### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = FAM46A)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"FAM46A"	"family with sequence similarity 46, member A"	"6"	"q14.1"	"unknown"	"NC_000006.11"	"UD_136086895769"	""	"https://www.LOVD.nl/FAM46A"	"Osteogenesis Imperfecta & Ehlers-Danlos syndrome variant databases <http://www.le.ac.uk/genetics/collagen/>\r\nOsteogenesis Imperfecta Federation Europe (OIFE) <https://oife.org>"	"1"	"18345"	"55603"	"611357"	"1"	"1"	"1"	"1"	"Alias C6orf37, FAM46A.\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by <a href=\'http://www.variome.org\' target=\'_blank\'>Global Variome</a>.\r\nThis database is supported by <a href=\"https://oife.org/\" target=\"_blank\"><img src=\"gfx/LOVD_logo_OIFE.png\" width=\"120\"> Osteogenesis Imperfecta Federation Europe (OIFE)</a>"	""	"g"	"https://databases.lovd.nl/shared/refseq/FAM46A_codingDNA.html"	"1"	""	"<font color=\"#FF0000\">NOTE: The gene symbol for FAM46A has been changed to TENT5A</font><BR>\r\n<img src=\"gfx/LOVD_logo_IDdatabase.png\"><br><b>Osteogenesis Imperfecta Variant Database</b>\r\n<form action=\"\" id=\"SelectGeneDBOI\" method=\"get\" style=\"margin : 0px;\" onsubmit=\"document.location.href=(document.location.href.replace(\'FAM46A\', $(this).children(\'select\').val())); return false;\">\r\n<select name=\"select_db\" onchange=\"$(this).parent().submit();\">\r\n<option value=\"BMP1\" selected>BMP1 (bone morphogenetic protein 1)</option>\r\n<option value=\"CCDC134\">CCDC134 (coiled-coil domain containing 134)</option>\r\n<option value=\"COL1A1\">COL1A1 (collagen type I alpha 1 chain)</option>\r\n<option value=\"COL1A2\">COL1A2 (collagen type I alpha 2 chain)</option>\r\n<option value=\"CREB3L1\">CREB3L1 (cAMP responsive element binding protein 3 like 1)</option>\r\n<option value=\"CRTAP\">CRTAP (cartilage associated protein)</option>\r\n<option value=\"FAM46A\">FAM46A/TENT5A (family with sequence similarity 46 member A)</option>\r\n<option value=\"FKBP10\">FKBP10 (FKBP prolyl isomerase 10)</option>\r\n<option value=\"IFITM5\">IFITM5 (interferon induced transmembrane protein 5)</option>\r\n<option value=\"KDELR2\">KDELR2 (KDEL endoplasmic reticulum protein retention receptor 2)</option>\r\n<option value=\"LRP5\">LRP5 (LDL receptor related protein 5)</option>\r\n<option value=\"MBTPS2\">MBTPS2 (membrane bound transcription factor peptidase, site 2)</option>\r\n<option value=\"MESDC2\">MESDC2/MESD (mesoderm development candidate 2)</option>\r\n<option value=\"P3H1\">P3H1 (prolyl 3-hydroxylase 1)</option>\r\n<option value=\"P4HB\">P4HB (prolyl 4-hydroxylase subunit beta)</option>\r\n<option value=\"PLOD2\">PLOD2 (procollagen-lysine,2-oxoglutarate 5-dioxygenase 2)</option>\r\n<option value=\"PLS3\">PLS3 (plastin 3)</option>\r\n<option value=\"PPIB\">PPIB (peptidylprolyl isomerase B)</option>\r\n<option value=\"SEC24D\">SEC24D (SEC24 homolog D, COPII coat complex component)</option>\r\n<option value=\"SERPINF1\">SERPINF1 (serpin family F member 1)</option>\r\n<option value=\"SERPINH1\">SERPINH1 (serpin family H member 1)</option>\r\n<option value=\"SP7\">SP7 (Sp7 transcription factor)</option>\r\n<option value=\"SPARC\">SPARC (secreted protein acidic and cysteine rich)</option>\r\n<option value=\"TMEM38B\">TMEM38B (transmembrane protein 38B)</option>\r\n<option value=\"WNT1\">WNT1 (Wnt family member 1)</option>\r\n</select><input type=\"submit\" value=\"Switch OI gene\">\r\n</form>"	"-1"	""	"-1"	"00001"	"2013-05-03 00:00:00"	"00085"	"2022-04-05 12:55:10"	"00000"	"2025-11-01 13:22:20"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00007431"	"FAM46A"	"family with sequence similarity 46, member A"	"001"	"NM_017633.2"	""	"NP_060103.2"	""	""	""	"-318"	"5294"	"1329"	"82462428"	"82455447"	""	"0000-00-00 00:00:00"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 4
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00636"	"OI3"	"osteogenesis imperfecta, type III (OI3)"	"AD"	"259420"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-05-16 21:55:28"
"04214"	"-"	"retinal disease"	""	""	""	""	""	"00006"	"2015-02-27 19:48:07"	"00001"	"2023-03-09 14:26:26"
"05296"	"OI"	"osteogenesis imperfecta"	""	""	""	""	""	"00006"	"2017-06-26 22:59:16"	"00006"	"2025-09-23 21:54:31"
"05933"	"OI18"	"osteogenesis imperfecta, type XVIII (OI18)"	"AR"	"617952"	""	""	""	"00006"	"2021-05-12 07:29:17"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"FAM46A"	"05296"
"FAM46A"	"05933"


## Individuals ## Do not remove or alter this header ##
## Count = 5
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00372768"	""	""	""	"1"	""	"00085"	"{PMID:Doyard 2018:29358272}"	"There are two affected individuals in the same family, each homozygous for the variant."	""	""	"France"	""	"0"	""	""	""	""
"00372769"	""	""	""	"1"	""	"00085"	"{PMID:Doyard 2018:29358272}"	""	""	""	"Italy"	""	"0"	""	""	""	""
"00372770"	""	""	""	"1"	""	"00085"	"{PMID:Doyard 2018:29358272}"	""	""	""	"Egypt"	""	"0"	""	""	""	""
"00407356"	""	""	""	"1"	""	"00000"	"{PMID:Borràs 2013:23534816}"	""	""	""	"Spain"	""	"0"	""	""	"Spanish"	"RP-95"
"00466830"	""	""	""	"1"	""	"00006"	"{PMID:Tuysuz 2022:34902613}"	""	""	""	"Turkey"	""	"0"	""	""	""	"Pat117"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 5
"{{individualid}}"	"{{diseaseid}}"
"00372768"	"05296"
"00372769"	"05296"
"00372770"	"00636"
"00407356"	"04214"
"00466830"	"05296"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00636, 04214, 05296, 05933
## Count = 5
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"
"0000268045"	"05296"	"00372768"	"00085"	"-"	""	""	""	""	""	""	""	""	""	""	"OI"
"0000268046"	"05296"	"00372769"	"00085"	"-"	""	""	""	""	""	""	""	""	""	""	"OI"
"0000268047"	"00636"	"00372770"	"00085"	"-"	""	""	""	""	""	""	""	""	""	""	"OI III"
"0000299710"	"04214"	"00407356"	"00000"	"Familial, autosomal dominant"	""	""	""	""	""	""	""	""	""	""	"severe autosomal dominant retinitis pigmentosa (adRP)"
"0000352193"	"05296"	"00466830"	"00006"	"Familial, autosomal recessive"	""	"OI2 perinatally lethal"	""	""	""	""	""	""	""	""	"osteogenesis imperfecta"


## Screenings ## Do not remove or alter this header ##
## Count = 5
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000374001"	"00372768"	"1"	"00085"	"00085"	"2018-01-26 12:29:17"	""	""	"PCR;SEQ"	"DNA"	""	""
"0000374002"	"00372769"	"1"	"00085"	"00085"	"2018-01-26 11:30:36"	"00085"	"2018-01-26 11:55:43"	"PCR;SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000374003"	"00372770"	"1"	"00085"	"00085"	"2018-01-26 12:33:08"	""	""	"PCR;SEQ"	"DNA"	""	""
"0000408604"	"00407356"	"1"	"00000"	"00008"	"2022-04-06 13:32:24"	""	""	"SEQ-NG;SEQ"	"DNA"	"blood"	""
"0000468494"	"00466830"	"1"	"00006"	"00006"	"2025-09-24 08:32:06"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 4
"{{screeningid}}"	"{{geneid}}"
"0000374001"	"FAM46A"
"0000374002"	"FAM46A"
"0000374003"	"FAM46A"
"0000408604"	"SLC1A7"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 26
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000276587"	"0"	"30"	"6"	"82461798"	"82461798"	"subst"	"0"	"01943"	"FAM46A_000013"	"g.82461798T>A"	""	""	""	"FAM46A(NM_017633.2):c.61A>T (p.I21F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.81752081T>A"	""	"likely benign"	""
"0000529919"	"0"	"30"	"6"	"82461465"	"82461465"	"subst"	"0.00598391"	"01804"	"FAM46A_000014"	"g.82461465C>G"	""	""	""	"FAM46A(NM_017633.2):c.394G>C (p.(Asp132His)), TENT5A(NM_017633.3):c.394G>C (p.D132H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.81751748C>G"	""	"likely benign"	""
"0000529920"	"0"	"30"	"6"	"82461524"	"82461524"	"subst"	"0.00101061"	"01804"	"FAM46A_000004"	"g.82461524C>A"	""	""	""	"FAM46A(NM_017633.2):c.335G>T (p.(Arg112Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.81751807C>A"	""	"likely benign"	""
"0000529923"	"0"	"30"	"6"	"82461760"	"82461789"	"del"	"0"	"01804"	"FAM46A_000007"	"g.82461760_82461789del"	""	""	""	"FAM46A(NM_017633.2):c.102_131del (p.(Asp36_Gly45del)), TENT5A(NM_017633.2):c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.D36_G45del), TENT5A(NM_01...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.81752043_81752072del"	""	"likely benign"	""
"0000621777"	"0"	"10"	"6"	"82461775"	"82461789"	"dup"	"0"	"02329"	"FAM46A_000010"	"g.82461775_82461789dup"	""	""	""	"TENT5A(NM_017633.2):c.117_131dupCGGCGACTTCGGCGG (p.D41_G45dup), TENT5A(NM_017633.3):c.117_131dupCGGCGACTTCGGCGG (p.D41_G45dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.81752058_81752072dup"	""	"benign"	""
"0000721123"	"0"	"30"	"6"	"82461760"	"82461789"	"del"	"0"	"01943"	"FAM46A_000007"	"g.82461760_82461789del"	""	""	""	"FAM46A(NM_017633.2):c.102_131del (p.(Asp36_Gly45del)), TENT5A(NM_017633.2):c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.D36_G45del), TENT5A(NM_01...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000721124"	"0"	"10"	"6"	"82461775"	"82461789"	"dup"	"0"	"01943"	"FAM46A_000010"	"g.82461775_82461789dup"	""	""	""	"TENT5A(NM_017633.2):c.117_131dupCGGCGACTTCGGCGG (p.D41_G45dup), TENT5A(NM_017633.3):c.117_131dupCGGCGACTTCGGCGG (p.D41_G45dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000784684"	"3"	"99"	"6"	"82461479"	"82461479"	"subst"	"4.1868E-6"	"00085"	"FAM46A_000002"	"g.82461479T>C"	""	"{PMID:Doyard 2018:29358272}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000784685"	"3"	"99"	"6"	"82460131"	"82460132"	"dup"	"0"	"00085"	"FAM46A_000001"	"g.82460131_82460132dup"	""	"{PMID:Doyard 2018:29358272}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.81750414_81750415dup"	""	"pathogenic"	""
"0000784686"	"3"	"99"	"6"	"82460049"	"82460049"	"subst"	"0"	"00085"	"FAM46A_000003"	"g.82460049T>C"	""	"{PMID:Doyard 2018:29358272}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic"	""
"0000845523"	"0"	"50"	"6"	"82461785"	"82461785"	"subst"	"0"	"00000"	"FAM46A_000011"	"g.82461785C>T"	"Novel"	"{PMID:Borràs 2013:23534816}"	""	"c.74G>A"	""	"Germline"	"no"	""	"0"	""	""	""	""	"VUS"	""
"0000851327"	"0"	"10"	"6"	"82461730"	"82461789"	"dup"	"0"	"02329"	"FAM46A_000015"	"g.82461730_82461789dup"	""	""	""	"TENT5A(NM_017633.3):c.72_131dup (p.D26_G45dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000860529"	"0"	"10"	"6"	"82461745"	"82461789"	"dup"	"0"	"02329"	"FAM46A_000016"	"g.82461745_82461789dup"	""	""	""	"TENT5A(NM_017633.3):c.87_131dup (p.D31_G45dup)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000860530"	"0"	"10"	"6"	"82461785"	"82461785"	"subst"	"0"	"02329"	"FAM46A_000011"	"g.82461785C>T"	""	""	""	"TENT5A(NM_017633.3):c.74G>A (p.G25D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000887479"	"0"	"10"	"6"	"82461296"	"82461296"	"subst"	"0.00705655"	"02329"	"FAM46A_000017"	"g.82461296G>A"	""	""	""	"TENT5A(NM_017633.3):c.552+11C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000887480"	"0"	"10"	"6"	"82461760"	"82461789"	"del"	"0"	"02329"	"FAM46A_000007"	"g.82461760_82461789del"	""	""	""	"FAM46A(NM_017633.2):c.102_131del (p.(Asp36_Gly45del)), TENT5A(NM_017633.2):c.102_131delCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.D36_G45del), TENT5A(NM_01...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000887481"	"0"	"10"	"6"	"82461760"	"82461789"	"dup"	"0"	"02329"	"FAM46A_000008"	"g.82461760_82461789dup"	""	""	""	"FAM46A(NM_017633.2):c.87_116dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.(Gly39_Gly40insGlyAspPheGlyGlyGlyAspPheGlyGly)), TENT5A(NM_017633.3):c.72_101dupCG..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000929248"	"0"	"10"	"6"	"82461465"	"82461465"	"subst"	"0.00598391"	"02329"	"FAM46A_000014"	"g.82461465C>G"	""	""	""	"FAM46A(NM_017633.2):c.394G>C (p.(Asp132His)), TENT5A(NM_017633.3):c.394G>C (p.D132H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000964287"	"0"	"50"	"6"	"82459434"	"82459434"	"subst"	"0"	"01804"	"FAM46A_000018"	"g.82459434G>C"	""	""	""	"FAM46A(NM_017633.2):c.1307C>G (p.(Ser436Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000964288"	"0"	"30"	"6"	"82460045"	"82460045"	"subst"	"0.000763215"	"02329"	"FAM46A_000019"	"g.82460045A>C"	""	""	""	"TENT5A(NM_017633.3):c.696T>G (p.S232=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000964289"	"0"	"30"	"6"	"82461538"	"82461538"	"subst"	"2.47924E-5"	"02329"	"FAM46A_000020"	"g.82461538G>A"	""	""	""	"TENT5A(NM_017633.3):c.321C>T (p.R107=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000995930"	"0"	"50"	"6"	"82461740"	"82461741"	"del"	"0"	"01804"	"FAM46A_000021"	"g.82461740_82461741del"	""	""	""	"FAM46A(NM_017633.2):c.118_119delGG (p.(Gly40fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000995931"	"0"	"50"	"6"	"82461744"	"82461756"	"del"	"0"	"01804"	"FAM46A_000022"	"g.82461744_82461756del"	""	""	""	"FAM46A(NM_017633.2):c.104_116delGCGACTTCGGCGG (p.(Gly35fs))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000995932"	"0"	"50"	"6"	"82461760"	"82461789"	"dup"	"0"	"01804"	"FAM46A_000008"	"g.82461760_82461789dup"	""	""	""	"FAM46A(NM_017633.2):c.87_116dupCGGCGACTTCGGCGGCGGCGACTTCGGCGG (p.(Gly39_Gly40insGlyAspPheGlyGlyGlyAspPheGlyGly)), TENT5A(NM_017633.3):c.72_101dupCG..."	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001048328"	"3"	"90"	"6"	"82459567"	"82459567"	"subst"	"0"	"00006"	"FAM46A_000023"	"g.82459567G>A"	""	"{PMID:Tuysuz 2022:34902613}"	""	""	"ACMG PM1, PM2, PM4, PP3, PP1"	"Germline"	""	""	"0"	""	""	"g.81749850G>A"	""	"pathogenic"	""
"0001052426"	"0"	"50"	"6"	"82459415"	"82459415"	"subst"	"0"	"01804"	"FAM46A_000024"	"g.82459415A>C"	""	""	""	"TENT5A(NM_017633.3):c.1326T>G (p.(Asn442Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes FAM46A
## Count = 26
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"
"0000276587"	"00007431"	"30"	"61"	"0"	"61"	"0"	"c.61A>T"	"r.(?)"	"p.(Ile21Phe)"	""
"0000529919"	"00007431"	"30"	"394"	"0"	"394"	"0"	"c.394G>C"	"r.(?)"	"p.(Asp132His)"	""
"0000529920"	"00007431"	"30"	"335"	"0"	"335"	"0"	"c.335G>T"	"r.(?)"	"p.(Arg112Leu)"	""
"0000529923"	"00007431"	"30"	"102"	"0"	"131"	"0"	"c.102_131del"	"r.(?)"	"p.(Asp36_Gly45del)"	""
"0000621777"	"00007431"	"10"	"117"	"0"	"131"	"0"	"c.117_131dup"	"r.(?)"	"p.(Asp41_Gly45dup)"	""
"0000721123"	"00007431"	"30"	"102"	"0"	"131"	"0"	"c.102_131del"	"r.(?)"	"p.(Asp36_Gly45del)"	""
"0000721124"	"00007431"	"10"	"117"	"0"	"131"	"0"	"c.117_131dup"	"r.(?)"	"p.(Asp41_Gly45dup)"	""
"0000784684"	"00007431"	"99"	"380"	"0"	"380"	"0"	"c.380A>G"	"r.(?)"	"p.(His127Arg)"	"2"
"0000784685"	"00007431"	"99"	"612"	"0"	"613"	"0"	"c.612_613dup"	"r.(?)"	"p.(Ser205Tyrfs*13)"	"3"
"0000784686"	"00007431"	"99"	"692"	"0"	"692"	"0"	"c.692A>G"	"r.(?)"	"p.(Asp231Gly)"	"3"
"0000845523"	"00007431"	"50"	"74"	"0"	"74"	"0"	"c.74G>A"	"r.(?)"	"p.(Gly25Asp)"	"0"
"0000851327"	"00007431"	"10"	"72"	"0"	"131"	"0"	"c.72_131dup"	"r.(?)"	"p.(Asp26_Gly45dup)"	""
"0000860529"	"00007431"	"10"	"87"	"0"	"131"	"0"	"c.87_131dup"	"r.(?)"	"p.(Asp31_Gly45dup)"	""
"0000860530"	"00007431"	"10"	"74"	"0"	"74"	"0"	"c.74G>A"	"r.(?)"	"p.(Gly25Asp)"	""
"0000887479"	"00007431"	"10"	"552"	"11"	"552"	"11"	"c.552+11C>T"	"r.(=)"	"p.(=)"	""
"0000887480"	"00007431"	"10"	"102"	"0"	"131"	"0"	"c.102_131del"	"r.(?)"	"p.(Asp36_Gly45del)"	""
"0000887481"	"00007431"	"10"	"102"	"0"	"131"	"0"	"c.102_131dup"	"r.(?)"	"p.(Asp36_Gly45dup)"	""
"0000929248"	"00007431"	"10"	"394"	"0"	"394"	"0"	"c.394G>C"	"r.(?)"	"p.(Asp132His)"	""
"0000964287"	"00007431"	"50"	"1307"	"0"	"1307"	"0"	"c.1307C>G"	"r.(?)"	"p.(Ser436Cys)"	""
"0000964288"	"00007431"	"30"	"696"	"0"	"696"	"0"	"c.696T>G"	"r.(?)"	"p.(=)"	""
"0000964289"	"00007431"	"30"	"321"	"0"	"321"	"0"	"c.321C>T"	"r.(?)"	"p.(=)"	""
"0000995930"	"00007431"	"50"	"118"	"0"	"119"	"0"	"c.118_119del"	"r.(?)"	"p.(Gly40Argfs*153)"	""
"0000995931"	"00007431"	"50"	"104"	"0"	"116"	"0"	"c.104_116del"	"r.(?)"	"p.(Gly35Alafs*28)"	""
"0000995932"	"00007431"	"50"	"102"	"0"	"131"	"0"	"c.102_131dup"	"r.(?)"	"p.(Asp36_Gly45dup)"	""
"0001048328"	"00007431"	"90"	"1174"	"0"	"1174"	"0"	"c.1174C>T"	"r.(?)"	"p.(Gln392Ter)"	""
"0001052426"	"00007431"	"50"	"1326"	"0"	"1326"	"0"	"c.1326T>G"	"r.(?)"	"p.(Asn442Lys)"	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 5
"{{screeningid}}"	"{{variantid}}"
"0000374001"	"0000784684"
"0000374002"	"0000784685"
"0000374003"	"0000784686"
"0000408604"	"0000845523"
"0000468494"	"0001048328"