### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = FBXO22) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "FBXO22" "F-box protein 22" "15" "q23" "unknown" "NC_000015.9" "UD_132378453606" "" "https://www.LOVD.nl/FBXO22" "" "1" "13593" "26263" "609096" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "" "" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2025-05-05 16:04:46" "00006" "2025-05-05 16:47:58" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00007801" "FBXO22" "transcript variant 1" "001" "NM_147188.2" "" "NP_671717.1" "" "" "" "-105" "3378" "1212" "76196200" "76227609" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "07166" "TYMAS" "Tayoun-Maawali syndrome" "AR" "621184" "" "failure to thrive (HP:0001508) (0.87), intrauterine growth restriction (HP:0001511) (0.73), short stature (HP:0004322) (0.67), decreased body weight (HP:0004325) (0.60), neurodevelopmental delay (HP:0012758) (0.867), microcephaly (HP:0011451) (0.733), muscular hypotonia (HP:0001252) (0.67), seizures (HP:0001250) (0.53), generalized hypotonia (HP:0001290) (0.53), intellectual disability (HP:0001249) (0.47), poor suck (HP:0002033) (0.40), abnormal craniofacial shape (HP:0001999) (0.80), depressed nasal bridge (HP:0005280) (0.60), high forehead (HP:0000348) (0.53), hypertelorism (HP:0000316) (0.47)" "" "00006" "2025-05-05 16:05:56" "00006" "2025-05-05 16:13:07" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "FBXO22" "07166" ## Individuals ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00426185" "" "" "" "1" "" "00006" "{PMID:Al-Kasbi 2022:36344539}" "patient, other affecteds in family" "M" "yes" "Oman" "" "0" "" "" "" "30BN13200" "00465256" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "United Arab Emirates" "" "0" "" "" "" "Fam1PatII1/Pat1" "00465257" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "United Arab Emirates" "" "0" "" "" "" "Fam2PatII3/Pat2" "00465258" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "United Arab Emirates" "" "0" "" "" "" "Fam3PatII2/Pat3" "00465259" "" "" "" "2" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 2 affected (female and fetus), unaffected heterozygous carrier parents" "F" "yes" "United Arab Emirates" "" "0" "" "" "" "Fam4PatII2/Pat4" "00465260" "" "" "00465259" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "fetus" "" "yes" "United Arab Emirates" "" "0" "" "" "" "Fam4PatII3/Pat5" "00465261" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Oman" "" "0" "" "" "" "Fam5PatII1/Pat6" "00465262" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Oman" "" "0" "" "" "" "Fam6PatII1/Pat7" "00465263" "" "" "" "2" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 2 affected brothers, unaffected heterozygous carrier parents" "M" "yes" "Oman" "" "0" "" "" "" "Fam7PatII1/Pat8" "00465264" "" "" "00465263" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "brother" "M" "yes" "" "" "0" "" "" "" "Fam7PatII3/Pat9" "00465265" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Oman" "" "0" "" "" "" "Fam8PatII1/Pat10" "00465266" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam9PatII1/Pat11" "00465267" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "Fam10PatII7/Pat12" "00465268" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "United Arab Emirates" "" "0" "" "" "" "Fam11PatII2/Pat13" "00465269" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "United Arab Emirates" "" "0" "" "" "" "Fam12PatII4/Pat14" "00465270" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "yes" "United Arab Emirates" "" "0" "" "" "" "Fam13PatII4/Pat15" "00465271" "" "" "" "1" "" "00006" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Lebanon" "" "0" "" "" "" "Fam14PatII1/Pat16" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 17 "{{individualid}}" "{{diseaseid}}" "00426185" "00139" "00465256" "00198" "00465257" "00198" "00465258" "00198" "00465259" "00198" "00465260" "00198" "00465261" "00198" "00465262" "00198" "00465263" "00198" "00465264" "00198" "00465265" "00198" "00465266" "00198" "00465267" "00198" "00465268" "00198" "00465269" "00198" "00465270" "00198" "00465271" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 07166 ## Count = 17 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000317335" "00139" "00426185" "00006" "Familial, autosomal recessive" "3y" "Symmetrical IUGR, clenched hands, hypertelorism, generalized hypotonia, duodenal atresia and annular pancreas" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000350794" "00198" "00465256" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350795" "00198" "00465257" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350796" "00198" "00465258" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350797" "00198" "00465259" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350798" "00198" "00465260" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350799" "00198" "00465261" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350800" "00198" "00465262" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350801" "00198" "00465263" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350802" "00198" "00465264" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350803" "00198" "00465265" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350804" "00198" "00465266" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350805" "00198" "00465267" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350806" "00198" "00465268" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350807" "00198" "00465269" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350808" "00198" "00465270" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" "0000350809" "00198" "00465271" "00006" "Familial, autosomal recessive" "" "see paper; ..." "1d" "" "" "" "" "" "" "" "TYMAS" "growth restriction, multi-system anomalies" "" ## Screenings ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000427505" "00426185" "1" "00006" "00006" "2022-11-28 11:02:11" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000466904" "00465256" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG;SEQ-ON" "DNA" "" "WES, WGS" "0000466905" "00465257" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WGS" "0000466906" "00465258" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WGS" "0000466907" "00465259" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466908" "00465260" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466909" "00465261" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466910" "00465262" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466911" "00465263" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000466912" "00465264" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ;SEQ-NG;SEQ-ON" "DNA" "" "WES, WGS" "0000466913" "00465265" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466914" "00465266" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WGS" "0000466915" "00465267" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000466916" "00465268" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466917" "00465269" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-ON" "DNA" "" "WGS" "0000466918" "00465270" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WES" "0000466919" "00465271" "1" "00006" "00006" "2025-05-05 16:47:56" "" "" "SEQ-NG" "DNA" "" "WGS" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 0 ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 17 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000904865" "3" "70" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Al-Kasbi 2022:36344539}" "" "NM_012170.3:c.159_162del (Arg53SerfsTer13)" "reported as candidate disease gene" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "VUS" "" "0001030950" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030951" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030952" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030953" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030954" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030955" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030956" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030957" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030958" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030959" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030960" "3" "90" "15" "76196312" "76196340" "del" "0" "00006" "FBXO22_000002" "g.76196312_76196340del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "8_36delCGGTAGGCTGCTGCGGCGAGTGCCGCGGC" "" "Germline" "" "" "0" "" "" "g.75903971_75903999del" "" "pathogenic (recessive)" "" "0001030961" "3" "90" "15" "76222315" "76222318" "del" "0" "00006" "FBXO22_000004" "g.76222315_76222318del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "" "" "Germline" "" "" "0" "" "" "g.75929974_75929977del" "" "pathogenic (recessive)" "" "0001030962" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030963" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030964" "3" "90" "15" "76196850" "76196853" "del" "0" "00006" "FBXO22_000001" "g.76196850_76196853del" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "159_162delGGAG" "" "Germline" "" "" "0" "" "" "g.75904509_75904512del" "" "pathogenic (recessive)" "" "0001030965" "3" "90" "15" "76222259" "76222262" "delins" "0" "00006" "FBXO22_000003" "g.76222259_76222262delinsG" "" "{PMID:Ramakrishna 2025:40215970}, {DOI:Ramakrishna 2025:10.1016/j.ajhg.2025.03.013}" "" "663_666delTGTCinsG" "" "Germline" "" "" "0" "" "" "g.75929918_75929921delinsG" "" "pathogenic (recessive)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes FBXO22 ## Count = 17 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000904865" "00007801" "70" "159" "0" "162" "0" "c.159_162del" "" "" "" "0001030950" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030951" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030952" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030953" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030954" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030955" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030956" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030957" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030958" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030959" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030960" "00007801" "90" "8" "0" "36" "0" "c.8_36del" "r.8_36del )" "p.0" "" "0001030961" "00007801" "90" "719" "0" "722" "0" "c.719_722del" "r.(719_722del)" "p.0" "" "0001030962" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030963" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030964" "00007801" "90" "159" "0" "162" "0" "c.159_162del" "r.(159_162del)" "p.0" "" "0001030965" "00007801" "90" "663" "0" "666" "0" "c.663_666delinsG" "r.(663_666delinsG)" "p.0" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 17 "{{screeningid}}" "{{variantid}}" "0000427505" "0000904865" "0000466904" "0001030950" "0000466905" "0001030951" "0000466906" "0001030952" "0000466907" "0001030953" "0000466908" "0001030954" "0000466909" "0001030955" "0000466910" "0001030956" "0000466911" "0001030957" "0000466912" "0001030958" "0000466913" "0001030959" "0000466914" "0001030960" "0000466915" "0001030961" "0000466916" "0001030962" "0000466917" "0001030963" "0000466918" "0001030964" "0000466919" "0001030965"