### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = FANCM)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"FANCM" "Fanconi anemia, complementation group M" "14" "q21.3" "unknown" "NG_007417.1" "UD_132118571737" "" "http://www.LOVD.nl/FANCM" "Fanconi anemia mutation databases homepage (Rockefeller University) " "1" "23168" "57697" "609644" "1" "1" "1" "1" "Reference sequence NG_007417.1 is identical to LRG_502" "" "g" "http://databases.lovd.nl/shared/refseq/FANCM_codingDNA.html" "1" "" "
A Fanconi anemia mutation database.
\r\n
" "-1" "" "-1" "00001" "2007-01-08 00:00:00" "00006" "2019-08-09 12:37:24" "00000" "2026-01-20 18:57:21"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00007729" "FANCM" "Fanconi anemia, complementation group M" "001" "NM_020937.2" "" "NP_065988.1" "" "" "" "-99" "7029" "6147" "45605136" "45670093" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 15
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00091" "CRC" "cancer, colorectal, susceptibility to (CRC)" "AD;SMu" "114500" "" "" "" "00001" "2012-12-07 10:49:46" "00006" "2021-12-10 21:51:32"
"00167" "FANCM" "Fanconi anemia, complementation group M" "" "614087" "" "" "" "00006" "2013-07-21 20:43:53" "00006" "2025-02-24 14:29:25"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00201" "INFM" "infertility, male (INFM)" "" "" "" "" "" "00006" "2013-09-14 21:03:39" "00006" "2015-12-07 07:11:25"
"00259" "obesity" "obesity, susceptibility to (incl. leanness)" "AD;AR;Mu" "601665" "" "" "" "00006" "2013-10-28 15:05:17" "00006" "2022-01-13 16:46:00"
"00318" "cancer, breast" "cancer, breast" "" "" "" "" "" "00006" "2014-02-02 14:42:53" "00006" "2019-08-28 08:24:47"
"00681" "cancer, pancreatic" "cancer, pancreatic" "" "260350" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-08-28 08:24:29"
"04187" "POF" "ovarian failure, premature (POF)" "" "" "" "" "" "00006" "2015-02-14 15:50:12" "00006" "2015-12-08 23:53:05"
"04300" "FANC" "Fanconi anemia (FANC)" "AD" "" "" "" "" "00006" "2015-07-19 11:40:38" "00006" "2021-12-10 21:51:32"
"05093" "cancer" "cancer" "" "" "" "" "" "00006" "2015-10-23 13:34:05" "" ""
"05562" "SPGF" "spermatogenic failure (SPGF)" "" "" "" "" "" "00006" "2019-02-13 22:06:30" "" ""
"05646" "SPGF28" "permatogenic failure, type 28 (SPGF-28)" "AR" "618086" "" "" "autosomal recessive" "00006" "2019-08-09 12:36:41" "00006" "2021-12-10 21:51:32"
"05647" "POF15" "ovarian failure, premature, type 15 (POF-15)" "AR" "618096" "" "" "autosomal recessive" "00006" "2019-08-09 13:13:15" "00006" "2021-12-10 21:51:32"
"07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 4
"{{geneid}}" "{{diseaseid}}"
"FANCM" "04300"
"FANCM" "05562"
"FANCM" "05646"
"FANCM" "05647"
## Individuals ## Do not remove or alter this header ##
## Count = 1535
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00001617" "" "" "" "1" "" "00075" "" "" "M" "yes" "Netherlands" "" "0" "" "" "white" ""
"00020027" "" "" "" "2" "" "00787" "{PMID:Meetei 2005:16116422}, {PMID:Singh 2009:19423727}" "2-generation family, 2 affected sibs, unaffected heterozygous carrier mother" "" "?" "" "" "0" "" "" "" "EUFA867"
"00020028" "" "" "" "1" "" "00787" "" "affected sibling of EUFA867" "?" "?" "" "" "0" "" "" "" ""
"00020029" "" "" "" "1" "" "00792" "{PMID:Harutyunyan 2011:21681190}" "polycythemia vera, subtype of myeloproliferative neoplasm; patient developed anemia and later transformed to secondary acute myeloid leukemia (sAML)" "M" "?" "Austria" "" "0" "" "" "" ""
"00020030" "" "" "" "1" "" "00046" "" "COIN trial" "?" "?" "" "" "0" "" "" "" ""
"00155228" "" "" "" "1" "" "00006" "{PMID:Saeed 2018:29311637}" "2-generation family, 1 affected, unaffected heterozygous carrier parents/relatives" "M" "yes" "Pakistan" "" "0" "" "" "Punjab" "29311637-Fam2"
"00179422" "" "" "" "1" "" "02551" "" "" "F" "" "" "" "0" "" "" "" ""
"00246517" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" ""
"00246518" "" "" "" "1" "" "00643" "{PMID:Fostira 2020:31300551}" "" "" "" "Greece" "" "0" "" "" "" ""
"00248192" "" "" "" "1" "" "01474" "{PMID:Lhota 2016:26822949}" "analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2" "F" "no" "Czech Republic" "" "0" "" "" "" ""
"00248207" "" "" "" "1" "" "01474" "{PMID:Lhota 2016:26822949}" "analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2" "F" "no" "Czech Republic" "" "0" "" "" "" ""
"00248236" "" "" "" "1" "" "01474" "{PMID:Lhota 2016:26822949}" "analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2" "F" "no" "Czech Republic" "" "0" "" "" "" ""
"00248252" "" "" "" "1" "" "01474" "{PMID:Lhota 2016:26822949}" "analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2" "F" "no" "Czech Republic" "" "0" "" "" "" ""
"00248272" "" "" "" "1" "" "01474" "{PMID:Lhota 2016:26822949}" "analysis 325 breast cancer cases negative for BRCA1/BRCA2/PALB2" "F" "no" "Czech Republic" "" "0" "" "" "" ""
"00260872" "" "" "" "4" "" "00006" "{PMID:Bogliolo 2018:28837157}, {DOI:Bogliolo 2018:10.1038/gim.2017.124}" "3-generation family, 4 affected (4M), unaffected heterozygous carrier parents/relatives" "M" "yes" "Spain" "" "0" "" "" "" "FamPatEGF280/EGF291"
"00260873" "" "" "" "1" "" "00006" "{PMID:Bogliolo 2018:28837157}, {DOI:Bogliolo 2018:10.1038/gim.2017.124}" "" "" "" "" "" "0" "" "" "" "PatEGF255"
"00260874" "" "" "" "1" "" "00006" "{PMID:Catucci 2018:28837162}" "" "F" "yes" "Italy" "" "0" "" "" "" "Pat1"
"00260875" "" "" "" "1" "" "00006" "{PMID:Catucci 2018:28837162}" "" "F" "" "Germany" "" "0" "" "" "" "Pat2"
"00260876" "" "" "" "1" "" "00006" "{PMID:Catucci 2018:28837162}" "" "F" "" "Sweden" "" "0" "" "" "" "Pat3"
"00260877" "" "" "" "1" "" "00006" "{PMID:Catucci 2018:28837162}" "" "F" "" "Sweden" "" "0" "" "" "" "Pat4"
"00260878" "" "" "" "1" "" "00006" "{PMID:Catucci 2018:28837162}" "" "F" "" "Spain" "" "0" "" "" "" "Pat5"
"00260880" "" "" "" "2" "" "00006" "{PMID:Kasak 2009:30075111}" "3-generation family, 2 affected brothers, unaffected heterozygous carrier parents" "M" "" "Estonia" "" "0" "" "" "" "FamPat1/2"
"00260881" "" "" "" "1" "" "00006" "{PMID:Kasak 2009:30075111}" "" "M" "" "Estonia" "" "0" "" "" "" "Pat3"
"00260882" "" "" "" "1" "" "00006" "{PMID:Kasak 2009:30075111}" "" "M" "" "Portugal" "" "0" "" "" "" "Pat4"
"00260884" "" "" "" "3" "" "00006" "{PMID:Yin 2019:29895858}" "family, 3 affected brothers, unaffected heterozygous carrier parents/relatives" "M" "yes" "Pakistan" "" "0" "" "" "" ""
"00260885" "" "" "" "2" "" "00006" "{PMID:Fouquet 2017:29231814}" "2-generation family, 2 affected sisters, unaffected heterozygous carrier parents/relatives" "F" "yes" "Finland" "" "0" "" "" "" ""
"00289279" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" ""
"00291034" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291035" "" "" "" "46" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291036" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291037" "" "" "" "28" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291038" "" "" "" "6" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291039" "" "" "" "224" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291040" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291041" "" "" "" "26" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291042" "" "" "" "14" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291043" "" "" "" "4" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00291044" "" "" "" "45" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304426" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304427" "" "" "" "7" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304428" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00336174" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336175" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336176" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336177" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336178" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336179" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336180" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336181" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336182" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336183" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336184" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336185" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336186" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336306" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336307" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336309" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336310" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336311" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336312" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00336313" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338713" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338714" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338715" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338716" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338717" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338718" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338719" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338720" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338721" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338722" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338723" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338724" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338725" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338726" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338727" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338728" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338729" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338730" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338731" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338732" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338733" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338734" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338735" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338736" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338737" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338738" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338739" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338740" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338741" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338742" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338743" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338744" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338745" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338746" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338747" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338748" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338749" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338750" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338751" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338752" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338753" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338754" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338755" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338756" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338757" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338758" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338759" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338760" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338761" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338762" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338763" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338764" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338765" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338766" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338767" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338768" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338769" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338770" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338771" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338772" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338773" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338774" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338775" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338776" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338777" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338778" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338779" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338780" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338781" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338782" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338783" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338784" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338785" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338786" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338787" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338788" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338789" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338790" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338791" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338792" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338793" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338794" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338795" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338796" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338797" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338798" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338799" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338800" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338801" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338802" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338803" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338804" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338805" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338806" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338807" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338808" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338809" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338810" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338811" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338812" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338813" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338814" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338815" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338816" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338817" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338818" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338819" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338820" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338821" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338822" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338823" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338824" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338825" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338826" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338827" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338828" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338829" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338830" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338831" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338832" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338833" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338834" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338835" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338836" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338837" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338838" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338839" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338840" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338841" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338842" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338843" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338844" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338845" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338846" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338847" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338848" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338849" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338850" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338851" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338852" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338853" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338854" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338855" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338856" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338857" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338858" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338859" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338860" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338861" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338862" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338863" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338864" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338865" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338866" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338867" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338868" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338869" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338870" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338871" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338872" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338873" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338874" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338875" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338876" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338877" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338878" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338879" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338880" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338881" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338882" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338883" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338884" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338885" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338886" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338887" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338888" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338889" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338890" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338891" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338892" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338893" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338894" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338895" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338896" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338897" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338898" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338899" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338900" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338901" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338902" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338903" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338904" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338905" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338906" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338907" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338908" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338909" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338910" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338911" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338912" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338913" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338914" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338915" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338916" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338917" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338918" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338919" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338920" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338921" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338922" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338923" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338924" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338925" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338926" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338927" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338928" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338929" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338930" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338931" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338932" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338933" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338934" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338935" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338936" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338937" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338938" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338939" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338940" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338941" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338942" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338943" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338944" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338945" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338946" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338947" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338948" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338949" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338950" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338951" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338952" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338953" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338954" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338955" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338956" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338957" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338958" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338959" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338960" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338961" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338962" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338963" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338964" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338965" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338966" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338967" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338968" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338969" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338970" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338971" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338972" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338973" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338974" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338975" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338976" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338977" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338978" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338979" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338980" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338981" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338982" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338983" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338984" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338985" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338986" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338987" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338988" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338989" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338990" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338991" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338992" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338993" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338994" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338995" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338996" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338997" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338998" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00338999" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339000" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339001" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339002" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339003" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339004" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339005" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339006" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339007" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339008" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339009" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339010" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339011" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339012" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339013" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339014" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339015" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339016" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339017" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339018" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339019" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339020" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339021" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339022" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339023" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339024" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339025" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339026" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339027" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339028" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339029" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339030" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339031" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339032" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339033" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339034" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339035" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339036" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339037" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339038" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339039" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339040" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339041" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339042" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339043" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339044" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339045" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339046" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339047" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339048" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339049" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339050" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339051" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339052" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339053" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339054" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339055" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339056" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339057" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339058" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339059" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339060" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339061" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339062" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339063" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339064" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339065" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339066" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339067" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339068" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339069" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339070" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339071" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339072" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339073" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339074" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339075" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339076" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339077" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339078" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339079" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339080" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339081" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339082" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339083" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339084" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339085" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339086" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339087" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339088" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339089" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339090" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339091" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339092" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339093" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339094" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339095" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339096" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339097" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339098" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339099" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339100" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339101" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339102" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339103" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339104" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339105" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339106" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339107" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339108" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339109" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339110" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339111" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339112" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339113" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339114" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339115" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339116" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339117" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339118" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339119" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339120" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339121" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339122" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339123" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00339124" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342262" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342263" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342264" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342265" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342266" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342267" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342268" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342269" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342270" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342271" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342272" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342273" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342274" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342275" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342276" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342277" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342278" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342279" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342280" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342281" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342282" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342529" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342530" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342531" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342533" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342534" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342535" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342536" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342537" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342538" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342539" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342540" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342541" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342542" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342543" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00342544" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345640" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345642" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345643" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345644" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345645" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345646" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345647" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345648" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345649" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345650" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345651" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345652" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345653" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345654" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345655" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345656" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345657" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345658" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345659" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345660" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345661" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345662" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345663" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345664" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345665" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345666" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345667" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345668" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345669" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345670" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345671" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345672" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345673" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345674" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345675" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345676" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345677" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345678" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345679" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345680" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345681" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345682" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345683" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345684" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345685" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345686" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345687" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345688" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345689" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345690" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345691" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345692" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345693" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345694" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345695" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345696" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345697" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345698" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345699" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345700" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345701" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345702" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345703" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345704" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345705" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345706" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345707" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345708" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345709" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345710" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345711" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345712" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345713" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345714" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345715" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345716" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345717" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345718" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345719" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345720" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345721" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345722" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345723" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345724" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345725" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345726" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345727" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345728" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345729" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345730" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345731" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345732" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345733" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345734" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345735" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345736" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345737" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345738" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345739" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345740" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345741" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345742" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345743" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345744" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345745" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345746" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345747" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345748" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345749" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345750" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345751" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345752" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345753" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345754" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345755" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345756" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345757" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345758" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345759" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345760" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345761" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345762" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345763" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345764" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345765" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345766" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345767" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345768" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345769" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345770" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345771" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345772" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345773" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345774" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345775" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345776" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345777" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345778" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345779" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345780" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345781" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345782" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345783" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345784" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345785" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345786" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345787" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345788" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345789" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345790" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345791" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345792" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345793" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345794" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345795" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345796" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345797" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345798" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345799" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345800" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345801" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345802" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345803" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345804" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345805" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345806" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345807" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345808" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345809" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345810" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345811" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345812" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345813" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345814" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345815" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345816" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345817" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345818" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345819" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345820" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345821" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345822" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345823" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345824" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345825" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345826" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345827" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345828" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345829" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345830" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345831" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345832" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345833" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345834" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345835" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345836" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345837" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345838" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345839" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345840" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345841" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345842" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345843" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345844" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345845" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345846" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345847" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345848" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345849" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345850" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345851" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345852" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345853" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345854" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345855" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345856" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345857" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345858" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345859" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345860" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345861" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345862" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345863" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345864" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345865" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345866" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345867" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345868" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345869" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345870" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345871" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345872" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345873" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345874" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345875" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345876" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345877" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345878" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345879" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345880" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345881" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345882" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345883" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345884" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345885" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345886" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345887" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345888" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345889" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345890" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345891" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345892" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345893" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345894" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345895" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345896" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345897" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345898" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345899" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345900" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345901" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345902" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345903" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345904" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345905" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345906" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345907" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345908" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345909" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345910" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345911" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345912" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345913" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345914" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345915" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345916" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345917" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345918" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345919" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345920" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345921" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345922" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345923" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345924" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345925" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345926" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345927" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345928" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345929" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345930" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345931" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345932" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345933" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345934" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345935" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345936" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345937" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345938" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345939" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345940" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345941" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345942" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345943" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345944" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345945" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345946" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345947" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345948" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345949" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345950" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345951" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345952" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345953" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345954" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345955" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345956" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345957" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345958" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345959" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345960" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345961" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345962" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345963" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345964" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345965" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345966" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345967" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345968" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345969" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345970" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345971" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345972" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345973" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345974" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345975" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345976" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345977" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345978" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345979" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345980" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345981" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345982" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345983" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345984" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345985" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345986" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345987" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345988" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345989" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345990" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345991" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345992" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345993" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345994" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345995" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345996" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345997" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345998" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00345999" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346000" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346001" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346002" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346003" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346004" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346005" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346006" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346007" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346008" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346009" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346010" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346011" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346012" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346013" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346014" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346015" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346016" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346017" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346018" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346019" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346020" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346021" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346022" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346023" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346024" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346025" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346026" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346027" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346028" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346029" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346030" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346031" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346032" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346033" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346034" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346035" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346036" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346037" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346038" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346039" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346040" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346041" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346042" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346043" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346044" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346045" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346046" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346047" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346048" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346049" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346050" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346051" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346052" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346053" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346054" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346055" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346056" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346057" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346058" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346059" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346060" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346061" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346062" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346063" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346064" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346065" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346066" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00346067" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349305" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349306" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349307" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349308" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349309" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349310" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349311" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349312" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00349396" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351462" "" "" "" "17" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351463" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351464" "" "" "" "12" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351465" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351466" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351467" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351468" "" "" "" "67" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351469" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351470" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351471" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351472" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351473" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351474" "" "" "" "58" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351475" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351476" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351477" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351478" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351479" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351480" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351481" "" "" "" "28" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351482" "" "" "" "41" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351483" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351484" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351485" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351486" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351487" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351488" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351489" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351490" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351491" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351492" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351493" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351494" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351495" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351496" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351497" "" "" "" "13" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351498" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351499" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351500" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351501" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351502" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351503" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351504" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351505" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351506" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351507" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351508" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351509" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351510" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351511" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351512" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351513" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351514" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351515" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351516" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351517" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351518" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351519" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351520" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351521" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351522" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351523" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351524" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351525" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351526" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351527" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351528" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351529" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351530" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351531" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351532" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351533" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351534" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351535" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351536" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351537" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351538" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351539" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351540" "" "" "" "44" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351541" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351542" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351543" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351544" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351545" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351546" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351547" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351548" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351549" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351550" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351551" "" "" "" "21" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351552" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351553" "" "" "" "13" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351554" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351555" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351556" "" "" "" "27" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351557" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351558" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351559" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351560" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351561" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351562" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351563" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351564" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351565" "" "" "" "18" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351566" "" "" "" "24" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351567" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351568" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351569" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351570" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351571" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351572" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351573" "" "" "" "23" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351574" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351575" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351576" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351577" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351578" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351579" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351580" "" "" "" "35" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351581" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351582" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351583" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351584" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351585" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351586" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351587" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351588" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351589" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351590" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351591" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351592" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351593" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351594" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351595" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351596" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351597" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351598" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351599" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351600" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351601" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351602" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351603" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351604" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351605" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351606" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351607" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351608" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351609" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351610" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351611" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351612" "" "" "" "24" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351613" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351614" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351615" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351616" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351617" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351618" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351619" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351620" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351621" "" "" "" "45" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351622" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351623" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351624" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351625" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351626" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351627" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351628" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351629" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351630" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351631" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351632" "" "" "" "12" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351633" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351634" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351635" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351636" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351637" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351638" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351639" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351640" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351641" "" "" "" "17" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351642" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351643" "" "" "" "16" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351644" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351645" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351646" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351647" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351648" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351649" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351650" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351651" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351652" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351653" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351654" "" "" "" "24" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351655" "" "" "" "18" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351656" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351657" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351658" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351659" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351660" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351661" "" "" "" "24" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351662" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351663" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351664" "" "" "" "12" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351665" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351666" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351667" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351668" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351669" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351670" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351671" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351672" "" "" "" "49" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351673" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351674" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351675" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351676" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351677" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351678" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351679" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351680" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351681" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351682" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351683" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351684" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351685" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351686" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351687" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351688" "" "" "" "34" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351689" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351690" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351691" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351692" "" "" "" "38" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351693" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351694" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351695" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351696" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351697" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351698" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351699" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351700" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351701" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351702" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351703" "" "" "" "38" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351704" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351705" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351706" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351707" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351708" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351709" "" "" "" "173" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351710" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351711" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351712" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351713" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351714" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351715" "" "" "" "23" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351716" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351717" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351718" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351719" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351720" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351721" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351722" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351723" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351724" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351725" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351726" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351727" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351728" "" "" "" "72" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351729" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351730" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351731" "" "" "" "19" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351732" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351733" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351734" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351735" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351736" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351737" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351738" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351739" "" "" "" "88" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351740" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351741" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351742" "" "" "" "19" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351743" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351744" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351745" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351746" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351747" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351748" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351749" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00351750" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 60466 cases (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354081" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354082" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354083" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354084" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354085" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354086" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354087" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354088" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00354172" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356238" "" "" "" "21" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356239" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356240" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356241" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356242" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356243" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356244" "" "" "" "55" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356245" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356246" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356247" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356248" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356249" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356250" "" "" "" "43" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356251" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356252" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356253" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356254" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356255" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356256" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356257" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356258" "" "" "" "30" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356259" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356260" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356261" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356262" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356263" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356264" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356265" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356266" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356267" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356268" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356269" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356270" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356271" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356272" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356273" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356274" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356275" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356276" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356277" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356278" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356279" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356280" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356281" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356282" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356283" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356284" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356285" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356286" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356287" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356288" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356289" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356290" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356291" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356292" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356293" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356294" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356295" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356296" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356297" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356298" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356299" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356300" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356301" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356302" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356303" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356304" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356305" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356306" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356307" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356308" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356309" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356310" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356311" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356312" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356313" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356314" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356315" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356316" "" "" "" "50" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356317" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356318" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356319" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356320" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356321" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356322" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356323" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356324" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356325" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356326" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356327" "" "" "" "17" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356328" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356329" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356330" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356331" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356332" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356333" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356334" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356335" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356336" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356337" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356338" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356339" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356340" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356341" "" "" "" "17" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356342" "" "" "" "32" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356343" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356344" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356345" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356346" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356347" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356348" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356349" "" "" "" "24" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356350" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356351" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356352" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356353" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356354" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356355" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356356" "" "" "" "45" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356357" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356358" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356359" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356360" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356361" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356362" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356363" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356364" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356365" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356366" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356367" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356368" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356369" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356370" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356371" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356372" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356373" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356374" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356375" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356376" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356377" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356378" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356379" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356380" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356381" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356382" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356383" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356384" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356385" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356386" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356387" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356388" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356389" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356390" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356391" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356392" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356393" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356394" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356395" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356396" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356397" "" "" "" "41" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356398" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356399" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356400" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356401" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356402" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356403" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356404" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356405" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356406" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356407" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356408" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356409" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356410" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356411" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356412" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356413" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356414" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356415" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356416" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356417" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356418" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356419" "" "" "" "22" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356420" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356421" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356422" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356423" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356424" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356425" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356426" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356427" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356428" "" "" "" "8" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356429" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356430" "" "" "" "14" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356431" "" "" "" "12" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356432" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356433" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356434" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356435" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356436" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356437" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356438" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356439" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356440" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356441" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356442" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356443" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356444" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356445" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356446" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356447" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356448" "" "" "" "40" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356449" "" "" "" "21" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356450" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356451" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356452" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356453" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356454" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356455" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356456" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356457" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356458" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356459" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356460" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356461" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356462" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356463" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356464" "" "" "" "31" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356465" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356466" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356467" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356468" "" "" "" "37" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356469" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356470" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356471" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356472" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356473" "" "" "" "4" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356474" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356475" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356476" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356477" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356478" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356479" "" "" "" "36" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356480" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356481" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356482" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356483" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356484" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356485" "" "" "" "129" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356486" "" "" "" "7" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356487" "" "" "" "9" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356488" "" "" "" "10" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356489" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356490" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356491" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356492" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356493" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356494" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356495" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356496" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356497" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356498" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356499" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356500" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356501" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356502" "" "" "" "15" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356503" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356504" "" "" "" "57" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356505" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356506" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356507" "" "" "" "24" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356508" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356509" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356510" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356511" "" "" "" "3" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356512" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356513" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356514" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356515" "" "" "" "81" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356516" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356517" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356518" "" "" "" "11" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356519" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356520" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356521" "" "" "" "5" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356522" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356523" "" "" "" "1" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356524" "" "" "" "2" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356525" "" "" "" "19" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00356526" "" "" "" "6" "" "04020" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "analysis 53461 controls (BRIDGES)" "" "" "" "" "0" "bcac.ccge.medschl.cam.ac.uk/contact" "" "" ""
"00376139" "" "" "" "1" "" "00585" "" "" "F" "" "Belgium" "" "0" "" "" "" ""
"00403087" "" "" "" "1" "" "00006" "{PMID:Kherraf 2022:35172124}, {DOI:Kherraf 2022:10.1016/j.ajhg.2022.01.011}" "analysis 96 unrelated men" "M" "" "Algeria" "" "0" "" "" "" "P0138"
"00470698" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected paternal aunt, paternal grandmother, maternal grandmother, maternal aunt, maternal cousin" "F" "" "Poland" "" "0" "" "" "" "Pat59"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 1534
"{{individualid}}" "{{diseaseid}}"
"00001617" "04300"
"00020027" "04300"
"00020028" "00167"
"00020029" "00167"
"00020030" "00091"
"00155228" "00259"
"00246517" "00318"
"00246518" "00318"
"00248192" "00318"
"00248207" "00318"
"00248236" "00318"
"00248252" "00318"
"00248272" "00318"
"00260872" "05093"
"00260873" "05093"
"00260874" "05093"
"00260875" "05093"
"00260876" "05093"
"00260877" "05093"
"00260878" "05093"
"00260880" "05562"
"00260881" "05562"
"00260882" "05562"
"00260884" "05562"
"00260885" "04187"
"00289279" "00198"
"00291034" "00198"
"00291035" "00198"
"00291036" "00198"
"00291037" "00198"
"00291038" "00198"
"00291039" "00198"
"00291040" "00198"
"00291041" "00198"
"00291042" "00198"
"00291043" "00198"
"00291044" "00198"
"00304426" "00198"
"00304427" "00198"
"00304428" "00198"
"00336174" "00000"
"00336175" "00000"
"00336176" "00000"
"00336177" "00000"
"00336178" "00000"
"00336179" "00000"
"00336180" "00000"
"00336181" "00000"
"00336182" "00000"
"00336183" "00000"
"00336184" "00000"
"00336185" "00000"
"00336186" "00000"
"00336306" "00000"
"00336307" "00000"
"00336309" "00000"
"00336310" "00000"
"00336311" "00000"
"00336312" "00000"
"00336313" "00000"
"00338713" "00000"
"00338714" "00000"
"00338715" "00000"
"00338716" "00000"
"00338717" "00000"
"00338718" "00000"
"00338719" "00000"
"00338720" "00000"
"00338721" "00000"
"00338722" "00000"
"00338723" "00000"
"00338724" "00000"
"00338725" "00000"
"00338726" "00000"
"00338727" "00000"
"00338728" "00000"
"00338729" "00000"
"00338730" "00000"
"00338731" "00000"
"00338732" "00000"
"00338733" "00000"
"00338734" "00000"
"00338735" "00000"
"00338736" "00000"
"00338737" "00000"
"00338738" "00000"
"00338739" "00000"
"00338740" "00000"
"00338741" "00000"
"00338742" "00000"
"00338743" "00000"
"00338744" "00000"
"00338745" "00000"
"00338746" "00000"
"00338747" "00000"
"00338748" "00000"
"00338749" "00000"
"00338750" "00000"
"00338751" "00000"
"00338752" "00000"
"00338753" "00000"
"00338754" "00000"
"00338755" "00000"
"00338756" "00000"
"00338757" "00000"
"00338758" "00000"
"00338759" "00000"
"00338760" "00000"
"00338761" "00000"
"00338762" "00000"
"00338763" "00000"
"00338764" "00000"
"00338765" "00000"
"00338766" "00000"
"00338767" "00000"
"00338768" "00000"
"00338769" "00000"
"00338770" "00000"
"00338771" "00000"
"00338772" "00000"
"00338773" "00000"
"00338774" "00000"
"00338775" "00000"
"00338776" "00000"
"00338777" "00000"
"00338778" "00000"
"00338779" "00000"
"00338780" "00000"
"00338781" "00000"
"00338782" "00000"
"00338783" "00000"
"00338784" "00000"
"00338785" "00000"
"00338786" "00000"
"00338787" "00000"
"00338788" "00000"
"00338789" "00000"
"00338790" "00000"
"00338791" "00000"
"00338792" "00000"
"00338793" "00000"
"00338794" "00000"
"00338795" "00000"
"00338796" "00000"
"00338797" "00000"
"00338798" "00000"
"00338799" "00000"
"00338800" "00000"
"00338801" "00000"
"00338802" "00000"
"00338803" "00000"
"00338804" "00000"
"00338805" "00000"
"00338806" "00000"
"00338807" "00000"
"00338808" "00000"
"00338809" "00000"
"00338810" "00000"
"00338811" "00000"
"00338812" "00000"
"00338813" "00000"
"00338814" "00000"
"00338815" "00000"
"00338816" "00000"
"00338817" "00000"
"00338818" "00000"
"00338819" "00000"
"00338820" "00000"
"00338821" "00000"
"00338822" "00000"
"00338823" "00000"
"00338824" "00000"
"00338825" "00000"
"00338826" "00000"
"00338827" "00000"
"00338828" "00000"
"00338829" "00000"
"00338830" "00000"
"00338831" "00000"
"00338832" "00000"
"00338833" "00000"
"00338834" "00000"
"00338835" "00000"
"00338836" "00000"
"00338837" "00000"
"00338838" "00000"
"00338839" "00000"
"00338840" "00000"
"00338841" "00000"
"00338842" "00000"
"00338843" "00000"
"00338844" "00000"
"00338845" "00000"
"00338846" "00000"
"00338847" "00000"
"00338848" "00000"
"00338849" "00000"
"00338850" "00000"
"00338851" "00000"
"00338852" "00000"
"00338853" "00000"
"00338854" "00000"
"00338855" "00000"
"00338856" "00000"
"00338857" "00000"
"00338858" "00000"
"00338859" "00000"
"00338860" "00000"
"00338861" "00000"
"00338862" "00000"
"00338863" "00000"
"00338864" "00000"
"00338865" "00000"
"00338866" "00000"
"00338867" "00000"
"00338868" "00000"
"00338869" "00000"
"00338870" "00000"
"00338871" "00000"
"00338872" "00000"
"00338873" "00000"
"00338874" "00000"
"00338875" "00000"
"00338876" "00000"
"00338877" "00000"
"00338878" "00000"
"00338879" "00000"
"00338880" "00000"
"00338881" "00000"
"00338882" "00000"
"00338883" "00000"
"00338884" "00000"
"00338885" "00000"
"00338886" "00000"
"00338887" "00000"
"00338888" "00000"
"00338889" "00000"
"00338890" "00000"
"00338891" "00000"
"00338892" "00000"
"00338893" "00000"
"00338894" "00000"
"00338895" "00000"
"00338896" "00000"
"00338897" "00000"
"00338898" "00000"
"00338899" "00000"
"00338900" "00000"
"00338901" "00000"
"00338902" "00000"
"00338903" "00000"
"00338904" "00000"
"00338905" "00000"
"00338906" "00000"
"00338907" "00000"
"00338908" "00000"
"00338909" "00000"
"00338910" "00000"
"00338911" "00000"
"00338912" "00000"
"00338913" "00000"
"00338914" "00000"
"00338915" "00000"
"00338916" "00000"
"00338917" "00000"
"00338918" "00000"
"00338919" "00000"
"00338920" "00000"
"00338921" "00000"
"00338922" "00000"
"00338923" "00000"
"00338924" "00000"
"00338925" "00000"
"00338926" "00000"
"00338927" "00000"
"00338928" "00000"
"00338929" "00000"
"00338930" "00000"
"00338931" "00000"
"00338932" "00000"
"00338933" "00000"
"00338934" "00000"
"00338935" "00000"
"00338936" "00000"
"00338937" "00000"
"00338938" "00000"
"00338939" "00000"
"00338940" "00000"
"00338941" "00000"
"00338942" "00000"
"00338943" "00000"
"00338944" "00000"
"00338945" "00000"
"00338946" "00000"
"00338947" "00000"
"00338948" "00000"
"00338949" "00000"
"00338950" "00000"
"00338951" "00000"
"00338952" "00000"
"00338953" "00000"
"00338954" "00000"
"00338955" "00000"
"00338956" "00000"
"00338957" "00000"
"00338958" "00000"
"00338959" "00000"
"00338960" "00000"
"00338961" "00000"
"00338962" "00000"
"00338963" "00000"
"00338964" "00000"
"00338965" "00000"
"00338966" "00000"
"00338967" "00000"
"00338968" "00000"
"00338969" "00000"
"00338970" "00000"
"00338971" "00000"
"00338972" "00000"
"00338973" "00000"
"00338974" "00000"
"00338975" "00000"
"00338976" "00000"
"00338977" "00000"
"00338978" "00000"
"00338979" "00000"
"00338980" "00000"
"00338981" "00000"
"00338982" "00000"
"00338983" "00000"
"00338984" "00000"
"00338985" "00000"
"00338986" "00000"
"00338987" "00000"
"00338988" "00000"
"00338989" "00000"
"00338990" "00000"
"00338991" "00000"
"00338992" "00000"
"00338993" "00000"
"00338994" "00000"
"00338995" "00000"
"00338996" "00000"
"00338997" "00000"
"00338998" "00000"
"00338999" "00000"
"00339000" "00000"
"00339001" "00000"
"00339002" "00000"
"00339003" "00000"
"00339004" "00000"
"00339005" "00000"
"00339006" "00000"
"00339007" "00000"
"00339008" "00000"
"00339009" "00000"
"00339010" "00000"
"00339011" "00000"
"00339012" "00000"
"00339013" "00000"
"00339014" "00000"
"00339015" "00000"
"00339016" "00000"
"00339017" "00000"
"00339018" "00000"
"00339019" "00000"
"00339020" "00000"
"00339021" "00000"
"00339022" "00000"
"00339023" "00000"
"00339024" "00000"
"00339025" "00000"
"00339026" "00000"
"00339027" "00000"
"00339028" "00000"
"00339029" "00000"
"00339030" "00000"
"00339031" "00000"
"00339032" "00000"
"00339033" "00000"
"00339034" "00000"
"00339035" "00000"
"00339036" "00000"
"00339037" "00000"
"00339038" "00000"
"00339039" "00000"
"00339040" "00000"
"00339041" "00000"
"00339042" "00000"
"00339043" "00000"
"00339044" "00000"
"00339045" "00000"
"00339046" "00000"
"00339047" "00000"
"00339048" "00000"
"00339049" "00000"
"00339050" "00000"
"00339051" "00000"
"00339052" "00000"
"00339053" "00000"
"00339054" "00000"
"00339055" "00000"
"00339056" "00000"
"00339057" "00000"
"00339058" "00000"
"00339059" "00000"
"00339060" "00000"
"00339061" "00000"
"00339062" "00000"
"00339063" "00000"
"00339064" "00000"
"00339065" "00000"
"00339066" "00000"
"00339067" "00000"
"00339068" "00000"
"00339069" "00000"
"00339070" "00000"
"00339071" "00000"
"00339072" "00000"
"00339073" "00000"
"00339074" "00000"
"00339075" "00000"
"00339076" "00000"
"00339077" "00000"
"00339078" "00000"
"00339079" "00000"
"00339080" "00000"
"00339081" "00000"
"00339082" "00000"
"00339083" "00000"
"00339084" "00000"
"00339085" "00000"
"00339086" "00000"
"00339087" "00000"
"00339088" "00000"
"00339089" "00000"
"00339090" "00000"
"00339091" "00000"
"00339092" "00000"
"00339093" "00000"
"00339094" "00000"
"00339095" "00000"
"00339096" "00000"
"00339097" "00000"
"00339098" "00000"
"00339099" "00000"
"00339100" "00000"
"00339101" "00000"
"00339102" "00000"
"00339103" "00000"
"00339104" "00000"
"00339105" "00000"
"00339106" "00000"
"00339107" "00000"
"00339108" "00000"
"00339109" "00000"
"00339110" "00000"
"00339111" "00000"
"00339112" "00000"
"00339113" "00000"
"00339114" "00000"
"00339115" "00000"
"00339116" "00000"
"00339117" "00000"
"00339118" "00000"
"00339119" "00000"
"00339120" "00000"
"00339121" "00000"
"00339122" "00000"
"00339123" "00000"
"00339124" "00000"
"00342262" "00318"
"00342263" "00318"
"00342264" "00318"
"00342265" "00318"
"00342266" "00318"
"00342267" "00318"
"00342268" "00318"
"00342269" "00318"
"00342270" "00318"
"00342271" "00318"
"00342272" "00318"
"00342273" "00318"
"00342274" "00318"
"00342275" "00318"
"00342276" "00318"
"00342277" "00318"
"00342278" "00318"
"00342279" "00318"
"00342280" "00318"
"00342281" "00318"
"00342282" "00318"
"00342529" "00318"
"00342530" "00318"
"00342531" "00318"
"00342533" "00318"
"00342534" "00318"
"00342535" "00318"
"00342536" "00318"
"00342537" "00318"
"00342538" "00318"
"00342539" "00318"
"00342540" "00318"
"00342541" "00318"
"00342542" "00318"
"00342543" "00318"
"00342544" "00318"
"00345640" "00318"
"00345642" "00318"
"00345643" "00318"
"00345644" "00318"
"00345645" "00318"
"00345646" "00318"
"00345647" "00318"
"00345648" "00318"
"00345649" "00318"
"00345650" "00318"
"00345651" "00318"
"00345652" "00318"
"00345653" "00318"
"00345654" "00318"
"00345655" "00318"
"00345656" "00318"
"00345657" "00318"
"00345658" "00318"
"00345659" "00318"
"00345660" "00318"
"00345661" "00318"
"00345662" "00318"
"00345663" "00318"
"00345664" "00318"
"00345665" "00318"
"00345666" "00318"
"00345667" "00318"
"00345668" "00318"
"00345669" "00318"
"00345670" "00318"
"00345671" "00318"
"00345672" "00318"
"00345673" "00318"
"00345674" "00318"
"00345675" "00318"
"00345676" "00318"
"00345677" "00318"
"00345678" "00318"
"00345679" "00318"
"00345680" "00318"
"00345681" "00318"
"00345682" "00318"
"00345683" "00318"
"00345684" "00318"
"00345685" "00318"
"00345686" "00318"
"00345687" "00318"
"00345688" "00318"
"00345689" "00318"
"00345690" "00318"
"00345691" "00318"
"00345692" "00318"
"00345693" "00318"
"00345694" "00318"
"00345695" "00318"
"00345696" "00318"
"00345697" "00318"
"00345698" "00318"
"00345699" "00318"
"00345700" "00318"
"00345701" "00318"
"00345702" "00318"
"00345703" "00318"
"00345704" "00318"
"00345705" "00318"
"00345706" "00318"
"00345707" "00318"
"00345708" "00318"
"00345709" "00318"
"00345710" "00318"
"00345711" "00318"
"00345712" "00318"
"00345713" "00318"
"00345714" "00318"
"00345715" "00318"
"00345716" "00318"
"00345717" "00318"
"00345718" "00318"
"00345719" "00318"
"00345720" "00318"
"00345721" "00318"
"00345722" "00318"
"00345723" "00318"
"00345724" "00318"
"00345725" "00318"
"00345726" "00318"
"00345727" "00318"
"00345728" "00318"
"00345729" "00318"
"00345730" "00318"
"00345731" "00318"
"00345732" "00318"
"00345733" "00318"
"00345734" "00318"
"00345735" "00318"
"00345736" "00318"
"00345737" "00318"
"00345738" "00318"
"00345739" "00318"
"00345740" "00318"
"00345741" "00318"
"00345742" "00318"
"00345743" "00318"
"00345744" "00318"
"00345745" "00318"
"00345746" "00318"
"00345747" "00318"
"00345748" "00318"
"00345749" "00318"
"00345750" "00318"
"00345751" "00318"
"00345752" "00318"
"00345753" "00318"
"00345754" "00318"
"00345755" "00318"
"00345756" "00318"
"00345757" "00318"
"00345758" "00318"
"00345759" "00318"
"00345760" "00318"
"00345761" "00318"
"00345762" "00318"
"00345763" "00318"
"00345764" "00318"
"00345765" "00318"
"00345766" "00318"
"00345767" "00318"
"00345768" "00318"
"00345769" "00318"
"00345770" "00318"
"00345771" "00318"
"00345772" "00318"
"00345773" "00318"
"00345774" "00318"
"00345775" "00318"
"00345776" "00318"
"00345777" "00318"
"00345778" "00318"
"00345779" "00318"
"00345780" "00318"
"00345781" "00318"
"00345782" "00318"
"00345783" "00318"
"00345784" "00318"
"00345785" "00318"
"00345786" "00318"
"00345787" "00318"
"00345788" "00318"
"00345789" "00318"
"00345790" "00318"
"00345791" "00318"
"00345792" "00318"
"00345793" "00318"
"00345794" "00318"
"00345795" "00318"
"00345796" "00318"
"00345797" "00318"
"00345798" "00318"
"00345799" "00318"
"00345800" "00318"
"00345801" "00318"
"00345802" "00318"
"00345803" "00318"
"00345804" "00318"
"00345805" "00318"
"00345806" "00318"
"00345807" "00318"
"00345808" "00318"
"00345809" "00318"
"00345810" "00318"
"00345811" "00318"
"00345812" "00318"
"00345813" "00318"
"00345814" "00318"
"00345815" "00318"
"00345816" "00318"
"00345817" "00318"
"00345818" "00318"
"00345819" "00318"
"00345820" "00318"
"00345821" "00318"
"00345822" "00318"
"00345823" "00318"
"00345824" "00318"
"00345825" "00318"
"00345826" "00318"
"00345827" "00318"
"00345828" "00318"
"00345829" "00318"
"00345830" "00318"
"00345831" "00318"
"00345832" "00318"
"00345833" "00318"
"00345834" "00318"
"00345835" "00318"
"00345836" "00318"
"00345837" "00318"
"00345838" "00318"
"00345839" "00318"
"00345840" "00318"
"00345841" "00318"
"00345842" "00318"
"00345843" "00318"
"00345844" "00318"
"00345845" "00318"
"00345846" "00318"
"00345847" "00318"
"00345848" "00318"
"00345849" "00318"
"00345850" "00318"
"00345851" "00318"
"00345852" "00318"
"00345853" "00318"
"00345854" "00318"
"00345855" "00318"
"00345856" "00318"
"00345857" "00318"
"00345858" "00318"
"00345859" "00318"
"00345860" "00318"
"00345861" "00318"
"00345862" "00318"
"00345863" "00318"
"00345864" "00318"
"00345865" "00318"
"00345866" "00318"
"00345867" "00318"
"00345868" "00318"
"00345869" "00318"
"00345870" "00318"
"00345871" "00318"
"00345872" "00318"
"00345873" "00318"
"00345874" "00318"
"00345875" "00318"
"00345876" "00318"
"00345877" "00318"
"00345878" "00318"
"00345879" "00318"
"00345880" "00318"
"00345881" "00318"
"00345882" "00318"
"00345883" "00318"
"00345884" "00318"
"00345885" "00318"
"00345886" "00318"
"00345887" "00318"
"00345888" "00318"
"00345889" "00318"
"00345890" "00318"
"00345891" "00318"
"00345892" "00318"
"00345893" "00318"
"00345894" "00318"
"00345895" "00318"
"00345896" "00318"
"00345897" "00318"
"00345898" "00318"
"00345899" "00318"
"00345900" "00318"
"00345901" "00318"
"00345902" "00318"
"00345903" "00318"
"00345904" "00318"
"00345905" "00318"
"00345906" "00318"
"00345907" "00318"
"00345908" "00318"
"00345909" "00318"
"00345910" "00318"
"00345911" "00318"
"00345912" "00318"
"00345913" "00318"
"00345914" "00318"
"00345915" "00318"
"00345916" "00318"
"00345917" "00318"
"00345918" "00318"
"00345919" "00318"
"00345920" "00318"
"00345921" "00318"
"00345922" "00318"
"00345923" "00318"
"00345924" "00318"
"00345925" "00318"
"00345926" "00318"
"00345927" "00318"
"00345928" "00318"
"00345929" "00318"
"00345930" "00318"
"00345931" "00318"
"00345932" "00318"
"00345933" "00318"
"00345934" "00318"
"00345935" "00318"
"00345936" "00318"
"00345937" "00318"
"00345938" "00318"
"00345939" "00318"
"00345940" "00318"
"00345941" "00318"
"00345942" "00318"
"00345943" "00318"
"00345944" "00318"
"00345945" "00318"
"00345946" "00318"
"00345947" "00318"
"00345948" "00318"
"00345949" "00318"
"00345950" "00318"
"00345951" "00318"
"00345952" "00318"
"00345953" "00318"
"00345954" "00318"
"00345955" "00318"
"00345956" "00318"
"00345957" "00318"
"00345958" "00318"
"00345959" "00318"
"00345960" "00318"
"00345961" "00318"
"00345962" "00318"
"00345963" "00318"
"00345964" "00318"
"00345965" "00318"
"00345966" "00318"
"00345967" "00318"
"00345968" "00318"
"00345969" "00318"
"00345970" "00318"
"00345971" "00318"
"00345972" "00318"
"00345973" "00318"
"00345974" "00318"
"00345975" "00318"
"00345976" "00318"
"00345977" "00318"
"00345978" "00318"
"00345979" "00318"
"00345980" "00318"
"00345981" "00318"
"00345982" "00318"
"00345983" "00318"
"00345984" "00318"
"00345985" "00318"
"00345986" "00318"
"00345987" "00318"
"00345988" "00318"
"00345989" "00318"
"00345990" "00318"
"00345991" "00318"
"00345992" "00318"
"00345993" "00318"
"00345994" "00318"
"00345995" "00318"
"00345996" "00318"
"00345997" "00318"
"00345998" "00318"
"00345999" "00318"
"00346000" "00318"
"00346001" "00318"
"00346002" "00318"
"00346003" "00318"
"00346004" "00318"
"00346005" "00318"
"00346006" "00318"
"00346007" "00318"
"00346008" "00318"
"00346009" "00318"
"00346010" "00318"
"00346011" "00318"
"00346012" "00318"
"00346013" "00318"
"00346014" "00318"
"00346015" "00318"
"00346016" "00318"
"00346017" "00318"
"00346018" "00318"
"00346019" "00318"
"00346020" "00318"
"00346021" "00318"
"00346022" "00318"
"00346023" "00318"
"00346024" "00318"
"00346025" "00318"
"00346026" "00318"
"00346027" "00318"
"00346028" "00318"
"00346029" "00318"
"00346030" "00318"
"00346031" "00318"
"00346032" "00318"
"00346033" "00318"
"00346034" "00318"
"00346035" "00318"
"00346036" "00318"
"00346037" "00318"
"00346038" "00318"
"00346039" "00318"
"00346040" "00318"
"00346041" "00318"
"00346042" "00318"
"00346043" "00318"
"00346044" "00318"
"00346045" "00318"
"00346046" "00318"
"00346047" "00318"
"00346048" "00318"
"00346049" "00318"
"00346050" "00318"
"00346051" "00318"
"00346052" "00318"
"00346053" "00318"
"00346054" "00318"
"00346055" "00318"
"00346056" "00318"
"00346057" "00318"
"00346058" "00318"
"00346059" "00318"
"00346060" "00318"
"00346061" "00318"
"00346062" "00318"
"00346063" "00318"
"00346064" "00318"
"00346065" "00318"
"00346066" "00318"
"00346067" "00318"
"00349305" "00318"
"00349306" "00318"
"00349307" "00318"
"00349308" "00318"
"00349309" "00318"
"00349310" "00318"
"00349311" "00318"
"00349312" "00318"
"00349396" "00318"
"00351462" "00318"
"00351463" "00318"
"00351464" "00318"
"00351465" "00318"
"00351466" "00318"
"00351467" "00318"
"00351468" "00318"
"00351469" "00318"
"00351470" "00318"
"00351471" "00318"
"00351472" "00318"
"00351473" "00318"
"00351474" "00318"
"00351475" "00318"
"00351476" "00318"
"00351477" "00318"
"00351478" "00318"
"00351479" "00318"
"00351480" "00318"
"00351481" "00318"
"00351482" "00318"
"00351483" "00318"
"00351484" "00318"
"00351485" "00318"
"00351486" "00318"
"00351487" "00318"
"00351488" "00318"
"00351489" "00318"
"00351490" "00318"
"00351491" "00318"
"00351492" "00318"
"00351493" "00318"
"00351494" "00318"
"00351495" "00318"
"00351496" "00318"
"00351497" "00318"
"00351498" "00318"
"00351499" "00318"
"00351500" "00318"
"00351501" "00318"
"00351502" "00318"
"00351503" "00318"
"00351504" "00318"
"00351505" "00318"
"00351506" "00318"
"00351507" "00318"
"00351508" "00318"
"00351509" "00318"
"00351510" "00318"
"00351511" "00318"
"00351512" "00318"
"00351513" "00318"
"00351514" "00318"
"00351515" "00318"
"00351516" "00318"
"00351517" "00318"
"00351518" "00318"
"00351519" "00318"
"00351520" "00318"
"00351521" "00318"
"00351522" "00318"
"00351523" "00318"
"00351524" "00318"
"00351525" "00318"
"00351526" "00318"
"00351527" "00318"
"00351528" "00318"
"00351529" "00318"
"00351530" "00318"
"00351531" "00318"
"00351532" "00318"
"00351533" "00318"
"00351534" "00318"
"00351535" "00318"
"00351536" "00318"
"00351537" "00318"
"00351538" "00318"
"00351539" "00318"
"00351540" "00318"
"00351541" "00318"
"00351542" "00318"
"00351543" "00318"
"00351544" "00318"
"00351545" "00318"
"00351546" "00318"
"00351547" "00318"
"00351548" "00318"
"00351549" "00318"
"00351550" "00318"
"00351551" "00318"
"00351552" "00318"
"00351553" "00318"
"00351554" "00318"
"00351555" "00318"
"00351556" "00318"
"00351557" "00318"
"00351558" "00318"
"00351559" "00318"
"00351560" "00318"
"00351561" "00318"
"00351562" "00318"
"00351563" "00318"
"00351564" "00318"
"00351565" "00318"
"00351566" "00318"
"00351567" "00318"
"00351568" "00318"
"00351569" "00318"
"00351570" "00318"
"00351571" "00318"
"00351572" "00318"
"00351573" "00318"
"00351574" "00318"
"00351575" "00318"
"00351576" "00318"
"00351577" "00318"
"00351578" "00318"
"00351579" "00318"
"00351580" "00318"
"00351581" "00318"
"00351582" "00318"
"00351583" "00318"
"00351584" "00318"
"00351585" "00318"
"00351586" "00318"
"00351587" "00318"
"00351588" "00318"
"00351589" "00318"
"00351590" "00318"
"00351591" "00318"
"00351592" "00318"
"00351593" "00318"
"00351594" "00318"
"00351595" "00318"
"00351596" "00318"
"00351597" "00318"
"00351598" "00318"
"00351599" "00318"
"00351600" "00318"
"00351601" "00318"
"00351602" "00318"
"00351603" "00318"
"00351604" "00318"
"00351605" "00318"
"00351606" "00318"
"00351607" "00318"
"00351608" "00318"
"00351609" "00318"
"00351610" "00318"
"00351611" "00318"
"00351612" "00318"
"00351613" "00318"
"00351614" "00318"
"00351615" "00318"
"00351616" "00318"
"00351617" "00318"
"00351618" "00318"
"00351619" "00318"
"00351620" "00318"
"00351621" "00318"
"00351622" "00318"
"00351623" "00318"
"00351624" "00318"
"00351625" "00318"
"00351626" "00318"
"00351627" "00318"
"00351628" "00318"
"00351629" "00318"
"00351630" "00318"
"00351631" "00318"
"00351632" "00318"
"00351633" "00318"
"00351634" "00318"
"00351635" "00318"
"00351636" "00318"
"00351637" "00318"
"00351638" "00318"
"00351639" "00318"
"00351640" "00318"
"00351641" "00318"
"00351642" "00318"
"00351643" "00318"
"00351644" "00318"
"00351645" "00318"
"00351646" "00318"
"00351647" "00318"
"00351648" "00318"
"00351649" "00318"
"00351650" "00318"
"00351651" "00318"
"00351652" "00318"
"00351653" "00318"
"00351654" "00318"
"00351655" "00318"
"00351656" "00318"
"00351657" "00318"
"00351658" "00318"
"00351659" "00318"
"00351660" "00318"
"00351661" "00318"
"00351662" "00318"
"00351663" "00318"
"00351664" "00318"
"00351665" "00318"
"00351666" "00318"
"00351667" "00318"
"00351668" "00318"
"00351669" "00318"
"00351670" "00318"
"00351671" "00318"
"00351672" "00318"
"00351673" "00318"
"00351674" "00318"
"00351675" "00318"
"00351676" "00318"
"00351677" "00318"
"00351678" "00318"
"00351679" "00318"
"00351680" "00318"
"00351681" "00318"
"00351682" "00318"
"00351683" "00318"
"00351684" "00318"
"00351685" "00318"
"00351686" "00318"
"00351687" "00318"
"00351688" "00318"
"00351689" "00318"
"00351690" "00318"
"00351691" "00318"
"00351692" "00318"
"00351693" "00318"
"00351694" "00318"
"00351695" "00318"
"00351696" "00318"
"00351697" "00318"
"00351698" "00318"
"00351699" "00318"
"00351700" "00318"
"00351701" "00318"
"00351702" "00318"
"00351703" "00318"
"00351704" "00318"
"00351705" "00318"
"00351706" "00318"
"00351707" "00318"
"00351708" "00318"
"00351709" "00318"
"00351710" "00318"
"00351711" "00318"
"00351712" "00318"
"00351713" "00318"
"00351714" "00318"
"00351715" "00318"
"00351716" "00318"
"00351717" "00318"
"00351718" "00318"
"00351719" "00318"
"00351720" "00318"
"00351721" "00318"
"00351722" "00318"
"00351723" "00318"
"00351724" "00318"
"00351725" "00318"
"00351726" "00318"
"00351727" "00318"
"00351728" "00318"
"00351729" "00318"
"00351730" "00318"
"00351731" "00318"
"00351732" "00318"
"00351733" "00318"
"00351734" "00318"
"00351735" "00318"
"00351736" "00318"
"00351737" "00318"
"00351738" "00318"
"00351739" "00318"
"00351740" "00318"
"00351741" "00318"
"00351742" "00318"
"00351743" "00318"
"00351744" "00318"
"00351745" "00318"
"00351746" "00318"
"00351747" "00318"
"00351748" "00318"
"00351749" "00318"
"00351750" "00318"
"00354081" "00000"
"00354082" "00000"
"00354083" "00000"
"00354084" "00000"
"00354085" "00000"
"00354086" "00000"
"00354087" "00000"
"00354088" "00000"
"00354172" "00000"
"00356238" "00000"
"00356239" "00000"
"00356240" "00000"
"00356241" "00000"
"00356242" "00000"
"00356243" "00000"
"00356244" "00000"
"00356245" "00000"
"00356246" "00000"
"00356247" "00000"
"00356248" "00000"
"00356249" "00000"
"00356250" "00000"
"00356251" "00000"
"00356252" "00000"
"00356253" "00000"
"00356254" "00000"
"00356255" "00000"
"00356256" "00000"
"00356257" "00000"
"00356258" "00000"
"00356259" "00000"
"00356260" "00000"
"00356261" "00000"
"00356262" "00000"
"00356263" "00000"
"00356264" "00000"
"00356265" "00000"
"00356266" "00000"
"00356267" "00000"
"00356268" "00000"
"00356269" "00000"
"00356270" "00000"
"00356271" "00000"
"00356272" "00000"
"00356273" "00000"
"00356274" "00000"
"00356275" "00000"
"00356276" "00000"
"00356277" "00000"
"00356278" "00000"
"00356279" "00000"
"00356280" "00000"
"00356281" "00000"
"00356282" "00000"
"00356283" "00000"
"00356284" "00000"
"00356285" "00000"
"00356286" "00000"
"00356287" "00000"
"00356288" "00000"
"00356289" "00000"
"00356290" "00000"
"00356291" "00000"
"00356292" "00000"
"00356293" "00000"
"00356294" "00000"
"00356295" "00000"
"00356296" "00000"
"00356297" "00000"
"00356298" "00000"
"00356299" "00000"
"00356300" "00000"
"00356301" "00000"
"00356302" "00000"
"00356303" "00000"
"00356304" "00000"
"00356305" "00000"
"00356306" "00000"
"00356307" "00000"
"00356308" "00000"
"00356309" "00000"
"00356310" "00000"
"00356311" "00000"
"00356312" "00000"
"00356313" "00000"
"00356314" "00000"
"00356315" "00000"
"00356316" "00000"
"00356317" "00000"
"00356318" "00000"
"00356319" "00000"
"00356320" "00000"
"00356321" "00000"
"00356322" "00000"
"00356323" "00000"
"00356324" "00000"
"00356325" "00000"
"00356326" "00000"
"00356327" "00000"
"00356328" "00000"
"00356329" "00000"
"00356330" "00000"
"00356331" "00000"
"00356332" "00000"
"00356333" "00000"
"00356334" "00000"
"00356335" "00000"
"00356336" "00000"
"00356337" "00000"
"00356338" "00000"
"00356339" "00000"
"00356340" "00000"
"00356341" "00000"
"00356342" "00000"
"00356343" "00000"
"00356344" "00000"
"00356345" "00000"
"00356346" "00000"
"00356347" "00000"
"00356348" "00000"
"00356349" "00000"
"00356350" "00000"
"00356351" "00000"
"00356352" "00000"
"00356353" "00000"
"00356354" "00000"
"00356355" "00000"
"00356356" "00000"
"00356357" "00000"
"00356358" "00000"
"00356359" "00000"
"00356360" "00000"
"00356361" "00000"
"00356362" "00000"
"00356363" "00000"
"00356364" "00000"
"00356365" "00000"
"00356366" "00000"
"00356367" "00000"
"00356368" "00000"
"00356369" "00000"
"00356370" "00000"
"00356371" "00000"
"00356372" "00000"
"00356373" "00000"
"00356374" "00000"
"00356375" "00000"
"00356376" "00000"
"00356377" "00000"
"00356378" "00000"
"00356379" "00000"
"00356380" "00000"
"00356381" "00000"
"00356382" "00000"
"00356383" "00000"
"00356384" "00000"
"00356385" "00000"
"00356386" "00000"
"00356387" "00000"
"00356388" "00000"
"00356389" "00000"
"00356390" "00000"
"00356391" "00000"
"00356392" "00000"
"00356393" "00000"
"00356394" "00000"
"00356395" "00000"
"00356396" "00000"
"00356397" "00000"
"00356398" "00000"
"00356399" "00000"
"00356400" "00000"
"00356401" "00000"
"00356402" "00000"
"00356403" "00000"
"00356404" "00000"
"00356405" "00000"
"00356406" "00000"
"00356407" "00000"
"00356408" "00000"
"00356409" "00000"
"00356410" "00000"
"00356411" "00000"
"00356412" "00000"
"00356413" "00000"
"00356414" "00000"
"00356415" "00000"
"00356416" "00000"
"00356417" "00000"
"00356418" "00000"
"00356419" "00000"
"00356420" "00000"
"00356421" "00000"
"00356422" "00000"
"00356423" "00000"
"00356424" "00000"
"00356425" "00000"
"00356426" "00000"
"00356427" "00000"
"00356428" "00000"
"00356429" "00000"
"00356430" "00000"
"00356431" "00000"
"00356432" "00000"
"00356433" "00000"
"00356434" "00000"
"00356435" "00000"
"00356436" "00000"
"00356437" "00000"
"00356438" "00000"
"00356439" "00000"
"00356440" "00000"
"00356441" "00000"
"00356442" "00000"
"00356443" "00000"
"00356444" "00000"
"00356445" "00000"
"00356446" "00000"
"00356447" "00000"
"00356448" "00000"
"00356449" "00000"
"00356450" "00000"
"00356451" "00000"
"00356452" "00000"
"00356453" "00000"
"00356454" "00000"
"00356455" "00000"
"00356456" "00000"
"00356457" "00000"
"00356458" "00000"
"00356459" "00000"
"00356460" "00000"
"00356461" "00000"
"00356462" "00000"
"00356463" "00000"
"00356464" "00000"
"00356465" "00000"
"00356466" "00000"
"00356467" "00000"
"00356468" "00000"
"00356469" "00000"
"00356470" "00000"
"00356471" "00000"
"00356472" "00000"
"00356473" "00000"
"00356474" "00000"
"00356475" "00000"
"00356476" "00000"
"00356477" "00000"
"00356478" "00000"
"00356479" "00000"
"00356480" "00000"
"00356481" "00000"
"00356482" "00000"
"00356483" "00000"
"00356484" "00000"
"00356485" "00000"
"00356486" "00000"
"00356487" "00000"
"00356488" "00000"
"00356489" "00000"
"00356490" "00000"
"00356491" "00000"
"00356492" "00000"
"00356493" "00000"
"00356494" "00000"
"00356495" "00000"
"00356496" "00000"
"00356497" "00000"
"00356498" "00000"
"00356499" "00000"
"00356500" "00000"
"00356501" "00000"
"00356502" "00000"
"00356503" "00000"
"00356504" "00000"
"00356505" "00000"
"00356506" "00000"
"00356507" "00000"
"00356508" "00000"
"00356509" "00000"
"00356510" "00000"
"00356511" "00000"
"00356512" "00000"
"00356513" "00000"
"00356514" "00000"
"00356515" "00000"
"00356516" "00000"
"00356517" "00000"
"00356518" "00000"
"00356519" "00000"
"00356520" "00000"
"00356521" "00000"
"00356522" "00000"
"00356523" "00000"
"00356524" "00000"
"00356525" "00000"
"00356526" "00000"
"00376139" "00681"
"00403087" "00201"
"00470698" "07210"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00091, 00167, 00198, 00201, 00259, 00318, 00681, 04187, 04300, 05093, 05562, 05646, 05647, 07210
## Count = 30
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Cysts}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Cancer/Sub_type}}" "{{Phenotype/Eye/Retina}}" "{{Phenotype/Neoplasm}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000017791" "00167" "00020028" "00787" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000017792" "00167" "00020029" "00792" "Isolated (sporadic)" "" "transformation to secondary AML, anemic phase before transformation" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000017793" "00091" "00020030" "00046" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000034682" "04300" "00001617" "00075" "Familial, autosomal recessive" "" "growth retardation, microcephaly; patient\'s cells sensitive to DNA interstrand cross linkers (submitted 2013-07-11 17:27:11)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000127756" "00259" "00155228" "00006" "Familial, autosomal recessive" "" "severe, early-onset obesity" "" "" "" "" "" "" "" "" "" "" "" "" "" "obesity" ""
"0000141908" "00198" "00179422" "02551" "Unknown" "" "HP:0003002 (Breast carcinoma)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000186368" "00318" "00246517" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 29y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000186369" "00318" "00246518" "00643" "Unknown" "" "family history; no triple-negative breast cancer; 47y first breast cancer" "" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000187201" "00318" "00248192" "01474" "Unknown" "" "49y ductal breast cancer, subtype basal" "49y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000187216" "00318" "00248207" "01474" "Unknown" "" "35y ductal breast cancer, subtype luminal A" "35y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000187245" "00318" "00248236" "01474" "Unknown" "" "57y breast cancer" "57y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000187261" "00318" "00248252" "01474" "Unknown" "" "54y ductal breast cancer, subtype luminal B" "54y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000187281" "00318" "00248272" "01474" "Unknown" "" "44y ductal breast cancer, subtype luminal B" "44y" "" "" "" "" "" "" "" "" "" "" "" "" "breast cancer" ""
"0000199405" "05093" "00260872" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199406" "05093" "00260873" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199407" "05093" "00260874" "00006" "Familial, autosomal recessive" "" "see paper; …, cancer predisposition, toxicity to chemotherapy, early menopause, possibly chromosome fragility" "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199408" "05093" "00260875" "00006" "Familial, autosomal recessive" "" "see paper; …, cancer predisposition, toxicity to chemotherapy, early menopause, possibly chromosome fragility" "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199409" "05093" "00260876" "00006" "Familial, autosomal recessive" "" "see paper; …, cancer predisposition, toxicity to chemotherapy, early menopause, possibly chromosome fragility" "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199410" "05093" "00260877" "00006" "Familial, autosomal recessive" "" "see paper; …, cancer predisposition, toxicity to chemotherapy, early menopause, possibly chromosome fragility" "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199411" "05093" "00260878" "00006" "Familial, autosomal recessive" "" "see paper; …, cancer predisposition, toxicity to chemotherapy, early menopause, possibly chromosome fragility" "" "" "" "" "" "" "" "" "" "" "" "" "" "cancer" ""
"0000199412" "04300" "00020027" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "FANCA" "Fanconi anemia" ""
"0000199414" "05562" "00260880" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "" "" "" "SPGF-28" "non-obstructive azoospermia" ""
"0000199415" "05562" "00260881" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "" "" "" "SPGF-28" "non-obstructive azoospermia" ""
"0000199416" "05562" "00260882" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "" "" "" "" "SPGF-28" "non-obstructive azoospermia" ""
"0000199417" "05562" "00260884" "00006" "Familial, autosomal recessive" "" "see paper; ..., infertility due to oligoasthenospermia or azoospermia" "" "" "" "" "" "" "" "" "" "" "" "" "SPGF-28" "infertility" ""
"0000199419" "04187" "00260885" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "POF-15" "non-syndromic primary ovarian insufficiency" ""
"0000222910" "00198" "00289279" "01164" "Unknown" "" "Papillary thyroid carcinoma (HP:0002895); Breast carcinoma (HP:0003002)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000271350" "00681" "00376139" "00585" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "pancreatic ductal adenocarcinoma" ""
"0000295834" "00201" "00403087" "00006" "Familial, autosomal recessive" "" "left/right testis volume 5-10/5-10 mL; testicular degeneration; sperm retrieval negative; no anosmia, no disorder of sex development, no abnormal secondary sex characteristics" "" "" "" "" "" "" "" "" "" "" "" "" "" "non-obstructive azoospermia" ""
"0000355592" "07210" "00470698" "00006" "Familial" "16y" "see paper; ... scoliosis, no other skeletal defects; back pain; depression; no physical activity" "" "" "" "" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" ""
## Screenings ## Do not remove or alter this header ##
## Count = 1535
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000001418" "00001617" "1" "00075" "00075" "2013-07-11 17:32:48" "" "" "SEQ;SEQ-NG-I" "DNA" "" ""
"0000020024" "00020027" "1" "00787" "00006" "2008-01-31 22:36:17" "00006" "2019-08-09 12:22:45" "RT-PCR;SEQ" "DNA;RNA" "" ""
"0000020025" "00020028" "1" "00787" "00006" "2008-01-31 22:36:17" "00006" "2011-02-07 23:10:42" "SEQ" "DNA" "" ""
"0000020026" "00020029" "1" "00792" "00006" "2011-05-18 17:59:04" "00006" "2012-04-07 15:19:34" "SEQ" "DNA" "" ""
"0000020027" "00020030" "1" "00046" "00046" "2012-11-30 17:54:02" "" "" "SEQ" "DNA" "" ""
"0000156092" "00155228" "1" "00006" "00006" "2018-03-18 13:06:48" "" "" "SEQ;SEQ-NG" "DNA" "" "wes"
"0000180325" "00179422" "1" "02551" "02551" "2018-08-21 16:24:49" "" "" "SEQ" "DNA" "" ""
"0000247629" "00246517" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel"
"0000247630" "00246518" "1" "00643" "00006" "2019-07-12 12:55:51" "" "" "SEQ" "DNA" "" "gene panel"
"0000249297" "00248192" "1" "01474" "00006" "2015-12-04 13:41:45" "" "" "SEQ-NG-S" "DNA" "blood" "581 gene panel"
"0000249312" "00248207" "1" "01474" "00006" "2015-12-04 13:41:45" "" "" "SEQ-NG-S" "DNA" "blood" "581 gene panel"
"0000249341" "00248236" "1" "01474" "00006" "2015-12-04 13:41:45" "" "" "SEQ-NG-S" "DNA" "blood" "581 gene panel"
"0000249357" "00248252" "1" "01474" "00006" "2015-12-04 13:41:45" "" "" "SEQ-NG-S" "DNA" "blood" "581 gene panel"
"0000249377" "00248272" "1" "01474" "00006" "2015-12-04 13:41:45" "" "" "SEQ-NG-S" "DNA" "blood" "581 gene panel"
"0000261977" "00260872" "1" "00006" "00006" "2019-08-09 11:44:12" "" "" "SEQ" "DNA" "" ""
"0000261978" "00260873" "1" "00006" "00006" "2019-08-09 11:47:56" "" "" "SEQ" "DNA" "" ""
"0000261979" "00260874" "1" "00006" "00006" "2019-08-09 12:03:46" "" "" "SEQ" "DNA" "" ""
"0000261980" "00260875" "1" "00006" "00006" "2019-08-09 12:03:46" "" "" "SEQ" "DNA" "" ""
"0000261981" "00260876" "1" "00006" "00006" "2019-08-09 12:03:46" "" "" "SEQ" "DNA" "" ""
"0000261982" "00260877" "1" "00006" "00006" "2019-08-09 12:03:46" "" "" "SEQ" "DNA" "" ""
"0000261983" "00260878" "1" "00006" "00006" "2019-08-09 12:03:46" "" "" "SEQ" "DNA" "" ""
"0000261984" "00260880" "1" "00006" "00006" "2019-08-09 12:46:32" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000261985" "00260881" "1" "00006" "00006" "2019-08-09 12:46:32" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000261986" "00260882" "1" "00006" "00006" "2019-08-09 12:46:32" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000261988" "00260884" "1" "00006" "00006" "2019-08-09 13:06:22" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000261990" "00260885" "1" "00006" "00006" "2019-08-09 13:15:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000290449" "00289279" "1" "01164" "01164" "2020-03-02 12:26:08" "" "" "SEQ-NG-S" "DNA" "" ""
"0000292202" "00291034" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292203" "00291035" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292204" "00291036" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292205" "00291037" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292206" "00291038" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292207" "00291039" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292208" "00291040" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292209" "00291041" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292210" "00291042" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292211" "00291043" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000292212" "00291044" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305555" "00304426" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305556" "00304427" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305557" "00304428" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000337404" "00336174" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337405" "00336175" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337406" "00336176" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337407" "00336177" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337408" "00336178" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337409" "00336179" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337410" "00336180" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337411" "00336181" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337412" "00336182" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337413" "00336183" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337414" "00336184" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337415" "00336185" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337416" "00336186" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337536" "00336306" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337537" "00336307" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337539" "00336309" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337540" "00336310" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337541" "00336311" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337542" "00336312" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000337543" "00336313" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339943" "00338713" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339944" "00338714" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339945" "00338715" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339946" "00338716" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339947" "00338717" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339948" "00338718" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339949" "00338719" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339950" "00338720" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339951" "00338721" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339952" "00338722" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339953" "00338723" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339954" "00338724" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339955" "00338725" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339956" "00338726" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339957" "00338727" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339958" "00338728" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339959" "00338729" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339960" "00338730" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339961" "00338731" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339962" "00338732" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339963" "00338733" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339964" "00338734" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339965" "00338735" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339966" "00338736" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339967" "00338737" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339968" "00338738" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339969" "00338739" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339970" "00338740" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339971" "00338741" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339972" "00338742" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339973" "00338743" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339974" "00338744" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339975" "00338745" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339976" "00338746" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339977" "00338747" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339978" "00338748" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339979" "00338749" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339980" "00338750" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339981" "00338751" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339982" "00338752" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339983" "00338753" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339984" "00338754" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339985" "00338755" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339986" "00338756" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339987" "00338757" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339988" "00338758" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339989" "00338759" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339990" "00338760" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339991" "00338761" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339992" "00338762" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339993" "00338763" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339994" "00338764" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339995" "00338765" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339996" "00338766" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339997" "00338767" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339998" "00338768" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000339999" "00338769" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340000" "00338770" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340001" "00338771" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340002" "00338772" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340003" "00338773" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340004" "00338774" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340005" "00338775" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340006" "00338776" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340007" "00338777" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340008" "00338778" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340009" "00338779" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340010" "00338780" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340011" "00338781" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340012" "00338782" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340013" "00338783" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340014" "00338784" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340015" "00338785" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340016" "00338786" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340017" "00338787" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340018" "00338788" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340019" "00338789" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340020" "00338790" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340021" "00338791" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340022" "00338792" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340023" "00338793" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340024" "00338794" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340025" "00338795" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340026" "00338796" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340027" "00338797" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340028" "00338798" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340029" "00338799" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340030" "00338800" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340031" "00338801" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340032" "00338802" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340033" "00338803" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340034" "00338804" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340035" "00338805" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340036" "00338806" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340037" "00338807" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340038" "00338808" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340039" "00338809" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340040" "00338810" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340041" "00338811" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340042" "00338812" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340043" "00338813" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340044" "00338814" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340045" "00338815" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340046" "00338816" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340047" "00338817" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340048" "00338818" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340049" "00338819" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340050" "00338820" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340051" "00338821" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340052" "00338822" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340053" "00338823" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340054" "00338824" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340055" "00338825" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340056" "00338826" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340057" "00338827" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340058" "00338828" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340059" "00338829" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340060" "00338830" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340061" "00338831" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340062" "00338832" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340063" "00338833" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340064" "00338834" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340065" "00338835" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340066" "00338836" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340067" "00338837" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340068" "00338838" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340069" "00338839" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340070" "00338840" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340071" "00338841" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340072" "00338842" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340073" "00338843" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340074" "00338844" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340075" "00338845" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340076" "00338846" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340077" "00338847" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340078" "00338848" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340079" "00338849" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340080" "00338850" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340081" "00338851" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340082" "00338852" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340083" "00338853" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340084" "00338854" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340085" "00338855" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340086" "00338856" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340087" "00338857" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340088" "00338858" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340089" "00338859" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340090" "00338860" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340091" "00338861" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340092" "00338862" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340093" "00338863" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340094" "00338864" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340095" "00338865" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340096" "00338866" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340097" "00338867" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340098" "00338868" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340099" "00338869" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340100" "00338870" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340101" "00338871" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340102" "00338872" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340103" "00338873" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340104" "00338874" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340105" "00338875" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340106" "00338876" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340107" "00338877" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340108" "00338878" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340109" "00338879" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340110" "00338880" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340111" "00338881" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340112" "00338882" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340113" "00338883" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340114" "00338884" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340115" "00338885" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340116" "00338886" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340117" "00338887" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340118" "00338888" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340119" "00338889" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340120" "00338890" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340121" "00338891" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340122" "00338892" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340123" "00338893" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340124" "00338894" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340125" "00338895" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340126" "00338896" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340127" "00338897" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340128" "00338898" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340129" "00338899" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340130" "00338900" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340131" "00338901" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340132" "00338902" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340133" "00338903" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340134" "00338904" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340135" "00338905" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340136" "00338906" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340137" "00338907" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340138" "00338908" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340139" "00338909" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340140" "00338910" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340141" "00338911" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340142" "00338912" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340143" "00338913" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340144" "00338914" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340145" "00338915" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340146" "00338916" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340147" "00338917" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340148" "00338918" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340149" "00338919" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340150" "00338920" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340151" "00338921" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340152" "00338922" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340153" "00338923" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340154" "00338924" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340155" "00338925" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340156" "00338926" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340157" "00338927" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340158" "00338928" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340159" "00338929" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340160" "00338930" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340161" "00338931" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340162" "00338932" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340163" "00338933" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340164" "00338934" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340165" "00338935" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340166" "00338936" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340167" "00338937" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340168" "00338938" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340169" "00338939" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340170" "00338940" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340171" "00338941" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340172" "00338942" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340173" "00338943" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340174" "00338944" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340175" "00338945" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340176" "00338946" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340177" "00338947" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340178" "00338948" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340179" "00338949" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340180" "00338950" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340181" "00338951" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340182" "00338952" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340183" "00338953" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340184" "00338954" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340185" "00338955" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340186" "00338956" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340187" "00338957" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340188" "00338958" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340189" "00338959" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340190" "00338960" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340191" "00338961" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340192" "00338962" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340193" "00338963" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340194" "00338964" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340195" "00338965" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340196" "00338966" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340197" "00338967" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340198" "00338968" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340199" "00338969" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340200" "00338970" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340201" "00338971" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340202" "00338972" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340203" "00338973" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340204" "00338974" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340205" "00338975" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340206" "00338976" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340207" "00338977" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340208" "00338978" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340209" "00338979" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340210" "00338980" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340211" "00338981" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340212" "00338982" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340213" "00338983" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340214" "00338984" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340215" "00338985" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340216" "00338986" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340217" "00338987" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340218" "00338988" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340219" "00338989" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340220" "00338990" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340221" "00338991" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340222" "00338992" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340223" "00338993" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340224" "00338994" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340225" "00338995" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340226" "00338996" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340227" "00338997" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340228" "00338998" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340229" "00338999" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340230" "00339000" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340231" "00339001" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340232" "00339002" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340233" "00339003" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340234" "00339004" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340235" "00339005" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340236" "00339006" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340237" "00339007" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340238" "00339008" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340239" "00339009" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340240" "00339010" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340241" "00339011" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340242" "00339012" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340243" "00339013" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340244" "00339014" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340245" "00339015" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340246" "00339016" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340247" "00339017" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340248" "00339018" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340249" "00339019" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340250" "00339020" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340251" "00339021" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340252" "00339022" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340253" "00339023" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340254" "00339024" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340255" "00339025" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340256" "00339026" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340257" "00339027" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340258" "00339028" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340259" "00339029" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340260" "00339030" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340261" "00339031" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340262" "00339032" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340263" "00339033" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340264" "00339034" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340265" "00339035" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340266" "00339036" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340267" "00339037" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340268" "00339038" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340269" "00339039" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340270" "00339040" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340271" "00339041" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340272" "00339042" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340273" "00339043" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340274" "00339044" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340275" "00339045" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340276" "00339046" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340277" "00339047" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340278" "00339048" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340279" "00339049" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340280" "00339050" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340281" "00339051" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340282" "00339052" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340283" "00339053" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340284" "00339054" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340285" "00339055" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340286" "00339056" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340287" "00339057" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340288" "00339058" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340289" "00339059" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340290" "00339060" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340291" "00339061" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340292" "00339062" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340293" "00339063" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340294" "00339064" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340295" "00339065" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340296" "00339066" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340297" "00339067" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340298" "00339068" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340299" "00339069" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340300" "00339070" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340301" "00339071" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340302" "00339072" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340303" "00339073" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340304" "00339074" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340305" "00339075" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340306" "00339076" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340307" "00339077" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340308" "00339078" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340309" "00339079" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340310" "00339080" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340311" "00339081" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340312" "00339082" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340313" "00339083" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340314" "00339084" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340315" "00339085" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340316" "00339086" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340317" "00339087" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340318" "00339088" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340319" "00339089" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340320" "00339090" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340321" "00339091" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340322" "00339092" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340323" "00339093" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340324" "00339094" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340325" "00339095" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340326" "00339096" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340327" "00339097" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340328" "00339098" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340329" "00339099" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340330" "00339100" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340331" "00339101" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340332" "00339102" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340333" "00339103" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340334" "00339104" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340335" "00339105" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340336" "00339106" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340337" "00339107" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340338" "00339108" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340339" "00339109" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340340" "00339110" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340341" "00339111" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340342" "00339112" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340343" "00339113" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340344" "00339114" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340345" "00339115" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340346" "00339116" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340347" "00339117" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340348" "00339118" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340349" "00339119" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340350" "00339120" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340351" "00339121" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340352" "00339122" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340353" "00339123" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000340354" "00339124" "1" "04020" "00006" "2021-03-11 11:28:20" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343492" "00342262" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343493" "00342263" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343494" "00342264" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343495" "00342265" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343496" "00342266" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343497" "00342267" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343498" "00342268" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343499" "00342269" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343500" "00342270" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343501" "00342271" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343502" "00342272" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343503" "00342273" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343504" "00342274" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343505" "00342275" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343506" "00342276" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343507" "00342277" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343508" "00342278" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343509" "00342279" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343510" "00342280" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343511" "00342281" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343512" "00342282" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343759" "00342529" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343760" "00342530" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343761" "00342531" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343763" "00342533" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343764" "00342534" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343765" "00342535" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343766" "00342536" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343767" "00342537" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343768" "00342538" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343769" "00342539" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343770" "00342540" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343771" "00342541" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343772" "00342542" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343773" "00342543" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000343774" "00342544" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346870" "00345640" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346872" "00345642" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346873" "00345643" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346874" "00345644" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346875" "00345645" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346876" "00345646" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346877" "00345647" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346878" "00345648" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346879" "00345649" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346880" "00345650" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346881" "00345651" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346882" "00345652" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346883" "00345653" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346884" "00345654" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346885" "00345655" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346886" "00345656" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346887" "00345657" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346888" "00345658" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346889" "00345659" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346890" "00345660" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346891" "00345661" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346892" "00345662" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346893" "00345663" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346894" "00345664" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346895" "00345665" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346896" "00345666" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346897" "00345667" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346898" "00345668" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346899" "00345669" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346900" "00345670" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346901" "00345671" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346902" "00345672" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346903" "00345673" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346904" "00345674" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346905" "00345675" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346906" "00345676" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346907" "00345677" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346908" "00345678" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346909" "00345679" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346910" "00345680" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346911" "00345681" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346912" "00345682" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346913" "00345683" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346914" "00345684" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346915" "00345685" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346916" "00345686" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346917" "00345687" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346918" "00345688" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346919" "00345689" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346920" "00345690" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346921" "00345691" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346922" "00345692" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346923" "00345693" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346924" "00345694" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346925" "00345695" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346926" "00345696" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346927" "00345697" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346928" "00345698" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346929" "00345699" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346930" "00345700" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346931" "00345701" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346932" "00345702" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346933" "00345703" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346934" "00345704" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346935" "00345705" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346936" "00345706" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346937" "00345707" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346938" "00345708" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346939" "00345709" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346940" "00345710" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346941" "00345711" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346942" "00345712" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346943" "00345713" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346944" "00345714" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346945" "00345715" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346946" "00345716" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346947" "00345717" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346948" "00345718" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346949" "00345719" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346950" "00345720" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346951" "00345721" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346952" "00345722" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346953" "00345723" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346954" "00345724" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346955" "00345725" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346956" "00345726" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346957" "00345727" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346958" "00345728" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346959" "00345729" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346960" "00345730" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346961" "00345731" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346962" "00345732" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346963" "00345733" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346964" "00345734" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346965" "00345735" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346966" "00345736" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346967" "00345737" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346968" "00345738" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346969" "00345739" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346970" "00345740" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346971" "00345741" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346972" "00345742" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346973" "00345743" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346974" "00345744" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346975" "00345745" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346976" "00345746" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346977" "00345747" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346978" "00345748" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346979" "00345749" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346980" "00345750" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346981" "00345751" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346982" "00345752" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346983" "00345753" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346984" "00345754" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346985" "00345755" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346986" "00345756" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346987" "00345757" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346988" "00345758" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346989" "00345759" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346990" "00345760" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346991" "00345761" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346992" "00345762" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346993" "00345763" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346994" "00345764" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346995" "00345765" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346996" "00345766" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346997" "00345767" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346998" "00345768" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000346999" "00345769" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347000" "00345770" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347001" "00345771" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347002" "00345772" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347003" "00345773" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347004" "00345774" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347005" "00345775" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347006" "00345776" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347007" "00345777" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347008" "00345778" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347009" "00345779" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347010" "00345780" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347011" "00345781" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347012" "00345782" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347013" "00345783" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347014" "00345784" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347015" "00345785" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347016" "00345786" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347017" "00345787" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347018" "00345788" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347019" "00345789" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347020" "00345790" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347021" "00345791" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347022" "00345792" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347023" "00345793" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347024" "00345794" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347025" "00345795" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347026" "00345796" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347027" "00345797" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347028" "00345798" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347029" "00345799" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347030" "00345800" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347031" "00345801" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347032" "00345802" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347033" "00345803" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347034" "00345804" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347035" "00345805" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347036" "00345806" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347037" "00345807" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347038" "00345808" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347039" "00345809" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347040" "00345810" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347041" "00345811" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347042" "00345812" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347043" "00345813" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347044" "00345814" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347045" "00345815" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347046" "00345816" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347047" "00345817" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347048" "00345818" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347049" "00345819" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347050" "00345820" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347051" "00345821" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347052" "00345822" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347053" "00345823" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347054" "00345824" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347055" "00345825" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347056" "00345826" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347057" "00345827" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347058" "00345828" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347059" "00345829" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347060" "00345830" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347061" "00345831" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347062" "00345832" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347063" "00345833" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347064" "00345834" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347065" "00345835" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347066" "00345836" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347067" "00345837" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347068" "00345838" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347069" "00345839" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347070" "00345840" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347071" "00345841" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347072" "00345842" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347073" "00345843" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347074" "00345844" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347075" "00345845" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347076" "00345846" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347077" "00345847" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347078" "00345848" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347079" "00345849" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347080" "00345850" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347081" "00345851" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347082" "00345852" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347083" "00345853" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347084" "00345854" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347085" "00345855" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347086" "00345856" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347087" "00345857" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347088" "00345858" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347089" "00345859" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347090" "00345860" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347091" "00345861" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347092" "00345862" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347093" "00345863" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347094" "00345864" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347095" "00345865" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347096" "00345866" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347097" "00345867" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347098" "00345868" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347099" "00345869" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347100" "00345870" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347101" "00345871" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347102" "00345872" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347103" "00345873" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347104" "00345874" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347105" "00345875" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347106" "00345876" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347107" "00345877" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347108" "00345878" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347109" "00345879" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347110" "00345880" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347111" "00345881" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347112" "00345882" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347113" "00345883" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347114" "00345884" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347115" "00345885" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347116" "00345886" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347117" "00345887" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347118" "00345888" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347119" "00345889" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347120" "00345890" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347121" "00345891" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347122" "00345892" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347123" "00345893" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347124" "00345894" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347125" "00345895" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347126" "00345896" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347127" "00345897" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347128" "00345898" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347129" "00345899" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347130" "00345900" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347131" "00345901" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347132" "00345902" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347133" "00345903" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347134" "00345904" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347135" "00345905" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347136" "00345906" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347137" "00345907" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347138" "00345908" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347139" "00345909" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347140" "00345910" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347141" "00345911" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347142" "00345912" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347143" "00345913" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347144" "00345914" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347145" "00345915" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347146" "00345916" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347147" "00345917" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347148" "00345918" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347149" "00345919" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347150" "00345920" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347151" "00345921" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347152" "00345922" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347153" "00345923" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347154" "00345924" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347155" "00345925" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347156" "00345926" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347157" "00345927" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347158" "00345928" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347159" "00345929" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347160" "00345930" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347161" "00345931" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347162" "00345932" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347163" "00345933" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347164" "00345934" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347165" "00345935" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347166" "00345936" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347167" "00345937" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347168" "00345938" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347169" "00345939" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347170" "00345940" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347171" "00345941" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347172" "00345942" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347173" "00345943" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347174" "00345944" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347175" "00345945" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347176" "00345946" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347177" "00345947" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347178" "00345948" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347179" "00345949" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347180" "00345950" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347181" "00345951" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347182" "00345952" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347183" "00345953" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347184" "00345954" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347185" "00345955" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347186" "00345956" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347187" "00345957" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347188" "00345958" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347189" "00345959" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347190" "00345960" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347191" "00345961" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347192" "00345962" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347193" "00345963" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347194" "00345964" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347195" "00345965" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347196" "00345966" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347197" "00345967" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347198" "00345968" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347199" "00345969" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347200" "00345970" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347201" "00345971" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347202" "00345972" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347203" "00345973" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347204" "00345974" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347205" "00345975" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347206" "00345976" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347207" "00345977" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347208" "00345978" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347209" "00345979" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347210" "00345980" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347211" "00345981" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347212" "00345982" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347213" "00345983" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347214" "00345984" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347215" "00345985" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347216" "00345986" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347217" "00345987" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347218" "00345988" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347219" "00345989" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347220" "00345990" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347221" "00345991" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347222" "00345992" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347223" "00345993" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347224" "00345994" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347225" "00345995" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347226" "00345996" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347227" "00345997" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347228" "00345998" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347229" "00345999" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347230" "00346000" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347231" "00346001" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347232" "00346002" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347233" "00346003" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347234" "00346004" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347235" "00346005" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347236" "00346006" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347237" "00346007" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347238" "00346008" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347239" "00346009" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347240" "00346010" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347241" "00346011" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347242" "00346012" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347243" "00346013" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347244" "00346014" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347245" "00346015" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347246" "00346016" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347247" "00346017" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347248" "00346018" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347249" "00346019" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347250" "00346020" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347251" "00346021" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347252" "00346022" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347253" "00346023" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347254" "00346024" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347255" "00346025" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347256" "00346026" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347257" "00346027" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347258" "00346028" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347259" "00346029" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347260" "00346030" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347261" "00346031" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347262" "00346032" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347263" "00346033" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347264" "00346034" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347265" "00346035" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347266" "00346036" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347267" "00346037" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347268" "00346038" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347269" "00346039" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347270" "00346040" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347271" "00346041" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347272" "00346042" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347273" "00346043" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347274" "00346044" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347275" "00346045" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347276" "00346046" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347277" "00346047" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347278" "00346048" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347279" "00346049" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347280" "00346050" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347281" "00346051" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347282" "00346052" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347283" "00346053" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347284" "00346054" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347285" "00346055" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347286" "00346056" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347287" "00346057" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347288" "00346058" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347289" "00346059" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347290" "00346060" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347291" "00346061" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347292" "00346062" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347293" "00346063" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347294" "00346064" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347295" "00346065" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347296" "00346066" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000347297" "00346067" "1" "04020" "00006" "2021-03-11 11:58:58" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350535" "00349305" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350536" "00349306" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350537" "00349307" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350538" "00349308" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350539" "00349309" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350540" "00349310" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350541" "00349311" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350542" "00349312" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000350626" "00349396" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352692" "00351462" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352693" "00351463" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352694" "00351464" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352695" "00351465" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352696" "00351466" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352697" "00351467" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352698" "00351468" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352699" "00351469" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352700" "00351470" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352701" "00351471" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352702" "00351472" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352703" "00351473" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352704" "00351474" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352705" "00351475" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352706" "00351476" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352707" "00351477" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352708" "00351478" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352709" "00351479" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352710" "00351480" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352711" "00351481" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352712" "00351482" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352713" "00351483" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352714" "00351484" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352715" "00351485" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352716" "00351486" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352717" "00351487" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352718" "00351488" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352719" "00351489" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352720" "00351490" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352721" "00351491" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352722" "00351492" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352723" "00351493" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352724" "00351494" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352725" "00351495" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352726" "00351496" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352727" "00351497" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352728" "00351498" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352729" "00351499" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352730" "00351500" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352731" "00351501" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352732" "00351502" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352733" "00351503" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352734" "00351504" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352735" "00351505" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352736" "00351506" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352737" "00351507" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352738" "00351508" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352739" "00351509" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352740" "00351510" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352741" "00351511" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352742" "00351512" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352743" "00351513" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352744" "00351514" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352745" "00351515" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352746" "00351516" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352747" "00351517" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352748" "00351518" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352749" "00351519" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352750" "00351520" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352751" "00351521" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352752" "00351522" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352753" "00351523" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352754" "00351524" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352755" "00351525" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352756" "00351526" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352757" "00351527" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352758" "00351528" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352759" "00351529" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352760" "00351530" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352761" "00351531" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352762" "00351532" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352763" "00351533" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352764" "00351534" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352765" "00351535" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352766" "00351536" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352767" "00351537" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352768" "00351538" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352769" "00351539" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352770" "00351540" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352771" "00351541" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352772" "00351542" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352773" "00351543" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352774" "00351544" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352775" "00351545" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352776" "00351546" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352777" "00351547" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352778" "00351548" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352779" "00351549" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352780" "00351550" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352781" "00351551" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352782" "00351552" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352783" "00351553" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352784" "00351554" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352785" "00351555" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352786" "00351556" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352787" "00351557" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352788" "00351558" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352789" "00351559" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352790" "00351560" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352791" "00351561" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352792" "00351562" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352793" "00351563" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352794" "00351564" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352795" "00351565" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352796" "00351566" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352797" "00351567" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352798" "00351568" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352799" "00351569" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352800" "00351570" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352801" "00351571" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352802" "00351572" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352803" "00351573" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352804" "00351574" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352805" "00351575" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352806" "00351576" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352807" "00351577" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352808" "00351578" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352809" "00351579" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352810" "00351580" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352811" "00351581" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352812" "00351582" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352813" "00351583" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352814" "00351584" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352815" "00351585" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352816" "00351586" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352817" "00351587" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352818" "00351588" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352819" "00351589" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352820" "00351590" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352821" "00351591" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352822" "00351592" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352823" "00351593" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352824" "00351594" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352825" "00351595" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352826" "00351596" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352827" "00351597" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352828" "00351598" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352829" "00351599" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352830" "00351600" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352831" "00351601" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352832" "00351602" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352833" "00351603" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352834" "00351604" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352835" "00351605" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352836" "00351606" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352837" "00351607" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352838" "00351608" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352839" "00351609" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352840" "00351610" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352841" "00351611" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352842" "00351612" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352843" "00351613" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352844" "00351614" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352845" "00351615" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352846" "00351616" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352847" "00351617" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352848" "00351618" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352849" "00351619" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352850" "00351620" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352851" "00351621" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352852" "00351622" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352853" "00351623" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352854" "00351624" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352855" "00351625" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352856" "00351626" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352857" "00351627" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352858" "00351628" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352859" "00351629" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352860" "00351630" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352861" "00351631" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352862" "00351632" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352863" "00351633" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352864" "00351634" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352865" "00351635" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352866" "00351636" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352867" "00351637" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352868" "00351638" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352869" "00351639" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352870" "00351640" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352871" "00351641" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352872" "00351642" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352873" "00351643" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352874" "00351644" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352875" "00351645" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352876" "00351646" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352877" "00351647" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352878" "00351648" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352879" "00351649" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352880" "00351650" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352881" "00351651" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352882" "00351652" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352883" "00351653" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352884" "00351654" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352885" "00351655" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352886" "00351656" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352887" "00351657" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352888" "00351658" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352889" "00351659" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352890" "00351660" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352891" "00351661" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352892" "00351662" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352893" "00351663" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352894" "00351664" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352895" "00351665" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352896" "00351666" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352897" "00351667" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352898" "00351668" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352899" "00351669" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352900" "00351670" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352901" "00351671" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352902" "00351672" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352903" "00351673" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352904" "00351674" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352905" "00351675" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352906" "00351676" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352907" "00351677" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352908" "00351678" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352909" "00351679" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352910" "00351680" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352911" "00351681" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352912" "00351682" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352913" "00351683" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352914" "00351684" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352915" "00351685" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352916" "00351686" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352917" "00351687" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352918" "00351688" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352919" "00351689" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352920" "00351690" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352921" "00351691" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352922" "00351692" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352923" "00351693" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352924" "00351694" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352925" "00351695" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352926" "00351696" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352927" "00351697" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352928" "00351698" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352929" "00351699" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352930" "00351700" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352931" "00351701" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352932" "00351702" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352933" "00351703" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352934" "00351704" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352935" "00351705" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352936" "00351706" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352937" "00351707" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352938" "00351708" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352939" "00351709" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352940" "00351710" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352941" "00351711" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352942" "00351712" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352943" "00351713" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352944" "00351714" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352945" "00351715" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352946" "00351716" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352947" "00351717" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352948" "00351718" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352949" "00351719" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352950" "00351720" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352951" "00351721" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352952" "00351722" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352953" "00351723" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352954" "00351724" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352955" "00351725" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352956" "00351726" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352957" "00351727" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352958" "00351728" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352959" "00351729" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352960" "00351730" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352961" "00351731" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352962" "00351732" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352963" "00351733" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352964" "00351734" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352965" "00351735" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352966" "00351736" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352967" "00351737" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352968" "00351738" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352969" "00351739" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352970" "00351740" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352971" "00351741" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352972" "00351742" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352973" "00351743" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352974" "00351744" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352975" "00351745" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352976" "00351746" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352977" "00351747" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352978" "00351748" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352979" "00351749" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000352980" "00351750" "1" "04020" "00006" "2021-03-11 12:50:37" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355311" "00354081" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355312" "00354082" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355313" "00354083" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355314" "00354084" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355315" "00354085" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355316" "00354086" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355317" "00354087" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355318" "00354088" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000355402" "00354172" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357468" "00356238" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357469" "00356239" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357470" "00356240" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357471" "00356241" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357472" "00356242" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357473" "00356243" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357474" "00356244" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357475" "00356245" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357476" "00356246" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357477" "00356247" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357478" "00356248" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357479" "00356249" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357480" "00356250" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357481" "00356251" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357482" "00356252" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357483" "00356253" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357484" "00356254" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357485" "00356255" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357486" "00356256" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357487" "00356257" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357488" "00356258" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357489" "00356259" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357490" "00356260" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357491" "00356261" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357492" "00356262" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357493" "00356263" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357494" "00356264" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357495" "00356265" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357496" "00356266" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357497" "00356267" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357498" "00356268" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357499" "00356269" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357500" "00356270" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357501" "00356271" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357502" "00356272" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357503" "00356273" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357504" "00356274" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357505" "00356275" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357506" "00356276" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357507" "00356277" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357508" "00356278" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357509" "00356279" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357510" "00356280" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357511" "00356281" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357512" "00356282" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357513" "00356283" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357514" "00356284" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357515" "00356285" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357516" "00356286" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357517" "00356287" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357518" "00356288" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357519" "00356289" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357520" "00356290" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357521" "00356291" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357522" "00356292" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357523" "00356293" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357524" "00356294" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357525" "00356295" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357526" "00356296" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357527" "00356297" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357528" "00356298" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357529" "00356299" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357530" "00356300" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357531" "00356301" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357532" "00356302" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357533" "00356303" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357534" "00356304" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357535" "00356305" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357536" "00356306" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357537" "00356307" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357538" "00356308" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357539" "00356309" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357540" "00356310" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357541" "00356311" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357542" "00356312" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357543" "00356313" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357544" "00356314" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357545" "00356315" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357546" "00356316" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357547" "00356317" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357548" "00356318" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357549" "00356319" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357550" "00356320" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357551" "00356321" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357552" "00356322" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357553" "00356323" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357554" "00356324" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357555" "00356325" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357556" "00356326" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357557" "00356327" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357558" "00356328" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357559" "00356329" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357560" "00356330" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357561" "00356331" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357562" "00356332" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357563" "00356333" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357564" "00356334" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357565" "00356335" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357566" "00356336" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357567" "00356337" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357568" "00356338" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357569" "00356339" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357570" "00356340" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357571" "00356341" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357572" "00356342" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357573" "00356343" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357574" "00356344" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357575" "00356345" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357576" "00356346" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357577" "00356347" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357578" "00356348" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357579" "00356349" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357580" "00356350" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357581" "00356351" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357582" "00356352" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357583" "00356353" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357584" "00356354" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357585" "00356355" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357586" "00356356" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357587" "00356357" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357588" "00356358" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357589" "00356359" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357590" "00356360" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357591" "00356361" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357592" "00356362" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357593" "00356363" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357594" "00356364" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357595" "00356365" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357596" "00356366" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357597" "00356367" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357598" "00356368" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357599" "00356369" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357600" "00356370" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357601" "00356371" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357602" "00356372" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357603" "00356373" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357604" "00356374" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357605" "00356375" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357606" "00356376" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357607" "00356377" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357608" "00356378" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357609" "00356379" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357610" "00356380" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357611" "00356381" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357612" "00356382" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357613" "00356383" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357614" "00356384" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357615" "00356385" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357616" "00356386" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357617" "00356387" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357618" "00356388" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357619" "00356389" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357620" "00356390" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357621" "00356391" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357622" "00356392" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357623" "00356393" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357624" "00356394" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357625" "00356395" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357626" "00356396" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357627" "00356397" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357628" "00356398" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357629" "00356399" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357630" "00356400" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357631" "00356401" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357632" "00356402" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357633" "00356403" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357634" "00356404" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357635" "00356405" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357636" "00356406" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357637" "00356407" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357638" "00356408" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357639" "00356409" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357640" "00356410" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357641" "00356411" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357642" "00356412" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357643" "00356413" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357644" "00356414" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357645" "00356415" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357646" "00356416" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357647" "00356417" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357648" "00356418" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357649" "00356419" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357650" "00356420" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357651" "00356421" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357652" "00356422" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357653" "00356423" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357654" "00356424" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357655" "00356425" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357656" "00356426" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357657" "00356427" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357658" "00356428" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357659" "00356429" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357660" "00356430" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357661" "00356431" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357662" "00356432" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357663" "00356433" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357664" "00356434" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357665" "00356435" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357666" "00356436" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357667" "00356437" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357668" "00356438" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357669" "00356439" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357670" "00356440" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357671" "00356441" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357672" "00356442" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357673" "00356443" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357674" "00356444" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357675" "00356445" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357676" "00356446" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357677" "00356447" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357678" "00356448" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357679" "00356449" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357680" "00356450" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357681" "00356451" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357682" "00356452" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357683" "00356453" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357684" "00356454" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357685" "00356455" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357686" "00356456" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357687" "00356457" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357688" "00356458" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357689" "00356459" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357690" "00356460" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357691" "00356461" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357692" "00356462" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357693" "00356463" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357694" "00356464" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357695" "00356465" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357696" "00356466" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357697" "00356467" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357698" "00356468" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357699" "00356469" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357700" "00356470" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357701" "00356471" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357702" "00356472" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357703" "00356473" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357704" "00356474" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357705" "00356475" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357706" "00356476" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357707" "00356477" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357708" "00356478" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357709" "00356479" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357710" "00356480" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357711" "00356481" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357712" "00356482" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357713" "00356483" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357714" "00356484" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357715" "00356485" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357716" "00356486" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357717" "00356487" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357718" "00356488" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357719" "00356489" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357720" "00356490" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357721" "00356491" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357722" "00356492" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357723" "00356493" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357724" "00356494" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357725" "00356495" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357726" "00356496" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357727" "00356497" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357728" "00356498" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357729" "00356499" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357730" "00356500" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357731" "00356501" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357732" "00356502" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357733" "00356503" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357734" "00356504" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357735" "00356505" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357736" "00356506" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357737" "00356507" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357738" "00356508" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357739" "00356509" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357740" "00356510" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357741" "00356511" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357742" "00356512" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357743" "00356513" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357744" "00356514" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357745" "00356515" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357746" "00356516" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357747" "00356517" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357748" "00356518" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357749" "00356519" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357750" "00356520" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357751" "00356521" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357752" "00356522" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357753" "00356523" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357754" "00356524" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357755" "00356525" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000357756" "00356526" "1" "04020" "00006" "2021-03-11 13:17:33" "" "" "SEQ-NG" "DNA" "" "34-gene panel"
"0000377335" "00376139" "1" "00585" "00585" "2021-06-17 14:26:27" "" "" "SEQ-NG" "DNA" "blood" ""
"0000404328" "00403087" "1" "00006" "00006" "2022-02-16 19:52:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
"0000472365" "00470698" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 1512
"{{screeningid}}" "{{geneid}}"
"0000001418" "FANCM"
"0000020024" "FANCA"
"0000020024" "FANCM"
"0000020025" "FANCM"
"0000020026" "FANCM"
"0000020027" "FANCM"
"0000247629" "FANCM"
"0000247630" "FANCM"
"0000261977" "FANCM"
"0000261978" "FANCM"
"0000261979" "FANCM"
"0000261980" "FANCM"
"0000261981" "FANCM"
"0000261982" "FANCM"
"0000261983" "FANCM"
"0000261984" "FANCM"
"0000261985" "FANCM"
"0000261986" "FANCM"
"0000261988" "FANCM"
"0000261990" "FANCM"
"0000337404" "FANCM"
"0000337405" "FANCM"
"0000337406" "FANCM"
"0000337407" "FANCM"
"0000337408" "FANCM"
"0000337409" "FANCM"
"0000337410" "FANCM"
"0000337411" "FANCM"
"0000337412" "FANCM"
"0000337413" "FANCM"
"0000337414" "FANCM"
"0000337415" "FANCM"
"0000337416" "FANCM"
"0000337536" "FANCM"
"0000337537" "FANCM"
"0000337539" "FANCM"
"0000337540" "FANCM"
"0000337541" "FANCM"
"0000337542" "FANCM"
"0000337543" "FANCM"
"0000339943" "FANCM"
"0000339944" "FANCM"
"0000339945" "FANCM"
"0000339946" "FANCM"
"0000339947" "FANCM"
"0000339948" "FANCM"
"0000339949" "FANCM"
"0000339950" "FANCM"
"0000339951" "FANCM"
"0000339952" "FANCM"
"0000339953" "FANCM"
"0000339954" "FANCM"
"0000339955" "FANCM"
"0000339956" "FANCM"
"0000339957" "FANCM"
"0000339958" "FANCM"
"0000339959" "FANCM"
"0000339960" "FANCM"
"0000339961" "FANCM"
"0000339962" "FANCM"
"0000339963" "FANCM"
"0000339964" "FANCM"
"0000339965" "FANCM"
"0000339966" "FANCM"
"0000339967" "FANCM"
"0000339968" "FANCM"
"0000339969" "FANCM"
"0000339970" "FANCM"
"0000339971" "FANCM"
"0000339972" "FANCM"
"0000339973" "FANCM"
"0000339974" "FANCM"
"0000339975" "FANCM"
"0000339976" "FANCM"
"0000339977" "FANCM"
"0000339978" "FANCM"
"0000339979" "FANCM"
"0000339980" "FANCM"
"0000339981" "FANCM"
"0000339982" "FANCM"
"0000339983" "FANCM"
"0000339984" "FANCM"
"0000339985" "FANCM"
"0000339986" "FANCM"
"0000339987" "FANCM"
"0000339988" "FANCM"
"0000339989" "FANCM"
"0000339990" "FANCM"
"0000339991" "FANCM"
"0000339992" "FANCM"
"0000339993" "FANCM"
"0000339994" "FANCM"
"0000339995" "FANCM"
"0000339996" "FANCM"
"0000339997" "FANCM"
"0000339998" "FANCM"
"0000339999" "FANCM"
"0000340000" "FANCM"
"0000340001" "FANCM"
"0000340002" "FANCM"
"0000340003" "FANCM"
"0000340004" "FANCM"
"0000340005" "FANCM"
"0000340006" "FANCM"
"0000340007" "FANCM"
"0000340008" "FANCM"
"0000340009" "FANCM"
"0000340010" "FANCM"
"0000340011" "FANCM"
"0000340012" "FANCM"
"0000340013" "FANCM"
"0000340014" "FANCM"
"0000340015" "FANCM"
"0000340016" "FANCM"
"0000340017" "FANCM"
"0000340018" "FANCM"
"0000340019" "FANCM"
"0000340020" "FANCM"
"0000340021" "FANCM"
"0000340022" "FANCM"
"0000340023" "FANCM"
"0000340024" "FANCM"
"0000340025" "FANCM"
"0000340026" "FANCM"
"0000340027" "FANCM"
"0000340028" "FANCM"
"0000340029" "FANCM"
"0000340030" "FANCM"
"0000340031" "FANCM"
"0000340032" "FANCM"
"0000340033" "FANCM"
"0000340034" "FANCM"
"0000340035" "FANCM"
"0000340036" "FANCM"
"0000340037" "FANCM"
"0000340038" "FANCM"
"0000340039" "FANCM"
"0000340040" "FANCM"
"0000340041" "FANCM"
"0000340042" "FANCM"
"0000340043" "FANCM"
"0000340044" "FANCM"
"0000340045" "FANCM"
"0000340046" "FANCM"
"0000340047" "FANCM"
"0000340048" "FANCM"
"0000340049" "FANCM"
"0000340050" "FANCM"
"0000340051" "FANCM"
"0000340052" "FANCM"
"0000340053" "FANCM"
"0000340054" "FANCM"
"0000340055" "FANCM"
"0000340056" "FANCM"
"0000340057" "FANCM"
"0000340058" "FANCM"
"0000340059" "FANCM"
"0000340060" "FANCM"
"0000340061" "FANCM"
"0000340062" "FANCM"
"0000340063" "FANCM"
"0000340064" "FANCM"
"0000340065" "FANCM"
"0000340066" "FANCM"
"0000340067" "FANCM"
"0000340068" "FANCM"
"0000340069" "FANCM"
"0000340070" "FANCM"
"0000340071" "FANCM"
"0000340072" "FANCM"
"0000340073" "FANCM"
"0000340074" "FANCM"
"0000340075" "FANCM"
"0000340076" "FANCM"
"0000340077" "FANCM"
"0000340078" "FANCM"
"0000340079" "FANCM"
"0000340080" "FANCM"
"0000340081" "FANCM"
"0000340082" "FANCM"
"0000340083" "FANCM"
"0000340084" "FANCM"
"0000340085" "FANCM"
"0000340086" "FANCM"
"0000340087" "FANCM"
"0000340088" "FANCM"
"0000340089" "FANCM"
"0000340090" "FANCM"
"0000340091" "FANCM"
"0000340092" "FANCM"
"0000340093" "FANCM"
"0000340094" "FANCM"
"0000340095" "FANCM"
"0000340096" "FANCM"
"0000340097" "FANCM"
"0000340098" "FANCM"
"0000340099" "FANCM"
"0000340100" "FANCM"
"0000340101" "FANCM"
"0000340102" "FANCM"
"0000340103" "FANCM"
"0000340104" "FANCM"
"0000340105" "FANCM"
"0000340106" "FANCM"
"0000340107" "FANCM"
"0000340108" "FANCM"
"0000340109" "FANCM"
"0000340110" "FANCM"
"0000340111" "FANCM"
"0000340112" "FANCM"
"0000340113" "FANCM"
"0000340114" "FANCM"
"0000340115" "FANCM"
"0000340116" "FANCM"
"0000340117" "FANCM"
"0000340118" "FANCM"
"0000340119" "FANCM"
"0000340120" "FANCM"
"0000340121" "FANCM"
"0000340122" "FANCM"
"0000340123" "FANCM"
"0000340124" "FANCM"
"0000340125" "FANCM"
"0000340126" "FANCM"
"0000340127" "FANCM"
"0000340128" "FANCM"
"0000340129" "FANCM"
"0000340130" "FANCM"
"0000340131" "FANCM"
"0000340132" "FANCM"
"0000340133" "FANCM"
"0000340134" "FANCM"
"0000340135" "FANCM"
"0000340136" "FANCM"
"0000340137" "FANCM"
"0000340138" "FANCM"
"0000340139" "FANCM"
"0000340140" "FANCM"
"0000340141" "FANCM"
"0000340142" "FANCM"
"0000340143" "FANCM"
"0000340144" "FANCM"
"0000340145" "FANCM"
"0000340146" "FANCM"
"0000340147" "FANCM"
"0000340148" "FANCM"
"0000340149" "FANCM"
"0000340150" "FANCM"
"0000340151" "FANCM"
"0000340152" "FANCM"
"0000340153" "FANCM"
"0000340154" "FANCM"
"0000340155" "FANCM"
"0000340156" "FANCM"
"0000340157" "FANCM"
"0000340158" "FANCM"
"0000340159" "FANCM"
"0000340160" "FANCM"
"0000340161" "FANCM"
"0000340162" "FANCM"
"0000340163" "FANCM"
"0000340164" "FANCM"
"0000340165" "FANCM"
"0000340166" "FANCM"
"0000340167" "FANCM"
"0000340168" "FANCM"
"0000340169" "FANCM"
"0000340170" "FANCM"
"0000340171" "FANCM"
"0000340172" "FANCM"
"0000340173" "FANCM"
"0000340174" "FANCM"
"0000340175" "FANCM"
"0000340176" "FANCM"
"0000340177" "FANCM"
"0000340178" "FANCM"
"0000340179" "FANCM"
"0000340180" "FANCM"
"0000340181" "FANCM"
"0000340182" "FANCM"
"0000340183" "FANCM"
"0000340184" "FANCM"
"0000340185" "FANCM"
"0000340186" "FANCM"
"0000340187" "FANCM"
"0000340188" "FANCM"
"0000340189" "FANCM"
"0000340190" "FANCM"
"0000340191" "FANCM"
"0000340192" "FANCM"
"0000340193" "FANCM"
"0000340194" "FANCM"
"0000340195" "FANCM"
"0000340196" "FANCM"
"0000340197" "FANCM"
"0000340198" "FANCM"
"0000340199" "FANCM"
"0000340200" "FANCM"
"0000340201" "FANCM"
"0000340202" "FANCM"
"0000340203" "FANCM"
"0000340204" "FANCM"
"0000340205" "FANCM"
"0000340206" "FANCM"
"0000340207" "FANCM"
"0000340208" "FANCM"
"0000340209" "FANCM"
"0000340210" "FANCM"
"0000340211" "FANCM"
"0000340212" "FANCM"
"0000340213" "FANCM"
"0000340214" "FANCM"
"0000340215" "FANCM"
"0000340216" "FANCM"
"0000340217" "FANCM"
"0000340218" "FANCM"
"0000340219" "FANCM"
"0000340220" "FANCM"
"0000340221" "FANCM"
"0000340222" "FANCM"
"0000340223" "FANCM"
"0000340224" "FANCM"
"0000340225" "FANCM"
"0000340226" "FANCM"
"0000340227" "FANCM"
"0000340228" "FANCM"
"0000340229" "FANCM"
"0000340230" "FANCM"
"0000340231" "FANCM"
"0000340232" "FANCM"
"0000340233" "FANCM"
"0000340234" "FANCM"
"0000340235" "FANCM"
"0000340236" "FANCM"
"0000340237" "FANCM"
"0000340238" "FANCM"
"0000340239" "FANCM"
"0000340240" "FANCM"
"0000340241" "FANCM"
"0000340242" "FANCM"
"0000340243" "FANCM"
"0000340244" "FANCM"
"0000340245" "FANCM"
"0000340246" "FANCM"
"0000340247" "FANCM"
"0000340248" "FANCM"
"0000340249" "FANCM"
"0000340250" "FANCM"
"0000340251" "FANCM"
"0000340252" "FANCM"
"0000340253" "FANCM"
"0000340254" "FANCM"
"0000340255" "FANCM"
"0000340256" "FANCM"
"0000340257" "FANCM"
"0000340258" "FANCM"
"0000340259" "FANCM"
"0000340260" "FANCM"
"0000340261" "FANCM"
"0000340262" "FANCM"
"0000340263" "FANCM"
"0000340264" "FANCM"
"0000340265" "FANCM"
"0000340266" "FANCM"
"0000340267" "FANCM"
"0000340268" "FANCM"
"0000340269" "FANCM"
"0000340270" "FANCM"
"0000340271" "FANCM"
"0000340272" "FANCM"
"0000340273" "FANCM"
"0000340274" "FANCM"
"0000340275" "FANCM"
"0000340276" "FANCM"
"0000340277" "FANCM"
"0000340278" "FANCM"
"0000340279" "FANCM"
"0000340280" "FANCM"
"0000340281" "FANCM"
"0000340282" "FANCM"
"0000340283" "FANCM"
"0000340284" "FANCM"
"0000340285" "FANCM"
"0000340286" "FANCM"
"0000340287" "FANCM"
"0000340288" "FANCM"
"0000340289" "FANCM"
"0000340290" "FANCM"
"0000340291" "FANCM"
"0000340292" "FANCM"
"0000340293" "FANCM"
"0000340294" "FANCM"
"0000340295" "FANCM"
"0000340296" "FANCM"
"0000340297" "FANCM"
"0000340298" "FANCM"
"0000340299" "FANCM"
"0000340300" "FANCM"
"0000340301" "FANCM"
"0000340302" "FANCM"
"0000340303" "FANCM"
"0000340304" "FANCM"
"0000340305" "FANCM"
"0000340306" "FANCM"
"0000340307" "FANCM"
"0000340308" "FANCM"
"0000340309" "FANCM"
"0000340310" "FANCM"
"0000340311" "FANCM"
"0000340312" "FANCM"
"0000340313" "FANCM"
"0000340314" "FANCM"
"0000340315" "FANCM"
"0000340316" "FANCM"
"0000340317" "FANCM"
"0000340318" "FANCM"
"0000340319" "FANCM"
"0000340320" "FANCM"
"0000340321" "FANCM"
"0000340322" "FANCM"
"0000340323" "FANCM"
"0000340324" "FANCM"
"0000340325" "FANCM"
"0000340326" "FANCM"
"0000340327" "FANCM"
"0000340328" "FANCM"
"0000340329" "FANCM"
"0000340330" "FANCM"
"0000340331" "FANCM"
"0000340332" "FANCM"
"0000340333" "FANCM"
"0000340334" "FANCM"
"0000340335" "FANCM"
"0000340336" "FANCM"
"0000340337" "FANCM"
"0000340338" "FANCM"
"0000340339" "FANCM"
"0000340340" "FANCM"
"0000340341" "FANCM"
"0000340342" "FANCM"
"0000340343" "FANCM"
"0000340344" "FANCM"
"0000340345" "FANCM"
"0000340346" "FANCM"
"0000340347" "FANCM"
"0000340348" "FANCM"
"0000340349" "FANCM"
"0000340350" "FANCM"
"0000340351" "FANCM"
"0000340352" "FANCM"
"0000340353" "FANCM"
"0000340354" "FANCM"
"0000343492" "FANCM"
"0000343493" "FANCM"
"0000343494" "FANCM"
"0000343495" "FANCM"
"0000343496" "FANCM"
"0000343497" "FANCM"
"0000343498" "FANCM"
"0000343499" "FANCM"
"0000343500" "FANCM"
"0000343501" "FANCM"
"0000343502" "FANCM"
"0000343503" "FANCM"
"0000343504" "FANCM"
"0000343505" "FANCM"
"0000343506" "FANCM"
"0000343507" "FANCM"
"0000343508" "FANCM"
"0000343509" "FANCM"
"0000343510" "FANCM"
"0000343511" "FANCM"
"0000343512" "FANCM"
"0000343759" "FANCM"
"0000343760" "FANCM"
"0000343761" "FANCM"
"0000343763" "FANCM"
"0000343764" "FANCM"
"0000343765" "FANCM"
"0000343766" "FANCM"
"0000343767" "FANCM"
"0000343768" "FANCM"
"0000343769" "FANCM"
"0000343770" "FANCM"
"0000343771" "FANCM"
"0000343772" "FANCM"
"0000343773" "FANCM"
"0000343774" "FANCM"
"0000346870" "FANCM"
"0000346872" "FANCM"
"0000346873" "FANCM"
"0000346874" "FANCM"
"0000346875" "FANCM"
"0000346876" "FANCM"
"0000346877" "FANCM"
"0000346878" "FANCM"
"0000346879" "FANCM"
"0000346880" "FANCM"
"0000346881" "FANCM"
"0000346882" "FANCM"
"0000346883" "FANCM"
"0000346884" "FANCM"
"0000346885" "FANCM"
"0000346886" "FANCM"
"0000346887" "FANCM"
"0000346888" "FANCM"
"0000346889" "FANCM"
"0000346890" "FANCM"
"0000346891" "FANCM"
"0000346892" "FANCM"
"0000346893" "FANCM"
"0000346894" "FANCM"
"0000346895" "FANCM"
"0000346896" "FANCM"
"0000346897" "FANCM"
"0000346898" "FANCM"
"0000346899" "FANCM"
"0000346900" "FANCM"
"0000346901" "FANCM"
"0000346902" "FANCM"
"0000346903" "FANCM"
"0000346904" "FANCM"
"0000346905" "FANCM"
"0000346906" "FANCM"
"0000346907" "FANCM"
"0000346908" "FANCM"
"0000346909" "FANCM"
"0000346910" "FANCM"
"0000346911" "FANCM"
"0000346912" "FANCM"
"0000346913" "FANCM"
"0000346914" "FANCM"
"0000346915" "FANCM"
"0000346916" "FANCM"
"0000346917" "FANCM"
"0000346918" "FANCM"
"0000346919" "FANCM"
"0000346920" "FANCM"
"0000346921" "FANCM"
"0000346922" "FANCM"
"0000346923" "FANCM"
"0000346924" "FANCM"
"0000346925" "FANCM"
"0000346926" "FANCM"
"0000346927" "FANCM"
"0000346928" "FANCM"
"0000346929" "FANCM"
"0000346930" "FANCM"
"0000346931" "FANCM"
"0000346932" "FANCM"
"0000346933" "FANCM"
"0000346934" "FANCM"
"0000346935" "FANCM"
"0000346936" "FANCM"
"0000346937" "FANCM"
"0000346938" "FANCM"
"0000346939" "FANCM"
"0000346940" "FANCM"
"0000346941" "FANCM"
"0000346942" "FANCM"
"0000346943" "FANCM"
"0000346944" "FANCM"
"0000346945" "FANCM"
"0000346946" "FANCM"
"0000346947" "FANCM"
"0000346948" "FANCM"
"0000346949" "FANCM"
"0000346950" "FANCM"
"0000346951" "FANCM"
"0000346952" "FANCM"
"0000346953" "FANCM"
"0000346954" "FANCM"
"0000346955" "FANCM"
"0000346956" "FANCM"
"0000346957" "FANCM"
"0000346958" "FANCM"
"0000346959" "FANCM"
"0000346960" "FANCM"
"0000346961" "FANCM"
"0000346962" "FANCM"
"0000346963" "FANCM"
"0000346964" "FANCM"
"0000346965" "FANCM"
"0000346966" "FANCM"
"0000346967" "FANCM"
"0000346968" "FANCM"
"0000346969" "FANCM"
"0000346970" "FANCM"
"0000346971" "FANCM"
"0000346972" "FANCM"
"0000346973" "FANCM"
"0000346974" "FANCM"
"0000346975" "FANCM"
"0000346976" "FANCM"
"0000346977" "FANCM"
"0000346978" "FANCM"
"0000346979" "FANCM"
"0000346980" "FANCM"
"0000346981" "FANCM"
"0000346982" "FANCM"
"0000346983" "FANCM"
"0000346984" "FANCM"
"0000346985" "FANCM"
"0000346986" "FANCM"
"0000346987" "FANCM"
"0000346988" "FANCM"
"0000346989" "FANCM"
"0000346990" "FANCM"
"0000346991" "FANCM"
"0000346992" "FANCM"
"0000346993" "FANCM"
"0000346994" "FANCM"
"0000346995" "FANCM"
"0000346996" "FANCM"
"0000346997" "FANCM"
"0000346998" "FANCM"
"0000346999" "FANCM"
"0000347000" "FANCM"
"0000347001" "FANCM"
"0000347002" "FANCM"
"0000347003" "FANCM"
"0000347004" "FANCM"
"0000347005" "FANCM"
"0000347006" "FANCM"
"0000347007" "FANCM"
"0000347008" "FANCM"
"0000347009" "FANCM"
"0000347010" "FANCM"
"0000347011" "FANCM"
"0000347012" "FANCM"
"0000347013" "FANCM"
"0000347014" "FANCM"
"0000347015" "FANCM"
"0000347016" "FANCM"
"0000347017" "FANCM"
"0000347018" "FANCM"
"0000347019" "FANCM"
"0000347020" "FANCM"
"0000347021" "FANCM"
"0000347022" "FANCM"
"0000347023" "FANCM"
"0000347024" "FANCM"
"0000347025" "FANCM"
"0000347026" "FANCM"
"0000347027" "FANCM"
"0000347028" "FANCM"
"0000347029" "FANCM"
"0000347030" "FANCM"
"0000347031" "FANCM"
"0000347032" "FANCM"
"0000347033" "FANCM"
"0000347034" "FANCM"
"0000347035" "FANCM"
"0000347036" "FANCM"
"0000347037" "FANCM"
"0000347038" "FANCM"
"0000347039" "FANCM"
"0000347040" "FANCM"
"0000347041" "FANCM"
"0000347042" "FANCM"
"0000347043" "FANCM"
"0000347044" "FANCM"
"0000347045" "FANCM"
"0000347046" "FANCM"
"0000347047" "FANCM"
"0000347048" "FANCM"
"0000347049" "FANCM"
"0000347050" "FANCM"
"0000347051" "FANCM"
"0000347052" "FANCM"
"0000347053" "FANCM"
"0000347054" "FANCM"
"0000347055" "FANCM"
"0000347056" "FANCM"
"0000347057" "FANCM"
"0000347058" "FANCM"
"0000347059" "FANCM"
"0000347060" "FANCM"
"0000347061" "FANCM"
"0000347062" "FANCM"
"0000347063" "FANCM"
"0000347064" "FANCM"
"0000347065" "FANCM"
"0000347066" "FANCM"
"0000347067" "FANCM"
"0000347068" "FANCM"
"0000347069" "FANCM"
"0000347070" "FANCM"
"0000347071" "FANCM"
"0000347072" "FANCM"
"0000347073" "FANCM"
"0000347074" "FANCM"
"0000347075" "FANCM"
"0000347076" "FANCM"
"0000347077" "FANCM"
"0000347078" "FANCM"
"0000347079" "FANCM"
"0000347080" "FANCM"
"0000347081" "FANCM"
"0000347082" "FANCM"
"0000347083" "FANCM"
"0000347084" "FANCM"
"0000347085" "FANCM"
"0000347086" "FANCM"
"0000347087" "FANCM"
"0000347088" "FANCM"
"0000347089" "FANCM"
"0000347090" "FANCM"
"0000347091" "FANCM"
"0000347092" "FANCM"
"0000347093" "FANCM"
"0000347094" "FANCM"
"0000347095" "FANCM"
"0000347096" "FANCM"
"0000347097" "FANCM"
"0000347098" "FANCM"
"0000347099" "FANCM"
"0000347100" "FANCM"
"0000347101" "FANCM"
"0000347102" "FANCM"
"0000347103" "FANCM"
"0000347104" "FANCM"
"0000347105" "FANCM"
"0000347106" "FANCM"
"0000347107" "FANCM"
"0000347108" "FANCM"
"0000347109" "FANCM"
"0000347110" "FANCM"
"0000347111" "FANCM"
"0000347112" "FANCM"
"0000347113" "FANCM"
"0000347114" "FANCM"
"0000347115" "FANCM"
"0000347116" "FANCM"
"0000347117" "FANCM"
"0000347118" "FANCM"
"0000347119" "FANCM"
"0000347120" "FANCM"
"0000347121" "FANCM"
"0000347122" "FANCM"
"0000347123" "FANCM"
"0000347124" "FANCM"
"0000347125" "FANCM"
"0000347126" "FANCM"
"0000347127" "FANCM"
"0000347128" "FANCM"
"0000347129" "FANCM"
"0000347130" "FANCM"
"0000347131" "FANCM"
"0000347132" "FANCM"
"0000347133" "FANCM"
"0000347134" "FANCM"
"0000347135" "FANCM"
"0000347136" "FANCM"
"0000347137" "FANCM"
"0000347138" "FANCM"
"0000347139" "FANCM"
"0000347140" "FANCM"
"0000347141" "FANCM"
"0000347142" "FANCM"
"0000347143" "FANCM"
"0000347144" "FANCM"
"0000347145" "FANCM"
"0000347146" "FANCM"
"0000347147" "FANCM"
"0000347148" "FANCM"
"0000347149" "FANCM"
"0000347150" "FANCM"
"0000347151" "FANCM"
"0000347152" "FANCM"
"0000347153" "FANCM"
"0000347154" "FANCM"
"0000347155" "FANCM"
"0000347156" "FANCM"
"0000347157" "FANCM"
"0000347158" "FANCM"
"0000347159" "FANCM"
"0000347160" "FANCM"
"0000347161" "FANCM"
"0000347162" "FANCM"
"0000347163" "FANCM"
"0000347164" "FANCM"
"0000347165" "FANCM"
"0000347166" "FANCM"
"0000347167" "FANCM"
"0000347168" "FANCM"
"0000347169" "FANCM"
"0000347170" "FANCM"
"0000347171" "FANCM"
"0000347172" "FANCM"
"0000347173" "FANCM"
"0000347174" "FANCM"
"0000347175" "FANCM"
"0000347176" "FANCM"
"0000347177" "FANCM"
"0000347178" "FANCM"
"0000347179" "FANCM"
"0000347180" "FANCM"
"0000347181" "FANCM"
"0000347182" "FANCM"
"0000347183" "FANCM"
"0000347184" "FANCM"
"0000347185" "FANCM"
"0000347186" "FANCM"
"0000347187" "FANCM"
"0000347188" "FANCM"
"0000347189" "FANCM"
"0000347190" "FANCM"
"0000347191" "FANCM"
"0000347192" "FANCM"
"0000347193" "FANCM"
"0000347194" "FANCM"
"0000347195" "FANCM"
"0000347196" "FANCM"
"0000347197" "FANCM"
"0000347198" "FANCM"
"0000347199" "FANCM"
"0000347200" "FANCM"
"0000347201" "FANCM"
"0000347202" "FANCM"
"0000347203" "FANCM"
"0000347204" "FANCM"
"0000347205" "FANCM"
"0000347206" "FANCM"
"0000347207" "FANCM"
"0000347208" "FANCM"
"0000347209" "FANCM"
"0000347210" "FANCM"
"0000347211" "FANCM"
"0000347212" "FANCM"
"0000347213" "FANCM"
"0000347214" "FANCM"
"0000347215" "FANCM"
"0000347216" "FANCM"
"0000347217" "FANCM"
"0000347218" "FANCM"
"0000347219" "FANCM"
"0000347220" "FANCM"
"0000347221" "FANCM"
"0000347222" "FANCM"
"0000347223" "FANCM"
"0000347224" "FANCM"
"0000347225" "FANCM"
"0000347226" "FANCM"
"0000347227" "FANCM"
"0000347228" "FANCM"
"0000347229" "FANCM"
"0000347230" "FANCM"
"0000347231" "FANCM"
"0000347232" "FANCM"
"0000347233" "FANCM"
"0000347234" "FANCM"
"0000347235" "FANCM"
"0000347236" "FANCM"
"0000347237" "FANCM"
"0000347238" "FANCM"
"0000347239" "FANCM"
"0000347240" "FANCM"
"0000347241" "FANCM"
"0000347242" "FANCM"
"0000347243" "FANCM"
"0000347244" "FANCM"
"0000347245" "FANCM"
"0000347246" "FANCM"
"0000347247" "FANCM"
"0000347248" "FANCM"
"0000347249" "FANCM"
"0000347250" "FANCM"
"0000347251" "FANCM"
"0000347252" "FANCM"
"0000347253" "FANCM"
"0000347254" "FANCM"
"0000347255" "FANCM"
"0000347256" "FANCM"
"0000347257" "FANCM"
"0000347258" "FANCM"
"0000347259" "FANCM"
"0000347260" "FANCM"
"0000347261" "FANCM"
"0000347262" "FANCM"
"0000347263" "FANCM"
"0000347264" "FANCM"
"0000347265" "FANCM"
"0000347266" "FANCM"
"0000347267" "FANCM"
"0000347268" "FANCM"
"0000347269" "FANCM"
"0000347270" "FANCM"
"0000347271" "FANCM"
"0000347272" "FANCM"
"0000347273" "FANCM"
"0000347274" "FANCM"
"0000347275" "FANCM"
"0000347276" "FANCM"
"0000347277" "FANCM"
"0000347278" "FANCM"
"0000347279" "FANCM"
"0000347280" "FANCM"
"0000347281" "FANCM"
"0000347282" "FANCM"
"0000347283" "FANCM"
"0000347284" "FANCM"
"0000347285" "FANCM"
"0000347286" "FANCM"
"0000347287" "FANCM"
"0000347288" "FANCM"
"0000347289" "FANCM"
"0000347290" "FANCM"
"0000347291" "FANCM"
"0000347292" "FANCM"
"0000347293" "FANCM"
"0000347294" "FANCM"
"0000347295" "FANCM"
"0000347296" "FANCM"
"0000347297" "FANCM"
"0000350535" "FANCM"
"0000350536" "FANCM"
"0000350537" "FANCM"
"0000350538" "FANCM"
"0000350539" "FANCM"
"0000350540" "FANCM"
"0000350541" "FANCM"
"0000350542" "FANCM"
"0000350626" "FANCM"
"0000352692" "FANCM"
"0000352693" "FANCM"
"0000352694" "FANCM"
"0000352695" "FANCM"
"0000352696" "FANCM"
"0000352697" "FANCM"
"0000352698" "FANCM"
"0000352699" "FANCM"
"0000352700" "FANCM"
"0000352701" "FANCM"
"0000352702" "FANCM"
"0000352703" "FANCM"
"0000352704" "FANCM"
"0000352705" "FANCM"
"0000352706" "FANCM"
"0000352707" "FANCM"
"0000352708" "FANCM"
"0000352709" "FANCM"
"0000352710" "FANCM"
"0000352711" "FANCM"
"0000352712" "FANCM"
"0000352713" "FANCM"
"0000352714" "FANCM"
"0000352715" "FANCM"
"0000352716" "FANCM"
"0000352717" "FANCM"
"0000352718" "FANCM"
"0000352719" "FANCM"
"0000352720" "FANCM"
"0000352721" "FANCM"
"0000352722" "FANCM"
"0000352723" "FANCM"
"0000352724" "FANCM"
"0000352725" "FANCM"
"0000352726" "FANCM"
"0000352727" "FANCM"
"0000352728" "FANCM"
"0000352729" "FANCM"
"0000352730" "FANCM"
"0000352731" "FANCM"
"0000352732" "FANCM"
"0000352733" "FANCM"
"0000352734" "FANCM"
"0000352735" "FANCM"
"0000352736" "FANCM"
"0000352737" "FANCM"
"0000352738" "FANCM"
"0000352739" "FANCM"
"0000352740" "FANCM"
"0000352741" "FANCM"
"0000352742" "FANCM"
"0000352743" "FANCM"
"0000352744" "FANCM"
"0000352745" "FANCM"
"0000352746" "FANCM"
"0000352747" "FANCM"
"0000352748" "FANCM"
"0000352749" "FANCM"
"0000352750" "FANCM"
"0000352751" "FANCM"
"0000352752" "FANCM"
"0000352753" "FANCM"
"0000352754" "FANCM"
"0000352755" "FANCM"
"0000352756" "FANCM"
"0000352757" "FANCM"
"0000352758" "FANCM"
"0000352759" "FANCM"
"0000352760" "FANCM"
"0000352761" "FANCM"
"0000352762" "FANCM"
"0000352763" "FANCM"
"0000352764" "FANCM"
"0000352765" "FANCM"
"0000352766" "FANCM"
"0000352767" "FANCM"
"0000352768" "FANCM"
"0000352769" "FANCM"
"0000352770" "FANCM"
"0000352771" "FANCM"
"0000352772" "FANCM"
"0000352773" "FANCM"
"0000352774" "FANCM"
"0000352775" "FANCM"
"0000352776" "FANCM"
"0000352777" "FANCM"
"0000352778" "FANCM"
"0000352779" "FANCM"
"0000352780" "FANCM"
"0000352781" "FANCM"
"0000352782" "FANCM"
"0000352783" "FANCM"
"0000352784" "FANCM"
"0000352785" "FANCM"
"0000352786" "FANCM"
"0000352787" "FANCM"
"0000352788" "FANCM"
"0000352789" "FANCM"
"0000352790" "FANCM"
"0000352791" "FANCM"
"0000352792" "FANCM"
"0000352793" "FANCM"
"0000352794" "FANCM"
"0000352795" "FANCM"
"0000352796" "FANCM"
"0000352797" "FANCM"
"0000352798" "FANCM"
"0000352799" "FANCM"
"0000352800" "FANCM"
"0000352801" "FANCM"
"0000352802" "FANCM"
"0000352803" "FANCM"
"0000352804" "FANCM"
"0000352805" "FANCM"
"0000352806" "FANCM"
"0000352807" "FANCM"
"0000352808" "FANCM"
"0000352809" "FANCM"
"0000352810" "FANCM"
"0000352811" "FANCM"
"0000352812" "FANCM"
"0000352813" "FANCM"
"0000352814" "FANCM"
"0000352815" "FANCM"
"0000352816" "FANCM"
"0000352817" "FANCM"
"0000352818" "FANCM"
"0000352819" "FANCM"
"0000352820" "FANCM"
"0000352821" "FANCM"
"0000352822" "FANCM"
"0000352823" "FANCM"
"0000352824" "FANCM"
"0000352825" "FANCM"
"0000352826" "FANCM"
"0000352827" "FANCM"
"0000352828" "FANCM"
"0000352829" "FANCM"
"0000352830" "FANCM"
"0000352831" "FANCM"
"0000352832" "FANCM"
"0000352833" "FANCM"
"0000352834" "FANCM"
"0000352835" "FANCM"
"0000352836" "FANCM"
"0000352837" "FANCM"
"0000352838" "FANCM"
"0000352839" "FANCM"
"0000352840" "FANCM"
"0000352841" "FANCM"
"0000352842" "FANCM"
"0000352843" "FANCM"
"0000352844" "FANCM"
"0000352845" "FANCM"
"0000352846" "FANCM"
"0000352847" "FANCM"
"0000352848" "FANCM"
"0000352849" "FANCM"
"0000352850" "FANCM"
"0000352851" "FANCM"
"0000352852" "FANCM"
"0000352853" "FANCM"
"0000352854" "FANCM"
"0000352855" "FANCM"
"0000352856" "FANCM"
"0000352857" "FANCM"
"0000352858" "FANCM"
"0000352859" "FANCM"
"0000352860" "FANCM"
"0000352861" "FANCM"
"0000352862" "FANCM"
"0000352863" "FANCM"
"0000352864" "FANCM"
"0000352865" "FANCM"
"0000352866" "FANCM"
"0000352867" "FANCM"
"0000352868" "FANCM"
"0000352869" "FANCM"
"0000352870" "FANCM"
"0000352871" "FANCM"
"0000352872" "FANCM"
"0000352873" "FANCM"
"0000352874" "FANCM"
"0000352875" "FANCM"
"0000352876" "FANCM"
"0000352877" "FANCM"
"0000352878" "FANCM"
"0000352879" "FANCM"
"0000352880" "FANCM"
"0000352881" "FANCM"
"0000352882" "FANCM"
"0000352883" "FANCM"
"0000352884" "FANCM"
"0000352885" "FANCM"
"0000352886" "FANCM"
"0000352887" "FANCM"
"0000352888" "FANCM"
"0000352889" "FANCM"
"0000352890" "FANCM"
"0000352891" "FANCM"
"0000352892" "FANCM"
"0000352893" "FANCM"
"0000352894" "FANCM"
"0000352895" "FANCM"
"0000352896" "FANCM"
"0000352897" "FANCM"
"0000352898" "FANCM"
"0000352899" "FANCM"
"0000352900" "FANCM"
"0000352901" "FANCM"
"0000352902" "FANCM"
"0000352903" "FANCM"
"0000352904" "FANCM"
"0000352905" "FANCM"
"0000352906" "FANCM"
"0000352907" "FANCM"
"0000352908" "FANCM"
"0000352909" "FANCM"
"0000352910" "FANCM"
"0000352911" "FANCM"
"0000352912" "FANCM"
"0000352913" "FANCM"
"0000352914" "FANCM"
"0000352915" "FANCM"
"0000352916" "FANCM"
"0000352917" "FANCM"
"0000352918" "FANCM"
"0000352919" "FANCM"
"0000352920" "FANCM"
"0000352921" "FANCM"
"0000352922" "FANCM"
"0000352923" "FANCM"
"0000352924" "FANCM"
"0000352925" "FANCM"
"0000352926" "FANCM"
"0000352927" "FANCM"
"0000352928" "FANCM"
"0000352929" "FANCM"
"0000352930" "FANCM"
"0000352931" "FANCM"
"0000352932" "FANCM"
"0000352933" "FANCM"
"0000352934" "FANCM"
"0000352935" "FANCM"
"0000352936" "FANCM"
"0000352937" "FANCM"
"0000352938" "FANCM"
"0000352939" "FANCM"
"0000352940" "FANCM"
"0000352941" "FANCM"
"0000352942" "FANCM"
"0000352943" "FANCM"
"0000352944" "FANCM"
"0000352945" "FANCM"
"0000352946" "FANCM"
"0000352947" "FANCM"
"0000352948" "FANCM"
"0000352949" "FANCM"
"0000352950" "FANCM"
"0000352951" "FANCM"
"0000352952" "FANCM"
"0000352953" "FANCM"
"0000352954" "FANCM"
"0000352955" "FANCM"
"0000352956" "FANCM"
"0000352957" "FANCM"
"0000352958" "FANCM"
"0000352959" "FANCM"
"0000352960" "FANCM"
"0000352961" "FANCM"
"0000352962" "FANCM"
"0000352963" "FANCM"
"0000352964" "FANCM"
"0000352965" "FANCM"
"0000352966" "FANCM"
"0000352967" "FANCM"
"0000352968" "FANCM"
"0000352969" "FANCM"
"0000352970" "FANCM"
"0000352971" "FANCM"
"0000352972" "FANCM"
"0000352973" "FANCM"
"0000352974" "FANCM"
"0000352975" "FANCM"
"0000352976" "FANCM"
"0000352977" "FANCM"
"0000352978" "FANCM"
"0000352979" "FANCM"
"0000352980" "FANCM"
"0000355311" "FANCM"
"0000355312" "FANCM"
"0000355313" "FANCM"
"0000355314" "FANCM"
"0000355315" "FANCM"
"0000355316" "FANCM"
"0000355317" "FANCM"
"0000355318" "FANCM"
"0000355402" "FANCM"
"0000357468" "FANCM"
"0000357469" "FANCM"
"0000357470" "FANCM"
"0000357471" "FANCM"
"0000357472" "FANCM"
"0000357473" "FANCM"
"0000357474" "FANCM"
"0000357475" "FANCM"
"0000357476" "FANCM"
"0000357477" "FANCM"
"0000357478" "FANCM"
"0000357479" "FANCM"
"0000357480" "FANCM"
"0000357481" "FANCM"
"0000357482" "FANCM"
"0000357483" "FANCM"
"0000357484" "FANCM"
"0000357485" "FANCM"
"0000357486" "FANCM"
"0000357487" "FANCM"
"0000357488" "FANCM"
"0000357489" "FANCM"
"0000357490" "FANCM"
"0000357491" "FANCM"
"0000357492" "FANCM"
"0000357493" "FANCM"
"0000357494" "FANCM"
"0000357495" "FANCM"
"0000357496" "FANCM"
"0000357497" "FANCM"
"0000357498" "FANCM"
"0000357499" "FANCM"
"0000357500" "FANCM"
"0000357501" "FANCM"
"0000357502" "FANCM"
"0000357503" "FANCM"
"0000357504" "FANCM"
"0000357505" "FANCM"
"0000357506" "FANCM"
"0000357507" "FANCM"
"0000357508" "FANCM"
"0000357509" "FANCM"
"0000357510" "FANCM"
"0000357511" "FANCM"
"0000357512" "FANCM"
"0000357513" "FANCM"
"0000357514" "FANCM"
"0000357515" "FANCM"
"0000357516" "FANCM"
"0000357517" "FANCM"
"0000357518" "FANCM"
"0000357519" "FANCM"
"0000357520" "FANCM"
"0000357521" "FANCM"
"0000357522" "FANCM"
"0000357523" "FANCM"
"0000357524" "FANCM"
"0000357525" "FANCM"
"0000357526" "FANCM"
"0000357527" "FANCM"
"0000357528" "FANCM"
"0000357529" "FANCM"
"0000357530" "FANCM"
"0000357531" "FANCM"
"0000357532" "FANCM"
"0000357533" "FANCM"
"0000357534" "FANCM"
"0000357535" "FANCM"
"0000357536" "FANCM"
"0000357537" "FANCM"
"0000357538" "FANCM"
"0000357539" "FANCM"
"0000357540" "FANCM"
"0000357541" "FANCM"
"0000357542" "FANCM"
"0000357543" "FANCM"
"0000357544" "FANCM"
"0000357545" "FANCM"
"0000357546" "FANCM"
"0000357547" "FANCM"
"0000357548" "FANCM"
"0000357549" "FANCM"
"0000357550" "FANCM"
"0000357551" "FANCM"
"0000357552" "FANCM"
"0000357553" "FANCM"
"0000357554" "FANCM"
"0000357555" "FANCM"
"0000357556" "FANCM"
"0000357557" "FANCM"
"0000357558" "FANCM"
"0000357559" "FANCM"
"0000357560" "FANCM"
"0000357561" "FANCM"
"0000357562" "FANCM"
"0000357563" "FANCM"
"0000357564" "FANCM"
"0000357565" "FANCM"
"0000357566" "FANCM"
"0000357567" "FANCM"
"0000357568" "FANCM"
"0000357569" "FANCM"
"0000357570" "FANCM"
"0000357571" "FANCM"
"0000357572" "FANCM"
"0000357573" "FANCM"
"0000357574" "FANCM"
"0000357575" "FANCM"
"0000357576" "FANCM"
"0000357577" "FANCM"
"0000357578" "FANCM"
"0000357579" "FANCM"
"0000357580" "FANCM"
"0000357581" "FANCM"
"0000357582" "FANCM"
"0000357583" "FANCM"
"0000357584" "FANCM"
"0000357585" "FANCM"
"0000357586" "FANCM"
"0000357587" "FANCM"
"0000357588" "FANCM"
"0000357589" "FANCM"
"0000357590" "FANCM"
"0000357591" "FANCM"
"0000357592" "FANCM"
"0000357593" "FANCM"
"0000357594" "FANCM"
"0000357595" "FANCM"
"0000357596" "FANCM"
"0000357597" "FANCM"
"0000357598" "FANCM"
"0000357599" "FANCM"
"0000357600" "FANCM"
"0000357601" "FANCM"
"0000357602" "FANCM"
"0000357603" "FANCM"
"0000357604" "FANCM"
"0000357605" "FANCM"
"0000357606" "FANCM"
"0000357607" "FANCM"
"0000357608" "FANCM"
"0000357609" "FANCM"
"0000357610" "FANCM"
"0000357611" "FANCM"
"0000357612" "FANCM"
"0000357613" "FANCM"
"0000357614" "FANCM"
"0000357615" "FANCM"
"0000357616" "FANCM"
"0000357617" "FANCM"
"0000357618" "FANCM"
"0000357619" "FANCM"
"0000357620" "FANCM"
"0000357621" "FANCM"
"0000357622" "FANCM"
"0000357623" "FANCM"
"0000357624" "FANCM"
"0000357625" "FANCM"
"0000357626" "FANCM"
"0000357627" "FANCM"
"0000357628" "FANCM"
"0000357629" "FANCM"
"0000357630" "FANCM"
"0000357631" "FANCM"
"0000357632" "FANCM"
"0000357633" "FANCM"
"0000357634" "FANCM"
"0000357635" "FANCM"
"0000357636" "FANCM"
"0000357637" "FANCM"
"0000357638" "FANCM"
"0000357639" "FANCM"
"0000357640" "FANCM"
"0000357641" "FANCM"
"0000357642" "FANCM"
"0000357643" "FANCM"
"0000357644" "FANCM"
"0000357645" "FANCM"
"0000357646" "FANCM"
"0000357647" "FANCM"
"0000357648" "FANCM"
"0000357649" "FANCM"
"0000357650" "FANCM"
"0000357651" "FANCM"
"0000357652" "FANCM"
"0000357653" "FANCM"
"0000357654" "FANCM"
"0000357655" "FANCM"
"0000357656" "FANCM"
"0000357657" "FANCM"
"0000357658" "FANCM"
"0000357659" "FANCM"
"0000357660" "FANCM"
"0000357661" "FANCM"
"0000357662" "FANCM"
"0000357663" "FANCM"
"0000357664" "FANCM"
"0000357665" "FANCM"
"0000357666" "FANCM"
"0000357667" "FANCM"
"0000357668" "FANCM"
"0000357669" "FANCM"
"0000357670" "FANCM"
"0000357671" "FANCM"
"0000357672" "FANCM"
"0000357673" "FANCM"
"0000357674" "FANCM"
"0000357675" "FANCM"
"0000357676" "FANCM"
"0000357677" "FANCM"
"0000357678" "FANCM"
"0000357679" "FANCM"
"0000357680" "FANCM"
"0000357681" "FANCM"
"0000357682" "FANCM"
"0000357683" "FANCM"
"0000357684" "FANCM"
"0000357685" "FANCM"
"0000357686" "FANCM"
"0000357687" "FANCM"
"0000357688" "FANCM"
"0000357689" "FANCM"
"0000357690" "FANCM"
"0000357691" "FANCM"
"0000357692" "FANCM"
"0000357693" "FANCM"
"0000357694" "FANCM"
"0000357695" "FANCM"
"0000357696" "FANCM"
"0000357697" "FANCM"
"0000357698" "FANCM"
"0000357699" "FANCM"
"0000357700" "FANCM"
"0000357701" "FANCM"
"0000357702" "FANCM"
"0000357703" "FANCM"
"0000357704" "FANCM"
"0000357705" "FANCM"
"0000357706" "FANCM"
"0000357707" "FANCM"
"0000357708" "FANCM"
"0000357709" "FANCM"
"0000357710" "FANCM"
"0000357711" "FANCM"
"0000357712" "FANCM"
"0000357713" "FANCM"
"0000357714" "FANCM"
"0000357715" "FANCM"
"0000357716" "FANCM"
"0000357717" "FANCM"
"0000357718" "FANCM"
"0000357719" "FANCM"
"0000357720" "FANCM"
"0000357721" "FANCM"
"0000357722" "FANCM"
"0000357723" "FANCM"
"0000357724" "FANCM"
"0000357725" "FANCM"
"0000357726" "FANCM"
"0000357727" "FANCM"
"0000357728" "FANCM"
"0000357729" "FANCM"
"0000357730" "FANCM"
"0000357731" "FANCM"
"0000357732" "FANCM"
"0000357733" "FANCM"
"0000357734" "FANCM"
"0000357735" "FANCM"
"0000357736" "FANCM"
"0000357737" "FANCM"
"0000357738" "FANCM"
"0000357739" "FANCM"
"0000357740" "FANCM"
"0000357741" "FANCM"
"0000357742" "FANCM"
"0000357743" "FANCM"
"0000357744" "FANCM"
"0000357745" "FANCM"
"0000357746" "FANCM"
"0000357747" "FANCM"
"0000357748" "FANCM"
"0000357749" "FANCM"
"0000357750" "FANCM"
"0000357751" "FANCM"
"0000357752" "FANCM"
"0000357753" "FANCM"
"0000357754" "FANCM"
"0000357755" "FANCM"
"0000357756" "FANCM"
"0000404328" "FANCM"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 1635
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000019155" "3" "70" "14" "45645018" "45645018" "del" "0" "00075" "FANCM_000005" "g.45645018del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.45175815del" "" "likely pathogenic" ""
"0000040554" "11" "90" "14" "45648160" "45650713" "del" "0" "00787" "FANCM_000002" "g.45648160_45650713del" "" "{PMID:Meetei 2005:16116422}" "" "" "2554bp deletion from IVS14 into exon 15, presumably from paternal allele (by linkage and paternal markers found in patient/sib), though deletion is not evident in father\'s blood-mosaicism is suspected" "Germline" "?" "" "0" "" "" "g.45178957_45181510del" "" "VUS" ""
"0000040555" "10" "90" "14" "45648160" "45650713" "del" "0" "00787" "FANCM_000002" "g.45648160_45650713del" "" "{PMID:Meetei 2005:16116422}" "" "" "2554bp deletion from IVS14 into exon 15, presumably from paternal allele (by linkage and paternal markers found in patient, though deletion is not evident in father\'s blood-mosaicism is suspected" "Germline" "?" "" "0" "" "" "g.45178957_45181510del" "" "pathogenic" ""
"0000040556" "1" "90" "14" "45639860" "45639860" "subst" "0" "00792" "FANCM_000003" "g.45639860C>T" "" "{PMID:Harutyunyan 2011:21681190}" "" "" "somatically acquired uniparental disomy chromosome 14q converted FANCM variant to homozygosity\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Uniparental disomy" "?" "" "0" "" "" "" "" "pathogenic" ""
"0000040557" "1" "50" "14" "45667921" "45667921" "subst" "0.00102796" "00046" "FANCM_000004" "g.45667921C>T" "" "" "" "" "" "Unknown" "?" "" "0" "" "" "g.45198718C>T" "" "VUS" ""
"0000040558" "21" "90" "14" "45642268" "45642268" "subst" "0" "00787" "FANCM_000001" "g.45642268C>A" "" "{PMID:Meetei 2005:16116422}" "" "" "" "Germline" "?" "" "0" "" "" "g.45173065C>A" "" "VUS" ""
"0000040559" "21" "90" "14" "45642268" "45642268" "subst" "0" "00787" "FANCM_000001" "g.45642268C>A" "" "{PMID:Meetei 2005:16116422}" "" "" "" "Germline" "?" "" "0" "" "" "g.45173065C>A" "" "pathogenic" ""
"0000040560" "2" "90" "14" "45639860" "45639860" "subst" "0" "00792" "FANCM_000003" "g.45639860C>T" "" "{PMID:Harutyunyan 2011:21681190}" "" "" "somatically acquired uniparental disomy chromosome 14q converted FANCM variant to homozygosity\r\nVariant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Uniparental disomy" "?" "" "0" "" "" "" "" "pathogenic" ""
"0000250140" "0" "10" "14" "45658449" "45658449" "subst" "0.00860063" "02329" "FANCM_000030" "g.45658449A>G" "" "" "" "FANCM(NM_001308133.1):c.5146A>G (p.(Ile1716Val)), FANCM(NM_020937.4):c.5224A>G (p.I1742V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45189246A>G" "" "benign" ""
"0000250141" "0" "10" "14" "45606387" "45606387" "subst" "0.010232" "02329" "FANCM_000011" "g.45606387A>G" "" "" "" "FANCM(NM_020937.4):c.624A>G (p.I208M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45137184A>G" "" "benign" ""
"0000250163" "0" "10" "14" "45645820" "45645820" "subst" "0.00224252" "02329" "FANCM_000019" "g.45645820A>G" "" "" "" "FANCM(NM_020937.4):c.3863A>G (p.N1288S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45176617A>G" "" "benign" ""
"0000250164" "0" "10" "14" "45665661" "45665661" "subst" "0.0213866" "02329" "FANCM_000025" "g.45665661A>G" "" "" "" "FANCM(NM_001308133.1):c.5549A>G (p.(Asn1850Ser)), FANCM(NM_020937.4):c.5627A>G (p.N1876S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45196458A>G" "" "benign" ""
"0000250167" "0" "10" "14" "45636328" "45636328" "subst" "0.0106565" "02329" "FANCM_000015" "g.45636328A>G" "" "" "" "FANCM(NM_020937.4):c.1964A>G (p.N655S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45167125A>G" "" "benign" ""
"0000250175" "0" "10" "14" "45605463" "45605463" "subst" "0.0114242" "02329" "FANCM_000008" "g.45605463A>G" "" "" "" "FANCM(NM_001308133.1):c.229A>G (p.(Thr77Ala)), FANCM(NM_020937.4):c.229A>G (p.T77A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45136260A>G" "" "benign" ""
"0000250315" "0" "30" "14" "45642287" "45642287" "subst" "0.00395691" "02329" "FANCM_000016" "g.45642287A>G" "" "" "" "FANCM(NM_020937.2):c.2190A>G (p.Q730=), FANCM(NM_020937.4):c.2190A>G (p.Q730=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45173084A>G" "" "likely benign" ""
"0000250369" "0" "30" "14" "45658273" "45658273" "subst" "1.21995E-5" "02329" "FANCM_000022" "g.45658273A>G" "" "" "" "FANCM(NM_020937.4):c.5048A>G (p.K1683R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45189070A>G" "" "likely benign" ""
"0000256304" "0" "50" "14" "45665702" "45665702" "subst" "8.12651E-6" "01943" "FANCM_000031" "g.45665702A>G" "" "" "" "FANCM(NM_020937.2):c.5668A>G (p.M1890V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45196499A>G" "" "VUS" ""
"0000282991" "0" "30" "14" "45623953" "45623953" "subst" "0.000692724" "02329" "FANCM_000012" "g.45623953T>C" "" "" "" "FANCM(NM_020937.2):c.1237T>C (p.Y413H, p.(Tyr413His)), FANCM(NM_020937.4):c.1237T>C (p.Y413H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45154750T>C" "" "likely benign" ""
"0000282992" "0" "30" "14" "45628478" "45628478" "subst" "0.000970517" "02329" "FANCM_000013" "g.45628478C>G" "" "" "" "FANCM(NM_020937.2):c.1576C>G (p.L526V), FANCM(NM_020937.4):c.1576C>G (p.L526V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45159275C>G" "" "likely benign" ""
"0000282993" "0" "30" "14" "45605405" "45605405" "subst" "0.00172992" "02329" "FANCM_000007" "g.45605405G>C" "" "" "" "FANCM(NM_001308133.1):c.171G>C (p.(Leu57Phe)), FANCM(NM_020937.2):c.171G>C (p.L57F), FANCM(NM_020937.4):c.171G>C (p.L57F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45136202G>C" "" "likely benign" ""
"0000282994" "0" "10" "14" "45644627" "45644627" "subst" "0.00774054" "02329" "FANCM_000017" "g.45644627T>C" "" "" "" "FANCM(NM_020937.4):c.2670T>C (p.F890=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45175424T>C" "" "benign" ""
"0000282995" "0" "30" "14" "45645253" "45645253" "subst" "0.000342318" "02329" "FANCM_000018" "g.45645253G>A" "" "" "" "FANCM(NM_020937.4):c.3296G>A (p.R1099H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45176050G>A" "" "likely benign" ""
"0000282996" "0" "10" "14" "45658024" "45658024" "subst" "0.0177924" "02329" "FANCM_000021" "g.45658024C>T" "" "" "" "FANCM(NM_001308133.1):c.4721C>T (p.(Thr1574Ile)), FANCM(NM_020937.2):c.4799C>T (p.T1600I), FANCM(NM_020937.4):c.4799C>T (p.T1600I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45188821C>T" "" "benign" ""
"0000282997" "0" "30" "14" "45605753" "45605753" "subst" "0" "02329" "FANCM_000009" "g.45605753C>T" "" "" "" "FANCM(NM_020937.4):c.508+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45136550C>T" "" "likely benign" ""
"0000282999" "0" "10" "14" "45658415" "45658415" "subst" "0.00224485" "02329" "FANCM_000024" "g.45658415G>A" "" "" "" "FANCM(NM_020937.4):c.5190G>A (p.Q1730=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45189212G>A" "" "benign" ""
"0000283000" "0" "10" "14" "45606290" "45606290" "subst" "0.00418553" "02329" "FANCM_000010" "g.45606290C>T" "" "" "" "FANCM(NM_020937.2):c.527C>T (p.(Thr176Ile), p.T176I), FANCM(NM_020937.4):c.527C>T (p.T176I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45137087C>T" "" "benign" ""
"0000283001" "0" "10" "14" "45665690" "45665690" "subst" "0.00215738" "02329" "FANCM_000026" "g.45665690C>T" "" "" "" "FANCM(NM_020937.4):c.5656C>T (p.H1886Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45196487C>T" "" "benign" ""
"0000283002" "0" "50" "14" "45667921" "45667921" "subst" "0.00102796" "02329" "FANCM_000004" "g.45667921C>T" "" "" "" "FANCM(NM_020937.4):c.5791C>T (p.R1931*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45198718C>T" "" "VUS" ""
"0000283003" "0" "50" "14" "45669170" "45669170" "subst" "0" "02329" "FANCM_000028" "g.45669170C>T" "" "" "" "FANCM(NM_020937.4):c.6106C>T (p.P2036S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45199967C>T" "" "VUS" ""
"0000287102" "0" "30" "14" "45650641" "45650641" "subst" "0" "01943" "FANCM_000020" "g.45650641T>A" "" "" "" "FANCM(NM_020937.2):c.4231T>A (p.L1411I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45181438T>A" "" "likely benign" ""
"0000287103" "0" "50" "14" "45605287" "45605287" "subst" "0.000134991" "01943" "FANCM_000006" "g.45605287G>A" "" "" "" "FANCM(NM_020937.2):c.53G>A (p.R18Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45136084G>A" "" "VUS" ""
"0000323659" "0" "50" "14" "45633647" "45633647" "subst" "0.000125921" "01804" "FANCM_000014" "g.45633647A>G" "" "" "" "FANCM(NM_020937.2):c.1667A>G (p.(Asp556Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45164444A>G" "" "VUS" ""
"0000342163" "0" "90" "14" "45667921" "45667921" "subst" "0.00102796" "02327" "FANCM_000004" "g.45667921C>T" "" "" "" "FANCM(NM_020937.4):c.5791C>T (p.R1931*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45198718C>T" "" "pathogenic" ""
"0000357974" "3" "30" "14" "45636313" "45636313" "subst" "1.21954E-5" "00006" "FANCM_000029" "g.45636313A>C" "" "{PMID:Saeed 2018:29311637}" "" "" "" "Germline" "" "" "0" "" "" "g.45167110A>C" "" "likely benign" ""
"0000403788" "0" "70" "14" "45639870" "45639870" "subst" "0" "02551" "FANCM_000032" "g.45639870T>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.45170667T>A" "" "likely pathogenic" ""
"0000500475" "0" "90" "14" "45658068" "45658068" "subst" "0" "00643" "FANCM_000033" "g.45658068A>T" "" "{PMID:Fostira 2020:31300551}" "" "" "" "Germline" "" "" "0" "" "" "g.45188865A>T" "" "pathogenic" ""
"0000500476" "0" "90" "14" "45658540" "45658541" "del" "0" "00643" "FANCM_000034" "g.45658540_45658541del" "" "{PMID:Fostira 2020:31300551}" "" "5314_5315delTG" "" "Germline" "" "" "0" "" "" "g.45189337_45189338del" "" "pathogenic" ""
"0000552558" "0" "50" "14" "45605405" "45605405" "subst" "0.00172992" "01943" "FANCM_000007" "g.45605405G>C" "" "" "" "FANCM(NM_001308133.1):c.171G>C (p.(Leu57Phe)), FANCM(NM_020937.2):c.171G>C (p.L57F), FANCM(NM_020937.4):c.171G>C (p.L57F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45136202G>C" "" "VUS" ""
"0000552559" "0" "50" "14" "45605405" "45605405" "subst" "0.00172992" "01804" "FANCM_000007" "g.45605405G>C" "" "" "" "FANCM(NM_001308133.1):c.171G>C (p.(Leu57Phe)), FANCM(NM_020937.2):c.171G>C (p.L57F), FANCM(NM_020937.4):c.171G>C (p.L57F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45136202G>C" "" "VUS" ""
"0000552560" "0" "10" "14" "45605463" "45605463" "subst" "0.0114242" "01804" "FANCM_000008" "g.45605463A>G" "" "" "" "FANCM(NM_001308133.1):c.229A>G (p.(Thr77Ala)), FANCM(NM_020937.4):c.229A>G (p.T77A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45136260A>G" "" "benign" ""
"0000552561" "0" "30" "14" "45606290" "45606290" "subst" "0.00418553" "01804" "FANCM_000010" "g.45606290C>T" "" "" "" "FANCM(NM_020937.2):c.527C>T (p.(Thr176Ile), p.T176I), FANCM(NM_020937.4):c.527C>T (p.T176I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45137087C>T" "" "likely benign" ""
"0000552564" "0" "30" "14" "45628478" "45628478" "subst" "0.000970517" "01943" "FANCM_000013" "g.45628478C>G" "" "" "" "FANCM(NM_020937.2):c.1576C>G (p.L526V), FANCM(NM_020937.4):c.1576C>G (p.L526V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45159275C>G" "" "likely benign" ""
"0000552565" "0" "30" "14" "45642365" "45642365" "subst" "0.00110172" "02329" "FANCM_000036" "g.45642365C>A" "" "" "" "FANCM(NM_020937.2):c.2268C>A (p.R756=), FANCM(NM_020937.4):c.2268C>A (p.R756=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45173162C>A" "" "likely benign" ""
"0000552566" "0" "10" "14" "45644706" "45644706" "subst" "0.00584958" "01804" "FANCM_000037" "g.45644706A>G" "" "" "" "FANCM(NM_001308133.1):c.2671A>G (p.(Ile891Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45175503A>G" "" "benign" ""
"0000552567" "0" "30" "14" "45644816" "45644816" "subst" "0.00108907" "01804" "FANCM_000038" "g.45644816A>C" "" "" "" "FANCM(NM_020937.2):c.2859A>C (p.(Lys953Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45175613A>C" "" "likely benign" ""
"0000552568" "0" "30" "14" "45645165" "45645165" "subst" "0" "02329" "FANCM_000039" "g.45645165C>T" "" "" "" "FANCM(NM_020937.4):c.3208C>T (p.P1070S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45175962C>T" "" "likely benign" ""
"0000552569" "0" "30" "14" "45645300" "45645300" "subst" "0" "01943" "FANCM_000040" "g.45645300A>G" "" "" "" "FANCM(NM_020937.2):c.3343A>G (p.N1115D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45176097A>G" "" "likely benign" ""
"0000552570" "0" "30" "14" "45645312" "45645312" "subst" "4.0711E-6" "01943" "FANCM_000041" "g.45645312G>C" "" "" "" "FANCM(NM_020937.2):c.3355G>C (p.D1119H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45176109G>C" "" "likely benign" ""
"0000552571" "0" "30" "14" "45645514" "45645514" "subst" "4.06848E-6" "01943" "FANCM_000042" "g.45645514A>G" "" "" "" "FANCM(NM_020937.2):c.3557A>G (p.N1186S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45176311A>G" "" "likely benign" ""
"0000552572" "0" "10" "14" "45645715" "45645715" "subst" "0.0253811" "01804" "FANCM_000043" "g.45645715A>G" "" "" "" "FANCM(NM_001308133.1):c.3680A>G (p.(Asn1227Ser)), FANCM(NM_020937.4):c.3758A>G (p.N1253S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45176512A>G" "" "benign" ""
"0000552573" "0" "10" "14" "45645715" "45645715" "subst" "0.0253811" "02329" "FANCM_000043" "g.45645715A>G" "" "" "" "FANCM(NM_001308133.1):c.3680A>G (p.(Asn1227Ser)), FANCM(NM_020937.4):c.3758A>G (p.N1253S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45176512A>G" "" "benign" ""
"0000552574" "0" "10" "14" "45658024" "45658024" "subst" "0.0177924" "01804" "FANCM_000021" "g.45658024C>T" "" "" "" "FANCM(NM_001308133.1):c.4721C>T (p.(Thr1574Ile)), FANCM(NM_020937.2):c.4799C>T (p.T1600I), FANCM(NM_020937.4):c.4799C>T (p.T1600I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45188821C>T" "" "benign" ""
"0000552575" "0" "30" "14" "45658449" "45658449" "subst" "0.00860063" "01804" "FANCM_000030" "g.45658449A>G" "" "" "" "FANCM(NM_001308133.1):c.5146A>G (p.(Ile1716Val)), FANCM(NM_020937.4):c.5224A>G (p.I1742V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45189246A>G" "" "likely benign" ""
"0000552576" "0" "10" "14" "45665661" "45665661" "subst" "0.0213866" "01804" "FANCM_000025" "g.45665661A>G" "" "" "" "FANCM(NM_001308133.1):c.5549A>G (p.(Asn1850Ser)), FANCM(NM_020937.4):c.5627A>G (p.N1876S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45196458A>G" "" "benign" ""
"0000552577" "0" "30" "14" "45667870" "45667870" "subst" "0" "01804" "FANCM_000045" "g.45667870A>G" "" "" "" "FANCM(NM_020937.2):c.5740A>G (p.(Arg1914Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45198667A>G" "" "likely benign" ""
"0000552579" "0" "10" "14" "45669205" "45669205" "subst" "0.013774" "02329" "FANCM_000047" "g.45669205T>C" "" "" "" "FANCM(NM_001308133.1):c.6063T>C (p.(Asp2021=)), FANCM(NM_020937.4):c.6141T>C (p.D2047=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45200002T>C" "" "benign" ""
"0000578048" "0" "50" "14" "45658326" "45658326" "subst" "0.00128864" "01474" "FANCM_000023" "g.45658326C>T" "" "{PMID:Lhota 2016:26822949}" "" "" "" "Germline" "" "rs147021911" "0" "" "" "g.45189123C>T" "" "VUS" ""
"0000578064" "0" "50" "14" "45658326" "45658326" "subst" "0.00128864" "01474" "FANCM_000023" "g.45658326C>T" "" "{PMID:Lhota 2016:26822949}" "" "" "" "Germline" "" "rs147021911" "0" "" "" "g.45189123C>T" "" "VUS" ""
"0000578100" "0" "50" "14" "45645936" "45645937" "del" "8.15116E-6" "01474" "FANCM_000044" "g.45645936_45645937del" "" "{PMID:Lhota 2016:26822949}" "" "3979_3980delCA" "" "Germline" "" "" "0" "" "" "g.45176733_45176734del" "" "VUS" ""
"0000578120" "0" "50" "14" "45636336" "45636336" "subst" "8.13286E-5" "01474" "FANCM_000003" "g.45636336C>T" "" "{PMID:Lhota 2016:26822949}" "" "" "" "Germline" "" "" "0" "" "" "g.45167133C>T" "" "VUS" ""
"0000578143" "0" "50" "14" "45667921" "45667921" "subst" "0.00102796" "01474" "FANCM_000004" "g.45667921C>T" "" "{PMID:Lhota 2016:26822949}" "" "" "" "Germline" "" "rs144567652" "0" "" "" "g.45198718C>T" "" "VUS" ""
"0000592106" "3" "90" "14" "45628408" "45628409" "ins" "4.06263E-6" "00006" "FANCM_000048" "g.45628408_45628409insTA" "" "{PMID:Bogliolo 2018:28837157}, {DOI:Bogliolo 2018:10.1038/gim.2017.124}" "" "" "" "Germline" "yes" "" "0" "" "" "g.45159205_45159206insTA" "" "pathogenic (recessive)" ""
"0000592107" "3" "90" "14" "45644543" "45644546" "del" "0" "00006" "FANCM_000049" "g.45644543_45644546del" "" "{PMID:Bogliolo 2018:28837157}, {DOI:Bogliolo 2018:10.1038/gim.2017.124}" "" "2586_2589del4" "" "Germline" "" "" "0" "" "" "g.45175340_45175343del" "" "pathogenic (recessive)" ""
"0000592108" "3" "90" "14" "45636336" "45636336" "subst" "8.13286E-5" "00006" "FANCM_000003" "g.45636336C>T" "" "{PMID:Catucci 2018:28837162}" "" "" "" "Germline" "" "rs368728266" "0" "" "" "g.45167133C>T" "" "pathogenic (recessive)" ""
"0000592109" "3" "90" "14" "45636336" "45636336" "subst" "8.13286E-5" "00006" "FANCM_000003" "g.45636336C>T" "" "{PMID:Catucci 2018:28837162}" "" "" "" "Germline" "" "rs368728266" "0" "" "" "g.45167133C>T" "" "pathogenic (recessive)" ""
"0000592110" "3" "90" "14" "45658326" "45658326" "subst" "0.00128864" "00006" "FANCM_000023" "g.45658326C>T" "" "{PMID:Catucci 2018:28837162}" "" "" "" "Germline" "" "rs147021911" "0" "" "" "g.45189123C>T" "" "pathogenic (recessive)" ""
"0000592111" "3" "90" "14" "45658326" "45658326" "subst" "0.00128864" "00006" "FANCM_000023" "g.45658326C>T" "" "{PMID:Catucci 2018:28837162}" "" "" "" "Germline" "" "rs147021911" "0" "" "" "g.45189123C>T" "" "pathogenic (recessive)" ""
"0000592112" "3" "90" "14" "45667921" "45667921" "subst" "0.00102796" "00006" "FANCM_000004" "g.45667921C>T" "" "{PMID:Catucci 2018:28837162}" "" "" "" "Germline" "" "rs144567652" "0" "" "" "g.45198718C>T" "" "pathogenic (recessive)" ""
"0000592115" "21" "90" "14" "45628393" "45628393" "dup" "0" "00006" "FANCM_000050" "g.45628393dup" "" "{PMID:Kasak 2009:30075111}" "" "1491dupA" "" "Germline" "yes" "" "0" "" "" "g.45159190dup" "" "pathogenic (recessive)" ""
"0000592116" "11" "90" "14" "45652967" "45652967" "subst" "0" "00006" "FANCM_000051" "g.45652967A>G" "" "{PMID:Kasak 2009:30075111}" "" "" "" "Germline" "yes" "" "0" "" "" "g.45183764A>G" "" "pathogenic (recessive)" ""
"0000592118" "3" "90" "14" "45658326" "45658326" "subst" "0.00128864" "00006" "FANCM_000023" "g.45658326C>T" "" "{PMID:Kasak 2009:30075111}" "" "" "" "Germline" "" "rs147021911" "0" "" "" "g.45189123C>T" "" "pathogenic (recessive)" ""
"0000592119" "3" "90" "14" "45667921" "45667921" "subst" "0.00102796" "00006" "FANCM_000004" "g.45667921C>T" "" "{PMID:Kasak 2009:30075111}" "" "" "" "Germline" "" "rs144567652" "0" "" "" "g.45198718C>T" "" "pathogenic (recessive)" ""
"0000592122" "3" "90" "14" "45636310" "45636322" "del" "0" "00006" "FANCM_000052" "g.45636310_45636322del" "" "{PMID:Yin 2019:29895858}" "" "" "" "Germline" "yes" "" "0" "" "" "g.45167107_45167119del" "" "pathogenic (recessive)" ""
"0000592124" "3" "90" "14" "45658326" "45658326" "subst" "0.00128864" "00006" "FANCM_000023" "g.45658326C>T" "" "{PMID:Fouquet 2017:29231814}" "" "" "" "Germline" "yes" "" "0" "" "" "g.45189123C>T" "" "pathogenic (recessive)" ""
"0000647115" "0" "50" "14" "45667921" "45667921" "subst" "0.00102796" "01164" "FANCM_000004" "g.45667921C>T" "" "" "" "" "ACMG: PS1,PM2,PP5; Peterlongo et al. 2015. Hum Mol Genet 24: 5345; Lhota et al. 2016. Clin Genet 90: 324; Easton et al. 2015. N Engl J Med 372: 2243" "Germline" "" "rs144567652" "0" "" "" "g.45198718C>T" "" "VUS" "ACMG"
"0000648891" "1" "50" "14" "45605413" "45605413" "subst" "4.06075E-5" "03575" "FANCM_000053" "g.45605413C>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs200717151}" "Germline" "" "rs200717151" "0" "" "" "g.45136210C>A" "" "VUS" ""
"0000648892" "1" "10" "14" "45606387" "45606387" "subst" "0.010232" "03575" "FANCM_000011" "g.45606387A>G" "46/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "46 heterozygous; {DB:CLININrs45547534}" "Germline" "" "rs45547534" "0" "" "" "g.45137184A>G" "" "benign" ""
"0000648893" "1" "50" "14" "45623938" "45623938" "subst" "5.71088E-5" "03575" "FANCM_000054" "g.45623938G>C" "1/2779 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs199929558}" "Germline" "" "rs199929558" "0" "" "" "g.45154735G>C" "" "VUS" ""
"0000648894" "1" "50" "14" "45636328" "45636328" "subst" "0.0106565" "03575" "FANCM_000015" "g.45636328A>G" "28/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 28 heterozygous, no homozygous; {DB:CLININrs61753893}" "Germline" "" "rs61753893" "0" "" "" "g.45167125A>G" "" "VUS" ""
"0000648895" "1" "50" "14" "45644953" "45644953" "subst" "0.000273858" "03575" "FANCM_000055" "g.45644953C>T" "6/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "6 heterozygous, no homozygous; {DB:CLININrs148304968}" "Germline" "" "rs148304968" "0" "" "" "g.45175750C>T" "" "VUS" ""
"0000648896" "1" "30" "14" "45645715" "45645715" "subst" "0.0253811" "03575" "FANCM_000043" "g.45645715A>G" "224/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "224 heterozygous; {DB:CLININrs45604036}" "Germline" "" "rs45604036" "0" "" "" "g.45176512A>G" "" "likely benign" ""
"0000648897" "1" "30" "14" "45658024" "45658024" "subst" "0.0177924" "03575" "FANCM_000021" "g.45658024C>T" "9/2791 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "9 heterozygous, no homozygous; {DB:CLININrs61746943}" "Germline" "" "rs61746943" "0" "" "" "g.45188821C>T" "" "likely benign" ""
"0000648898" "1" "30" "14" "45658156" "45658156" "subst" "0.00163973" "03575" "FANCM_000056" "g.45658156G>A" "26/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "26 heterozygous; {DB:CLININrs138151018}" "Germline" "" "rs138151018" "0" "" "" "g.45188953G>A" "" "likely benign" ""
"0000648899" "1" "50" "14" "45658449" "45658449" "subst" "0.00860063" "03575" "FANCM_000030" "g.45658449A>G" "14/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 14 heterozygous, no homozygous; {DB:CLININrs143662421}" "Germline" "" "rs143662421" "0" "" "" "g.45189246A>G" "" "VUS" ""
"0000648900" "1" "50" "14" "45665603" "45665603" "subst" "0.000446744" "03575" "FANCM_000057" "g.45665603G>A" "4/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "4 heterozygous, no homozygous; {DB:CLININrs144008013}" "Germline" "" "rs144008013" "0" "" "" "g.45196400G>A" "" "VUS" ""
"0000648901" "1" "30" "14" "45665661" "45665661" "subst" "0.0213866" "03575" "FANCM_000025" "g.45665661A>G" "45/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "45 heterozygous, no homozygous; {DB:CLININrs45557033}" "Germline" "" "rs45557033" "0" "" "" "g.45196458A>G" "" "likely benign" ""
"0000657442" "0" "30" "14" "45623953" "45623953" "subst" "0.000692724" "01804" "FANCM_000012" "g.45623953T>C" "" "" "" "FANCM(NM_020937.2):c.1237T>C (p.Y413H, p.(Tyr413His)), FANCM(NM_020937.4):c.1237T>C (p.Y413H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45154750T>C" "" "likely benign" ""
"0000657443" "0" "30" "14" "45645784" "45645784" "subst" "5.83124E-5" "01943" "FANCM_000058" "g.45645784C>T" "" "" "" "FANCM(NM_020937.2):c.3827C>T (p.S1276L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45176581C>T" "" "likely benign" ""
"0000657444" "0" "30" "14" "45658342" "45658342" "subst" "2.84504E-5" "01943" "FANCM_000059" "g.45658342A>C" "" "" "" "FANCM(NM_020937.2):c.5117A>C (p.N1706T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45189139A>C" "" "likely benign" ""
"0000669243" "3" "10" "14" "45606387" "45606387" "subst" "0.010232" "03575" "FANCM_000011" "g.45606387A>G" "2/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs45547534}" "Germline" "" "rs45547534" "0" "" "" "g.45137184A>G" "" "benign" ""
"0000669244" "3" "30" "14" "45645715" "45645715" "subst" "0.0253811" "03575" "FANCM_000043" "g.45645715A>G" "7/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "7 homozygous; {DB:CLININrs45604036}" "Germline" "" "rs45604036" "0" "" "" "g.45176512A>G" "" "likely benign" ""
"0000669245" "3" "30" "14" "45658156" "45658156" "subst" "0.00163973" "03575" "FANCM_000056" "g.45658156G>A" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs138151018}" "Germline" "" "rs138151018" "0" "" "" "g.45188953G>A" "" "likely benign" ""
"0000679973" "0" "90" "14" "45605574" "45605574" "subst" "4.06062E-6" "02327" "FANCM_000060" "g.45605574G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000679974" "0" "50" "14" "45623953" "45623953" "subst" "0.000692724" "01943" "FANCM_000012" "g.45623953T>C" "" "" "" "FANCM(NM_020937.2):c.1237T>C (p.Y413H, p.(Tyr413His)), FANCM(NM_020937.4):c.1237T>C (p.Y413H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000679975" "0" "10" "14" "45645504" "45645504" "subst" "0.000695444" "01804" "FANCM_000061" "g.45645504T>C" "" "" "" "FANCM(NM_020937.2):c.3547T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000679976" "0" "30" "14" "45646186" "45646186" "subst" "0.000674572" "01804" "FANCM_000062" "g.45646186T>G" "" "" "" "FANCM(NM_020937.2):c.4222+7T>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000679977" "0" "10" "14" "45658024" "45658024" "subst" "0.0177924" "01943" "FANCM_000021" "g.45658024C>T" "" "" "" "FANCM(NM_001308133.1):c.4721C>T (p.(Thr1574Ile)), FANCM(NM_020937.2):c.4799C>T (p.T1600I), FANCM(NM_020937.4):c.4799C>T (p.T1600I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000679978" "0" "50" "14" "45658090" "45658092" "del" "0" "01943" "FANCM_000063" "g.45658090_45658092del" "" "" "" "FANCM(NM_020937.2):c.4865_4867delAAG (p.E1622del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000679979" "0" "30" "14" "45658292" "45658292" "subst" "0.000248048" "01943" "FANCM_000064" "g.45658292G>A" "" "" "" "FANCM(NM_020937.2):c.5067G>A (p.A1689=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724767" "0" "30" "14" "45605327" "45605327" "subst" "2.44157E-5" "01943" "FANCM_000065" "g.45605327A>G" "" "" "" "FANCM(NM_020937.2):c.93A>G (p.R31=), FANCM(NM_020937.4):c.93A>G (p.R31=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724768" "0" "30" "14" "45644383" "45644383" "subst" "1.22175E-5" "01943" "FANCM_000066" "g.45644383T>G" "" "" "" "FANCM(NM_020937.2):c.2426T>G (p.F809C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724769" "0" "30" "14" "45645069" "45645069" "subst" "1.22463E-5" "01943" "FANCM_000067" "g.45645069C>T" "" "" "" "FANCM(NM_020937.2):c.3112C>T (p.L1038=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724770" "0" "30" "14" "45645949" "45645949" "subst" "0.000106728" "01943" "FANCM_000068" "g.45645949C>T" "" "" "" "FANCM(NM_020937.2):c.3992C>T (p.P1331L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000724771" "0" "90" "14" "45667921" "45667921" "subst" "0.00102796" "02325" "FANCM_000004" "g.45667921C>T" "" "" "" "FANCM(NM_020937.4):c.5791C>T (p.R1931*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000724772" "0" "10" "14" "45669205" "45669205" "subst" "0.013774" "01804" "FANCM_000047" "g.45669205T>C" "" "" "" "FANCM(NM_001308133.1):c.6063T>C (p.(Asp2021=)), FANCM(NM_020937.4):c.6141T>C (p.D2047=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000737035" "1" "50" "14" "45606395" "45606399" "del" "0" "04020" "FANCM_000181" "g.45606395_45606399del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606391_TGTTTA_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737036" "1" "50" "14" "45620654" "45620654" "del" "0" "04020" "FANCM_000239" "g.45620654del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620651_AG_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737037" "1" "50" "14" "45624612" "45624612" "del" "0" "04020" "FANCM_000319" "g.45624612del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624609_CA_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737038" "1" "50" "14" "45633571" "45633572" "del" "0" "04020" "FANCM_000376" "g.45633571_45633572del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633569_AAC_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737039" "1" "50" "14" "45642298" "45642299" "del" "0" "04020" "FANCM_000489" "g.45642298_45642299del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642287_ACT_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737040" "1" "50" "14" "45644561" "45644561" "del" "0" "04020" "FANCM_000563" "g.45644561del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644555_TA_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737041" "1" "50" "14" "45645073" "45645085" "del" "0" "04020" "FANCM_000654" "g.45645073_45645085del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645067_TGCTGTCACATTCA_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737042" "1" "50" "14" "45645916" "45645926" "del" "0" "04020" "FANCM_000812" "g.45645916_45645926del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645914_ATTGTTATCTCC_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737043" "1" "50" "14" "45646134" "45646134" "del" "0" "04020" "FANCM_000850" "g.45646134del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646130_TA_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737044" "1" "50" "14" "45653011" "45653032" "del" "0" "04020" "FANCM_000923" "g.45653011_45653032del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653006_GAATTTTCCCAAACCATGTTCAC_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737045" "1" "50" "14" "45657091" "45657091" "del" "0" "04020" "FANCM_001004" "g.45657091del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657089_AG_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737046" "1" "50" "14" "45658273" "45658277" "del" "0" "04020" "FANCM_001044" "g.45658273_45658277del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658271_TAAAAG_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737047" "1" "50" "14" "45667876" "45667877" "del" "0" "04020" "FANCM_001169" "g.45667876_45667877del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667874_CAA_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737167" "1" "50" "14" "45653065" "45653075" "del" "0" "04020" "FANCM_000935" "g.45653065_45653075del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653064_AGAAGAGGCATC_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737168" "1" "50" "14" "45639943" "45639945" "delins" "0" "04020" "FANCM_000476" "g.45639943_45639945delinsAT" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639943_CAA_AT" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737170" "1" "50" "14" "45645936" "45645937" "del" "8.15116E-6" "04020" "FANCM_000044" "g.45645936_45645937del" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645935_TCA_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737171" "1" "50" "14" "45639930" "45639931" "delins" "0" "04020" "FANCM_000469" "g.45639930_45639931delinsGG" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639930_AA_GG" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737172" "1" "50" "14" "45639901" "45639901" "del" "0" "04020" "FANCM_000465" "g.45639901del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639900_CA_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737173" "1" "50" "14" "45644547" "45644547" "del" "0" "04020" "FANCM_000559" "g.45644547del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644546_AG_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000737174" "1" "50" "14" "45654441" "45654441" "del" "0" "04020" "FANCM_000956" "g.45654441del" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654440_AG_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739574" "1" "50" "14" "45605235" "45605235" "subst" "4.12872E-6" "04020" "FANCM_000069" "g.45605235A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605235_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739575" "1" "50" "14" "45605242" "45605242" "subst" "0" "04020" "FANCM_000070" "g.45605242G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605242_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739576" "1" "50" "14" "45605251" "45605251" "subst" "0" "04020" "FANCM_000072" "g.45605251G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605251_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739577" "1" "50" "14" "45605257" "45605257" "subst" "4.1111E-6" "04020" "FANCM_000073" "g.45605257T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605257_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739578" "1" "50" "14" "45605257" "45605257" "subst" "0" "04020" "FANCM_000074" "g.45605257T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605257_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739579" "1" "50" "14" "45605310" "45605310" "subst" "0" "04020" "FANCM_000084" "g.45605310A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605310_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739580" "1" "50" "14" "45605311" "45605311" "subst" "0" "04020" "FANCM_000085" "g.45605311G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605311_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739581" "1" "50" "14" "45605320" "45605320" "subst" "4.07163E-6" "04020" "FANCM_000087" "g.45605320C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605320_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739582" "1" "50" "14" "45605322" "45605322" "subst" "4.07123E-6" "04020" "FANCM_000088" "g.45605322G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605322_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739583" "1" "50" "14" "45605325" "45605325" "subst" "0" "04020" "FANCM_000089" "g.45605325C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605325_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739584" "1" "50" "14" "45605326" "45605326" "subst" "4.06961E-6" "04020" "FANCM_000090" "g.45605326G>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605326_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739585" "1" "50" "14" "45605329" "45605329" "subst" "0" "04020" "FANCM_000091" "g.45605329C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605329_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739586" "1" "50" "14" "45605344" "45605344" "subst" "0" "04020" "FANCM_000094" "g.45605344G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605344_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739587" "1" "50" "14" "45605356" "45605356" "subst" "6.91057E-5" "04020" "FANCM_000095" "g.45605356C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605356_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739588" "1" "50" "14" "45605394" "45605394" "subst" "0" "04020" "FANCM_000102" "g.45605394G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605394_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739589" "1" "50" "14" "45605400" "45605400" "subst" "0" "04020" "FANCM_000104" "g.45605400G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605400_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739590" "1" "50" "14" "45605415" "45605415" "subst" "0" "04020" "FANCM_000106" "g.45605415G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605415_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739591" "1" "50" "14" "45605438" "45605438" "subst" "0" "04020" "FANCM_000110" "g.45605438G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605438_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739592" "1" "50" "14" "45605488" "45605488" "subst" "0" "04020" "FANCM_000115" "g.45605488A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605488_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739593" "1" "50" "14" "45605494" "45605494" "subst" "4.06062E-6" "04020" "FANCM_000116" "g.45605494C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605494_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739594" "1" "50" "14" "45605509" "45605509" "subst" "0" "04020" "FANCM_000121" "g.45605509G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605509_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739595" "1" "50" "14" "45605535" "45605535" "subst" "0" "04020" "FANCM_000124" "g.45605535G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605535_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739596" "1" "50" "14" "45605593" "45605593" "subst" "4.06088E-6" "04020" "FANCM_000132" "g.45605593T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605593_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739597" "1" "50" "14" "45605608" "45605608" "subst" "4.06121E-6" "04020" "FANCM_000134" "g.45605608T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605608_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739598" "1" "50" "14" "45605610" "45605610" "subst" "0" "04020" "FANCM_000135" "g.45605610T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605610_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739599" "1" "50" "14" "45605614" "45605614" "subst" "8.12295E-6" "04020" "FANCM_000136" "g.45605614A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605614_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739600" "1" "50" "14" "45605616" "45605616" "subst" "0" "04020" "FANCM_000137" "g.45605616T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605616_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739601" "1" "50" "14" "45605618" "45605618" "subst" "0" "04020" "FANCM_000138" "g.45605618C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605618_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739602" "1" "50" "14" "45605623" "45605623" "subst" "4.06194E-6" "04020" "FANCM_000140" "g.45605623G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605623_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739603" "1" "50" "14" "45605632" "45605632" "subst" "4.06319E-6" "04020" "FANCM_000143" "g.45605632C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605632_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739604" "1" "50" "14" "45605641" "45605641" "subst" "0" "04020" "FANCM_000144" "g.45605641A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605641_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739605" "1" "50" "14" "45605665" "45605665" "subst" "0" "04020" "FANCM_000149" "g.45605665A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605665_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739606" "1" "50" "14" "45605700" "45605700" "subst" "0" "04020" "FANCM_000152" "g.45605700C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605700_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739607" "1" "50" "14" "45605706" "45605706" "subst" "0" "04020" "FANCM_000153" "g.45605706A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605706_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739608" "1" "50" "14" "45605712" "45605712" "subst" "0" "04020" "FANCM_000154" "g.45605712A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605712_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739609" "1" "50" "14" "45605727" "45605727" "subst" "8.19907E-6" "04020" "FANCM_000156" "g.45605727A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605727_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739610" "1" "50" "14" "45605731" "45605731" "subst" "1.23048E-5" "04020" "FANCM_000158" "g.45605731C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605731_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739611" "1" "50" "14" "45605736" "45605736" "subst" "0" "04020" "FANCM_000160" "g.45605736A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605736_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739612" "1" "50" "14" "45605740" "45605740" "subst" "4.10705E-6" "04020" "FANCM_000161" "g.45605740C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605740_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739613" "1" "50" "14" "45606284" "45606284" "subst" "0" "04020" "FANCM_000162" "g.45606284C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606284_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739614" "1" "50" "14" "45606315" "45606315" "subst" "0" "04020" "FANCM_000169" "g.45606315G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606315_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739615" "1" "50" "14" "45606359" "45606359" "subst" "0" "04020" "FANCM_000174" "g.45606359C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606359_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739616" "1" "50" "14" "45606361" "45606361" "subst" "4.06365E-6" "04020" "FANCM_000175" "g.45606361A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606361_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739617" "1" "50" "14" "45606364" "45606364" "subst" "8.53416E-5" "04020" "FANCM_000176" "g.45606364G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606364_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739618" "1" "50" "14" "45606368" "45606368" "subst" "0" "04020" "FANCM_000177" "g.45606368C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606368_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739619" "1" "50" "14" "45606383" "45606383" "subst" "0" "04020" "FANCM_000179" "g.45606383A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606383_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739620" "1" "50" "14" "45606409" "45606409" "subst" "0" "04020" "FANCM_000183" "g.45606409G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606409_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739621" "1" "50" "14" "45606425" "45606425" "subst" "0" "04020" "FANCM_000185" "g.45606425G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606425_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739622" "1" "50" "14" "45606430" "45606430" "subst" "0" "04020" "FANCM_000188" "g.45606430T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606430_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739623" "1" "50" "14" "45609853" "45609853" "subst" "0" "04020" "FANCM_000189" "g.45609853A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609853_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739624" "1" "50" "14" "45609868" "45609868" "subst" "0" "04020" "FANCM_000193" "g.45609868T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609868_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739625" "1" "50" "14" "45609892" "45609892" "subst" "0" "04020" "FANCM_000195" "g.45609892A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609892_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739626" "1" "50" "14" "45609901" "45609901" "subst" "0" "04020" "FANCM_000196" "g.45609901A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609901_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739627" "1" "50" "14" "45609904" "45609904" "subst" "0" "04020" "FANCM_000198" "g.45609904G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609904_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739628" "1" "50" "14" "45618040" "45618040" "subst" "1.62635E-5" "04020" "FANCM_000200" "g.45618040G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618040_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739629" "1" "50" "14" "45618043" "45618043" "subst" "0" "04020" "FANCM_000201" "g.45618043G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618043_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739630" "1" "50" "14" "45618109" "45618109" "subst" "0" "04020" "FANCM_000212" "g.45618109A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618109_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739631" "1" "50" "14" "45618115" "45618115" "subst" "0" "04020" "FANCM_000213" "g.45618115A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618115_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739632" "1" "50" "14" "45618125" "45618125" "subst" "8.12486E-6" "04020" "FANCM_000215" "g.45618125A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618125_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739633" "1" "50" "14" "45618139" "45618139" "subst" "0" "04020" "FANCM_000217" "g.45618139G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618139_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739634" "1" "50" "14" "45618186" "45618186" "subst" "1.62533E-5" "04020" "FANCM_000227" "g.45618186G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618186_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739635" "1" "50" "14" "45618188" "45618188" "subst" "4.06382E-6" "04020" "FANCM_000228" "g.45618188C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618188_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739636" "1" "50" "14" "45620607" "45620607" "subst" "0.000158689" "04020" "FANCM_000231" "g.45620607A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620607_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739637" "1" "50" "14" "45620609" "45620609" "subst" "0" "04020" "FANCM_000232" "g.45620609T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620609_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739638" "1" "50" "14" "45620645" "45620645" "subst" "0" "04020" "FANCM_000238" "g.45620645A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620645_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739639" "1" "50" "14" "45620663" "45620663" "subst" "0" "04020" "FANCM_000242" "g.45620663A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620663_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739640" "1" "50" "14" "45620702" "45620702" "subst" "1.21915E-5" "04020" "FANCM_000246" "g.45620702T>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620702_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739641" "1" "50" "14" "45620709" "45620709" "subst" "0" "04020" "FANCM_000247" "g.45620709A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620709_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739642" "1" "50" "14" "45620713" "45620713" "subst" "1.21931E-5" "04020" "FANCM_000248" "g.45620713C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620713_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739643" "1" "50" "14" "45620715" "45620715" "subst" "0" "04020" "FANCM_000249" "g.45620715C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620715_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739644" "1" "50" "14" "45620721" "45620721" "subst" "0" "04020" "FANCM_000250" "g.45620721C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620721_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739645" "1" "50" "14" "45623172" "45623172" "subst" "4.06293E-6" "04020" "FANCM_000258" "g.45623172T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623172_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739646" "1" "50" "14" "45623187" "45623187" "subst" "4.06283E-6" "04020" "FANCM_000259" "g.45623187A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623187_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739647" "1" "50" "14" "45623195" "45623195" "subst" "0" "04020" "FANCM_000260" "g.45623195C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623195_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739648" "1" "50" "14" "45623210" "45623210" "subst" "0" "04020" "FANCM_000265" "g.45623210A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623210_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739649" "1" "50" "14" "45623234" "45623234" "subst" "4.06455E-6" "04020" "FANCM_000268" "g.45623234G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623234_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739650" "1" "50" "14" "45623237" "45623237" "subst" "0" "04020" "FANCM_000269" "g.45623237A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623237_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739651" "1" "50" "14" "45623250" "45623250" "subst" "0" "04020" "FANCM_000270" "g.45623250C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623250_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739652" "1" "50" "14" "45623256" "45623256" "subst" "0" "04020" "FANCM_000271" "g.45623256G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623256_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739653" "1" "50" "14" "45623906" "45623906" "subst" "0" "04020" "FANCM_000273" "g.45623906C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623906_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739654" "1" "50" "14" "45623915" "45623915" "subst" "0" "04020" "FANCM_000278" "g.45623915A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623915_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739655" "1" "50" "14" "45623920" "45623920" "subst" "0" "04020" "FANCM_000280" "g.45623920G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623920_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739656" "1" "50" "14" "45623927" "45623927" "subst" "0" "04020" "FANCM_000281" "g.45623927G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623927_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739657" "1" "50" "14" "45623936" "45623936" "subst" "0" "04020" "FANCM_000282" "g.45623936A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623936_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739658" "1" "50" "14" "45623939" "45623939" "subst" "0" "04020" "FANCM_000283" "g.45623939A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623939_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739659" "1" "50" "14" "45623963" "45623963" "subst" "0" "04020" "FANCM_000289" "g.45623963T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623963_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739660" "1" "50" "14" "45623971" "45623971" "subst" "0" "04020" "FANCM_000291" "g.45623971A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623971_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739661" "1" "50" "14" "45623978" "45623978" "subst" "0" "04020" "FANCM_000294" "g.45623978C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623978_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739662" "1" "50" "14" "45623981" "45623981" "subst" "0" "04020" "FANCM_000296" "g.45623981G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623981_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739663" "1" "50" "14" "45623995" "45623995" "subst" "8.15129E-6" "04020" "FANCM_000300" "g.45623995T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623995_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739664" "1" "50" "14" "45623995" "45623995" "subst" "0" "04020" "FANCM_000301" "g.45623995T>G" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623995_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739665" "1" "50" "14" "45623998" "45623998" "subst" "4.07621E-6" "04020" "FANCM_000302" "g.45623998G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623998_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739666" "1" "50" "14" "45624013" "45624013" "subst" "0" "04020" "FANCM_000304" "g.45624013G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624013_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739667" "1" "50" "14" "45624025" "45624025" "subst" "0" "04020" "FANCM_000308" "g.45624025G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624025_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739668" "1" "50" "14" "45624574" "45624574" "subst" "0" "04020" "FANCM_000309" "g.45624574A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624574_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739669" "1" "50" "14" "45624594" "45624594" "subst" "0" "04020" "FANCM_000315" "g.45624594T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624594_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739670" "1" "50" "14" "45624602" "45624602" "subst" "0" "04020" "FANCM_000318" "g.45624602A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624602_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739671" "1" "50" "14" "45624612" "45624612" "subst" "0" "04020" "FANCM_000320" "g.45624612A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624612_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739672" "1" "50" "14" "45624617" "45624617" "subst" "0" "04020" "FANCM_000321" "g.45624617A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624617_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739673" "1" "50" "14" "45624619" "45624619" "subst" "4.07203E-6" "04020" "FANCM_000323" "g.45624619G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624619_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739674" "1" "50" "14" "45624626" "45624626" "subst" "0" "04020" "FANCM_000326" "g.45624626G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624626_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739675" "1" "50" "14" "45624633" "45624633" "subst" "0" "04020" "FANCM_000329" "g.45624633T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624633_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739676" "1" "50" "14" "45624639" "45624639" "subst" "2.84627E-5" "04020" "FANCM_000330" "g.45624639T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624639_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739677" "1" "50" "14" "45624644" "45624644" "subst" "4.06742E-6" "04020" "FANCM_000332" "g.45624644C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624644_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739678" "1" "50" "14" "45628297" "45628297" "subst" "0" "04020" "FANCM_000339" "g.45628297A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628297_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739679" "1" "50" "14" "45628308" "45628308" "subst" "0" "04020" "FANCM_000343" "g.45628308C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628308_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739680" "1" "50" "14" "45628310" "45628310" "subst" "0" "04020" "FANCM_000344" "g.45628310A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628310_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739681" "1" "50" "14" "45628322" "45628322" "subst" "1.63981E-5" "04020" "FANCM_000349" "g.45628322C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628322_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739682" "1" "50" "14" "45628325" "45628325" "subst" "0" "04020" "FANCM_000351" "g.45628325G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628325_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739683" "1" "50" "14" "45628341" "45628341" "subst" "0" "04020" "FANCM_000355" "g.45628341T>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628341_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739684" "1" "50" "14" "45628346" "45628346" "subst" "0" "04020" "FANCM_000356" "g.45628346T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628346_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739685" "1" "50" "14" "45628355" "45628355" "subst" "0" "04020" "FANCM_000357" "g.45628355T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628355_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739686" "1" "50" "14" "45628365" "45628365" "subst" "4.06616E-6" "04020" "FANCM_000360" "g.45628365G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628365_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739687" "1" "50" "14" "45628434" "45628434" "subst" "0" "04020" "FANCM_000366" "g.45628434A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628434_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739688" "1" "50" "14" "45628445" "45628445" "subst" "0" "04020" "FANCM_000367" "g.45628445A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628445_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739689" "1" "50" "14" "45628448" "45628448" "subst" "0" "04020" "FANCM_000370" "g.45628448A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628448_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739690" "1" "50" "14" "45628452" "45628452" "subst" "0" "04020" "FANCM_000371" "g.45628452C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628452_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739691" "1" "50" "14" "45628469" "45628469" "subst" "0" "04020" "FANCM_000373" "g.45628469A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628469_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739692" "1" "50" "14" "45633581" "45633581" "subst" "0" "04020" "FANCM_000380" "g.45633581A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633581_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739693" "1" "50" "14" "45633634" "45633634" "subst" "0" "04020" "FANCM_000386" "g.45633634A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633634_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739694" "1" "50" "14" "45633654" "45633654" "subst" "0" "04020" "FANCM_000389" "g.45633654A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633654_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739695" "1" "50" "14" "45633658" "45633658" "subst" "0" "04020" "FANCM_000390" "g.45633658T>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633658_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739696" "1" "50" "14" "45633703" "45633703" "subst" "0" "04020" "FANCM_000397" "g.45633703G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633703_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739697" "1" "50" "14" "45633722" "45633722" "subst" "2.43881E-5" "04020" "FANCM_000401" "g.45633722G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633722_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739698" "1" "50" "14" "45633757" "45633757" "subst" "0" "04020" "FANCM_000405" "g.45633757C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633757_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739699" "1" "50" "14" "45633758" "45633758" "subst" "0" "04020" "FANCM_000407" "g.45633758G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633758_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739700" "1" "50" "14" "45633762" "45633762" "subst" "0" "04020" "FANCM_000408" "g.45633762G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633762_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739701" "1" "50" "14" "45633763" "45633763" "subst" "4.15521E-6" "04020" "FANCM_000409" "g.45633763G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633763_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739702" "1" "50" "14" "45633766" "45633766" "subst" "1.25391E-5" "04020" "FANCM_000411" "g.45633766C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633766_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739703" "1" "50" "14" "45636159" "45636159" "subst" "0" "04020" "FANCM_000413" "g.45636159A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636159_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739704" "1" "50" "14" "45636180" "45636180" "subst" "0" "04020" "FANCM_000417" "g.45636180A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636180_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739705" "1" "50" "14" "45636186" "45636186" "subst" "8.13001E-6" "04020" "FANCM_000418" "g.45636186A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636186_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739706" "1" "50" "14" "45636216" "45636216" "subst" "0" "04020" "FANCM_000424" "g.45636216G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636216_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739707" "1" "50" "14" "45636243" "45636243" "subst" "8.12876E-6" "04020" "FANCM_000428" "g.45636243C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636243_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739708" "1" "50" "14" "45636248" "45636248" "subst" "0" "04020" "FANCM_000431" "g.45636248G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636248_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739709" "1" "50" "14" "45636279" "45636279" "subst" "1.62562E-5" "04020" "FANCM_000433" "g.45636279A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636279_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739710" "1" "50" "14" "45636283" "45636283" "subst" "0" "04020" "FANCM_000435" "g.45636283T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636283_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739711" "1" "50" "14" "45636285" "45636285" "subst" "0" "04020" "FANCM_000436" "g.45636285T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636285_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739712" "1" "50" "14" "45636298" "45636298" "subst" "0" "04020" "FANCM_000439" "g.45636298G>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636298_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739713" "1" "50" "14" "45636325" "45636325" "subst" "8.132E-6" "04020" "FANCM_000446" "g.45636325G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636325_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739714" "1" "50" "14" "45636358" "45636358" "subst" "2.03494E-5" "04020" "FANCM_000449" "g.45636358A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636358_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739715" "1" "50" "14" "45639813" "45639813" "subst" "0" "04020" "FANCM_000452" "g.45639813A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639813_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739716" "1" "50" "14" "45639818" "45639818" "subst" "0" "04020" "FANCM_000453" "g.45639818G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639818_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739717" "1" "50" "14" "45639822" "45639822" "subst" "0" "04020" "FANCM_000454" "g.45639822G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639822_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739718" "1" "50" "14" "45639824" "45639824" "subst" "0" "04020" "FANCM_000455" "g.45639824T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639824_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739719" "1" "50" "14" "45639851" "45639851" "subst" "0" "04020" "FANCM_000459" "g.45639851T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639851_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739720" "1" "50" "14" "45639873" "45639873" "subst" "0" "04020" "FANCM_000460" "g.45639873G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639873_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739721" "1" "50" "14" "45639874" "45639874" "subst" "0" "04020" "FANCM_000461" "g.45639874G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639874_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739722" "1" "50" "14" "45639879" "45639879" "subst" "0" "04020" "FANCM_000463" "g.45639879G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639879_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739723" "1" "50" "14" "45639915" "45639915" "subst" "0" "04020" "FANCM_000466" "g.45639915A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639915_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739724" "1" "50" "14" "45639941" "45639941" "subst" "0" "04020" "FANCM_000473" "g.45639941A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639941_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739725" "1" "50" "14" "45639942" "45639942" "subst" "0" "04020" "FANCM_000474" "g.45639942A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639942_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739726" "1" "50" "14" "45639946" "45639946" "subst" "0" "04020" "FANCM_000478" "g.45639946A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639946_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739727" "1" "50" "14" "45639947" "45639947" "subst" "2.43966E-5" "04020" "FANCM_000479" "g.45639947C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639947_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739728" "1" "50" "14" "45642274" "45642274" "subst" "4.06646E-6" "04020" "FANCM_000482" "g.45642274C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642274_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739729" "1" "50" "14" "45642292" "45642292" "subst" "0" "04020" "FANCM_000485" "g.45642292C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642292_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739730" "1" "50" "14" "45642292" "45642292" "subst" "0" "04020" "FANCM_000486" "g.45642292C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642292_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739731" "1" "50" "14" "45642294" "45642294" "subst" "0" "04020" "FANCM_000487" "g.45642294C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642294_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739732" "1" "50" "14" "45642297" "45642297" "subst" "0" "04020" "FANCM_000488" "g.45642297T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642297_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739733" "1" "50" "14" "45642319" "45642319" "subst" "0" "04020" "FANCM_000491" "g.45642319A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642319_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739734" "1" "50" "14" "45642325" "45642325" "subst" "0" "04020" "FANCM_000493" "g.45642325C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642325_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739735" "1" "50" "14" "45642379" "45642379" "subst" "0" "04020" "FANCM_000504" "g.45642379T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642379_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739736" "1" "50" "14" "45644285" "45644285" "subst" "4.08403E-6" "04020" "FANCM_000512" "g.45644285C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644285_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739737" "1" "50" "14" "45644307" "45644307" "subst" "0" "04020" "FANCM_000516" "g.45644307T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644307_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739738" "1" "50" "14" "45644311" "45644311" "subst" "0" "04020" "FANCM_000518" "g.45644311T>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644311_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739739" "1" "50" "14" "45644314" "45644314" "subst" "8.15561E-6" "04020" "FANCM_000519" "g.45644314A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644314_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739740" "1" "50" "14" "45644318" "45644318" "subst" "4.07874E-6" "04020" "FANCM_000520" "g.45644318G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644318_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739741" "1" "50" "14" "45644325" "45644325" "subst" "0" "04020" "FANCM_000521" "g.45644325G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644325_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739742" "1" "50" "14" "45644325" "45644325" "subst" "0" "04020" "FANCM_000522" "g.45644325G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644325_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739743" "1" "50" "14" "45644334" "45644334" "subst" "8.15142E-6" "04020" "FANCM_000523" "g.45644334A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644334_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739744" "1" "50" "14" "45644346" "45644346" "subst" "4.07993E-6" "04020" "FANCM_000524" "g.45644346C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644346_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739745" "1" "50" "14" "45644349" "45644349" "subst" "1.22301E-5" "04020" "FANCM_000526" "g.45644349A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644349_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739746" "1" "50" "14" "45644352" "45644352" "subst" "0" "04020" "FANCM_000527" "g.45644352A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644352_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739747" "1" "50" "14" "45644370" "45644370" "subst" "0" "04020" "FANCM_000530" "g.45644370G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644370_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739748" "1" "50" "14" "45644380" "45644380" "subst" "4.07266E-6" "04020" "FANCM_000531" "g.45644380C>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644380_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739749" "1" "50" "14" "45644423" "45644423" "subst" "4.08383E-6" "04020" "FANCM_000535" "g.45644423T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644423_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739750" "1" "50" "14" "45644475" "45644475" "subst" "2.98304E-5" "04020" "FANCM_000544" "g.45644475G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644475_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739751" "1" "50" "14" "45644504" "45644504" "subst" "0" "04020" "FANCM_000550" "g.45644504A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644504_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739752" "1" "50" "14" "45644505" "45644505" "subst" "0" "04020" "FANCM_000551" "g.45644505A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644505_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739753" "1" "50" "14" "45644536" "45644536" "subst" "0" "04020" "FANCM_000556" "g.45644536A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644536_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739754" "1" "50" "14" "45644543" "45644543" "subst" "0" "04020" "FANCM_000558" "g.45644543A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644543_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739755" "1" "50" "14" "45644553" "45644553" "subst" "0" "04020" "FANCM_000560" "g.45644553C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644553_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739756" "1" "50" "14" "45644565" "45644565" "subst" "0" "04020" "FANCM_000564" "g.45644565A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644565_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739757" "1" "50" "14" "45644574" "45644574" "subst" "9.11436E-6" "04020" "FANCM_000565" "g.45644574G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644574_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739758" "1" "50" "14" "45644575" "45644575" "subst" "0" "04020" "FANCM_000566" "g.45644575G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644575_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739759" "1" "50" "14" "45644586" "45644586" "subst" "0" "04020" "FANCM_000569" "g.45644586T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644586_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739760" "1" "50" "14" "45644619" "45644619" "subst" "0" "04020" "FANCM_000574" "g.45644619A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644619_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739761" "1" "50" "14" "45644625" "45644625" "subst" "0" "04020" "FANCM_000577" "g.45644625T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644625_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739762" "1" "50" "14" "45644629" "45644629" "subst" "8.80856E-6" "04020" "FANCM_000578" "g.45644629A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644629_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739763" "1" "50" "14" "45644644" "45644644" "subst" "0" "04020" "FANCM_000580" "g.45644644A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644644_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739764" "1" "50" "14" "45644647" "45644647" "subst" "0" "04020" "FANCM_000581" "g.45644647A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644647_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739765" "1" "50" "14" "45644650" "45644650" "subst" "0" "04020" "FANCM_000582" "g.45644650A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644650_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739766" "1" "50" "14" "45644661" "45644661" "subst" "0" "04020" "FANCM_000586" "g.45644661G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644661_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739767" "1" "50" "14" "45644679" "45644679" "subst" "0" "04020" "FANCM_000591" "g.45644679G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644679_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739768" "1" "50" "14" "45644695" "45644695" "subst" "0" "04020" "FANCM_000597" "g.45644695A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644695_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739769" "1" "50" "14" "45644712" "45644712" "subst" "3.26168E-5" "04020" "FANCM_000600" "g.45644712G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644712_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739770" "1" "50" "14" "45644712" "45644712" "subst" "0" "04020" "FANCM_000601" "g.45644712G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644712_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739771" "1" "50" "14" "45644716" "45644716" "subst" "4.07634E-5" "04020" "FANCM_000603" "g.45644716C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644716_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739772" "1" "50" "14" "45644758" "45644758" "subst" "3.259E-5" "04020" "FANCM_000606" "g.45644758C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644758_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739773" "1" "50" "14" "45644772" "45644772" "subst" "0" "04020" "FANCM_000607" "g.45644772G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644772_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739774" "1" "50" "14" "45644836" "45644836" "subst" "0" "04020" "FANCM_000618" "g.45644836T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644836_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739775" "1" "50" "14" "45644844" "45644844" "subst" "0" "04020" "FANCM_000620" "g.45644844T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644844_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739776" "1" "50" "14" "45644879" "45644879" "subst" "0" "04020" "FANCM_000628" "g.45644879C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644879_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739777" "1" "50" "14" "45644887" "45644887" "subst" "4.07465E-6" "04020" "FANCM_000629" "g.45644887A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644887_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739778" "1" "50" "14" "45644895" "45644895" "subst" "0" "04020" "FANCM_000630" "g.45644895C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644895_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739779" "1" "50" "14" "45644913" "45644913" "subst" "0" "04020" "FANCM_000631" "g.45644913G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644913_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739780" "1" "50" "14" "45644919" "45644919" "subst" "8.15341E-6" "04020" "FANCM_000632" "g.45644919G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644919_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739781" "1" "50" "14" "45645030" "45645030" "subst" "0" "04020" "FANCM_000645" "g.45645030T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645030_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739782" "1" "50" "14" "45645046" "45645046" "subst" "0" "04020" "FANCM_000649" "g.45645046G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645046_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739783" "1" "50" "14" "45645057" "45645057" "subst" "4.08177E-6" "04020" "FANCM_000650" "g.45645057T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645057_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739784" "1" "50" "14" "45645132" "45645132" "subst" "1.22939E-5" "04020" "FANCM_000661" "g.45645132T>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645132_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739785" "1" "50" "14" "45645139" "45645139" "subst" "0" "04020" "FANCM_000663" "g.45645139C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645139_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739786" "1" "50" "14" "45645163" "45645163" "subst" "0" "04020" "FANCM_000667" "g.45645163T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645163_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739787" "1" "50" "14" "45645169" "45645169" "subst" "0" "04020" "FANCM_000668" "g.45645169A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645169_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739788" "1" "50" "14" "45645174" "45645174" "subst" "0" "04020" "FANCM_000669" "g.45645174A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645174_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739789" "1" "50" "14" "45645178" "45645178" "subst" "4.0798E-6" "04020" "FANCM_000670" "g.45645178T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645178_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739790" "1" "50" "14" "45645181" "45645181" "subst" "0" "04020" "FANCM_000672" "g.45645181C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645181_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739791" "1" "50" "14" "45645189" "45645189" "subst" "0" "04020" "FANCM_000673" "g.45645189C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645189_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739792" "1" "50" "14" "45645195" "45645195" "subst" "0" "04020" "FANCM_000674" "g.45645195C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645195_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739793" "1" "50" "14" "45645204" "45645204" "subst" "0" "04020" "FANCM_000676" "g.45645204T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645204_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739794" "1" "50" "14" "45645222" "45645222" "subst" "0" "04020" "FANCM_000679" "g.45645222A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645222_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739795" "1" "50" "14" "45645260" "45645260" "subst" "4.07422E-6" "04020" "FANCM_000686" "g.45645260A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645260_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739796" "1" "50" "14" "45645276" "45645276" "subst" "4.07372E-6" "04020" "FANCM_000692" "g.45645276G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645276_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739797" "1" "50" "14" "45645304" "45645304" "subst" "4.07126E-6" "04020" "FANCM_000696" "g.45645304A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645304_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739798" "1" "50" "14" "45645320" "45645320" "subst" "8.14074E-6" "04020" "FANCM_000699" "g.45645320T>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645320_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739799" "1" "50" "14" "45645336" "45645336" "subst" "0" "04020" "FANCM_000701" "g.45645336T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645336_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739800" "1" "50" "14" "45645351" "45645351" "subst" "0" "04020" "FANCM_000704" "g.45645351G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645351_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739801" "1" "50" "14" "45645384" "45645384" "subst" "4.06779E-6" "04020" "FANCM_000707" "g.45645384G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645384_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739802" "1" "50" "14" "45645424" "45645424" "subst" "0" "04020" "FANCM_000716" "g.45645424G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645424_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739803" "1" "50" "14" "45645448" "45645448" "subst" "0" "04020" "FANCM_000722" "g.45645448A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645448_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739804" "1" "50" "14" "45645453" "45645453" "subst" "0" "04020" "FANCM_000723" "g.45645453G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645453_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739805" "1" "50" "14" "45645456" "45645456" "subst" "1.22005E-5" "04020" "FANCM_000724" "g.45645456A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645456_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739806" "1" "50" "14" "45645477" "45645477" "subst" "4.06696E-6" "04020" "FANCM_000729" "g.45645477T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645477_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739807" "1" "50" "14" "45645481" "45645481" "subst" "0" "04020" "FANCM_000730" "g.45645481A>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645481_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739808" "1" "50" "14" "45645481" "45645481" "subst" "4.06716E-6" "04020" "FANCM_000731" "g.45645481A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645481_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739809" "1" "50" "14" "45645502" "45645502" "subst" "0" "04020" "FANCM_000734" "g.45645502T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645502_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739810" "1" "50" "14" "45645568" "45645568" "subst" "0" "04020" "FANCM_000745" "g.45645568G>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645568_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739811" "1" "50" "14" "45645600" "45645600" "subst" "0" "04020" "FANCM_000749" "g.45645600A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645600_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739812" "1" "50" "14" "45645616" "45645616" "subst" "0" "04020" "FANCM_000752" "g.45645616T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645616_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739813" "1" "50" "14" "45645619" "45645619" "subst" "4.0812E-6" "04020" "FANCM_000754" "g.45645619T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645619_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739814" "1" "50" "14" "45645627" "45645627" "subst" "0" "04020" "FANCM_000756" "g.45645627T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645627_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739815" "1" "50" "14" "45645663" "45645663" "subst" "0" "04020" "FANCM_000760" "g.45645663T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645663_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739816" "1" "50" "14" "45645702" "45645702" "subst" "0" "04020" "FANCM_000765" "g.45645702A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645702_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739817" "1" "50" "14" "45645724" "45645724" "subst" "0" "04020" "FANCM_000772" "g.45645724T>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645724_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739818" "1" "50" "14" "45645759" "45645759" "subst" "0" "04020" "FANCM_000777" "g.45645759G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645759_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739819" "1" "50" "14" "45645799" "45645799" "subst" "0" "04020" "FANCM_000780" "g.45645799T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645799_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739820" "1" "50" "14" "45645826" "45645826" "subst" "2.0581E-5" "04020" "FANCM_000786" "g.45645826C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645826_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739821" "1" "50" "14" "45645834" "45645834" "subst" "0" "04020" "FANCM_000788" "g.45645834A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645834_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739822" "1" "50" "14" "45645856" "45645856" "subst" "0" "04020" "FANCM_000794" "g.45645856A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645856_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739823" "1" "50" "14" "45645863" "45645863" "subst" "0" "04020" "FANCM_000799" "g.45645863G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645863_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739824" "1" "50" "14" "45645879" "45645879" "subst" "0" "04020" "FANCM_000804" "g.45645879G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645879_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739825" "1" "50" "14" "45645916" "45645916" "subst" "0" "04020" "FANCM_000811" "g.45645916T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645916_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739826" "1" "50" "14" "45645927" "45645927" "subst" "0" "04020" "FANCM_000813" "g.45645927G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645927_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739827" "1" "50" "14" "45645932" "45645932" "subst" "0" "04020" "FANCM_000815" "g.45645932T>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645932_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739828" "1" "50" "14" "45645940" "45645940" "subst" "0" "04020" "FANCM_000817" "g.45645940T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645940_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739829" "1" "50" "14" "45645972" "45645972" "subst" "0" "04020" "FANCM_000824" "g.45645972A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645972_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739830" "1" "50" "14" "45645982" "45645982" "subst" "0" "04020" "FANCM_000827" "g.45645982C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645982_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739831" "1" "50" "14" "45645987" "45645987" "subst" "0" "04020" "FANCM_000829" "g.45645987T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645987_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739832" "1" "50" "14" "45646011" "45646011" "subst" "0" "04020" "FANCM_000833" "g.45646011A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646011_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739833" "1" "50" "14" "45646064" "45646064" "subst" "4.11025E-6" "04020" "FANCM_000841" "g.45646064C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646064_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739834" "1" "50" "14" "45646105" "45646105" "subst" "0" "04020" "FANCM_000846" "g.45646105A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646105_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739835" "1" "50" "14" "45646119" "45646119" "subst" "4.11834E-6" "04020" "FANCM_000848" "g.45646119C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646119_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739836" "1" "50" "14" "45646134" "45646134" "subst" "0" "04020" "FANCM_000851" "g.45646134A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646134_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739837" "1" "50" "14" "45646140" "45646140" "subst" "0" "04020" "FANCM_000852" "g.45646140G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646140_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739838" "1" "50" "14" "45646146" "45646146" "subst" "0" "04020" "FANCM_000853" "g.45646146A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646146_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739839" "1" "50" "14" "45646155" "45646155" "subst" "0" "04020" "FANCM_000857" "g.45646155C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646155_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739840" "1" "50" "14" "45650635" "45650635" "subst" "4.08704E-6" "04020" "FANCM_000860" "g.45650635G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650635_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739841" "1" "50" "14" "45650639" "45650639" "subst" "0" "04020" "FANCM_000861" "g.45650639A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650639_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739842" "1" "50" "14" "45650644" "45650644" "subst" "0" "04020" "FANCM_000862" "g.45650644T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650644_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739843" "1" "50" "14" "45650645" "45650645" "subst" "0" "04020" "FANCM_000863" "g.45650645T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650645_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739844" "1" "50" "14" "45650647" "45650647" "subst" "0" "04020" "FANCM_000864" "g.45650647A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650647_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739845" "1" "50" "14" "45650663" "45650663" "subst" "0" "04020" "FANCM_000869" "g.45650663A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650663_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739846" "1" "50" "14" "45650665" "45650665" "subst" "0" "04020" "FANCM_000871" "g.45650665G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650665_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739847" "1" "50" "14" "45650671" "45650671" "subst" "0" "04020" "FANCM_000873" "g.45650671G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650671_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739848" "1" "50" "14" "45650674" "45650674" "subst" "4.06699E-6" "04020" "FANCM_000874" "g.45650674A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650674_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739849" "1" "50" "14" "45650681" "45650681" "subst" "0" "04020" "FANCM_000878" "g.45650681G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650681_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739850" "1" "50" "14" "45650690" "45650690" "subst" "8.13319E-6" "04020" "FANCM_000882" "g.45650690T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650690_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739851" "1" "50" "14" "45650719" "45650719" "subst" "0" "04020" "FANCM_000892" "g.45650719T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650719_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739852" "1" "50" "14" "45650719" "45650719" "subst" "0" "04020" "FANCM_000893" "g.45650719T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650719_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739853" "1" "50" "14" "45650841" "45650841" "subst" "0" "04020" "FANCM_000896" "g.45650841A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650841_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739854" "1" "50" "14" "45650847" "45650847" "subst" "0" "04020" "FANCM_000899" "g.45650847A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650847_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739855" "1" "50" "14" "45650870" "45650870" "subst" "4.08213E-6" "04020" "FANCM_000906" "g.45650870C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650870_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739856" "1" "50" "14" "45650894" "45650894" "subst" "0" "04020" "FANCM_000914" "g.45650894T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650894_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739857" "1" "50" "14" "45650897" "45650897" "subst" "0" "04020" "FANCM_000915" "g.45650897C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650897_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739858" "1" "50" "14" "45652986" "45652986" "subst" "4.07827E-6" "04020" "FANCM_000917" "g.45652986T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652986_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739859" "1" "50" "14" "45652990" "45652990" "subst" "0" "04020" "FANCM_000918" "g.45652990C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652990_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739860" "1" "50" "14" "45653014" "45653014" "subst" "4.07183E-6" "04020" "FANCM_000924" "g.45653014C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653014_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739861" "1" "50" "14" "45653017" "45653017" "subst" "0" "04020" "FANCM_000926" "g.45653017A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653017_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739862" "1" "50" "14" "45653028" "45653028" "subst" "0" "04020" "FANCM_000929" "g.45653028C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653028_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739863" "1" "50" "14" "45653044" "45653044" "subst" "0" "04020" "FANCM_000933" "g.45653044A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653044_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739864" "1" "50" "14" "45653070" "45653070" "subst" "0" "04020" "FANCM_000937" "g.45653070G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653070_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739865" "1" "50" "14" "45653103" "45653103" "subst" "0" "04020" "FANCM_000946" "g.45653103A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653103_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739866" "1" "50" "14" "45654427" "45654427" "subst" "4.53305E-5" "04020" "FANCM_000949" "g.45654427C>G" "9/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654427_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739867" "1" "50" "14" "45654430" "45654430" "subst" "0" "04020" "FANCM_000951" "g.45654430G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654430_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739868" "1" "50" "14" "45654435" "45654435" "subst" "0" "04020" "FANCM_000954" "g.45654435T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654435_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739869" "1" "50" "14" "45654440" "45654440" "subst" "0" "04020" "FANCM_000955" "g.45654440A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654440_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739870" "1" "50" "14" "45654448" "45654448" "subst" "4.10075E-6" "04020" "FANCM_000959" "g.45654448A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654448_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739871" "1" "50" "14" "45654449" "45654449" "subst" "0" "04020" "FANCM_000961" "g.45654449A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654449_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739872" "1" "50" "14" "45654460" "45654460" "subst" "8.20358E-6" "04020" "FANCM_000962" "g.45654460C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654460_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739873" "1" "50" "14" "45654471" "45654471" "subst" "0" "04020" "FANCM_000965" "g.45654471G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654471_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739874" "1" "50" "14" "45654475" "45654475" "subst" "0" "04020" "FANCM_000966" "g.45654475A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654475_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739875" "1" "50" "14" "45654505" "45654505" "subst" "0" "04020" "FANCM_000970" "g.45654505C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654505_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739876" "1" "50" "14" "45654510" "45654510" "subst" "1.23868E-5" "04020" "FANCM_000971" "g.45654510A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654510_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739877" "1" "50" "14" "45654529" "45654529" "subst" "0" "04020" "FANCM_000976" "g.45654529T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654529_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739878" "1" "50" "14" "45654538" "45654538" "subst" "0" "04020" "FANCM_000979" "g.45654538T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654538_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739879" "1" "50" "14" "45654542" "45654542" "subst" "0" "04020" "FANCM_000980" "g.45654542A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654542_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739880" "1" "50" "14" "45654570" "45654570" "subst" "0" "04020" "FANCM_000983" "g.45654570A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654570_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739881" "1" "50" "14" "45654577" "45654577" "subst" "0" "04020" "FANCM_000985" "g.45654577G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654577_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739882" "1" "50" "14" "45656996" "45656996" "subst" "4.0825E-6" "04020" "FANCM_000990" "g.45656996G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45656996_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739883" "1" "50" "14" "45657055" "45657055" "subst" "0" "04020" "FANCM_001000" "g.45657055C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657055_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739884" "1" "50" "14" "45657062" "45657062" "subst" "0" "04020" "FANCM_001001" "g.45657062C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657062_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739885" "1" "50" "14" "45657073" "45657073" "subst" "0" "04020" "FANCM_001003" "g.45657073A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657073_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739886" "1" "50" "14" "45657091" "45657091" "subst" "0" "04020" "FANCM_001005" "g.45657091G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657091_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739887" "1" "50" "14" "45658008" "45658008" "subst" "1.22695E-5" "04020" "FANCM_001006" "g.45658008C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658008_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739888" "1" "50" "14" "45658009" "45658009" "subst" "0" "04020" "FANCM_001007" "g.45658009C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658009_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739889" "1" "50" "14" "45658045" "45658045" "subst" "4.07385E-5" "04020" "FANCM_001012" "g.45658045G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658045_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739890" "1" "50" "14" "45658060" "45658060" "subst" "0" "04020" "FANCM_001013" "g.45658060A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658060_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739891" "1" "50" "14" "45658072" "45658072" "subst" "8.13815E-6" "04020" "FANCM_001016" "g.45658072G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658072_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739892" "1" "50" "14" "45658093" "45658093" "subst" "4.06659E-6" "04020" "FANCM_001017" "g.45658093T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658093_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739893" "1" "50" "14" "45658114" "45658114" "subst" "0" "04020" "FANCM_001019" "g.45658114T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658114_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739894" "1" "50" "14" "45658126" "45658126" "subst" "0" "04020" "FANCM_001021" "g.45658126G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658126_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739895" "1" "50" "14" "45658164" "45658164" "subst" "1.22036E-5" "04020" "FANCM_001029" "g.45658164G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658164_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739896" "1" "50" "14" "45658168" "45658168" "subst" "0" "04020" "FANCM_001031" "g.45658168T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658168_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739897" "1" "50" "14" "45658171" "45658171" "subst" "0" "04020" "FANCM_001032" "g.45658171T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658171_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739898" "1" "50" "14" "45658191" "45658191" "subst" "0" "04020" "FANCM_001035" "g.45658191A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658191_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739899" "1" "50" "14" "45658211" "45658211" "subst" "4.47507E-5" "04020" "FANCM_001036" "g.45658211G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658211_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739900" "1" "50" "14" "45658222" "45658222" "subst" "0" "04020" "FANCM_001037" "g.45658222G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658222_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739901" "1" "50" "14" "45658237" "45658237" "subst" "4.06709E-6" "04020" "FANCM_001038" "g.45658237A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658237_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739902" "1" "50" "14" "45658267" "45658267" "subst" "0" "04020" "FANCM_001041" "g.45658267A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658267_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739903" "1" "50" "14" "45658285" "45658285" "subst" "0" "04020" "FANCM_001047" "g.45658285A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658285_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739904" "1" "50" "14" "45658293" "45658293" "subst" "0" "04020" "FANCM_001050" "g.45658293G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658293_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739905" "1" "50" "14" "45658308" "45658308" "subst" "0" "04020" "FANCM_001053" "g.45658308G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658308_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739906" "1" "50" "14" "45658316" "45658316" "subst" "0" "04020" "FANCM_001054" "g.45658316G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658316_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739907" "1" "50" "14" "45658321" "45658321" "subst" "0" "04020" "FANCM_001055" "g.45658321A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658321_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739908" "1" "50" "14" "45658337" "45658337" "subst" "0" "04020" "FANCM_001059" "g.45658337T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658337_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739909" "1" "50" "14" "45658354" "45658354" "subst" "0" "04020" "FANCM_001061" "g.45658354C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658354_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739910" "1" "50" "14" "45658354" "45658354" "subst" "0" "04020" "FANCM_001062" "g.45658354C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658354_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739911" "1" "50" "14" "45658357" "45658357" "subst" "0" "04020" "FANCM_001063" "g.45658357G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658357_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739912" "1" "50" "14" "45658357" "45658357" "subst" "0" "04020" "FANCM_001064" "g.45658357G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658357_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739913" "1" "50" "14" "45658363" "45658363" "subst" "0" "04020" "FANCM_001066" "g.45658363C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658363_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739914" "1" "50" "14" "45658371" "45658371" "subst" "4.06441E-6" "04020" "FANCM_001068" "g.45658371T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658371_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739915" "1" "50" "14" "45658376" "45658376" "subst" "0" "04020" "FANCM_001069" "g.45658376G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658376_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739916" "1" "50" "14" "45658381" "45658381" "subst" "1.21953E-5" "04020" "FANCM_001071" "g.45658381G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658381_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739917" "1" "50" "14" "45658449" "45658449" "subst" "0" "04020" "FANCM_001080" "g.45658449A>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658449_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739918" "1" "50" "14" "45658512" "45658512" "subst" "0" "04020" "FANCM_001088" "g.45658512T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658512_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739919" "1" "50" "14" "45658513" "45658513" "subst" "0" "04020" "FANCM_001089" "g.45658513T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658513_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739920" "1" "50" "14" "45658527" "45658527" "subst" "0" "04020" "FANCM_001092" "g.45658527T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658527_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739921" "1" "50" "14" "45658561" "45658561" "subst" "8.13908E-6" "04020" "FANCM_001095" "g.45658561A>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658561_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739922" "1" "50" "14" "45665378" "45665378" "subst" "0" "04020" "FANCM_001099" "g.45665378G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665378_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739923" "1" "50" "14" "45665379" "45665379" "subst" "0" "04020" "FANCM_001100" "g.45665379G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665379_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739924" "1" "50" "14" "45665390" "45665390" "subst" "0" "04020" "FANCM_001101" "g.45665390G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665390_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739925" "1" "50" "14" "45665415" "45665415" "subst" "0" "04020" "FANCM_001106" "g.45665415C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665415_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739926" "1" "50" "14" "45665431" "45665431" "subst" "4.06204E-6" "04020" "FANCM_001110" "g.45665431A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665431_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739927" "1" "50" "14" "45665432" "45665432" "subst" "1.62489E-5" "04020" "FANCM_001111" "g.45665432C>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665432_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739928" "1" "50" "14" "45665441" "45665441" "subst" "1.62477E-5" "04020" "FANCM_001112" "g.45665441G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665441_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739929" "1" "50" "14" "45665448" "45665448" "subst" "0" "04020" "FANCM_001113" "g.45665448C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665448_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739930" "1" "50" "14" "45665457" "45665457" "subst" "0" "04020" "FANCM_001114" "g.45665457C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665457_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739931" "1" "50" "14" "45665466" "45665466" "subst" "0" "04020" "FANCM_001115" "g.45665466T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665466_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739932" "1" "50" "14" "45665468" "45665468" "subst" "3.24973E-5" "04020" "FANCM_001116" "g.45665468C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665468_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739933" "1" "50" "14" "45665480" "45665480" "subst" "0" "04020" "FANCM_001119" "g.45665480A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665480_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739934" "1" "50" "14" "45665483" "45665483" "subst" "0" "04020" "FANCM_001120" "g.45665483G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665483_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739935" "1" "50" "14" "45665538" "45665538" "subst" "0" "04020" "FANCM_001128" "g.45665538C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665538_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739936" "1" "50" "14" "45665550" "45665550" "subst" "0" "04020" "FANCM_001129" "g.45665550C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665550_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739937" "1" "50" "14" "45665550" "45665550" "subst" "0" "04020" "FANCM_001130" "g.45665550C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665550_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739938" "1" "50" "14" "45665567" "45665567" "subst" "2.03077E-5" "04020" "FANCM_001132" "g.45665567G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665567_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739939" "1" "50" "14" "45665579" "45665579" "subst" "4.06154E-6" "04020" "FANCM_001134" "g.45665579C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665579_C_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739940" "1" "50" "14" "45665611" "45665611" "subst" "0" "04020" "FANCM_001135" "g.45665611T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665611_T_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739941" "1" "50" "14" "45665618" "45665618" "subst" "4.06121E-6" "04020" "FANCM_001139" "g.45665618G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665618_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739942" "1" "50" "14" "45665627" "45665627" "subst" "0" "04020" "FANCM_001141" "g.45665627A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665627_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739943" "1" "50" "14" "45665661" "45665661" "subst" "4.06204E-6" "04020" "FANCM_001145" "g.45665661A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665661_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739944" "1" "50" "14" "45665684" "45665684" "subst" "0" "04020" "FANCM_001147" "g.45665684A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665684_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739945" "1" "50" "14" "45665685" "45665685" "subst" "0" "04020" "FANCM_001148" "g.45665685T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665685_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739946" "1" "50" "14" "45665687" "45665687" "subst" "0" "04020" "FANCM_001149" "g.45665687C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665687_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739947" "1" "50" "14" "45665718" "45665718" "subst" "1.62637E-5" "04020" "FANCM_001154" "g.45665718G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665718_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739948" "1" "50" "14" "45667853" "45667853" "subst" "0" "04020" "FANCM_001160" "g.45667853C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667853_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739949" "1" "50" "14" "45667861" "45667861" "subst" "8.13319E-6" "04020" "FANCM_001162" "g.45667861A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667861_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739950" "1" "50" "14" "45667862" "45667862" "subst" "0" "04020" "FANCM_001163" "g.45667862T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667862_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739951" "1" "50" "14" "45667866" "45667866" "subst" "8.1316E-6" "04020" "FANCM_001166" "g.45667866T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667866_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739952" "1" "50" "14" "45667876" "45667876" "subst" "0" "04020" "FANCM_001168" "g.45667876A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667876_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739953" "1" "50" "14" "45667883" "45667883" "subst" "8.12889E-6" "04020" "FANCM_001172" "g.45667883A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667883_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739954" "1" "50" "14" "45667885" "45667885" "subst" "0" "04020" "FANCM_001173" "g.45667885G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667885_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739955" "1" "50" "14" "45667897" "45667897" "subst" "4.06379E-6" "04020" "FANCM_001174" "g.45667897A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667897_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739956" "1" "50" "14" "45667901" "45667901" "subst" "8.1279E-6" "04020" "FANCM_001176" "g.45667901C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667901_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739957" "1" "50" "14" "45667906" "45667906" "subst" "0" "04020" "FANCM_001178" "g.45667906A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667906_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739958" "1" "50" "14" "45667912" "45667912" "subst" "0" "04020" "FANCM_001180" "g.45667912G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667912_G_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739959" "1" "50" "14" "45667927" "45667927" "subst" "0" "04020" "FANCM_001183" "g.45667927C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667927_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739960" "1" "50" "14" "45667937" "45667937" "subst" "0" "04020" "FANCM_001185" "g.45667937C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667937_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739961" "1" "50" "14" "45667954" "45667954" "subst" "0" "04020" "FANCM_001188" "g.45667954G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667954_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739962" "1" "50" "14" "45667958" "45667958" "subst" "0" "04020" "FANCM_001190" "g.45667958A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667958_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739963" "1" "50" "14" "45667968" "45667968" "subst" "0" "04020" "FANCM_001192" "g.45667968G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667968_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739964" "1" "50" "14" "45667985" "45667985" "subst" "0" "04020" "FANCM_001195" "g.45667985A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667985_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739965" "1" "50" "14" "45668009" "45668009" "subst" "0" "04020" "FANCM_001201" "g.45668009A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668009_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739966" "1" "50" "14" "45668018" "45668018" "subst" "0" "04020" "FANCM_001204" "g.45668018C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668018_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739967" "1" "50" "14" "45668024" "45668024" "subst" "0" "04020" "FANCM_001205" "g.45668024T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668024_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739968" "1" "50" "14" "45668042" "45668042" "subst" "0" "04020" "FANCM_001207" "g.45668042A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668042_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739969" "1" "50" "14" "45668101" "45668101" "subst" "0" "04020" "FANCM_001211" "g.45668101T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668101_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739970" "1" "50" "14" "45668106" "45668106" "subst" "0" "04020" "FANCM_001212" "g.45668106C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668106_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739971" "1" "50" "14" "45668113" "45668113" "subst" "0" "04020" "FANCM_001213" "g.45668113T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668113_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739972" "1" "50" "14" "45668114" "45668114" "subst" "0" "04020" "FANCM_001214" "g.45668114C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668114_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739973" "1" "50" "14" "45668116" "45668116" "subst" "0" "04020" "FANCM_001215" "g.45668116T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668116_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739974" "1" "50" "14" "45668120" "45668120" "subst" "0" "04020" "FANCM_001216" "g.45668120T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668120_T_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739975" "1" "50" "14" "45668131" "45668131" "subst" "0" "04020" "FANCM_001217" "g.45668131G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668131_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739976" "1" "50" "14" "45669074" "45669074" "subst" "0" "04020" "FANCM_000046" "g.45669074T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669074_T_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739977" "1" "50" "14" "45669088" "45669088" "subst" "0" "04020" "FANCM_001219" "g.45669088C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669088_C_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739978" "1" "50" "14" "45669090" "45669090" "subst" "0" "04020" "FANCM_001220" "g.45669090C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669090_C_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739979" "1" "50" "14" "45669094" "45669094" "subst" "0" "04020" "FANCM_001222" "g.45669094G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669094_G_A" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739980" "1" "50" "14" "45669111" "45669111" "subst" "0" "04020" "FANCM_001225" "g.45669111A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669111_A_T" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739981" "1" "50" "14" "45669115" "45669115" "subst" "0" "04020" "FANCM_001226" "g.45669115G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669115_G_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739982" "1" "50" "14" "45669116" "45669116" "subst" "0" "04020" "FANCM_001227" "g.45669116A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669116_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739983" "1" "50" "14" "45669147" "45669147" "subst" "0" "04020" "FANCM_001229" "g.45669147A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669147_A_C" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739984" "1" "50" "14" "45669156" "45669156" "subst" "0" "04020" "FANCM_001230" "g.45669156A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669156_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000739985" "1" "50" "14" "45669208" "45669208" "subst" "0" "04020" "FANCM_001236" "g.45669208A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669208_A_G" "not in 60466 cases; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743123" "1" "50" "14" "45605503" "45605503" "del" "0" "04020" "FANCM_000118" "g.45605503del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605500_GC_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743124" "1" "50" "14" "45606318" "45606319" "del" "0" "04020" "FANCM_000170" "g.45606318_45606319del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606313_AAG_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743125" "1" "50" "14" "45623201" "45623201" "del" "0" "04020" "FANCM_000262" "g.45623201del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623198_CA_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743126" "1" "50" "14" "45623918" "45623918" "del" "0" "04020" "FANCM_000279" "g.45623918del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623912_CA_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743127" "1" "50" "14" "45623952" "45623953" "del" "0" "04020" "FANCM_000287" "g.45623952_45623953del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623949_ACT_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743128" "1" "50" "14" "45624599" "45624599" "del" "0" "04020" "FANCM_000316" "g.45624599del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624596_GT_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743129" "1" "50" "14" "45624660" "45624660" "del" "0" "04020" "FANCM_000337" "g.45624660del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624658_GA_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743130" "1" "50" "14" "45644482" "45644485" "del" "0" "04020" "FANCM_000546" "g.45644482_45644485del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644477_TAAAC_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743131" "1" "50" "14" "45644489" "45644493" "del" "0" "04020" "FANCM_000547" "g.45644489_45644493del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644485_CTCATA_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743132" "1" "50" "14" "45645180" "45645180" "del" "0" "04020" "FANCM_000671" "g.45645180del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645177_AT_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743133" "1" "50" "14" "45645245" "45645245" "dup" "0" "04020" "FANCM_000683" "g.45645245dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645244_C_CT" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743134" "1" "50" "14" "45645432" "45645433" "del" "0" "04020" "FANCM_000719" "g.45645432_45645433del" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645430_CTT_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743135" "1" "50" "14" "45650694" "45650695" "del" "0" "04020" "FANCM_000884" "g.45650694_45650695del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650691_TAA_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743136" "1" "50" "14" "45653094" "45653095" "del" "0" "04020" "FANCM_000944" "g.45653094_45653095del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653091_CAG_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743137" "1" "50" "14" "45653104" "45653104" "del" "0" "04020" "FANCM_000947" "g.45653104del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653101_TA_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743138" "1" "50" "14" "45658424" "45658425" "del" "0" "04020" "FANCM_001077" "g.45658424_45658425del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658422_CAG_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743139" "1" "50" "14" "45665747" "45665747" "del" "0" "04020" "FANCM_001157" "g.45665747del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665741_GA_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743140" "1" "50" "14" "45665747" "45665747" "dup" "0" "04020" "FANCM_001158" "g.45665747dup" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665741_G_GA" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743141" "1" "50" "14" "45667879" "45667880" "del" "0" "04020" "FANCM_001170" "g.45667879_45667880del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667876_AAG_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743142" "1" "50" "14" "45667969" "45667969" "del" "0" "04020" "FANCM_001193" "g.45667969del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667967_AG_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743143" "1" "50" "14" "45667994" "45667997" "del" "0" "04020" "FANCM_001197" "g.45667994_45667997del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667987_CAAAG_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743390" "1" "50" "14" "45668053" "45668056" "del" "0" "04020" "FANCM_001208" "g.45668053_45668056del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668052_GTTTT_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743391" "1" "50" "14" "45644815" "45644818" "delins" "0" "04020" "FANCM_000617" "g.45644815_45644818delinsGA" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644815_AATC_GA" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743392" "1" "50" "14" "45658494" "45658495" "del" "0" "04020" "FANCM_001085" "g.45658494_45658495del" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658493_CCA_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743394" "1" "50" "14" "45620676" "45620676" "del" "0" "04020" "FANCM_000243" "g.45620676del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620675_TA_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743395" "1" "50" "14" "45620696" "45620696" "del" "0" "04020" "FANCM_000244" "g.45620696del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620695_AG_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743396" "1" "50" "14" "45624650" "45624651" "delins" "0" "04020" "FANCM_000334" "g.45624650_45624651delinsT" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624650_AA_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743397" "1" "50" "14" "45636305" "45636305" "del" "0" "04020" "FANCM_000442" "g.45636305del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636304_AT_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743398" "1" "50" "14" "45644843" "45644843" "del" "0" "04020" "FANCM_000619" "g.45644843del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644842_CA_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743399" "1" "50" "14" "45645018" "45645018" "del" "0" "04020" "FANCM_000005" "g.45645018del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645017_GC_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743400" "1" "50" "14" "45645546" "45645546" "del" "0" "04020" "FANCM_000742" "g.45645546del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645545_TG_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743401" "1" "50" "14" "45645704" "45645704" "del" "0" "04020" "FANCM_000767" "g.45645704del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645703_CA_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743402" "1" "50" "14" "45652991" "45652991" "del" "0" "04020" "FANCM_000920" "g.45652991del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652990_CT_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743403" "1" "50" "14" "45658426" "45658426" "del" "0" "04020" "FANCM_001078" "g.45658426del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658425_AC_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743404" "1" "50" "14" "45665414" "45665414" "del" "0" "04020" "FANCM_001105" "g.45665414del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665413_AT_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000743405" "1" "50" "14" "45645960" "45645961" "ins" "0" "04020" "FANCM_000822" "g.45645960_45645961insG" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645960_A_AG" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746501" "1" "50" "14" "45605245" "45605245" "subst" "1.64898E-5" "04020" "FANCM_000071" "g.45605245G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605245_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746503" "1" "50" "14" "45605264" "45605264" "subst" "0" "04020" "FANCM_000075" "g.45605264G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605264_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746504" "1" "50" "14" "45605277" "45605277" "subst" "0" "04020" "FANCM_000076" "g.45605277A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605277_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746505" "1" "50" "14" "45605278" "45605278" "subst" "0" "04020" "FANCM_000077" "g.45605278G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605278_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746506" "1" "50" "14" "45605280" "45605280" "subst" "4.09326E-6" "04020" "FANCM_000078" "g.45605280A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605280_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746507" "1" "50" "14" "45605299" "45605299" "subst" "0" "04020" "FANCM_000081" "g.45605299C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605299_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746508" "1" "50" "14" "45605304" "45605304" "subst" "4.07834E-6" "04020" "FANCM_000083" "g.45605304G>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605304_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746509" "1" "50" "14" "45605317" "45605317" "subst" "0" "04020" "FANCM_000086" "g.45605317G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605317_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746510" "1" "50" "14" "45605332" "45605332" "subst" "8.13557E-6" "04020" "FANCM_000092" "g.45605332A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605332_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746511" "1" "50" "14" "45605358" "45605358" "subst" "0" "04020" "FANCM_000096" "g.45605358T>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605358_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746512" "1" "50" "14" "45605362" "45605362" "subst" "1.62582E-5" "04020" "FANCM_000097" "g.45605362C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605362_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746513" "1" "50" "14" "45605371" "45605371" "subst" "0" "04020" "FANCM_000098" "g.45605371C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605371_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746514" "1" "50" "14" "45605381" "45605381" "subst" "0" "04020" "FANCM_000099" "g.45605381G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605381_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746515" "1" "50" "14" "45605391" "45605391" "subst" "4.06105E-6" "04020" "FANCM_000101" "g.45605391G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605391_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746516" "1" "50" "14" "45605416" "45605416" "subst" "0" "04020" "FANCM_000107" "g.45605416C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605416_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746517" "1" "50" "14" "45605431" "45605431" "subst" "0" "04020" "FANCM_000109" "g.45605431G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605431_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746518" "1" "50" "14" "45605449" "45605449" "subst" "4.06194E-6" "04020" "FANCM_000111" "g.45605449A>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605449_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746519" "1" "50" "14" "45605469" "45605469" "subst" "0" "04020" "FANCM_000113" "g.45605469G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605469_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746520" "1" "50" "14" "45605500" "45605500" "subst" "0" "04020" "FANCM_000117" "g.45605500G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605500_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746521" "1" "50" "14" "45605503" "45605503" "subst" "0" "04020" "FANCM_000119" "g.45605503C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605503_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746522" "1" "50" "14" "45605532" "45605532" "subst" "8.1213E-6" "04020" "FANCM_000123" "g.45605532C>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605532_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746523" "1" "50" "14" "45605541" "45605541" "subst" "0" "04020" "FANCM_000125" "g.45605541C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605541_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746524" "1" "50" "14" "45605547" "45605547" "subst" "0" "04020" "FANCM_000126" "g.45605547T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605547_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746525" "1" "50" "14" "45605551" "45605551" "subst" "4.46664E-5" "04020" "FANCM_000127" "g.45605551A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605551_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746526" "1" "50" "14" "45605560" "45605560" "subst" "0" "04020" "FANCM_000128" "g.45605560T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605560_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746527" "1" "50" "14" "45605574" "45605574" "subst" "4.06062E-6" "04020" "FANCM_000129" "g.45605574G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605574_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746528" "1" "50" "14" "45605586" "45605586" "subst" "0" "04020" "FANCM_000130" "g.45605586A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605586_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746529" "1" "50" "14" "45605590" "45605590" "subst" "4.06088E-6" "04020" "FANCM_000131" "g.45605590T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605590_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746530" "1" "50" "14" "45605598" "45605598" "subst" "0" "04020" "FANCM_000133" "g.45605598G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605598_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746531" "1" "50" "14" "45605619" "45605619" "subst" "8.12328E-6" "04020" "FANCM_000139" "g.45605619T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605619_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746532" "1" "50" "14" "45605623" "45605623" "subst" "0" "04020" "FANCM_000141" "g.45605623G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605623_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746533" "1" "50" "14" "45605630" "45605630" "subst" "0" "04020" "FANCM_000142" "g.45605630C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605630_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746534" "1" "50" "14" "45605658" "45605658" "subst" "8.14359E-6" "04020" "FANCM_000146" "g.45605658C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605658_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746535" "1" "50" "14" "45605661" "45605661" "subst" "1.2214E-5" "04020" "FANCM_000148" "g.45605661A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605661_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746536" "1" "50" "14" "45605713" "45605713" "subst" "8.18753E-6" "04020" "FANCM_000155" "g.45605713T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605713_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746537" "1" "50" "14" "45605733" "45605733" "subst" "0" "04020" "FANCM_000159" "g.45605733G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605733_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746538" "1" "50" "14" "45606304" "45606304" "subst" "0" "04020" "FANCM_000164" "g.45606304T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606304_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746539" "1" "50" "14" "45606307" "45606307" "subst" "4.06329E-6" "04020" "FANCM_000165" "g.45606307T>A" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606307_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746540" "1" "50" "14" "45606346" "45606346" "subst" "0" "04020" "FANCM_000173" "g.45606346G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606346_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746541" "1" "50" "14" "45606382" "45606382" "subst" "0" "04020" "FANCM_000178" "g.45606382G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606382_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746542" "1" "50" "14" "45609859" "45609859" "subst" "0" "04020" "FANCM_000190" "g.45609859A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609859_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746543" "1" "50" "14" "45609880" "45609880" "subst" "0" "04020" "FANCM_000194" "g.45609880G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609880_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746544" "1" "50" "14" "45609902" "45609902" "subst" "0" "04020" "FANCM_000197" "g.45609902G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609902_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746545" "1" "50" "14" "45618044" "45618044" "subst" "0" "04020" "FANCM_000202" "g.45618044T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618044_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746546" "1" "50" "14" "45618046" "45618046" "subst" "0" "04020" "FANCM_000203" "g.45618046C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618046_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746547" "1" "50" "14" "45618080" "45618080" "subst" "8.12526E-6" "04020" "FANCM_000205" "g.45618080T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618080_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746548" "1" "50" "14" "45618081" "45618081" "subst" "0" "04020" "FANCM_000206" "g.45618081A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618081_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746549" "1" "50" "14" "45618089" "45618089" "subst" "0" "04020" "FANCM_000208" "g.45618089G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618089_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746550" "1" "50" "14" "45618089" "45618089" "subst" "4.06286E-6" "04020" "FANCM_000209" "g.45618089G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618089_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746551" "1" "50" "14" "45618098" "45618098" "subst" "0" "04020" "FANCM_000210" "g.45618098A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618098_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746552" "1" "50" "14" "45618101" "45618101" "subst" "0" "04020" "FANCM_000211" "g.45618101C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618101_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746553" "1" "50" "14" "45618135" "45618135" "subst" "0" "04020" "FANCM_000216" "g.45618135A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618135_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746554" "1" "50" "14" "45618154" "45618154" "subst" "4.06286E-6" "04020" "FANCM_000220" "g.45618154C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618154_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746555" "1" "50" "14" "45618157" "45618157" "subst" "0" "04020" "FANCM_000223" "g.45618157C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618157_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746556" "1" "50" "14" "45618178" "45618178" "subst" "8.12565E-6" "04020" "FANCM_000225" "g.45618178A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618178_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746557" "1" "50" "14" "45618194" "45618194" "subst" "0" "04020" "FANCM_000229" "g.45618194T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618194_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746558" "1" "50" "14" "45620618" "45620618" "subst" "5.69458E-5" "04020" "FANCM_000233" "g.45620618C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620618_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746559" "1" "50" "14" "45620627" "45620627" "subst" "1.21989E-5" "04020" "FANCM_000235" "g.45620627A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620627_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746560" "1" "50" "14" "45620660" "45620660" "subst" "4.06441E-6" "04020" "FANCM_000241" "g.45620660C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620660_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746561" "1" "50" "14" "45620698" "45620698" "subst" "0" "04020" "FANCM_000245" "g.45620698T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620698_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746562" "1" "50" "14" "45623126" "45623126" "subst" "0" "04020" "FANCM_000253" "g.45623126A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623126_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746563" "1" "50" "14" "45623143" "45623143" "subst" "4.06379E-6" "04020" "FANCM_000254" "g.45623143C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623143_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746564" "1" "50" "14" "45623144" "45623144" "subst" "4.06359E-6" "04020" "FANCM_000255" "g.45623144G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623144_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746565" "1" "50" "14" "45623159" "45623159" "subst" "8.12519E-6" "04020" "FANCM_000256" "g.45623159A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623159_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746566" "1" "50" "14" "45623199" "45623199" "subst" "0" "04020" "FANCM_000261" "g.45623199A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623199_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746567" "1" "50" "14" "45623211" "45623211" "subst" "0" "04020" "FANCM_000266" "g.45623211G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623211_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746568" "1" "50" "14" "45623214" "45623214" "subst" "4.06326E-6" "04020" "FANCM_000267" "g.45623214C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623214_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746569" "1" "50" "14" "45623903" "45623903" "subst" "0" "04020" "FANCM_000272" "g.45623903T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623903_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746570" "1" "50" "14" "45623914" "45623914" "subst" "0" "04020" "FANCM_000277" "g.45623914A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623914_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746571" "1" "50" "14" "45623941" "45623941" "subst" "0" "04020" "FANCM_000284" "g.45623941T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623941_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746572" "1" "50" "14" "45623965" "45623965" "subst" "0" "04020" "FANCM_000290" "g.45623965G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623965_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746573" "1" "50" "14" "45623971" "45623971" "subst" "1.22257E-5" "04020" "FANCM_000292" "g.45623971A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623971_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746574" "1" "50" "14" "45623975" "45623975" "subst" "0" "04020" "FANCM_000293" "g.45623975T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623975_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746575" "1" "50" "14" "45623983" "45623983" "subst" "0" "04020" "FANCM_000297" "g.45623983A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623983_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746576" "1" "50" "14" "45624020" "45624020" "subst" "0" "04020" "FANCM_000306" "g.45624020A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624020_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746577" "1" "50" "14" "45624020" "45624020" "subst" "0" "04020" "FANCM_000307" "g.45624020A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624020_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746578" "1" "50" "14" "45624575" "45624575" "subst" "0" "04020" "FANCM_000310" "g.45624575G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624575_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746579" "1" "50" "14" "45624578" "45624578" "subst" "0" "04020" "FANCM_000311" "g.45624578G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624578_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746580" "1" "50" "14" "45624590" "45624590" "subst" "0" "04020" "FANCM_000313" "g.45624590A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624590_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746581" "1" "50" "14" "45624593" "45624593" "subst" "4.18669E-6" "04020" "FANCM_000314" "g.45624593T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624593_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746582" "1" "50" "14" "45624599" "45624599" "subst" "0" "04020" "FANCM_000317" "g.45624599T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624599_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746583" "1" "50" "14" "45624618" "45624618" "subst" "4.07236E-6" "04020" "FANCM_000322" "g.45624618A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624618_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746584" "1" "50" "14" "45624621" "45624621" "subst" "0" "04020" "FANCM_000324" "g.45624621A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624621_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746585" "1" "50" "14" "45624648" "45624648" "subst" "0" "04020" "FANCM_000333" "g.45624648T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624648_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746586" "1" "50" "14" "45624651" "45624651" "subst" "0" "04020" "FANCM_000335" "g.45624651A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624651_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746587" "1" "50" "14" "45624652" "45624652" "subst" "0" "04020" "FANCM_000336" "g.45624652G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624652_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746588" "1" "50" "14" "45628305" "45628305" "subst" "0" "04020" "FANCM_000342" "g.45628305A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628305_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746589" "1" "50" "14" "45628319" "45628319" "subst" "0" "04020" "FANCM_000347" "g.45628319A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628319_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746590" "1" "50" "14" "45628320" "45628320" "subst" "0" "04020" "FANCM_000348" "g.45628320A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628320_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746591" "1" "50" "14" "45628323" "45628323" "subst" "8.19014E-6" "04020" "FANCM_000350" "g.45628323G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628323_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746592" "1" "50" "14" "45628325" "45628325" "subst" "0" "04020" "FANCM_000352" "g.45628325G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628325_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746593" "1" "50" "14" "45628335" "45628335" "subst" "0" "04020" "FANCM_000353" "g.45628335G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628335_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746594" "1" "50" "14" "45628340" "45628340" "subst" "0" "04020" "FANCM_000354" "g.45628340A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628340_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746595" "1" "50" "14" "45628392" "45628392" "subst" "4.06405E-6" "04020" "FANCM_000361" "g.45628392C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628392_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746596" "1" "50" "14" "45628410" "45628410" "subst" "8.1248E-6" "04020" "FANCM_000363" "g.45628410T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628410_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746597" "1" "50" "14" "45628430" "45628430" "subst" "1.21875E-5" "04020" "FANCM_000365" "g.45628430G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628430_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746598" "1" "50" "14" "45628446" "45628446" "subst" "0" "04020" "FANCM_000368" "g.45628446A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628446_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746599" "1" "50" "14" "45628484" "45628484" "subst" "0" "04020" "FANCM_000374" "g.45628484G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628484_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746600" "1" "50" "14" "45628485" "45628485" "subst" "0" "04020" "FANCM_000375" "g.45628485T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628485_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746601" "1" "50" "14" "45633583" "45633583" "subst" "4.06177E-6" "04020" "FANCM_000381" "g.45633583G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633583_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746602" "1" "50" "14" "45633607" "45633607" "subst" "4.06151E-6" "04020" "FANCM_000384" "g.45633607A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633607_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746603" "1" "50" "14" "45633635" "45633635" "subst" "4.06194E-6" "04020" "FANCM_000387" "g.45633635T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633635_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746604" "1" "50" "14" "45633670" "45633670" "subst" "0" "04020" "FANCM_000391" "g.45633670C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633670_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746605" "1" "50" "14" "45633671" "45633671" "subst" "4.06213E-6" "04020" "FANCM_000392" "g.45633671A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633671_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746606" "1" "50" "14" "45633674" "45633674" "subst" "0" "04020" "FANCM_000393" "g.45633674A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633674_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746607" "1" "50" "14" "45633733" "45633733" "subst" "4.06732E-6" "04020" "FANCM_000402" "g.45633733A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633733_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746608" "1" "50" "14" "45633763" "45633763" "subst" "0" "04020" "FANCM_000410" "g.45633763G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633763_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746609" "1" "50" "14" "45633767" "45633767" "subst" "0" "04020" "FANCM_000412" "g.45633767G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633767_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746610" "1" "50" "14" "45636175" "45636175" "subst" "0" "04020" "FANCM_000414" "g.45636175A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636175_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746611" "1" "50" "14" "45636177" "45636177" "subst" "0" "04020" "FANCM_000415" "g.45636177A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636177_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746612" "1" "50" "14" "45636178" "45636178" "subst" "4.06779E-6" "04020" "FANCM_000416" "g.45636178A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636178_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746613" "1" "50" "14" "45636210" "45636210" "subst" "1.62558E-5" "04020" "FANCM_000420" "g.45636210A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636210_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746614" "1" "50" "14" "45636211" "45636211" "subst" "0" "04020" "FANCM_000421" "g.45636211G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636211_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746615" "1" "50" "14" "45636212" "45636212" "subst" "8.12929E-6" "04020" "FANCM_000422" "g.45636212G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636212_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746616" "1" "50" "14" "45636230" "45636230" "subst" "0" "04020" "FANCM_000425" "g.45636230C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636230_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746617" "1" "50" "14" "45636232" "45636232" "subst" "8.12817E-6" "04020" "FANCM_000426" "g.45636232A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636232_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746618" "1" "50" "14" "45636240" "45636240" "subst" "4.06438E-6" "04020" "FANCM_000427" "g.45636240C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636240_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746619" "1" "50" "14" "45636256" "45636256" "subst" "0" "04020" "FANCM_000432" "g.45636256A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636256_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746620" "1" "50" "14" "45636282" "45636282" "subst" "0" "04020" "FANCM_000434" "g.45636282A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636282_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746621" "1" "50" "14" "45636297" "45636297" "subst" "4.06497E-6" "04020" "FANCM_000437" "g.45636297G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636297_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746622" "1" "50" "14" "45636333" "45636333" "subst" "0" "04020" "FANCM_000447" "g.45636333C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636333_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746623" "1" "50" "14" "45636346" "45636346" "subst" "0" "04020" "FANCM_000448" "g.45636346C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636346_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746624" "1" "50" "14" "45639808" "45639808" "subst" "4.07741E-6" "04020" "FANCM_000451" "g.45639808C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639808_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746625" "1" "50" "14" "45639828" "45639828" "subst" "0" "04020" "FANCM_000456" "g.45639828T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639828_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746626" "1" "50" "14" "45639839" "45639839" "subst" "0" "04020" "FANCM_000457" "g.45639839G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639839_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746627" "1" "50" "14" "45639842" "45639842" "subst" "1.22125E-5" "04020" "FANCM_000458" "g.45639842T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639842_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746628" "1" "50" "14" "45639875" "45639875" "subst" "0" "04020" "FANCM_000462" "g.45639875G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639875_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746629" "1" "50" "14" "45639897" "45639897" "subst" "0" "04020" "FANCM_000464" "g.45639897T>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639897_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746630" "1" "50" "14" "45639921" "45639921" "subst" "8.13173E-6" "04020" "FANCM_000467" "g.45639921C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639921_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746631" "1" "50" "14" "45639927" "45639927" "subst" "0" "04020" "FANCM_000468" "g.45639927T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639927_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746632" "1" "50" "14" "45639933" "45639933" "subst" "0" "04020" "FANCM_000470" "g.45639933A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639933_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746633" "1" "50" "14" "45639939" "45639939" "subst" "0" "04020" "FANCM_000472" "g.45639939A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639939_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746634" "1" "50" "14" "45639945" "45639945" "subst" "0" "04020" "FANCM_000477" "g.45639945A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639945_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746635" "1" "50" "14" "45642258" "45642258" "subst" "0" "04020" "FANCM_000480" "g.45642258G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642258_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746636" "1" "50" "14" "45642259" "45642259" "subst" "0" "04020" "FANCM_000481" "g.45642259C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642259_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746637" "1" "50" "14" "45642322" "45642322" "subst" "0" "04020" "FANCM_000492" "g.45642322A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642322_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746638" "1" "50" "14" "45642330" "45642330" "subst" "0" "04020" "FANCM_000494" "g.45642330C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642330_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746639" "1" "50" "14" "45642352" "45642352" "subst" "0" "04020" "FANCM_000498" "g.45642352C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642352_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746640" "1" "50" "14" "45642355" "45642355" "subst" "9.35013E-5" "04020" "FANCM_000499" "g.45642355A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642355_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746641" "1" "50" "14" "45642358" "45642358" "subst" "2.0329E-5" "04020" "FANCM_000500" "g.45642358G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642358_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746642" "1" "50" "14" "45642382" "45642382" "subst" "4.06478E-6" "04020" "FANCM_000506" "g.45642382T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642382_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746643" "1" "50" "14" "45642399" "45642399" "subst" "0" "04020" "FANCM_000508" "g.45642399A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642399_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746644" "1" "50" "14" "45642414" "45642414" "subst" "0" "04020" "FANCM_000510" "g.45642414G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642414_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746645" "1" "50" "14" "45644277" "45644277" "subst" "0" "04020" "FANCM_000511" "g.45644277G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644277_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746646" "1" "50" "14" "45644285" "45644285" "subst" "0" "04020" "FANCM_000513" "g.45644285C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644285_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746647" "1" "50" "14" "45644309" "45644309" "subst" "0" "04020" "FANCM_000517" "g.45644309T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644309_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746648" "1" "50" "14" "45644356" "45644356" "subst" "0" "04020" "FANCM_000528" "g.45644356A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644356_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746649" "1" "50" "14" "45644361" "45644361" "subst" "0" "04020" "FANCM_000529" "g.45644361A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644361_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746650" "1" "50" "14" "45644432" "45644432" "subst" "0" "04020" "FANCM_000536" "g.45644432T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644432_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746651" "1" "50" "14" "45644445" "45644445" "subst" "0" "04020" "FANCM_000537" "g.45644445A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644445_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746652" "1" "50" "14" "45644446" "45644446" "subst" "4.12154E-6" "04020" "FANCM_000538" "g.45644446T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644446_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746653" "1" "50" "14" "45644456" "45644456" "subst" "0" "04020" "FANCM_000540" "g.45644456T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644456_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746654" "1" "50" "14" "45644458" "45644458" "subst" "8.34564E-6" "04020" "FANCM_000541" "g.45644458A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644458_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746655" "1" "50" "14" "45644474" "45644474" "subst" "0.000174614" "04020" "FANCM_000543" "g.45644474T>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644474_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746656" "1" "50" "14" "45644492" "45644492" "subst" "0" "04020" "FANCM_000548" "g.45644492C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644492_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746657" "1" "50" "14" "45644502" "45644502" "subst" "0" "04020" "FANCM_000549" "g.45644502A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644502_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746658" "1" "50" "14" "45644530" "45644530" "subst" "0" "04020" "FANCM_000553" "g.45644530C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644530_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746659" "1" "50" "14" "45644532" "45644532" "subst" "0" "04020" "FANCM_000554" "g.45644532A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644532_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746660" "1" "50" "14" "45644535" "45644535" "subst" "0" "04020" "FANCM_000555" "g.45644535G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644535_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746661" "1" "50" "14" "45644559" "45644559" "subst" "0" "04020" "FANCM_000561" "g.45644559A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644559_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746662" "1" "50" "14" "45644594" "45644594" "subst" "0" "04020" "FANCM_000570" "g.45644594T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644594_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746663" "1" "50" "14" "45644596" "45644596" "subst" "0" "04020" "FANCM_000571" "g.45644596A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644596_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746664" "1" "50" "14" "45644601" "45644601" "subst" "0" "04020" "FANCM_000572" "g.45644601A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644601_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746665" "1" "50" "14" "45644614" "45644614" "subst" "4.39159E-6" "04020" "FANCM_000573" "g.45644614T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644614_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746666" "1" "50" "14" "45644619" "45644619" "subst" "0" "04020" "FANCM_000575" "g.45644619A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644619_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746667" "1" "50" "14" "45644658" "45644658" "subst" "0" "04020" "FANCM_000584" "g.45644658T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644658_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746668" "1" "50" "14" "45644659" "45644659" "subst" "0" "04020" "FANCM_000585" "g.45644659C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644659_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746669" "1" "50" "14" "45644668" "45644668" "subst" "0" "04020" "FANCM_000587" "g.45644668A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644668_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746670" "1" "50" "14" "45644672" "45644672" "subst" "0" "04020" "FANCM_000589" "g.45644672A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644672_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746671" "1" "50" "14" "45644673" "45644673" "subst" "2.47594E-5" "04020" "FANCM_000590" "g.45644673A>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644673_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746672" "1" "50" "14" "45644686" "45644686" "subst" "0" "04020" "FANCM_000592" "g.45644686G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644686_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746673" "1" "50" "14" "45644688" "45644688" "subst" "0" "04020" "FANCM_000593" "g.45644688A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644688_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746674" "1" "50" "14" "45644692" "45644692" "subst" "4.08173E-6" "04020" "FANCM_000595" "g.45644692T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644692_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746675" "1" "50" "14" "45644694" "45644694" "subst" "0" "04020" "FANCM_000596" "g.45644694A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644694_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746676" "1" "50" "14" "45644787" "45644787" "subst" "0" "04020" "FANCM_000608" "g.45644787T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644787_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746677" "1" "50" "14" "45644788" "45644788" "subst" "0" "04020" "FANCM_000609" "g.45644788C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644788_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746678" "1" "50" "14" "45644790" "45644790" "subst" "0" "04020" "FANCM_000610" "g.45644790G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644790_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746679" "1" "50" "14" "45644791" "45644791" "subst" "4.07584E-6" "04020" "FANCM_000611" "g.45644791G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644791_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746680" "1" "50" "14" "45644800" "45644800" "subst" "0" "04020" "FANCM_000613" "g.45644800G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644800_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746681" "1" "50" "14" "45644804" "45644804" "subst" "4.07651E-6" "04020" "FANCM_000614" "g.45644804C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644804_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746682" "1" "50" "14" "45644806" "45644806" "subst" "1.63083E-5" "04020" "FANCM_000615" "g.45644806A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644806_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746683" "1" "50" "14" "45644862" "45644862" "subst" "0" "04020" "FANCM_000624" "g.45644862A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644862_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746684" "1" "50" "14" "45644865" "45644865" "subst" "4.07661E-6" "04020" "FANCM_000625" "g.45644865G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644865_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746685" "1" "50" "14" "45644871" "45644871" "subst" "0" "04020" "FANCM_000627" "g.45644871A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644871_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746686" "1" "50" "14" "45644937" "45644937" "subst" "0" "04020" "FANCM_000635" "g.45644937T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644937_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746687" "1" "50" "14" "45644955" "45644955" "subst" "0" "04020" "FANCM_000636" "g.45644955C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644955_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746688" "1" "50" "14" "45644961" "45644961" "subst" "0" "04020" "FANCM_000637" "g.45644961A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644961_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746689" "1" "50" "14" "45644998" "45644998" "subst" "0" "04020" "FANCM_000639" "g.45644998G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644998_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746690" "1" "50" "14" "45645003" "45645003" "subst" "0" "04020" "FANCM_000641" "g.45645003G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645003_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746691" "1" "50" "14" "45645021" "45645021" "subst" "4.08373E-6" "04020" "FANCM_000643" "g.45645021T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645021_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746692" "1" "50" "14" "45645022" "45645022" "subst" "4.08417E-6" "04020" "FANCM_000644" "g.45645022T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645022_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746693" "1" "50" "14" "45645040" "45645040" "subst" "0" "04020" "FANCM_000647" "g.45645040A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645040_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746694" "1" "50" "14" "45645061" "45645061" "subst" "4.0815E-6" "04020" "FANCM_000651" "g.45645061C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645061_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746695" "1" "50" "14" "45645063" "45645063" "subst" "0" "04020" "FANCM_000652" "g.45645063T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645063_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746696" "1" "50" "14" "45645070" "45645070" "subst" "0" "04020" "FANCM_000653" "g.45645070T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645070_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746697" "1" "50" "14" "45645085" "45645085" "subst" "0" "04020" "FANCM_000655" "g.45645085T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645085_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746698" "1" "50" "14" "45645101" "45645101" "subst" "0" "04020" "FANCM_000656" "g.45645101T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645101_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746699" "1" "50" "14" "45645106" "45645106" "subst" "0" "04020" "FANCM_000657" "g.45645106A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645106_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746700" "1" "50" "14" "45645109" "45645109" "subst" "0" "04020" "FANCM_000659" "g.45645109T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645109_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746701" "1" "50" "14" "45645114" "45645114" "subst" "0" "04020" "FANCM_000660" "g.45645114T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645114_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746702" "1" "50" "14" "45645133" "45645133" "subst" "0" "04020" "FANCM_000662" "g.45645133A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645133_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746703" "1" "50" "14" "45645139" "45645139" "subst" "0" "04020" "FANCM_000664" "g.45645139C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645139_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746704" "1" "50" "14" "45645147" "45645147" "subst" "4.09068E-6" "04020" "FANCM_000665" "g.45645147A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645147_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746705" "1" "50" "14" "45645160" "45645160" "subst" "0" "04020" "FANCM_000666" "g.45645160A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645160_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746706" "1" "50" "14" "45645214" "45645214" "subst" "0" "04020" "FANCM_000677" "g.45645214A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645214_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746707" "1" "50" "14" "45645228" "45645228" "subst" "0" "04020" "FANCM_000680" "g.45645228A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645228_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746708" "1" "50" "14" "45645240" "45645240" "subst" "0" "04020" "FANCM_000681" "g.45645240G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645240_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746709" "1" "50" "14" "45645244" "45645244" "subst" "0" "04020" "FANCM_000682" "g.45645244C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645244_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746710" "1" "50" "14" "45645246" "45645246" "subst" "4.07435E-6" "04020" "FANCM_000684" "g.45645246A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645246_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746711" "1" "50" "14" "45645250" "45645250" "subst" "8.1493E-6" "04020" "FANCM_000685" "g.45645250A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645250_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746712" "1" "50" "14" "45645264" "45645264" "subst" "0" "04020" "FANCM_000687" "g.45645264C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645264_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746713" "1" "50" "14" "45645265" "45645265" "subst" "0" "04020" "FANCM_000688" "g.45645265A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645265_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746714" "1" "50" "14" "45645270" "45645270" "subst" "0" "04020" "FANCM_000690" "g.45645270A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645270_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746715" "1" "50" "14" "45645280" "45645280" "subst" "4.07289E-6" "04020" "FANCM_000693" "g.45645280A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645280_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746716" "1" "50" "14" "45645296" "45645296" "subst" "0" "04020" "FANCM_000695" "g.45645296G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645296_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746717" "1" "50" "14" "45645306" "45645306" "subst" "0" "04020" "FANCM_000697" "g.45645306G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645306_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746718" "1" "50" "14" "45645309" "45645309" "subst" "0" "04020" "FANCM_000698" "g.45645309G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645309_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746719" "1" "50" "14" "45645312" "45645312" "subst" "4.0711E-6" "04020" "FANCM_000041" "g.45645312G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645312_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746720" "1" "50" "14" "45645330" "45645330" "subst" "0" "04020" "FANCM_000700" "g.45645330G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645330_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746721" "1" "50" "14" "45645340" "45645340" "subst" "0" "04020" "FANCM_000702" "g.45645340C>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645340_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746722" "1" "50" "14" "45645382" "45645382" "subst" "0" "04020" "FANCM_000706" "g.45645382C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645382_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746723" "1" "50" "14" "45645394" "45645394" "subst" "0" "04020" "FANCM_000710" "g.45645394A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645394_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746724" "1" "50" "14" "45645400" "45645400" "subst" "0" "04020" "FANCM_000711" "g.45645400G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645400_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746725" "1" "50" "14" "45645409" "45645409" "subst" "0" "04020" "FANCM_000712" "g.45645409C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645409_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746726" "1" "50" "14" "45645418" "45645418" "subst" "0" "04020" "FANCM_000714" "g.45645418G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645418_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746727" "1" "50" "14" "45645420" "45645420" "subst" "0" "04020" "FANCM_000715" "g.45645420A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645420_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746728" "1" "50" "14" "45645433" "45645433" "subst" "0" "04020" "FANCM_000720" "g.45645433T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645433_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746729" "1" "50" "14" "45645436" "45645436" "subst" "4.06782E-6" "04020" "FANCM_000721" "g.45645436C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645436_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746730" "1" "50" "14" "45645457" "45645457" "subst" "0" "04020" "FANCM_000725" "g.45645457T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645457_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746731" "1" "50" "14" "45645462" "45645462" "subst" "0" "04020" "FANCM_000726" "g.45645462G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645462_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746732" "1" "50" "14" "45645466" "45645466" "subst" "8.13445E-6" "04020" "FANCM_000727" "g.45645466C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645466_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746733" "1" "50" "14" "45645471" "45645471" "subst" "4.06699E-6" "04020" "FANCM_000728" "g.45645471C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645471_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746734" "1" "50" "14" "45645498" "45645498" "subst" "0" "04020" "FANCM_000733" "g.45645498G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645498_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746735" "1" "50" "14" "45645506" "45645506" "subst" "0" "04020" "FANCM_000735" "g.45645506G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645506_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746736" "1" "50" "14" "45645507" "45645507" "subst" "0" "04020" "FANCM_000736" "g.45645507T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645507_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746737" "1" "50" "14" "45645513" "45645513" "subst" "4.06775E-6" "04020" "FANCM_000737" "g.45645513A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645513_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746738" "1" "50" "14" "45645525" "45645525" "subst" "0" "04020" "FANCM_000738" "g.45645525C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645525_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746739" "1" "50" "14" "45645528" "45645528" "subst" "0" "04020" "FANCM_000739" "g.45645528C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645528_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746740" "1" "50" "14" "45645532" "45645532" "subst" "0" "04020" "FANCM_000740" "g.45645532A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645532_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746741" "1" "50" "14" "45645543" "45645543" "subst" "0" "04020" "FANCM_000741" "g.45645543C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645543_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746742" "1" "50" "14" "45645570" "45645570" "subst" "0" "04020" "FANCM_000746" "g.45645570G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645570_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746743" "1" "50" "14" "45645582" "45645582" "subst" "8.16393E-6" "04020" "FANCM_000747" "g.45645582G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645582_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746744" "1" "50" "14" "45645597" "45645597" "subst" "0" "04020" "FANCM_000748" "g.45645597G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645597_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746745" "1" "50" "14" "45645611" "45645611" "subst" "0" "04020" "FANCM_000750" "g.45645611G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645611_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746746" "1" "50" "14" "45645618" "45645618" "subst" "0" "04020" "FANCM_000753" "g.45645618T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645618_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746747" "1" "50" "14" "45645622" "45645622" "subst" "0" "04020" "FANCM_000755" "g.45645622A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645622_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746748" "1" "50" "14" "45645630" "45645630" "subst" "8.16453E-6" "04020" "FANCM_000757" "g.45645630A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645630_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746749" "1" "50" "14" "45645633" "45645633" "subst" "0" "04020" "FANCM_000758" "g.45645633G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645633_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746750" "1" "50" "14" "45645681" "45645681" "subst" "0" "04020" "FANCM_000761" "g.45645681G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645681_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746751" "1" "50" "14" "45645702" "45645702" "subst" "4.15766E-6" "04020" "FANCM_000766" "g.45645702A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645702_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746752" "1" "50" "14" "45645710" "45645710" "subst" "0" "04020" "FANCM_000768" "g.45645710T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645710_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746753" "1" "50" "14" "45645717" "45645717" "subst" "0" "04020" "FANCM_000770" "g.45645717A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645717_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746754" "1" "50" "14" "45645720" "45645720" "subst" "0" "04020" "FANCM_000771" "g.45645720C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645720_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746755" "1" "50" "14" "45645736" "45645736" "subst" "8.44402E-6" "04020" "FANCM_000773" "g.45645736A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645736_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746756" "1" "50" "14" "45645736" "45645736" "subst" "0" "04020" "FANCM_000774" "g.45645736A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645736_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746757" "1" "50" "14" "45645745" "45645745" "subst" "0" "04020" "FANCM_000775" "g.45645745A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645745_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746758" "1" "50" "14" "45645757" "45645757" "subst" "4.21564E-6" "04020" "FANCM_000776" "g.45645757A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645757_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746759" "1" "50" "14" "45645771" "45645771" "subst" "0" "04020" "FANCM_000778" "g.45645771G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645771_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746760" "1" "50" "14" "45645792" "45645792" "subst" "8.2672E-6" "04020" "FANCM_000779" "g.45645792G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645792_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746761" "1" "50" "14" "45645804" "45645804" "subst" "0" "04020" "FANCM_000781" "g.45645804A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645804_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746762" "1" "50" "14" "45645813" "45645813" "subst" "0" "04020" "FANCM_000783" "g.45645813A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645813_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746763" "1" "50" "14" "45645814" "45645814" "subst" "0" "04020" "FANCM_000784" "g.45645814G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645814_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746764" "1" "50" "14" "45645838" "45645838" "subst" "0" "04020" "FANCM_000789" "g.45645838T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645838_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746765" "1" "50" "14" "45645852" "45645852" "subst" "4.0713E-6" "04020" "FANCM_000791" "g.45645852A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645852_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746766" "1" "50" "14" "45645853" "45645853" "subst" "0" "04020" "FANCM_000792" "g.45645853A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645853_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746767" "1" "50" "14" "45645859" "45645859" "subst" "0" "04020" "FANCM_000795" "g.45645859A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645859_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746768" "1" "50" "14" "45645861" "45645861" "subst" "0" "04020" "FANCM_000797" "g.45645861A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645861_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746769" "1" "50" "14" "45645862" "45645862" "subst" "0" "04020" "FANCM_000798" "g.45645862T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645862_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746770" "1" "50" "14" "45645868" "45645868" "subst" "1.22121E-5" "04020" "FANCM_000801" "g.45645868A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645868_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746771" "1" "50" "14" "45645874" "45645874" "subst" "0" "04020" "FANCM_000802" "g.45645874A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645874_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746772" "1" "50" "14" "45645887" "45645887" "subst" "0" "04020" "FANCM_000805" "g.45645887G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645887_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746773" "1" "50" "14" "45645898" "45645898" "subst" "0" "04020" "FANCM_000808" "g.45645898C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645898_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746774" "1" "50" "14" "45645913" "45645913" "subst" "4.0715E-6" "04020" "FANCM_000810" "g.45645913A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645913_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746775" "1" "50" "14" "45645928" "45645928" "subst" "0" "04020" "FANCM_000814" "g.45645928G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645928_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746776" "1" "50" "14" "45645934" "45645934" "subst" "4.07564E-6" "04020" "FANCM_000816" "g.45645934C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645934_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746777" "1" "50" "14" "45645943" "45645943" "subst" "0" "04020" "FANCM_000818" "g.45645943C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645943_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746778" "1" "50" "14" "45645948" "45645948" "subst" "0" "04020" "FANCM_000819" "g.45645948C>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645948_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746779" "1" "50" "14" "45645955" "45645955" "subst" "0" "04020" "FANCM_000820" "g.45645955A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645955_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746780" "1" "50" "14" "45645981" "45645981" "subst" "0" "04020" "FANCM_000826" "g.45645981T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645981_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746781" "1" "50" "14" "45645999" "45645999" "subst" "0" "04020" "FANCM_000831" "g.45645999A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645999_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746782" "1" "50" "14" "45646009" "45646009" "subst" "0" "04020" "FANCM_000832" "g.45646009C>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646009_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746783" "1" "50" "14" "45646025" "45646025" "subst" "4.13979E-6" "04020" "FANCM_000834" "g.45646025A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646025_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746784" "1" "50" "14" "45646063" "45646063" "subst" "4.53672E-5" "04020" "FANCM_000840" "g.45646063A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646063_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746785" "1" "50" "14" "45646090" "45646090" "subst" "0" "04020" "FANCM_000843" "g.45646090A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646090_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746786" "1" "50" "14" "45646095" "45646095" "subst" "0" "04020" "FANCM_000844" "g.45646095A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646095_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746787" "1" "50" "14" "45646103" "45646103" "subst" "0" "04020" "FANCM_000845" "g.45646103T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646103_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746788" "1" "50" "14" "45646105" "45646105" "subst" "0" "04020" "FANCM_000847" "g.45646105A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646105_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746789" "1" "50" "14" "45646120" "45646120" "subst" "0" "04020" "FANCM_000849" "g.45646120T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646120_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746790" "1" "50" "14" "45646177" "45646177" "subst" "8.34808E-6" "04020" "FANCM_000858" "g.45646177A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646177_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746791" "1" "50" "14" "45650633" "45650633" "subst" "4.08991E-6" "04020" "FANCM_000859" "g.45650633A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650633_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746792" "1" "50" "14" "45650641" "45650641" "subst" "0" "04020" "FANCM_000020" "g.45650641T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650641_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746793" "1" "50" "14" "45650650" "45650650" "subst" "0" "04020" "FANCM_000865" "g.45650650A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650650_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746794" "1" "50" "14" "45650653" "45650653" "subst" "0" "04020" "FANCM_000866" "g.45650653A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650653_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746795" "1" "50" "14" "45650654" "45650654" "subst" "0" "04020" "FANCM_000867" "g.45650654A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650654_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746796" "1" "50" "14" "45650656" "45650656" "subst" "4.07103E-6" "04020" "FANCM_000868" "g.45650656G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650656_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746797" "1" "50" "14" "45650663" "45650663" "subst" "0" "04020" "FANCM_000870" "g.45650663A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650663_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746798" "1" "50" "14" "45650666" "45650666" "subst" "0" "04020" "FANCM_000872" "g.45650666A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650666_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746799" "1" "50" "14" "45650675" "45650675" "subst" "0" "04020" "FANCM_000875" "g.45650675T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650675_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746800" "1" "50" "14" "45650678" "45650678" "subst" "0" "04020" "FANCM_000876" "g.45650678T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650678_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746801" "1" "50" "14" "45650683" "45650683" "subst" "0" "04020" "FANCM_000879" "g.45650683A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650683_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746802" "1" "50" "14" "45650686" "45650686" "subst" "0" "04020" "FANCM_000880" "g.45650686A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650686_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746803" "1" "50" "14" "45650686" "45650686" "subst" "0" "04020" "FANCM_000881" "g.45650686A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650686_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746804" "1" "50" "14" "45650693" "45650693" "subst" "0" "04020" "FANCM_000883" "g.45650693A>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650693_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746805" "1" "50" "14" "45650695" "45650695" "subst" "0" "04020" "FANCM_000885" "g.45650695A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650695_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746806" "1" "50" "14" "45650695" "45650695" "subst" "0" "04020" "FANCM_000886" "g.45650695A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650695_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746807" "1" "50" "14" "45650698" "45650698" "subst" "0" "04020" "FANCM_000888" "g.45650698G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650698_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746808" "1" "50" "14" "45650705" "45650705" "subst" "4.06696E-6" "04020" "FANCM_000890" "g.45650705G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650705_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746809" "1" "50" "14" "45650708" "45650708" "subst" "0" "04020" "FANCM_000891" "g.45650708A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650708_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746810" "1" "50" "14" "45650839" "45650839" "subst" "7.34688E-5" "04020" "FANCM_000894" "g.45650839G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650839_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746811" "1" "50" "14" "45650840" "45650840" "subst" "0" "04020" "FANCM_000895" "g.45650840G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650840_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746812" "1" "50" "14" "45650844" "45650844" "subst" "0" "04020" "FANCM_000897" "g.45650844A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650844_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746813" "1" "50" "14" "45650845" "45650845" "subst" "0" "04020" "FANCM_000898" "g.45650845G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650845_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746814" "1" "50" "14" "45650849" "45650849" "subst" "0" "04020" "FANCM_000900" "g.45650849A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650849_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746815" "1" "50" "14" "45650858" "45650858" "subst" "0" "04020" "FANCM_000901" "g.45650858G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650858_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746816" "1" "50" "14" "45650865" "45650865" "subst" "0" "04020" "FANCM_000903" "g.45650865C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650865_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746817" "1" "50" "14" "45650865" "45650865" "subst" "8.1642E-6" "04020" "FANCM_000904" "g.45650865C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650865_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746818" "1" "50" "14" "45650868" "45650868" "subst" "4.083E-6" "04020" "FANCM_000905" "g.45650868C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650868_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746819" "1" "50" "14" "45650884" "45650884" "subst" "0" "04020" "FANCM_000908" "g.45650884A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650884_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746820" "1" "50" "14" "45650891" "45650891" "subst" "0" "04020" "FANCM_000912" "g.45650891A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650891_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746821" "1" "50" "14" "45650892" "45650892" "subst" "0" "04020" "FANCM_000913" "g.45650892G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650892_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746822" "1" "50" "14" "45653016" "45653016" "subst" "0" "04020" "FANCM_000925" "g.45653016A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653016_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746823" "1" "50" "14" "45653043" "45653043" "subst" "0" "04020" "FANCM_000931" "g.45653043A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653043_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746824" "1" "50" "14" "45653043" "45653043" "subst" "0" "04020" "FANCM_000932" "g.45653043A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653043_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746825" "1" "50" "14" "45653067" "45653067" "subst" "4.0703E-6" "04020" "FANCM_000936" "g.45653067A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653067_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746826" "1" "50" "14" "45653070" "45653070" "subst" "4.07156E-6" "04020" "FANCM_000938" "g.45653070G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653070_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746827" "1" "50" "14" "45653073" "45653073" "subst" "2.03517E-5" "04020" "FANCM_000940" "g.45653073A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653073_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746828" "1" "50" "14" "45653079" "45653079" "subst" "0" "04020" "FANCM_000941" "g.45653079G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653079_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746829" "1" "50" "14" "45653080" "45653080" "subst" "0" "04020" "FANCM_000942" "g.45653080T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653080_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746830" "1" "50" "14" "45653091" "45653091" "subst" "1.22261E-5" "04020" "FANCM_000943" "g.45653091C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653091_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746831" "1" "50" "14" "45653097" "45653097" "subst" "0" "04020" "FANCM_000945" "g.45653097C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653097_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746832" "1" "50" "14" "45653106" "45653106" "subst" "0" "04020" "FANCM_000948" "g.45653106G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653106_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746833" "1" "50" "14" "45654429" "45654429" "subst" "4.11462E-6" "04020" "FANCM_000950" "g.45654429A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654429_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746834" "1" "50" "14" "45654431" "45654431" "subst" "0" "04020" "FANCM_000952" "g.45654431G>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654431_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746835" "1" "50" "14" "45654433" "45654433" "subst" "0" "04020" "FANCM_000953" "g.45654433A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654433_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746836" "1" "50" "14" "45654447" "45654447" "subst" "0" "04020" "FANCM_000957" "g.45654447G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654447_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746837" "1" "50" "14" "45654448" "45654448" "subst" "0" "04020" "FANCM_000960" "g.45654448A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654448_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746838" "1" "50" "14" "45654478" "45654478" "subst" "8.2122E-6" "04020" "FANCM_000967" "g.45654478A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654478_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746839" "1" "50" "14" "45654495" "45654495" "subst" "0" "04020" "FANCM_000968" "g.45654495A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654495_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746840" "1" "50" "14" "45654498" "45654498" "subst" "0" "04020" "FANCM_000969" "g.45654498G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654498_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746841" "1" "50" "14" "45654513" "45654513" "subst" "8.28041E-6" "04020" "FANCM_000972" "g.45654513G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654513_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746842" "1" "50" "14" "45654520" "45654520" "subst" "4.12344E-6" "04020" "FANCM_000973" "g.45654520A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654520_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746843" "1" "50" "14" "45654522" "45654522" "subst" "4.13603E-6" "04020" "FANCM_000974" "g.45654522T>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654522_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746844" "1" "50" "14" "45654531" "45654531" "subst" "0" "04020" "FANCM_000977" "g.45654531C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654531_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746845" "1" "50" "14" "45654561" "45654561" "subst" "0" "04020" "FANCM_000982" "g.45654561T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654561_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746846" "1" "50" "14" "45656983" "45656983" "subst" "0" "04020" "FANCM_000986" "g.45656983G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45656983_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746847" "1" "50" "14" "45656986" "45656986" "subst" "0" "04020" "FANCM_000987" "g.45656986T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45656986_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746848" "1" "50" "14" "45656994" "45656994" "subst" "0" "04020" "FANCM_000988" "g.45656994G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45656994_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746849" "1" "50" "14" "45656995" "45656995" "subst" "0" "04020" "FANCM_000989" "g.45656995A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45656995_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746850" "1" "50" "14" "45657007" "45657007" "subst" "1.6304E-5" "04020" "FANCM_000991" "g.45657007A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657007_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746851" "1" "50" "14" "45657014" "45657014" "subst" "8.14837E-6" "04020" "FANCM_000992" "g.45657014C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657014_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746852" "1" "50" "14" "45657020" "45657020" "subst" "0" "04020" "FANCM_000994" "g.45657020G>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657020_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746853" "1" "50" "14" "45657028" "45657028" "subst" "8.14166E-6" "04020" "FANCM_000996" "g.45657028A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657028_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746854" "1" "50" "14" "45657032" "45657032" "subst" "0" "04020" "FANCM_000997" "g.45657032T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657032_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746855" "1" "50" "14" "45657037" "45657037" "subst" "0" "04020" "FANCM_000998" "g.45657037A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657037_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746856" "1" "50" "14" "45657070" "45657070" "subst" "0" "04020" "FANCM_001002" "g.45657070A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657070_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746857" "1" "50" "14" "45658033" "45658033" "subst" "0" "04020" "FANCM_001010" "g.45658033A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658033_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746858" "1" "50" "14" "45658039" "45658039" "subst" "0" "04020" "FANCM_001011" "g.45658039G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658039_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746859" "1" "50" "14" "45658066" "45658066" "subst" "0" "04020" "FANCM_001014" "g.45658066G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658066_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746860" "1" "50" "14" "45658071" "45658071" "subst" "0" "04020" "FANCM_001015" "g.45658071G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658071_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746861" "1" "50" "14" "45658120" "45658120" "subst" "0" "04020" "FANCM_001020" "g.45658120A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658120_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746862" "1" "50" "14" "45658140" "45658140" "subst" "0" "04020" "FANCM_001023" "g.45658140A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658140_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746863" "1" "50" "14" "45658150" "45658150" "subst" "0" "04020" "FANCM_001024" "g.45658150A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658150_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746864" "1" "50" "14" "45658159" "45658159" "subst" "4.06835E-6" "04020" "FANCM_001027" "g.45658159G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658159_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746865" "1" "50" "14" "45658180" "45658180" "subst" "0" "04020" "FANCM_001034" "g.45658180T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658180_T_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746866" "1" "50" "14" "45658266" "45658266" "subst" "0" "04020" "FANCM_001040" "g.45658266A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658266_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746867" "1" "50" "14" "45658267" "45658267" "subst" "0" "04020" "FANCM_001042" "g.45658267A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658267_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746868" "1" "50" "14" "45658277" "45658277" "subst" "4.06607E-6" "04020" "FANCM_001045" "g.45658277A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658277_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746869" "1" "50" "14" "45658278" "45658278" "subst" "0" "04020" "FANCM_001046" "g.45658278G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658278_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746870" "1" "50" "14" "45658291" "45658291" "subst" "4.06686E-6" "04020" "FANCM_001048" "g.45658291C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658291_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746871" "1" "50" "14" "45658332" "45658332" "subst" "4.06474E-6" "04020" "FANCM_001056" "g.45658332C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658332_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746872" "1" "50" "14" "45658350" "45658350" "subst" "4.06428E-6" "04020" "FANCM_001060" "g.45658350C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658350_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746873" "1" "50" "14" "45658380" "45658380" "subst" "4.06527E-6" "04020" "FANCM_001070" "g.45658380C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658380_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746874" "1" "50" "14" "45658390" "45658390" "subst" "0" "04020" "FANCM_001072" "g.45658390C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658390_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746875" "1" "50" "14" "45658417" "45658417" "subst" "0" "04020" "FANCM_001074" "g.45658417G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658417_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746876" "1" "50" "14" "45658422" "45658422" "subst" "8.13332E-6" "04020" "FANCM_001075" "g.45658422C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658422_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746877" "1" "50" "14" "45658423" "45658423" "subst" "0" "04020" "FANCM_001076" "g.45658423A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658423_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746878" "1" "50" "14" "45658429" "45658429" "subst" "8.13491E-6" "04020" "FANCM_001079" "g.45658429C>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658429_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746879" "1" "50" "14" "45658465" "45658465" "subst" "4.06878E-6" "04020" "FANCM_001082" "g.45658465A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658465_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746880" "1" "50" "14" "45658492" "45658492" "subst" "0" "04020" "FANCM_001084" "g.45658492T>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658492_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746881" "1" "50" "14" "45658518" "45658518" "subst" "4.06653E-6" "04020" "FANCM_001090" "g.45658518A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658518_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746882" "1" "50" "14" "45658521" "45658521" "subst" "0" "04020" "FANCM_001091" "g.45658521G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658521_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746883" "1" "50" "14" "45658534" "45658534" "subst" "0" "04020" "FANCM_001093" "g.45658534A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658534_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746884" "1" "50" "14" "45658538" "45658538" "subst" "4.06679E-6" "04020" "FANCM_001094" "g.45658538C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658538_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746885" "1" "50" "14" "45658566" "45658566" "subst" "0" "04020" "FANCM_001097" "g.45658566G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658566_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746886" "1" "50" "14" "45665399" "45665399" "subst" "0" "04020" "FANCM_001102" "g.45665399A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665399_A_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746887" "1" "50" "14" "45665406" "45665406" "subst" "4.06197E-6" "04020" "FANCM_001103" "g.45665406C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665406_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746888" "1" "50" "14" "45665408" "45665408" "subst" "0" "04020" "FANCM_001104" "g.45665408G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665408_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746889" "1" "50" "14" "45665427" "45665427" "subst" "0" "04020" "FANCM_001108" "g.45665427C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665427_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746890" "1" "50" "14" "45665430" "45665430" "subst" "4.0621E-6" "04020" "FANCM_001109" "g.45665430G>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665430_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746891" "1" "50" "14" "45665499" "45665499" "subst" "0" "04020" "FANCM_001121" "g.45665499T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665499_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746892" "1" "50" "14" "45665502" "45665502" "subst" "0" "04020" "FANCM_001122" "g.45665502G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665502_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746893" "1" "50" "14" "45665510" "45665510" "subst" "0" "04020" "FANCM_001124" "g.45665510G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665510_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746894" "1" "50" "14" "45665522" "45665522" "subst" "0" "04020" "FANCM_001125" "g.45665522G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665522_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746895" "1" "50" "14" "45665566" "45665566" "subst" "0" "04020" "FANCM_001131" "g.45665566A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665566_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746896" "1" "50" "14" "45665577" "45665577" "subst" "0" "04020" "FANCM_001133" "g.45665577G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665577_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746897" "1" "50" "14" "45665612" "45665612" "subst" "1.21834E-5" "04020" "FANCM_001136" "g.45665612C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665612_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746898" "1" "50" "14" "45665615" "45665615" "subst" "2.03061E-5" "04020" "FANCM_001138" "g.45665615A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665615_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746899" "1" "50" "14" "45665624" "45665624" "subst" "0" "04020" "FANCM_001140" "g.45665624G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665624_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746900" "1" "50" "14" "45665645" "45665645" "subst" "8.12328E-6" "04020" "FANCM_001143" "g.45665645A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665645_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746901" "1" "50" "14" "45665646" "45665646" "subst" "0" "04020" "FANCM_001144" "g.45665646T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665646_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746902" "1" "50" "14" "45665674" "45665674" "subst" "0" "04020" "FANCM_001146" "g.45665674C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665674_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746903" "1" "50" "14" "45665696" "45665696" "subst" "0" "04020" "FANCM_001150" "g.45665696C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665696_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746904" "1" "50" "14" "45665702" "45665702" "subst" "8.12651E-6" "04020" "FANCM_000031" "g.45665702A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665702_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746905" "1" "50" "14" "45665713" "45665713" "subst" "4.06478E-6" "04020" "FANCM_001151" "g.45665713A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665713_A_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746906" "1" "50" "14" "45665715" "45665715" "subst" "8.12968E-6" "04020" "FANCM_001152" "g.45665715T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665715_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746907" "1" "50" "14" "45665718" "45665718" "subst" "0" "04020" "FANCM_001155" "g.45665718G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665718_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746908" "1" "50" "14" "45667850" "45667850" "subst" "0" "04020" "FANCM_001159" "g.45667850A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667850_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746909" "1" "50" "14" "45667862" "45667862" "subst" "0" "04020" "FANCM_001164" "g.45667862T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667862_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746910" "1" "50" "14" "45667863" "45667863" "subst" "0" "04020" "FANCM_001165" "g.45667863G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667863_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746911" "1" "50" "14" "45667874" "45667874" "subst" "0" "04020" "FANCM_001167" "g.45667874C>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667874_C_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746912" "1" "50" "14" "45667903" "45667903" "subst" "0" "04020" "FANCM_001177" "g.45667903T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667903_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746913" "1" "50" "14" "45667922" "45667922" "subst" "0" "04020" "FANCM_001182" "g.45667922G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667922_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746914" "1" "50" "14" "45667939" "45667939" "subst" "0" "04020" "FANCM_001186" "g.45667939T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667939_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746915" "1" "50" "14" "45667954" "45667954" "subst" "1.21876E-5" "04020" "FANCM_001189" "g.45667954G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667954_G_A" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746916" "1" "50" "14" "45667973" "45667973" "subst" "0" "04020" "FANCM_001194" "g.45667973T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667973_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746917" "1" "50" "14" "45667994" "45667994" "subst" "0" "04020" "FANCM_001196" "g.45667994A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667994_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746918" "1" "50" "14" "45668000" "45668000" "subst" "0" "04020" "FANCM_001199" "g.45668000T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668000_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746919" "1" "50" "14" "45668002" "45668002" "subst" "0" "04020" "FANCM_001200" "g.45668002G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668002_G_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746920" "1" "50" "14" "45668012" "45668012" "subst" "0" "04020" "FANCM_001202" "g.45668012T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668012_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746921" "1" "50" "14" "45668032" "45668032" "subst" "0" "04020" "FANCM_001206" "g.45668032A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668032_A_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746922" "1" "50" "14" "45668067" "45668067" "subst" "0" "04020" "FANCM_001209" "g.45668067T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668067_T_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746923" "1" "50" "14" "45669074" "45669074" "subst" "4.06593E-6" "04020" "FANCM_001218" "g.45669074T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669074_T_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746924" "1" "50" "14" "45669104" "45669104" "subst" "0" "04020" "FANCM_001223" "g.45669104G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669104_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746925" "1" "50" "14" "45669145" "45669145" "subst" "4.06573E-6" "04020" "FANCM_001228" "g.45669145C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669145_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746926" "1" "50" "14" "45669170" "45669170" "subst" "0" "04020" "FANCM_001231" "g.45669170C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669170_C_G" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746927" "1" "50" "14" "45669170" "45669170" "subst" "0" "04020" "FANCM_000028" "g.45669170C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669170_C_T" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000746928" "1" "50" "14" "45669176" "45669176" "subst" "0" "04020" "FANCM_001232" "g.45669176G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669176_G_C" "not in 53461 controls; the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750168" "1" "50" "14" "45606314" "45606314" "dup" "0" "04020" "FANCM_000168" "g.45606314dup" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606312_T_TA" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750169" "1" "50" "14" "45624628" "45624629" "ins" "0" "04020" "FANCM_000327" "g.45624628_45624629insCAAAGTTAAA" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624626_G_GAACAAAGTTA" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750170" "1" "50" "14" "45628393" "45628393" "dup" "0" "04020" "FANCM_000050" "g.45628393dup" "8/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628392_C_CA" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750171" "1" "50" "14" "45633704" "45633704" "del" "0" "04020" "FANCM_000398" "g.45633704del" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633701_TG_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750172" "1" "50" "14" "45639936" "45639937" "del" "0" "04020" "FANCM_000471" "g.45639936_45639937del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639934_TGA_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750173" "1" "50" "14" "45644543" "45644546" "del" "0" "04020" "FANCM_000049" "g.45644543_45644546del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644539_TAAAA_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750174" "1" "50" "14" "45645982" "45645983" "del" "0" "04020" "FANCM_000828" "g.45645982_45645983del" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645977_ACT_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750175" "1" "50" "14" "45650695" "45650695" "del" "0" "04020" "FANCM_000887" "g.45650695del" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650691_TA_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000750259" "1" "50" "14" "45606310" "45606311" "delins" "0" "04020" "FANCM_000167" "g.45606310_45606311delinsCT" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606310_AG_CT" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752325" "1" "50" "14" "45605287" "45605287" "subst" "0.000134991" "04020" "FANCM_000006" "g.45605287G>A" "17/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605287_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752326" "1" "50" "14" "45605290" "45605290" "subst" "4.08781E-6" "04020" "FANCM_000079" "g.45605290C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605290_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752327" "1" "50" "14" "45605293" "45605293" "subst" "0.000114421" "04020" "FANCM_000080" "g.45605293C>G" "12/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605293_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752328" "1" "50" "14" "45605302" "45605302" "subst" "8.16413E-6" "04020" "FANCM_000082" "g.45605302C>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605302_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752329" "1" "50" "14" "45605338" "45605338" "subst" "0" "04020" "FANCM_000093" "g.45605338C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605338_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752330" "1" "50" "14" "45605389" "45605389" "subst" "0" "04020" "FANCM_000100" "g.45605389C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605389_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752331" "1" "50" "14" "45605397" "45605397" "subst" "0.000320817" "04020" "FANCM_000103" "g.45605397G>A" "67/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605397_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752332" "1" "50" "14" "45605413" "45605413" "subst" "4.06075E-5" "04020" "FANCM_000053" "g.45605413C>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605413_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752333" "1" "50" "14" "45605413" "45605413" "subst" "4.06075E-6" "04020" "FANCM_000105" "g.45605413C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605413_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752334" "1" "50" "14" "45605423" "45605423" "subst" "0" "04020" "FANCM_000108" "g.45605423G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605423_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752335" "1" "50" "14" "45605454" "45605454" "subst" "1.22733E-5" "04020" "FANCM_000112" "g.45605454G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605454_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752336" "1" "50" "14" "45605476" "45605476" "subst" "0.000178683" "04020" "FANCM_000114" "g.45605476C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605476_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752337" "1" "50" "14" "45605503" "45605503" "subst" "0.00029236" "04020" "FANCM_000120" "g.45605503C>T" "58/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605503_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752338" "1" "50" "14" "45605515" "45605515" "subst" "4.06058E-6" "04020" "FANCM_000122" "g.45605515A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605515_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752339" "1" "50" "14" "45605656" "45605656" "subst" "8.14153E-6" "04020" "FANCM_000145" "g.45605656C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605656_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752340" "1" "50" "14" "45605658" "45605658" "subst" "0" "04020" "FANCM_000147" "g.45605658C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605658_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752341" "1" "50" "14" "45605677" "45605677" "subst" "8.15847E-6" "04020" "FANCM_000150" "g.45605677C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605677_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752342" "1" "50" "14" "45605695" "45605695" "subst" "2.86046E-5" "04020" "FANCM_000151" "g.45605695G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605695_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752343" "1" "50" "14" "45605730" "45605730" "subst" "2.87116E-5" "04020" "FANCM_000157" "g.45605730G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605730_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752344" "1" "50" "14" "45606301" "45606301" "subst" "0.000134087" "04020" "FANCM_000163" "g.45606301A>G" "28/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606301_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752345" "1" "50" "14" "45606310" "45606310" "subst" "0.000195027" "04020" "FANCM_000166" "g.45606310A>C" "41/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606310_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752346" "1" "50" "14" "45606320" "45606320" "subst" "0" "04020" "FANCM_000171" "g.45606320T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606320_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752347" "1" "50" "14" "45606328" "45606328" "subst" "8.12665E-6" "04020" "FANCM_000172" "g.45606328C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606328_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752348" "1" "50" "14" "45606394" "45606394" "subst" "0" "04020" "FANCM_000180" "g.45606394T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606394_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752349" "1" "50" "14" "45606398" "45606398" "subst" "8.13392E-6" "04020" "FANCM_000182" "g.45606398T>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606398_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752350" "1" "50" "14" "45606418" "45606418" "subst" "0" "04020" "FANCM_000184" "g.45606418G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606418_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752351" "1" "50" "14" "45606425" "45606425" "subst" "0" "04020" "FANCM_000186" "g.45606425G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606425_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752352" "1" "50" "14" "45606428" "45606428" "subst" "0" "04020" "FANCM_000187" "g.45606428A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606428_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752353" "1" "50" "14" "45609862" "45609862" "subst" "1.6284E-5" "04020" "FANCM_000191" "g.45609862A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609862_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752354" "1" "50" "14" "45609863" "45609863" "subst" "0" "04020" "FANCM_000192" "g.45609863A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609863_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752355" "1" "50" "14" "45609913" "45609913" "subst" "8.16227E-6" "04020" "FANCM_000199" "g.45609913G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609913_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752356" "1" "50" "14" "45618055" "45618055" "subst" "2.84453E-5" "04020" "FANCM_000204" "g.45618055A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618055_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752357" "1" "50" "14" "45618088" "45618088" "subst" "0.00015032" "04020" "FANCM_000207" "g.45618088C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618088_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752358" "1" "50" "14" "45618124" "45618124" "subst" "0" "04020" "FANCM_000214" "g.45618124C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618124_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752359" "1" "50" "14" "45618148" "45618148" "subst" "2.0312E-5" "04020" "FANCM_000218" "g.45618148A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618148_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752360" "1" "50" "14" "45618149" "45618149" "subst" "3.65586E-5" "04020" "FANCM_000219" "g.45618149T>C" "13/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618149_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752361" "1" "50" "14" "45618154" "45618154" "subst" "4.06286E-6" "04020" "FANCM_000221" "g.45618154C>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618154_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752362" "1" "50" "14" "45618155" "45618155" "subst" "4.06303E-5" "04020" "FANCM_000222" "g.45618155C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618155_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752363" "1" "50" "14" "45618176" "45618176" "subst" "4.06293E-6" "04020" "FANCM_000224" "g.45618176C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618176_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752364" "1" "50" "14" "45618182" "45618182" "subst" "0" "04020" "FANCM_000226" "g.45618182A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618182_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752365" "1" "50" "14" "45620606" "45620606" "subst" "1.22082E-5" "04020" "FANCM_000230" "g.45620606G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620606_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752366" "1" "50" "14" "45620619" "45620619" "subst" "5.28791E-5" "04020" "FANCM_000234" "g.45620619G>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620619_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752367" "1" "50" "14" "45620631" "45620631" "subst" "2.033E-5" "04020" "FANCM_000236" "g.45620631A>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620631_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752368" "1" "50" "14" "45620644" "45620644" "subst" "1.62611E-5" "04020" "FANCM_000237" "g.45620644G>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620644_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752369" "1" "50" "14" "45620655" "45620655" "subst" "0" "04020" "FANCM_000240" "g.45620655A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620655_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752370" "1" "50" "14" "45620721" "45620721" "subst" "0.000487841" "04020" "FANCM_000251" "g.45620721C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620721_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752371" "1" "50" "14" "45620730" "45620730" "subst" "0" "04020" "FANCM_000252" "g.45620730T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620730_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752372" "1" "50" "14" "45623169" "45623169" "subst" "8.12605E-6" "04020" "FANCM_000257" "g.45623169G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623169_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752373" "1" "50" "14" "45623203" "45623203" "subst" "1.6252E-5" "04020" "FANCM_000263" "g.45623203G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623203_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752374" "1" "50" "14" "45623204" "45623204" "subst" "1.21885E-5" "04020" "FANCM_000264" "g.45623204G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623204_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752375" "1" "50" "14" "45623908" "45623908" "subst" "4.09655E-5" "04020" "FANCM_000274" "g.45623908C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623908_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752376" "1" "50" "14" "45623909" "45623909" "subst" "0.000176092" "04020" "FANCM_000275" "g.45623909G>A" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623909_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752377" "1" "50" "14" "45623912" "45623912" "subst" "0" "04020" "FANCM_000276" "g.45623912C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623912_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752378" "1" "50" "14" "45623938" "45623938" "subst" "5.71088E-5" "04020" "FANCM_000054" "g.45623938G>C" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623938_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752379" "1" "50" "14" "45623947" "45623947" "subst" "0" "04020" "FANCM_000285" "g.45623947A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623947_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752380" "1" "50" "14" "45623951" "45623951" "subst" "0" "04020" "FANCM_000286" "g.45623951T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623951_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752381" "1" "50" "14" "45623954" "45623954" "subst" "4.07448E-6" "04020" "FANCM_000288" "g.45623954A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623954_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752382" "1" "50" "14" "45623980" "45623980" "subst" "2.03877E-5" "04020" "FANCM_000295" "g.45623980C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623980_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752383" "1" "50" "14" "45623986" "45623986" "subst" "2.8516E-5" "04020" "FANCM_000298" "g.45623986C>T" "8/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623986_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752384" "1" "50" "14" "45623987" "45623987" "subst" "8.15255E-6" "04020" "FANCM_000299" "g.45623987G>A" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623987_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752385" "1" "50" "14" "45624010" "45624010" "subst" "0" "04020" "FANCM_000303" "g.45624010T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624010_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752386" "1" "50" "14" "45624016" "45624016" "subst" "0" "04020" "FANCM_000305" "g.45624016A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624016_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752387" "1" "50" "14" "45624585" "45624585" "subst" "0" "04020" "FANCM_000312" "g.45624585A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624585_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752388" "1" "50" "14" "45624624" "45624624" "subst" "4.06891E-6" "04020" "FANCM_000325" "g.45624624T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624624_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752389" "1" "50" "14" "45624632" "45624632" "subst" "2.84659E-5" "04020" "FANCM_000328" "g.45624632G>A" "10/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624632_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752390" "1" "50" "14" "45624642" "45624642" "subst" "0" "04020" "FANCM_000331" "g.45624642A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624642_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752391" "1" "50" "14" "45624660" "45624660" "subst" "1.21982E-5" "04020" "FANCM_000338" "g.45624660A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624660_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752392" "1" "50" "14" "45628298" "45628298" "subst" "0" "04020" "FANCM_000340" "g.45628298G>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628298_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752393" "1" "50" "14" "45628304" "45628304" "subst" "0" "04020" "FANCM_000341" "g.45628304A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628304_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752394" "1" "50" "14" "45628313" "45628313" "subst" "6.19958E-5" "04020" "FANCM_000345" "g.45628313G>A" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628313_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752395" "1" "50" "14" "45628317" "45628317" "subst" "4.11276E-6" "04020" "FANCM_000346" "g.45628317A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628317_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752396" "1" "50" "14" "45628358" "45628358" "subst" "0" "04020" "FANCM_000358" "g.45628358C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628358_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752397" "1" "50" "14" "45628364" "45628364" "subst" "2.44035E-5" "04020" "FANCM_000359" "g.45628364A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628364_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752398" "1" "50" "14" "45628394" "45628394" "subst" "0" "04020" "FANCM_000362" "g.45628394C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628394_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752399" "1" "50" "14" "45628411" "45628411" "subst" "6.09389E-5" "04020" "FANCM_000364" "g.45628411T>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628411_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752400" "1" "50" "14" "45628447" "45628447" "subst" "4.06494E-6" "04020" "FANCM_000369" "g.45628447A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628447_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752401" "1" "50" "14" "45628452" "45628452" "subst" "4.06646E-5" "04020" "FANCM_000372" "g.45628452C>T" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628452_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752402" "1" "50" "14" "45633575" "45633575" "subst" "1.62458E-5" "04020" "FANCM_000377" "g.45633575T>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633575_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752403" "1" "50" "14" "45633577" "45633577" "subst" "0.000288393" "04020" "FANCM_000378" "g.45633577C>T" "44/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633577_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752404" "1" "50" "14" "45633578" "45633578" "subst" "0" "04020" "FANCM_000379" "g.45633578G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633578_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752405" "1" "50" "14" "45633584" "45633584" "subst" "0" "04020" "FANCM_000382" "g.45633584G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633584_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752406" "1" "50" "14" "45633596" "45633596" "subst" "8.12348E-6" "04020" "FANCM_000383" "g.45633596C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633596_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752407" "1" "50" "14" "45633616" "45633616" "subst" "5.28017E-5" "04020" "FANCM_000385" "g.45633616G>A" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633616_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752408" "1" "50" "14" "45633637" "45633637" "subst" "0" "04020" "FANCM_000388" "g.45633637G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633637_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752409" "1" "50" "14" "45633647" "45633647" "subst" "0.000125921" "04020" "FANCM_000014" "g.45633647A>G" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633647_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752410" "1" "50" "14" "45633682" "45633682" "subst" "1.21863E-5" "04020" "FANCM_000394" "g.45633682A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633682_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752411" "1" "50" "14" "45633697" "45633697" "subst" "4.0626E-6" "04020" "FANCM_000395" "g.45633697C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633697_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752412" "1" "50" "14" "45633698" "45633698" "subst" "3.65663E-5" "04020" "FANCM_000396" "g.45633698G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633698_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752413" "1" "50" "14" "45633715" "45633715" "subst" "1.21884E-5" "04020" "FANCM_000399" "g.45633715C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633715_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752414" "1" "50" "14" "45633721" "45633721" "subst" "0.000341375" "04020" "FANCM_000400" "g.45633721C>T" "21/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633721_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752415" "1" "50" "14" "45633736" "45633736" "subst" "1.2206E-5" "04020" "FANCM_000403" "g.45633736G>C" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633736_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752416" "1" "50" "14" "45633740" "45633740" "subst" "0.000113996" "04020" "FANCM_000404" "g.45633740T>C" "13/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633740_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752417" "1" "50" "14" "45633757" "45633757" "subst" "0" "04020" "FANCM_000406" "g.45633757C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633757_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752418" "1" "50" "14" "45636188" "45636188" "subst" "0" "04020" "FANCM_000419" "g.45636188A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636188_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752419" "1" "50" "14" "45636213" "45636213" "subst" "0.00013413" "04020" "FANCM_000423" "g.45636213C>G" "27/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636213_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752420" "1" "50" "14" "45636244" "45636244" "subst" "4.06448E-6" "04020" "FANCM_000429" "g.45636244G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636244_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752421" "1" "50" "14" "45636244" "45636244" "subst" "2.43869E-5" "04020" "FANCM_000430" "g.45636244G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636244_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752422" "1" "50" "14" "45636297" "45636297" "subst" "0" "04020" "FANCM_000438" "g.45636297G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636297_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752423" "1" "50" "14" "45636298" "45636298" "subst" "4.06501E-6" "04020" "FANCM_000440" "g.45636298G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636298_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752424" "1" "50" "14" "45636301" "45636301" "subst" "0" "04020" "FANCM_000441" "g.45636301T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636301_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752425" "1" "50" "14" "45636312" "45636312" "subst" "4.06521E-6" "04020" "FANCM_000443" "g.45636312G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636312_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752426" "1" "50" "14" "45636318" "45636318" "subst" "0" "04020" "FANCM_000444" "g.45636318C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636318_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752427" "1" "50" "14" "45636324" "45636324" "subst" "2.4395E-5" "04020" "FANCM_000445" "g.45636324C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636324_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752428" "1" "50" "14" "45636336" "45636336" "subst" "8.13286E-5" "04020" "FANCM_000003" "g.45636336C>T" "18/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636336_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752429" "1" "50" "14" "45636360" "45636360" "subst" "0.000150598" "04020" "FANCM_000450" "g.45636360A>G" "24/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636360_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752430" "1" "50" "14" "45639943" "45639943" "subst" "4.0658E-6" "04020" "FANCM_000475" "g.45639943C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639943_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752431" "1" "50" "14" "45642287" "45642287" "subst" "6.10635E-5" "04020" "FANCM_000483" "g.45642287A>T" "11/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642287_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752432" "1" "50" "14" "45642288" "45642288" "subst" "0" "04020" "FANCM_000484" "g.45642288C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642288_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752433" "1" "50" "14" "45642312" "45642312" "subst" "8.13107E-6" "04020" "FANCM_000490" "g.45642312T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642312_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752434" "1" "50" "14" "45642331" "45642331" "subst" "1.62617E-5" "04020" "FANCM_000495" "g.45642331C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642331_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752435" "1" "50" "14" "45642333" "45642333" "subst" "1.62611E-5" "04020" "FANCM_000496" "g.45642333A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642333_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752436" "1" "50" "14" "45642337" "45642337" "subst" "0.000121953" "04020" "FANCM_000497" "g.45642337A>G" "23/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642337_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752437" "1" "50" "14" "45642363" "45642363" "subst" "3.25235E-5" "04020" "FANCM_000501" "g.45642363C>T" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642363_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752438" "1" "50" "14" "45642364" "45642364" "subst" "0.000654589" "04020" "FANCM_000502" "g.45642364G>A" "10/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642364_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752439" "1" "50" "14" "45642364" "45642364" "subst" "3.65919E-5" "04020" "FANCM_000503" "g.45642364G>T" "8/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642364_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752440" "1" "50" "14" "45642381" "45642381" "subst" "1.21936E-5" "04020" "FANCM_000505" "g.45642381A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642381_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752441" "1" "50" "14" "45642383" "45642383" "subst" "2.84539E-5" "04020" "FANCM_000507" "g.45642383G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642383_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752442" "1" "50" "14" "45642408" "45642408" "subst" "3.65815E-5" "04020" "FANCM_000509" "g.45642408G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642408_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752443" "1" "50" "14" "45644287" "45644287" "subst" "0.000212286" "04020" "FANCM_000514" "g.45644287A>G" "35/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644287_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752444" "1" "50" "14" "45644296" "45644296" "subst" "2.44748E-5" "04020" "FANCM_000515" "g.45644296A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644296_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752445" "1" "50" "14" "45644346" "45644346" "subst" "2.44796E-5" "04020" "FANCM_000525" "g.45644346C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644346_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752446" "1" "50" "14" "45644401" "45644401" "subst" "1.63024E-5" "04020" "FANCM_000532" "g.45644401C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644401_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752447" "1" "50" "14" "45644409" "45644409" "subst" "0.00015083" "04020" "FANCM_000533" "g.45644409A>G" "15/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644409_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752448" "1" "50" "14" "45644415" "45644415" "subst" "1.63203E-5" "04020" "FANCM_000534" "g.45644415A>G" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644415_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752449" "1" "50" "14" "45644454" "45644454" "subst" "7.0752E-5" "04020" "FANCM_000539" "g.45644454G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644454_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752450" "1" "50" "14" "45644458" "45644458" "subst" "1.66913E-5" "04020" "FANCM_000542" "g.45644458A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644458_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752451" "1" "50" "14" "45644481" "45644481" "subst" "8.55893E-6" "04020" "FANCM_000545" "g.45644481C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644481_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752452" "1" "50" "14" "45644526" "45644526" "subst" "0" "04020" "FANCM_000552" "g.45644526G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644526_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752453" "1" "50" "14" "45644539" "45644539" "subst" "0" "04020" "FANCM_000557" "g.45644539T>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644539_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752454" "1" "50" "14" "45644560" "45644560" "subst" "0" "04020" "FANCM_000562" "g.45644560A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644560_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752455" "1" "50" "14" "45644578" "45644578" "subst" "8.97739E-6" "04020" "FANCM_000567" "g.45644578T>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644578_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752456" "1" "50" "14" "45644581" "45644581" "subst" "0" "04020" "FANCM_000568" "g.45644581T>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644581_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752457" "1" "50" "14" "45644619" "45644619" "subst" "0" "04020" "FANCM_000576" "g.45644619A>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644619_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752458" "1" "50" "14" "45644641" "45644641" "subst" "0" "04020" "FANCM_000579" "g.45644641C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644641_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752459" "1" "50" "14" "45644653" "45644653" "subst" "1.69324E-5" "04020" "FANCM_000583" "g.45644653G>A" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644653_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752460" "1" "50" "14" "45644671" "45644671" "subst" "8.25443E-6" "04020" "FANCM_000588" "g.45644671A>T" "11/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644671_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752461" "1" "50" "14" "45644691" "45644691" "subst" "1.63275E-5" "04020" "FANCM_000594" "g.45644691A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644691_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752462" "1" "50" "14" "45644707" "45644707" "subst" "4.07844E-6" "04020" "FANCM_000598" "g.45644707T>C" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644707_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752463" "1" "50" "14" "45644709" "45644709" "subst" "2.44702E-5" "04020" "FANCM_000599" "g.45644709A>G" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644709_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752464" "1" "50" "14" "45644715" "45644715" "subst" "2.44565E-5" "04020" "FANCM_000602" "g.45644715C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644715_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752465" "1" "50" "14" "45644731" "45644731" "subst" "8.14817E-6" "04020" "FANCM_000604" "g.45644731C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644731_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752466" "1" "50" "14" "45644748" "45644748" "subst" "8.14657E-6" "04020" "FANCM_000605" "g.45644748A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644748_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752467" "1" "50" "14" "45644794" "45644794" "subst" "4.07478E-6" "04020" "FANCM_000612" "g.45644794A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644794_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752468" "1" "50" "14" "45644809" "45644809" "subst" "4.07697E-6" "04020" "FANCM_000616" "g.45644809A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644809_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752469" "1" "50" "14" "45644847" "45644847" "subst" "2.855E-5" "04020" "FANCM_000621" "g.45644847G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644847_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752470" "1" "50" "14" "45644853" "45644853" "subst" "0" "04020" "FANCM_000622" "g.45644853G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644853_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752471" "1" "50" "14" "45644860" "45644860" "subst" "2.03814E-5" "04020" "FANCM_000623" "g.45644860A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644860_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752472" "1" "50" "14" "45644865" "45644865" "subst" "8.15322E-6" "04020" "FANCM_000626" "g.45644865G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644865_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752473" "1" "50" "14" "45644925" "45644925" "subst" "3.67032E-5" "04020" "FANCM_000633" "g.45644925G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644925_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752474" "1" "50" "14" "45644926" "45644926" "subst" "0" "04020" "FANCM_000634" "g.45644926T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644926_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752475" "1" "50" "14" "45644953" "45644953" "subst" "0.000273858" "04020" "FANCM_000055" "g.45644953C>T" "24/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644953_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752476" "1" "50" "14" "45644997" "45644997" "subst" "0.0010379" "04020" "FANCM_000638" "g.45644997G>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644997_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752477" "1" "50" "14" "45645001" "45645001" "subst" "4.0856E-6" "04020" "FANCM_000640" "g.45645001C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645001_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752478" "1" "50" "14" "45645006" "45645006" "subst" "8.17047E-6" "04020" "FANCM_000642" "g.45645006C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645006_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752479" "1" "50" "14" "45645031" "45645031" "subst" "0" "04020" "FANCM_000646" "g.45645031G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645031_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752480" "1" "50" "14" "45645045" "45645045" "subst" "4.0817E-6" "04020" "FANCM_000648" "g.45645045C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645045_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752481" "1" "50" "14" "45645106" "45645106" "subst" "0" "04020" "FANCM_000658" "g.45645106A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645106_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752482" "1" "50" "14" "45645195" "45645195" "subst" "0" "04020" "FANCM_000675" "g.45645195C>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645195_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752483" "1" "50" "14" "45645218" "45645218" "subst" "0" "04020" "FANCM_000678" "g.45645218A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645218_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752484" "1" "50" "14" "45645253" "45645253" "subst" "0.000342318" "04020" "FANCM_000018" "g.45645253G>A" "45/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645253_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752485" "1" "50" "14" "45645265" "45645265" "subst" "8.14764E-6" "04020" "FANCM_000689" "g.45645265A>C" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645265_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752486" "1" "50" "14" "45645270" "45645270" "subst" "4.07355E-6" "04020" "FANCM_000691" "g.45645270A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645270_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752487" "1" "50" "14" "45645289" "45645289" "subst" "2.85091E-5" "04020" "FANCM_000694" "g.45645289T>C" "15/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645289_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752488" "1" "50" "14" "45645345" "45645345" "subst" "0" "04020" "FANCM_000703" "g.45645345C>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645345_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752489" "1" "50" "14" "45645364" "45645364" "subst" "2.84798E-5" "04020" "FANCM_000705" "g.45645364T>C" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645364_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752490" "1" "50" "14" "45645390" "45645390" "subst" "1.22027E-5" "04020" "FANCM_000708" "g.45645390G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645390_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752491" "1" "50" "14" "45645393" "45645393" "subst" "1.62701E-5" "04020" "FANCM_000709" "g.45645393G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645393_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752492" "1" "50" "14" "45645409" "45645409" "subst" "0" "04020" "FANCM_000713" "g.45645409C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645409_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752493" "1" "50" "14" "45645425" "45645425" "subst" "1.2203E-5" "04020" "FANCM_000717" "g.45645425C>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645425_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752494" "1" "50" "14" "45645426" "45645426" "subst" "2.84745E-5" "04020" "FANCM_000718" "g.45645426G>A" "8/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645426_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752495" "1" "50" "14" "45645482" "45645482" "subst" "0.000101684" "04020" "FANCM_000732" "g.45645482G>T" "12/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645482_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752496" "1" "50" "14" "45645552" "45645552" "subst" "0" "04020" "FANCM_000743" "g.45645552A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645552_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752497" "1" "50" "14" "45645567" "45645567" "subst" "1.22352E-5" "04020" "FANCM_000744" "g.45645567C>T" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645567_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752498" "1" "50" "14" "45645615" "45645615" "subst" "3.26568E-5" "04020" "FANCM_000751" "g.45645615A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645615_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752499" "1" "50" "14" "45645661" "45645661" "subst" "1.63345E-5" "04020" "FANCM_000759" "g.45645661G>T" "9/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645661_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752500" "1" "50" "14" "45645688" "45645688" "subst" "1.6531E-5" "04020" "FANCM_000762" "g.45645688A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645688_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752501" "1" "50" "14" "45645689" "45645689" "subst" "4.1325E-6" "04020" "FANCM_000763" "g.45645689A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645689_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752502" "1" "50" "14" "45645700" "45645700" "subst" "0" "04020" "FANCM_000764" "g.45645700A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645700_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752503" "1" "50" "14" "45645715" "45645715" "subst" "0" "04020" "FANCM_000769" "g.45645715A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645715_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752504" "1" "50" "14" "45645784" "45645784" "subst" "5.83124E-5" "04020" "FANCM_000058" "g.45645784C>T" "17/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645784_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752505" "1" "50" "14" "45645811" "45645811" "subst" "8.27458E-6" "04020" "FANCM_000782" "g.45645811A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645811_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752506" "1" "50" "14" "45645820" "45645820" "subst" "0.00224252" "04020" "FANCM_000019" "g.45645820A>G" "16/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645820_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752507" "1" "50" "14" "45645825" "45645825" "subst" "6.18353E-5" "04020" "FANCM_000785" "g.45645825A>G" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645825_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752508" "1" "50" "14" "45645828" "45645828" "subst" "0" "04020" "FANCM_000787" "g.45645828A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645828_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752509" "1" "50" "14" "45645841" "45645841" "subst" "4.07312E-6" "04020" "FANCM_000790" "g.45645841T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645841_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752510" "1" "50" "14" "45645855" "45645855" "subst" "8.14226E-6" "04020" "FANCM_000793" "g.45645855G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645855_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752511" "1" "50" "14" "45645859" "45645859" "subst" "4.07116E-6" "04020" "FANCM_000796" "g.45645859A>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645859_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752512" "1" "50" "14" "45645865" "45645865" "subst" "0" "04020" "FANCM_000800" "g.45645865A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645865_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752513" "1" "50" "14" "45645877" "45645877" "subst" "0.00118056" "04020" "FANCM_000803" "g.45645877A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645877_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752514" "1" "50" "14" "45645888" "45645888" "subst" "4.07206E-6" "04020" "FANCM_000806" "g.45645888C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645888_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752515" "1" "50" "14" "45645892" "45645892" "subst" "0.000109935" "04020" "FANCM_000807" "g.45645892T>C" "9/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645892_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752516" "1" "50" "14" "45645898" "45645898" "subst" "4.07266E-6" "04020" "FANCM_000809" "g.45645898C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645898_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752517" "1" "50" "14" "45645949" "45645949" "subst" "0.000106728" "04020" "FANCM_000068" "g.45645949C>T" "24/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645949_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752518" "1" "50" "14" "45645955" "45645955" "subst" "0.000117222" "04020" "FANCM_000821" "g.45645955A>C" "18/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645955_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752519" "1" "50" "14" "45645961" "45645961" "subst" "1.63271E-5" "04020" "FANCM_000823" "g.45645961A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645961_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752520" "1" "50" "14" "45645975" "45645975" "subst" "0" "04020" "FANCM_000825" "g.45645975C>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645975_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752521" "1" "50" "14" "45645994" "45645994" "subst" "0" "04020" "FANCM_000830" "g.45645994C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645994_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752522" "1" "50" "14" "45646030" "45646030" "subst" "0" "04020" "FANCM_000835" "g.45646030T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646030_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752523" "1" "50" "14" "45646033" "45646033" "subst" "0" "04020" "FANCM_000836" "g.45646033A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646033_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752524" "1" "50" "14" "45646041" "45646041" "subst" "0.000284405" "04020" "FANCM_000837" "g.45646041G>A" "24/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646041_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752525" "1" "50" "14" "45646055" "45646055" "subst" "0.000157044" "04020" "FANCM_000838" "g.45646055A>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646055_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752526" "1" "50" "14" "45646062" "45646062" "subst" "4.1265E-6" "04020" "FANCM_000839" "g.45646062A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646062_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752527" "1" "50" "14" "45646083" "45646083" "subst" "1.6389E-5" "04020" "FANCM_000842" "g.45646083G>A" "12/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646083_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752528" "1" "50" "14" "45646146" "45646146" "subst" "3.72329E-5" "04020" "FANCM_000854" "g.45646146A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646146_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752529" "1" "50" "14" "45646150" "45646150" "subst" "1.24285E-5" "04020" "FANCM_000855" "g.45646150A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646150_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752530" "1" "50" "14" "45646151" "45646151" "subst" "4.14261E-6" "04020" "FANCM_000856" "g.45646151T>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646151_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752531" "1" "50" "14" "45650680" "45650680" "subst" "2.8472E-5" "04020" "FANCM_000877" "g.45650680C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650680_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752532" "1" "50" "14" "45650702" "45650702" "subst" "2.43984E-5" "04020" "FANCM_000889" "g.45650702A>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650702_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752533" "1" "50" "14" "45650858" "45650858" "subst" "8.1616E-6" "04020" "FANCM_000902" "g.45650858G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650858_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752534" "1" "50" "14" "45650874" "45650874" "subst" "7.75707E-5" "04020" "FANCM_000907" "g.45650874A>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650874_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752535" "1" "50" "14" "45650888" "45650888" "subst" "0.000237413" "04020" "FANCM_000909" "g.45650888C>T" "49/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650888_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752536" "1" "50" "14" "45650889" "45650889" "subst" "4.0943E-5" "04020" "FANCM_000910" "g.45650889G>A" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650889_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752537" "1" "50" "14" "45650889" "45650889" "subst" "2.45658E-5" "04020" "FANCM_000911" "g.45650889G>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650889_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752538" "1" "50" "14" "45650900" "45650900" "subst" "8.21369E-6" "04020" "FANCM_000916" "g.45650900A>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650900_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752539" "1" "50" "14" "45652990" "45652990" "subst" "0" "04020" "FANCM_000919" "g.45652990C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652990_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752540" "1" "50" "14" "45652993" "45652993" "subst" "0" "04020" "FANCM_000921" "g.45652993G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652993_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752541" "1" "50" "14" "45653000" "45653000" "subst" "0.000321716" "04020" "FANCM_000922" "g.45653000G>C" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653000_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752542" "1" "50" "14" "45653019" "45653019" "subst" "0" "04020" "FANCM_000927" "g.45653019C>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653019_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752543" "1" "50" "14" "45653023" "45653023" "subst" "2.03533E-5" "04020" "FANCM_000928" "g.45653023G>A" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653023_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752544" "1" "50" "14" "45653029" "45653029" "subst" "2.03459E-5" "04020" "FANCM_000930" "g.45653029A>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653029_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752545" "1" "50" "14" "45653055" "45653055" "subst" "2.44242E-5" "04020" "FANCM_000934" "g.45653055G>A" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653055_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752546" "1" "50" "14" "45653070" "45653070" "subst" "4.07156E-6" "04020" "FANCM_000939" "g.45653070G>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653070_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752547" "1" "50" "14" "45654447" "45654447" "subst" "0" "04020" "FANCM_000958" "g.45654447G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654447_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752548" "1" "50" "14" "45654467" "45654467" "subst" "0.000971702" "04020" "FANCM_000963" "g.45654467A>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654467_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752549" "1" "50" "14" "45654469" "45654469" "subst" "1.23074E-5" "04020" "FANCM_000964" "g.45654469A>G" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654469_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752550" "1" "50" "14" "45654526" "45654526" "subst" "8.31829E-6" "04020" "FANCM_000975" "g.45654526C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654526_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752551" "1" "50" "14" "45654531" "45654531" "subst" "0.000233372" "04020" "FANCM_000978" "g.45654531C>T" "34/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654531_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752552" "1" "50" "14" "45654547" "45654547" "subst" "8.36512E-6" "04020" "FANCM_000981" "g.45654547A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654547_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752553" "1" "50" "14" "45654570" "45654570" "subst" "3.8371E-5" "04020" "FANCM_000984" "g.45654570A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654570_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752554" "1" "50" "14" "45657019" "45657019" "subst" "5.29747E-5" "04020" "FANCM_000993" "g.45657019C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657019_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752555" "1" "50" "14" "45657020" "45657020" "subst" "0.000272944" "04020" "FANCM_000995" "g.45657020G>A" "38/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657020_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752556" "1" "50" "14" "45657038" "45657038" "subst" "8.14352E-6" "04020" "FANCM_000999" "g.45657038A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657038_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752557" "1" "50" "14" "45658009" "45658009" "subst" "1.63568E-5" "04020" "FANCM_001008" "g.45658009C>A" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658009_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752558" "1" "50" "14" "45658023" "45658023" "subst" "8.16013E-6" "04020" "FANCM_001009" "g.45658023A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658023_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752559" "1" "50" "14" "45658097" "45658097" "subst" "4.0661E-6" "04020" "FANCM_001018" "g.45658097T>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658097_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752560" "1" "50" "14" "45658138" "45658138" "subst" "1.22022E-5" "04020" "FANCM_001022" "g.45658138G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658138_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752561" "1" "50" "14" "45658153" "45658153" "subst" "8.13696E-6" "04020" "FANCM_001025" "g.45658153C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658153_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752562" "1" "50" "14" "45658158" "45658158" "subst" "7.32315E-5" "04020" "FANCM_001026" "g.45658158C>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658158_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752563" "1" "50" "14" "45658159" "45658159" "subst" "5.69569E-5" "04020" "FANCM_001028" "g.45658159G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658159_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752564" "1" "50" "14" "45658164" "45658164" "subst" "0" "04020" "FANCM_001030" "g.45658164G>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658164_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752565" "1" "50" "14" "45658176" "45658176" "subst" "1.22055E-5" "04020" "FANCM_001033" "g.45658176G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658176_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752566" "1" "50" "14" "45658251" "45658251" "subst" "0.000195252" "04020" "FANCM_001039" "g.45658251G>A" "38/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658251_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752567" "1" "50" "14" "45658270" "45658270" "subst" "0" "04020" "FANCM_001043" "g.45658270A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658270_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752568" "1" "50" "14" "45658273" "45658273" "subst" "1.21995E-5" "04020" "FANCM_000022" "g.45658273A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658273_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752569" "1" "50" "14" "45658291" "45658291" "subst" "8.13372E-6" "04020" "FANCM_001049" "g.45658291C>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658291_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752570" "1" "50" "14" "45658293" "45658293" "subst" "4.06636E-5" "04020" "FANCM_001051" "g.45658293G>C" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658293_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752571" "1" "50" "14" "45658303" "45658303" "subst" "6.50523E-5" "04020" "FANCM_001052" "g.45658303G>A" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658303_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752572" "1" "50" "14" "45658326" "45658326" "subst" "0.00128864" "04020" "FANCM_000023" "g.45658326C>T" "173/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658326_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752573" "1" "50" "14" "45658332" "45658332" "subst" "2.43885E-5" "04020" "FANCM_001057" "g.45658332C>G" "8/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658332_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752574" "1" "50" "14" "45658333" "45658333" "subst" "0.00032519" "04020" "FANCM_001058" "g.45658333A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658333_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752575" "1" "50" "14" "45658342" "45658342" "subst" "2.84504E-5" "04020" "FANCM_000059" "g.45658342A>C" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658342_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752576" "1" "50" "14" "45658359" "45658359" "subst" "0" "04020" "FANCM_001065" "g.45658359T>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658359_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752577" "1" "50" "14" "45658366" "45658366" "subst" "0.00013006" "04020" "FANCM_001067" "g.45658366C>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658366_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752578" "1" "50" "14" "45658402" "45658402" "subst" "4.87912E-5" "04020" "FANCM_001073" "g.45658402C>T" "23/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658402_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752579" "1" "50" "14" "45658455" "45658455" "subst" "1.22085E-5" "04020" "FANCM_001081" "g.45658455G>A" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658455_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752580" "1" "50" "14" "45658474" "45658474" "subst" "4.06861E-6" "04020" "FANCM_001083" "g.45658474C>T" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658474_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752581" "1" "50" "14" "45658506" "45658506" "subst" "0.000109803" "04020" "FANCM_001086" "g.45658506C>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658506_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752582" "1" "50" "14" "45658507" "45658507" "subst" "4.06689E-6" "04020" "FANCM_001087" "g.45658507C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658507_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752583" "1" "50" "14" "45658562" "45658562" "subst" "3.66357E-5" "04020" "FANCM_001096" "g.45658562G>T" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658562_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752584" "1" "50" "14" "45658566" "45658566" "subst" "2.0362E-5" "04020" "FANCM_001098" "g.45658566G>T" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658566_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752585" "1" "50" "14" "45665421" "45665421" "subst" "1.21856E-5" "04020" "FANCM_001107" "g.45665421C>G" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665421_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752586" "1" "50" "14" "45665469" "45665469" "subst" "4.46882E-5" "04020" "FANCM_001117" "g.45665469C>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665469_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752587" "1" "50" "14" "45665474" "45665474" "subst" "7.31261E-5" "04020" "FANCM_001118" "g.45665474G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665474_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752588" "1" "50" "14" "45665508" "45665508" "subst" "1.21857E-5" "04020" "FANCM_001123" "g.45665508A>G" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665508_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752589" "1" "50" "14" "45665530" "45665530" "subst" "2.03102E-5" "04020" "FANCM_001126" "g.45665530A>C" "15/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665530_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752590" "1" "50" "14" "45665532" "45665532" "subst" "4.06194E-6" "04020" "FANCM_001127" "g.45665532T>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665532_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752591" "1" "50" "14" "45665603" "45665603" "subst" "0.000446744" "04020" "FANCM_000057" "g.45665603G>A" "72/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665603_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752592" "1" "50" "14" "45665613" "45665613" "subst" "5.27945E-5" "04020" "FANCM_001137" "g.45665613G>A" "8/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665613_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752593" "1" "50" "14" "45665637" "45665637" "subst" "1.62464E-5" "04020" "FANCM_001142" "g.45665637A>G" "6/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665637_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752594" "1" "50" "14" "45665690" "45665690" "subst" "0.00215738" "04020" "FANCM_000026" "g.45665690C>T" "19/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665690_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752595" "1" "50" "14" "45665717" "45665717" "subst" "4.47202E-5" "04020" "FANCM_001153" "g.45665717T>C" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665717_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752596" "1" "50" "14" "45665726" "45665726" "subst" "8.13597E-6" "04020" "FANCM_001156" "g.45665726G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665726_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752597" "1" "50" "14" "45667859" "45667859" "subst" "4.06736E-6" "04020" "FANCM_001161" "g.45667859G>C" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667859_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752598" "1" "50" "14" "45667880" "45667880" "subst" "0" "04020" "FANCM_001171" "g.45667880G>A" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667880_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752599" "1" "50" "14" "45667900" "45667900" "subst" "2.43825E-5" "04020" "FANCM_001175" "g.45667900A>T" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667900_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752600" "1" "50" "14" "45667906" "45667906" "subst" "0" "04020" "FANCM_001179" "g.45667906A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667906_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752601" "1" "50" "14" "45667912" "45667912" "subst" "0" "04020" "FANCM_001181" "g.45667912G>A" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667912_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752602" "1" "50" "14" "45667921" "45667921" "subst" "0.00102796" "04020" "FANCM_000004" "g.45667921C>T" "88/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667921_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752603" "1" "50" "14" "45667928" "45667928" "subst" "0" "04020" "FANCM_001184" "g.45667928T>C" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667928_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752604" "1" "50" "14" "45667949" "45667949" "subst" "0" "04020" "FANCM_001187" "g.45667949A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667949_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752605" "1" "50" "14" "45667962" "45667962" "subst" "0.000121866" "04020" "FANCM_001191" "g.45667962G>T" "19/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667962_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752606" "1" "50" "14" "45667996" "45667996" "subst" "1.21862E-5" "04020" "FANCM_001198" "g.45667996A>G" "1/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667996_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752607" "1" "50" "14" "45668017" "45668017" "subst" "1.62483E-5" "04020" "FANCM_001203" "g.45668017A>G" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668017_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752608" "1" "50" "14" "45668081" "45668081" "subst" "5.69643E-5" "04020" "FANCM_001210" "g.45668081A>T" "5/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668081_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752609" "1" "50" "14" "45669092" "45669092" "subst" "4.06504E-6" "04020" "FANCM_001221" "g.45669092A>G" "2/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669092_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752610" "1" "50" "14" "45669105" "45669105" "subst" "4.47169E-5" "04020" "FANCM_001224" "g.45669105T>C" "7/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669105_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752611" "1" "50" "14" "45669193" "45669193" "subst" "2.43998E-5" "04020" "FANCM_001233" "g.45669193A>T" "3/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669193_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752612" "1" "50" "14" "45669203" "45669203" "subst" "0.000122013" "04020" "FANCM_001234" "g.45669203G>A" "14/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669203_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000752613" "1" "50" "14" "45669207" "45669207" "subst" "4.06659E-5" "04020" "FANCM_001235" "g.45669207T>C" "4/60466 cases" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669207_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754942" "1" "50" "14" "45606314" "45606314" "dup" "0" "04020" "FANCM_000168" "g.45606314dup" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606312_T_TA" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754943" "1" "50" "14" "45624628" "45624629" "ins" "0" "04020" "FANCM_000327" "g.45624628_45624629insCAAAGTTAAA" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624626_G_GAACAAAGTTA" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754944" "1" "50" "14" "45628393" "45628393" "dup" "0" "04020" "FANCM_000050" "g.45628393dup" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628392_C_CA" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754945" "1" "50" "14" "45633704" "45633704" "del" "0" "04020" "FANCM_000398" "g.45633704del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633701_TG_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754946" "1" "50" "14" "45639936" "45639937" "del" "0" "04020" "FANCM_000471" "g.45639936_45639937del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639934_TGA_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754947" "1" "50" "14" "45644543" "45644546" "del" "0" "04020" "FANCM_000049" "g.45644543_45644546del" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644539_TAAAA_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754948" "1" "50" "14" "45645982" "45645983" "del" "0" "04020" "FANCM_000828" "g.45645982_45645983del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645977_ACT_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000754949" "1" "50" "14" "45650695" "45650695" "del" "0" "04020" "FANCM_000887" "g.45650695del" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650691_TA_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000755033" "1" "50" "14" "45606310" "45606311" "delins" "0" "04020" "FANCM_000167" "g.45606310_45606311delinsCT" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606310_AG_CT" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757099" "1" "50" "14" "45605287" "45605287" "subst" "0.000134991" "04020" "FANCM_000006" "g.45605287G>A" "21/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605287_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757100" "1" "50" "14" "45605290" "45605290" "subst" "4.08781E-6" "04020" "FANCM_000079" "g.45605290C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605290_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757101" "1" "50" "14" "45605293" "45605293" "subst" "0.000114421" "04020" "FANCM_000080" "g.45605293C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605293_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757102" "1" "50" "14" "45605302" "45605302" "subst" "8.16413E-6" "04020" "FANCM_000082" "g.45605302C>A" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605302_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757103" "1" "50" "14" "45605338" "45605338" "subst" "0" "04020" "FANCM_000093" "g.45605338C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605338_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757104" "1" "50" "14" "45605389" "45605389" "subst" "0" "04020" "FANCM_000100" "g.45605389C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605389_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757105" "1" "50" "14" "45605397" "45605397" "subst" "0.000320817" "04020" "FANCM_000103" "g.45605397G>A" "55/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605397_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757106" "1" "50" "14" "45605413" "45605413" "subst" "4.06075E-5" "04020" "FANCM_000053" "g.45605413C>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605413_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757107" "1" "50" "14" "45605413" "45605413" "subst" "4.06075E-6" "04020" "FANCM_000105" "g.45605413C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605413_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757108" "1" "50" "14" "45605423" "45605423" "subst" "0" "04020" "FANCM_000108" "g.45605423G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605423_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757109" "1" "50" "14" "45605454" "45605454" "subst" "1.22733E-5" "04020" "FANCM_000112" "g.45605454G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605454_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757110" "1" "50" "14" "45605476" "45605476" "subst" "0.000178683" "04020" "FANCM_000114" "g.45605476C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605476_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757111" "1" "50" "14" "45605503" "45605503" "subst" "0.00029236" "04020" "FANCM_000120" "g.45605503C>T" "43/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605503_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757112" "1" "50" "14" "45605515" "45605515" "subst" "4.06058E-6" "04020" "FANCM_000122" "g.45605515A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605515_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757113" "1" "50" "14" "45605656" "45605656" "subst" "8.14153E-6" "04020" "FANCM_000145" "g.45605656C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605656_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757114" "1" "50" "14" "45605658" "45605658" "subst" "0" "04020" "FANCM_000147" "g.45605658C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605658_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757115" "1" "50" "14" "45605677" "45605677" "subst" "8.15847E-6" "04020" "FANCM_000150" "g.45605677C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605677_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757116" "1" "50" "14" "45605695" "45605695" "subst" "2.86046E-5" "04020" "FANCM_000151" "g.45605695G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605695_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757117" "1" "50" "14" "45605730" "45605730" "subst" "2.87116E-5" "04020" "FANCM_000157" "g.45605730G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45605730_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757118" "1" "50" "14" "45606301" "45606301" "subst" "0.000134087" "04020" "FANCM_000163" "g.45606301A>G" "15/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606301_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757119" "1" "50" "14" "45606310" "45606310" "subst" "0.000195027" "04020" "FANCM_000166" "g.45606310A>C" "30/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606310_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757120" "1" "50" "14" "45606320" "45606320" "subst" "0" "04020" "FANCM_000171" "g.45606320T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606320_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757121" "1" "50" "14" "45606328" "45606328" "subst" "8.12665E-6" "04020" "FANCM_000172" "g.45606328C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606328_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757122" "1" "50" "14" "45606394" "45606394" "subst" "0" "04020" "FANCM_000180" "g.45606394T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606394_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757123" "1" "50" "14" "45606398" "45606398" "subst" "8.13392E-6" "04020" "FANCM_000182" "g.45606398T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606398_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757124" "1" "50" "14" "45606418" "45606418" "subst" "0" "04020" "FANCM_000184" "g.45606418G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606418_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757125" "1" "50" "14" "45606425" "45606425" "subst" "0" "04020" "FANCM_000186" "g.45606425G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606425_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757126" "1" "50" "14" "45606428" "45606428" "subst" "0" "04020" "FANCM_000187" "g.45606428A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45606428_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757127" "1" "50" "14" "45609862" "45609862" "subst" "1.6284E-5" "04020" "FANCM_000191" "g.45609862A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609862_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757128" "1" "50" "14" "45609863" "45609863" "subst" "0" "04020" "FANCM_000192" "g.45609863A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609863_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757129" "1" "50" "14" "45609913" "45609913" "subst" "8.16227E-6" "04020" "FANCM_000199" "g.45609913G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45609913_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757130" "1" "50" "14" "45618055" "45618055" "subst" "2.84453E-5" "04020" "FANCM_000204" "g.45618055A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618055_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757131" "1" "50" "14" "45618088" "45618088" "subst" "0.00015032" "04020" "FANCM_000207" "g.45618088C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618088_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757132" "1" "50" "14" "45618124" "45618124" "subst" "0" "04020" "FANCM_000214" "g.45618124C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618124_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757133" "1" "50" "14" "45618148" "45618148" "subst" "2.0312E-5" "04020" "FANCM_000218" "g.45618148A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618148_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757134" "1" "50" "14" "45618149" "45618149" "subst" "3.65586E-5" "04020" "FANCM_000219" "g.45618149T>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618149_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757135" "1" "50" "14" "45618154" "45618154" "subst" "4.06286E-6" "04020" "FANCM_000221" "g.45618154C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618154_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757136" "1" "50" "14" "45618155" "45618155" "subst" "4.06303E-5" "04020" "FANCM_000222" "g.45618155C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618155_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757137" "1" "50" "14" "45618176" "45618176" "subst" "4.06293E-6" "04020" "FANCM_000224" "g.45618176C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618176_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757138" "1" "50" "14" "45618182" "45618182" "subst" "0" "04020" "FANCM_000226" "g.45618182A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45618182_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757139" "1" "50" "14" "45620606" "45620606" "subst" "1.22082E-5" "04020" "FANCM_000230" "g.45620606G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620606_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757140" "1" "50" "14" "45620619" "45620619" "subst" "5.28791E-5" "04020" "FANCM_000234" "g.45620619G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620619_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757141" "1" "50" "14" "45620631" "45620631" "subst" "2.033E-5" "04020" "FANCM_000236" "g.45620631A>G" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620631_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757142" "1" "50" "14" "45620644" "45620644" "subst" "1.62611E-5" "04020" "FANCM_000237" "g.45620644G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620644_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757143" "1" "50" "14" "45620655" "45620655" "subst" "0" "04020" "FANCM_000240" "g.45620655A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620655_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757144" "1" "50" "14" "45620721" "45620721" "subst" "0.000487841" "04020" "FANCM_000251" "g.45620721C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620721_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757145" "1" "50" "14" "45620730" "45620730" "subst" "0" "04020" "FANCM_000252" "g.45620730T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45620730_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757146" "1" "50" "14" "45623169" "45623169" "subst" "8.12605E-6" "04020" "FANCM_000257" "g.45623169G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623169_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757147" "1" "50" "14" "45623203" "45623203" "subst" "1.6252E-5" "04020" "FANCM_000263" "g.45623203G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623203_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757148" "1" "50" "14" "45623204" "45623204" "subst" "1.21885E-5" "04020" "FANCM_000264" "g.45623204G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623204_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757149" "1" "50" "14" "45623908" "45623908" "subst" "4.09655E-5" "04020" "FANCM_000274" "g.45623908C>T" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623908_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757150" "1" "50" "14" "45623909" "45623909" "subst" "0.000176092" "04020" "FANCM_000275" "g.45623909G>A" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623909_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757151" "1" "50" "14" "45623912" "45623912" "subst" "0" "04020" "FANCM_000276" "g.45623912C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623912_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757152" "1" "50" "14" "45623938" "45623938" "subst" "5.71088E-5" "04020" "FANCM_000054" "g.45623938G>C" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623938_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757153" "1" "50" "14" "45623947" "45623947" "subst" "0" "04020" "FANCM_000285" "g.45623947A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623947_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757154" "1" "50" "14" "45623951" "45623951" "subst" "0" "04020" "FANCM_000286" "g.45623951T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623951_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757155" "1" "50" "14" "45623954" "45623954" "subst" "4.07448E-6" "04020" "FANCM_000288" "g.45623954A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623954_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757156" "1" "50" "14" "45623980" "45623980" "subst" "2.03877E-5" "04020" "FANCM_000295" "g.45623980C>T" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623980_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757157" "1" "50" "14" "45623986" "45623986" "subst" "2.8516E-5" "04020" "FANCM_000298" "g.45623986C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623986_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757158" "1" "50" "14" "45623987" "45623987" "subst" "8.15255E-6" "04020" "FANCM_000299" "g.45623987G>A" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45623987_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757159" "1" "50" "14" "45624010" "45624010" "subst" "0" "04020" "FANCM_000303" "g.45624010T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624010_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757160" "1" "50" "14" "45624016" "45624016" "subst" "0" "04020" "FANCM_000305" "g.45624016A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624016_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757161" "1" "50" "14" "45624585" "45624585" "subst" "0" "04020" "FANCM_000312" "g.45624585A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624585_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757162" "1" "50" "14" "45624624" "45624624" "subst" "4.06891E-6" "04020" "FANCM_000325" "g.45624624T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624624_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757163" "1" "50" "14" "45624632" "45624632" "subst" "2.84659E-5" "04020" "FANCM_000328" "g.45624632G>A" "11/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624632_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757164" "1" "50" "14" "45624642" "45624642" "subst" "0" "04020" "FANCM_000331" "g.45624642A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624642_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757165" "1" "50" "14" "45624660" "45624660" "subst" "1.21982E-5" "04020" "FANCM_000338" "g.45624660A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45624660_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757166" "1" "50" "14" "45628298" "45628298" "subst" "0" "04020" "FANCM_000340" "g.45628298G>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628298_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757167" "1" "50" "14" "45628304" "45628304" "subst" "0" "04020" "FANCM_000341" "g.45628304A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628304_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757168" "1" "50" "14" "45628313" "45628313" "subst" "6.19958E-5" "04020" "FANCM_000345" "g.45628313G>A" "15/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628313_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757169" "1" "50" "14" "45628317" "45628317" "subst" "4.11276E-6" "04020" "FANCM_000346" "g.45628317A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628317_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757170" "1" "50" "14" "45628358" "45628358" "subst" "0" "04020" "FANCM_000358" "g.45628358C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628358_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757171" "1" "50" "14" "45628364" "45628364" "subst" "2.44035E-5" "04020" "FANCM_000359" "g.45628364A>G" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628364_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757172" "1" "50" "14" "45628394" "45628394" "subst" "0" "04020" "FANCM_000362" "g.45628394C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628394_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757173" "1" "50" "14" "45628411" "45628411" "subst" "6.09389E-5" "04020" "FANCM_000364" "g.45628411T>G" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628411_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757174" "1" "50" "14" "45628447" "45628447" "subst" "4.06494E-6" "04020" "FANCM_000369" "g.45628447A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628447_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757175" "1" "50" "14" "45628452" "45628452" "subst" "4.06646E-5" "04020" "FANCM_000372" "g.45628452C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45628452_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757176" "1" "50" "14" "45633575" "45633575" "subst" "1.62458E-5" "04020" "FANCM_000377" "g.45633575T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633575_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757177" "1" "50" "14" "45633577" "45633577" "subst" "0.000288393" "04020" "FANCM_000378" "g.45633577C>T" "50/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633577_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757178" "1" "50" "14" "45633578" "45633578" "subst" "0" "04020" "FANCM_000379" "g.45633578G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633578_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757179" "1" "50" "14" "45633584" "45633584" "subst" "0" "04020" "FANCM_000382" "g.45633584G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633584_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757180" "1" "50" "14" "45633596" "45633596" "subst" "8.12348E-6" "04020" "FANCM_000383" "g.45633596C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633596_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757181" "1" "50" "14" "45633616" "45633616" "subst" "5.28017E-5" "04020" "FANCM_000385" "g.45633616G>A" "10/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633616_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757182" "1" "50" "14" "45633637" "45633637" "subst" "0" "04020" "FANCM_000388" "g.45633637G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633637_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757183" "1" "50" "14" "45633647" "45633647" "subst" "0.000125921" "04020" "FANCM_000014" "g.45633647A>G" "8/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633647_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757184" "1" "50" "14" "45633682" "45633682" "subst" "1.21863E-5" "04020" "FANCM_000394" "g.45633682A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633682_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757185" "1" "50" "14" "45633697" "45633697" "subst" "4.0626E-6" "04020" "FANCM_000395" "g.45633697C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633697_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757186" "1" "50" "14" "45633698" "45633698" "subst" "3.65663E-5" "04020" "FANCM_000396" "g.45633698G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633698_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757187" "1" "50" "14" "45633715" "45633715" "subst" "1.21884E-5" "04020" "FANCM_000399" "g.45633715C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633715_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757188" "1" "50" "14" "45633721" "45633721" "subst" "0.000341375" "04020" "FANCM_000400" "g.45633721C>T" "17/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633721_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757189" "1" "50" "14" "45633736" "45633736" "subst" "1.2206E-5" "04020" "FANCM_000403" "g.45633736G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633736_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757190" "1" "50" "14" "45633740" "45633740" "subst" "0.000113996" "04020" "FANCM_000404" "g.45633740T>C" "11/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633740_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757191" "1" "50" "14" "45633757" "45633757" "subst" "0" "04020" "FANCM_000406" "g.45633757C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45633757_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757192" "1" "50" "14" "45636188" "45636188" "subst" "0" "04020" "FANCM_000419" "g.45636188A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636188_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757193" "1" "50" "14" "45636213" "45636213" "subst" "0.00013413" "04020" "FANCM_000423" "g.45636213C>G" "14/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636213_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757194" "1" "50" "14" "45636244" "45636244" "subst" "4.06448E-6" "04020" "FANCM_000429" "g.45636244G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636244_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757195" "1" "50" "14" "45636244" "45636244" "subst" "2.43869E-5" "04020" "FANCM_000430" "g.45636244G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636244_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757196" "1" "50" "14" "45636297" "45636297" "subst" "0" "04020" "FANCM_000438" "g.45636297G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636297_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757197" "1" "50" "14" "45636298" "45636298" "subst" "4.06501E-6" "04020" "FANCM_000440" "g.45636298G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636298_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757198" "1" "50" "14" "45636301" "45636301" "subst" "0" "04020" "FANCM_000441" "g.45636301T>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636301_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757199" "1" "50" "14" "45636312" "45636312" "subst" "4.06521E-6" "04020" "FANCM_000443" "g.45636312G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636312_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757200" "1" "50" "14" "45636318" "45636318" "subst" "0" "04020" "FANCM_000444" "g.45636318C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636318_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757201" "1" "50" "14" "45636324" "45636324" "subst" "2.4395E-5" "04020" "FANCM_000445" "g.45636324C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636324_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757202" "1" "50" "14" "45636336" "45636336" "subst" "8.13286E-5" "04020" "FANCM_000003" "g.45636336C>T" "17/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636336_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757203" "1" "50" "14" "45636360" "45636360" "subst" "0.000150598" "04020" "FANCM_000450" "g.45636360A>G" "32/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45636360_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757204" "1" "50" "14" "45639943" "45639943" "subst" "4.0658E-6" "04020" "FANCM_000475" "g.45639943C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45639943_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757205" "1" "50" "14" "45642287" "45642287" "subst" "6.10635E-5" "04020" "FANCM_000483" "g.45642287A>T" "7/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642287_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757206" "1" "50" "14" "45642288" "45642288" "subst" "0" "04020" "FANCM_000484" "g.45642288C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642288_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757207" "1" "50" "14" "45642312" "45642312" "subst" "8.13107E-6" "04020" "FANCM_000490" "g.45642312T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642312_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757208" "1" "50" "14" "45642331" "45642331" "subst" "1.62617E-5" "04020" "FANCM_000495" "g.45642331C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642331_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757209" "1" "50" "14" "45642333" "45642333" "subst" "1.62611E-5" "04020" "FANCM_000496" "g.45642333A>G" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642333_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757210" "1" "50" "14" "45642337" "45642337" "subst" "0.000121953" "04020" "FANCM_000497" "g.45642337A>G" "24/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642337_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757211" "1" "50" "14" "45642363" "45642363" "subst" "3.25235E-5" "04020" "FANCM_000501" "g.45642363C>T" "8/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642363_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757212" "1" "50" "14" "45642364" "45642364" "subst" "0.000654589" "04020" "FANCM_000502" "g.45642364G>A" "15/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642364_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757213" "1" "50" "14" "45642364" "45642364" "subst" "3.65919E-5" "04020" "FANCM_000503" "g.45642364G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642364_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757214" "1" "50" "14" "45642381" "45642381" "subst" "1.21936E-5" "04020" "FANCM_000505" "g.45642381A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642381_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757215" "1" "50" "14" "45642383" "45642383" "subst" "2.84539E-5" "04020" "FANCM_000507" "g.45642383G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642383_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757216" "1" "50" "14" "45642408" "45642408" "subst" "3.65815E-5" "04020" "FANCM_000509" "g.45642408G>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45642408_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757217" "1" "50" "14" "45644287" "45644287" "subst" "0.000212286" "04020" "FANCM_000514" "g.45644287A>G" "45/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644287_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757218" "1" "50" "14" "45644296" "45644296" "subst" "2.44748E-5" "04020" "FANCM_000515" "g.45644296A>C" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644296_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757219" "1" "50" "14" "45644346" "45644346" "subst" "2.44796E-5" "04020" "FANCM_000525" "g.45644346C>G" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644346_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757220" "1" "50" "14" "45644401" "45644401" "subst" "1.63024E-5" "04020" "FANCM_000532" "g.45644401C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644401_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757221" "1" "50" "14" "45644409" "45644409" "subst" "0.00015083" "04020" "FANCM_000533" "g.45644409A>G" "10/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644409_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757222" "1" "50" "14" "45644415" "45644415" "subst" "1.63203E-5" "04020" "FANCM_000534" "g.45644415A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644415_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757223" "1" "50" "14" "45644454" "45644454" "subst" "7.0752E-5" "04020" "FANCM_000539" "g.45644454G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644454_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757224" "1" "50" "14" "45644458" "45644458" "subst" "1.66913E-5" "04020" "FANCM_000542" "g.45644458A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644458_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757225" "1" "50" "14" "45644481" "45644481" "subst" "8.55893E-6" "04020" "FANCM_000545" "g.45644481C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644481_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757226" "1" "50" "14" "45644526" "45644526" "subst" "0" "04020" "FANCM_000552" "g.45644526G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644526_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757227" "1" "50" "14" "45644539" "45644539" "subst" "0" "04020" "FANCM_000557" "g.45644539T>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644539_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757228" "1" "50" "14" "45644560" "45644560" "subst" "0" "04020" "FANCM_000562" "g.45644560A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644560_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757229" "1" "50" "14" "45644578" "45644578" "subst" "8.97739E-6" "04020" "FANCM_000567" "g.45644578T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644578_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757230" "1" "50" "14" "45644581" "45644581" "subst" "0" "04020" "FANCM_000568" "g.45644581T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644581_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757231" "1" "50" "14" "45644619" "45644619" "subst" "0" "04020" "FANCM_000576" "g.45644619A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644619_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757232" "1" "50" "14" "45644641" "45644641" "subst" "0" "04020" "FANCM_000579" "g.45644641C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644641_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757233" "1" "50" "14" "45644653" "45644653" "subst" "1.69324E-5" "04020" "FANCM_000583" "g.45644653G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644653_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757234" "1" "50" "14" "45644671" "45644671" "subst" "8.25443E-6" "04020" "FANCM_000588" "g.45644671A>T" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644671_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757235" "1" "50" "14" "45644691" "45644691" "subst" "1.63275E-5" "04020" "FANCM_000594" "g.45644691A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644691_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757236" "1" "50" "14" "45644707" "45644707" "subst" "4.07844E-6" "04020" "FANCM_000598" "g.45644707T>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644707_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757237" "1" "50" "14" "45644709" "45644709" "subst" "2.44702E-5" "04020" "FANCM_000599" "g.45644709A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644709_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757238" "1" "50" "14" "45644715" "45644715" "subst" "2.44565E-5" "04020" "FANCM_000602" "g.45644715C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644715_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757239" "1" "50" "14" "45644731" "45644731" "subst" "8.14817E-6" "04020" "FANCM_000604" "g.45644731C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644731_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757240" "1" "50" "14" "45644748" "45644748" "subst" "8.14657E-6" "04020" "FANCM_000605" "g.45644748A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644748_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757241" "1" "50" "14" "45644794" "45644794" "subst" "4.07478E-6" "04020" "FANCM_000612" "g.45644794A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644794_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757242" "1" "50" "14" "45644809" "45644809" "subst" "4.07697E-6" "04020" "FANCM_000616" "g.45644809A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644809_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757243" "1" "50" "14" "45644847" "45644847" "subst" "2.855E-5" "04020" "FANCM_000621" "g.45644847G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644847_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757244" "1" "50" "14" "45644853" "45644853" "subst" "0" "04020" "FANCM_000622" "g.45644853G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644853_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757245" "1" "50" "14" "45644860" "45644860" "subst" "2.03814E-5" "04020" "FANCM_000623" "g.45644860A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644860_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757246" "1" "50" "14" "45644865" "45644865" "subst" "8.15322E-6" "04020" "FANCM_000626" "g.45644865G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644865_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757247" "1" "50" "14" "45644925" "45644925" "subst" "3.67032E-5" "04020" "FANCM_000633" "g.45644925G>A" "8/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644925_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757248" "1" "50" "14" "45644926" "45644926" "subst" "0" "04020" "FANCM_000634" "g.45644926T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644926_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757249" "1" "50" "14" "45644953" "45644953" "subst" "0.000273858" "04020" "FANCM_000055" "g.45644953C>T" "8/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644953_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757250" "1" "50" "14" "45644997" "45644997" "subst" "0.0010379" "04020" "FANCM_000638" "g.45644997G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45644997_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757251" "1" "50" "14" "45645001" "45645001" "subst" "4.0856E-6" "04020" "FANCM_000640" "g.45645001C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645001_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757252" "1" "50" "14" "45645006" "45645006" "subst" "8.17047E-6" "04020" "FANCM_000642" "g.45645006C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645006_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757253" "1" "50" "14" "45645031" "45645031" "subst" "0" "04020" "FANCM_000646" "g.45645031G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645031_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757254" "1" "50" "14" "45645045" "45645045" "subst" "4.0817E-6" "04020" "FANCM_000648" "g.45645045C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645045_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757255" "1" "50" "14" "45645106" "45645106" "subst" "0" "04020" "FANCM_000658" "g.45645106A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645106_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757256" "1" "50" "14" "45645195" "45645195" "subst" "0" "04020" "FANCM_000675" "g.45645195C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645195_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757257" "1" "50" "14" "45645218" "45645218" "subst" "0" "04020" "FANCM_000678" "g.45645218A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645218_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757258" "1" "50" "14" "45645253" "45645253" "subst" "0.000342318" "04020" "FANCM_000018" "g.45645253G>A" "41/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645253_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757259" "1" "50" "14" "45645265" "45645265" "subst" "8.14764E-6" "04020" "FANCM_000689" "g.45645265A>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645265_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757260" "1" "50" "14" "45645270" "45645270" "subst" "4.07355E-6" "04020" "FANCM_000691" "g.45645270A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645270_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757261" "1" "50" "14" "45645289" "45645289" "subst" "2.85091E-5" "04020" "FANCM_000694" "g.45645289T>C" "15/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645289_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757262" "1" "50" "14" "45645345" "45645345" "subst" "0" "04020" "FANCM_000703" "g.45645345C>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645345_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757263" "1" "50" "14" "45645364" "45645364" "subst" "2.84798E-5" "04020" "FANCM_000705" "g.45645364T>C" "9/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645364_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757264" "1" "50" "14" "45645390" "45645390" "subst" "1.22027E-5" "04020" "FANCM_000708" "g.45645390G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645390_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757265" "1" "50" "14" "45645393" "45645393" "subst" "1.62701E-5" "04020" "FANCM_000709" "g.45645393G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645393_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757266" "1" "50" "14" "45645409" "45645409" "subst" "0" "04020" "FANCM_000713" "g.45645409C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645409_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757267" "1" "50" "14" "45645425" "45645425" "subst" "1.2203E-5" "04020" "FANCM_000717" "g.45645425C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645425_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757268" "1" "50" "14" "45645426" "45645426" "subst" "2.84745E-5" "04020" "FANCM_000718" "g.45645426G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645426_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757269" "1" "50" "14" "45645482" "45645482" "subst" "0.000101684" "04020" "FANCM_000732" "g.45645482G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645482_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757270" "1" "50" "14" "45645552" "45645552" "subst" "0" "04020" "FANCM_000743" "g.45645552A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645552_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757271" "1" "50" "14" "45645567" "45645567" "subst" "1.22352E-5" "04020" "FANCM_000744" "g.45645567C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645567_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757272" "1" "50" "14" "45645615" "45645615" "subst" "3.26568E-5" "04020" "FANCM_000751" "g.45645615A>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645615_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757273" "1" "50" "14" "45645661" "45645661" "subst" "1.63345E-5" "04020" "FANCM_000759" "g.45645661G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645661_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757274" "1" "50" "14" "45645688" "45645688" "subst" "1.6531E-5" "04020" "FANCM_000762" "g.45645688A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645688_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757275" "1" "50" "14" "45645689" "45645689" "subst" "4.1325E-6" "04020" "FANCM_000763" "g.45645689A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645689_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757276" "1" "50" "14" "45645700" "45645700" "subst" "0" "04020" "FANCM_000764" "g.45645700A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645700_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757277" "1" "50" "14" "45645715" "45645715" "subst" "0" "04020" "FANCM_000769" "g.45645715A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645715_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757278" "1" "50" "14" "45645784" "45645784" "subst" "5.83124E-5" "04020" "FANCM_000058" "g.45645784C>T" "11/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645784_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757279" "1" "50" "14" "45645811" "45645811" "subst" "8.27458E-6" "04020" "FANCM_000782" "g.45645811A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645811_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757280" "1" "50" "14" "45645820" "45645820" "subst" "0.00224252" "04020" "FANCM_000019" "g.45645820A>G" "22/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645820_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757281" "1" "50" "14" "45645825" "45645825" "subst" "6.18353E-5" "04020" "FANCM_000785" "g.45645825A>G" "10/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645825_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757282" "1" "50" "14" "45645828" "45645828" "subst" "0" "04020" "FANCM_000787" "g.45645828A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645828_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757283" "1" "50" "14" "45645841" "45645841" "subst" "4.07312E-6" "04020" "FANCM_000790" "g.45645841T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645841_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757284" "1" "50" "14" "45645855" "45645855" "subst" "8.14226E-6" "04020" "FANCM_000793" "g.45645855G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645855_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757285" "1" "50" "14" "45645859" "45645859" "subst" "4.07116E-6" "04020" "FANCM_000796" "g.45645859A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645859_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757286" "1" "50" "14" "45645865" "45645865" "subst" "0" "04020" "FANCM_000800" "g.45645865A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645865_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757287" "1" "50" "14" "45645877" "45645877" "subst" "0.00118056" "04020" "FANCM_000803" "g.45645877A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645877_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757288" "1" "50" "14" "45645888" "45645888" "subst" "4.07206E-6" "04020" "FANCM_000806" "g.45645888C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645888_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757289" "1" "50" "14" "45645892" "45645892" "subst" "0.000109935" "04020" "FANCM_000807" "g.45645892T>C" "8/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645892_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757290" "1" "50" "14" "45645898" "45645898" "subst" "4.07266E-6" "04020" "FANCM_000809" "g.45645898C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645898_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757291" "1" "50" "14" "45645949" "45645949" "subst" "0.000106728" "04020" "FANCM_000068" "g.45645949C>T" "14/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645949_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757292" "1" "50" "14" "45645955" "45645955" "subst" "0.000117222" "04020" "FANCM_000821" "g.45645955A>C" "12/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645955_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757293" "1" "50" "14" "45645961" "45645961" "subst" "1.63271E-5" "04020" "FANCM_000823" "g.45645961A>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645961_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757294" "1" "50" "14" "45645975" "45645975" "subst" "0" "04020" "FANCM_000825" "g.45645975C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645975_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757295" "1" "50" "14" "45645994" "45645994" "subst" "0" "04020" "FANCM_000830" "g.45645994C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45645994_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757296" "1" "50" "14" "45646030" "45646030" "subst" "0" "04020" "FANCM_000835" "g.45646030T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646030_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757297" "1" "50" "14" "45646033" "45646033" "subst" "0" "04020" "FANCM_000836" "g.45646033A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646033_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757298" "1" "50" "14" "45646041" "45646041" "subst" "0.000284405" "04020" "FANCM_000837" "g.45646041G>A" "11/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646041_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757299" "1" "50" "14" "45646055" "45646055" "subst" "0.000157044" "04020" "FANCM_000838" "g.45646055A>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646055_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757300" "1" "50" "14" "45646062" "45646062" "subst" "4.1265E-6" "04020" "FANCM_000839" "g.45646062A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646062_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757301" "1" "50" "14" "45646083" "45646083" "subst" "1.6389E-5" "04020" "FANCM_000842" "g.45646083G>A" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646083_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757302" "1" "50" "14" "45646146" "45646146" "subst" "3.72329E-5" "04020" "FANCM_000854" "g.45646146A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646146_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757303" "1" "50" "14" "45646150" "45646150" "subst" "1.24285E-5" "04020" "FANCM_000855" "g.45646150A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646150_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757304" "1" "50" "14" "45646151" "45646151" "subst" "4.14261E-6" "04020" "FANCM_000856" "g.45646151T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45646151_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757305" "1" "50" "14" "45650680" "45650680" "subst" "2.8472E-5" "04020" "FANCM_000877" "g.45650680C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650680_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757306" "1" "50" "14" "45650702" "45650702" "subst" "2.43984E-5" "04020" "FANCM_000889" "g.45650702A>G" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650702_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757307" "1" "50" "14" "45650858" "45650858" "subst" "8.1616E-6" "04020" "FANCM_000902" "g.45650858G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650858_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757308" "1" "50" "14" "45650874" "45650874" "subst" "7.75707E-5" "04020" "FANCM_000907" "g.45650874A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650874_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757309" "1" "50" "14" "45650888" "45650888" "subst" "0.000237413" "04020" "FANCM_000909" "g.45650888C>T" "40/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650888_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757310" "1" "50" "14" "45650889" "45650889" "subst" "4.0943E-5" "04020" "FANCM_000910" "g.45650889G>A" "21/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650889_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757311" "1" "50" "14" "45650889" "45650889" "subst" "2.45658E-5" "04020" "FANCM_000911" "g.45650889G>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650889_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757312" "1" "50" "14" "45650900" "45650900" "subst" "8.21369E-6" "04020" "FANCM_000916" "g.45650900A>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45650900_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757313" "1" "50" "14" "45652990" "45652990" "subst" "0" "04020" "FANCM_000919" "g.45652990C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652990_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757314" "1" "50" "14" "45652993" "45652993" "subst" "0" "04020" "FANCM_000921" "g.45652993G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45652993_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757315" "1" "50" "14" "45653000" "45653000" "subst" "0.000321716" "04020" "FANCM_000922" "g.45653000G>C" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653000_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757316" "1" "50" "14" "45653019" "45653019" "subst" "0" "04020" "FANCM_000927" "g.45653019C>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653019_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757317" "1" "50" "14" "45653023" "45653023" "subst" "2.03533E-5" "04020" "FANCM_000928" "g.45653023G>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653023_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757318" "1" "50" "14" "45653029" "45653029" "subst" "2.03459E-5" "04020" "FANCM_000930" "g.45653029A>G" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653029_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757319" "1" "50" "14" "45653055" "45653055" "subst" "2.44242E-5" "04020" "FANCM_000934" "g.45653055G>A" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653055_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757320" "1" "50" "14" "45653070" "45653070" "subst" "4.07156E-6" "04020" "FANCM_000939" "g.45653070G>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45653070_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757321" "1" "50" "14" "45654447" "45654447" "subst" "0" "04020" "FANCM_000958" "g.45654447G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654447_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757322" "1" "50" "14" "45654467" "45654467" "subst" "0.000971702" "04020" "FANCM_000963" "g.45654467A>C" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654467_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757323" "1" "50" "14" "45654469" "45654469" "subst" "1.23074E-5" "04020" "FANCM_000964" "g.45654469A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654469_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757324" "1" "50" "14" "45654526" "45654526" "subst" "8.31829E-6" "04020" "FANCM_000975" "g.45654526C>T" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654526_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757325" "1" "50" "14" "45654531" "45654531" "subst" "0.000233372" "04020" "FANCM_000978" "g.45654531C>T" "31/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654531_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757326" "1" "50" "14" "45654547" "45654547" "subst" "8.36512E-6" "04020" "FANCM_000981" "g.45654547A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654547_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757327" "1" "50" "14" "45654570" "45654570" "subst" "3.8371E-5" "04020" "FANCM_000984" "g.45654570A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45654570_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757328" "1" "50" "14" "45657019" "45657019" "subst" "5.29747E-5" "04020" "FANCM_000993" "g.45657019C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657019_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757329" "1" "50" "14" "45657020" "45657020" "subst" "0.000272944" "04020" "FANCM_000995" "g.45657020G>A" "37/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657020_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757330" "1" "50" "14" "45657038" "45657038" "subst" "8.14352E-6" "04020" "FANCM_000999" "g.45657038A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45657038_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757331" "1" "50" "14" "45658009" "45658009" "subst" "1.63568E-5" "04020" "FANCM_001008" "g.45658009C>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658009_C_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757332" "1" "50" "14" "45658023" "45658023" "subst" "8.16013E-6" "04020" "FANCM_001009" "g.45658023A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658023_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757333" "1" "50" "14" "45658097" "45658097" "subst" "4.0661E-6" "04020" "FANCM_001018" "g.45658097T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658097_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757334" "1" "50" "14" "45658138" "45658138" "subst" "1.22022E-5" "04020" "FANCM_001022" "g.45658138G>A" "4/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658138_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757335" "1" "50" "14" "45658153" "45658153" "subst" "8.13696E-6" "04020" "FANCM_001025" "g.45658153C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658153_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757336" "1" "50" "14" "45658158" "45658158" "subst" "7.32315E-5" "04020" "FANCM_001026" "g.45658158C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658158_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757337" "1" "50" "14" "45658159" "45658159" "subst" "5.69569E-5" "04020" "FANCM_001028" "g.45658159G>A" "7/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658159_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757338" "1" "50" "14" "45658164" "45658164" "subst" "0" "04020" "FANCM_001030" "g.45658164G>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658164_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757339" "1" "50" "14" "45658176" "45658176" "subst" "1.22055E-5" "04020" "FANCM_001033" "g.45658176G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658176_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757340" "1" "50" "14" "45658251" "45658251" "subst" "0.000195252" "04020" "FANCM_001039" "g.45658251G>A" "36/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658251_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757341" "1" "50" "14" "45658270" "45658270" "subst" "0" "04020" "FANCM_001043" "g.45658270A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658270_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757342" "1" "50" "14" "45658273" "45658273" "subst" "1.21995E-5" "04020" "FANCM_000022" "g.45658273A>G" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658273_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757343" "1" "50" "14" "45658291" "45658291" "subst" "8.13372E-6" "04020" "FANCM_001049" "g.45658291C>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658291_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757344" "1" "50" "14" "45658293" "45658293" "subst" "4.06636E-5" "04020" "FANCM_001051" "g.45658293G>C" "7/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658293_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757345" "1" "50" "14" "45658303" "45658303" "subst" "6.50523E-5" "04020" "FANCM_001052" "g.45658303G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658303_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757346" "1" "50" "14" "45658326" "45658326" "subst" "0.00128864" "04020" "FANCM_000023" "g.45658326C>T" "129/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658326_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757347" "1" "50" "14" "45658332" "45658332" "subst" "2.43885E-5" "04020" "FANCM_001057" "g.45658332C>G" "7/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658332_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757348" "1" "50" "14" "45658333" "45658333" "subst" "0.00032519" "04020" "FANCM_001058" "g.45658333A>G" "9/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658333_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757349" "1" "50" "14" "45658342" "45658342" "subst" "2.84504E-5" "04020" "FANCM_000059" "g.45658342A>C" "10/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658342_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757350" "1" "50" "14" "45658359" "45658359" "subst" "0" "04020" "FANCM_001065" "g.45658359T>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658359_T_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757351" "1" "50" "14" "45658366" "45658366" "subst" "0.00013006" "04020" "FANCM_001067" "g.45658366C>T" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658366_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757352" "1" "50" "14" "45658402" "45658402" "subst" "4.87912E-5" "04020" "FANCM_001073" "g.45658402C>T" "11/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658402_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757353" "1" "50" "14" "45658455" "45658455" "subst" "1.22085E-5" "04020" "FANCM_001081" "g.45658455G>A" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658455_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757354" "1" "50" "14" "45658474" "45658474" "subst" "4.06861E-6" "04020" "FANCM_001083" "g.45658474C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658474_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757355" "1" "50" "14" "45658506" "45658506" "subst" "0.000109803" "04020" "FANCM_001086" "g.45658506C>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658506_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757356" "1" "50" "14" "45658507" "45658507" "subst" "4.06689E-6" "04020" "FANCM_001087" "g.45658507C>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658507_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757357" "1" "50" "14" "45658562" "45658562" "subst" "3.66357E-5" "04020" "FANCM_001096" "g.45658562G>T" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658562_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757358" "1" "50" "14" "45658566" "45658566" "subst" "2.0362E-5" "04020" "FANCM_001098" "g.45658566G>T" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45658566_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757359" "1" "50" "14" "45665421" "45665421" "subst" "1.21856E-5" "04020" "FANCM_001107" "g.45665421C>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665421_C_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757360" "1" "50" "14" "45665469" "45665469" "subst" "4.46882E-5" "04020" "FANCM_001117" "g.45665469C>T" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665469_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757361" "1" "50" "14" "45665474" "45665474" "subst" "7.31261E-5" "04020" "FANCM_001118" "g.45665474G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665474_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757362" "1" "50" "14" "45665508" "45665508" "subst" "1.21857E-5" "04020" "FANCM_001123" "g.45665508A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665508_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757363" "1" "50" "14" "45665530" "45665530" "subst" "2.03102E-5" "04020" "FANCM_001126" "g.45665530A>C" "15/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665530_A_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757364" "1" "50" "14" "45665532" "45665532" "subst" "4.06194E-6" "04020" "FANCM_001127" "g.45665532T>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665532_T_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757365" "1" "50" "14" "45665603" "45665603" "subst" "0.000446744" "04020" "FANCM_000057" "g.45665603G>A" "57/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665603_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757366" "1" "50" "14" "45665613" "45665613" "subst" "5.27945E-5" "04020" "FANCM_001137" "g.45665613G>A" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665613_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757367" "1" "50" "14" "45665637" "45665637" "subst" "1.62464E-5" "04020" "FANCM_001142" "g.45665637A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665637_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757368" "1" "50" "14" "45665690" "45665690" "subst" "0.00215738" "04020" "FANCM_000026" "g.45665690C>T" "24/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665690_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757369" "1" "50" "14" "45665717" "45665717" "subst" "4.47202E-5" "04020" "FANCM_001153" "g.45665717T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665717_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757370" "1" "50" "14" "45665726" "45665726" "subst" "8.13597E-6" "04020" "FANCM_001156" "g.45665726G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45665726_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757371" "1" "50" "14" "45667859" "45667859" "subst" "4.06736E-6" "04020" "FANCM_001161" "g.45667859G>C" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667859_G_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757372" "1" "50" "14" "45667880" "45667880" "subst" "0" "04020" "FANCM_001171" "g.45667880G>A" "3/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667880_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757373" "1" "50" "14" "45667900" "45667900" "subst" "2.43825E-5" "04020" "FANCM_001175" "g.45667900A>T" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667900_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757374" "1" "50" "14" "45667906" "45667906" "subst" "0" "04020" "FANCM_001179" "g.45667906A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667906_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757375" "1" "50" "14" "45667912" "45667912" "subst" "0" "04020" "FANCM_001181" "g.45667912G>A" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667912_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757376" "1" "50" "14" "45667921" "45667921" "subst" "0.00102796" "04020" "FANCM_000004" "g.45667921C>T" "81/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667921_C_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757377" "1" "50" "14" "45667928" "45667928" "subst" "0" "04020" "FANCM_001184" "g.45667928T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667928_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757378" "1" "50" "14" "45667949" "45667949" "subst" "0" "04020" "FANCM_001187" "g.45667949A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667949_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757379" "1" "50" "14" "45667962" "45667962" "subst" "0.000121866" "04020" "FANCM_001191" "g.45667962G>T" "11/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667962_G_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757380" "1" "50" "14" "45667996" "45667996" "subst" "1.21862E-5" "04020" "FANCM_001198" "g.45667996A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45667996_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757381" "1" "50" "14" "45668017" "45668017" "subst" "1.62483E-5" "04020" "FANCM_001203" "g.45668017A>G" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668017_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757382" "1" "50" "14" "45668081" "45668081" "subst" "5.69643E-5" "04020" "FANCM_001210" "g.45668081A>T" "5/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45668081_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757383" "1" "50" "14" "45669092" "45669092" "subst" "4.06504E-6" "04020" "FANCM_001221" "g.45669092A>G" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669092_A_G" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757384" "1" "50" "14" "45669105" "45669105" "subst" "4.47169E-5" "04020" "FANCM_001224" "g.45669105T>C" "1/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669105_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757385" "1" "50" "14" "45669193" "45669193" "subst" "2.43998E-5" "04020" "FANCM_001233" "g.45669193A>T" "2/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669193_A_T" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757386" "1" "50" "14" "45669203" "45669203" "subst" "0.000122013" "04020" "FANCM_001234" "g.45669203G>A" "19/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669203_G_A" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000757387" "1" "50" "14" "45669207" "45669207" "subst" "4.06659E-5" "04020" "FANCM_001235" "g.45669207T>C" "6/53461 controls" "{PMID:Dorling 2021:33471991}, {DOI:Dorling 2021:10.1056/NEJMoa1913948}" "" "chr14_45669207_T_C" "the study was not designed to clinically classify individual variants but performed burden-type association analyses, grouping certain variant types" "Germline" "" "" "0" "" "" "" "" "NA" ""
"0000789647" "0" "90" "14" "45667921" "45667921" "subst" "0.00102796" "00585" "FANCM_000004" "g.45667921C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.45198718C>T" "" "pathogenic" "ACMG"
"0000806401" "0" "50" "14" "45623200" "45623200" "subst" "0" "01943" "FANCM_001237" "g.45623200A>T" "" "" "" "FANCM(NM_020937.2):c.1128A>T (p.Q376H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000806402" "0" "50" "14" "45623953" "45623953" "subst" "0.000692724" "02325" "FANCM_000012" "g.45623953T>C" "" "" "" "FANCM(NM_020937.2):c.1237T>C (p.Y413H, p.(Tyr413His)), FANCM(NM_020937.4):c.1237T>C (p.Y413H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000839998" "3" "90" "14" "45667921" "45667921" "subst" "0.00102796" "00006" "FANCM_000004" "g.45667921C>T" "" "{PMID:Kherraf 2022:35172124}, {DOI:Kherraf 2022:10.1016/j.ajhg.2022.01.011}" "" "NM_020937.4:c.5791C>T" "" "Germline" "" "" "0" "" "" "g.45198718C>T" "" "pathogenic (recessive)" ""
"0000853832" "0" "30" "14" "45642365" "45642365" "subst" "0.00110172" "01943" "FANCM_000036" "g.45642365C>A" "" "" "" "FANCM(NM_020937.2):c.2268C>A (p.R756=), FANCM(NM_020937.4):c.2268C>A (p.R756=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000853833" "0" "30" "14" "45644430" "45644430" "subst" "0.000135287" "01943" "FANCM_001241" "g.45644430A>C" "" "" "" "FANCM(NM_020937.2):c.2473A>C (p.S825R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000863559" "0" "50" "14" "45618154" "45618154" "subst" "0.000105634" "02325" "FANCM_001238" "g.45618154C>G" "" "" "" "FANCM(NM_020937.4):c.874C>G (p.P292A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000863560" "0" "30" "14" "45620722" "45620722" "subst" "0.0058383" "01804" "FANCM_001239" "g.45620722G>A" "" "" "" "FANCM(NM_001308133.1):c.963G>A (p.(Pro321=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000863561" "0" "10" "14" "45628296" "45628297" "del" "0" "02326" "FANCM_001240" "g.45628296_45628297del" "" "" "" "FANCM(NM_020937.2):c.1397-3_1397-2delTA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000863562" "0" "50" "14" "45667978" "45667978" "subst" "6.0931E-5" "02325" "FANCM_001242" "g.45667978T>G" "" "" "" "FANCM(NM_020937.4):c.5848T>G (p.L1950V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000891789" "0" "30" "14" "45605327" "45605327" "subst" "2.44157E-5" "02329" "FANCM_000065" "g.45605327A>G" "" "" "" "FANCM(NM_020937.2):c.93A>G (p.R31=), FANCM(NM_020937.4):c.93A>G (p.R31=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000891790" "0" "10" "14" "45644402" "45644402" "subst" "0.00196857" "02329" "FANCM_001243" "g.45644402G>A" "" "" "" "FANCM(NM_020937.4):c.2445G>A (p.S815=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000891791" "0" "30" "14" "45650670" "45650670" "subst" "0.000728193" "02329" "FANCM_001244" "g.45650670C>T" "" "" "" "FANCM(NM_020937.4):c.4260C>T (p.D1420=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000891792" "0" "10" "14" "45665611" "45665611" "subst" "0.000848752" "02329" "FANCM_001245" "g.45665611T>C" "" "" "" "FANCM(NM_020937.4):c.5577T>C (p.N1859=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000914192" "0" "30" "14" "45606290" "45606290" "subst" "0.00418553" "02326" "FANCM_000010" "g.45606290C>T" "" "" "" "FANCM(NM_020937.2):c.527C>T (p.(Thr176Ile), p.T176I), FANCM(NM_020937.4):c.527C>T (p.T176I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000967488" "0" "50" "14" "45650837" "45650837" "subst" "4.48928E-5" "02329" "FANCM_001246" "g.45650837T>G" "" "" "" "FANCM(NM_020937.4):c.4318-3T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000967489" "0" "50" "14" "45665717" "45665717" "subst" "4.47202E-5" "02329" "FANCM_001153" "g.45665717T>C" "" "" "" "FANCM(NM_020937.4):c.5683T>C (p.C1895R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000980909" "0" "50" "14" "45605503" "45605503" "subst" "0.00029236" "01804" "FANCM_000120" "g.45605503C>T" "" "" "" "FANCM(NM_020937.4):c.269C>T (p.(Pro90Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000980910" "0" "50" "14" "45633736" "45633736" "subst" "1.2206E-5" "02329" "FANCM_000403" "g.45633736G>C" "" "" "" "FANCM(NM_020937.4):c.1756G>C (p.V586L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000980911" "0" "50" "14" "45653030" "45653030" "subst" "4.06898E-6" "01804" "FANCM_001247" "g.45653030A>G" "" "" "" "FANCM(NM_020937.4):c.4440A>G (p.(Gln1480=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001001007" "0" "50" "14" "45605397" "45605397" "subst" "0.000320817" "01804" "FANCM_000103" "g.45605397G>A" "" "" "" "FANCM(NM_020937.2):c.163G>A (p.(Asp55Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001001008" "0" "70" "14" "45644561" "45644561" "del" "0" "01804" "FANCM_000563" "g.45644561del" "" "" "" "FANCM(NM_020937.2):c.2604delA (p.(Glu869fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0001001009" "0" "50" "14" "45658366" "45658366" "subst" "0.00013006" "01804" "FANCM_001067" "g.45658366C>T" "" "" "" "FANCM(NM_020937.2):c.5141C>T (p.(Ala1714Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001026387" "0" "50" "14" "45623930" "45623930" "subst" "1.22476E-5" "02329" "FANCM_001248" "g.45623930G>A" "" "" "" "FANCM(NM_020937.4):c.1214G>A (p.R405Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001026388" "0" "50" "14" "45645627" "45645627" "subst" "0" "02325" "FANCM_000756" "g.45645627T>C" "" "" "" "FANCM(NM_020937.4):c.3670T>C (p.S1224P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001026389" "0" "70" "14" "45645936" "45645937" "del" "8.15116E-6" "02327" "FANCM_000044" "g.45645936_45645937del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0001026390" "0" "30" "14" "45650888" "45650888" "subst" "0.000237413" "02329" "FANCM_000909" "g.45650888C>T" "" "" "" "FANCM(NM_020937.4):c.4366C>T (p.R1456C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001026391" "0" "10" "14" "45658588" "45658588" "subst" "0.00867983" "02329" "FANCM_001249" "g.45658588A>T" "" "" "" "FANCM(NM_020937.4):c.5340+23A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001039965" "0" "30" "14" "45623285" "45623285" "subst" "4.12909E-6" "02329" "FANCM_001250" "g.45623285A>G" "" "" "" "FANCM(NM_020937.4):c.1183+30A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001039966" "0" "30" "14" "45624672" "45624672" "subst" "5.69703E-5" "01804" "FANCM_001251" "g.45624672A>G" "" "" "" "FANCM(NM_020937.4):c.1396+10A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001039967" "0" "50" "14" "45645982" "45645983" "del" "0" "01804" "FANCM_000828" "g.45645982_45645983del" "" "" "" "FANCM(NM_020937.4):c.4025_4026del (p.(Ser1342*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001046471" "0" "10" "14" "45642287" "45642287" "subst" "0.00395691" "02326" "FANCM_000016" "g.45642287A>G" "" "" "" "FANCM(NM_020937.2):c.2190A>G (p.Q730=), FANCM(NM_020937.4):c.2190A>G (p.Q730=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001046472" "0" "30" "14" "45658332" "45658332" "subst" "2.43885E-5" "02326" "FANCM_001057" "g.45658332C>G" "" "" "" "FANCM(NM_020937.2):c.5107C>G (p.H1703D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001046473" "0" "50" "14" "45665507" "45665507" "subst" "0" "02325" "FANCM_001252" "g.45665507C>A" "" "" "" "FANCM(NM_020937.4):c.5473C>A (p.H1825N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001054824" "0" "90" "14" "45636336" "45636336" "subst" "8.13286E-5" "01804" "FANCM_000003" "g.45636336C>T" "" "" "" "FANCM(NM_020937.4):c.1972C>T (p.(Arg658Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0001054825" "0" "50" "14" "45644482" "45644485" "del" "0" "01804" "FANCM_000546" "g.45644482_45644485del" "" "" "" "FANCM(NM_020937.4):c.2525_2528del (p.(Gln842Leufs*11))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001060857" "0" "90" "14" "45636336" "45636336" "subst" "8.13286E-5" "00006" "FANCM_000003" "g.45636336C>T" "" "{PMID:Horbacz 2025:41210864}" "" "" "ACMG PVS1, PM2, PP5, PS3; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.45167133C>T" "" "pathogenic" "ACMG"
"0001066063" "0" "50" "14" "45605532" "45605532" "subst" "8.1213E-6" "02325" "FANCM_000123" "g.45605532C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001066064" "0" "90" "14" "45644543" "45644546" "del" "0" "02325" "FANCM_000049" "g.45644543_45644546del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes FANCM
## Count = 1635
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "{{VariantOnTranscript/Haplotype}}"
"0000019155" "00007729" "70" "3061" "0" "3061" "0" "c.3061del" "r.(?)" "p.(Leu1021Phefs*23)" "14" ""
"0000040554" "00007729" "90" "4222" "1981" "4303" "0" "c.4222+1981_4303del" "r.4223_4317del" "p.Asp1408Glyfs*5" "14i_15" "FA"
"0000040555" "00007729" "90" "4222" "1981" "4303" "0" "c.4222+1981_4303del" "r.spl?" "p.?" "15" "FA"
"0000040556" "00007729" "90" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "11" "FA"
"0000040557" "00007729" "50" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "22" ""
"0000040558" "00007729" "90" "2171" "0" "2171" "0" "c.2171C>A" "r.2171c>a" "p.Ser724*" "13" "FA"
"0000040559" "00007729" "90" "2171" "0" "2171" "0" "c.2171C>A" "r.(?)" "p.(Ser724*)" "13" "FA"
"0000040560" "00007729" "90" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "11" "FA"
"0000250140" "00007729" "10" "5224" "0" "5224" "0" "c.5224A>G" "r.(?)" "p.(Ile1742Val)" "" ""
"0000250141" "00007729" "10" "624" "0" "624" "0" "c.624A>G" "r.(?)" "p.(Ile208Met)" "" ""
"0000250163" "00007729" "10" "3863" "0" "3863" "0" "c.3863A>G" "r.(?)" "p.(Asn1288Ser)" "" ""
"0000250164" "00007729" "10" "5627" "0" "5627" "0" "c.5627A>G" "r.(?)" "p.(Asn1876Ser)" "" ""
"0000250167" "00007729" "10" "1964" "0" "1964" "0" "c.1964A>G" "r.(?)" "p.(Asn655Ser)" "" ""
"0000250175" "00007729" "10" "229" "0" "229" "0" "c.229A>G" "r.(?)" "p.(Thr77Ala)" "" ""
"0000250315" "00007729" "30" "2190" "0" "2190" "0" "c.2190A>G" "r.(?)" "p.(Gln730=)" "" ""
"0000250369" "00007729" "30" "5048" "0" "5048" "0" "c.5048A>G" "r.(?)" "p.(Lys1683Arg)" "" ""
"0000256304" "00007729" "50" "5668" "0" "5668" "0" "c.5668A>G" "r.(?)" "p.(Met1890Val)" "" ""
"0000282991" "00007729" "30" "1237" "0" "1237" "0" "c.1237T>C" "r.(?)" "p.(Tyr413His)" "" ""
"0000282992" "00007729" "30" "1576" "0" "1576" "0" "c.1576C>G" "r.(?)" "p.(Leu526Val)" "" ""
"0000282993" "00007729" "30" "171" "0" "171" "0" "c.171G>C" "r.(?)" "p.(Leu57Phe)" "" ""
"0000282994" "00007729" "10" "2670" "0" "2670" "0" "c.2670T>C" "r.(?)" "p.(Phe890=)" "" ""
"0000282995" "00007729" "30" "3296" "0" "3296" "0" "c.3296G>A" "r.(?)" "p.(Arg1099His)" "" ""
"0000282996" "00007729" "10" "4799" "0" "4799" "0" "c.4799C>T" "r.(?)" "p.(Thr1600Ile)" "" ""
"0000282997" "00007729" "30" "508" "11" "508" "11" "c.508+11C>T" "r.(=)" "p.(=)" "" ""
"0000282999" "00007729" "10" "5190" "0" "5190" "0" "c.5190G>A" "r.(?)" "p.(Gln1730=)" "" ""
"0000283000" "00007729" "10" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Thr176Ile)" "" ""
"0000283001" "00007729" "10" "5656" "0" "5656" "0" "c.5656C>T" "r.(?)" "p.(His1886Tyr)" "" ""
"0000283002" "00007729" "50" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931Ter)" "" ""
"0000283003" "00007729" "50" "6106" "0" "6106" "0" "c.6106C>T" "r.(?)" "p.(Pro2036Ser)" "" ""
"0000287102" "00007729" "30" "4231" "0" "4231" "0" "c.4231T>A" "r.(?)" "p.(Leu1411Ile)" "" ""
"0000287103" "00007729" "50" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Arg18Gln)" "" ""
"0000323659" "00007729" "50" "1667" "0" "1667" "0" "c.1667A>G" "r.(?)" "p.(Asp556Gly)" "" ""
"0000342163" "00007729" "90" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931Ter)" "" ""
"0000357974" "00007729" "00" "1949" "0" "1949" "0" "c.1949A>C" "r.(?)" "p.(Glu650Ala)" "" ""
"0000403788" "00007729" "70" "2081" "0" "2081" "0" "c.2081T>A" "r.(?)" "p.(Leu694*)" "" ""
"0000500475" "00007729" "90" "4843" "0" "4843" "0" "c.4843A>T" "r.(?)" "p.(Lys1615*)" "" ""
"0000500476" "00007729" "90" "5315" "0" "5316" "0" "c.5315_5316del" "r.(?)" "p.(Cys1772*)" "" ""
"0000552558" "00007729" "50" "171" "0" "171" "0" "c.171G>C" "r.(?)" "p.(Leu57Phe)" "" ""
"0000552559" "00007729" "50" "171" "0" "171" "0" "c.171G>C" "r.(?)" "p.(Leu57Phe)" "" ""
"0000552560" "00007729" "10" "229" "0" "229" "0" "c.229A>G" "r.(?)" "p.(Thr77Ala)" "" ""
"0000552561" "00007729" "30" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Thr176Ile)" "" ""
"0000552564" "00007729" "30" "1576" "0" "1576" "0" "c.1576C>G" "r.(?)" "p.(Leu526Val)" "" ""
"0000552565" "00007729" "30" "2268" "0" "2268" "0" "c.2268C>A" "r.(?)" "p.(Arg756=)" "" ""
"0000552566" "00007729" "10" "2749" "0" "2749" "0" "c.2749A>G" "r.(?)" "p.(Ile917Val)" "" ""
"0000552567" "00007729" "30" "2859" "0" "2859" "0" "c.2859A>C" "r.(?)" "p.(Lys953Asn)" "" ""
"0000552568" "00007729" "30" "3208" "0" "3208" "0" "c.3208C>T" "r.(?)" "p.(Pro1070Ser)" "" ""
"0000552569" "00007729" "30" "3343" "0" "3343" "0" "c.3343A>G" "r.(?)" "p.(Asn1115Asp)" "" ""
"0000552570" "00007729" "30" "3355" "0" "3355" "0" "c.3355G>C" "r.(?)" "p.(Asp1119His)" "" ""
"0000552571" "00007729" "30" "3557" "0" "3557" "0" "c.3557A>G" "r.(?)" "p.(Asn1186Ser)" "" ""
"0000552572" "00007729" "10" "3758" "0" "3758" "0" "c.3758A>G" "r.(?)" "p.(Asn1253Ser)" "" ""
"0000552573" "00007729" "10" "3758" "0" "3758" "0" "c.3758A>G" "r.(?)" "p.(Asn1253Ser)" "" ""
"0000552574" "00007729" "10" "4799" "0" "4799" "0" "c.4799C>T" "r.(?)" "p.(Thr1600Ile)" "" ""
"0000552575" "00007729" "30" "5224" "0" "5224" "0" "c.5224A>G" "r.(?)" "p.(Ile1742Val)" "" ""
"0000552576" "00007729" "10" "5627" "0" "5627" "0" "c.5627A>G" "r.(?)" "p.(Asn1876Ser)" "" ""
"0000552577" "00007729" "30" "5740" "0" "5740" "0" "c.5740A>G" "r.(?)" "p.(Arg1914Gly)" "" ""
"0000552579" "00007729" "10" "6141" "0" "6141" "0" "c.6141T>C" "r.(?)" "p.(Asp2047=)" "" ""
"0000578048" "00007729" "00" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000578064" "00007729" "00" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000578100" "00007729" "00" "3979" "0" "3980" "0" "c.3979_3980del" "r.(?)" "p.(Gln1327Valfs*16)" "" ""
"0000578120" "00007729" "00" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "" ""
"0000578143" "00007729" "00" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000592106" "00007729" "90" "1506" "0" "1507" "0" "c.1506_1507insTA" "r.(?)" "p.(Ile503*)" "" ""
"0000592107" "00007729" "90" "2586" "0" "2589" "0" "c.2586_2589del" "r.(?)" "p.(Lys863Ilefs*12)" "" ""
"0000592108" "00007729" "90" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "" ""
"0000592109" "00007729" "90" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "" ""
"0000592110" "00007729" "90" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000592111" "00007729" "90" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000592112" "00007729" "90" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000592115" "00007729" "90" "1491" "0" "1491" "0" "c.1491dup" "r.(?)" "p.(.Gln498Thrfs*7)" "" ""
"0000592116" "00007729" "90" "4387" "-10" "4387" "-10" "c.4387-10A>G" "r.spl" "p.(Arg1436_Ser1437insLeuLeu*)" "" ""
"0000592118" "00007729" "90" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000592119" "00007729" "90" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000592122" "00007729" "90" "1946" "0" "1958" "0" "c.1946_1958del" "r.(?)" "p.(Pro649Leufs*17)" "" ""
"0000592124" "00007729" "90" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000647115" "00007729" "50" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000648891" "00007729" "50" "179" "0" "179" "0" "c.179C>A" "r.(?)" "p.(Ala60Glu)" "" ""
"0000648892" "00007729" "10" "624" "0" "624" "0" "c.624A>G" "r.(?)" "p.(Ile208Met)" "" ""
"0000648893" "00007729" "50" "1222" "0" "1222" "0" "c.1222G>C" "r.(?)" "p.(Asp408His)" "" ""
"0000648894" "00007729" "50" "1964" "0" "1964" "0" "c.1964A>G" "r.(?)" "p.(Asn655Ser)" "" ""
"0000648895" "00007729" "50" "2996" "0" "2996" "0" "c.2996C>T" "r.(?)" "p.(Pro999Leu)" "" ""
"0000648896" "00007729" "30" "3758" "0" "3758" "0" "c.3758A>G" "r.(?)" "p.(Asn1253Ser)" "" ""
"0000648897" "00007729" "30" "4799" "0" "4799" "0" "c.4799C>T" "r.(?)" "p.(Thr1600Ile)" "" ""
"0000648898" "00007729" "30" "4931" "0" "4931" "0" "c.4931G>A" "r.(?)" "p.(Arg1644Gln)" "" ""
"0000648899" "00007729" "50" "5224" "0" "5224" "0" "c.5224A>G" "r.(?)" "p.(Ile1742Val)" "" ""
"0000648900" "00007729" "50" "5569" "0" "5569" "0" "c.5569G>A" "r.(?)" "p.(Val1857Met)" "" ""
"0000648901" "00007729" "30" "5627" "0" "5627" "0" "c.5627A>G" "r.(?)" "p.(Asn1876Ser)" "" ""
"0000657442" "00007729" "30" "1237" "0" "1237" "0" "c.1237T>C" "r.(?)" "p.(Tyr413His)" "" ""
"0000657443" "00007729" "30" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Ser1276Leu)" "" ""
"0000657444" "00007729" "30" "5117" "0" "5117" "0" "c.5117A>C" "r.(?)" "p.(Asn1706Thr)" "" ""
"0000669243" "00007729" "10" "624" "0" "624" "0" "c.624A>G" "r.(?)" "p.(Ile208Met)" "" ""
"0000669244" "00007729" "30" "3758" "0" "3758" "0" "c.3758A>G" "r.(?)" "p.(Asn1253Ser)" "" ""
"0000669245" "00007729" "30" "4931" "0" "4931" "0" "c.4931G>A" "r.(?)" "p.(Arg1644Gln)" "" ""
"0000679973" "00007729" "90" "340" "0" "340" "0" "c.340G>T" "r.(?)" "p.(Gly114Ter)" "" ""
"0000679974" "00007729" "50" "1237" "0" "1237" "0" "c.1237T>C" "r.(?)" "p.(Tyr413His)" "" ""
"0000679975" "00007729" "10" "3547" "0" "3547" "0" "c.3547T>C" "r.(?)" "p.(Leu1183=)" "" ""
"0000679976" "00007729" "30" "4222" "7" "4222" "7" "c.4222+7T>G" "r.(=)" "p.(=)" "" ""
"0000679977" "00007729" "10" "4799" "0" "4799" "0" "c.4799C>T" "r.(?)" "p.(Thr1600Ile)" "" ""
"0000679978" "00007729" "50" "4865" "0" "4867" "0" "c.4865_4867del" "r.(?)" "p.(Glu1622del)" "" ""
"0000679979" "00007729" "30" "5067" "0" "5067" "0" "c.5067G>A" "r.(?)" "p.(Ala1689=)" "" ""
"0000724767" "00007729" "30" "93" "0" "93" "0" "c.93A>G" "r.(?)" "p.(Arg31=)" "" ""
"0000724768" "00007729" "30" "2426" "0" "2426" "0" "c.2426T>G" "r.(?)" "p.(Phe809Cys)" "" ""
"0000724769" "00007729" "30" "3112" "0" "3112" "0" "c.3112C>T" "r.(?)" "p.(Leu1038=)" "" ""
"0000724770" "00007729" "30" "3992" "0" "3992" "0" "c.3992C>T" "r.(?)" "p.(Pro1331Leu)" "" ""
"0000724771" "00007729" "90" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931Ter)" "" ""
"0000724772" "00007729" "10" "6141" "0" "6141" "0" "c.6141T>C" "r.(?)" "p.(Asp2047=)" "" ""
"0000737035" "00007729" "50" "632" "0" "636" "0" "c.632_636del" "r.(?)" "p.(Leu211Tyrfs*2)" "" ""
"0000737036" "00007729" "50" "973" "0" "973" "0" "c.973del" "r.(?)" "p.(Asp325Ilefs*5)" "" ""
"0000737037" "00007729" "50" "1346" "0" "1346" "0" "c.1346del" "r.(?)" "p.(Lys449Serfs*2)" "" ""
"0000737038" "00007729" "50" "1591" "0" "1592" "0" "c.1591_1592del" "r.(?)" "p.(Gln531Valfs*3)" "" ""
"0000737039" "00007729" "50" "2201" "0" "2202" "0" "c.2201_2202del" "r.(?)" "p.(Ser734*)" "" ""
"0000737040" "00007729" "50" "2604" "0" "2604" "0" "c.2604del" "r.(?)" "p.(Glu869Lysfs*7)" "" ""
"0000737041" "00007729" "50" "3116" "0" "3128" "0" "c.3116_3128del" "r.(?)" "p.(Ser1039*)" "" ""
"0000737042" "00007729" "50" "3959" "0" "3969" "0" "c.3959_3969del" "r.(?)" "p.(Leu1320Trpfs*20)" "" ""
"0000737043" "00007729" "50" "4177" "0" "4177" "0" "c.4177del" "r.(?)" "p.(Ser1393Alafs*20)" "" ""
"0000737044" "00007729" "50" "4421" "0" "4442" "0" "c.4421_4442del" "r.(?)" "p.(Phe1474*)" "" ""
"0000737045" "00007729" "50" "4779" "1" "4779" "1" "c.4779+1del" "r.spl?" "p.?" "" ""
"0000737046" "00007729" "50" "5048" "0" "5052" "0" "c.5048_5052del" "r.(?)" "p.(Lys1683Argfs*3)" "" ""
"0000737047" "00007729" "50" "5746" "0" "5747" "0" "c.5746_5747del" "r.(?)" "p.(Lys1916Glufs*3)" "" ""
"0000737167" "00007729" "50" "4475" "0" "4485" "0" "c.4475_4485del" "r.(?)" "p.(Arg1492Lysfs*14)" "" ""
"0000737168" "00007729" "50" "2154" "0" "2156" "0" "c.2154_2156delinsAT" "r.(?)" "p.(Asn718Lysfs*42)" "" ""
"0000737170" "00007729" "50" "3979" "0" "3980" "0" "c.3979_3980del" "r.(?)" "p.(Gln1327Valfs*16)" "" ""
"0000737171" "00007729" "50" "2141" "0" "2142" "0" "c.2141_2142delinsGG" "r.(?)" "p.(Gln714Arg)" "" ""
"0000737172" "00007729" "50" "2112" "0" "2112" "0" "c.2112del" "r.(?)" "p.(Leu705Cysfs*55)" "" ""
"0000737173" "00007729" "50" "2590" "0" "2590" "0" "c.2590del" "r.(?)" "p.(Asp864Ilefs*12)" "" ""
"0000737174" "00007729" "50" "4537" "0" "4537" "0" "c.4537del" "r.(?)" "p.(Asp1513Metfs*34)" "" ""
"0000739574" "00007729" "50" "1" "0" "1" "0" "c.1A>G" "r.?" "p.?" "" ""
"0000739575" "00007729" "50" "8" "0" "8" "0" "c.8G>T" "r.(?)" "p.(Gly3Val)" "" ""
"0000739576" "00007729" "50" "17" "0" "17" "0" "c.17G>T" "r.(?)" "p.(Arg6Ile)" "" ""
"0000739577" "00007729" "50" "23" "0" "23" "0" "c.23T>A" "r.(?)" "p.(Leu8His)" "" ""
"0000739578" "00007729" "50" "23" "0" "23" "0" "c.23T>C" "r.(?)" "p.(Leu8Pro)" "" ""
"0000739579" "00007729" "50" "76" "0" "76" "0" "c.76A>G" "r.(?)" "p.(Ser26Gly)" "" ""
"0000739580" "00007729" "50" "77" "0" "77" "0" "c.77G>C" "r.(?)" "p.(Ser26Thr)" "" ""
"0000739581" "00007729" "50" "86" "0" "86" "0" "c.86C>G" "r.(?)" "p.(Thr29Ser)" "" ""
"0000739582" "00007729" "50" "88" "0" "88" "0" "c.88G>C" "r.(?)" "p.(Glu30Gln)" "" ""
"0000739583" "00007729" "50" "91" "0" "91" "0" "c.91C>T" "r.(?)" "p.(Arg31*)" "" ""
"0000739584" "00007729" "50" "92" "0" "92" "0" "c.92G>T" "r.(?)" "p.(Arg31Leu)" "" ""
"0000739585" "00007729" "50" "95" "0" "95" "0" "c.95C>T" "r.(?)" "p.(Pro32Leu)" "" ""
"0000739586" "00007729" "50" "110" "0" "110" "0" "c.110G>A" "r.(?)" "p.(Ser37Asn)" "" ""
"0000739587" "00007729" "50" "122" "0" "122" "0" "c.122C>T" "r.(?)" "p.(Pro41Leu)" "" ""
"0000739588" "00007729" "50" "160" "0" "160" "0" "c.160G>C" "r.(?)" "p.(Asp54His)" "" ""
"0000739589" "00007729" "50" "166" "0" "166" "0" "c.166G>A" "r.(?)" "p.(Val56Met)" "" ""
"0000739590" "00007729" "50" "181" "0" "181" "0" "c.181G>A" "r.(?)" "p.(Ala61Thr)" "" ""
"0000739591" "00007729" "50" "204" "0" "204" "0" "c.204G>C" "r.(?)" "p.(Leu68Phe)" "" ""
"0000739592" "00007729" "50" "254" "0" "254" "0" "c.254A>G" "r.(?)" "p.(Tyr85Cys)" "" ""
"0000739593" "00007729" "50" "260" "0" "260" "0" "c.260C>T" "r.(?)" "p.(Thr87Ile)" "" ""
"0000739594" "00007729" "50" "275" "0" "275" "0" "c.275G>T" "r.(?)" "p.(Arg92Leu)" "" ""
"0000739595" "00007729" "50" "301" "0" "301" "0" "c.301G>T" "r.(?)" "p.(Ala101Ser)" "" ""
"0000739596" "00007729" "50" "359" "0" "359" "0" "c.359T>C" "r.(?)" "p.(Ile120Thr)" "" ""
"0000739597" "00007729" "50" "374" "0" "374" "0" "c.374T>C" "r.(?)" "p.(Met125Thr)" "" ""
"0000739598" "00007729" "50" "376" "0" "376" "0" "c.376T>G" "r.(?)" "p.(Tyr126Asp)" "" ""
"0000739599" "00007729" "50" "380" "0" "380" "0" "c.380A>G" "r.(?)" "p.(Asn127Ser)" "" ""
"0000739600" "00007729" "50" "382" "0" "382" "0" "c.382T>C" "r.(?)" "p.(Phe128Leu)" "" ""
"0000739601" "00007729" "50" "384" "0" "384" "0" "c.384C>G" "r.(?)" "p.(Phe128Leu)" "" ""
"0000739602" "00007729" "50" "389" "0" "389" "0" "c.389G>A" "r.(?)" "p.(Arg130His)" "" ""
"0000739603" "00007729" "50" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Pro133Leu)" "" ""
"0000739604" "00007729" "50" "407" "0" "407" "0" "c.407A>G" "r.(?)" "p.(Lys136Arg)" "" ""
"0000739605" "00007729" "50" "431" "0" "431" "0" "c.431A>G" "r.(?)" "p.(Lys144Arg)" "" ""
"0000739606" "00007729" "50" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Gln156*)" "" ""
"0000739607" "00007729" "50" "472" "0" "472" "0" "c.472A>T" "r.(?)" "p.(Met158Leu)" "" ""
"0000739608" "00007729" "50" "478" "0" "478" "0" "c.478A>G" "r.(?)" "p.(Ile160Val)" "" ""
"0000739609" "00007729" "50" "493" "0" "493" "0" "c.493A>G" "r.(?)" "p.(Met165Val)" "" ""
"0000739610" "00007729" "50" "497" "0" "497" "0" "c.497C>A" "r.(?)" "p.(Ala166Asp)" "" ""
"0000739611" "00007729" "50" "502" "0" "502" "0" "c.502A>G" "r.(?)" "p.(Met168Val)" "" ""
"0000739612" "00007729" "50" "506" "0" "506" "0" "c.506C>T" "r.(?)" "p.(Thr169Ile)" "" ""
"0000739613" "00007729" "50" "521" "0" "521" "0" "c.521C>G" "r.(?)" "p.(Ala174Gly)" "" ""
"0000739614" "00007729" "50" "552" "0" "552" "0" "c.552G>T" "r.(?)" "p.(Lys184Asn)" "" ""
"0000739615" "00007729" "50" "596" "0" "596" "0" "c.596C>G" "r.(?)" "p.(Ser199Cys)" "" ""
"0000739616" "00007729" "50" "598" "0" "598" "0" "c.598A>G" "r.(?)" "p.(Arg200Gly)" "" ""
"0000739617" "00007729" "50" "601" "0" "601" "0" "c.601G>A" "r.(?)" "p.(Gly201Arg)" "" ""
"0000739618" "00007729" "50" "605" "0" "605" "0" "c.605C>T" "r.(?)" "p.(Ala202Val)" "" ""
"0000739619" "00007729" "50" "620" "0" "620" "0" "c.620A>T" "r.(?)" "p.(Glu207Val)" "" ""
"0000739620" "00007729" "50" "646" "0" "646" "0" "c.646G>A" "r.(?)" "p.(Ala216Thr)" "" ""
"0000739621" "00007729" "50" "662" "0" "662" "0" "c.662G>T" "r.(?)" "p.(Gly221Val)" "" ""
"0000739622" "00007729" "50" "667" "0" "667" "0" "c.667T>C" "r.(?)" "p.(Tyr223His)" "" ""
"0000739623" "00007729" "50" "700" "0" "700" "0" "c.700A>G" "r.(?)" "p.(Lys234Glu)" "" ""
"0000739624" "00007729" "50" "715" "0" "715" "0" "c.715T>C" "r.(?)" "p.(Phe239Leu)" "" ""
"0000739625" "00007729" "50" "739" "0" "739" "0" "c.739A>G" "r.(?)" "p.(Thr247Ala)" "" ""
"0000739626" "00007729" "50" "748" "0" "748" "0" "c.748A>G" "r.(?)" "p.(Ser250Gly)" "" ""
"0000739627" "00007729" "50" "751" "0" "751" "0" "c.751G>T" "r.(?)" "p.(Asp251Tyr)" "" ""
"0000739628" "00007729" "50" "760" "0" "760" "0" "c.760G>A" "r.(?)" "p.(Ala254Thr)" "" ""
"0000739629" "00007729" "50" "763" "0" "763" "0" "c.763G>A" "r.(?)" "p.(Val255Met)" "" ""
"0000739630" "00007729" "50" "829" "0" "829" "0" "c.829A>G" "r.(?)" "p.(Ile277Val)" "" ""
"0000739631" "00007729" "50" "835" "0" "835" "0" "c.835A>G" "r.(?)" "p.(Thr279Ala)" "" ""
"0000739632" "00007729" "50" "845" "0" "845" "0" "c.845A>G" "r.(?)" "p.(His282Arg)" "" ""
"0000739633" "00007729" "50" "859" "0" "859" "0" "c.859G>A" "r.(?)" "p.(Glu287Lys)" "" ""
"0000739634" "00007729" "50" "906" "0" "906" "0" "c.906G>C" "r.(?)" "p.(Lys302Asn)" "" ""
"0000739635" "00007729" "50" "908" "0" "908" "0" "c.908C>A" "r.(?)" "p.(Thr303Asn)" "" ""
"0000739636" "00007729" "50" "926" "0" "926" "0" "c.926A>C" "r.(?)" "p.(Glu309Ala)" "" ""
"0000739637" "00007729" "50" "928" "0" "928" "0" "c.928T>C" "r.(?)" "p.(Ser310Pro)" "" ""
"0000739638" "00007729" "50" "964" "0" "964" "0" "c.964A>C" "r.(?)" "p.(Met322Leu)" "" ""
"0000739639" "00007729" "50" "982" "0" "982" "0" "c.982A>C" "r.(?)" "p.(Asn328His)" "" ""
"0000739640" "00007729" "50" "1021" "0" "1021" "0" "c.1021T>C" "r.(?)" "p.(Phe341Leu)" "" ""
"0000739641" "00007729" "50" "1028" "0" "1028" "0" "c.1028A>G" "r.(?)" "p.(Lys343Arg)" "" ""
"0000739642" "00007729" "50" "1032" "0" "1032" "0" "c.1032C>A" "r.(?)" "p.(Asn344Lys)" "" ""
"0000739643" "00007729" "50" "1034" "0" "1034" "0" "c.1034C>T" "r.(?)" "p.(Pro345Leu)" "" ""
"0000739644" "00007729" "50" "1040" "0" "1040" "0" "c.1040C>A" "r.(?)" "p.(Pro347Gln)" "" ""
"0000739645" "00007729" "50" "1100" "0" "1100" "0" "c.1100T>C" "r.(?)" "p.(Leu367Ser)" "" ""
"0000739646" "00007729" "50" "1115" "0" "1115" "0" "c.1115A>G" "r.(?)" "p.(Glu372Gly)" "" ""
"0000739647" "00007729" "50" "1123" "0" "1123" "0" "c.1123C>T" "r.(?)" "p.(Gln375*)" "" ""
"0000739648" "00007729" "50" "1138" "0" "1138" "0" "c.1138A>G" "r.(?)" "p.(Arg380Gly)" "" ""
"0000739649" "00007729" "50" "1162" "0" "1162" "0" "c.1162G>A" "r.(?)" "p.(Gly388Arg)" "" ""
"0000739650" "00007729" "50" "1165" "0" "1165" "0" "c.1165A>G" "r.(?)" "p.(Ile389Val)" "" ""
"0000739651" "00007729" "50" "1178" "0" "1178" "0" "c.1178C>T" "r.(?)" "p.(Thr393Ile)" "" ""
"0000739652" "00007729" "50" "1183" "1" "1183" "1" "c.1183+1G>A" "r.spl?" "p.?" "" ""
"0000739653" "00007729" "50" "1190" "0" "1190" "0" "c.1190C>G" "r.(?)" "p.(Thr397Arg)" "" ""
"0000739654" "00007729" "50" "1199" "0" "1199" "0" "c.1199A>G" "r.(?)" "p.(Lys400Arg)" "" ""
"0000739655" "00007729" "50" "1204" "0" "1204" "0" "c.1204G>T" "r.(?)" "p.(Glu402*)" "" ""
"0000739656" "00007729" "50" "1211" "0" "1211" "0" "c.1211G>A" "r.(?)" "p.(Gly404Asp)" "" ""
"0000739657" "00007729" "50" "1220" "0" "1220" "0" "c.1220A>G" "r.(?)" "p.(Glu407Gly)" "" ""
"0000739658" "00007729" "50" "1223" "0" "1223" "0" "c.1223A>G" "r.(?)" "p.(Asp408Gly)" "" ""
"0000739659" "00007729" "50" "1247" "0" "1247" "0" "c.1247T>C" "r.(?)" "p.(Leu416Pro)" "" ""
"0000739660" "00007729" "50" "1255" "0" "1255" "0" "c.1255A>C" "r.(?)" "p.(Met419Leu)" "" ""
"0000739661" "00007729" "50" "1262" "0" "1262" "0" "c.1262C>T" "r.(?)" "p.(Ala421Val)" "" ""
"0000739662" "00007729" "50" "1265" "0" "1265" "0" "c.1265G>A" "r.(?)" "p.(Arg422His)" "" ""
"0000739663" "00007729" "50" "1279" "0" "1279" "0" "c.1279T>A" "r.(?)" "p.(Ser427Thr)" "" ""
"0000739664" "00007729" "50" "1279" "0" "1279" "0" "c.1279T>G" "r.(?)" "p.(Ser427Ala)" "" ""
"0000739665" "00007729" "50" "1282" "0" "1282" "0" "c.1282G>C" "r.(?)" "p.(Ala428Pro)" "" ""
"0000739666" "00007729" "50" "1297" "0" "1297" "0" "c.1297G>A" "r.(?)" "p.(Ala433Thr)" "" ""
"0000739667" "00007729" "50" "1309" "0" "1309" "0" "c.1309G>A" "r.(?)" "p.(Gly437Arg)" "" ""
"0000739668" "00007729" "50" "1310" "-2" "1310" "-2" "c.1310-2A>G" "r.spl?" "p.?" "" ""
"0000739669" "00007729" "50" "1328" "0" "1328" "0" "c.1328T>C" "r.(?)" "p.(Phe443Ser)" "" ""
"0000739670" "00007729" "50" "1336" "0" "1336" "0" "c.1336A>G" "r.(?)" "p.(Ser446Gly)" "" ""
"0000739671" "00007729" "50" "1346" "0" "1346" "0" "c.1346A>G" "r.(?)" "p.(Lys449Arg)" "" ""
"0000739672" "00007729" "50" "1351" "0" "1351" "0" "c.1351A>G" "r.(?)" "p.(Lys451Glu)" "" ""
"0000739673" "00007729" "50" "1353" "0" "1353" "0" "c.1353G>T" "r.(?)" "p.(Lys451Asn)" "" ""
"0000739674" "00007729" "50" "1360" "0" "1360" "0" "c.1360G>A" "r.(?)" "p.(Glu454Lys)" "" ""
"0000739675" "00007729" "50" "1367" "0" "1367" "0" "c.1367T>C" "r.(?)" "p.(Val456Ala)" "" ""
"0000739676" "00007729" "50" "1373" "0" "1373" "0" "c.1373T>C" "r.(?)" "p.(Ile458Thr)" "" ""
"0000739677" "00007729" "50" "1378" "0" "1378" "0" "c.1378C>T" "r.(?)" "p.(His460Tyr)" "" ""
"0000739678" "00007729" "50" "1397" "-2" "1397" "-2" "c.1397-2A>G" "r.spl?" "p.?" "" ""
"0000739679" "00007729" "50" "1406" "0" "1406" "0" "c.1406C>G" "r.(?)" "p.(Thr469Ser)" "" ""
"0000739680" "00007729" "50" "1408" "0" "1408" "0" "c.1408A>G" "r.(?)" "p.(Thr470Ala)" "" ""
"0000739681" "00007729" "50" "1420" "0" "1420" "0" "c.1420C>T" "r.(?)" "p.(Arg474Cys)" "" ""
"0000739682" "00007729" "50" "1423" "0" "1423" "0" "c.1423G>T" "r.(?)" "p.(Asp475Tyr)" "" ""
"0000739683" "00007729" "50" "1439" "0" "1439" "0" "c.1439T>A" "r.(?)" "p.(Met480Lys)" "" ""
"0000739684" "00007729" "50" "1444" "0" "1444" "0" "c.1444T>A" "r.(?)" "p.(Phe482Ile)" "" ""
"0000739685" "00007729" "50" "1453" "0" "1453" "0" "c.1453T>C" "r.(?)" "p.(Phe485Leu)" "" ""
"0000739686" "00007729" "50" "1463" "0" "1463" "0" "c.1463G>A" "r.(?)" "p.(Ser488Asn)" "" ""
"0000739687" "00007729" "50" "1532" "0" "1532" "0" "c.1532A>G" "r.(?)" "p.(His511Arg)" "" ""
"0000739688" "00007729" "50" "1543" "0" "1543" "0" "c.1543A>G" "r.(?)" "p.(Lys515Glu)" "" ""
"0000739689" "00007729" "50" "1546" "0" "1546" "0" "c.1546A>G" "r.(?)" "p.(Ser516Gly)" "" ""
"0000739690" "00007729" "50" "1550" "0" "1550" "0" "c.1550C>G" "r.(?)" "p.(Thr517Arg)" "" ""
"0000739691" "00007729" "50" "1567" "0" "1567" "0" "c.1567A>T" "r.(?)" "p.(Lys523*)" "" ""
"0000739692" "00007729" "50" "1601" "0" "1601" "0" "c.1601A>G" "r.(?)" "p.(Asp534Gly)" "" ""
"0000739693" "00007729" "50" "1654" "0" "1654" "0" "c.1654A>G" "r.(?)" "p.(Ile552Val)" "" ""
"0000739694" "00007729" "50" "1674" "0" "1674" "0" "c.1674A>G" "r.(?)" "p.(Ile558Met)" "" ""
"0000739695" "00007729" "50" "1678" "0" "1678" "0" "c.1678T>A" "r.(?)" "p.(Cys560Ser)" "" ""
"0000739696" "00007729" "50" "1723" "0" "1723" "0" "c.1723G>A" "r.(?)" "p.(Gly575Ser)" "" ""
"0000739697" "00007729" "50" "1742" "0" "1742" "0" "c.1742G>A" "r.(?)" "p.(Arg581His)" "" ""
"0000739698" "00007729" "50" "1777" "0" "1777" "0" "c.1777C>G" "r.(?)" "p.(Arg593Gly)" "" ""
"0000739699" "00007729" "50" "1778" "0" "1778" "0" "c.1778G>A" "r.(?)" "p.(Arg593Gln)" "" ""
"0000739700" "00007729" "50" "1782" "0" "1782" "0" "c.1782G>T" "r.(?)" "p.(Glu594Asp)" "" ""
"0000739701" "00007729" "50" "1783" "0" "1783" "0" "c.1783G>A" "r.(?)" "p.(Glu595Lys)" "" ""
"0000739702" "00007729" "50" "1786" "0" "1786" "0" "c.1786C>T" "r.(?)" "p.(Arg596Cys)" "" ""
"0000739703" "00007729" "50" "1795" "0" "1795" "0" "c.1795A>T" "r.(?)" "p.(Asn599Tyr)" "" ""
"0000739704" "00007729" "50" "1816" "0" "1816" "0" "c.1816A>G" "r.(?)" "p.(Arg606Gly)" "" ""
"0000739705" "00007729" "50" "1822" "0" "1822" "0" "c.1822A>G" "r.(?)" "p.(Ile608Val)" "" ""
"0000739706" "00007729" "50" "1852" "0" "1852" "0" "c.1852G>T" "r.(?)" "p.(Val618Phe)" "" ""
"0000739707" "00007729" "50" "1879" "0" "1879" "0" "c.1879C>T" "r.(?)" "p.(Arg627*)" "" ""
"0000739708" "00007729" "50" "1884" "0" "1884" "0" "c.1884G>A" "r.(?)" "p.(Met628Ile)" "" ""
"0000739709" "00007729" "50" "1915" "0" "1915" "0" "c.1915A>G" "r.(?)" "p.(Lys639Glu)" "" ""
"0000739710" "00007729" "50" "1919" "0" "1919" "0" "c.1919T>A" "r.(?)" "p.(Met640Lys)" "" ""
"0000739711" "00007729" "50" "1921" "0" "1921" "0" "c.1921T>C" "r.(?)" "p.(Phe641Leu)" "" ""
"0000739712" "00007729" "50" "1934" "0" "1934" "0" "c.1934G>T" "r.(?)" "p.(Gly645Val)" "" ""
"0000739713" "00007729" "50" "1961" "0" "1961" "0" "c.1961G>A" "r.(?)" "p.(Arg654Gln)" "" ""
"0000739714" "00007729" "50" "1994" "0" "1994" "0" "c.1994A>G" "r.(?)" "p.(Tyr665Cys)" "" ""
"0000739715" "00007729" "50" "2024" "0" "2024" "0" "c.2024A>G" "r.(?)" "p.(Lys675Arg)" "" ""
"0000739716" "00007729" "50" "2029" "0" "2029" "0" "c.2029G>A" "r.(?)" "p.(Asp677Asn)" "" ""
"0000739717" "00007729" "50" "2033" "0" "2033" "0" "c.2033G>C" "r.(?)" "p.(Trp678Ser)" "" ""
"0000739718" "00007729" "50" "2035" "0" "2035" "0" "c.2035T>C" "r.(?)" "p.(Phe679Leu)" "" ""
"0000739719" "00007729" "50" "2062" "0" "2062" "0" "c.2062T>C" "r.(?)" "p.(Trp688Arg)" "" ""
"0000739720" "00007729" "50" "2084" "0" "2084" "0" "c.2084G>A" "r.(?)" "p.(Arg695Lys)" "" ""
"0000739721" "00007729" "50" "2085" "0" "2085" "0" "c.2085G>C" "r.(?)" "p.(Arg695Ser)" "" ""
"0000739722" "00007729" "50" "2090" "0" "2090" "0" "c.2090G>A" "r.(?)" "p.(Ser697Asn)" "" ""
"0000739723" "00007729" "50" "2126" "0" "2126" "0" "c.2126A>G" "r.(?)" "p.(Gln709Arg)" "" ""
"0000739724" "00007729" "50" "2152" "0" "2152" "0" "c.2152A>G" "r.(?)" "p.(Asn718Asp)" "" ""
"0000739725" "00007729" "50" "2153" "0" "2153" "0" "c.2153A>G" "r.(?)" "p.(Asn718Ser)" "" ""
"0000739726" "00007729" "50" "2157" "0" "2157" "0" "c.2157A>T" "r.(?)" "p.(Lys719Asn)" "" ""
"0000739727" "00007729" "50" "2158" "0" "2158" "0" "c.2158C>T" "r.(?)" "p.(Pro720Ser)" "" ""
"0000739728" "00007729" "50" "2177" "0" "2177" "0" "c.2177C>T" "r.(?)" "p.(Thr726Ile)" "" ""
"0000739729" "00007729" "50" "2195" "0" "2195" "0" "c.2195C>G" "r.(?)" "p.(Ser732Cys)" "" ""
"0000739730" "00007729" "50" "2195" "0" "2195" "0" "c.2195C>T" "r.(?)" "p.(Ser732Phe)" "" ""
"0000739731" "00007729" "50" "2197" "0" "2197" "0" "c.2197C>T" "r.(?)" "p.(Leu733Phe)" "" ""
"0000739732" "00007729" "50" "2200" "0" "2200" "0" "c.2200T>C" "r.(?)" "p.(Ser734Pro)" "" ""
"0000739733" "00007729" "50" "2222" "0" "2222" "0" "c.2222A>G" "r.(?)" "p.(Asp741Gly)" "" ""
"0000739734" "00007729" "50" "2228" "0" "2228" "0" "c.2228C>G" "r.(?)" "p.(Pro743Arg)" "" ""
"0000739735" "00007729" "50" "2282" "0" "2282" "0" "c.2282T>A" "r.(?)" "p.(Leu761His)" "" ""
"0000739736" "00007729" "50" "2328" "0" "2328" "0" "c.2328C>A" "r.(?)" "p.(Ser776Arg)" "" ""
"0000739737" "00007729" "50" "2350" "0" "2350" "0" "c.2350T>C" "r.(?)" "p.(Tyr784His)" "" ""
"0000739738" "00007729" "50" "2354" "0" "2354" "0" "c.2354T>G" "r.(?)" "p.(Leu785*)" "" ""
"0000739739" "00007729" "50" "2357" "0" "2357" "0" "c.2357A>G" "r.(?)" "p.(Gln786Arg)" "" ""
"0000739740" "00007729" "50" "2361" "0" "2361" "0" "c.2361G>A" "r.(?)" "p.(Met787Ile)" "" ""
"0000739741" "00007729" "50" "2368" "0" "2368" "0" "c.2368G>A" "r.(?)" "p.(Val790Ile)" "" ""
"0000739742" "00007729" "50" "2368" "0" "2368" "0" "c.2368G>C" "r.(?)" "p.(Val790Leu)" "" ""
"0000739743" "00007729" "50" "2377" "0" "2377" "0" "c.2377A>G" "r.(?)" "p.(Thr793Ala)" "" ""
"0000739744" "00007729" "50" "2389" "0" "2389" "0" "c.2389C>T" "r.(?)" "p.(Pro797Ser)" "" ""
"0000739745" "00007729" "50" "2392" "0" "2392" "0" "c.2392A>G" "r.(?)" "p.(Arg798Gly)" "" ""
"0000739746" "00007729" "50" "2395" "0" "2395" "0" "c.2395A>G" "r.(?)" "p.(Asn799Asp)" "" ""
"0000739747" "00007729" "50" "2413" "0" "2413" "0" "c.2413G>A" "r.(?)" "p.(Ala805Thr)" "" ""
"0000739748" "00007729" "50" "2423" "0" "2423" "0" "c.2423C>A" "r.(?)" "p.(Thr808Asn)" "" ""
"0000739749" "00007729" "50" "2466" "0" "2466" "0" "c.2466T>A" "r.(?)" "p.(Asn822Lys)" "" ""
"0000739750" "00007729" "50" "2518" "0" "2518" "0" "c.2518G>A" "r.(?)" "p.(Val840Ile)" "" ""
"0000739751" "00007729" "50" "2547" "0" "2547" "0" "c.2547A>C" "r.(?)" "p.(Lys849Asn)" "" ""
"0000739752" "00007729" "50" "2548" "0" "2548" "0" "c.2548A>G" "r.(?)" "p.(Ile850Val)" "" ""
"0000739753" "00007729" "50" "2579" "0" "2579" "0" "c.2579A>G" "r.(?)" "p.(Glu860Gly)" "" ""
"0000739754" "00007729" "50" "2586" "0" "2586" "0" "c.2586A>T" "r.(?)" "p.(Lys862Asn)" "" ""
"0000739755" "00007729" "50" "2596" "0" "2596" "0" "c.2596C>T" "r.(?)" "p.(Leu866Phe)" "" ""
"0000739756" "00007729" "50" "2608" "0" "2608" "0" "c.2608A>G" "r.(?)" "p.(Asn870Asp)" "" ""
"0000739757" "00007729" "50" "2617" "0" "2617" "0" "c.2617G>A" "r.(?)" "p.(Gly873Ser)" "" ""
"0000739758" "00007729" "50" "2618" "0" "2618" "0" "c.2618G>C" "r.(?)" "p.(Gly873Ala)" "" ""
"0000739759" "00007729" "50" "2629" "0" "2629" "0" "c.2629T>C" "r.(?)" "p.(Ser877Pro)" "" ""
"0000739760" "00007729" "50" "2662" "0" "2662" "0" "c.2662A>T" "r.(?)" "p.(Asn888Tyr)" "" ""
"0000739761" "00007729" "50" "2668" "0" "2668" "0" "c.2668T>C" "r.(?)" "p.(Phe890Leu)" "" ""
"0000739762" "00007729" "50" "2672" "0" "2672" "0" "c.2672A>C" "r.(?)" "p.(Gln891Pro)" "" ""
"0000739763" "00007729" "50" "2687" "0" "2687" "0" "c.2687A>G" "r.(?)" "p.(Asn896Ser)" "" ""
"0000739764" "00007729" "50" "2690" "0" "2690" "0" "c.2690A>T" "r.(?)" "p.(Asp897Val)" "" ""
"0000739765" "00007729" "50" "2693" "0" "2693" "0" "c.2693A>G" "r.(?)" "p.(Lys898Arg)" "" ""
"0000739766" "00007729" "50" "2704" "0" "2704" "0" "c.2704G>C" "r.(?)" "p.(Asp902His)" "" ""
"0000739767" "00007729" "50" "2722" "0" "2722" "0" "c.2722G>A" "r.(?)" "p.(Ala908Thr)" "" ""
"0000739768" "00007729" "50" "2738" "0" "2738" "0" "c.2738A>G" "r.(?)" "p.(Asn913Ser)" "" ""
"0000739769" "00007729" "50" "2755" "0" "2755" "0" "c.2755G>A" "r.(?)" "p.(Glu919Lys)" "" ""
"0000739770" "00007729" "50" "2755" "0" "2755" "0" "c.2755G>C" "r.(?)" "p.(Glu919Gln)" "" ""
"0000739771" "00007729" "50" "2759" "0" "2759" "0" "c.2759C>T" "r.(?)" "p.(Pro920Leu)" "" ""
"0000739772" "00007729" "50" "2801" "0" "2801" "0" "c.2801C>T" "r.(?)" "p.(Thr934Ile)" "" ""
"0000739773" "00007729" "50" "2815" "0" "2815" "0" "c.2815G>A" "r.(?)" "p.(Gly939Arg)" "" ""
"0000739774" "00007729" "50" "2879" "0" "2879" "0" "c.2879T>C" "r.(?)" "p.(Phe960Ser)" "" ""
"0000739775" "00007729" "50" "2887" "0" "2887" "0" "c.2887T>C" "r.(?)" "p.(Phe963Leu)" "" ""
"0000739776" "00007729" "50" "2922" "0" "2922" "0" "c.2922C>G" "r.(?)" "p.(Asp974Glu)" "" ""
"0000739777" "00007729" "50" "2930" "0" "2930" "0" "c.2930A>G" "r.(?)" "p.(Tyr977Cys)" "" ""
"0000739778" "00007729" "50" "2938" "0" "2938" "0" "c.2938C>T" "r.(?)" "p.(His980Tyr)" "" ""
"0000739779" "00007729" "50" "2956" "0" "2956" "0" "c.2956G>C" "r.(?)" "p.(Val986Leu)" "" ""
"0000739780" "00007729" "50" "2962" "0" "2962" "0" "c.2962G>A" "r.(?)" "p.(Ala988Thr)" "" ""
"0000739781" "00007729" "50" "3073" "0" "3073" "0" "c.3073T>C" "r.(?)" "p.(Cys1025Arg)" "" ""
"0000739782" "00007729" "50" "3089" "0" "3089" "0" "c.3089G>A" "r.(?)" "p.(Arg1030Gln)" "" ""
"0000739783" "00007729" "50" "3100" "0" "3100" "0" "c.3100T>G" "r.(?)" "p.(Cys1034Gly)" "" ""
"0000739784" "00007729" "50" "3175" "0" "3175" "0" "c.3175T>C" "r.(?)" "p.(Tyr1059His)" "" ""
"0000739785" "00007729" "50" "3182" "0" "3182" "0" "c.3182C>T" "r.(?)" "p.(Ser1061Phe)" "" ""
"0000739786" "00007729" "50" "3206" "0" "3206" "0" "c.3206T>C" "r.(?)" "p.(Ile1069Thr)" "" ""
"0000739787" "00007729" "50" "3212" "0" "3212" "0" "c.3212A>G" "r.(?)" "p.(Asn1071Ser)" "" ""
"0000739788" "00007729" "50" "3217" "0" "3217" "0" "c.3217A>G" "r.(?)" "p.(Asn1073Asp)" "" ""
"0000739789" "00007729" "50" "3221" "0" "3221" "0" "c.3221T>A" "r.(?)" "p.(Ile1074Asn)" "" ""
"0000739790" "00007729" "50" "3224" "0" "3224" "0" "c.3224C>T" "r.(?)" "p.(Ser1075Phe)" "" ""
"0000739791" "00007729" "50" "3232" "0" "3232" "0" "c.3232C>G" "r.(?)" "p.(Pro1078Ala)" "" ""
"0000739792" "00007729" "50" "3238" "0" "3238" "0" "c.3238C>A" "r.(?)" "p.(Leu1080Ile)" "" ""
"0000739793" "00007729" "50" "3247" "0" "3247" "0" "c.3247T>C" "r.(?)" "p.(Cys1083Arg)" "" ""
"0000739794" "00007729" "50" "3265" "0" "3265" "0" "c.3265A>G" "r.(?)" "p.(Asn1089Asp)" "" ""
"0000739795" "00007729" "50" "3303" "0" "3303" "0" "c.3303A>C" "r.(?)" "p.(Gln1101His)" "" ""
"0000739796" "00007729" "50" "3319" "0" "3319" "0" "c.3319G>C" "r.(?)" "p.(Ala1107Pro)" "" ""
"0000739797" "00007729" "50" "3347" "0" "3347" "0" "c.3347A>G" "r.(?)" "p.(His1116Arg)" "" ""
"0000739798" "00007729" "50" "3363" "0" "3363" "0" "c.3363T>G" "r.(?)" "p.(Ser1121Arg)" "" ""
"0000739799" "00007729" "50" "3379" "0" "3379" "0" "c.3379T>A" "r.(?)" "p.(Ser1127Thr)" "" ""
"0000739800" "00007729" "50" "3394" "0" "3394" "0" "c.3394G>T" "r.(?)" "p.(Glu1132*)" "" ""
"0000739801" "00007729" "50" "3427" "0" "3427" "0" "c.3427G>C" "r.(?)" "p.(Glu1143Gln)" "" ""
"0000739802" "00007729" "50" "3467" "0" "3467" "0" "c.3467G>A" "r.(?)" "p.(Ser1156Asn)" "" ""
"0000739803" "00007729" "50" "3491" "0" "3491" "0" "c.3491A>G" "r.(?)" "p.(Lys1164Arg)" "" ""
"0000739804" "00007729" "50" "3496" "0" "3496" "0" "c.3496G>A" "r.(?)" "p.(Ala1166Thr)" "" ""
"0000739805" "00007729" "50" "3499" "0" "3499" "0" "c.3499A>G" "r.(?)" "p.(Ile1167Val)" "" ""
"0000739806" "00007729" "50" "3520" "0" "3520" "0" "c.3520T>C" "r.(?)" "p.(Ser1174Pro)" "" ""
"0000739807" "00007729" "50" "3524" "0" "3524" "0" "c.3524A>C" "r.(?)" "p.(Gln1175Pro)" "" ""
"0000739808" "00007729" "50" "3524" "0" "3524" "0" "c.3524A>G" "r.(?)" "p.(Gln1175Arg)" "" ""
"0000739809" "00007729" "50" "3545" "0" "3545" "0" "c.3545T>C" "r.(?)" "p.(Leu1182Pro)" "" ""
"0000739810" "00007729" "50" "3611" "0" "3611" "0" "c.3611G>T" "r.(?)" "p.(Arg1204Leu)" "" ""
"0000739811" "00007729" "50" "3643" "0" "3643" "0" "c.3643A>G" "r.(?)" "p.(Lys1215Glu)" "" ""
"0000739812" "00007729" "50" "3659" "0" "3659" "0" "c.3659T>G" "r.(?)" "p.(Ile1220Ser)" "" ""
"0000739813" "00007729" "50" "3662" "0" "3662" "0" "c.3662T>C" "r.(?)" "p.(Phe1221Ser)" "" ""
"0000739814" "00007729" "50" "3670" "0" "3670" "0" "c.3670T>C" "r.(?)" "p.(Ser1224Pro)" "" ""
"0000739815" "00007729" "50" "3706" "0" "3706" "0" "c.3706T>G" "r.(?)" "p.(Phe1236Val)" "" ""
"0000739816" "00007729" "50" "3745" "0" "3745" "0" "c.3745A>T" "r.(?)" "p.(Thr1249Ser)" "" ""
"0000739817" "00007729" "50" "3767" "0" "3767" "0" "c.3767T>G" "r.(?)" "p.(Leu1256Arg)" "" ""
"0000739818" "00007729" "50" "3802" "0" "3802" "0" "c.3802G>A" "r.(?)" "p.(Glu1268Lys)" "" ""
"0000739819" "00007729" "50" "3842" "0" "3842" "0" "c.3842T>C" "r.(?)" "p.(Ile1281Thr)" "" ""
"0000739820" "00007729" "50" "3869" "0" "3869" "0" "c.3869C>T" "r.(?)" "p.(Thr1290Ile)" "" ""
"0000739821" "00007729" "50" "3877" "0" "3877" "0" "c.3877A>G" "r.(?)" "p.(Thr1293Ala)" "" ""
"0000739822" "00007729" "50" "3899" "0" "3899" "0" "c.3899A>G" "r.(?)" "p.(Glu1300Gly)" "" ""
"0000739823" "00007729" "50" "3906" "0" "3906" "0" "c.3906G>A" "r.(?)" "p.(Met1302Ile)" "" ""
"0000739824" "00007729" "50" "3922" "0" "3922" "0" "c.3922G>A" "r.(?)" "p.(Val1308Ile)" "" ""
"0000739825" "00007729" "50" "3959" "0" "3959" "0" "c.3959T>C" "r.(?)" "p.(Leu1320Ser)" "" ""
"0000739826" "00007729" "50" "3970" "0" "3970" "0" "c.3970G>C" "r.(?)" "p.(Gly1324Arg)" "" ""
"0000739827" "00007729" "50" "3975" "0" "3975" "0" "c.3975T>G" "r.(?)" "p.(Tyr1325*)" "" ""
"0000739828" "00007729" "50" "3983" "0" "3983" "0" "c.3983T>C" "r.(?)" "p.(Phe1328Ser)" "" ""
"0000739829" "00007729" "50" "4015" "0" "4015" "0" "c.4015A>G" "r.(?)" "p.(Thr1339Ala)" "" ""
"0000739830" "00007729" "50" "4025" "0" "4025" "0" "c.4025C>G" "r.(?)" "p.(Ser1342Cys)" "" ""
"0000739831" "00007729" "50" "4030" "0" "4030" "0" "c.4030T>C" "r.(?)" "p.(Ser1344Pro)" "" ""
"0000739832" "00007729" "50" "4054" "0" "4054" "0" "c.4054A>G" "r.(?)" "p.(Lys1352Glu)" "" ""
"0000739833" "00007729" "50" "4107" "0" "4107" "0" "c.4107C>A" "r.(?)" "p.(Asn1369Lys)" "" ""
"0000739834" "00007729" "50" "4148" "0" "4148" "0" "c.4148A>T" "r.(?)" "p.(Tyr1383Phe)" "" ""
"0000739835" "00007729" "50" "4162" "0" "4162" "0" "c.4162C>G" "r.(?)" "p.(Leu1388Val)" "" ""
"0000739836" "00007729" "50" "4177" "0" "4177" "0" "c.4177A>G" "r.(?)" "p.(Ser1393Gly)" "" ""
"0000739837" "00007729" "50" "4183" "0" "4183" "0" "c.4183G>T" "r.(?)" "p.(Gly1395Cys)" "" ""
"0000739838" "00007729" "50" "4189" "0" "4189" "0" "c.4189A>T" "r.(?)" "p.(Met1397Leu)" "" ""
"0000739839" "00007729" "50" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(His1400Tyr)" "" ""
"0000739840" "00007729" "50" "4225" "0" "4225" "0" "c.4225G>A" "r.(?)" "p.(Gly1409Arg)" "" ""
"0000739841" "00007729" "50" "4229" "0" "4229" "0" "c.4229A>G" "r.(?)" "p.(Gln1410Arg)" "" ""
"0000739842" "00007729" "50" "4234" "0" "4234" "0" "c.4234T>A" "r.(?)" "p.(Leu1412Ile)" "" ""
"0000739843" "00007729" "50" "4235" "0" "4235" "0" "c.4235T>C" "r.(?)" "p.(Leu1412Ser)" "" ""
"0000739844" "00007729" "50" "4237" "0" "4237" "0" "c.4237A>G" "r.(?)" "p.(Thr1413Ala)" "" ""
"0000739845" "00007729" "50" "4253" "0" "4253" "0" "c.4253A>G" "r.(?)" "p.(Glu1418Gly)" "" ""
"0000739846" "00007729" "50" "4255" "0" "4255" "0" "c.4255G>A" "r.(?)" "p.(Asp1419Asn)" "" ""
"0000739847" "00007729" "50" "4261" "0" "4261" "0" "c.4261G>A" "r.(?)" "p.(Glu1421Lys)" "" ""
"0000739848" "00007729" "50" "4264" "0" "4264" "0" "c.4264A>G" "r.(?)" "p.(Ile1422Val)" "" ""
"0000739849" "00007729" "50" "4271" "0" "4271" "0" "c.4271G>T" "r.(?)" "p.(Arg1424Leu)" "" ""
"0000739850" "00007729" "50" "4280" "0" "4280" "0" "c.4280T>G" "r.(?)" "p.(Val1427Gly)" "" ""
"0000739851" "00007729" "50" "4309" "0" "4309" "0" "c.4309T>A" "r.(?)" "p.(Ser1437Thr)" "" ""
"0000739852" "00007729" "50" "4309" "0" "4309" "0" "c.4309T>C" "r.(?)" "p.(Ser1437Pro)" "" ""
"0000739853" "00007729" "50" "4319" "0" "4319" "0" "c.4319A>G" "r.(?)" "p.(Asp1440Gly)" "" ""
"0000739854" "00007729" "50" "4325" "0" "4325" "0" "c.4325A>T" "r.(?)" "p.(Lys1442Ile)" "" ""
"0000739855" "00007729" "50" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Leu1450Phe)" "" ""
"0000739856" "00007729" "50" "4372" "0" "4372" "0" "c.4372T>C" "r.(?)" "p.(Phe1458Leu)" "" ""
"0000739857" "00007729" "50" "4375" "0" "4375" "0" "c.4375C>T" "r.(?)" "p.(Pro1459Ser)" "" ""
"0000739858" "00007729" "50" "4396" "0" "4396" "0" "c.4396T>C" "r.(?)" "p.(Ser1466Pro)" "" ""
"0000739859" "00007729" "50" "4400" "0" "4400" "0" "c.4400C>G" "r.(?)" "p.(Ser1467Cys)" "" ""
"0000739860" "00007729" "50" "4424" "0" "4424" "0" "c.4424C>G" "r.(?)" "p.(Pro1475Arg)" "" ""
"0000739861" "00007729" "50" "4427" "0" "4427" "0" "c.4427A>G" "r.(?)" "p.(Lys1476Arg)" "" ""
"0000739862" "00007729" "50" "4438" "0" "4438" "0" "c.4438C>T" "r.(?)" "p.(Gln1480*)" "" ""
"0000739863" "00007729" "50" "4454" "0" "4454" "0" "c.4454A>G" "r.(?)" "p.(Lys1485Arg)" "" ""
"0000739864" "00007729" "50" "4480" "0" "4480" "0" "c.4480G>A" "r.(?)" "p.(Gly1494Ser)" "" ""
"0000739865" "00007729" "50" "4513" "0" "4513" "0" "c.4513A>G" "r.(?)" "p.(Lys1505Glu)" "" ""
"0000739866" "00007729" "50" "4523" "0" "4523" "0" "c.4523C>G" "r.(?)" "p.(Ala1508Gly)" "" ""
"0000739867" "00007729" "50" "4526" "0" "4526" "0" "c.4526G>A" "r.(?)" "p.(Arg1509Lys)" "" ""
"0000739868" "00007729" "50" "4531" "0" "4531" "0" "c.4531T>C" "r.(?)" "p.(Phe1511Leu)" "" ""
"0000739869" "00007729" "50" "4536" "0" "4536" "0" "c.4536A>T" "r.(?)" "p.(Leu1512Phe)" "" ""
"0000739870" "00007729" "50" "4544" "0" "4544" "0" "c.4544A>T" "r.(?)" "p.(Glu1515Val)" "" ""
"0000739871" "00007729" "50" "4545" "0" "4545" "0" "c.4545A>T" "r.(?)" "p.(Glu1515Asp)" "" ""
"0000739872" "00007729" "50" "4556" "0" "4556" "0" "c.4556C>G" "r.(?)" "p.(Ser1519Cys)" "" ""
"0000739873" "00007729" "50" "4567" "0" "4567" "0" "c.4567G>A" "r.(?)" "p.(Ala1523Thr)" "" ""
"0000739874" "00007729" "50" "4571" "0" "4571" "0" "c.4571A>G" "r.(?)" "p.(Glu1524Gly)" "" ""
"0000739875" "00007729" "50" "4601" "0" "4601" "0" "c.4601C>T" "r.(?)" "p.(Ser1534Leu)" "" ""
"0000739876" "00007729" "50" "4606" "0" "4606" "0" "c.4606A>G" "r.(?)" "p.(Asn1536Asp)" "" ""
"0000739877" "00007729" "50" "4625" "0" "4625" "0" "c.4625T>G" "r.(?)" "p.(Leu1542*)" "" ""
"0000739878" "00007729" "50" "4634" "0" "4634" "0" "c.4634T>C" "r.(?)" "p.(Phe1545Ser)" "" ""
"0000739879" "00007729" "50" "4638" "0" "4638" "0" "c.4638A>C" "r.(?)" "p.(Leu1546Phe)" "" ""
"0000739880" "00007729" "50" "4666" "0" "4666" "0" "c.4666A>C" "r.(?)" "p.(Ile1556Leu)" "" ""
"0000739881" "00007729" "50" "4672" "1" "4672" "1" "c.4672+1G>A" "r.spl?" "p.?" "" ""
"0000739882" "00007729" "50" "4685" "0" "4685" "0" "c.4685G>A" "r.(?)" "p.(Arg1562Lys)" "" ""
"0000739883" "00007729" "50" "4744" "0" "4744" "0" "c.4744C>G" "r.(?)" "p.(His1582Asp)" "" ""
"0000739884" "00007729" "50" "4751" "0" "4751" "0" "c.4751C>T" "r.(?)" "p.(Thr1584Ile)" "" ""
"0000739885" "00007729" "50" "4762" "0" "4762" "0" "c.4762A>G" "r.(?)" "p.(Ile1588Val)" "" ""
"0000739886" "00007729" "50" "4779" "1" "4779" "1" "c.4779+1G>T" "r.spl?" "p.?" "" ""
"0000739887" "00007729" "50" "4783" "0" "4783" "0" "c.4783C>T" "r.(?)" "p.(Pro1595Ser)" "" ""
"0000739888" "00007729" "50" "4784" "0" "4784" "0" "c.4784C>T" "r.(?)" "p.(Pro1595Leu)" "" ""
"0000739889" "00007729" "50" "4820" "0" "4820" "0" "c.4820G>A" "r.(?)" "p.(Cys1607Tyr)" "" ""
"0000739890" "00007729" "50" "4835" "0" "4835" "0" "c.4835A>G" "r.(?)" "p.(Glu1612Gly)" "" ""
"0000739891" "00007729" "50" "4847" "0" "4847" "0" "c.4847G>A" "r.(?)" "p.(Gly1616Asp)" "" ""
"0000739892" "00007729" "50" "4868" "0" "4868" "0" "c.4868T>C" "r.(?)" "p.(Val1623Ala)" "" ""
"0000739893" "00007729" "50" "4889" "0" "4889" "0" "c.4889T>A" "r.(?)" "p.(Ile1630Lys)" "" ""
"0000739894" "00007729" "50" "4901" "0" "4901" "0" "c.4901G>C" "r.(?)" "p.(Cys1634Ser)" "" ""
"0000739895" "00007729" "50" "4939" "0" "4939" "0" "c.4939G>A" "r.(?)" "p.(Val1647Ile)" "" ""
"0000739896" "00007729" "50" "4943" "0" "4943" "0" "c.4943T>C" "r.(?)" "p.(Met1648Thr)" "" ""
"0000739897" "00007729" "50" "4946" "0" "4946" "0" "c.4946T>G" "r.(?)" "p.(Leu1649Arg)" "" ""
"0000739898" "00007729" "50" "4966" "0" "4966" "0" "c.4966A>C" "r.(?)" "p.(Asn1656His)" "" ""
"0000739899" "00007729" "50" "4986" "0" "4986" "0" "c.4986G>T" "r.(?)" "p.(Lys1662Asn)" "" ""
"0000739900" "00007729" "50" "4997" "0" "4997" "0" "c.4997G>C" "r.(?)" "p.(Arg1666Thr)" "" ""
"0000739901" "00007729" "50" "5012" "0" "5012" "0" "c.5012A>G" "r.(?)" "p.(Asp1671Gly)" "" ""
"0000739902" "00007729" "50" "5042" "0" "5042" "0" "c.5042A>C" "r.(?)" "p.(Asn1681Thr)" "" ""
"0000739903" "00007729" "50" "5060" "0" "5060" "0" "c.5060A>G" "r.(?)" "p.(Asn1687Ser)" "" ""
"0000739904" "00007729" "50" "5068" "0" "5068" "0" "c.5068G>A" "r.(?)" "p.(Val1690Ile)" "" ""
"0000739905" "00007729" "50" "5083" "0" "5083" "0" "c.5083G>A" "r.(?)" "p.(Val1695Ile)" "" ""
"0000739906" "00007729" "50" "5091" "0" "5091" "0" "c.5091G>T" "r.(?)" "p.(Lys1697Asn)" "" ""
"0000739907" "00007729" "50" "5096" "0" "5096" "0" "c.5096A>G" "r.(?)" "p.(Lys1699Arg)" "" ""
"0000739908" "00007729" "50" "5112" "0" "5112" "0" "c.5112T>G" "r.(?)" "p.(Cys1704Trp)" "" ""
"0000739909" "00007729" "50" "5129" "0" "5129" "0" "c.5129C>A" "r.(?)" "p.(Ser1710Tyr)" "" ""
"0000739910" "00007729" "50" "5129" "0" "5129" "0" "c.5129C>T" "r.(?)" "p.(Ser1710Phe)" "" ""
"0000739911" "00007729" "50" "5132" "0" "5132" "0" "c.5132G>A" "r.(?)" "p.(Gly1711Glu)" "" ""
"0000739912" "00007729" "50" "5132" "0" "5132" "0" "c.5132G>T" "r.(?)" "p.(Gly1711Val)" "" ""
"0000739913" "00007729" "50" "5138" "0" "5138" "0" "c.5138C>T" "r.(?)" "p.(Ser1713Phe)" "" ""
"0000739914" "00007729" "50" "5146" "0" "5146" "0" "c.5146T>C" "r.(?)" "p.(Ser1716Pro)" "" ""
"0000739915" "00007729" "50" "5151" "0" "5151" "0" "c.5151G>C" "r.(?)" "p.(Lys1717Asn)" "" ""
"0000739916" "00007729" "50" "5156" "0" "5156" "0" "c.5156G>A" "r.(?)" "p.(Arg1719His)" "" ""
"0000739917" "00007729" "50" "5224" "0" "5224" "0" "c.5224A>C" "r.(?)" "p.(Ile1742Leu)" "" ""
"0000739918" "00007729" "50" "5287" "0" "5287" "0" "c.5287T>G" "r.(?)" "p.(Phe1763Val)" "" ""
"0000739919" "00007729" "50" "5288" "0" "5288" "0" "c.5288T>A" "r.(?)" "p.(Phe1763Tyr)" "" ""
"0000739920" "00007729" "50" "5302" "0" "5302" "0" "c.5302T>C" "r.(?)" "p.(Ser1768Pro)" "" ""
"0000739921" "00007729" "50" "5336" "0" "5336" "0" "c.5336A>C" "r.(?)" "p.(Gln1779Pro)" "" ""
"0000739922" "00007729" "50" "5344" "0" "5344" "0" "c.5344G>T" "r.(?)" "p.(Gly1782Cys)" "" ""
"0000739923" "00007729" "50" "5345" "0" "5345" "0" "c.5345G>A" "r.(?)" "p.(Gly1782Asp)" "" ""
"0000739924" "00007729" "50" "5356" "0" "5356" "0" "c.5356G>A" "r.(?)" "p.(Glu1786Lys)" "" ""
"0000739925" "00007729" "50" "5381" "0" "5381" "0" "c.5381C>T" "r.(?)" "p.(Ser1794Phe)" "" ""
"0000739926" "00007729" "50" "5397" "0" "5397" "0" "c.5397A>T" "r.(?)" "p.(Arg1799Ser)" "" ""
"0000739927" "00007729" "50" "5398" "0" "5398" "0" "c.5398C>T" "r.(?)" "p.(Pro1800Ser)" "" ""
"0000739928" "00007729" "50" "5407" "0" "5407" "0" "c.5407G>A" "r.(?)" "p.(Ala1803Thr)" "" ""
"0000739929" "00007729" "50" "5414" "0" "5414" "0" "c.5414C>T" "r.(?)" "p.(Thr1805Ile)" "" ""
"0000739930" "00007729" "50" "5423" "0" "5423" "0" "c.5423C>G" "r.(?)" "p.(Ser1808Cys)" "" ""
"0000739931" "00007729" "50" "5432" "0" "5432" "0" "c.5432T>C" "r.(?)" "p.(Leu1811Pro)" "" ""
"0000739932" "00007729" "50" "5434" "0" "5434" "0" "c.5434C>A" "r.(?)" "p.(Pro1812Thr)" "" ""
"0000739933" "00007729" "50" "5446" "0" "5446" "0" "c.5446A>G" "r.(?)" "p.(Lys1816Glu)" "" ""
"0000739934" "00007729" "50" "5449" "0" "5449" "0" "c.5449G>A" "r.(?)" "p.(Gly1817Arg)" "" ""
"0000739935" "00007729" "50" "5504" "0" "5504" "0" "c.5504C>A" "r.(?)" "p.(Ser1835Tyr)" "" ""
"0000739936" "00007729" "50" "5516" "0" "5516" "0" "c.5516C>G" "r.(?)" "p.(Ala1839Gly)" "" ""
"0000739937" "00007729" "50" "5516" "0" "5516" "0" "c.5516C>T" "r.(?)" "p.(Ala1839Val)" "" ""
"0000739938" "00007729" "50" "5533" "0" "5533" "0" "c.5533G>A" "r.(?)" "p.(Val1845Ile)" "" ""
"0000739939" "00007729" "50" "5545" "0" "5545" "0" "c.5545C>A" "r.(?)" "p.(Pro1849Thr)" "" ""
"0000739940" "00007729" "50" "5577" "0" "5577" "0" "c.5577T>G" "r.(?)" "p.(Asn1859Lys)" "" ""
"0000739941" "00007729" "50" "5584" "0" "5584" "0" "c.5584G>A" "r.(?)" "p.(Val1862Met)" "" ""
"0000739942" "00007729" "50" "5593" "0" "5593" "0" "c.5593A>G" "r.(?)" "p.(Arg1865Gly)" "" ""
"0000739943" "00007729" "50" "5627" "0" "5627" "0" "c.5627A>C" "r.(?)" "p.(Asn1876Thr)" "" ""
"0000739944" "00007729" "50" "5650" "0" "5650" "0" "c.5650A>G" "r.(?)" "p.(Ile1884Val)" "" ""
"0000739945" "00007729" "50" "5651" "0" "5651" "0" "c.5651T>C" "r.(?)" "p.(Ile1884Thr)" "" ""
"0000739946" "00007729" "50" "5653" "0" "5653" "0" "c.5653C>T" "r.(?)" "p.(Gln1885*)" "" ""
"0000739947" "00007729" "50" "5684" "0" "5684" "0" "c.5684G>A" "r.(?)" "p.(Cys1895Tyr)" "" ""
"0000739948" "00007729" "50" "5723" "0" "5723" "0" "c.5723C>T" "r.(?)" "p.(Thr1908Ile)" "" ""
"0000739949" "00007729" "50" "5731" "0" "5731" "0" "c.5731A>G" "r.(?)" "p.(Met1911Val)" "" ""
"0000739950" "00007729" "50" "5732" "0" "5732" "0" "c.5732T>A" "r.(?)" "p.(Met1911Lys)" "" ""
"0000739951" "00007729" "50" "5736" "0" "5736" "0" "c.5736T>A" "r.(?)" "p.(Phe1912Leu)" "" ""
"0000739952" "00007729" "50" "5746" "0" "5746" "0" "c.5746A>G" "r.(?)" "p.(Lys1916Glu)" "" ""
"0000739953" "00007729" "50" "5753" "0" "5753" "0" "c.5753A>G" "r.(?)" "p.(Tyr1918Cys)" "" ""
"0000739954" "00007729" "50" "5755" "0" "5755" "0" "c.5755G>A" "r.(?)" "p.(Asp1919Asn)" "" ""
"0000739955" "00007729" "50" "5767" "0" "5767" "0" "c.5767A>T" "r.(?)" "p.(Thr1923Ser)" "" ""
"0000739956" "00007729" "50" "5771" "0" "5771" "0" "c.5771C>T" "r.(?)" "p.(Thr1924Ile)" "" ""
"0000739957" "00007729" "50" "5776" "0" "5776" "0" "c.5776A>C" "r.(?)" "p.(Ile1926Leu)" "" ""
"0000739958" "00007729" "50" "5782" "0" "5782" "0" "c.5782G>T" "r.(?)" "p.(Ala1928Ser)" "" ""
"0000739959" "00007729" "50" "5797" "0" "5797" "0" "c.5797C>T" "r.(?)" "p.(Leu1933Phe)" "" ""
"0000739960" "00007729" "50" "5807" "0" "5807" "0" "c.5807C>T" "r.(?)" "p.(Ser1936Phe)" "" ""
"0000739961" "00007729" "50" "5824" "0" "5824" "0" "c.5824G>C" "r.(?)" "p.(Ala1942Pro)" "" ""
"0000739962" "00007729" "50" "5828" "0" "5828" "0" "c.5828A>G" "r.(?)" "p.(Asp1943Gly)" "" ""
"0000739963" "00007729" "50" "5838" "0" "5838" "0" "c.5838G>C" "r.(?)" "p.(Lys1946Asn)" "" ""
"0000739964" "00007729" "50" "5855" "0" "5855" "0" "c.5855A>G" "r.(?)" "p.(Glu1952Gly)" "" ""
"0000739965" "00007729" "50" "5879" "0" "5879" "0" "c.5879A>G" "r.(?)" "p.(His1960Arg)" "" ""
"0000739966" "00007729" "50" "5888" "0" "5888" "0" "c.5888C>T" "r.(?)" "p.(Thr1963Ile)" "" ""
"0000739967" "00007729" "50" "5894" "0" "5894" "0" "c.5894T>C" "r.(?)" "p.(Val1965Ala)" "" ""
"0000739968" "00007729" "50" "5912" "0" "5912" "0" "c.5912A>G" "r.(?)" "p.(Glu1971Gly)" "" ""
"0000739969" "00007729" "50" "5971" "0" "5971" "0" "c.5971T>C" "r.(?)" "p.(Cys1991Arg)" "" ""
"0000739970" "00007729" "50" "5976" "0" "5976" "0" "c.5976C>G" "r.(?)" "p.(His1992Gln)" "" ""
"0000739971" "00007729" "50" "5983" "0" "5983" "0" "c.5983T>C" "r.(?)" "p.(Ser1995Pro)" "" ""
"0000739972" "00007729" "50" "5984" "0" "5984" "0" "c.5984C>T" "r.(?)" "p.(Ser1995Leu)" "" ""
"0000739973" "00007729" "50" "5986" "0" "5986" "0" "c.5986T>C" "r.(?)" "p.(Ser1996Pro)" "" ""
"0000739974" "00007729" "50" "5990" "0" "5990" "0" "c.5990T>C" "r.(?)" "p.(Val1997Ala)" "" ""
"0000739975" "00007729" "50" "6001" "0" "6001" "0" "c.6001G>A" "r.(?)" "p.(Ala2001Thr)" "" ""
"0000739976" "00007729" "50" "6010" "0" "6010" "0" "c.6010T>A" "r.(?)" "p.(Ser2004Thr)" "" ""
"0000739977" "00007729" "50" "6024" "0" "6024" "0" "c.6024C>G" "r.(?)" "p.(Ile2008Met)" "" ""
"0000739978" "00007729" "50" "6026" "0" "6026" "0" "c.6026C>T" "r.(?)" "p.(Ser2009Phe)" "" ""
"0000739979" "00007729" "50" "6030" "0" "6030" "0" "c.6030G>A" "r.(?)" "p.(Met2010Ile)" "" ""
"0000739980" "00007729" "50" "6047" "0" "6047" "0" "c.6047A>T" "r.(?)" "p.(His2016Leu)" "" ""
"0000739981" "00007729" "50" "6051" "0" "6051" "0" "c.6051G>C" "r.(?)" "p.(Gln2017His)" "" ""
"0000739982" "00007729" "50" "6052" "0" "6052" "0" "c.6052A>G" "r.(?)" "p.(Lys2018Glu)" "" ""
"0000739983" "00007729" "50" "6083" "0" "6083" "0" "c.6083A>C" "r.(?)" "p.(Tyr2028Ser)" "" ""
"0000739984" "00007729" "50" "6092" "0" "6092" "0" "c.6092A>G" "r.(?)" "p.(Asp2031Gly)" "" ""
"0000739985" "00007729" "50" "6144" "0" "6144" "0" "c.6144A>G" "r.(?)" "p.(Ile2048Met)" "" ""
"0000743123" "00007729" "50" "269" "0" "269" "0" "c.269del" "r.(?)" "p.(Pro90Glnfs*58)" "" ""
"0000743124" "00007729" "50" "555" "0" "556" "0" "c.555_556del" "r.(?)" "p.(Arg185Serfs*12)" "" ""
"0000743125" "00007729" "50" "1129" "0" "1129" "0" "c.1129del" "r.(?)" "p.(Met377Trpfs*3)" "" ""
"0000743126" "00007729" "50" "1202" "0" "1202" "0" "c.1202del" "r.(?)" "p.(Asn401Metfs*10)" "" ""
"0000743127" "00007729" "50" "1236" "0" "1237" "0" "c.1236_1237del" "r.(?)" "p.(Tyr413*)" "" ""
"0000743128" "00007729" "50" "1333" "0" "1333" "0" "c.1333del" "r.(?)" "p.(Tyr445Ilefs*6)" "" ""
"0000743129" "00007729" "50" "1394" "0" "1394" "0" "c.1394del" "r.(?)" "p.(Asn465Metfs*16)" "" ""
"0000743130" "00007729" "50" "2525" "0" "2528" "0" "c.2525_2528del" "r.(?)" "p.(Gln842Leufs*11)" "" ""
"0000743131" "00007729" "50" "2532" "0" "2536" "0" "c.2532_2536del" "r.(?)" "p.(His844Glnfs*4)" "" ""
"0000743132" "00007729" "50" "3223" "0" "3223" "0" "c.3223del" "r.(?)" "p.(Ser1075Leufs*20)" "" ""
"0000743133" "00007729" "50" "3288" "0" "3288" "0" "c.3288dup" "r.(?)" "p.(Asn1097*)" "" ""
"0000743134" "00007729" "50" "3475" "0" "3476" "0" "c.3475_3476del" "r.(?)" "p.(Leu1159Thrfs*9)" "" ""
"0000743135" "00007729" "50" "4284" "0" "4285" "0" "c.4284_4285del" "r.(?)" "p.(Arg1429Serfs*10)" "" ""
"0000743136" "00007729" "50" "4504" "0" "4505" "0" "c.4504_4505del" "r.(?)" "p.(His1503Leufs*6)" "" ""
"0000743137" "00007729" "50" "4514" "0" "4514" "0" "c.4514del" "r.(?)" "p.(Lys1505Serfs*3)" "" ""
"0000743138" "00007729" "50" "5199" "0" "5200" "0" "c.5199_5200del" "r.(?)" "p.(Gln1733Hisfs*21)" "" ""
"0000743139" "00007729" "50" "5713" "0" "5713" "0" "c.5713del" "r.(?)" "p.(Thr1905Glnfs*18)" "" ""
"0000743140" "00007729" "50" "5713" "0" "5713" "0" "c.5713dup" "r.(?)" "p.(Thr1905Asnfs*9)" "" ""
"0000743141" "00007729" "50" "5749" "0" "5750" "0" "c.5749_5750del" "r.(?)" "p.(Ser1917Leufs*2)" "" ""
"0000743142" "00007729" "50" "5839" "0" "5839" "0" "c.5839del" "r.(?)" "p.(Glu1947Asnfs*4)" "" ""
"0000743143" "00007729" "50" "5864" "0" "5867" "0" "c.5864_5867del" "r.(?)" "p.(Lys1955Metfs*10)" "" ""
"0000743390" "00007729" "50" "5923" "0" "5926" "0" "c.5923_5926del" "r.(?)" "p.(Phe1975Ilefs*2)" "" ""
"0000743391" "00007729" "50" "2858" "0" "2861" "0" "c.2858_2861delinsGA" "r.(?)" "p.(Lys953Argfs*5)" "" ""
"0000743392" "00007729" "50" "5269" "0" "5270" "0" "c.5269_5270del" "r.(?)" "p.(Gln1757Valfs*10)" "" ""
"0000743394" "00007729" "50" "995" "0" "995" "0" "c.995del" "r.(?)" "p.(Tyr332Phefs*3)" "" ""
"0000743395" "00007729" "50" "1015" "0" "1015" "0" "c.1015del" "r.(?)" "p.(Asp339Ilefs*18)" "" ""
"0000743396" "00007729" "50" "1384" "0" "1385" "0" "c.1384_1385delinsT" "r.(?)" "p.(Lys462Cysfs*19)" "" ""
"0000743397" "00007729" "50" "1941" "0" "1941" "0" "c.1941del" "r.(?)" "p.(Tyr647*)" "" ""
"0000743398" "00007729" "50" "2886" "0" "2886" "0" "c.2886del" "r.(?)" "p.(Phe963Serfs*20)" "" ""
"0000743399" "00007729" "50" "3061" "0" "3061" "0" "c.3061del" "r.(?)" "p.(Leu1021Phefs*23)" "" ""
"0000743400" "00007729" "50" "3589" "0" "3589" "0" "c.3589del" "r.(?)" "p.(Asp1197Metfs*18)" "" ""
"0000743401" "00007729" "50" "3747" "0" "3747" "0" "c.3747del" "r.(?)" "p.(Ser1250Glnfs*7)" "" ""
"0000743402" "00007729" "50" "4401" "0" "4401" "0" "c.4401del" "r.(?)" "p.(Ser1468Valfs*14)" "" ""
"0000743403" "00007729" "50" "5201" "0" "5201" "0" "c.5201del" "r.(?)" "p.(Thr1734Asnfs*3)" "" ""
"0000743404" "00007729" "50" "5380" "0" "5380" "0" "c.5380del" "r.(?)" "p.(Ser1794Profs*9)" "" ""
"0000743405" "00007729" "50" "4003" "0" "4004" "0" "c.4003_4004insG" "r.(?)" "p.(Lys1335Argfs*9)" "" ""
"0000746501" "00007729" "50" "11" "0" "11" "0" "c.11G>A" "r.(?)" "p.(Arg4Gln)" "" ""
"0000746503" "00007729" "50" "30" "0" "30" "0" "c.30G>C" "r.(?)" "p.(Gln10His)" "" ""
"0000746504" "00007729" "50" "43" "0" "43" "0" "c.43A>C" "r.(?)" "p.(Ser15Arg)" "" ""
"0000746505" "00007729" "50" "44" "0" "44" "0" "c.44G>A" "r.(?)" "p.(Ser15Asn)" "" ""
"0000746506" "00007729" "50" "46" "0" "46" "0" "c.46A>G" "r.(?)" "p.(Ile16Val)" "" ""
"0000746507" "00007729" "50" "65" "0" "65" "0" "c.65C>G" "r.(?)" "p.(Thr22Ser)" "" ""
"0000746508" "00007729" "50" "70" "0" "70" "0" "c.70G>C" "r.(?)" "p.(Gly24Arg)" "" ""
"0000746509" "00007729" "50" "83" "0" "83" "0" "c.83G>T" "r.(?)" "p.(Gly28Val)" "" ""
"0000746510" "00007729" "50" "98" "0" "98" "0" "c.98A>G" "r.(?)" "p.(Gln33Arg)" "" ""
"0000746511" "00007729" "50" "124" "0" "124" "0" "c.124T>A" "r.(?)" "p.(Leu42Met)" "" ""
"0000746512" "00007729" "50" "128" "0" "128" "0" "c.128C>T" "r.(?)" "p.(Pro43Leu)" "" ""
"0000746513" "00007729" "50" "137" "0" "137" "0" "c.137C>T" "r.(?)" "p.(Ala46Val)" "" ""
"0000746514" "00007729" "50" "147" "0" "147" "0" "c.147G>C" "r.(?)" "p.(Gln49His)" "" ""
"0000746515" "00007729" "50" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Asp53Asn)" "" ""
"0000746516" "00007729" "50" "182" "0" "182" "0" "c.182C>G" "r.(?)" "p.(Ala61Gly)" "" ""
"0000746517" "00007729" "50" "197" "0" "197" "0" "c.197G>A" "r.(?)" "p.(Arg66Gln)" "" ""
"0000746518" "00007729" "50" "215" "0" "215" "0" "c.215A>T" "r.(?)" "p.(Asn72Ile)" "" ""
"0000746519" "00007729" "50" "235" "0" "235" "0" "c.235G>C" "r.(?)" "p.(Ala79Pro)" "" ""
"0000746520" "00007729" "50" "266" "0" "266" "0" "c.266G>C" "r.(?)" "p.(Cys89Ser)" "" ""
"0000746521" "00007729" "50" "269" "0" "269" "0" "c.269C>G" "r.(?)" "p.(Pro90Arg)" "" ""
"0000746522" "00007729" "50" "298" "0" "298" "0" "c.298C>G" "r.(?)" "p.(Arg100Gly)" "" ""
"0000746523" "00007729" "50" "307" "0" "307" "0" "c.307C>G" "r.(?)" "p.(Leu103Val)" "" ""
"0000746524" "00007729" "50" "313" "0" "313" "0" "c.313T>C" "r.(?)" "p.(Cys105Arg)" "" ""
"0000746525" "00007729" "50" "317" "0" "317" "0" "c.317A>G" "r.(?)" "p.(Asn106Ser)" "" ""
"0000746526" "00007729" "50" "326" "0" "326" "0" "c.326T>G" "r.(?)" "p.(Val109Gly)" "" ""
"0000746527" "00007729" "50" "340" "0" "340" "0" "c.340G>A" "r.(?)" "p.(Gly114Arg)" "" ""
"0000746528" "00007729" "50" "352" "0" "352" "0" "c.352A>G" "r.(?)" "p.(Thr118Ala)" "" ""
"0000746529" "00007729" "50" "356" "0" "356" "0" "c.356T>A" "r.(?)" "p.(Phe119Tyr)" "" ""
"0000746530" "00007729" "50" "364" "0" "364" "0" "c.364G>T" "r.(?)" "p.(Ala122Ser)" "" ""
"0000746531" "00007729" "50" "385" "0" "385" "0" "c.385T>C" "r.(?)" "p.(Tyr129His)" "" ""
"0000746532" "00007729" "50" "389" "0" "389" "0" "c.389G>T" "r.(?)" "p.(Arg130Leu)" "" ""
"0000746533" "00007729" "50" "396" "0" "396" "0" "c.396C>G" "r.(?)" "p.(Phe132Leu)" "" ""
"0000746534" "00007729" "50" "424" "0" "424" "0" "c.424C>T" "r.(?)" "p.(Pro142Ser)" "" ""
"0000746535" "00007729" "50" "427" "0" "427" "0" "c.427A>G" "r.(?)" "p.(Thr143Ala)" "" ""
"0000746536" "00007729" "50" "479" "0" "479" "0" "c.479T>A" "r.(?)" "p.(Ile160Asn)" "" ""
"0000746537" "00007729" "50" "499" "0" "499" "0" "c.499G>T" "r.(?)" "p.(Glu167*)" "" ""
"0000746538" "00007729" "50" "541" "0" "541" "0" "c.541T>C" "r.(?)" "p.(Trp181Arg)" "" ""
"0000746539" "00007729" "50" "544" "0" "544" "0" "c.544T>A" "r.(?)" "p.(Cys182Ser)" "" ""
"0000746540" "00007729" "50" "583" "0" "583" "0" "c.583G>A" "r.(?)" "p.(Val195Ile)" "" ""
"0000746541" "00007729" "50" "619" "0" "619" "0" "c.619G>A" "r.(?)" "p.(Glu207Lys)" "" ""
"0000746542" "00007729" "50" "706" "0" "706" "0" "c.706A>G" "r.(?)" "p.(Thr236Ala)" "" ""
"0000746543" "00007729" "50" "727" "0" "727" "0" "c.727G>C" "r.(?)" "p.(Ala243Pro)" "" ""
"0000746544" "00007729" "50" "749" "0" "749" "0" "c.749G>A" "r.(?)" "p.(Ser250Asn)" "" ""
"0000746545" "00007729" "50" "764" "0" "764" "0" "c.764T>C" "r.(?)" "p.(Val255Ala)" "" ""
"0000746546" "00007729" "50" "766" "0" "766" "0" "c.766C>T" "r.(?)" "p.(Gln256*)" "" ""
"0000746547" "00007729" "50" "800" "0" "800" "0" "c.800T>C" "r.(?)" "p.(Ile267Thr)" "" ""
"0000746548" "00007729" "50" "801" "0" "801" "0" "c.801A>G" "r.(?)" "p.(Ile267Met)" "" ""
"0000746549" "00007729" "50" "809" "0" "809" "0" "c.809G>A" "r.(?)" "p.(Arg270His)" "" ""
"0000746550" "00007729" "50" "809" "0" "809" "0" "c.809G>T" "r.(?)" "p.(Arg270Leu)" "" ""
"0000746551" "00007729" "50" "818" "0" "818" "0" "c.818A>T" "r.(?)" "p.(Asp273Val)" "" ""
"0000746552" "00007729" "50" "821" "0" "821" "0" "c.821C>T" "r.(?)" "p.(Ser274Phe)" "" ""
"0000746553" "00007729" "50" "855" "0" "855" "0" "c.855A>C" "r.(?)" "p.(Lys285Asn)" "" ""
"0000746554" "00007729" "50" "874" "0" "874" "0" "c.874C>T" "r.(?)" "p.(Pro292Ser)" "" ""
"0000746555" "00007729" "50" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Leu293Phe)" "" ""
"0000746556" "00007729" "50" "898" "0" "898" "0" "c.898A>G" "r.(?)" "p.(Ile300Val)" "" ""
"0000746557" "00007729" "50" "914" "0" "914" "0" "c.914T>C" "r.(?)" "p.(Ile305Thr)" "" ""
"0000746558" "00007729" "50" "937" "0" "937" "0" "c.937C>T" "r.(?)" "p.(Arg313Cys)" "" ""
"0000746559" "00007729" "50" "946" "0" "946" "0" "c.946A>G" "r.(?)" "p.(Ile316Val)" "" ""
"0000746560" "00007729" "50" "979" "0" "979" "0" "c.979C>T" "r.(?)" "p.(Pro327Ser)" "" ""
"0000746561" "00007729" "50" "1017" "0" "1017" "0" "c.1017T>A" "r.(?)" "p.(Asp339Glu)" "" ""
"0000746562" "00007729" "50" "1054" "0" "1054" "0" "c.1054A>G" "r.(?)" "p.(Ile352Val)" "" ""
"0000746563" "00007729" "50" "1071" "0" "1071" "0" "c.1071C>G" "r.(?)" "p.(Ile357Met)" "" ""
"0000746564" "00007729" "50" "1072" "0" "1072" "0" "c.1072G>A" "r.(?)" "p.(Glu358Lys)" "" ""
"0000746565" "00007729" "50" "1087" "0" "1087" "0" "c.1087A>G" "r.(?)" "p.(Ile363Val)" "" ""
"0000746566" "00007729" "50" "1127" "0" "1127" "0" "c.1127A>G" "r.(?)" "p.(Gln376Arg)" "" ""
"0000746567" "00007729" "50" "1139" "0" "1139" "0" "c.1139G>A" "r.(?)" "p.(Arg380Lys)" "" ""
"0000746568" "00007729" "50" "1142" "0" "1142" "0" "c.1142C>A" "r.(?)" "p.(Ser381*)" "" ""
"0000746569" "00007729" "50" "1187" "0" "1187" "0" "c.1187T>C" "r.(?)" "p.(Met396Thr)" "" ""
"0000746570" "00007729" "50" "1198" "0" "1198" "0" "c.1198A>G" "r.(?)" "p.(Lys400Glu)" "" ""
"0000746571" "00007729" "50" "1225" "0" "1225" "0" "c.1225T>C" "r.(?)" "p.(Phe409Leu)" "" ""
"0000746572" "00007729" "50" "1249" "0" "1249" "0" "c.1249G>T" "r.(?)" "p.(Glu417*)" "" ""
"0000746573" "00007729" "50" "1255" "0" "1255" "0" "c.1255A>G" "r.(?)" "p.(Met419Val)" "" ""
"0000746574" "00007729" "50" "1259" "0" "1259" "0" "c.1259T>C" "r.(?)" "p.(Phe420Ser)" "" ""
"0000746575" "00007729" "50" "1267" "0" "1267" "0" "c.1267A>G" "r.(?)" "p.(Thr423Ala)" "" ""
"0000746576" "00007729" "50" "1304" "0" "1304" "0" "c.1304A>G" "r.(?)" "p.(Gln435Arg)" "" ""
"0000746577" "00007729" "50" "1304" "0" "1304" "0" "c.1304A>T" "r.(?)" "p.(Gln435Leu)" "" ""
"0000746578" "00007729" "50" "1310" "-1" "1310" "-1" "c.1310-1G>A" "r.spl?" "p.?" "" ""
"0000746579" "00007729" "50" "1312" "0" "1312" "0" "c.1312G>C" "r.(?)" "p.(Asp438His)" "" ""
"0000746580" "00007729" "50" "1324" "0" "1324" "0" "c.1324A>G" "r.(?)" "p.(Lys442Glu)" "" ""
"0000746581" "00007729" "50" "1327" "0" "1327" "0" "c.1327T>A" "r.(?)" "p.(Phe443Ile)" "" ""
"0000746582" "00007729" "50" "1333" "0" "1333" "0" "c.1333T>C" "r.(?)" "p.(Tyr445His)" "" ""
"0000746583" "00007729" "50" "1352" "0" "1352" "0" "c.1352A>G" "r.(?)" "p.(Lys451Arg)" "" ""
"0000746584" "00007729" "50" "1355" "0" "1355" "0" "c.1355A>G" "r.(?)" "p.(Lys452Arg)" "" ""
"0000746585" "00007729" "50" "1382" "0" "1382" "0" "c.1382T>C" "r.(?)" "p.(Phe461Ser)" "" ""
"0000746586" "00007729" "50" "1385" "0" "1385" "0" "c.1385A>C" "r.(?)" "p.(Lys462Thr)" "" ""
"0000746587" "00007729" "50" "1386" "0" "1386" "0" "c.1386G>C" "r.(?)" "p.(Lys462Asn)" "" ""
"0000746588" "00007729" "50" "1403" "0" "1403" "0" "c.1403A>G" "r.(?)" "p.(Asn468Ser)" "" ""
"0000746589" "00007729" "50" "1417" "0" "1417" "0" "c.1417A>G" "r.(?)" "p.(Lys473Glu)" "" ""
"0000746590" "00007729" "50" "1418" "0" "1418" "0" "c.1418A>G" "r.(?)" "p.(Lys473Arg)" "" ""
"0000746591" "00007729" "50" "1421" "0" "1421" "0" "c.1421G>A" "r.(?)" "p.(Arg474His)" "" ""
"0000746592" "00007729" "50" "1423" "0" "1423" "0" "c.1423G>A" "r.(?)" "p.(Asp475Asn)" "" ""
"0000746593" "00007729" "50" "1433" "0" "1433" "0" "c.1433G>A" "r.(?)" "p.(Arg478Gln)" "" ""
"0000746594" "00007729" "50" "1438" "0" "1438" "0" "c.1438A>C" "r.(?)" "p.(Met480Leu)" "" ""
"0000746595" "00007729" "50" "1490" "0" "1490" "0" "c.1490C>T" "r.(?)" "p.(Ser497Leu)" "" ""
"0000746596" "00007729" "50" "1508" "0" "1508" "0" "c.1508T>A" "r.(?)" "p.(Ile503Asn)" "" ""
"0000746597" "00007729" "50" "1528" "0" "1528" "0" "c.1528G>A" "r.(?)" "p.(Gly510Ser)" "" ""
"0000746598" "00007729" "50" "1544" "0" "1544" "0" "c.1544A>C" "r.(?)" "p.(Lys515Thr)" "" ""
"0000746599" "00007729" "50" "1581" "1" "1581" "1" "c.1581+1G>A" "r.spl?" "p.?" "" ""
"0000746600" "00007729" "50" "1581" "2" "1581" "2" "c.1581+2T>A" "r.spl?" "p.?" "" ""
"0000746601" "00007729" "50" "1603" "0" "1603" "0" "c.1603G>A" "r.(?)" "p.(Gly535Ser)" "" ""
"0000746602" "00007729" "50" "1627" "0" "1627" "0" "c.1627A>G" "r.(?)" "p.(Thr543Ala)" "" ""
"0000746603" "00007729" "50" "1655" "0" "1655" "0" "c.1655T>C" "r.(?)" "p.(Ile552Thr)" "" ""
"0000746604" "00007729" "50" "1690" "0" "1690" "0" "c.1690C>T" "r.(?)" "p.(Gln564*)" "" ""
"0000746605" "00007729" "50" "1691" "0" "1691" "0" "c.1691A>C" "r.(?)" "p.(Gln564Pro)" "" ""
"0000746606" "00007729" "50" "1694" "0" "1694" "0" "c.1694A>G" "r.(?)" "p.(Lys565Arg)" "" ""
"0000746607" "00007729" "50" "1753" "0" "1753" "0" "c.1753A>G" "r.(?)" "p.(Ile585Val)" "" ""
"0000746608" "00007729" "50" "1783" "0" "1783" "0" "c.1783G>T" "r.(?)" "p.(Glu595*)" "" ""
"0000746609" "00007729" "50" "1787" "0" "1787" "0" "c.1787G>A" "r.(?)" "p.(Arg596His)" "" ""
"0000746610" "00007729" "50" "1811" "0" "1811" "0" "c.1811A>G" "r.(?)" "p.(Asn604Ser)" "" ""
"0000746611" "00007729" "50" "1813" "0" "1813" "0" "c.1813A>G" "r.(?)" "p.(Lys605Glu)" "" ""
"0000746612" "00007729" "50" "1814" "0" "1814" "0" "c.1814A>G" "r.(?)" "p.(Lys605Arg)" "" ""
"0000746613" "00007729" "50" "1846" "0" "1846" "0" "c.1846A>G" "r.(?)" "p.(Arg616Gly)" "" ""
"0000746614" "00007729" "50" "1847" "0" "1847" "0" "c.1847G>C" "r.(?)" "p.(Arg616Thr)" "" ""
"0000746615" "00007729" "50" "1848" "0" "1848" "0" "c.1848G>T" "r.(?)" "p.(Arg616Ser)" "" ""
"0000746616" "00007729" "50" "1866" "0" "1866" "0" "c.1866C>A" "r.(?)" "p.(Tyr622*)" "" ""
"0000746617" "00007729" "50" "1868" "0" "1868" "0" "c.1868A>G" "r.(?)" "p.(Gln623Arg)" "" ""
"0000746618" "00007729" "50" "1876" "0" "1876" "0" "c.1876C>T" "r.(?)" "p.(Pro626Ser)" "" ""
"0000746619" "00007729" "50" "1892" "0" "1892" "0" "c.1892A>T" "r.(?)" "p.(Asp631Val)" "" ""
"0000746620" "00007729" "50" "1918" "0" "1918" "0" "c.1918A>C" "r.(?)" "p.(Met640Leu)" "" ""
"0000746621" "00007729" "50" "1933" "0" "1933" "0" "c.1933G>A" "r.(?)" "p.(Gly645Ser)" "" ""
"0000746622" "00007729" "50" "1969" "0" "1969" "0" "c.1969C>T" "r.(?)" "p.(Gln657*)" "" ""
"0000746623" "00007729" "50" "1982" "0" "1982" "0" "c.1982C>T" "r.(?)" "p.(Ser661Phe)" "" ""
"0000746624" "00007729" "50" "2019" "0" "2019" "0" "c.2019C>G" "r.(?)" "p.(Ser673Arg)" "" ""
"0000746625" "00007729" "50" "2039" "0" "2039" "0" "c.2039T>C" "r.(?)" "p.(Leu680Ser)" "" ""
"0000746626" "00007729" "50" "2050" "0" "2050" "0" "c.2050G>T" "r.(?)" "p.(Glu684*)" "" ""
"0000746627" "00007729" "50" "2053" "0" "2053" "0" "c.2053T>G" "r.(?)" "p.(Phe685Val)" "" ""
"0000746628" "00007729" "50" "2086" "0" "2086" "0" "c.2086G>T" "r.(?)" "p.(Asp696Tyr)" "" ""
"0000746629" "00007729" "50" "2108" "0" "2108" "0" "c.2108T>G" "r.(?)" "p.(Ile703Arg)" "" ""
"0000746630" "00007729" "50" "2132" "0" "2132" "0" "c.2132C>T" "r.(?)" "p.(Ser711Phe)" "" ""
"0000746631" "00007729" "50" "2138" "0" "2138" "0" "c.2138T>C" "r.(?)" "p.(Leu713Ser)" "" ""
"0000746632" "00007729" "50" "2144" "0" "2144" "0" "c.2144A>G" "r.(?)" "p.(Asn715Ser)" "" ""
"0000746633" "00007729" "50" "2150" "0" "2150" "0" "c.2150A>G" "r.(?)" "p.(Glu717Gly)" "" ""
"0000746634" "00007729" "50" "2156" "0" "2156" "0" "c.2156A>T" "r.(?)" "p.(Lys719Ile)" "" ""
"0000746635" "00007729" "50" "2161" "0" "2161" "0" "c.2161G>T" "r.(?)" "p.(Ala721Ser)" "" ""
"0000746636" "00007729" "50" "2162" "0" "2162" "0" "c.2162C>G" "r.(?)" "p.(Ala721Gly)" "" ""
"0000746637" "00007729" "50" "2225" "0" "2225" "0" "c.2225A>T" "r.(?)" "p.(His742Leu)" "" ""
"0000746638" "00007729" "50" "2233" "0" "2233" "0" "c.2233C>T" "r.(?)" "p.(Pro745Ser)" "" ""
"0000746639" "00007729" "50" "2255" "0" "2255" "0" "c.2255C>T" "r.(?)" "p.(Ser752Leu)" "" ""
"0000746640" "00007729" "50" "2258" "0" "2258" "0" "c.2258A>G" "r.(?)" "p.(Asp753Gly)" "" ""
"0000746641" "00007729" "50" "2261" "0" "2261" "0" "c.2261G>A" "r.(?)" "p.(Arg754Gln)" "" ""
"0000746642" "00007729" "50" "2285" "0" "2285" "0" "c.2285T>C" "r.(?)" "p.(Met762Thr)" "" ""
"0000746643" "00007729" "50" "2302" "0" "2302" "0" "c.2302A>G" "r.(?)" "p.(Met768Val)" "" ""
"0000746644" "00007729" "50" "2316" "1" "2316" "1" "c.2316+1G>A" "r.spl?" "p.?" "" ""
"0000746645" "00007729" "50" "2320" "0" "2320" "0" "c.2320G>T" "r.(?)" "p.(Glu774*)" "" ""
"0000746646" "00007729" "50" "2328" "0" "2328" "0" "c.2328C>G" "r.(?)" "p.(Ser776Arg)" "" ""
"0000746647" "00007729" "50" "2352" "0" "2352" "0" "c.2352T>A" "r.(?)" "p.(Tyr784*)" "" ""
"0000746648" "00007729" "50" "2399" "0" "2399" "0" "c.2399A>T" "r.(?)" "p.(Glu800Val)" "" ""
"0000746649" "00007729" "50" "2404" "0" "2404" "0" "c.2404A>G" "r.(?)" "p.(Asn802Asp)" "" ""
"0000746650" "00007729" "50" "2475" "0" "2475" "0" "c.2475T>G" "r.(?)" "p.(Ser825Arg)" "" ""
"0000746651" "00007729" "50" "2488" "0" "2488" "0" "c.2488A>G" "r.(?)" "p.(Ile830Val)" "" ""
"0000746652" "00007729" "50" "2489" "0" "2489" "0" "c.2489T>C" "r.(?)" "p.(Ile830Thr)" "" ""
"0000746653" "00007729" "50" "2499" "0" "2499" "0" "c.2499T>G" "r.(?)" "p.(Asp833Glu)" "" ""
"0000746654" "00007729" "50" "2501" "0" "2501" "0" "c.2501A>C" "r.(?)" "p.(Glu834Ala)" "" ""
"0000746655" "00007729" "50" "2517" "0" "2517" "0" "c.2517T>G" "r.(?)" "p.(Ile839Met)" "" ""
"0000746656" "00007729" "50" "2535" "0" "2535" "0" "c.2535C>G" "r.(?)" "p.(Ile845Met)" "" ""
"0000746657" "00007729" "50" "2545" "0" "2545" "0" "c.2545A>G" "r.(?)" "p.(Lys849Glu)" "" ""
"0000746658" "00007729" "50" "2573" "0" "2573" "0" "c.2573C>G" "r.(?)" "p.(Ser858Cys)" "" ""
"0000746659" "00007729" "50" "2575" "0" "2575" "0" "c.2575A>G" "r.(?)" "p.(Lys859Glu)" "" ""
"0000746660" "00007729" "50" "2578" "0" "2578" "0" "c.2578G>T" "r.(?)" "p.(Glu860*)" "" ""
"0000746661" "00007729" "50" "2602" "0" "2602" "0" "c.2602A>G" "r.(?)" "p.(Lys868Glu)" "" ""
"0000746662" "00007729" "50" "2637" "0" "2637" "0" "c.2637T>A" "r.(?)" "p.(Asp879Glu)" "" ""
"0000746663" "00007729" "50" "2639" "0" "2639" "0" "c.2639A>C" "r.(?)" "p.(Asn880Thr)" "" ""
"0000746664" "00007729" "50" "2644" "0" "2644" "0" "c.2644A>G" "r.(?)" "p.(Arg882Gly)" "" ""
"0000746665" "00007729" "50" "2657" "0" "2657" "0" "c.2657T>C" "r.(?)" "p.(Val886Ala)" "" ""
"0000746666" "00007729" "50" "2662" "0" "2662" "0" "c.2662A>G" "r.(?)" "p.(Asn888Asp)" "" ""
"0000746667" "00007729" "50" "2701" "0" "2701" "0" "c.2701T>C" "r.(?)" "p.(Ser901Pro)" "" ""
"0000746668" "00007729" "50" "2702" "0" "2702" "0" "c.2702C>T" "r.(?)" "p.(Ser901Leu)" "" ""
"0000746669" "00007729" "50" "2711" "0" "2711" "0" "c.2711A>G" "r.(?)" "p.(Asp904Gly)" "" ""
"0000746670" "00007729" "50" "2715" "0" "2715" "0" "c.2715A>T" "r.(?)" "p.(Glu905Asp)" "" ""
"0000746671" "00007729" "50" "2716" "0" "2716" "0" "c.2716A>T" "r.(?)" "p.(Ile906Phe)" "" ""
"0000746672" "00007729" "50" "2729" "0" "2729" "0" "c.2729G>A" "r.(?)" "p.(Cys910Tyr)" "" ""
"0000746673" "00007729" "50" "2731" "0" "2731" "0" "c.2731A>C" "r.(?)" "p.(Thr911Pro)" "" ""
"0000746674" "00007729" "50" "2735" "0" "2735" "0" "c.2735T>G" "r.(?)" "p.(Ile912Ser)" "" ""
"0000746675" "00007729" "50" "2737" "0" "2737" "0" "c.2737A>T" "r.(?)" "p.(Asn913Tyr)" "" ""
"0000746676" "00007729" "50" "2830" "0" "2830" "0" "c.2830T>C" "r.(?)" "p.(Ser944Pro)" "" ""
"0000746677" "00007729" "50" "2831" "0" "2831" "0" "c.2831C>T" "r.(?)" "p.(Ser944Phe)" "" ""
"0000746678" "00007729" "50" "2833" "0" "2833" "0" "c.2833G>C" "r.(?)" "p.(Gly945Arg)" "" ""
"0000746679" "00007729" "50" "2834" "0" "2834" "0" "c.2834G>A" "r.(?)" "p.(Gly945Asp)" "" ""
"0000746680" "00007729" "50" "2843" "0" "2843" "0" "c.2843G>A" "r.(?)" "p.(Ser948Asn)" "" ""
"0000746681" "00007729" "50" "2847" "0" "2847" "0" "c.2847C>G" "r.(?)" "p.(Phe949Leu)" "" ""
"0000746682" "00007729" "50" "2849" "0" "2849" "0" "c.2849A>G" "r.(?)" "p.(Asn950Ser)" "" ""
"0000746683" "00007729" "50" "2905" "0" "2905" "0" "c.2905A>G" "r.(?)" "p.(Ile969Val)" "" ""
"0000746684" "00007729" "50" "2908" "0" "2908" "0" "c.2908G>C" "r.(?)" "p.(Val970Leu)" "" ""
"0000746685" "00007729" "50" "2914" "0" "2914" "0" "c.2914A>G" "r.(?)" "p.(Thr972Ala)" "" ""
"0000746686" "00007729" "50" "2980" "0" "2980" "0" "c.2980T>G" "r.(?)" "p.(Leu994Val)" "" ""
"0000746687" "00007729" "50" "2998" "0" "2998" "0" "c.2998C>T" "r.(?)" "p.(Pro1000Ser)" "" ""
"0000746688" "00007729" "50" "3004" "0" "3004" "0" "c.3004A>G" "r.(?)" "p.(Ser1002Gly)" "" ""
"0000746689" "00007729" "50" "3041" "0" "3041" "0" "c.3041G>A" "r.(?)" "p.(Gly1014Asp)" "" ""
"0000746690" "00007729" "50" "3046" "0" "3046" "0" "c.3046G>A" "r.(?)" "p.(Ala1016Thr)" "" ""
"0000746691" "00007729" "50" "3064" "0" "3064" "0" "c.3064T>C" "r.(?)" "p.(Phe1022Leu)" "" ""
"0000746692" "00007729" "50" "3065" "0" "3065" "0" "c.3065T>C" "r.(?)" "p.(Phe1022Ser)" "" ""
"0000746693" "00007729" "50" "3083" "0" "3083" "0" "c.3083A>G" "r.(?)" "p.(His1028Arg)" "" ""
"0000746694" "00007729" "50" "3104" "0" "3104" "0" "c.3104C>A" "r.(?)" "p.(Thr1035Asn)" "" ""
"0000746695" "00007729" "50" "3106" "0" "3106" "0" "c.3106T>G" "r.(?)" "p.(Cys1036Gly)" "" ""
"0000746696" "00007729" "50" "3113" "0" "3113" "0" "c.3113T>C" "r.(?)" "p.(Leu1038Pro)" "" ""
"0000746697" "00007729" "50" "3128" "0" "3128" "0" "c.3128T>C" "r.(?)" "p.(Val1043Ala)" "" ""
"0000746698" "00007729" "50" "3144" "0" "3144" "0" "c.3144T>G" "r.(?)" "p.(Asn1048Lys)" "" ""
"0000746699" "00007729" "50" "3149" "0" "3149" "0" "c.3149A>G" "r.(?)" "p.(Glu1050Gly)" "" ""
"0000746700" "00007729" "50" "3152" "0" "3152" "0" "c.3152T>A" "r.(?)" "p.(Leu1051*)" "" ""
"0000746701" "00007729" "50" "3157" "0" "3157" "0" "c.3157T>C" "r.(?)" "p.(Ser1053Pro)" "" ""
"0000746702" "00007729" "50" "3176" "0" "3176" "0" "c.3176A>T" "r.(?)" "p.(Tyr1059Phe)" "" ""
"0000746703" "00007729" "50" "3182" "0" "3182" "0" "c.3182C>G" "r.(?)" "p.(Ser1061Cys)" "" ""
"0000746704" "00007729" "50" "3190" "0" "3190" "0" "c.3190A>C" "r.(?)" "p.(Ser1064Arg)" "" ""
"0000746705" "00007729" "50" "3203" "0" "3203" "0" "c.3203A>G" "r.(?)" "p.(Asp1068Gly)" "" ""
"0000746706" "00007729" "50" "3257" "0" "3257" "0" "c.3257A>G" "r.(?)" "p.(His1086Arg)" "" ""
"0000746707" "00007729" "50" "3271" "0" "3271" "0" "c.3271A>C" "r.(?)" "p.(Asn1091His)" "" ""
"0000746708" "00007729" "50" "3283" "0" "3283" "0" "c.3283G>T" "r.(?)" "p.(Val1095Leu)" "" ""
"0000746709" "00007729" "50" "3287" "0" "3287" "0" "c.3287C>T" "r.(?)" "p.(Pro1096Leu)" "" ""
"0000746710" "00007729" "50" "3289" "0" "3289" "0" "c.3289A>G" "r.(?)" "p.(Asn1097Asp)" "" ""
"0000746711" "00007729" "50" "3293" "0" "3293" "0" "c.3293A>G" "r.(?)" "p.(Asn1098Ser)" "" ""
"0000746712" "00007729" "50" "3307" "0" "3307" "0" "c.3307C>T" "r.(?)" "p.(His1103Tyr)" "" ""
"0000746713" "00007729" "50" "3308" "0" "3308" "0" "c.3308A>G" "r.(?)" "p.(His1103Arg)" "" ""
"0000746714" "00007729" "50" "3313" "0" "3313" "0" "c.3313A>C" "r.(?)" "p.(Ser1105Arg)" "" ""
"0000746715" "00007729" "50" "3323" "0" "3323" "0" "c.3323A>G" "r.(?)" "p.(Gln1108Arg)" "" ""
"0000746716" "00007729" "50" "3339" "0" "3339" "0" "c.3339G>C" "r.(?)" "p.(Glu1113Asp)" "" ""
"0000746717" "00007729" "50" "3349" "0" "3349" "0" "c.3349G>A" "r.(?)" "p.(Asp1117Asn)" "" ""
"0000746718" "00007729" "50" "3352" "0" "3352" "0" "c.3352G>A" "r.(?)" "p.(Val1118Ile)" "" ""
"0000746719" "00007729" "50" "3355" "0" "3355" "0" "c.3355G>C" "r.(?)" "p.(Asp1119His)" "" ""
"0000746720" "00007729" "50" "3373" "0" "3373" "0" "c.3373G>T" "r.(?)" "p.(Val1125Leu)" "" ""
"0000746721" "00007729" "50" "3383" "0" "3383" "0" "c.3383C>A" "r.(?)" "p.(Thr1128Asn)" "" ""
"0000746722" "00007729" "50" "3425" "0" "3425" "0" "c.3425C>T" "r.(?)" "p.(Thr1142Ile)" "" ""
"0000746723" "00007729" "50" "3437" "0" "3437" "0" "c.3437A>T" "r.(?)" "p.(Asp1146Val)" "" ""
"0000746724" "00007729" "50" "3443" "0" "3443" "0" "c.3443G>A" "r.(?)" "p.(Ser1148Asn)" "" ""
"0000746725" "00007729" "50" "3452" "0" "3452" "0" "c.3452C>A" "r.(?)" "p.(Pro1151His)" "" ""
"0000746726" "00007729" "50" "3461" "0" "3461" "0" "c.3461G>A" "r.(?)" "p.(Ser1154Asn)" "" ""
"0000746727" "00007729" "50" "3463" "0" "3463" "0" "c.3463A>G" "r.(?)" "p.(Lys1155Glu)" "" ""
"0000746728" "00007729" "50" "3476" "0" "3476" "0" "c.3476T>C" "r.(?)" "p.(Leu1159Ser)" "" ""
"0000746729" "00007729" "50" "3479" "0" "3479" "0" "c.3479C>A" "r.(?)" "p.(Pro1160His)" "" ""
"0000746730" "00007729" "50" "3500" "0" "3500" "0" "c.3500T>C" "r.(?)" "p.(Ile1167Thr)" "" ""
"0000746731" "00007729" "50" "3505" "0" "3505" "0" "c.3505G>A" "r.(?)" "p.(Glu1169Lys)" "" ""
"0000746732" "00007729" "50" "3509" "0" "3509" "0" "c.3509C>T" "r.(?)" "p.(Thr1170Met)" "" ""
"0000746733" "00007729" "50" "3514" "0" "3514" "0" "c.3514C>G" "r.(?)" "p.(Leu1172Val)" "" ""
"0000746734" "00007729" "50" "3541" "0" "3541" "0" "c.3541G>A" "r.(?)" "p.(Glu1181Lys)" "" ""
"0000746735" "00007729" "50" "3549" "0" "3549" "0" "c.3549G>T" "r.(?)" "p.(Leu1183Phe)" "" ""
"0000746736" "00007729" "50" "3550" "0" "3550" "0" "c.3550T>G" "r.(?)" "p.(Leu1184Val)" "" ""
"0000746737" "00007729" "50" "3556" "0" "3556" "0" "c.3556A>G" "r.(?)" "p.(Asn1186Asp)" "" ""
"0000746738" "00007729" "50" "3568" "0" "3568" "0" "c.3568C>T" "r.(?)" "p.(Leu1190Phe)" "" ""
"0000746739" "00007729" "50" "3571" "0" "3571" "0" "c.3571C>A" "r.(?)" "p.(Gln1191Lys)" "" ""
"0000746740" "00007729" "50" "3575" "0" "3575" "0" "c.3575A>T" "r.(?)" "p.(Asp1192Val)" "" ""
"0000746741" "00007729" "50" "3586" "0" "3586" "0" "c.3586C>T" "r.(?)" "p.(Arg1196Cys)" "" ""
"0000746742" "00007729" "50" "3613" "0" "3613" "0" "c.3613G>A" "r.(?)" "p.(Asp1205Asn)" "" ""
"0000746743" "00007729" "50" "3625" "0" "3625" "0" "c.3625G>A" "r.(?)" "p.(Val1209Ile)" "" ""
"0000746744" "00007729" "50" "3640" "0" "3640" "0" "c.3640G>A" "r.(?)" "p.(Val1214Met)" "" ""
"0000746745" "00007729" "50" "3654" "0" "3654" "0" "c.3654G>C" "r.(?)" "p.(Glu1218Asp)" "" ""
"0000746746" "00007729" "50" "3661" "0" "3661" "0" "c.3661T>C" "r.(?)" "p.(Phe1221Leu)" "" ""
"0000746747" "00007729" "50" "3665" "0" "3665" "0" "c.3665A>G" "r.(?)" "p.(Asp1222Gly)" "" ""
"0000746748" "00007729" "50" "3673" "0" "3673" "0" "c.3673A>G" "r.(?)" "p.(Arg1225Gly)" "" ""
"0000746749" "00007729" "50" "3676" "0" "3676" "0" "c.3676G>A" "r.(?)" "p.(Asp1226Asn)" "" ""
"0000746750" "00007729" "50" "3724" "0" "3724" "0" "c.3724G>C" "r.(?)" "p.(Asp1242His)" "" ""
"0000746751" "00007729" "50" "3745" "0" "3745" "0" "c.3745A>G" "r.(?)" "p.(Thr1249Ala)" "" ""
"0000746752" "00007729" "50" "3753" "0" "3753" "0" "c.3753T>G" "r.(?)" "p.(Asp1251Glu)" "" ""
"0000746753" "00007729" "50" "3760" "0" "3760" "0" "c.3760A>G" "r.(?)" "p.(Arg1254Gly)" "" ""
"0000746754" "00007729" "50" "3763" "0" "3763" "0" "c.3763C>T" "r.(?)" "p.(Pro1255Ser)" "" ""
"0000746755" "00007729" "50" "3779" "0" "3779" "0" "c.3779A>G" "r.(?)" "p.(Tyr1260Cys)" "" ""
"0000746756" "00007729" "50" "3779" "0" "3779" "0" "c.3779A>T" "r.(?)" "p.(Tyr1260Phe)" "" ""
"0000746757" "00007729" "50" "3788" "0" "3788" "0" "c.3788A>G" "r.(?)" "p.(Tyr1263Cys)" "" ""
"0000746758" "00007729" "50" "3800" "0" "3800" "0" "c.3800A>C" "r.(?)" "p.(Lys1267Thr)" "" ""
"0000746759" "00007729" "50" "3814" "0" "3814" "0" "c.3814G>T" "r.(?)" "p.(Ala1272Ser)" "" ""
"0000746760" "00007729" "50" "3835" "0" "3835" "0" "c.3835G>A" "r.(?)" "p.(Ala1279Thr)" "" ""
"0000746761" "00007729" "50" "3847" "0" "3847" "0" "c.3847A>G" "r.(?)" "p.(Arg1283Gly)" "" ""
"0000746762" "00007729" "50" "3856" "0" "3856" "0" "c.3856A>G" "r.(?)" "p.(Ser1286Gly)" "" ""
"0000746763" "00007729" "50" "3857" "0" "3857" "0" "c.3857G>T" "r.(?)" "p.(Ser1286Ile)" "" ""
"0000746764" "00007729" "50" "3881" "0" "3881" "0" "c.3881T>A" "r.(?)" "p.(Val1294Asp)" "" ""
"0000746765" "00007729" "50" "3895" "0" "3895" "0" "c.3895A>G" "r.(?)" "p.(Asn1299Asp)" "" ""
"0000746766" "00007729" "50" "3896" "0" "3896" "0" "c.3896A>C" "r.(?)" "p.(Asn1299Thr)" "" ""
"0000746767" "00007729" "50" "3902" "0" "3902" "0" "c.3902A>G" "r.(?)" "p.(Asp1301Gly)" "" ""
"0000746768" "00007729" "50" "3904" "0" "3904" "0" "c.3904A>G" "r.(?)" "p.(Met1302Val)" "" ""
"0000746769" "00007729" "50" "3905" "0" "3905" "0" "c.3905T>C" "r.(?)" "p.(Met1302Thr)" "" ""
"0000746770" "00007729" "50" "3911" "0" "3911" "0" "c.3911A>G" "r.(?)" "p.(Asn1304Ser)" "" ""
"0000746771" "00007729" "50" "3917" "0" "3917" "0" "c.3917A>G" "r.(?)" "p.(Asn1306Ser)" "" ""
"0000746772" "00007729" "50" "3930" "0" "3930" "0" "c.3930G>C" "r.(?)" "p.(Leu1310Phe)" "" ""
"0000746773" "00007729" "50" "3941" "0" "3941" "0" "c.3941C>G" "r.(?)" "p.(Ala1314Gly)" "" ""
"0000746774" "00007729" "50" "3956" "0" "3956" "0" "c.3956A>G" "r.(?)" "p.(Glu1319Gly)" "" ""
"0000746775" "00007729" "50" "3971" "0" "3971" "0" "c.3971G>A" "r.(?)" "p.(Gly1324Asp)" "" ""
"0000746776" "00007729" "50" "3977" "0" "3977" "0" "c.3977C>T" "r.(?)" "p.(Ser1326Phe)" "" ""
"0000746777" "00007729" "50" "3986" "0" "3986" "0" "c.3986C>T" "r.(?)" "p.(Ser1329Phe)" "" ""
"0000746778" "00007729" "50" "3991" "0" "3991" "0" "c.3991C>A" "r.(?)" "p.(Pro1331Thr)" "" ""
"0000746779" "00007729" "50" "3998" "0" "3998" "0" "c.3998A>G" "r.(?)" "p.(Gln1333Arg)" "" ""
"0000746780" "00007729" "50" "4024" "0" "4024" "0" "c.4024T>C" "r.(?)" "p.(Ser1342Pro)" "" ""
"0000746781" "00007729" "50" "4042" "0" "4042" "0" "c.4042A>G" "r.(?)" "p.(Asn1348Asp)" "" ""
"0000746782" "00007729" "50" "4052" "0" "4052" "0" "c.4052C>A" "r.(?)" "p.(Ser1351Tyr)" "" ""
"0000746783" "00007729" "50" "4068" "0" "4068" "0" "c.4068A>C" "r.(?)" "p.(Glu1356Asp)" "" ""
"0000746784" "00007729" "50" "4106" "0" "4106" "0" "c.4106A>T" "r.(?)" "p.(Asn1369Ile)" "" ""
"0000746785" "00007729" "50" "4133" "0" "4133" "0" "c.4133A>G" "r.(?)" "p.(Asn1378Ser)" "" ""
"0000746786" "00007729" "50" "4138" "0" "4138" "0" "c.4138A>G" "r.(?)" "p.(Thr1380Ala)" "" ""
"0000746787" "00007729" "50" "4146" "0" "4146" "0" "c.4146T>A" "r.(?)" "p.(Asp1382Glu)" "" ""
"0000746788" "00007729" "50" "4148" "0" "4148" "0" "c.4148A>G" "r.(?)" "p.(Tyr1383Cys)" "" ""
"0000746789" "00007729" "50" "4163" "0" "4163" "0" "c.4163T>C" "r.(?)" "p.(Leu1388Pro)" "" ""
"0000746790" "00007729" "50" "4220" "0" "4220" "0" "c.4220A>G" "r.(?)" "p.(Glu1407Gly)" "" ""
"0000746791" "00007729" "50" "4223" "0" "4223" "0" "c.4223A>T" "r.(?)" "p.(Asp1408Val)" "" ""
"0000746792" "00007729" "50" "4231" "0" "4231" "0" "c.4231T>A" "r.(?)" "p.(Leu1411Ile)" "" ""
"0000746793" "00007729" "50" "4240" "0" "4240" "0" "c.4240A>G" "r.(?)" "p.(Ser1414Gly)" "" ""
"0000746794" "00007729" "50" "4243" "0" "4243" "0" "c.4243A>G" "r.(?)" "p.(Asn1415Asp)" "" ""
"0000746795" "00007729" "50" "4244" "0" "4244" "0" "c.4244A>G" "r.(?)" "p.(Asn1415Ser)" "" ""
"0000746796" "00007729" "50" "4246" "0" "4246" "0" "c.4246G>A" "r.(?)" "p.(Glu1416Lys)" "" ""
"0000746797" "00007729" "50" "4253" "0" "4253" "0" "c.4253A>T" "r.(?)" "p.(Glu1418Val)" "" ""
"0000746798" "00007729" "50" "4256" "0" "4256" "0" "c.4256A>G" "r.(?)" "p.(Asp1419Gly)" "" ""
"0000746799" "00007729" "50" "4265" "0" "4265" "0" "c.4265T>C" "r.(?)" "p.(Ile1422Thr)" "" ""
"0000746800" "00007729" "50" "4268" "0" "4268" "0" "c.4268T>A" "r.(?)" "p.(Phe1423Tyr)" "" ""
"0000746801" "00007729" "50" "4273" "0" "4273" "0" "c.4273A>G" "r.(?)" "p.(Arg1425Gly)" "" ""
"0000746802" "00007729" "50" "4276" "0" "4276" "0" "c.4276A>C" "r.(?)" "p.(Lys1426Gln)" "" ""
"0000746803" "00007729" "50" "4276" "0" "4276" "0" "c.4276A>G" "r.(?)" "p.(Lys1426Glu)" "" ""
"0000746804" "00007729" "50" "4283" "0" "4283" "0" "c.4283A>T" "r.(?)" "p.(Lys1428Ile)" "" ""
"0000746805" "00007729" "50" "4285" "0" "4285" "0" "c.4285A>G" "r.(?)" "p.(Arg1429Gly)" "" ""
"0000746806" "00007729" "50" "4285" "0" "4285" "0" "c.4285A>T" "r.(?)" "p.(Arg1429*)" "" ""
"0000746807" "00007729" "50" "4288" "0" "4288" "0" "c.4288G>C" "r.(?)" "p.(Ala1430Pro)" "" ""
"0000746808" "00007729" "50" "4295" "0" "4295" "0" "c.4295G>A" "r.(?)" "p.(Gly1432Glu)" "" ""
"0000746809" "00007729" "50" "4298" "0" "4298" "0" "c.4298A>G" "r.(?)" "p.(Asn1433Ser)" "" ""
"0000746810" "00007729" "50" "4318" "-1" "4318" "-1" "c.4318-1G>A" "r.spl?" "p.?" "" ""
"0000746811" "00007729" "50" "4318" "0" "4318" "0" "c.4318G>T" "r.(?)" "p.(Asp1440Tyr)" "" ""
"0000746812" "00007729" "50" "4322" "0" "4322" "0" "c.4322A>C" "r.(?)" "p.(Gln1441Pro)" "" ""
"0000746813" "00007729" "50" "4323" "0" "4323" "0" "c.4323G>T" "r.(?)" "p.(Gln1441His)" "" ""
"0000746814" "00007729" "50" "4327" "0" "4327" "0" "c.4327A>G" "r.(?)" "p.(Asn1443Asp)" "" ""
"0000746815" "00007729" "50" "4336" "0" "4336" "0" "c.4336G>C" "r.(?)" "p.(Val1446Leu)" "" ""
"0000746816" "00007729" "50" "4343" "0" "4343" "0" "c.4343C>G" "r.(?)" "p.(Ser1448Cys)" "" ""
"0000746817" "00007729" "50" "4343" "0" "4343" "0" "c.4343C>T" "r.(?)" "p.(Ser1448Phe)" "" ""
"0000746818" "00007729" "50" "4346" "0" "4346" "0" "c.4346C>T" "r.(?)" "p.(Pro1449Leu)" "" ""
"0000746819" "00007729" "50" "4362" "0" "4362" "0" "c.4362A>T" "r.(?)" "p.(Lys1454Asn)" "" ""
"0000746820" "00007729" "50" "4369" "0" "4369" "0" "c.4369A>G" "r.(?)" "p.(Arg1457Gly)" "" ""
"0000746821" "00007729" "50" "4370" "0" "4370" "0" "c.4370G>T" "r.(?)" "p.(Arg1457Ile)" "" ""
"0000746822" "00007729" "50" "4426" "0" "4426" "0" "c.4426A>G" "r.(?)" "p.(Lys1476Glu)" "" ""
"0000746823" "00007729" "50" "4453" "0" "4453" "0" "c.4453A>C" "r.(?)" "p.(Lys1485Gln)" "" ""
"0000746824" "00007729" "50" "4453" "0" "4453" "0" "c.4453A>T" "r.(?)" "p.(Lys1485*)" "" ""
"0000746825" "00007729" "50" "4477" "0" "4477" "0" "c.4477A>G" "r.(?)" "p.(Arg1493Gly)" "" ""
"0000746826" "00007729" "50" "4480" "0" "4480" "0" "c.4480G>C" "r.(?)" "p.(Gly1494Arg)" "" ""
"0000746827" "00007729" "50" "4483" "0" "4483" "0" "c.4483A>G" "r.(?)" "p.(Ile1495Val)" "" ""
"0000746828" "00007729" "50" "4489" "0" "4489" "0" "c.4489G>A" "r.(?)" "p.(Val1497Ile)" "" ""
"0000746829" "00007729" "50" "4490" "0" "4490" "0" "c.4490T>C" "r.(?)" "p.(Val1497Ala)" "" ""
"0000746830" "00007729" "50" "4501" "0" "4501" "0" "c.4501C>T" "r.(?)" "p.(Gln1501*)" "" ""
"0000746831" "00007729" "50" "4507" "0" "4507" "0" "c.4507C>T" "r.(?)" "p.(His1503Tyr)" "" ""
"0000746832" "00007729" "50" "4515" "1" "4515" "1" "c.4515+1G>A" "r.spl?" "p.?" "" ""
"0000746833" "00007729" "50" "4525" "0" "4525" "0" "c.4525A>G" "r.(?)" "p.(Arg1509Gly)" "" ""
"0000746834" "00007729" "50" "4527" "0" "4527" "0" "c.4527G>T" "r.(?)" "p.(Arg1509Ser)" "" ""
"0000746835" "00007729" "50" "4529" "0" "4529" "0" "c.4529A>G" "r.(?)" "p.(Lys1510Arg)" "" ""
"0000746836" "00007729" "50" "4543" "0" "4543" "0" "c.4543G>T" "r.(?)" "p.(Glu1515*)" "" ""
"0000746837" "00007729" "50" "4544" "0" "4544" "0" "c.4544A>G" "r.(?)" "p.(Glu1515Gly)" "" ""
"0000746838" "00007729" "50" "4574" "0" "4574" "0" "c.4574A>G" "r.(?)" "p.(Tyr1525Cys)" "" ""
"0000746839" "00007729" "50" "4591" "0" "4591" "0" "c.4591A>G" "r.(?)" "p.(Asn1531Asp)" "" ""
"0000746840" "00007729" "50" "4594" "0" "4594" "0" "c.4594G>A" "r.(?)" "p.(Asp1532Asn)" "" ""
"0000746841" "00007729" "50" "4609" "0" "4609" "0" "c.4609G>T" "r.(?)" "p.(Glu1537*)" "" ""
"0000746842" "00007729" "50" "4616" "0" "4616" "0" "c.4616A>G" "r.(?)" "p.(Asp1539Gly)" "" ""
"0000746843" "00007729" "50" "4618" "0" "4618" "0" "c.4618T>G" "r.(?)" "p.(Ser1540Ala)" "" ""
"0000746844" "00007729" "50" "4627" "0" "4627" "0" "c.4627C>G" "r.(?)" "p.(Leu1543Val)" "" ""
"0000746845" "00007729" "50" "4657" "0" "4657" "0" "c.4657T>G" "r.(?)" "p.(Ser1553Ala)" "" ""
"0000746846" "00007729" "50" "4673" "-1" "4673" "-1" "c.4673-1G>A" "r.spl?" "p.?" "" ""
"0000746847" "00007729" "50" "4675" "0" "4675" "0" "c.4675T>G" "r.(?)" "p.(Ser1559Ala)" "" ""
"0000746848" "00007729" "50" "4683" "0" "4683" "0" "c.4683G>A" "r.(?)" "p.(Met1561Ile)" "" ""
"0000746849" "00007729" "50" "4684" "0" "4684" "0" "c.4684A>T" "r.(?)" "p.(Arg1562*)" "" ""
"0000746850" "00007729" "50" "4696" "0" "4696" "0" "c.4696A>G" "r.(?)" "p.(Met1566Val)" "" ""
"0000746851" "00007729" "50" "4703" "0" "4703" "0" "c.4703C>T" "r.(?)" "p.(Ser1568Phe)" "" ""
"0000746852" "00007729" "50" "4709" "0" "4709" "0" "c.4709G>T" "r.(?)" "p.(Arg1570Leu)" "" ""
"0000746853" "00007729" "50" "4717" "0" "4717" "0" "c.4717A>G" "r.(?)" "p.(Met1573Val)" "" ""
"0000746854" "00007729" "50" "4721" "0" "4721" "0" "c.4721T>G" "r.(?)" "p.(Met1574Arg)" "" ""
"0000746855" "00007729" "50" "4726" "0" "4726" "0" "c.4726A>G" "r.(?)" "p.(Asn1576Asp)" "" ""
"0000746856" "00007729" "50" "4759" "0" "4759" "0" "c.4759A>G" "r.(?)" "p.(Asn1587Asp)" "" ""
"0000746857" "00007729" "50" "4808" "0" "4808" "0" "c.4808A>C" "r.(?)" "p.(Glu1603Ala)" "" ""
"0000746858" "00007729" "50" "4814" "0" "4814" "0" "c.4814G>A" "r.(?)" "p.(Ser1605Asn)" "" ""
"0000746859" "00007729" "50" "4841" "0" "4841" "0" "c.4841G>A" "r.(?)" "p.(Cys1614Tyr)" "" ""
"0000746860" "00007729" "50" "4846" "0" "4846" "0" "c.4846G>A" "r.(?)" "p.(Gly1616Ser)" "" ""
"0000746861" "00007729" "50" "4895" "0" "4895" "0" "c.4895A>T" "r.(?)" "p.(Asp1632Val)" "" ""
"0000746862" "00007729" "50" "4915" "0" "4915" "0" "c.4915A>G" "r.(?)" "p.(Lys1639Glu)" "" ""
"0000746863" "00007729" "50" "4925" "0" "4925" "0" "c.4925A>G" "r.(?)" "p.(Lys1642Arg)" "" ""
"0000746864" "00007729" "50" "4934" "0" "4934" "0" "c.4934G>C" "r.(?)" "p.(Arg1645Pro)" "" ""
"0000746865" "00007729" "50" "4955" "0" "4955" "0" "c.4955T>A" "r.(?)" "p.(Met1652Lys)" "" ""
"0000746866" "00007729" "50" "5041" "0" "5041" "0" "c.5041A>T" "r.(?)" "p.(Asn1681Tyr)" "" ""
"0000746867" "00007729" "50" "5042" "0" "5042" "0" "c.5042A>G" "r.(?)" "p.(Asn1681Ser)" "" ""
"0000746868" "00007729" "50" "5052" "0" "5052" "0" "c.5052A>C" "r.(?)" "p.(Arg1684Ser)" "" ""
"0000746869" "00007729" "50" "5053" "0" "5053" "0" "c.5053G>T" "r.(?)" "p.(Glu1685*)" "" ""
"0000746870" "00007729" "50" "5066" "0" "5066" "0" "c.5066C>G" "r.(?)" "p.(Ala1689Gly)" "" ""
"0000746871" "00007729" "50" "5107" "0" "5107" "0" "c.5107C>T" "r.(?)" "p.(His1703Tyr)" "" ""
"0000746872" "00007729" "50" "5125" "0" "5125" "0" "c.5125C>T" "r.(?)" "p.(Pro1709Ser)" "" ""
"0000746873" "00007729" "50" "5155" "0" "5155" "0" "c.5155C>T" "r.(?)" "p.(Arg1719Cys)" "" ""
"0000746874" "00007729" "50" "5165" "0" "5165" "0" "c.5165C>G" "r.(?)" "p.(Pro1722Arg)" "" ""
"0000746875" "00007729" "50" "5192" "0" "5192" "0" "c.5192G>A" "r.(?)" "p.(Ser1731Asn)" "" ""
"0000746876" "00007729" "50" "5197" "0" "5197" "0" "c.5197C>G" "r.(?)" "p.(Gln1733Glu)" "" ""
"0000746877" "00007729" "50" "5198" "0" "5198" "0" "c.5198A>G" "r.(?)" "p.(Gln1733Arg)" "" ""
"0000746878" "00007729" "50" "5204" "0" "5204" "0" "c.5204C>T" "r.(?)" "p.(Ser1735Leu)" "" ""
"0000746879" "00007729" "50" "5240" "0" "5240" "0" "c.5240A>G" "r.(?)" "p.(Asp1747Gly)" "" ""
"0000746880" "00007729" "50" "5267" "0" "5267" "0" "c.5267T>C" "r.(?)" "p.(Val1756Ala)" "" ""
"0000746881" "00007729" "50" "5293" "0" "5293" "0" "c.5293A>G" "r.(?)" "p.(Thr1765Ala)" "" ""
"0000746882" "00007729" "50" "5296" "0" "5296" "0" "c.5296G>A" "r.(?)" "p.(Val1766Ile)" "" ""
"0000746883" "00007729" "50" "5309" "0" "5309" "0" "c.5309A>G" "r.(?)" "p.(Lys1770Arg)" "" ""
"0000746884" "00007729" "50" "5313" "0" "5313" "0" "c.5313C>A" "r.(?)" "p.(Asp1771Glu)" "" ""
"0000746885" "00007729" "50" "5340" "1" "5340" "1" "c.5340+1G>A" "r.spl?" "p.?" "" ""
"0000746886" "00007729" "50" "5365" "0" "5365" "0" "c.5365A>C" "r.(?)" "p.(Ser1789Arg)" "" ""
"0000746887" "00007729" "50" "5372" "0" "5372" "0" "c.5372C>T" "r.(?)" "p.(Ser1791Leu)" "" ""
"0000746888" "00007729" "50" "5374" "0" "5374" "0" "c.5374G>A" "r.(?)" "p.(Gly1792Arg)" "" ""
"0000746889" "00007729" "50" "5393" "0" "5393" "0" "c.5393C>G" "r.(?)" "p.(Ser1798*)" "" ""
"0000746890" "00007729" "50" "5396" "0" "5396" "0" "c.5396G>T" "r.(?)" "p.(Arg1799Ile)" "" ""
"0000746891" "00007729" "50" "5465" "0" "5465" "0" "c.5465T>C" "r.(?)" "p.(Val1822Ala)" "" ""
"0000746892" "00007729" "50" "5468" "0" "5468" "0" "c.5468G>A" "r.(?)" "p.(Gly1823Asp)" "" ""
"0000746893" "00007729" "50" "5476" "0" "5476" "0" "c.5476G>T" "r.(?)" "p.(Glu1826*)" "" ""
"0000746894" "00007729" "50" "5488" "0" "5488" "0" "c.5488G>A" "r.(?)" "p.(Gly1830Arg)" "" ""
"0000746895" "00007729" "50" "5532" "0" "5532" "0" "c.5532A>T" "r.(?)" "p.(Gln1844His)" "" ""
"0000746896" "00007729" "50" "5543" "0" "5543" "0" "c.5543G>A" "r.(?)" "p.(Cys1848Tyr)" "" ""
"0000746897" "00007729" "50" "5578" "0" "5578" "0" "c.5578C>T" "r.(?)" "p.(Arg1860Cys)" "" ""
"0000746898" "00007729" "50" "5581" "0" "5581" "0" "c.5581A>G" "r.(?)" "p.(Met1861Val)" "" ""
"0000746899" "00007729" "50" "5590" "0" "5590" "0" "c.5590G>C" "r.(?)" "p.(Glu1864Gln)" "" ""
"0000746900" "00007729" "50" "5611" "0" "5611" "0" "c.5611A>T" "r.(?)" "p.(Met1871Leu)" "" ""
"0000746901" "00007729" "50" "5612" "0" "5612" "0" "c.5612T>C" "r.(?)" "p.(Met1871Thr)" "" ""
"0000746902" "00007729" "50" "5640" "0" "5640" "0" "c.5640C>A" "r.(?)" "p.(Phe1880Leu)" "" ""
"0000746903" "00007729" "50" "5662" "0" "5662" "0" "c.5662C>T" "r.(?)" "p.(Gln1888*)" "" ""
"0000746904" "00007729" "50" "5668" "0" "5668" "0" "c.5668A>G" "r.(?)" "p.(Met1890Val)" "" ""
"0000746905" "00007729" "50" "5679" "0" "5679" "0" "c.5679A>T" "r.(?)" "p.(Arg1893Ser)" "" ""
"0000746906" "00007729" "50" "5681" "0" "5681" "0" "c.5681T>C" "r.(?)" "p.(Ile1894Thr)" "" ""
"0000746907" "00007729" "50" "5684" "0" "5684" "0" "c.5684G>T" "r.(?)" "p.(Cys1895Phe)" "" ""
"0000746908" "00007729" "50" "5720" "0" "5720" "0" "c.5720A>G" "r.(?)" "p.(Asp1907Gly)" "" ""
"0000746909" "00007729" "50" "5732" "0" "5732" "0" "c.5732T>C" "r.(?)" "p.(Met1911Thr)" "" ""
"0000746910" "00007729" "50" "5733" "0" "5733" "0" "c.5733G>A" "r.(?)" "p.(Met1911Ile)" "" ""
"0000746911" "00007729" "50" "5744" "0" "5744" "0" "c.5744C>A" "r.(?)" "p.(Thr1915Lys)" "" ""
"0000746912" "00007729" "50" "5773" "0" "5773" "0" "c.5773T>G" "r.(?)" "p.(Leu1925Val)" "" ""
"0000746913" "00007729" "50" "5792" "0" "5792" "0" "c.5792G>C" "r.(?)" "p.(Arg1931Pro)" "" ""
"0000746914" "00007729" "50" "5809" "0" "5809" "0" "c.5809T>C" "r.(?)" "p.(Cys1937Arg)" "" ""
"0000746915" "00007729" "50" "5824" "0" "5824" "0" "c.5824G>A" "r.(?)" "p.(Ala1942Thr)" "" ""
"0000746916" "00007729" "50" "5843" "0" "5843" "0" "c.5843T>G" "r.(?)" "p.(Leu1948Arg)" "" ""
"0000746917" "00007729" "50" "5864" "0" "5864" "0" "c.5864A>G" "r.(?)" "p.(Lys1955Arg)" "" ""
"0000746918" "00007729" "50" "5870" "0" "5870" "0" "c.5870T>C" "r.(?)" "p.(Val1957Ala)" "" ""
"0000746919" "00007729" "50" "5872" "0" "5872" "0" "c.5872G>T" "r.(?)" "p.(Gly1958Cys)" "" ""
"0000746920" "00007729" "50" "5882" "0" "5882" "0" "c.5882T>G" "r.(?)" "p.(Val1961Gly)" "" ""
"0000746921" "00007729" "50" "5902" "0" "5902" "0" "c.5902A>G" "r.(?)" "p.(Asn1968Asp)" "" ""
"0000746922" "00007729" "50" "5937" "0" "5937" "0" "c.5937T>G" "r.(?)" "p.(Ile1979Met)" "" ""
"0000746923" "00007729" "50" "6010" "0" "6010" "0" "c.6010T>C" "r.(?)" "p.(Ser2004Pro)" "" ""
"0000746924" "00007729" "50" "6040" "0" "6040" "0" "c.6040G>C" "r.(?)" "p.(Val2014Leu)" "" ""
"0000746925" "00007729" "50" "6081" "0" "6081" "0" "c.6081C>G" "r.(?)" "p.(His2027Gln)" "" ""
"0000746926" "00007729" "50" "6106" "0" "6106" "0" "c.6106C>G" "r.(?)" "p.(Pro2036Ala)" "" ""
"0000746927" "00007729" "50" "6106" "0" "6106" "0" "c.6106C>T" "r.(?)" "p.(Pro2036Ser)" "" ""
"0000746928" "00007729" "50" "6112" "0" "6112" "0" "c.6112G>C" "r.(?)" "p.(Asp2038His)" "" ""
"0000750168" "00007729" "50" "551" "0" "551" "0" "c.551dup" "r.(?)" "p.(Arg185Glufs*13)" "" ""
"0000750169" "00007729" "50" "1362" "0" "1363" "0" "c.1362_1363insCAAAGTTAAA" "r.(?)" "p.(Glu455Glnfs*3)" "" ""
"0000750170" "00007729" "50" "1491" "0" "1491" "0" "c.1491dup" "r.(?)" "p.(Gln498Thrfs*7)" "" ""
"0000750171" "00007729" "50" "1724" "0" "1724" "0" "c.1724del" "r.(?)" "p.(Gly575Valfs*11)" "" ""
"0000750172" "00007729" "50" "2147" "0" "2148" "0" "c.2147_2148del" "r.(?)" "p.(Glu716Glyfs*19)" "" ""
"0000750173" "00007729" "50" "2586" "0" "2589" "0" "c.2586_2589del" "r.(?)" "p.(Lys863Ilefs*12)" "" ""
"0000750174" "00007729" "50" "4025" "0" "4026" "0" "c.4025_4026del" "r.(?)" "p.(Ser1342*)" "" ""
"0000750175" "00007729" "50" "4285" "0" "4285" "0" "c.4285del" "r.(?)" "p.(Arg1429Glufs*7)" "" ""
"0000750259" "00007729" "50" "547" "0" "548" "0" "c.547_548inv" "r.(?)" "p.(Ser183Leu)" "" ""
"0000752325" "00007729" "50" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Arg18Gln)" "" ""
"0000752326" "00007729" "50" "56" "0" "56" "0" "c.56C>T" "r.(?)" "p.(Ser19Leu)" "" ""
"0000752327" "00007729" "50" "59" "0" "59" "0" "c.59C>G" "r.(?)" "p.(Ser20Cys)" "" ""
"0000752328" "00007729" "50" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23Gln)" "" ""
"0000752329" "00007729" "50" "104" "0" "104" "0" "c.104C>G" "r.(?)" "p.(Pro35Arg)" "" ""
"0000752330" "00007729" "50" "155" "0" "155" "0" "c.155C>T" "r.(?)" "p.(Ser52Leu)" "" ""
"0000752331" "00007729" "50" "163" "0" "163" "0" "c.163G>A" "r.(?)" "p.(Asp55Asn)" "" ""
"0000752332" "00007729" "50" "179" "0" "179" "0" "c.179C>A" "r.(?)" "p.(Ala60Glu)" "" ""
"0000752333" "00007729" "50" "179" "0" "179" "0" "c.179C>T" "r.(?)" "p.(Ala60Val)" "" ""
"0000752334" "00007729" "50" "189" "0" "189" "0" "c.189G>T" "r.(?)" "p.(Glu63Asp)" "" ""
"0000752335" "00007729" "50" "220" "0" "220" "0" "c.220G>A" "r.(?)" "p.(Gly74Arg)" "" ""
"0000752336" "00007729" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Ala81Val)" "" ""
"0000752337" "00007729" "50" "269" "0" "269" "0" "c.269C>T" "r.(?)" "p.(Pro90Leu)" "" ""
"0000752338" "00007729" "50" "281" "0" "281" "0" "c.281A>G" "r.(?)" "p.(Tyr94Cys)" "" ""
"0000752339" "00007729" "50" "422" "0" "422" "0" "c.422C>T" "r.(?)" "p.(Ala141Val)" "" ""
"0000752340" "00007729" "50" "424" "0" "424" "0" "c.424C>A" "r.(?)" "p.(Pro142Thr)" "" ""
"0000752341" "00007729" "50" "443" "0" "443" "0" "c.443C>T" "r.(?)" "p.(Thr148Ile)" "" ""
"0000752342" "00007729" "50" "461" "0" "461" "0" "c.461G>C" "r.(?)" "p.(Cys154Ser)" "" ""
"0000752343" "00007729" "50" "496" "0" "496" "0" "c.496G>A" "r.(?)" "p.(Ala166Thr)" "" ""
"0000752344" "00007729" "50" "538" "0" "538" "0" "c.538A>G" "r.(?)" "p.(Ile180Val)" "" ""
"0000752345" "00007729" "50" "547" "0" "547" "0" "c.547A>C" "r.(?)" "p.(Ser183Arg)" "" ""
"0000752346" "00007729" "50" "557" "0" "557" "0" "c.557T>G" "r.(?)" "p.(Val186Gly)" "" ""
"0000752347" "00007729" "50" "565" "0" "565" "0" "c.565C>G" "r.(?)" "p.(Leu189Val)" "" ""
"0000752348" "00007729" "50" "631" "0" "631" "0" "c.631T>G" "r.(?)" "p.(Leu211Val)" "" ""
"0000752349" "00007729" "50" "635" "0" "635" "0" "c.635T>A" "r.(?)" "p.(Val212Asp)" "" ""
"0000752350" "00007729" "50" "655" "0" "655" "0" "c.655G>C" "r.(?)" "p.(Ala219Pro)" "" ""
"0000752351" "00007729" "50" "662" "0" "662" "0" "c.662G>C" "r.(?)" "p.(Gly221Ala)" "" ""
"0000752352" "00007729" "50" "665" "0" "665" "0" "c.665A>G" "r.(?)" "p.(Asn222Ser)" "" ""
"0000752353" "00007729" "50" "709" "0" "709" "0" "c.709A>T" "r.(?)" "p.(Asn237Tyr)" "" ""
"0000752354" "00007729" "50" "710" "0" "710" "0" "c.710A>G" "r.(?)" "p.(Asn237Ser)" "" ""
"0000752355" "00007729" "50" "759" "1" "759" "1" "c.759+1G>A" "r.spl?" "p.?" "" ""
"0000752356" "00007729" "50" "775" "0" "775" "0" "c.775A>G" "r.(?)" "p.(Ile259Val)" "" ""
"0000752357" "00007729" "50" "808" "0" "808" "0" "c.808C>T" "r.(?)" "p.(Arg270Cys)" "" ""
"0000752358" "00007729" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(His282Tyr)" "" ""
"0000752359" "00007729" "50" "868" "0" "868" "0" "c.868A>G" "r.(?)" "p.(Ile290Val)" "" ""
"0000752360" "00007729" "50" "869" "0" "869" "0" "c.869T>C" "r.(?)" "p.(Ile290Thr)" "" ""
"0000752361" "00007729" "50" "874" "0" "874" "0" "c.874C>A" "r.(?)" "p.(Pro292Thr)" "" ""
"0000752362" "00007729" "50" "875" "0" "875" "0" "c.875C>T" "r.(?)" "p.(Pro292Leu)" "" ""
"0000752363" "00007729" "50" "896" "0" "896" "0" "c.896C>G" "r.(?)" "p.(Ala299Gly)" "" ""
"0000752364" "00007729" "50" "902" "0" "902" "0" "c.902A>G" "r.(?)" "p.(Gln301Arg)" "" ""
"0000752365" "00007729" "50" "925" "0" "925" "0" "c.925G>A" "r.(?)" "p.(Glu309Lys)" "" ""
"0000752366" "00007729" "50" "938" "0" "938" "0" "c.938G>A" "r.(?)" "p.(Arg313His)" "" ""
"0000752367" "00007729" "50" "950" "0" "950" "0" "c.950A>G" "r.(?)" "p.(Gln317Arg)" "" ""
"0000752368" "00007729" "50" "963" "0" "963" "0" "c.963G>C" "r.(?)" "p.(Leu321Phe)" "" ""
"0000752369" "00007729" "50" "974" "0" "974" "0" "c.974A>G" "r.(?)" "p.(Asp325Gly)" "" ""
"0000752370" "00007729" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" ""
"0000752371" "00007729" "50" "1049" "0" "1049" "0" "c.1049T>C" "r.(?)" "p.(Val350Ala)" "" ""
"0000752372" "00007729" "50" "1097" "0" "1097" "0" "c.1097G>A" "r.(?)" "p.(Ser366Asn)" "" ""
"0000752373" "00007729" "50" "1131" "0" "1131" "0" "c.1131G>A" "r.(?)" "p.(Met377Ile)" "" ""
"0000752374" "00007729" "50" "1132" "0" "1132" "0" "c.1132G>C" "r.(?)" "p.(Gly378Arg)" "" ""
"0000752375" "00007729" "50" "1192" "0" "1192" "0" "c.1192C>T" "r.(?)" "p.(Arg398Trp)" "" ""
"0000752376" "00007729" "50" "1193" "0" "1193" "0" "c.1193G>A" "r.(?)" "p.(Arg398Gln)" "" ""
"0000752377" "00007729" "50" "1196" "0" "1196" "0" "c.1196C>G" "r.(?)" "p.(Ser399*)" "" ""
"0000752378" "00007729" "50" "1222" "0" "1222" "0" "c.1222G>C" "r.(?)" "p.(Asp408His)" "" ""
"0000752379" "00007729" "50" "1231" "0" "1231" "0" "c.1231A>G" "r.(?)" "p.(Lys411Glu)" "" ""
"0000752380" "00007729" "50" "1235" "0" "1235" "0" "c.1235T>G" "r.(?)" "p.(Leu412Arg)" "" ""
"0000752381" "00007729" "50" "1238" "0" "1238" "0" "c.1238A>G" "r.(?)" "p.(Tyr413Cys)" "" ""
"0000752382" "00007729" "50" "1264" "0" "1264" "0" "c.1264C>T" "r.(?)" "p.(Arg422Cys)" "" ""
"0000752383" "00007729" "50" "1270" "0" "1270" "0" "c.1270C>T" "r.(?)" "p.(Arg424Cys)" "" ""
"0000752384" "00007729" "50" "1271" "0" "1271" "0" "c.1271G>A" "r.(?)" "p.(Arg424His)" "" ""
"0000752385" "00007729" "50" "1294" "0" "1294" "0" "c.1294T>C" "r.(?)" "p.(Ser432Pro)" "" ""
"0000752386" "00007729" "50" "1300" "0" "1300" "0" "c.1300A>G" "r.(?)" "p.(Ile434Val)" "" ""
"0000752387" "00007729" "50" "1319" "0" "1319" "0" "c.1319A>G" "r.(?)" "p.(Asn440Ser)" "" ""
"0000752388" "00007729" "50" "1358" "0" "1358" "0" "c.1358T>C" "r.(?)" "p.(Leu453Ser)" "" ""
"0000752389" "00007729" "50" "1366" "0" "1366" "0" "c.1366G>A" "r.(?)" "p.(Val456Ile)" "" ""
"0000752390" "00007729" "50" "1376" "0" "1376" "0" "c.1376A>G" "r.(?)" "p.(Glu459Gly)" "" ""
"0000752391" "00007729" "50" "1394" "0" "1394" "0" "c.1394A>G" "r.(?)" "p.(Asn465Ser)" "" ""
"0000752392" "00007729" "50" "1397" "-1" "1397" "-1" "c.1397-1G>T" "r.spl?" "p.?" "" ""
"0000752393" "00007729" "50" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" ""
"0000752394" "00007729" "50" "1411" "0" "1411" "0" "c.1411G>A" "r.(?)" "p.(Glu471Lys)" "" ""
"0000752395" "00007729" "50" "1415" "0" "1415" "0" "c.1415A>G" "r.(?)" "p.(Lys472Arg)" "" ""
"0000752396" "00007729" "50" "1456" "0" "1456" "0" "c.1456C>T" "r.(?)" "p.(Arg486*)" "" ""
"0000752397" "00007729" "50" "1462" "0" "1462" "0" "c.1462A>G" "r.(?)" "p.(Ser488Gly)" "" ""
"0000752398" "00007729" "50" "1492" "0" "1492" "0" "c.1492C>T" "r.(?)" "p.(Gln498*)" "" ""
"0000752399" "00007729" "50" "1509" "0" "1509" "0" "c.1509T>G" "r.(?)" "p.(Ile503Met)" "" ""
"0000752400" "00007729" "50" "1545" "0" "1545" "0" "c.1545A>C" "r.(?)" "p.(Lys515Asn)" "" ""
"0000752401" "00007729" "50" "1550" "0" "1550" "0" "c.1550C>T" "r.(?)" "p.(Thr517Met)" "" ""
"0000752402" "00007729" "50" "1595" "0" "1595" "0" "c.1595T>G" "r.(?)" "p.(Phe532Cys)" "" ""
"0000752403" "00007729" "50" "1597" "0" "1597" "0" "c.1597C>T" "r.(?)" "p.(Arg533Cys)" "" ""
"0000752404" "00007729" "50" "1598" "0" "1598" "0" "c.1598G>A" "r.(?)" "p.(Arg533His)" "" ""
"0000752405" "00007729" "50" "1604" "0" "1604" "0" "c.1604G>A" "r.(?)" "p.(Gly535Asp)" "" ""
"0000752406" "00007729" "50" "1616" "0" "1616" "0" "c.1616C>T" "r.(?)" "p.(Thr539Met)" "" ""
"0000752407" "00007729" "50" "1636" "0" "1636" "0" "c.1636G>A" "r.(?)" "p.(Gly546Ser)" "" ""
"0000752408" "00007729" "50" "1657" "0" "1657" "0" "c.1657G>C" "r.(?)" "p.(Gly553Arg)" "" ""
"0000752409" "00007729" "50" "1667" "0" "1667" "0" "c.1667A>G" "r.(?)" "p.(Asp556Gly)" "" ""
"0000752410" "00007729" "50" "1702" "0" "1702" "0" "c.1702A>G" "r.(?)" "p.(Ile568Val)" "" ""
"0000752411" "00007729" "50" "1717" "0" "1717" "0" "c.1717C>T" "r.(?)" "p.(Arg573*)" "" ""
"0000752412" "00007729" "50" "1718" "0" "1718" "0" "c.1718G>A" "r.(?)" "p.(Arg573Gln)" "" ""
"0000752413" "00007729" "50" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" ""
"0000752414" "00007729" "50" "1741" "0" "1741" "0" "c.1741C>T" "r.(?)" "p.(Arg581Cys)" "" ""
"0000752415" "00007729" "50" "1756" "0" "1756" "0" "c.1756G>C" "r.(?)" "p.(Val586Leu)" "" ""
"0000752416" "00007729" "50" "1760" "0" "1760" "0" "c.1760T>C" "r.(?)" "p.(Ile587Thr)" "" ""
"0000752417" "00007729" "50" "1777" "0" "1777" "0" "c.1777C>T" "r.(?)" "p.(Arg593*)" "" ""
"0000752418" "00007729" "50" "1824" "0" "1824" "0" "c.1824A>G" "r.(?)" "p.(Ile608Met)" "" ""
"0000752419" "00007729" "50" "1849" "0" "1849" "0" "c.1849C>G" "r.(?)" "p.(Gln617Glu)" "" ""
"0000752420" "00007729" "50" "1880" "0" "1880" "0" "c.1880G>A" "r.(?)" "p.(Arg627Gln)" "" ""
"0000752421" "00007729" "50" "1880" "0" "1880" "0" "c.1880G>C" "r.(?)" "p.(Arg627Pro)" "" ""
"0000752422" "00007729" "50" "1933" "0" "1933" "0" "c.1933G>C" "r.(?)" "p.(Gly645Arg)" "" ""
"0000752423" "00007729" "50" "1934" "0" "1934" "0" "c.1934G>A" "r.(?)" "p.(Gly645Asp)" "" ""
"0000752424" "00007729" "50" "1937" "0" "1937" "0" "c.1937T>G" "r.(?)" "p.(Val646Gly)" "" ""
"0000752425" "00007729" "50" "1948" "0" "1948" "0" "c.1948G>A" "r.(?)" "p.(Glu650Lys)" "" ""
"0000752426" "00007729" "50" "1954" "0" "1954" "0" "c.1954C>G" "r.(?)" "p.(Pro652Ala)" "" ""
"0000752427" "00007729" "50" "1960" "0" "1960" "0" "c.1960C>T" "r.(?)" "p.(Arg654Trp)" "" ""
"0000752428" "00007729" "50" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "" ""
"0000752429" "00007729" "50" "1996" "0" "1996" "0" "c.1996A>G" "r.(?)" "p.(Arg666Gly)" "" ""
"0000752430" "00007729" "50" "2154" "0" "2154" "0" "c.2154C>G" "r.(?)" "p.(Asn718Lys)" "" ""
"0000752431" "00007729" "50" "2190" "0" "2190" "0" "c.2190A>T" "r.(?)" "p.(Gln730His)" "" ""
"0000752432" "00007729" "50" "2191" "0" "2191" "0" "c.2191C>T" "r.(?)" "p.(Leu731Phe)" "" ""
"0000752433" "00007729" "50" "2215" "0" "2215" "0" "c.2215T>C" "r.(?)" "p.(Trp739Arg)" "" ""
"0000752434" "00007729" "50" "2234" "0" "2234" "0" "c.2234C>T" "r.(?)" "p.(Pro745Leu)" "" ""
"0000752435" "00007729" "50" "2236" "0" "2236" "0" "c.2236A>G" "r.(?)" "p.(Thr746Ala)" "" ""
"0000752436" "00007729" "50" "2240" "0" "2240" "0" "c.2240A>G" "r.(?)" "p.(His747Arg)" "" ""
"0000752437" "00007729" "50" "2266" "0" "2266" "0" "c.2266C>T" "r.(?)" "p.(Arg756Cys)" "" ""
"0000752438" "00007729" "50" "2267" "0" "2267" "0" "c.2267G>A" "r.(?)" "p.(Arg756His)" "" ""
"0000752439" "00007729" "50" "2267" "0" "2267" "0" "c.2267G>T" "r.(?)" "p.(Arg756Leu)" "" ""
"0000752440" "00007729" "50" "2284" "0" "2284" "0" "c.2284A>G" "r.(?)" "p.(Met762Val)" "" ""
"0000752441" "00007729" "50" "2286" "0" "2286" "0" "c.2286G>A" "r.(?)" "p.(Met762Ile)" "" ""
"0000752442" "00007729" "50" "2311" "0" "2311" "0" "c.2311G>A" "r.(?)" "p.(Glu771Lys)" "" ""
"0000752443" "00007729" "50" "2330" "0" "2330" "0" "c.2330A>G" "r.(?)" "p.(Tyr777Cys)" "" ""
"0000752444" "00007729" "50" "2339" "0" "2339" "0" "c.2339A>C" "r.(?)" "p.(Glu780Ala)" "" ""
"0000752445" "00007729" "50" "2389" "0" "2389" "0" "c.2389C>G" "r.(?)" "p.(Pro797Ala)" "" ""
"0000752446" "00007729" "50" "2444" "0" "2444" "0" "c.2444C>T" "r.(?)" "p.(Ser815Leu)" "" ""
"0000752447" "00007729" "50" "2452" "0" "2452" "0" "c.2452A>G" "r.(?)" "p.(Ile818Val)" "" ""
"0000752448" "00007729" "50" "2458" "0" "2458" "0" "c.2458A>G" "r.(?)" "p.(Asn820Asp)" "" ""
"0000752449" "00007729" "50" "2497" "0" "2497" "0" "c.2497G>A" "r.(?)" "p.(Asp833Asn)" "" ""
"0000752450" "00007729" "50" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Glu834Gly)" "" ""
"0000752451" "00007729" "50" "2524" "0" "2524" "0" "c.2524C>T" "r.(?)" "p.(Gln842*)" "" ""
"0000752452" "00007729" "50" "2569" "0" "2569" "0" "c.2569G>C" "r.(?)" "p.(Val857Leu)" "" ""
"0000752453" "00007729" "50" "2582" "0" "2582" "0" "c.2582T>A" "r.(?)" "p.(Ile861Lys)" "" ""
"0000752454" "00007729" "50" "2603" "0" "2603" "0" "c.2603A>T" "r.(?)" "p.(Lys868Ile)" "" ""
"0000752455" "00007729" "50" "2621" "0" "2621" "0" "c.2621T>C" "r.(?)" "p.(Ile874Thr)" "" ""
"0000752456" "00007729" "50" "2624" "0" "2624" "0" "c.2624T>C" "r.(?)" "p.(Ile875Thr)" "" ""
"0000752457" "00007729" "50" "2662" "0" "2662" "0" "c.2662A>C" "r.(?)" "p.(Asn888His)" "" ""
"0000752458" "00007729" "50" "2684" "0" "2684" "0" "c.2684C>T" "r.(?)" "p.(Pro895Leu)" "" ""
"0000752459" "00007729" "50" "2696" "0" "2696" "0" "c.2696G>A" "r.(?)" "p.(Arg899Lys)" "" ""
"0000752460" "00007729" "50" "2714" "0" "2714" "0" "c.2714A>T" "r.(?)" "p.(Glu905Val)" "" ""
"0000752461" "00007729" "50" "2734" "0" "2734" "0" "c.2734A>G" "r.(?)" "p.(Ile912Val)" "" ""
"0000752462" "00007729" "50" "2750" "0" "2750" "0" "c.2750T>C" "r.(?)" "p.(Ile917Thr)" "" ""
"0000752463" "00007729" "50" "2752" "0" "2752" "0" "c.2752A>G" "r.(?)" "p.(Lys918Glu)" "" ""
"0000752464" "00007729" "50" "2758" "0" "2758" "0" "c.2758C>T" "r.(?)" "p.(Pro920Ser)" "" ""
"0000752465" "00007729" "50" "2774" "0" "2774" "0" "c.2774C>T" "r.(?)" "p.(Thr925Ile)" "" ""
"0000752466" "00007729" "50" "2791" "0" "2791" "0" "c.2791A>G" "r.(?)" "p.(Asn931Asp)" "" ""
"0000752467" "00007729" "50" "2837" "0" "2837" "0" "c.2837A>G" "r.(?)" "p.(Tyr946Cys)" "" ""
"0000752468" "00007729" "50" "2852" "0" "2852" "0" "c.2852A>G" "r.(?)" "p.(Asp951Gly)" "" ""
"0000752469" "00007729" "50" "2890" "0" "2890" "0" "c.2890G>A" "r.(?)" "p.(Glu964Lys)" "" ""
"0000752470" "00007729" "50" "2896" "0" "2896" "0" "c.2896G>C" "r.(?)" "p.(Glu966Gln)" "" ""
"0000752471" "00007729" "50" "2903" "0" "2903" "0" "c.2903A>G" "r.(?)" "p.(Tyr968Cys)" "" ""
"0000752472" "00007729" "50" "2908" "0" "2908" "0" "c.2908G>T" "r.(?)" "p.(Val970Phe)" "" ""
"0000752473" "00007729" "50" "2968" "0" "2968" "0" "c.2968G>A" "r.(?)" "p.(Val990Ile)" "" ""
"0000752474" "00007729" "50" "2969" "0" "2969" "0" "c.2969T>C" "r.(?)" "p.(Val990Ala)" "" ""
"0000752475" "00007729" "50" "2996" "0" "2996" "0" "c.2996C>T" "r.(?)" "p.(Pro999Leu)" "" ""
"0000752476" "00007729" "50" "3040" "0" "3040" "0" "c.3040G>T" "r.(?)" "p.(Gly1014Cys)" "" ""
"0000752477" "00007729" "50" "3044" "0" "3044" "0" "c.3044C>G" "r.(?)" "p.(Thr1015Ser)" "" ""
"0000752478" "00007729" "50" "3049" "0" "3049" "0" "c.3049C>T" "r.(?)" "p.(Leu1017Phe)" "" ""
"0000752479" "00007729" "50" "3074" "0" "3074" "0" "c.3074G>C" "r.(?)" "p.(Cys1025Ser)" "" ""
"0000752480" "00007729" "50" "3088" "0" "3088" "0" "c.3088C>T" "r.(?)" "p.(Arg1030*)" "" ""
"0000752481" "00007729" "50" "3149" "0" "3149" "0" "c.3149A>T" "r.(?)" "p.(Glu1050Val)" "" ""
"0000752482" "00007729" "50" "3238" "0" "3238" "0" "c.3238C>G" "r.(?)" "p.(Leu1080Val)" "" ""
"0000752483" "00007729" "50" "3261" "0" "3261" "0" "c.3261A>T" "r.(?)" "p.(Lys1087Asn)" "" ""
"0000752484" "00007729" "50" "3296" "0" "3296" "0" "c.3296G>A" "r.(?)" "p.(Arg1099His)" "" ""
"0000752485" "00007729" "50" "3308" "0" "3308" "0" "c.3308A>C" "r.(?)" "p.(His1103Pro)" "" ""
"0000752486" "00007729" "50" "3313" "0" "3313" "0" "c.3313A>G" "r.(?)" "p.(Ser1105Gly)" "" ""
"0000752487" "00007729" "50" "3332" "0" "3332" "0" "c.3332T>C" "r.(?)" "p.(Val1111Ala)" "" ""
"0000752488" "00007729" "50" "3388" "0" "3388" "0" "c.3388C>A" "r.(?)" "p.(Gln1130Lys)" "" ""
"0000752489" "00007729" "50" "3407" "0" "3407" "0" "c.3407T>C" "r.(?)" "p.(Leu1136Ser)" "" ""
"0000752490" "00007729" "50" "3433" "0" "3433" "0" "c.3433G>A" "r.(?)" "p.(Asp1145Asn)" "" ""
"0000752491" "00007729" "50" "3436" "0" "3436" "0" "c.3436G>A" "r.(?)" "p.(Asp1146Asn)" "" ""
"0000752492" "00007729" "50" "3452" "0" "3452" "0" "c.3452C>T" "r.(?)" "p.(Pro1151Leu)" "" ""
"0000752493" "00007729" "50" "3468" "0" "3468" "0" "c.3468C>G" "r.(?)" "p.(Ser1156Arg)" "" ""
"0000752494" "00007729" "50" "3469" "0" "3469" "0" "c.3469G>A" "r.(?)" "p.(Glu1157Lys)" "" ""
"0000752495" "00007729" "50" "3525" "0" "3525" "0" "c.3525G>T" "r.(?)" "p.(Gln1175His)" "" ""
"0000752496" "00007729" "50" "3595" "0" "3595" "0" "c.3595A>C" "r.(?)" "p.(Asn1199His)" "" ""
"0000752497" "00007729" "50" "3610" "0" "3610" "0" "c.3610C>T" "r.(?)" "p.(Arg1204Cys)" "" ""
"0000752498" "00007729" "50" "3658" "0" "3658" "0" "c.3658A>T" "r.(?)" "p.(Ile1220Phe)" "" ""
"0000752499" "00007729" "50" "3704" "0" "3704" "0" "c.3704G>T" "r.(?)" "p.(Gly1235Val)" "" ""
"0000752500" "00007729" "50" "3731" "0" "3731" "0" "c.3731A>G" "r.(?)" "p.(Glu1244Gly)" "" ""
"0000752501" "00007729" "50" "3732" "0" "3732" "0" "c.3732A>T" "r.(?)" "p.(Glu1244Asp)" "" ""
"0000752502" "00007729" "50" "3743" "0" "3743" "0" "c.3743A>G" "r.(?)" "p.(His1248Arg)" "" ""
"0000752503" "00007729" "50" "3758" "0" "3758" "0" "c.3758A>T" "r.(?)" "p.(Asn1253Ile)" "" ""
"0000752504" "00007729" "50" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Ser1276Leu)" "" ""
"0000752505" "00007729" "50" "3854" "0" "3854" "0" "c.3854A>G" "r.(?)" "p.(His1285Arg)" "" ""
"0000752506" "00007729" "50" "3863" "0" "3863" "0" "c.3863A>G" "r.(?)" "p.(Asn1288Ser)" "" ""
"0000752507" "00007729" "50" "3868" "0" "3868" "0" "c.3868A>G" "r.(?)" "p.(Thr1290Ala)" "" ""
"0000752508" "00007729" "50" "3871" "0" "3871" "0" "c.3871A>G" "r.(?)" "p.(Ser1291Gly)" "" ""
"0000752509" "00007729" "50" "3884" "0" "3884" "0" "c.3884T>C" "r.(?)" "p.(Ile1295Thr)" "" ""
"0000752510" "00007729" "50" "3898" "0" "3898" "0" "c.3898G>A" "r.(?)" "p.(Glu1300Lys)" "" ""
"0000752511" "00007729" "50" "3902" "0" "3902" "0" "c.3902A>T" "r.(?)" "p.(Asp1301Val)" "" ""
"0000752512" "00007729" "50" "3908" "0" "3908" "0" "c.3908A>G" "r.(?)" "p.(Gln1303Arg)" "" ""
"0000752513" "00007729" "50" "3920" "0" "3920" "0" "c.3920A>G" "r.(?)" "p.(Tyr1307Cys)" "" ""
"0000752514" "00007729" "50" "3931" "0" "3931" "0" "c.3931C>T" "r.(?)" "p.(Pro1311Ser)" "" ""
"0000752515" "00007729" "50" "3935" "0" "3935" "0" "c.3935T>C" "r.(?)" "p.(Leu1312Pro)" "" ""
"0000752516" "00007729" "50" "3941" "0" "3941" "0" "c.3941C>T" "r.(?)" "p.(Ala1314Val)" "" ""
"0000752517" "00007729" "50" "3992" "0" "3992" "0" "c.3992C>T" "r.(?)" "p.(Pro1331Leu)" "" ""
"0000752518" "00007729" "50" "3998" "0" "3998" "0" "c.3998A>C" "r.(?)" "p.(Gln1333Pro)" "" ""
"0000752519" "00007729" "50" "4004" "0" "4004" "0" "c.4004A>C" "r.(?)" "p.(Lys1335Thr)" "" ""
"0000752520" "00007729" "50" "4018" "0" "4018" "0" "c.4018C>T" "r.(?)" "p.(Pro1340Ser)" "" ""
"0000752521" "00007729" "50" "4037" "0" "4037" "0" "c.4037C>T" "r.(?)" "p.(Thr1346Ile)" "" ""
"0000752522" "00007729" "50" "4073" "0" "4073" "0" "c.4073T>C" "r.(?)" "p.(Leu1358Pro)" "" ""
"0000752523" "00007729" "50" "4076" "0" "4076" "0" "c.4076A>G" "r.(?)" "p.(Lys1359Arg)" "" ""
"0000752524" "00007729" "50" "4084" "0" "4084" "0" "c.4084G>A" "r.(?)" "p.(Asp1362Asn)" "" ""
"0000752525" "00007729" "50" "4098" "0" "4098" "0" "c.4098A>T" "r.(?)" "p.(Glu1366Asp)" "" ""
"0000752526" "00007729" "50" "4105" "0" "4105" "0" "c.4105A>G" "r.(?)" "p.(Asn1369Asp)" "" ""
"0000752527" "00007729" "50" "4126" "0" "4126" "0" "c.4126G>A" "r.(?)" "p.(Ala1376Thr)" "" ""
"0000752528" "00007729" "50" "4189" "0" "4189" "0" "c.4189A>G" "r.(?)" "p.(Met1397Val)" "" ""
"0000752529" "00007729" "50" "4193" "0" "4193" "0" "c.4193A>G" "r.(?)" "p.(Tyr1398Cys)" "" ""
"0000752530" "00007729" "50" "4194" "0" "4194" "0" "c.4194T>G" "r.(?)" "p.(Tyr1398*)" "" ""
"0000752531" "00007729" "50" "4270" "0" "4270" "0" "c.4270C>T" "r.(?)" "p.(Arg1424*)" "" ""
"0000752532" "00007729" "50" "4292" "0" "4292" "0" "c.4292A>G" "r.(?)" "p.(Lys1431Arg)" "" ""
"0000752533" "00007729" "50" "4336" "0" "4336" "0" "c.4336G>A" "r.(?)" "p.(Val1446Ile)" "" ""
"0000752534" "00007729" "50" "4352" "0" "4352" "0" "c.4352A>G" "r.(?)" "p.(His1451Arg)" "" ""
"0000752535" "00007729" "50" "4366" "0" "4366" "0" "c.4366C>T" "r.(?)" "p.(Arg1456Cys)" "" ""
"0000752536" "00007729" "50" "4367" "0" "4367" "0" "c.4367G>A" "r.(?)" "p.(Arg1456His)" "" ""
"0000752537" "00007729" "50" "4367" "0" "4367" "0" "c.4367G>T" "r.(?)" "p.(Arg1456Leu)" "" ""
"0000752538" "00007729" "50" "4378" "0" "4378" "0" "c.4378A>C" "r.(?)" "p.(Ile1460Leu)" "" ""
"0000752539" "00007729" "50" "4400" "0" "4400" "0" "c.4400C>T" "r.(?)" "p.(Ser1467Phe)" "" ""
"0000752540" "00007729" "50" "4403" "0" "4403" "0" "c.4403G>A" "r.(?)" "p.(Ser1468Asn)" "" ""
"0000752541" "00007729" "50" "4410" "0" "4410" "0" "c.4410G>C" "r.(?)" "p.(Glu1470Asp)" "" ""
"0000752542" "00007729" "50" "4429" "0" "4429" "0" "c.4429C>A" "r.(?)" "p.(Pro1477Thr)" "" ""
"0000752543" "00007729" "50" "4433" "0" "4433" "0" "c.4433G>A" "r.(?)" "p.(Cys1478Tyr)" "" ""
"0000752544" "00007729" "50" "4439" "0" "4439" "0" "c.4439A>G" "r.(?)" "p.(Gln1480Arg)" "" ""
"0000752545" "00007729" "50" "4465" "0" "4465" "0" "c.4465G>A" "r.(?)" "p.(Gly1489Arg)" "" ""
"0000752546" "00007729" "50" "4480" "0" "4480" "0" "c.4480G>T" "r.(?)" "p.(Gly1494Cys)" "" ""
"0000752547" "00007729" "50" "4543" "0" "4543" "0" "c.4543G>A" "r.(?)" "p.(Glu1515Lys)" "" ""
"0000752548" "00007729" "50" "4563" "0" "4563" "0" "c.4563A>C" "r.(?)" "p.(Glu1521Asp)" "" ""
"0000752549" "00007729" "50" "4565" "0" "4565" "0" "c.4565A>G" "r.(?)" "p.(Asp1522Gly)" "" ""
"0000752550" "00007729" "50" "4622" "0" "4622" "0" "c.4622C>T" "r.(?)" "p.(Ser1541Leu)" "" ""
"0000752551" "00007729" "50" "4627" "0" "4627" "0" "c.4627C>T" "r.(?)" "p.(Leu1543Phe)" "" ""
"0000752552" "00007729" "50" "4643" "0" "4643" "0" "c.4643A>G" "r.(?)" "p.(Asp1548Gly)" "" ""
"0000752553" "00007729" "50" "4666" "0" "4666" "0" "c.4666A>G" "r.(?)" "p.(Ile1556Val)" "" ""
"0000752554" "00007729" "50" "4708" "0" "4708" "0" "c.4708C>T" "r.(?)" "p.(Arg1570Cys)" "" ""
"0000752555" "00007729" "50" "4709" "0" "4709" "0" "c.4709G>A" "r.(?)" "p.(Arg1570His)" "" ""
"0000752556" "00007729" "50" "4727" "0" "4727" "0" "c.4727A>G" "r.(?)" "p.(Asn1576Ser)" "" ""
"0000752557" "00007729" "50" "4784" "0" "4784" "0" "c.4784C>A" "r.(?)" "p.(Pro1595His)" "" ""
"0000752558" "00007729" "50" "4798" "0" "4798" "0" "c.4798A>G" "r.(?)" "p.(Thr1600Ala)" "" ""
"0000752559" "00007729" "50" "4872" "0" "4872" "0" "c.4872T>G" "r.(?)" "p.(Cys1624Trp)" "" ""
"0000752560" "00007729" "50" "4913" "0" "4913" "0" "c.4913G>A" "r.(?)" "p.(Ser1638Asn)" "" ""
"0000752561" "00007729" "50" "4928" "0" "4928" "0" "c.4928C>T" "r.(?)" "p.(Thr1643Ile)" "" ""
"0000752562" "00007729" "50" "4933" "0" "4933" "0" "c.4933C>T" "r.(?)" "p.(Arg1645Cys)" "" ""
"0000752563" "00007729" "50" "4934" "0" "4934" "0" "c.4934G>A" "r.(?)" "p.(Arg1645His)" "" ""
"0000752564" "00007729" "50" "4939" "0" "4939" "0" "c.4939G>C" "r.(?)" "p.(Val1647Leu)" "" ""
"0000752565" "00007729" "50" "4951" "0" "4951" "0" "c.4951G>A" "r.(?)" "p.(Glu1651Lys)" "" ""
"0000752566" "00007729" "50" "5026" "0" "5026" "0" "c.5026G>A" "r.(?)" "p.(Glu1676Lys)" "" ""
"0000752567" "00007729" "50" "5045" "0" "5045" "0" "c.5045A>G" "r.(?)" "p.(Asp1682Gly)" "" ""
"0000752568" "00007729" "50" "5048" "0" "5048" "0" "c.5048A>G" "r.(?)" "p.(Lys1683Arg)" "" ""
"0000752569" "00007729" "50" "5066" "0" "5066" "0" "c.5066C>T" "r.(?)" "p.(Ala1689Val)" "" ""
"0000752570" "00007729" "50" "5068" "0" "5068" "0" "c.5068G>C" "r.(?)" "p.(Val1690Leu)" "" ""
"0000752571" "00007729" "50" "5078" "0" "5078" "0" "c.5078G>A" "r.(?)" "p.(Ser1693Asn)" "" ""
"0000752572" "00007729" "50" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000752573" "00007729" "50" "5107" "0" "5107" "0" "c.5107C>G" "r.(?)" "p.(His1703Asp)" "" ""
"0000752574" "00007729" "50" "5108" "0" "5108" "0" "c.5108A>G" "r.(?)" "p.(His1703Arg)" "" ""
"0000752575" "00007729" "50" "5117" "0" "5117" "0" "c.5117A>C" "r.(?)" "p.(Asn1706Thr)" "" ""
"0000752576" "00007729" "50" "5134" "0" "5134" "0" "c.5134T>A" "r.(?)" "p.(Ser1712Thr)" "" ""
"0000752577" "00007729" "50" "5141" "0" "5141" "0" "c.5141C>T" "r.(?)" "p.(Ala1714Val)" "" ""
"0000752578" "00007729" "50" "5177" "0" "5177" "0" "c.5177C>T" "r.(?)" "p.(Pro1726Leu)" "" ""
"0000752579" "00007729" "50" "5230" "0" "5230" "0" "c.5230G>A" "r.(?)" "p.(Glu1744Lys)" "" ""
"0000752580" "00007729" "50" "5249" "0" "5249" "0" "c.5249C>T" "r.(?)" "p.(Pro1750Leu)" "" ""
"0000752581" "00007729" "50" "5281" "0" "5281" "0" "c.5281C>G" "r.(?)" "p.(Pro1761Ala)" "" ""
"0000752582" "00007729" "50" "5282" "0" "5282" "0" "c.5282C>T" "r.(?)" "p.(Pro1761Leu)" "" ""
"0000752583" "00007729" "50" "5337" "0" "5337" "0" "c.5337G>T" "r.(?)" "p.(Gln1779His)" "" ""
"0000752584" "00007729" "50" "5340" "1" "5340" "1" "c.5340+1G>T" "r.spl?" "p.?" "" ""
"0000752585" "00007729" "50" "5387" "0" "5387" "0" "c.5387C>G" "r.(?)" "p.(Ser1796Cys)" "" ""
"0000752586" "00007729" "50" "5435" "0" "5435" "0" "c.5435C>T" "r.(?)" "p.(Pro1812Leu)" "" ""
"0000752587" "00007729" "50" "5440" "0" "5440" "0" "c.5440G>A" "r.(?)" "p.(Glu1814Lys)" "" ""
"0000752588" "00007729" "50" "5474" "0" "5474" "0" "c.5474A>G" "r.(?)" "p.(His1825Arg)" "" ""
"0000752589" "00007729" "50" "5496" "0" "5496" "0" "c.5496A>C" "r.(?)" "p.(Glu1832Asp)" "" ""
"0000752590" "00007729" "50" "5498" "0" "5498" "0" "c.5498T>G" "r.(?)" "p.(Val1833Gly)" "" ""
"0000752591" "00007729" "50" "5569" "0" "5569" "0" "c.5569G>A" "r.(?)" "p.(Val1857Met)" "" ""
"0000752592" "00007729" "50" "5579" "0" "5579" "0" "c.5579G>A" "r.(?)" "p.(Arg1860His)" "" ""
"0000752593" "00007729" "50" "5603" "0" "5603" "0" "c.5603A>G" "r.(?)" "p.(Gln1868Arg)" "" ""
"0000752594" "00007729" "50" "5656" "0" "5656" "0" "c.5656C>T" "r.(?)" "p.(His1886Tyr)" "" ""
"0000752595" "00007729" "50" "5683" "0" "5683" "0" "c.5683T>C" "r.(?)" "p.(Cys1895Arg)" "" ""
"0000752596" "00007729" "50" "5692" "0" "5692" "0" "c.5692G>A" "r.(?)" "p.(Val1898Met)" "" ""
"0000752597" "00007729" "50" "5729" "0" "5729" "0" "c.5729G>C" "r.(?)" "p.(Arg1910Thr)" "" ""
"0000752598" "00007729" "50" "5750" "0" "5750" "0" "c.5750G>A" "r.(?)" "p.(Ser1917Asn)" "" ""
"0000752599" "00007729" "50" "5770" "0" "5770" "0" "c.5770A>T" "r.(?)" "p.(Thr1924Ser)" "" ""
"0000752600" "00007729" "50" "5776" "0" "5776" "0" "c.5776A>G" "r.(?)" "p.(Ile1926Val)" "" ""
"0000752601" "00007729" "50" "5782" "0" "5782" "0" "c.5782G>A" "r.(?)" "p.(Ala1928Thr)" "" ""
"0000752602" "00007729" "50" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000752603" "00007729" "50" "5798" "0" "5798" "0" "c.5798T>C" "r.(?)" "p.(Leu1933Pro)" "" ""
"0000752604" "00007729" "50" "5819" "0" "5819" "0" "c.5819A>G" "r.(?)" "p.(Glu1940Gly)" "" ""
"0000752605" "00007729" "50" "5832" "0" "5832" "0" "c.5832G>T" "r.(?)" "p.(Leu1944Phe)" "" ""
"0000752606" "00007729" "50" "5866" "0" "5866" "0" "c.5866A>G" "r.(?)" "p.(Asn1956Asp)" "" ""
"0000752607" "00007729" "50" "5887" "0" "5887" "0" "c.5887A>G" "r.(?)" "p.(Thr1963Ala)" "" ""
"0000752608" "00007729" "50" "5951" "0" "5951" "0" "c.5951A>T" "r.(?)" "p.(Tyr1984Phe)" "" ""
"0000752609" "00007729" "50" "6028" "0" "6028" "0" "c.6028A>G" "r.(?)" "p.(Met2010Val)" "" ""
"0000752610" "00007729" "50" "6041" "0" "6041" "0" "c.6041T>C" "r.(?)" "p.(Val2014Ala)" "" ""
"0000752611" "00007729" "50" "6129" "0" "6129" "0" "c.6129A>T" "r.(?)" "p.(Arg2043Ser)" "" ""
"0000752612" "00007729" "50" "6139" "0" "6139" "0" "c.6139G>A" "r.(?)" "p.(Asp2047Asn)" "" ""
"0000752613" "00007729" "50" "6143" "0" "6143" "0" "c.6143T>C" "r.(?)" "p.(Ile2048Thr)" "" ""
"0000754942" "00007729" "50" "551" "0" "551" "0" "c.551dup" "r.(?)" "p.(Arg185Glufs*13)" "" ""
"0000754943" "00007729" "50" "1362" "0" "1363" "0" "c.1362_1363insCAAAGTTAAA" "r.(?)" "p.(Glu455Glnfs*3)" "" ""
"0000754944" "00007729" "50" "1491" "0" "1491" "0" "c.1491dup" "r.(?)" "p.(Gln498Thrfs*7)" "" ""
"0000754945" "00007729" "50" "1724" "0" "1724" "0" "c.1724del" "r.(?)" "p.(Gly575Valfs*11)" "" ""
"0000754946" "00007729" "50" "2147" "0" "2148" "0" "c.2147_2148del" "r.(?)" "p.(Glu716Glyfs*19)" "" ""
"0000754947" "00007729" "50" "2586" "0" "2589" "0" "c.2586_2589del" "r.(?)" "p.(Lys863Ilefs*12)" "" ""
"0000754948" "00007729" "50" "4025" "0" "4026" "0" "c.4025_4026del" "r.(?)" "p.(Ser1342*)" "" ""
"0000754949" "00007729" "50" "4285" "0" "4285" "0" "c.4285del" "r.(?)" "p.(Arg1429Glufs*7)" "" ""
"0000755033" "00007729" "50" "547" "0" "548" "0" "c.547_548inv" "r.(?)" "p.(Ser183Leu)" "" ""
"0000757099" "00007729" "50" "53" "0" "53" "0" "c.53G>A" "r.(?)" "p.(Arg18Gln)" "" ""
"0000757100" "00007729" "50" "56" "0" "56" "0" "c.56C>T" "r.(?)" "p.(Ser19Leu)" "" ""
"0000757101" "00007729" "50" "59" "0" "59" "0" "c.59C>G" "r.(?)" "p.(Ser20Cys)" "" ""
"0000757102" "00007729" "50" "68" "0" "68" "0" "c.68C>A" "r.(?)" "p.(Pro23Gln)" "" ""
"0000757103" "00007729" "50" "104" "0" "104" "0" "c.104C>G" "r.(?)" "p.(Pro35Arg)" "" ""
"0000757104" "00007729" "50" "155" "0" "155" "0" "c.155C>T" "r.(?)" "p.(Ser52Leu)" "" ""
"0000757105" "00007729" "50" "163" "0" "163" "0" "c.163G>A" "r.(?)" "p.(Asp55Asn)" "" ""
"0000757106" "00007729" "50" "179" "0" "179" "0" "c.179C>A" "r.(?)" "p.(Ala60Glu)" "" ""
"0000757107" "00007729" "50" "179" "0" "179" "0" "c.179C>T" "r.(?)" "p.(Ala60Val)" "" ""
"0000757108" "00007729" "50" "189" "0" "189" "0" "c.189G>T" "r.(?)" "p.(Glu63Asp)" "" ""
"0000757109" "00007729" "50" "220" "0" "220" "0" "c.220G>A" "r.(?)" "p.(Gly74Arg)" "" ""
"0000757110" "00007729" "50" "242" "0" "242" "0" "c.242C>T" "r.(?)" "p.(Ala81Val)" "" ""
"0000757111" "00007729" "50" "269" "0" "269" "0" "c.269C>T" "r.(?)" "p.(Pro90Leu)" "" ""
"0000757112" "00007729" "50" "281" "0" "281" "0" "c.281A>G" "r.(?)" "p.(Tyr94Cys)" "" ""
"0000757113" "00007729" "50" "422" "0" "422" "0" "c.422C>T" "r.(?)" "p.(Ala141Val)" "" ""
"0000757114" "00007729" "50" "424" "0" "424" "0" "c.424C>A" "r.(?)" "p.(Pro142Thr)" "" ""
"0000757115" "00007729" "50" "443" "0" "443" "0" "c.443C>T" "r.(?)" "p.(Thr148Ile)" "" ""
"0000757116" "00007729" "50" "461" "0" "461" "0" "c.461G>C" "r.(?)" "p.(Cys154Ser)" "" ""
"0000757117" "00007729" "50" "496" "0" "496" "0" "c.496G>A" "r.(?)" "p.(Ala166Thr)" "" ""
"0000757118" "00007729" "50" "538" "0" "538" "0" "c.538A>G" "r.(?)" "p.(Ile180Val)" "" ""
"0000757119" "00007729" "50" "547" "0" "547" "0" "c.547A>C" "r.(?)" "p.(Ser183Arg)" "" ""
"0000757120" "00007729" "50" "557" "0" "557" "0" "c.557T>G" "r.(?)" "p.(Val186Gly)" "" ""
"0000757121" "00007729" "50" "565" "0" "565" "0" "c.565C>G" "r.(?)" "p.(Leu189Val)" "" ""
"0000757122" "00007729" "50" "631" "0" "631" "0" "c.631T>G" "r.(?)" "p.(Leu211Val)" "" ""
"0000757123" "00007729" "50" "635" "0" "635" "0" "c.635T>A" "r.(?)" "p.(Val212Asp)" "" ""
"0000757124" "00007729" "50" "655" "0" "655" "0" "c.655G>C" "r.(?)" "p.(Ala219Pro)" "" ""
"0000757125" "00007729" "50" "662" "0" "662" "0" "c.662G>C" "r.(?)" "p.(Gly221Ala)" "" ""
"0000757126" "00007729" "50" "665" "0" "665" "0" "c.665A>G" "r.(?)" "p.(Asn222Ser)" "" ""
"0000757127" "00007729" "50" "709" "0" "709" "0" "c.709A>T" "r.(?)" "p.(Asn237Tyr)" "" ""
"0000757128" "00007729" "50" "710" "0" "710" "0" "c.710A>G" "r.(?)" "p.(Asn237Ser)" "" ""
"0000757129" "00007729" "50" "759" "1" "759" "1" "c.759+1G>A" "r.spl?" "p.?" "" ""
"0000757130" "00007729" "50" "775" "0" "775" "0" "c.775A>G" "r.(?)" "p.(Ile259Val)" "" ""
"0000757131" "00007729" "50" "808" "0" "808" "0" "c.808C>T" "r.(?)" "p.(Arg270Cys)" "" ""
"0000757132" "00007729" "50" "844" "0" "844" "0" "c.844C>T" "r.(?)" "p.(His282Tyr)" "" ""
"0000757133" "00007729" "50" "868" "0" "868" "0" "c.868A>G" "r.(?)" "p.(Ile290Val)" "" ""
"0000757134" "00007729" "50" "869" "0" "869" "0" "c.869T>C" "r.(?)" "p.(Ile290Thr)" "" ""
"0000757135" "00007729" "50" "874" "0" "874" "0" "c.874C>A" "r.(?)" "p.(Pro292Thr)" "" ""
"0000757136" "00007729" "50" "875" "0" "875" "0" "c.875C>T" "r.(?)" "p.(Pro292Leu)" "" ""
"0000757137" "00007729" "50" "896" "0" "896" "0" "c.896C>G" "r.(?)" "p.(Ala299Gly)" "" ""
"0000757138" "00007729" "50" "902" "0" "902" "0" "c.902A>G" "r.(?)" "p.(Gln301Arg)" "" ""
"0000757139" "00007729" "50" "925" "0" "925" "0" "c.925G>A" "r.(?)" "p.(Glu309Lys)" "" ""
"0000757140" "00007729" "50" "938" "0" "938" "0" "c.938G>A" "r.(?)" "p.(Arg313His)" "" ""
"0000757141" "00007729" "50" "950" "0" "950" "0" "c.950A>G" "r.(?)" "p.(Gln317Arg)" "" ""
"0000757142" "00007729" "50" "963" "0" "963" "0" "c.963G>C" "r.(?)" "p.(Leu321Phe)" "" ""
"0000757143" "00007729" "50" "974" "0" "974" "0" "c.974A>G" "r.(?)" "p.(Asp325Gly)" "" ""
"0000757144" "00007729" "50" "1040" "0" "1040" "0" "c.1040C>T" "r.(?)" "p.(Pro347Leu)" "" ""
"0000757145" "00007729" "50" "1049" "0" "1049" "0" "c.1049T>C" "r.(?)" "p.(Val350Ala)" "" ""
"0000757146" "00007729" "50" "1097" "0" "1097" "0" "c.1097G>A" "r.(?)" "p.(Ser366Asn)" "" ""
"0000757147" "00007729" "50" "1131" "0" "1131" "0" "c.1131G>A" "r.(?)" "p.(Met377Ile)" "" ""
"0000757148" "00007729" "50" "1132" "0" "1132" "0" "c.1132G>C" "r.(?)" "p.(Gly378Arg)" "" ""
"0000757149" "00007729" "50" "1192" "0" "1192" "0" "c.1192C>T" "r.(?)" "p.(Arg398Trp)" "" ""
"0000757150" "00007729" "50" "1193" "0" "1193" "0" "c.1193G>A" "r.(?)" "p.(Arg398Gln)" "" ""
"0000757151" "00007729" "50" "1196" "0" "1196" "0" "c.1196C>G" "r.(?)" "p.(Ser399*)" "" ""
"0000757152" "00007729" "50" "1222" "0" "1222" "0" "c.1222G>C" "r.(?)" "p.(Asp408His)" "" ""
"0000757153" "00007729" "50" "1231" "0" "1231" "0" "c.1231A>G" "r.(?)" "p.(Lys411Glu)" "" ""
"0000757154" "00007729" "50" "1235" "0" "1235" "0" "c.1235T>G" "r.(?)" "p.(Leu412Arg)" "" ""
"0000757155" "00007729" "50" "1238" "0" "1238" "0" "c.1238A>G" "r.(?)" "p.(Tyr413Cys)" "" ""
"0000757156" "00007729" "50" "1264" "0" "1264" "0" "c.1264C>T" "r.(?)" "p.(Arg422Cys)" "" ""
"0000757157" "00007729" "50" "1270" "0" "1270" "0" "c.1270C>T" "r.(?)" "p.(Arg424Cys)" "" ""
"0000757158" "00007729" "50" "1271" "0" "1271" "0" "c.1271G>A" "r.(?)" "p.(Arg424His)" "" ""
"0000757159" "00007729" "50" "1294" "0" "1294" "0" "c.1294T>C" "r.(?)" "p.(Ser432Pro)" "" ""
"0000757160" "00007729" "50" "1300" "0" "1300" "0" "c.1300A>G" "r.(?)" "p.(Ile434Val)" "" ""
"0000757161" "00007729" "50" "1319" "0" "1319" "0" "c.1319A>G" "r.(?)" "p.(Asn440Ser)" "" ""
"0000757162" "00007729" "50" "1358" "0" "1358" "0" "c.1358T>C" "r.(?)" "p.(Leu453Ser)" "" ""
"0000757163" "00007729" "50" "1366" "0" "1366" "0" "c.1366G>A" "r.(?)" "p.(Val456Ile)" "" ""
"0000757164" "00007729" "50" "1376" "0" "1376" "0" "c.1376A>G" "r.(?)" "p.(Glu459Gly)" "" ""
"0000757165" "00007729" "50" "1394" "0" "1394" "0" "c.1394A>G" "r.(?)" "p.(Asn465Ser)" "" ""
"0000757166" "00007729" "50" "1397" "-1" "1397" "-1" "c.1397-1G>T" "r.spl?" "p.?" "" ""
"0000757167" "00007729" "50" "1402" "0" "1402" "0" "c.1402A>G" "r.(?)" "p.(Asn468Asp)" "" ""
"0000757168" "00007729" "50" "1411" "0" "1411" "0" "c.1411G>A" "r.(?)" "p.(Glu471Lys)" "" ""
"0000757169" "00007729" "50" "1415" "0" "1415" "0" "c.1415A>G" "r.(?)" "p.(Lys472Arg)" "" ""
"0000757170" "00007729" "50" "1456" "0" "1456" "0" "c.1456C>T" "r.(?)" "p.(Arg486*)" "" ""
"0000757171" "00007729" "50" "1462" "0" "1462" "0" "c.1462A>G" "r.(?)" "p.(Ser488Gly)" "" ""
"0000757172" "00007729" "50" "1492" "0" "1492" "0" "c.1492C>T" "r.(?)" "p.(Gln498*)" "" ""
"0000757173" "00007729" "50" "1509" "0" "1509" "0" "c.1509T>G" "r.(?)" "p.(Ile503Met)" "" ""
"0000757174" "00007729" "50" "1545" "0" "1545" "0" "c.1545A>C" "r.(?)" "p.(Lys515Asn)" "" ""
"0000757175" "00007729" "50" "1550" "0" "1550" "0" "c.1550C>T" "r.(?)" "p.(Thr517Met)" "" ""
"0000757176" "00007729" "50" "1595" "0" "1595" "0" "c.1595T>G" "r.(?)" "p.(Phe532Cys)" "" ""
"0000757177" "00007729" "50" "1597" "0" "1597" "0" "c.1597C>T" "r.(?)" "p.(Arg533Cys)" "" ""
"0000757178" "00007729" "50" "1598" "0" "1598" "0" "c.1598G>A" "r.(?)" "p.(Arg533His)" "" ""
"0000757179" "00007729" "50" "1604" "0" "1604" "0" "c.1604G>A" "r.(?)" "p.(Gly535Asp)" "" ""
"0000757180" "00007729" "50" "1616" "0" "1616" "0" "c.1616C>T" "r.(?)" "p.(Thr539Met)" "" ""
"0000757181" "00007729" "50" "1636" "0" "1636" "0" "c.1636G>A" "r.(?)" "p.(Gly546Ser)" "" ""
"0000757182" "00007729" "50" "1657" "0" "1657" "0" "c.1657G>C" "r.(?)" "p.(Gly553Arg)" "" ""
"0000757183" "00007729" "50" "1667" "0" "1667" "0" "c.1667A>G" "r.(?)" "p.(Asp556Gly)" "" ""
"0000757184" "00007729" "50" "1702" "0" "1702" "0" "c.1702A>G" "r.(?)" "p.(Ile568Val)" "" ""
"0000757185" "00007729" "50" "1717" "0" "1717" "0" "c.1717C>T" "r.(?)" "p.(Arg573*)" "" ""
"0000757186" "00007729" "50" "1718" "0" "1718" "0" "c.1718G>A" "r.(?)" "p.(Arg573Gln)" "" ""
"0000757187" "00007729" "50" "1735" "0" "1735" "0" "c.1735C>T" "r.(?)" "p.(Arg579Cys)" "" ""
"0000757188" "00007729" "50" "1741" "0" "1741" "0" "c.1741C>T" "r.(?)" "p.(Arg581Cys)" "" ""
"0000757189" "00007729" "50" "1756" "0" "1756" "0" "c.1756G>C" "r.(?)" "p.(Val586Leu)" "" ""
"0000757190" "00007729" "50" "1760" "0" "1760" "0" "c.1760T>C" "r.(?)" "p.(Ile587Thr)" "" ""
"0000757191" "00007729" "50" "1777" "0" "1777" "0" "c.1777C>T" "r.(?)" "p.(Arg593*)" "" ""
"0000757192" "00007729" "50" "1824" "0" "1824" "0" "c.1824A>G" "r.(?)" "p.(Ile608Met)" "" ""
"0000757193" "00007729" "50" "1849" "0" "1849" "0" "c.1849C>G" "r.(?)" "p.(Gln617Glu)" "" ""
"0000757194" "00007729" "50" "1880" "0" "1880" "0" "c.1880G>A" "r.(?)" "p.(Arg627Gln)" "" ""
"0000757195" "00007729" "50" "1880" "0" "1880" "0" "c.1880G>C" "r.(?)" "p.(Arg627Pro)" "" ""
"0000757196" "00007729" "50" "1933" "0" "1933" "0" "c.1933G>C" "r.(?)" "p.(Gly645Arg)" "" ""
"0000757197" "00007729" "50" "1934" "0" "1934" "0" "c.1934G>A" "r.(?)" "p.(Gly645Asp)" "" ""
"0000757198" "00007729" "50" "1937" "0" "1937" "0" "c.1937T>G" "r.(?)" "p.(Val646Gly)" "" ""
"0000757199" "00007729" "50" "1948" "0" "1948" "0" "c.1948G>A" "r.(?)" "p.(Glu650Lys)" "" ""
"0000757200" "00007729" "50" "1954" "0" "1954" "0" "c.1954C>G" "r.(?)" "p.(Pro652Ala)" "" ""
"0000757201" "00007729" "50" "1960" "0" "1960" "0" "c.1960C>T" "r.(?)" "p.(Arg654Trp)" "" ""
"0000757202" "00007729" "50" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "" ""
"0000757203" "00007729" "50" "1996" "0" "1996" "0" "c.1996A>G" "r.(?)" "p.(Arg666Gly)" "" ""
"0000757204" "00007729" "50" "2154" "0" "2154" "0" "c.2154C>G" "r.(?)" "p.(Asn718Lys)" "" ""
"0000757205" "00007729" "50" "2190" "0" "2190" "0" "c.2190A>T" "r.(?)" "p.(Gln730His)" "" ""
"0000757206" "00007729" "50" "2191" "0" "2191" "0" "c.2191C>T" "r.(?)" "p.(Leu731Phe)" "" ""
"0000757207" "00007729" "50" "2215" "0" "2215" "0" "c.2215T>C" "r.(?)" "p.(Trp739Arg)" "" ""
"0000757208" "00007729" "50" "2234" "0" "2234" "0" "c.2234C>T" "r.(?)" "p.(Pro745Leu)" "" ""
"0000757209" "00007729" "50" "2236" "0" "2236" "0" "c.2236A>G" "r.(?)" "p.(Thr746Ala)" "" ""
"0000757210" "00007729" "50" "2240" "0" "2240" "0" "c.2240A>G" "r.(?)" "p.(His747Arg)" "" ""
"0000757211" "00007729" "50" "2266" "0" "2266" "0" "c.2266C>T" "r.(?)" "p.(Arg756Cys)" "" ""
"0000757212" "00007729" "50" "2267" "0" "2267" "0" "c.2267G>A" "r.(?)" "p.(Arg756His)" "" ""
"0000757213" "00007729" "50" "2267" "0" "2267" "0" "c.2267G>T" "r.(?)" "p.(Arg756Leu)" "" ""
"0000757214" "00007729" "50" "2284" "0" "2284" "0" "c.2284A>G" "r.(?)" "p.(Met762Val)" "" ""
"0000757215" "00007729" "50" "2286" "0" "2286" "0" "c.2286G>A" "r.(?)" "p.(Met762Ile)" "" ""
"0000757216" "00007729" "50" "2311" "0" "2311" "0" "c.2311G>A" "r.(?)" "p.(Glu771Lys)" "" ""
"0000757217" "00007729" "50" "2330" "0" "2330" "0" "c.2330A>G" "r.(?)" "p.(Tyr777Cys)" "" ""
"0000757218" "00007729" "50" "2339" "0" "2339" "0" "c.2339A>C" "r.(?)" "p.(Glu780Ala)" "" ""
"0000757219" "00007729" "50" "2389" "0" "2389" "0" "c.2389C>G" "r.(?)" "p.(Pro797Ala)" "" ""
"0000757220" "00007729" "50" "2444" "0" "2444" "0" "c.2444C>T" "r.(?)" "p.(Ser815Leu)" "" ""
"0000757221" "00007729" "50" "2452" "0" "2452" "0" "c.2452A>G" "r.(?)" "p.(Ile818Val)" "" ""
"0000757222" "00007729" "50" "2458" "0" "2458" "0" "c.2458A>G" "r.(?)" "p.(Asn820Asp)" "" ""
"0000757223" "00007729" "50" "2497" "0" "2497" "0" "c.2497G>A" "r.(?)" "p.(Asp833Asn)" "" ""
"0000757224" "00007729" "50" "2501" "0" "2501" "0" "c.2501A>G" "r.(?)" "p.(Glu834Gly)" "" ""
"0000757225" "00007729" "50" "2524" "0" "2524" "0" "c.2524C>T" "r.(?)" "p.(Gln842*)" "" ""
"0000757226" "00007729" "50" "2569" "0" "2569" "0" "c.2569G>C" "r.(?)" "p.(Val857Leu)" "" ""
"0000757227" "00007729" "50" "2582" "0" "2582" "0" "c.2582T>A" "r.(?)" "p.(Ile861Lys)" "" ""
"0000757228" "00007729" "50" "2603" "0" "2603" "0" "c.2603A>T" "r.(?)" "p.(Lys868Ile)" "" ""
"0000757229" "00007729" "50" "2621" "0" "2621" "0" "c.2621T>C" "r.(?)" "p.(Ile874Thr)" "" ""
"0000757230" "00007729" "50" "2624" "0" "2624" "0" "c.2624T>C" "r.(?)" "p.(Ile875Thr)" "" ""
"0000757231" "00007729" "50" "2662" "0" "2662" "0" "c.2662A>C" "r.(?)" "p.(Asn888His)" "" ""
"0000757232" "00007729" "50" "2684" "0" "2684" "0" "c.2684C>T" "r.(?)" "p.(Pro895Leu)" "" ""
"0000757233" "00007729" "50" "2696" "0" "2696" "0" "c.2696G>A" "r.(?)" "p.(Arg899Lys)" "" ""
"0000757234" "00007729" "50" "2714" "0" "2714" "0" "c.2714A>T" "r.(?)" "p.(Glu905Val)" "" ""
"0000757235" "00007729" "50" "2734" "0" "2734" "0" "c.2734A>G" "r.(?)" "p.(Ile912Val)" "" ""
"0000757236" "00007729" "50" "2750" "0" "2750" "0" "c.2750T>C" "r.(?)" "p.(Ile917Thr)" "" ""
"0000757237" "00007729" "50" "2752" "0" "2752" "0" "c.2752A>G" "r.(?)" "p.(Lys918Glu)" "" ""
"0000757238" "00007729" "50" "2758" "0" "2758" "0" "c.2758C>T" "r.(?)" "p.(Pro920Ser)" "" ""
"0000757239" "00007729" "50" "2774" "0" "2774" "0" "c.2774C>T" "r.(?)" "p.(Thr925Ile)" "" ""
"0000757240" "00007729" "50" "2791" "0" "2791" "0" "c.2791A>G" "r.(?)" "p.(Asn931Asp)" "" ""
"0000757241" "00007729" "50" "2837" "0" "2837" "0" "c.2837A>G" "r.(?)" "p.(Tyr946Cys)" "" ""
"0000757242" "00007729" "50" "2852" "0" "2852" "0" "c.2852A>G" "r.(?)" "p.(Asp951Gly)" "" ""
"0000757243" "00007729" "50" "2890" "0" "2890" "0" "c.2890G>A" "r.(?)" "p.(Glu964Lys)" "" ""
"0000757244" "00007729" "50" "2896" "0" "2896" "0" "c.2896G>C" "r.(?)" "p.(Glu966Gln)" "" ""
"0000757245" "00007729" "50" "2903" "0" "2903" "0" "c.2903A>G" "r.(?)" "p.(Tyr968Cys)" "" ""
"0000757246" "00007729" "50" "2908" "0" "2908" "0" "c.2908G>T" "r.(?)" "p.(Val970Phe)" "" ""
"0000757247" "00007729" "50" "2968" "0" "2968" "0" "c.2968G>A" "r.(?)" "p.(Val990Ile)" "" ""
"0000757248" "00007729" "50" "2969" "0" "2969" "0" "c.2969T>C" "r.(?)" "p.(Val990Ala)" "" ""
"0000757249" "00007729" "50" "2996" "0" "2996" "0" "c.2996C>T" "r.(?)" "p.(Pro999Leu)" "" ""
"0000757250" "00007729" "50" "3040" "0" "3040" "0" "c.3040G>T" "r.(?)" "p.(Gly1014Cys)" "" ""
"0000757251" "00007729" "50" "3044" "0" "3044" "0" "c.3044C>G" "r.(?)" "p.(Thr1015Ser)" "" ""
"0000757252" "00007729" "50" "3049" "0" "3049" "0" "c.3049C>T" "r.(?)" "p.(Leu1017Phe)" "" ""
"0000757253" "00007729" "50" "3074" "0" "3074" "0" "c.3074G>C" "r.(?)" "p.(Cys1025Ser)" "" ""
"0000757254" "00007729" "50" "3088" "0" "3088" "0" "c.3088C>T" "r.(?)" "p.(Arg1030*)" "" ""
"0000757255" "00007729" "50" "3149" "0" "3149" "0" "c.3149A>T" "r.(?)" "p.(Glu1050Val)" "" ""
"0000757256" "00007729" "50" "3238" "0" "3238" "0" "c.3238C>G" "r.(?)" "p.(Leu1080Val)" "" ""
"0000757257" "00007729" "50" "3261" "0" "3261" "0" "c.3261A>T" "r.(?)" "p.(Lys1087Asn)" "" ""
"0000757258" "00007729" "50" "3296" "0" "3296" "0" "c.3296G>A" "r.(?)" "p.(Arg1099His)" "" ""
"0000757259" "00007729" "50" "3308" "0" "3308" "0" "c.3308A>C" "r.(?)" "p.(His1103Pro)" "" ""
"0000757260" "00007729" "50" "3313" "0" "3313" "0" "c.3313A>G" "r.(?)" "p.(Ser1105Gly)" "" ""
"0000757261" "00007729" "50" "3332" "0" "3332" "0" "c.3332T>C" "r.(?)" "p.(Val1111Ala)" "" ""
"0000757262" "00007729" "50" "3388" "0" "3388" "0" "c.3388C>A" "r.(?)" "p.(Gln1130Lys)" "" ""
"0000757263" "00007729" "50" "3407" "0" "3407" "0" "c.3407T>C" "r.(?)" "p.(Leu1136Ser)" "" ""
"0000757264" "00007729" "50" "3433" "0" "3433" "0" "c.3433G>A" "r.(?)" "p.(Asp1145Asn)" "" ""
"0000757265" "00007729" "50" "3436" "0" "3436" "0" "c.3436G>A" "r.(?)" "p.(Asp1146Asn)" "" ""
"0000757266" "00007729" "50" "3452" "0" "3452" "0" "c.3452C>T" "r.(?)" "p.(Pro1151Leu)" "" ""
"0000757267" "00007729" "50" "3468" "0" "3468" "0" "c.3468C>G" "r.(?)" "p.(Ser1156Arg)" "" ""
"0000757268" "00007729" "50" "3469" "0" "3469" "0" "c.3469G>A" "r.(?)" "p.(Glu1157Lys)" "" ""
"0000757269" "00007729" "50" "3525" "0" "3525" "0" "c.3525G>T" "r.(?)" "p.(Gln1175His)" "" ""
"0000757270" "00007729" "50" "3595" "0" "3595" "0" "c.3595A>C" "r.(?)" "p.(Asn1199His)" "" ""
"0000757271" "00007729" "50" "3610" "0" "3610" "0" "c.3610C>T" "r.(?)" "p.(Arg1204Cys)" "" ""
"0000757272" "00007729" "50" "3658" "0" "3658" "0" "c.3658A>T" "r.(?)" "p.(Ile1220Phe)" "" ""
"0000757273" "00007729" "50" "3704" "0" "3704" "0" "c.3704G>T" "r.(?)" "p.(Gly1235Val)" "" ""
"0000757274" "00007729" "50" "3731" "0" "3731" "0" "c.3731A>G" "r.(?)" "p.(Glu1244Gly)" "" ""
"0000757275" "00007729" "50" "3732" "0" "3732" "0" "c.3732A>T" "r.(?)" "p.(Glu1244Asp)" "" ""
"0000757276" "00007729" "50" "3743" "0" "3743" "0" "c.3743A>G" "r.(?)" "p.(His1248Arg)" "" ""
"0000757277" "00007729" "50" "3758" "0" "3758" "0" "c.3758A>T" "r.(?)" "p.(Asn1253Ile)" "" ""
"0000757278" "00007729" "50" "3827" "0" "3827" "0" "c.3827C>T" "r.(?)" "p.(Ser1276Leu)" "" ""
"0000757279" "00007729" "50" "3854" "0" "3854" "0" "c.3854A>G" "r.(?)" "p.(His1285Arg)" "" ""
"0000757280" "00007729" "50" "3863" "0" "3863" "0" "c.3863A>G" "r.(?)" "p.(Asn1288Ser)" "" ""
"0000757281" "00007729" "50" "3868" "0" "3868" "0" "c.3868A>G" "r.(?)" "p.(Thr1290Ala)" "" ""
"0000757282" "00007729" "50" "3871" "0" "3871" "0" "c.3871A>G" "r.(?)" "p.(Ser1291Gly)" "" ""
"0000757283" "00007729" "50" "3884" "0" "3884" "0" "c.3884T>C" "r.(?)" "p.(Ile1295Thr)" "" ""
"0000757284" "00007729" "50" "3898" "0" "3898" "0" "c.3898G>A" "r.(?)" "p.(Glu1300Lys)" "" ""
"0000757285" "00007729" "50" "3902" "0" "3902" "0" "c.3902A>T" "r.(?)" "p.(Asp1301Val)" "" ""
"0000757286" "00007729" "50" "3908" "0" "3908" "0" "c.3908A>G" "r.(?)" "p.(Gln1303Arg)" "" ""
"0000757287" "00007729" "50" "3920" "0" "3920" "0" "c.3920A>G" "r.(?)" "p.(Tyr1307Cys)" "" ""
"0000757288" "00007729" "50" "3931" "0" "3931" "0" "c.3931C>T" "r.(?)" "p.(Pro1311Ser)" "" ""
"0000757289" "00007729" "50" "3935" "0" "3935" "0" "c.3935T>C" "r.(?)" "p.(Leu1312Pro)" "" ""
"0000757290" "00007729" "50" "3941" "0" "3941" "0" "c.3941C>T" "r.(?)" "p.(Ala1314Val)" "" ""
"0000757291" "00007729" "50" "3992" "0" "3992" "0" "c.3992C>T" "r.(?)" "p.(Pro1331Leu)" "" ""
"0000757292" "00007729" "50" "3998" "0" "3998" "0" "c.3998A>C" "r.(?)" "p.(Gln1333Pro)" "" ""
"0000757293" "00007729" "50" "4004" "0" "4004" "0" "c.4004A>C" "r.(?)" "p.(Lys1335Thr)" "" ""
"0000757294" "00007729" "50" "4018" "0" "4018" "0" "c.4018C>T" "r.(?)" "p.(Pro1340Ser)" "" ""
"0000757295" "00007729" "50" "4037" "0" "4037" "0" "c.4037C>T" "r.(?)" "p.(Thr1346Ile)" "" ""
"0000757296" "00007729" "50" "4073" "0" "4073" "0" "c.4073T>C" "r.(?)" "p.(Leu1358Pro)" "" ""
"0000757297" "00007729" "50" "4076" "0" "4076" "0" "c.4076A>G" "r.(?)" "p.(Lys1359Arg)" "" ""
"0000757298" "00007729" "50" "4084" "0" "4084" "0" "c.4084G>A" "r.(?)" "p.(Asp1362Asn)" "" ""
"0000757299" "00007729" "50" "4098" "0" "4098" "0" "c.4098A>T" "r.(?)" "p.(Glu1366Asp)" "" ""
"0000757300" "00007729" "50" "4105" "0" "4105" "0" "c.4105A>G" "r.(?)" "p.(Asn1369Asp)" "" ""
"0000757301" "00007729" "50" "4126" "0" "4126" "0" "c.4126G>A" "r.(?)" "p.(Ala1376Thr)" "" ""
"0000757302" "00007729" "50" "4189" "0" "4189" "0" "c.4189A>G" "r.(?)" "p.(Met1397Val)" "" ""
"0000757303" "00007729" "50" "4193" "0" "4193" "0" "c.4193A>G" "r.(?)" "p.(Tyr1398Cys)" "" ""
"0000757304" "00007729" "50" "4194" "0" "4194" "0" "c.4194T>G" "r.(?)" "p.(Tyr1398*)" "" ""
"0000757305" "00007729" "50" "4270" "0" "4270" "0" "c.4270C>T" "r.(?)" "p.(Arg1424*)" "" ""
"0000757306" "00007729" "50" "4292" "0" "4292" "0" "c.4292A>G" "r.(?)" "p.(Lys1431Arg)" "" ""
"0000757307" "00007729" "50" "4336" "0" "4336" "0" "c.4336G>A" "r.(?)" "p.(Val1446Ile)" "" ""
"0000757308" "00007729" "50" "4352" "0" "4352" "0" "c.4352A>G" "r.(?)" "p.(His1451Arg)" "" ""
"0000757309" "00007729" "50" "4366" "0" "4366" "0" "c.4366C>T" "r.(?)" "p.(Arg1456Cys)" "" ""
"0000757310" "00007729" "50" "4367" "0" "4367" "0" "c.4367G>A" "r.(?)" "p.(Arg1456His)" "" ""
"0000757311" "00007729" "50" "4367" "0" "4367" "0" "c.4367G>T" "r.(?)" "p.(Arg1456Leu)" "" ""
"0000757312" "00007729" "50" "4378" "0" "4378" "0" "c.4378A>C" "r.(?)" "p.(Ile1460Leu)" "" ""
"0000757313" "00007729" "50" "4400" "0" "4400" "0" "c.4400C>T" "r.(?)" "p.(Ser1467Phe)" "" ""
"0000757314" "00007729" "50" "4403" "0" "4403" "0" "c.4403G>A" "r.(?)" "p.(Ser1468Asn)" "" ""
"0000757315" "00007729" "50" "4410" "0" "4410" "0" "c.4410G>C" "r.(?)" "p.(Glu1470Asp)" "" ""
"0000757316" "00007729" "50" "4429" "0" "4429" "0" "c.4429C>A" "r.(?)" "p.(Pro1477Thr)" "" ""
"0000757317" "00007729" "50" "4433" "0" "4433" "0" "c.4433G>A" "r.(?)" "p.(Cys1478Tyr)" "" ""
"0000757318" "00007729" "50" "4439" "0" "4439" "0" "c.4439A>G" "r.(?)" "p.(Gln1480Arg)" "" ""
"0000757319" "00007729" "50" "4465" "0" "4465" "0" "c.4465G>A" "r.(?)" "p.(Gly1489Arg)" "" ""
"0000757320" "00007729" "50" "4480" "0" "4480" "0" "c.4480G>T" "r.(?)" "p.(Gly1494Cys)" "" ""
"0000757321" "00007729" "50" "4543" "0" "4543" "0" "c.4543G>A" "r.(?)" "p.(Glu1515Lys)" "" ""
"0000757322" "00007729" "50" "4563" "0" "4563" "0" "c.4563A>C" "r.(?)" "p.(Glu1521Asp)" "" ""
"0000757323" "00007729" "50" "4565" "0" "4565" "0" "c.4565A>G" "r.(?)" "p.(Asp1522Gly)" "" ""
"0000757324" "00007729" "50" "4622" "0" "4622" "0" "c.4622C>T" "r.(?)" "p.(Ser1541Leu)" "" ""
"0000757325" "00007729" "50" "4627" "0" "4627" "0" "c.4627C>T" "r.(?)" "p.(Leu1543Phe)" "" ""
"0000757326" "00007729" "50" "4643" "0" "4643" "0" "c.4643A>G" "r.(?)" "p.(Asp1548Gly)" "" ""
"0000757327" "00007729" "50" "4666" "0" "4666" "0" "c.4666A>G" "r.(?)" "p.(Ile1556Val)" "" ""
"0000757328" "00007729" "50" "4708" "0" "4708" "0" "c.4708C>T" "r.(?)" "p.(Arg1570Cys)" "" ""
"0000757329" "00007729" "50" "4709" "0" "4709" "0" "c.4709G>A" "r.(?)" "p.(Arg1570His)" "" ""
"0000757330" "00007729" "50" "4727" "0" "4727" "0" "c.4727A>G" "r.(?)" "p.(Asn1576Ser)" "" ""
"0000757331" "00007729" "50" "4784" "0" "4784" "0" "c.4784C>A" "r.(?)" "p.(Pro1595His)" "" ""
"0000757332" "00007729" "50" "4798" "0" "4798" "0" "c.4798A>G" "r.(?)" "p.(Thr1600Ala)" "" ""
"0000757333" "00007729" "50" "4872" "0" "4872" "0" "c.4872T>G" "r.(?)" "p.(Cys1624Trp)" "" ""
"0000757334" "00007729" "50" "4913" "0" "4913" "0" "c.4913G>A" "r.(?)" "p.(Ser1638Asn)" "" ""
"0000757335" "00007729" "50" "4928" "0" "4928" "0" "c.4928C>T" "r.(?)" "p.(Thr1643Ile)" "" ""
"0000757336" "00007729" "50" "4933" "0" "4933" "0" "c.4933C>T" "r.(?)" "p.(Arg1645Cys)" "" ""
"0000757337" "00007729" "50" "4934" "0" "4934" "0" "c.4934G>A" "r.(?)" "p.(Arg1645His)" "" ""
"0000757338" "00007729" "50" "4939" "0" "4939" "0" "c.4939G>C" "r.(?)" "p.(Val1647Leu)" "" ""
"0000757339" "00007729" "50" "4951" "0" "4951" "0" "c.4951G>A" "r.(?)" "p.(Glu1651Lys)" "" ""
"0000757340" "00007729" "50" "5026" "0" "5026" "0" "c.5026G>A" "r.(?)" "p.(Glu1676Lys)" "" ""
"0000757341" "00007729" "50" "5045" "0" "5045" "0" "c.5045A>G" "r.(?)" "p.(Asp1682Gly)" "" ""
"0000757342" "00007729" "50" "5048" "0" "5048" "0" "c.5048A>G" "r.(?)" "p.(Lys1683Arg)" "" ""
"0000757343" "00007729" "50" "5066" "0" "5066" "0" "c.5066C>T" "r.(?)" "p.(Ala1689Val)" "" ""
"0000757344" "00007729" "50" "5068" "0" "5068" "0" "c.5068G>C" "r.(?)" "p.(Val1690Leu)" "" ""
"0000757345" "00007729" "50" "5078" "0" "5078" "0" "c.5078G>A" "r.(?)" "p.(Ser1693Asn)" "" ""
"0000757346" "00007729" "50" "5101" "0" "5101" "0" "c.5101C>T" "r.(?)" "p.(Gln1701*)" "" ""
"0000757347" "00007729" "50" "5107" "0" "5107" "0" "c.5107C>G" "r.(?)" "p.(His1703Asp)" "" ""
"0000757348" "00007729" "50" "5108" "0" "5108" "0" "c.5108A>G" "r.(?)" "p.(His1703Arg)" "" ""
"0000757349" "00007729" "50" "5117" "0" "5117" "0" "c.5117A>C" "r.(?)" "p.(Asn1706Thr)" "" ""
"0000757350" "00007729" "50" "5134" "0" "5134" "0" "c.5134T>A" "r.(?)" "p.(Ser1712Thr)" "" ""
"0000757351" "00007729" "50" "5141" "0" "5141" "0" "c.5141C>T" "r.(?)" "p.(Ala1714Val)" "" ""
"0000757352" "00007729" "50" "5177" "0" "5177" "0" "c.5177C>T" "r.(?)" "p.(Pro1726Leu)" "" ""
"0000757353" "00007729" "50" "5230" "0" "5230" "0" "c.5230G>A" "r.(?)" "p.(Glu1744Lys)" "" ""
"0000757354" "00007729" "50" "5249" "0" "5249" "0" "c.5249C>T" "r.(?)" "p.(Pro1750Leu)" "" ""
"0000757355" "00007729" "50" "5281" "0" "5281" "0" "c.5281C>G" "r.(?)" "p.(Pro1761Ala)" "" ""
"0000757356" "00007729" "50" "5282" "0" "5282" "0" "c.5282C>T" "r.(?)" "p.(Pro1761Leu)" "" ""
"0000757357" "00007729" "50" "5337" "0" "5337" "0" "c.5337G>T" "r.(?)" "p.(Gln1779His)" "" ""
"0000757358" "00007729" "50" "5340" "1" "5340" "1" "c.5340+1G>T" "r.spl?" "p.?" "" ""
"0000757359" "00007729" "50" "5387" "0" "5387" "0" "c.5387C>G" "r.(?)" "p.(Ser1796Cys)" "" ""
"0000757360" "00007729" "50" "5435" "0" "5435" "0" "c.5435C>T" "r.(?)" "p.(Pro1812Leu)" "" ""
"0000757361" "00007729" "50" "5440" "0" "5440" "0" "c.5440G>A" "r.(?)" "p.(Glu1814Lys)" "" ""
"0000757362" "00007729" "50" "5474" "0" "5474" "0" "c.5474A>G" "r.(?)" "p.(His1825Arg)" "" ""
"0000757363" "00007729" "50" "5496" "0" "5496" "0" "c.5496A>C" "r.(?)" "p.(Glu1832Asp)" "" ""
"0000757364" "00007729" "50" "5498" "0" "5498" "0" "c.5498T>G" "r.(?)" "p.(Val1833Gly)" "" ""
"0000757365" "00007729" "50" "5569" "0" "5569" "0" "c.5569G>A" "r.(?)" "p.(Val1857Met)" "" ""
"0000757366" "00007729" "50" "5579" "0" "5579" "0" "c.5579G>A" "r.(?)" "p.(Arg1860His)" "" ""
"0000757367" "00007729" "50" "5603" "0" "5603" "0" "c.5603A>G" "r.(?)" "p.(Gln1868Arg)" "" ""
"0000757368" "00007729" "50" "5656" "0" "5656" "0" "c.5656C>T" "r.(?)" "p.(His1886Tyr)" "" ""
"0000757369" "00007729" "50" "5683" "0" "5683" "0" "c.5683T>C" "r.(?)" "p.(Cys1895Arg)" "" ""
"0000757370" "00007729" "50" "5692" "0" "5692" "0" "c.5692G>A" "r.(?)" "p.(Val1898Met)" "" ""
"0000757371" "00007729" "50" "5729" "0" "5729" "0" "c.5729G>C" "r.(?)" "p.(Arg1910Thr)" "" ""
"0000757372" "00007729" "50" "5750" "0" "5750" "0" "c.5750G>A" "r.(?)" "p.(Ser1917Asn)" "" ""
"0000757373" "00007729" "50" "5770" "0" "5770" "0" "c.5770A>T" "r.(?)" "p.(Thr1924Ser)" "" ""
"0000757374" "00007729" "50" "5776" "0" "5776" "0" "c.5776A>G" "r.(?)" "p.(Ile1926Val)" "" ""
"0000757375" "00007729" "50" "5782" "0" "5782" "0" "c.5782G>A" "r.(?)" "p.(Ala1928Thr)" "" ""
"0000757376" "00007729" "50" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000757377" "00007729" "50" "5798" "0" "5798" "0" "c.5798T>C" "r.(?)" "p.(Leu1933Pro)" "" ""
"0000757378" "00007729" "50" "5819" "0" "5819" "0" "c.5819A>G" "r.(?)" "p.(Glu1940Gly)" "" ""
"0000757379" "00007729" "50" "5832" "0" "5832" "0" "c.5832G>T" "r.(?)" "p.(Leu1944Phe)" "" ""
"0000757380" "00007729" "50" "5866" "0" "5866" "0" "c.5866A>G" "r.(?)" "p.(Asn1956Asp)" "" ""
"0000757381" "00007729" "50" "5887" "0" "5887" "0" "c.5887A>G" "r.(?)" "p.(Thr1963Ala)" "" ""
"0000757382" "00007729" "50" "5951" "0" "5951" "0" "c.5951A>T" "r.(?)" "p.(Tyr1984Phe)" "" ""
"0000757383" "00007729" "50" "6028" "0" "6028" "0" "c.6028A>G" "r.(?)" "p.(Met2010Val)" "" ""
"0000757384" "00007729" "50" "6041" "0" "6041" "0" "c.6041T>C" "r.(?)" "p.(Val2014Ala)" "" ""
"0000757385" "00007729" "50" "6129" "0" "6129" "0" "c.6129A>T" "r.(?)" "p.(Arg2043Ser)" "" ""
"0000757386" "00007729" "50" "6139" "0" "6139" "0" "c.6139G>A" "r.(?)" "p.(Asp2047Asn)" "" ""
"0000757387" "00007729" "50" "6143" "0" "6143" "0" "c.6143T>C" "r.(?)" "p.(Ile2048Thr)" "" ""
"0000789647" "00007729" "90" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931Ter)" "22" ""
"0000806401" "00007729" "50" "1128" "0" "1128" "0" "c.1128A>T" "r.(?)" "p.(Gln376His)" "" ""
"0000806402" "00007729" "50" "1237" "0" "1237" "0" "c.1237T>C" "r.(?)" "p.(Tyr413His)" "" ""
"0000839998" "00007729" "90" "5791" "0" "5791" "0" "c.5791C>T" "r.(?)" "p.(Arg1931*)" "" ""
"0000853832" "00007729" "30" "2268" "0" "2268" "0" "c.2268C>A" "r.(?)" "p.(Arg756=)" "" ""
"0000853833" "00007729" "30" "2473" "0" "2473" "0" "c.2473A>C" "r.(?)" "p.(Ser825Arg)" "" ""
"0000863559" "00007729" "50" "874" "0" "874" "0" "c.874C>G" "r.(?)" "p.(Pro292Ala)" "" ""
"0000863560" "00007729" "30" "1041" "0" "1041" "0" "c.1041G>A" "r.(?)" "p.(Pro347=)" "" ""
"0000863561" "00007729" "10" "1397" "-3" "1397" "-2" "c.1397-3_1397-2del" "r.spl?" "p.?" "" ""
"0000863562" "00007729" "50" "5848" "0" "5848" "0" "c.5848T>G" "r.(?)" "p.(Leu1950Val)" "" ""
"0000891789" "00007729" "30" "93" "0" "93" "0" "c.93A>G" "r.(?)" "p.(Arg31=)" "" ""
"0000891790" "00007729" "10" "2445" "0" "2445" "0" "c.2445G>A" "r.(?)" "p.(Ser815=)" "" ""
"0000891791" "00007729" "30" "4260" "0" "4260" "0" "c.4260C>T" "r.(?)" "p.(Asp1420=)" "" ""
"0000891792" "00007729" "10" "5577" "0" "5577" "0" "c.5577T>C" "r.(?)" "p.(Asn1859=)" "" ""
"0000914192" "00007729" "30" "527" "0" "527" "0" "c.527C>T" "r.(?)" "p.(Thr176Ile)" "" ""
"0000967488" "00007729" "50" "4318" "-3" "4318" "-3" "c.4318-3T>G" "r.spl?" "p.?" "" ""
"0000967489" "00007729" "50" "5683" "0" "5683" "0" "c.5683T>C" "r.(?)" "p.(Cys1895Arg)" "" ""
"0000980909" "00007729" "50" "269" "0" "269" "0" "c.269C>T" "r.(?)" "p.(Pro90Leu)" "" ""
"0000980910" "00007729" "50" "1756" "0" "1756" "0" "c.1756G>C" "r.(?)" "p.(Val586Leu)" "" ""
"0000980911" "00007729" "50" "4440" "0" "4440" "0" "c.4440A>G" "r.(?)" "p.(=)" "" ""
"0001001007" "00007729" "50" "163" "0" "163" "0" "c.163G>A" "r.(?)" "p.(Asp55Asn)" "" ""
"0001001008" "00007729" "70" "2604" "0" "2604" "0" "c.2604del" "r.(?)" "p.(Glu869Lysfs*7)" "" ""
"0001001009" "00007729" "50" "5141" "0" "5141" "0" "c.5141C>T" "r.(?)" "p.(Ala1714Val)" "" ""
"0001026387" "00007729" "50" "1214" "0" "1214" "0" "c.1214G>A" "r.(?)" "p.(Arg405Gln)" "" ""
"0001026388" "00007729" "50" "3670" "0" "3670" "0" "c.3670T>C" "r.(?)" "p.(Ser1224Pro)" "" ""
"0001026389" "00007729" "70" "3979" "0" "3980" "0" "c.3979_3980del" "r.(?)" "p.(Gln1327Valfs*16)" "" ""
"0001026390" "00007729" "30" "4366" "0" "4366" "0" "c.4366C>T" "r.(?)" "p.(Arg1456Cys)" "" ""
"0001026391" "00007729" "10" "5340" "23" "5340" "23" "c.5340+23A>T" "r.(=)" "p.(=)" "" ""
"0001039965" "00007729" "30" "1183" "30" "1183" "30" "c.1183+30A>G" "r.(=)" "p.(=)" "" ""
"0001039966" "00007729" "30" "1396" "10" "1396" "10" "c.1396+10A>G" "r.(=)" "p.(=)" "" ""
"0001039967" "00007729" "50" "4025" "0" "4026" "0" "c.4025_4026del" "r.(?)" "p.(Ser1342*)" "" ""
"0001046471" "00007729" "10" "2190" "0" "2190" "0" "c.2190A>G" "r.(?)" "p.(Gln730=)" "" ""
"0001046472" "00007729" "30" "5107" "0" "5107" "0" "c.5107C>G" "r.(?)" "p.(His1703Asp)" "" ""
"0001046473" "00007729" "50" "5473" "0" "5473" "0" "c.5473C>A" "r.(?)" "p.(His1825Asn)" "" ""
"0001054824" "00007729" "90" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658*)" "" ""
"0001054825" "00007729" "50" "2525" "0" "2528" "0" "c.2525_2528del" "r.(?)" "p.(Gln842Leufs*11)" "" ""
"0001060857" "00007729" "90" "1972" "0" "1972" "0" "c.1972C>T" "r.(?)" "p.(Arg658Ter)" "" ""
"0001066063" "00007729" "50" "298" "0" "298" "0" "c.298C>G" "r.(?)" "p.(Arg100Gly)" "" ""
"0001066064" "00007729" "90" "2586" "0" "2589" "0" "c.2586_2589del" "r.(?)" "p.(Lys863Ilefs*12)" "" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 1539
"{{screeningid}}" "{{variantid}}"
"0000001418" "0000019155"
"0000020024" "0000040554"
"0000020024" "0000040558"
"0000020025" "0000040555"
"0000020025" "0000040559"
"0000020026" "0000040556"
"0000020026" "0000040560"
"0000020027" "0000040557"
"0000156092" "0000357974"
"0000180325" "0000403788"
"0000247629" "0000500475"
"0000247630" "0000500476"
"0000249297" "0000578048"
"0000249312" "0000578064"
"0000249341" "0000578100"
"0000249357" "0000578120"
"0000249377" "0000578143"
"0000261977" "0000592106"
"0000261978" "0000592107"
"0000261979" "0000592108"
"0000261980" "0000592109"
"0000261981" "0000592110"
"0000261982" "0000592111"
"0000261983" "0000592112"
"0000261984" "0000592115"
"0000261984" "0000592116"
"0000261985" "0000592118"
"0000261986" "0000592119"
"0000261988" "0000592122"
"0000261990" "0000592124"
"0000290449" "0000647115"
"0000292202" "0000648891"
"0000292203" "0000648892"
"0000292204" "0000648893"
"0000292205" "0000648894"
"0000292206" "0000648895"
"0000292207" "0000648896"
"0000292208" "0000648897"
"0000292209" "0000648898"
"0000292210" "0000648899"
"0000292211" "0000648900"
"0000292212" "0000648901"
"0000305555" "0000669243"
"0000305556" "0000669244"
"0000305557" "0000669245"
"0000337404" "0000737035"
"0000337405" "0000737036"
"0000337406" "0000737037"
"0000337407" "0000737038"
"0000337408" "0000737039"
"0000337409" "0000737040"
"0000337410" "0000737041"
"0000337411" "0000737042"
"0000337412" "0000737043"
"0000337413" "0000737044"
"0000337414" "0000737045"
"0000337415" "0000737046"
"0000337416" "0000737047"
"0000337536" "0000737167"
"0000337537" "0000737168"
"0000337539" "0000737170"
"0000337540" "0000737171"
"0000337541" "0000737172"
"0000337542" "0000737173"
"0000337543" "0000737174"
"0000339943" "0000739574"
"0000339944" "0000739575"
"0000339945" "0000739576"
"0000339946" "0000739577"
"0000339947" "0000739578"
"0000339948" "0000739579"
"0000339949" "0000739580"
"0000339950" "0000739581"
"0000339951" "0000739582"
"0000339952" "0000739583"
"0000339953" "0000739584"
"0000339954" "0000739585"
"0000339955" "0000739586"
"0000339956" "0000739587"
"0000339957" "0000739588"
"0000339958" "0000739589"
"0000339959" "0000739590"
"0000339960" "0000739591"
"0000339961" "0000739592"
"0000339962" "0000739593"
"0000339963" "0000739594"
"0000339964" "0000739595"
"0000339965" "0000739596"
"0000339966" "0000739597"
"0000339967" "0000739598"
"0000339968" "0000739599"
"0000339969" "0000739600"
"0000339970" "0000739601"
"0000339971" "0000739602"
"0000339972" "0000739603"
"0000339973" "0000739604"
"0000339974" "0000739605"
"0000339975" "0000739606"
"0000339976" "0000739607"
"0000339977" "0000739608"
"0000339978" "0000739609"
"0000339979" "0000739610"
"0000339980" "0000739611"
"0000339981" "0000739612"
"0000339982" "0000739613"
"0000339983" "0000739614"
"0000339984" "0000739615"
"0000339985" "0000739616"
"0000339986" "0000739617"
"0000339987" "0000739618"
"0000339988" "0000739619"
"0000339989" "0000739620"
"0000339990" "0000739621"
"0000339991" "0000739622"
"0000339992" "0000739623"
"0000339993" "0000739624"
"0000339994" "0000739625"
"0000339995" "0000739626"
"0000339996" "0000739627"
"0000339997" "0000739628"
"0000339998" "0000739629"
"0000339999" "0000739630"
"0000340000" "0000739631"
"0000340001" "0000739632"
"0000340002" "0000739633"
"0000340003" "0000739634"
"0000340004" "0000739635"
"0000340005" "0000739636"
"0000340006" "0000739637"
"0000340007" "0000739638"
"0000340008" "0000739639"
"0000340009" "0000739640"
"0000340010" "0000739641"
"0000340011" "0000739642"
"0000340012" "0000739643"
"0000340013" "0000739644"
"0000340014" "0000739645"
"0000340015" "0000739646"
"0000340016" "0000739647"
"0000340017" "0000739648"
"0000340018" "0000739649"
"0000340019" "0000739650"
"0000340020" "0000739651"
"0000340021" "0000739652"
"0000340022" "0000739653"
"0000340023" "0000739654"
"0000340024" "0000739655"
"0000340025" "0000739656"
"0000340026" "0000739657"
"0000340027" "0000739658"
"0000340028" "0000739659"
"0000340029" "0000739660"
"0000340030" "0000739661"
"0000340031" "0000739662"
"0000340032" "0000739663"
"0000340033" "0000739664"
"0000340034" "0000739665"
"0000340035" "0000739666"
"0000340036" "0000739667"
"0000340037" "0000739668"
"0000340038" "0000739669"
"0000340039" "0000739670"
"0000340040" "0000739671"
"0000340041" "0000739672"
"0000340042" "0000739673"
"0000340043" "0000739674"
"0000340044" "0000739675"
"0000340045" "0000739676"
"0000340046" "0000739677"
"0000340047" "0000739678"
"0000340048" "0000739679"
"0000340049" "0000739680"
"0000340050" "0000739681"
"0000340051" "0000739682"
"0000340052" "0000739683"
"0000340053" "0000739684"
"0000340054" "0000739685"
"0000340055" "0000739686"
"0000340056" "0000739687"
"0000340057" "0000739688"
"0000340058" "0000739689"
"0000340059" "0000739690"
"0000340060" "0000739691"
"0000340061" "0000739692"
"0000340062" "0000739693"
"0000340063" "0000739694"
"0000340064" "0000739695"
"0000340065" "0000739696"
"0000340066" "0000739697"
"0000340067" "0000739698"
"0000340068" "0000739699"
"0000340069" "0000739700"
"0000340070" "0000739701"
"0000340071" "0000739702"
"0000340072" "0000739703"
"0000340073" "0000739704"
"0000340074" "0000739705"
"0000340075" "0000739706"
"0000340076" "0000739707"
"0000340077" "0000739708"
"0000340078" "0000739709"
"0000340079" "0000739710"
"0000340080" "0000739711"
"0000340081" "0000739712"
"0000340082" "0000739713"
"0000340083" "0000739714"
"0000340084" "0000739715"
"0000340085" "0000739716"
"0000340086" "0000739717"
"0000340087" "0000739718"
"0000340088" "0000739719"
"0000340089" "0000739720"
"0000340090" "0000739721"
"0000340091" "0000739722"
"0000340092" "0000739723"
"0000340093" "0000739724"
"0000340094" "0000739725"
"0000340095" "0000739726"
"0000340096" "0000739727"
"0000340097" "0000739728"
"0000340098" "0000739729"
"0000340099" "0000739730"
"0000340100" "0000739731"
"0000340101" "0000739732"
"0000340102" "0000739733"
"0000340103" "0000739734"
"0000340104" "0000739735"
"0000340105" "0000739736"
"0000340106" "0000739737"
"0000340107" "0000739738"
"0000340108" "0000739739"
"0000340109" "0000739740"
"0000340110" "0000739741"
"0000340111" "0000739742"
"0000340112" "0000739743"
"0000340113" "0000739744"
"0000340114" "0000739745"
"0000340115" "0000739746"
"0000340116" "0000739747"
"0000340117" "0000739748"
"0000340118" "0000739749"
"0000340119" "0000739750"
"0000340120" "0000739751"
"0000340121" "0000739752"
"0000340122" "0000739753"
"0000340123" "0000739754"
"0000340124" "0000739755"
"0000340125" "0000739756"
"0000340126" "0000739757"
"0000340127" "0000739758"
"0000340128" "0000739759"
"0000340129" "0000739760"
"0000340130" "0000739761"
"0000340131" "0000739762"
"0000340132" "0000739763"
"0000340133" "0000739764"
"0000340134" "0000739765"
"0000340135" "0000739766"
"0000340136" "0000739767"
"0000340137" "0000739768"
"0000340138" "0000739769"
"0000340139" "0000739770"
"0000340140" "0000739771"
"0000340141" "0000739772"
"0000340142" "0000739773"
"0000340143" "0000739774"
"0000340144" "0000739775"
"0000340145" "0000739776"
"0000340146" "0000739777"
"0000340147" "0000739778"
"0000340148" "0000739779"
"0000340149" "0000739780"
"0000340150" "0000739781"
"0000340151" "0000739782"
"0000340152" "0000739783"
"0000340153" "0000739784"
"0000340154" "0000739785"
"0000340155" "0000739786"
"0000340156" "0000739787"
"0000340157" "0000739788"
"0000340158" "0000739789"
"0000340159" "0000739790"
"0000340160" "0000739791"
"0000340161" "0000739792"
"0000340162" "0000739793"
"0000340163" "0000739794"
"0000340164" "0000739795"
"0000340165" "0000739796"
"0000340166" "0000739797"
"0000340167" "0000739798"
"0000340168" "0000739799"
"0000340169" "0000739800"
"0000340170" "0000739801"
"0000340171" "0000739802"
"0000340172" "0000739803"
"0000340173" "0000739804"
"0000340174" "0000739805"
"0000340175" "0000739806"
"0000340176" "0000739807"
"0000340177" "0000739808"
"0000340178" "0000739809"
"0000340179" "0000739810"
"0000340180" "0000739811"
"0000340181" "0000739812"
"0000340182" "0000739813"
"0000340183" "0000739814"
"0000340184" "0000739815"
"0000340185" "0000739816"
"0000340186" "0000739817"
"0000340187" "0000739818"
"0000340188" "0000739819"
"0000340189" "0000739820"
"0000340190" "0000739821"
"0000340191" "0000739822"
"0000340192" "0000739823"
"0000340193" "0000739824"
"0000340194" "0000739825"
"0000340195" "0000739826"
"0000340196" "0000739827"
"0000340197" "0000739828"
"0000340198" "0000739829"
"0000340199" "0000739830"
"0000340200" "0000739831"
"0000340201" "0000739832"
"0000340202" "0000739833"
"0000340203" "0000739834"
"0000340204" "0000739835"
"0000340205" "0000739836"
"0000340206" "0000739837"
"0000340207" "0000739838"
"0000340208" "0000739839"
"0000340209" "0000739840"
"0000340210" "0000739841"
"0000340211" "0000739842"
"0000340212" "0000739843"
"0000340213" "0000739844"
"0000340214" "0000739845"
"0000340215" "0000739846"
"0000340216" "0000739847"
"0000340217" "0000739848"
"0000340218" "0000739849"
"0000340219" "0000739850"
"0000340220" "0000739851"
"0000340221" "0000739852"
"0000340222" "0000739853"
"0000340223" "0000739854"
"0000340224" "0000739855"
"0000340225" "0000739856"
"0000340226" "0000739857"
"0000340227" "0000739858"
"0000340228" "0000739859"
"0000340229" "0000739860"
"0000340230" "0000739861"
"0000340231" "0000739862"
"0000340232" "0000739863"
"0000340233" "0000739864"
"0000340234" "0000739865"
"0000340235" "0000739866"
"0000340236" "0000739867"
"0000340237" "0000739868"
"0000340238" "0000739869"
"0000340239" "0000739870"
"0000340240" "0000739871"
"0000340241" "0000739872"
"0000340242" "0000739873"
"0000340243" "0000739874"
"0000340244" "0000739875"
"0000340245" "0000739876"
"0000340246" "0000739877"
"0000340247" "0000739878"
"0000340248" "0000739879"
"0000340249" "0000739880"
"0000340250" "0000739881"
"0000340251" "0000739882"
"0000340252" "0000739883"
"0000340253" "0000739884"
"0000340254" "0000739885"
"0000340255" "0000739886"
"0000340256" "0000739887"
"0000340257" "0000739888"
"0000340258" "0000739889"
"0000340259" "0000739890"
"0000340260" "0000739891"
"0000340261" "0000739892"
"0000340262" "0000739893"
"0000340263" "0000739894"
"0000340264" "0000739895"
"0000340265" "0000739896"
"0000340266" "0000739897"
"0000340267" "0000739898"
"0000340268" "0000739899"
"0000340269" "0000739900"
"0000340270" "0000739901"
"0000340271" "0000739902"
"0000340272" "0000739903"
"0000340273" "0000739904"
"0000340274" "0000739905"
"0000340275" "0000739906"
"0000340276" "0000739907"
"0000340277" "0000739908"
"0000340278" "0000739909"
"0000340279" "0000739910"
"0000340280" "0000739911"
"0000340281" "0000739912"
"0000340282" "0000739913"
"0000340283" "0000739914"
"0000340284" "0000739915"
"0000340285" "0000739916"
"0000340286" "0000739917"
"0000340287" "0000739918"
"0000340288" "0000739919"
"0000340289" "0000739920"
"0000340290" "0000739921"
"0000340291" "0000739922"
"0000340292" "0000739923"
"0000340293" "0000739924"
"0000340294" "0000739925"
"0000340295" "0000739926"
"0000340296" "0000739927"
"0000340297" "0000739928"
"0000340298" "0000739929"
"0000340299" "0000739930"
"0000340300" "0000739931"
"0000340301" "0000739932"
"0000340302" "0000739933"
"0000340303" "0000739934"
"0000340304" "0000739935"
"0000340305" "0000739936"
"0000340306" "0000739937"
"0000340307" "0000739938"
"0000340308" "0000739939"
"0000340309" "0000739940"
"0000340310" "0000739941"
"0000340311" "0000739942"
"0000340312" "0000739943"
"0000340313" "0000739944"
"0000340314" "0000739945"
"0000340315" "0000739946"
"0000340316" "0000739947"
"0000340317" "0000739948"
"0000340318" "0000739949"
"0000340319" "0000739950"
"0000340320" "0000739951"
"0000340321" "0000739952"
"0000340322" "0000739953"
"0000340323" "0000739954"
"0000340324" "0000739955"
"0000340325" "0000739956"
"0000340326" "0000739957"
"0000340327" "0000739958"
"0000340328" "0000739959"
"0000340329" "0000739960"
"0000340330" "0000739961"
"0000340331" "0000739962"
"0000340332" "0000739963"
"0000340333" "0000739964"
"0000340334" "0000739965"
"0000340335" "0000739966"
"0000340336" "0000739967"
"0000340337" "0000739968"
"0000340338" "0000739969"
"0000340339" "0000739970"
"0000340340" "0000739971"
"0000340341" "0000739972"
"0000340342" "0000739973"
"0000340343" "0000739974"
"0000340344" "0000739975"
"0000340345" "0000739976"
"0000340346" "0000739977"
"0000340347" "0000739978"
"0000340348" "0000739979"
"0000340349" "0000739980"
"0000340350" "0000739981"
"0000340351" "0000739982"
"0000340352" "0000739983"
"0000340353" "0000739984"
"0000340354" "0000739985"
"0000343492" "0000743123"
"0000343493" "0000743124"
"0000343494" "0000743125"
"0000343495" "0000743126"
"0000343496" "0000743127"
"0000343497" "0000743128"
"0000343498" "0000743129"
"0000343499" "0000743130"
"0000343500" "0000743131"
"0000343501" "0000743132"
"0000343502" "0000743133"
"0000343503" "0000743134"
"0000343504" "0000743135"
"0000343505" "0000743136"
"0000343506" "0000743137"
"0000343507" "0000743138"
"0000343508" "0000743139"
"0000343509" "0000743140"
"0000343510" "0000743141"
"0000343511" "0000743142"
"0000343512" "0000743143"
"0000343759" "0000743390"
"0000343760" "0000743391"
"0000343761" "0000743392"
"0000343763" "0000743394"
"0000343764" "0000743395"
"0000343765" "0000743396"
"0000343766" "0000743397"
"0000343767" "0000743398"
"0000343768" "0000743399"
"0000343769" "0000743400"
"0000343770" "0000743401"
"0000343771" "0000743402"
"0000343772" "0000743403"
"0000343773" "0000743404"
"0000343774" "0000743405"
"0000346870" "0000746501"
"0000346872" "0000746503"
"0000346873" "0000746504"
"0000346874" "0000746505"
"0000346875" "0000746506"
"0000346876" "0000746507"
"0000346877" "0000746508"
"0000346878" "0000746509"
"0000346879" "0000746510"
"0000346880" "0000746511"
"0000346881" "0000746512"
"0000346882" "0000746513"
"0000346883" "0000746514"
"0000346884" "0000746515"
"0000346885" "0000746516"
"0000346886" "0000746517"
"0000346887" "0000746518"
"0000346888" "0000746519"
"0000346889" "0000746520"
"0000346890" "0000746521"
"0000346891" "0000746522"
"0000346892" "0000746523"
"0000346893" "0000746524"
"0000346894" "0000746525"
"0000346895" "0000746526"
"0000346896" "0000746527"
"0000346897" "0000746528"
"0000346898" "0000746529"
"0000346899" "0000746530"
"0000346900" "0000746531"
"0000346901" "0000746532"
"0000346902" "0000746533"
"0000346903" "0000746534"
"0000346904" "0000746535"
"0000346905" "0000746536"
"0000346906" "0000746537"
"0000346907" "0000746538"
"0000346908" "0000746539"
"0000346909" "0000746540"
"0000346910" "0000746541"
"0000346911" "0000746542"
"0000346912" "0000746543"
"0000346913" "0000746544"
"0000346914" "0000746545"
"0000346915" "0000746546"
"0000346916" "0000746547"
"0000346917" "0000746548"
"0000346918" "0000746549"
"0000346919" "0000746550"
"0000346920" "0000746551"
"0000346921" "0000746552"
"0000346922" "0000746553"
"0000346923" "0000746554"
"0000346924" "0000746555"
"0000346925" "0000746556"
"0000346926" "0000746557"
"0000346927" "0000746558"
"0000346928" "0000746559"
"0000346929" "0000746560"
"0000346930" "0000746561"
"0000346931" "0000746562"
"0000346932" "0000746563"
"0000346933" "0000746564"
"0000346934" "0000746565"
"0000346935" "0000746566"
"0000346936" "0000746567"
"0000346937" "0000746568"
"0000346938" "0000746569"
"0000346939" "0000746570"
"0000346940" "0000746571"
"0000346941" "0000746572"
"0000346942" "0000746573"
"0000346943" "0000746574"
"0000346944" "0000746575"
"0000346945" "0000746576"
"0000346946" "0000746577"
"0000346947" "0000746578"
"0000346948" "0000746579"
"0000346949" "0000746580"
"0000346950" "0000746581"
"0000346951" "0000746582"
"0000346952" "0000746583"
"0000346953" "0000746584"
"0000346954" "0000746585"
"0000346955" "0000746586"
"0000346956" "0000746587"
"0000346957" "0000746588"
"0000346958" "0000746589"
"0000346959" "0000746590"
"0000346960" "0000746591"
"0000346961" "0000746592"
"0000346962" "0000746593"
"0000346963" "0000746594"
"0000346964" "0000746595"
"0000346965" "0000746596"
"0000346966" "0000746597"
"0000346967" "0000746598"
"0000346968" "0000746599"
"0000346969" "0000746600"
"0000346970" "0000746601"
"0000346971" "0000746602"
"0000346972" "0000746603"
"0000346973" "0000746604"
"0000346974" "0000746605"
"0000346975" "0000746606"
"0000346976" "0000746607"
"0000346977" "0000746608"
"0000346978" "0000746609"
"0000346979" "0000746610"
"0000346980" "0000746611"
"0000346981" "0000746612"
"0000346982" "0000746613"
"0000346983" "0000746614"
"0000346984" "0000746615"
"0000346985" "0000746616"
"0000346986" "0000746617"
"0000346987" "0000746618"
"0000346988" "0000746619"
"0000346989" "0000746620"
"0000346990" "0000746621"
"0000346991" "0000746622"
"0000346992" "0000746623"
"0000346993" "0000746624"
"0000346994" "0000746625"
"0000346995" "0000746626"
"0000346996" "0000746627"
"0000346997" "0000746628"
"0000346998" "0000746629"
"0000346999" "0000746630"
"0000347000" "0000746631"
"0000347001" "0000746632"
"0000347002" "0000746633"
"0000347003" "0000746634"
"0000347004" "0000746635"
"0000347005" "0000746636"
"0000347006" "0000746637"
"0000347007" "0000746638"
"0000347008" "0000746639"
"0000347009" "0000746640"
"0000347010" "0000746641"
"0000347011" "0000746642"
"0000347012" "0000746643"
"0000347013" "0000746644"
"0000347014" "0000746645"
"0000347015" "0000746646"
"0000347016" "0000746647"
"0000347017" "0000746648"
"0000347018" "0000746649"
"0000347019" "0000746650"
"0000347020" "0000746651"
"0000347021" "0000746652"
"0000347022" "0000746653"
"0000347023" "0000746654"
"0000347024" "0000746655"
"0000347025" "0000746656"
"0000347026" "0000746657"
"0000347027" "0000746658"
"0000347028" "0000746659"
"0000347029" "0000746660"
"0000347030" "0000746661"
"0000347031" "0000746662"
"0000347032" "0000746663"
"0000347033" "0000746664"
"0000347034" "0000746665"
"0000347035" "0000746666"
"0000347036" "0000746667"
"0000347037" "0000746668"
"0000347038" "0000746669"
"0000347039" "0000746670"
"0000347040" "0000746671"
"0000347041" "0000746672"
"0000347042" "0000746673"
"0000347043" "0000746674"
"0000347044" "0000746675"
"0000347045" "0000746676"
"0000347046" "0000746677"
"0000347047" "0000746678"
"0000347048" "0000746679"
"0000347049" "0000746680"
"0000347050" "0000746681"
"0000347051" "0000746682"
"0000347052" "0000746683"
"0000347053" "0000746684"
"0000347054" "0000746685"
"0000347055" "0000746686"
"0000347056" "0000746687"
"0000347057" "0000746688"
"0000347058" "0000746689"
"0000347059" "0000746690"
"0000347060" "0000746691"
"0000347061" "0000746692"
"0000347062" "0000746693"
"0000347063" "0000746694"
"0000347064" "0000746695"
"0000347065" "0000746696"
"0000347066" "0000746697"
"0000347067" "0000746698"
"0000347068" "0000746699"
"0000347069" "0000746700"
"0000347070" "0000746701"
"0000347071" "0000746702"
"0000347072" "0000746703"
"0000347073" "0000746704"
"0000347074" "0000746705"
"0000347075" "0000746706"
"0000347076" "0000746707"
"0000347077" "0000746708"
"0000347078" "0000746709"
"0000347079" "0000746710"
"0000347080" "0000746711"
"0000347081" "0000746712"
"0000347082" "0000746713"
"0000347083" "0000746714"
"0000347084" "0000746715"
"0000347085" "0000746716"
"0000347086" "0000746717"
"0000347087" "0000746718"
"0000347088" "0000746719"
"0000347089" "0000746720"
"0000347090" "0000746721"
"0000347091" "0000746722"
"0000347092" "0000746723"
"0000347093" "0000746724"
"0000347094" "0000746725"
"0000347095" "0000746726"
"0000347096" "0000746727"
"0000347097" "0000746728"
"0000347098" "0000746729"
"0000347099" "0000746730"
"0000347100" "0000746731"
"0000347101" "0000746732"
"0000347102" "0000746733"
"0000347103" "0000746734"
"0000347104" "0000746735"
"0000347105" "0000746736"
"0000347106" "0000746737"
"0000347107" "0000746738"
"0000347108" "0000746739"
"0000347109" "0000746740"
"0000347110" "0000746741"
"0000347111" "0000746742"
"0000347112" "0000746743"
"0000347113" "0000746744"
"0000347114" "0000746745"
"0000347115" "0000746746"
"0000347116" "0000746747"
"0000347117" "0000746748"
"0000347118" "0000746749"
"0000347119" "0000746750"
"0000347120" "0000746751"
"0000347121" "0000746752"
"0000347122" "0000746753"
"0000347123" "0000746754"
"0000347124" "0000746755"
"0000347125" "0000746756"
"0000347126" "0000746757"
"0000347127" "0000746758"
"0000347128" "0000746759"
"0000347129" "0000746760"
"0000347130" "0000746761"
"0000347131" "0000746762"
"0000347132" "0000746763"
"0000347133" "0000746764"
"0000347134" "0000746765"
"0000347135" "0000746766"
"0000347136" "0000746767"
"0000347137" "0000746768"
"0000347138" "0000746769"
"0000347139" "0000746770"
"0000347140" "0000746771"
"0000347141" "0000746772"
"0000347142" "0000746773"
"0000347143" "0000746774"
"0000347144" "0000746775"
"0000347145" "0000746776"
"0000347146" "0000746777"
"0000347147" "0000746778"
"0000347148" "0000746779"
"0000347149" "0000746780"
"0000347150" "0000746781"
"0000347151" "0000746782"
"0000347152" "0000746783"
"0000347153" "0000746784"
"0000347154" "0000746785"
"0000347155" "0000746786"
"0000347156" "0000746787"
"0000347157" "0000746788"
"0000347158" "0000746789"
"0000347159" "0000746790"
"0000347160" "0000746791"
"0000347161" "0000746792"
"0000347162" "0000746793"
"0000347163" "0000746794"
"0000347164" "0000746795"
"0000347165" "0000746796"
"0000347166" "0000746797"
"0000347167" "0000746798"
"0000347168" "0000746799"
"0000347169" "0000746800"
"0000347170" "0000746801"
"0000347171" "0000746802"
"0000347172" "0000746803"
"0000347173" "0000746804"
"0000347174" "0000746805"
"0000347175" "0000746806"
"0000347176" "0000746807"
"0000347177" "0000746808"
"0000347178" "0000746809"
"0000347179" "0000746810"
"0000347180" "0000746811"
"0000347181" "0000746812"
"0000347182" "0000746813"
"0000347183" "0000746814"
"0000347184" "0000746815"
"0000347185" "0000746816"
"0000347186" "0000746817"
"0000347187" "0000746818"
"0000347188" "0000746819"
"0000347189" "0000746820"
"0000347190" "0000746821"
"0000347191" "0000746822"
"0000347192" "0000746823"
"0000347193" "0000746824"
"0000347194" "0000746825"
"0000347195" "0000746826"
"0000347196" "0000746827"
"0000347197" "0000746828"
"0000347198" "0000746829"
"0000347199" "0000746830"
"0000347200" "0000746831"
"0000347201" "0000746832"
"0000347202" "0000746833"
"0000347203" "0000746834"
"0000347204" "0000746835"
"0000347205" "0000746836"
"0000347206" "0000746837"
"0000347207" "0000746838"
"0000347208" "0000746839"
"0000347209" "0000746840"
"0000347210" "0000746841"
"0000347211" "0000746842"
"0000347212" "0000746843"
"0000347213" "0000746844"
"0000347214" "0000746845"
"0000347215" "0000746846"
"0000347216" "0000746847"
"0000347217" "0000746848"
"0000347218" "0000746849"
"0000347219" "0000746850"
"0000347220" "0000746851"
"0000347221" "0000746852"
"0000347222" "0000746853"
"0000347223" "0000746854"
"0000347224" "0000746855"
"0000347225" "0000746856"
"0000347226" "0000746857"
"0000347227" "0000746858"
"0000347228" "0000746859"
"0000347229" "0000746860"
"0000347230" "0000746861"
"0000347231" "0000746862"
"0000347232" "0000746863"
"0000347233" "0000746864"
"0000347234" "0000746865"
"0000347235" "0000746866"
"0000347236" "0000746867"
"0000347237" "0000746868"
"0000347238" "0000746869"
"0000347239" "0000746870"
"0000347240" "0000746871"
"0000347241" "0000746872"
"0000347242" "0000746873"
"0000347243" "0000746874"
"0000347244" "0000746875"
"0000347245" "0000746876"
"0000347246" "0000746877"
"0000347247" "0000746878"
"0000347248" "0000746879"
"0000347249" "0000746880"
"0000347250" "0000746881"
"0000347251" "0000746882"
"0000347252" "0000746883"
"0000347253" "0000746884"
"0000347254" "0000746885"
"0000347255" "0000746886"
"0000347256" "0000746887"
"0000347257" "0000746888"
"0000347258" "0000746889"
"0000347259" "0000746890"
"0000347260" "0000746891"
"0000347261" "0000746892"
"0000347262" "0000746893"
"0000347263" "0000746894"
"0000347264" "0000746895"
"0000347265" "0000746896"
"0000347266" "0000746897"
"0000347267" "0000746898"
"0000347268" "0000746899"
"0000347269" "0000746900"
"0000347270" "0000746901"
"0000347271" "0000746902"
"0000347272" "0000746903"
"0000347273" "0000746904"
"0000347274" "0000746905"
"0000347275" "0000746906"
"0000347276" "0000746907"
"0000347277" "0000746908"
"0000347278" "0000746909"
"0000347279" "0000746910"
"0000347280" "0000746911"
"0000347281" "0000746912"
"0000347282" "0000746913"
"0000347283" "0000746914"
"0000347284" "0000746915"
"0000347285" "0000746916"
"0000347286" "0000746917"
"0000347287" "0000746918"
"0000347288" "0000746919"
"0000347289" "0000746920"
"0000347290" "0000746921"
"0000347291" "0000746922"
"0000347292" "0000746923"
"0000347293" "0000746924"
"0000347294" "0000746925"
"0000347295" "0000746926"
"0000347296" "0000746927"
"0000347297" "0000746928"
"0000350535" "0000750168"
"0000350536" "0000750169"
"0000350537" "0000750170"
"0000350538" "0000750171"
"0000350539" "0000750172"
"0000350540" "0000750173"
"0000350541" "0000750174"
"0000350542" "0000750175"
"0000350626" "0000750259"
"0000352692" "0000752325"
"0000352693" "0000752326"
"0000352694" "0000752327"
"0000352695" "0000752328"
"0000352696" "0000752329"
"0000352697" "0000752330"
"0000352698" "0000752331"
"0000352699" "0000752332"
"0000352700" "0000752333"
"0000352701" "0000752334"
"0000352702" "0000752335"
"0000352703" "0000752336"
"0000352704" "0000752337"
"0000352705" "0000752338"
"0000352706" "0000752339"
"0000352707" "0000752340"
"0000352708" "0000752341"
"0000352709" "0000752342"
"0000352710" "0000752343"
"0000352711" "0000752344"
"0000352712" "0000752345"
"0000352713" "0000752346"
"0000352714" "0000752347"
"0000352715" "0000752348"
"0000352716" "0000752349"
"0000352717" "0000752350"
"0000352718" "0000752351"
"0000352719" "0000752352"
"0000352720" "0000752353"
"0000352721" "0000752354"
"0000352722" "0000752355"
"0000352723" "0000752356"
"0000352724" "0000752357"
"0000352725" "0000752358"
"0000352726" "0000752359"
"0000352727" "0000752360"
"0000352728" "0000752361"
"0000352729" "0000752362"
"0000352730" "0000752363"
"0000352731" "0000752364"
"0000352732" "0000752365"
"0000352733" "0000752366"
"0000352734" "0000752367"
"0000352735" "0000752368"
"0000352736" "0000752369"
"0000352737" "0000752370"
"0000352738" "0000752371"
"0000352739" "0000752372"
"0000352740" "0000752373"
"0000352741" "0000752374"
"0000352742" "0000752375"
"0000352743" "0000752376"
"0000352744" "0000752377"
"0000352745" "0000752378"
"0000352746" "0000752379"
"0000352747" "0000752380"
"0000352748" "0000752381"
"0000352749" "0000752382"
"0000352750" "0000752383"
"0000352751" "0000752384"
"0000352752" "0000752385"
"0000352753" "0000752386"
"0000352754" "0000752387"
"0000352755" "0000752388"
"0000352756" "0000752389"
"0000352757" "0000752390"
"0000352758" "0000752391"
"0000352759" "0000752392"
"0000352760" "0000752393"
"0000352761" "0000752394"
"0000352762" "0000752395"
"0000352763" "0000752396"
"0000352764" "0000752397"
"0000352765" "0000752398"
"0000352766" "0000752399"
"0000352767" "0000752400"
"0000352768" "0000752401"
"0000352769" "0000752402"
"0000352770" "0000752403"
"0000352771" "0000752404"
"0000352772" "0000752405"
"0000352773" "0000752406"
"0000352774" "0000752407"
"0000352775" "0000752408"
"0000352776" "0000752409"
"0000352777" "0000752410"
"0000352778" "0000752411"
"0000352779" "0000752412"
"0000352780" "0000752413"
"0000352781" "0000752414"
"0000352782" "0000752415"
"0000352783" "0000752416"
"0000352784" "0000752417"
"0000352785" "0000752418"
"0000352786" "0000752419"
"0000352787" "0000752420"
"0000352788" "0000752421"
"0000352789" "0000752422"
"0000352790" "0000752423"
"0000352791" "0000752424"
"0000352792" "0000752425"
"0000352793" "0000752426"
"0000352794" "0000752427"
"0000352795" "0000752428"
"0000352796" "0000752429"
"0000352797" "0000752430"
"0000352798" "0000752431"
"0000352799" "0000752432"
"0000352800" "0000752433"
"0000352801" "0000752434"
"0000352802" "0000752435"
"0000352803" "0000752436"
"0000352804" "0000752437"
"0000352805" "0000752438"
"0000352806" "0000752439"
"0000352807" "0000752440"
"0000352808" "0000752441"
"0000352809" "0000752442"
"0000352810" "0000752443"
"0000352811" "0000752444"
"0000352812" "0000752445"
"0000352813" "0000752446"
"0000352814" "0000752447"
"0000352815" "0000752448"
"0000352816" "0000752449"
"0000352817" "0000752450"
"0000352818" "0000752451"
"0000352819" "0000752452"
"0000352820" "0000752453"
"0000352821" "0000752454"
"0000352822" "0000752455"
"0000352823" "0000752456"
"0000352824" "0000752457"
"0000352825" "0000752458"
"0000352826" "0000752459"
"0000352827" "0000752460"
"0000352828" "0000752461"
"0000352829" "0000752462"
"0000352830" "0000752463"
"0000352831" "0000752464"
"0000352832" "0000752465"
"0000352833" "0000752466"
"0000352834" "0000752467"
"0000352835" "0000752468"
"0000352836" "0000752469"
"0000352837" "0000752470"
"0000352838" "0000752471"
"0000352839" "0000752472"
"0000352840" "0000752473"
"0000352841" "0000752474"
"0000352842" "0000752475"
"0000352843" "0000752476"
"0000352844" "0000752477"
"0000352845" "0000752478"
"0000352846" "0000752479"
"0000352847" "0000752480"
"0000352848" "0000752481"
"0000352849" "0000752482"
"0000352850" "0000752483"
"0000352851" "0000752484"
"0000352852" "0000752485"
"0000352853" "0000752486"
"0000352854" "0000752487"
"0000352855" "0000752488"
"0000352856" "0000752489"
"0000352857" "0000752490"
"0000352858" "0000752491"
"0000352859" "0000752492"
"0000352860" "0000752493"
"0000352861" "0000752494"
"0000352862" "0000752495"
"0000352863" "0000752496"
"0000352864" "0000752497"
"0000352865" "0000752498"
"0000352866" "0000752499"
"0000352867" "0000752500"
"0000352868" "0000752501"
"0000352869" "0000752502"
"0000352870" "0000752503"
"0000352871" "0000752504"
"0000352872" "0000752505"
"0000352873" "0000752506"
"0000352874" "0000752507"
"0000352875" "0000752508"
"0000352876" "0000752509"
"0000352877" "0000752510"
"0000352878" "0000752511"
"0000352879" "0000752512"
"0000352880" "0000752513"
"0000352881" "0000752514"
"0000352882" "0000752515"
"0000352883" "0000752516"
"0000352884" "0000752517"
"0000352885" "0000752518"
"0000352886" "0000752519"
"0000352887" "0000752520"
"0000352888" "0000752521"
"0000352889" "0000752522"
"0000352890" "0000752523"
"0000352891" "0000752524"
"0000352892" "0000752525"
"0000352893" "0000752526"
"0000352894" "0000752527"
"0000352895" "0000752528"
"0000352896" "0000752529"
"0000352897" "0000752530"
"0000352898" "0000752531"
"0000352899" "0000752532"
"0000352900" "0000752533"
"0000352901" "0000752534"
"0000352902" "0000752535"
"0000352903" "0000752536"
"0000352904" "0000752537"
"0000352905" "0000752538"
"0000352906" "0000752539"
"0000352907" "0000752540"
"0000352908" "0000752541"
"0000352909" "0000752542"
"0000352910" "0000752543"
"0000352911" "0000752544"
"0000352912" "0000752545"
"0000352913" "0000752546"
"0000352914" "0000752547"
"0000352915" "0000752548"
"0000352916" "0000752549"
"0000352917" "0000752550"
"0000352918" "0000752551"
"0000352919" "0000752552"
"0000352920" "0000752553"
"0000352921" "0000752554"
"0000352922" "0000752555"
"0000352923" "0000752556"
"0000352924" "0000752557"
"0000352925" "0000752558"
"0000352926" "0000752559"
"0000352927" "0000752560"
"0000352928" "0000752561"
"0000352929" "0000752562"
"0000352930" "0000752563"
"0000352931" "0000752564"
"0000352932" "0000752565"
"0000352933" "0000752566"
"0000352934" "0000752567"
"0000352935" "0000752568"
"0000352936" "0000752569"
"0000352937" "0000752570"
"0000352938" "0000752571"
"0000352939" "0000752572"
"0000352940" "0000752573"
"0000352941" "0000752574"
"0000352942" "0000752575"
"0000352943" "0000752576"
"0000352944" "0000752577"
"0000352945" "0000752578"
"0000352946" "0000752579"
"0000352947" "0000752580"
"0000352948" "0000752581"
"0000352949" "0000752582"
"0000352950" "0000752583"
"0000352951" "0000752584"
"0000352952" "0000752585"
"0000352953" "0000752586"
"0000352954" "0000752587"
"0000352955" "0000752588"
"0000352956" "0000752589"
"0000352957" "0000752590"
"0000352958" "0000752591"
"0000352959" "0000752592"
"0000352960" "0000752593"
"0000352961" "0000752594"
"0000352962" "0000752595"
"0000352963" "0000752596"
"0000352964" "0000752597"
"0000352965" "0000752598"
"0000352966" "0000752599"
"0000352967" "0000752600"
"0000352968" "0000752601"
"0000352969" "0000752602"
"0000352970" "0000752603"
"0000352971" "0000752604"
"0000352972" "0000752605"
"0000352973" "0000752606"
"0000352974" "0000752607"
"0000352975" "0000752608"
"0000352976" "0000752609"
"0000352977" "0000752610"
"0000352978" "0000752611"
"0000352979" "0000752612"
"0000352980" "0000752613"
"0000355311" "0000754942"
"0000355312" "0000754943"
"0000355313" "0000754944"
"0000355314" "0000754945"
"0000355315" "0000754946"
"0000355316" "0000754947"
"0000355317" "0000754948"
"0000355318" "0000754949"
"0000355402" "0000755033"
"0000357468" "0000757099"
"0000357469" "0000757100"
"0000357470" "0000757101"
"0000357471" "0000757102"
"0000357472" "0000757103"
"0000357473" "0000757104"
"0000357474" "0000757105"
"0000357475" "0000757106"
"0000357476" "0000757107"
"0000357477" "0000757108"
"0000357478" "0000757109"
"0000357479" "0000757110"
"0000357480" "0000757111"
"0000357481" "0000757112"
"0000357482" "0000757113"
"0000357483" "0000757114"
"0000357484" "0000757115"
"0000357485" "0000757116"
"0000357486" "0000757117"
"0000357487" "0000757118"
"0000357488" "0000757119"
"0000357489" "0000757120"
"0000357490" "0000757121"
"0000357491" "0000757122"
"0000357492" "0000757123"
"0000357493" "0000757124"
"0000357494" "0000757125"
"0000357495" "0000757126"
"0000357496" "0000757127"
"0000357497" "0000757128"
"0000357498" "0000757129"
"0000357499" "0000757130"
"0000357500" "0000757131"
"0000357501" "0000757132"
"0000357502" "0000757133"
"0000357503" "0000757134"
"0000357504" "0000757135"
"0000357505" "0000757136"
"0000357506" "0000757137"
"0000357507" "0000757138"
"0000357508" "0000757139"
"0000357509" "0000757140"
"0000357510" "0000757141"
"0000357511" "0000757142"
"0000357512" "0000757143"
"0000357513" "0000757144"
"0000357514" "0000757145"
"0000357515" "0000757146"
"0000357516" "0000757147"
"0000357517" "0000757148"
"0000357518" "0000757149"
"0000357519" "0000757150"
"0000357520" "0000757151"
"0000357521" "0000757152"
"0000357522" "0000757153"
"0000357523" "0000757154"
"0000357524" "0000757155"
"0000357525" "0000757156"
"0000357526" "0000757157"
"0000357527" "0000757158"
"0000357528" "0000757159"
"0000357529" "0000757160"
"0000357530" "0000757161"
"0000357531" "0000757162"
"0000357532" "0000757163"
"0000357533" "0000757164"
"0000357534" "0000757165"
"0000357535" "0000757166"
"0000357536" "0000757167"
"0000357537" "0000757168"
"0000357538" "0000757169"
"0000357539" "0000757170"
"0000357540" "0000757171"
"0000357541" "0000757172"
"0000357542" "0000757173"
"0000357543" "0000757174"
"0000357544" "0000757175"
"0000357545" "0000757176"
"0000357546" "0000757177"
"0000357547" "0000757178"
"0000357548" "0000757179"
"0000357549" "0000757180"
"0000357550" "0000757181"
"0000357551" "0000757182"
"0000357552" "0000757183"
"0000357553" "0000757184"
"0000357554" "0000757185"
"0000357555" "0000757186"
"0000357556" "0000757187"
"0000357557" "0000757188"
"0000357558" "0000757189"
"0000357559" "0000757190"
"0000357560" "0000757191"
"0000357561" "0000757192"
"0000357562" "0000757193"
"0000357563" "0000757194"
"0000357564" "0000757195"
"0000357565" "0000757196"
"0000357566" "0000757197"
"0000357567" "0000757198"
"0000357568" "0000757199"
"0000357569" "0000757200"
"0000357570" "0000757201"
"0000357571" "0000757202"
"0000357572" "0000757203"
"0000357573" "0000757204"
"0000357574" "0000757205"
"0000357575" "0000757206"
"0000357576" "0000757207"
"0000357577" "0000757208"
"0000357578" "0000757209"
"0000357579" "0000757210"
"0000357580" "0000757211"
"0000357581" "0000757212"
"0000357582" "0000757213"
"0000357583" "0000757214"
"0000357584" "0000757215"
"0000357585" "0000757216"
"0000357586" "0000757217"
"0000357587" "0000757218"
"0000357588" "0000757219"
"0000357589" "0000757220"
"0000357590" "0000757221"
"0000357591" "0000757222"
"0000357592" "0000757223"
"0000357593" "0000757224"
"0000357594" "0000757225"
"0000357595" "0000757226"
"0000357596" "0000757227"
"0000357597" "0000757228"
"0000357598" "0000757229"
"0000357599" "0000757230"
"0000357600" "0000757231"
"0000357601" "0000757232"
"0000357602" "0000757233"
"0000357603" "0000757234"
"0000357604" "0000757235"
"0000357605" "0000757236"
"0000357606" "0000757237"
"0000357607" "0000757238"
"0000357608" "0000757239"
"0000357609" "0000757240"
"0000357610" "0000757241"
"0000357611" "0000757242"
"0000357612" "0000757243"
"0000357613" "0000757244"
"0000357614" "0000757245"
"0000357615" "0000757246"
"0000357616" "0000757247"
"0000357617" "0000757248"
"0000357618" "0000757249"
"0000357619" "0000757250"
"0000357620" "0000757251"
"0000357621" "0000757252"
"0000357622" "0000757253"
"0000357623" "0000757254"
"0000357624" "0000757255"
"0000357625" "0000757256"
"0000357626" "0000757257"
"0000357627" "0000757258"
"0000357628" "0000757259"
"0000357629" "0000757260"
"0000357630" "0000757261"
"0000357631" "0000757262"
"0000357632" "0000757263"
"0000357633" "0000757264"
"0000357634" "0000757265"
"0000357635" "0000757266"
"0000357636" "0000757267"
"0000357637" "0000757268"
"0000357638" "0000757269"
"0000357639" "0000757270"
"0000357640" "0000757271"
"0000357641" "0000757272"
"0000357642" "0000757273"
"0000357643" "0000757274"
"0000357644" "0000757275"
"0000357645" "0000757276"
"0000357646" "0000757277"
"0000357647" "0000757278"
"0000357648" "0000757279"
"0000357649" "0000757280"
"0000357650" "0000757281"
"0000357651" "0000757282"
"0000357652" "0000757283"
"0000357653" "0000757284"
"0000357654" "0000757285"
"0000357655" "0000757286"
"0000357656" "0000757287"
"0000357657" "0000757288"
"0000357658" "0000757289"
"0000357659" "0000757290"
"0000357660" "0000757291"
"0000357661" "0000757292"
"0000357662" "0000757293"
"0000357663" "0000757294"
"0000357664" "0000757295"
"0000357665" "0000757296"
"0000357666" "0000757297"
"0000357667" "0000757298"
"0000357668" "0000757299"
"0000357669" "0000757300"
"0000357670" "0000757301"
"0000357671" "0000757302"
"0000357672" "0000757303"
"0000357673" "0000757304"
"0000357674" "0000757305"
"0000357675" "0000757306"
"0000357676" "0000757307"
"0000357677" "0000757308"
"0000357678" "0000757309"
"0000357679" "0000757310"
"0000357680" "0000757311"
"0000357681" "0000757312"
"0000357682" "0000757313"
"0000357683" "0000757314"
"0000357684" "0000757315"
"0000357685" "0000757316"
"0000357686" "0000757317"
"0000357687" "0000757318"
"0000357688" "0000757319"
"0000357689" "0000757320"
"0000357690" "0000757321"
"0000357691" "0000757322"
"0000357692" "0000757323"
"0000357693" "0000757324"
"0000357694" "0000757325"
"0000357695" "0000757326"
"0000357696" "0000757327"
"0000357697" "0000757328"
"0000357698" "0000757329"
"0000357699" "0000757330"
"0000357700" "0000757331"
"0000357701" "0000757332"
"0000357702" "0000757333"
"0000357703" "0000757334"
"0000357704" "0000757335"
"0000357705" "0000757336"
"0000357706" "0000757337"
"0000357707" "0000757338"
"0000357708" "0000757339"
"0000357709" "0000757340"
"0000357710" "0000757341"
"0000357711" "0000757342"
"0000357712" "0000757343"
"0000357713" "0000757344"
"0000357714" "0000757345"
"0000357715" "0000757346"
"0000357716" "0000757347"
"0000357717" "0000757348"
"0000357718" "0000757349"
"0000357719" "0000757350"
"0000357720" "0000757351"
"0000357721" "0000757352"
"0000357722" "0000757353"
"0000357723" "0000757354"
"0000357724" "0000757355"
"0000357725" "0000757356"
"0000357726" "0000757357"
"0000357727" "0000757358"
"0000357728" "0000757359"
"0000357729" "0000757360"
"0000357730" "0000757361"
"0000357731" "0000757362"
"0000357732" "0000757363"
"0000357733" "0000757364"
"0000357734" "0000757365"
"0000357735" "0000757366"
"0000357736" "0000757367"
"0000357737" "0000757368"
"0000357738" "0000757369"
"0000357739" "0000757370"
"0000357740" "0000757371"
"0000357741" "0000757372"
"0000357742" "0000757373"
"0000357743" "0000757374"
"0000357744" "0000757375"
"0000357745" "0000757376"
"0000357746" "0000757377"
"0000357747" "0000757378"
"0000357748" "0000757379"
"0000357749" "0000757380"
"0000357750" "0000757381"
"0000357751" "0000757382"
"0000357752" "0000757383"
"0000357753" "0000757384"
"0000357754" "0000757385"
"0000357755" "0000757386"
"0000357756" "0000757387"
"0000377335" "0000789647"
"0000404328" "0000839998"
"0000472365" "0001060857"