "0000829900" "0000397823" "0000829901" "0000397825" "0000829902" "0000397825" "0000829903" "0000397829" "0000829905" "0000397829" "0000829906" "0000397831" "0000829907" "0000397831" "0000829908" "0000397833" "0000829909" "0000397833" "0000829910" "0000397841" "0000829912" "0000397841" "0000829913" "0000397845" "0000829914" "0000397845" "0000829915" "0000397847" "0000829916" "0000397849" "0000829917" "0000397849" "0000829918" "0000397851" "0000829919" "0000397851" "0000829920" "0000397857" "0000829921" "0000397857" "0000829922" "0000397865" "0000829927" "0000397865" "0000829928" "0000397867" "0000829929" "0000397867" "0000829930" "0000397873" "0000829934" "0000397874" "0000829935" "0000397874" "0000829936" "0000397875" "0000829937" "0000397875" "0000829938" "0000397881" "0000829942" "0000397884" "0000829943" "0000397884" "0000829944" "0000397886" "0000829945" "0000397886" "0000829946" "0000397887" "0000829947" "0000397887" "0000829948" "0000397888" "0000829949" "0000397894" "0000829955" "0000397895" "0000829956" "0000397895" "0000829957" "0000397896" "0000829976" "0000397896" "0000829977" "0000397897" "0000829958" "0000397897" "0000829959" "0000401326" "0000834544" "0000403501" "0000838946" "0000403501" "0000838947" "0000403510" "0000838959" "0000403510" "0000838960" "0000409672" "0000846876" "0000409672" "0000846928" "0000409673" "0000846877" "0000409673" "0000846929" "0000409697" "0000846901" "0000409698" "0000846902" "0000410260" "0000847538" "0000410261" "0000847539" "0000410765" "0000867620" "0000410765" "0000867645" "0000410766" "0000867621" "0000410766" "0000867646" "0000410768" "0000867623" "0000410768" "0000867648" "0000410769" "0000867624" "0000410769" "0000867649" "0000410770" "0000867625" "0000410770" "0000867650" "0000410773" "0000867628" "0000410773" "0000867653" "0000410774" "0000867629" "0000410774" "0000867654" "0000410775" "0000867630" "0000410775" "0000867655" "0000410776" "0000867631" "0000410776" "0000867656" "0000410777" "0000867632" "0000410777" "0000867657" "0000410778" "0000867633" "0000410778" "0000867658" "0000410783" "0000867638" "0000410784" "0000867639" "0000410785" "0000867640" "0000410786" "0000867641" "0000410787" "0000867642" "0000412233" "0000869502" "0000412233" "0000869503" "0000412234" "0000869504" "0000412235" "0000869505" "0000412235" "0000869506" "0000412236" "0000869507" "0000412236" "0000869508" "0000412237" "0000869509" "0000412237" "0000869510" "0000412238" "0000869511" "0000412239" "0000869512" "0000412239" "0000869513" "0000412240" "0000869514" "0000412240" "0000869515" "0000412241" "0000869516" "0000412242" "0000869517" "0000412243" "0000869518" "0000412243" "0000869519" "0000412244" "0000869520" "0000412245" "0000869521" "0000412245" "0000869522" "0000412246" "0000869523" "0000412247" "0000869524" "0000412248" "0000869525" "0000412248" "0000869526" "0000412249" "0000869527" "0000412249" "0000869528" "0000412249" "0000869529" "0000412250" "0000869530" "0000412250" "0000869531" "0000412251" "0000869532" "0000412251" "0000869533" "0000412252" "0000869534" "0000412253" "0000869535" "0000412253" "0000869536" "0000412254" "0000869537" "0000412254" "0000869538" "0000412255" "0000869539" "0000412255" "0000869540" "0000412256" "0000869541" "0000412256" "0000869542" "0000412257" "0000869543" "0000412258" "0000869544" "0000412258" "0000869545" "0000412259" "0000869546" "0000412260" "0000869547" "0000412260" "0000869548" "0000412260" "0000869549" "0000412261" "0000869550" "0000412261" "0000869551" "0000412262" "0000869552" "0000412262" "0000869553" "0000412263" "0000869554" "0000412264" "0000869555" "0000412264" "0000869556" "0000412265" "0000869557" "0000412265" "0000869558" "0000412266" "0000869559" "0000412267" "0000869560" "0000412267" "0000869561" "0000412268" "0000869562" "0000412268" "0000869563" "0000412269" "0000869564" "0000412269" "0000869565" "0000412270" "0000869566" "0000412271" "0000869567" "0000412272" "0000869568" "0000412272" "0000869569" "0000412273" "0000869570" "0000412273" "0000869571" "0000415715" "0000873584" "0000415715" "0000873585" "0000420996" "0000881453" "0000420996" "0000881464" "0000421174" "0000881787" "0000421174" "0000881788" "0000421175" "0000881789" "0000421175" "0000881790" "0000421176" "0000881791" "0000421177" "0000881792" "0000421178" "0000881793" "0000421179" "0000881794" "0000421180" "0000881795" "0000421181" "0000881796" "0000421182" "0000881797" "0000421183" "0000881798" "0000421184" "0000881799" "0000421185" "0000881800" "0000421186" "0000881801" "0000421700" "0000896444" "0000421700" "0000896445" "0000421704" "0000896452" "0000421707" "0000896456" "0000421707" "0000896457" "0000421716" "0000896470" "0000421716" "0000896471" "0000421729" "0000896492" "0000421729" "0000896493" "0000421752" "0000896528" "0000421752" "0000896529" "0000421754" "0000896532" "0000421759" "0000896538" "0000421759" "0000896539" "0000421760" "0000896540" "0000421760" "0000896541" "0000421785" "0000896579" "0000421785" "0000896580" "0000421788" "0000896584" "0000421808" "0000896609" "0000421808" "0000896610" "0000421809" "0000896611" "0000421814" "0000896619" "0000421814" "0000896620" "0000421827" "0000896635" "0000421827" "0000896636" "0000421851" "0000896668" "0000421851" "0000896669" "0000421854" "0000896673" "0000421857" "0000896677" "0000421865" "0000896687" "0000421865" "0000896688" "0000421872" "0000896698" "0000421872" "0000896699" "0000421873" "0000896700" "0000421873" "0000896701" "0000421879" "0000896710" "0000421895" "0000896732" "0000421895" "0000896733" "0000427208" "0000904505" "0000428233" "0000905891" "0000430909" "0000915798" "0000430909" "0000915799" "0000430915" "0000915806" "0000430925" "0000915818" "0000430925" "0000915819" "0000430932" "0000915828" "0000430932" "0000915829" "0000430942" "0000915845" "0000430942" "0000915846" "0000430958" "0000915866" "0000430958" "0000915867" "0000430961" "0000915871" "0000430961" "0000915872" "0000430966" "0000915880" "0000430966" "0000915881" "0000430967" "0000915882" "0000430968" "0000915883" "0000430968" "0000915884" "0000430971" "0000915887" "0000430978" "0000915895" "0000430979" "0000915896" "0000430988" "0000915906" "0000430988" "0000915907" "0000430989" "0000915908" "0000430989" "0000915909" "0000430990" "0000915910" "0000430990" "0000915911" "0000430993" "0000915915" "0000430993" "0000915916" "0000430995" "0000915919" "0000430995" "0000915920" "0000431005" "0000915934" "0000431006" "0000915935" "0000431010" "0000915939" "0000431015" "0000915945" "0000431037" "0000915978" "0000431037" "0000915979" "0000431039" "0000915981" "0000431086" "0000916043" "0000431086" "0000916044" "0000431092" "0000916052" "0000431092" "0000916053" "0000431096" "0000916059" "0000431104" "0000916069" "0000431104" "0000916070" "0000431130" "0000916104" "0000431130" "0000916105" "0000431147" "0000916133" "0000431147" "0000916134" "0000431150" "0000916137" "0000431150" "0000916138" "0000431159" "0000916151" "0000431159" "0000916152" "0000431184" "0000916193" "0000431184" "0000916194" "0000431188" "0000916200" "0000431214" "0000916244" "0000431214" "0000916245" "0000431219" "0000916253" "0000431219" "0000916254" "0000431264" "0000916324" "0000431264" "0000916325" "0000431267" "0000916330" "0000431267" "0000916331" "0000431317" "0000916407" "0000431317" "0000916408" "0000431330" "0000916425" "0000431330" "0000916426" "0000431334" "0000916430" "0000431334" "0000916431" "0000431347" "0000916451" "0000431354" "0000916461" "0000431354" "0000916462" "0000431379" "0000916501" "0000431379" "0000916502" "0000431379" "0000916503" "0000431391" "0000916519" "0000431412" "0000916549" "0000431439" "0000916596" "0000431439" "0000916597" "0000431456" "0000916623" "0000431456" "0000916624" "0000431465" "0000916636" "0000431465" "0000916637" "0000431465" "0000916638" "0000431468" "0000916642" "0000431480" "0000916657" "0000431480" "0000916658" "0000431480" "0000916659" "0000431481" "0000916660" "0000431486" "0000916667" "0000431486" "0000916668" "0000431486" "0000916669" "0000431491" "0000916675" "0000431491" "0000916676" "0000431502" "0000916692" "0000431529" "0000916730" "0000431531" "0000916733" "0000432315" "0000917725" "0000432315" "0000917806" "0000437646" "0000932989" "0000437646" "0000932990" "0000437902" "0000933349" "0000437902" "0000933350" "0000437922" "0000933386" "0000437922" "0000933387" "0000440174" "0000936332" "0000443144" "0000944532" "0000443145" "0000944533" "0000445830" "0000954015" "0000445830" "0000954082" "0000448546" "0000958032" "0000448546" "0000958429" "0000448563" "0000958049" "0000448563" "0000958443" "0000448564" "0000958050" "0000448564" "0000958444" "0000448570" "0000958056" "0000448571" "0000958057" "0000448581" "0000958067" "0000448597" "0000958083" "0000448597" "0000958468" "0000448636" "0000958489" "0000448835" "0000958321" "0000448835" "0000958604" "0000448835" "0000958605" "0000448838" "0000958324" "0000448838" "0000958608" "0000448838" "0000958609" "0000448843" "0000958329" "0000448843" "0000958615" "0000448845" "0000958331" "0000448845" "0000958619" "0000448846" "0000958332" "0000448849" "0000958335" "0000448849" "0000958624" "0000448855" "0000958341" "0000448855" "0000958629" "0000448867" "0000958353" "0000448867" "0000958638" "0000448882" "0000958368" "0000448882" "0000958656" "0000449033" "0000959256" "0000449081" "0000958848" "0000449082" "0000958849" "0000449082" "0000959283" "0000449082" "0000959284" "0000449085" "0000958852" "0000449085" "0000959286" "0000449086" "0000958853" "0000449086" "0000959287" "0000449090" "0000959295" "0000449092" "0000958859" "0000449092" "0000959299" "0000449171" "0000958938" "0000449171" "0000959374" "0000449187" "0000958954" "0000449187" "0000959393" "0000449191" "0000959399" "0000449191" "0000959400" "0000449197" "0000958964" "0000449209" "0000959427" "0000449279" "0000959046" "0000449284" "0000959051" "0000449293" "0000959060" "0000449295" "0000959474" "0000449297" "0000959064" "0000451578" "0000985483" "0000451578" "0000985494" "0000452438" "0000986421" "0000452438" "0000986924" "0000452439" "0000986422" "0000452439" "0000986925" "0000452440" "0000986423" "0000452441" "0000986424" "0000452442" "0000986425" "0000452442" "0000986926" "0000452666" "0000987011" "0000452667" "0000987305" "0000452748" "0000987318" "0000452754" "0000987099" "0000452765" "0000987322" "0000452851" "0000987196" "0000452858" "0000987333" "0000452932" "0000987277" "0000452947" "0000987292" "0000460619" "0001019629" "0000460619" "0001019630" "0000460627" "0001019642" "0000460627" "0001019643" "0000460628" "0001019644" "0000460628" "0001019645" "0000462745" "0001022296" "0000462745" "0001022347" "0000462767" "0001022318" "0000462769" "0001022320" "0000466967" "0001044618" "0000469494" "0001049832" "0000469494" "0001049838" "0000481631" "0001078205"