### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = FGD1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "FGD1" "FYVE, RhoGEF and PH domain containing 1" "X" "p11.21" "unknown" "NG_008054.1" "UD_132118684532" "" "http://www.LOVD.nl/FGD1" "" "1" "3663" "2245" "300546" "1" "1" "1" "1" "We gratefully acknowledge the support of Johan den Dunnen in establishing this databases and curating it till 2014.
\r\nEstablishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/FGD1_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2016-02-04 02:30:10" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001217" "FGD1" "FYVE, RhoGEF and PH domain containing 1" "001" "NM_004463.2" "" "NP_004454.2" "" "" "" "-734" "3541" "2886" "54471887" "54522599" "00000" "2012-09-13 13:19:16" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 7 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00180" "RRS" "Robinow syndrome, autosomal recessive (RRS)" "AD" "" "" "" "" "00115" "2013-08-28 18:26:52" "00006" "2021-12-10 21:51:32" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00770" "AAS;MRX16" "Aarskog-Scott syndrome (AAS, faciogenital dysplasia, mental retardation, syndromic, X-linked syndrome, type 16 syndrome (MRX16)) syndrome (AAS)" "AR" "305400" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "FGD1" "00139" "FGD1" "00770" ## Individuals ## Do not remove or alter this header ## ## Count = 51 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00050543" "" "" "" "1" "" "00006" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "family, 1 affected" "M" "" "United Kingdom (Great Britain)" "" "0" "Decipher" "" "" "" "00058631" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377194-Pat?" "00058632" "" "" "" "3" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377195-Pat?" "00058633" "" "" "" "2" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377196-Pat?" "00058634" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "?" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377197-Pat?" "00058640" "" "" "" "1" "" "01533" "{PMID:Fryns 1992:1605221}" "" "M" "" "" "" "0" "" "" "" "" "00058641" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "identical twin with patient 91" "M" "" "Italy" "" "0" "" "" "" "" "00058642" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "identical twin with patient 90" "M" "" "Italy" "" "0" "" "" "" "" "00058643" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00058644" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058645" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "" "" "0" "" "" "European" "" "00058646" "" "" "" "1" "" "01533" "{PMID:Orrico 2007:17152066}" "" "M" "" "Argentina" "" "0" "" "" "?" "" "00058647" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "" "" "0" "" "" "European" "" "00058648" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058649" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058650" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058651" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058652" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058653" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058654" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058655" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058656" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058657" "" "" "" "1" "" "01533" "{PMID:Orrico 2010:20082460}" "" "M" "" "" "" "0" "" "" "European" "" "00058658" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "" "" "0" "" "" "European" "" "00058659" "" "" "" "1" "" "01533" "{PMID:Orrico 2005:14560308}" "" "M" "" "" "" "0" "" "" "?" "" "00058660" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "" "" "0" "" "" "European" "" "00058661" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "" "" "0" "" "" "European" "" "00058662" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "" "" "0" "" "" "European" "" "00058663" "" "" "" "1" "" "01533" "{PMID:Orrico 2004:14560308}" "" "M" "" "Ireland" "" "0" "" "" "?" "" "00058664" "" "" "" "1" "" "01533" "{PMID:Orrico 2000:14560308}" "" "M" "" "Italy" "" "0" "" "" "?" "" "00058665" "" "" "" "1" "" "01533" "{PMID:Kaname 2006:16688726}" "" "M" "" "" "" "0" "" "" "?" "" "00058666" "" "" "" "1" "" "01533" "{PMID:Kaname 2006:16688726}" "" "M" "" "" "" "0" "" "" "?" "" "00058667" "" "" "" "1" "" "01533" "{PMID:Pasteris 1994:7954831}" "" "M" "" "" "" "0" "" "" "?" "" "00058668" "" "" "" "1" "" "01533" "{PMID:Bottani 2007:17847065}" "" "M" "" "" "" "0" "" "" "Kosovo-Albanian" "" "00058669" "" "" "" "1" "" "01533" "{PMID:Schwartz 2000:11093277}" "cousin of IT" "M" "" "Italy" "" "0" "" "" "" "" "00058670" "" "" "" "1" "" "01533" "{PMID:Schwartz 2000:11093277}" "cousin of FC" "M" "" "Italy" "" "0" "" "" "" "" "00058671" "" "" "" "1" "" "01533" "{PMID:Schwartz 2000:11093277}" "" "M" "" "Germany" "" "0" "" "" "?" "" "00058672" "" "" "" "1" "" "01533" "{PMID:Shalev 2006:16353258}" "" "M" "" "" "" "0" "" "" "Arab" "" "00058673" "" "" "" "1" "" "01533" "{PMID:Bedoyan 2009:19110080}" "" "M" "" "" "" "0" "" "" "" "" "00058674" "" "" "" "1" "" "01533" "" "" "" "" "" "" "0" "" "" "" "" "00058675" "" "" "" "1" "" "01533" "" "" "" "" "" "" "0" "" "" "" "" "00058676" "" "" "" "3" "" "00006" "{PMID:Aten 2013:23169394}" "3-generation family, affected grandfather and 2 grandsons, unaffected heterozygous carrier daugther" "M" "no" "Netherlands" "" "0" "" "" "" "" "00183151" "" "" "" "2" "" "00006" "{PMID:Hu 2016:25644381}" "family, 2 affected, 3 unaffected heterozygous carrier females" "M" "" "" "" "0" "" "" "" "25644381-FamD176" "00311873" "" "" "" "1" "" "00006" "{PMID:White 2018:29276006}" "patient" "" "" "" "" "0" "" "" "" "BAB8747/BH8811_1" "00311874" "" "" "" "1" "" "00006" "{PMID:White 2018:29276006}" "patient" "" "" "" "" "0" "" "" "" "BAB8751/BH9281_1" "00324344" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00390722" "" "" "" "1" "" "00006" "{PMID:Gazdagh 2019:29698805}" "" "M" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "Pat5" "00415908" "" "" "" "1" "" "01164" "" "" "M" "?" "Afghanistan" "" "0" "" "" "" "203455" "00426122" "" "" "" "1" "" "00006" "{PMID:Al-Kasbi 2022:36344539}" "patient, other affecteds in family" "M" "" "Oman" "" "0" "" "" "" "10DH11200" "00433379" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "248708" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 51 "{{individualid}}" "{{diseaseid}}" "00000209" "01157" "00050543" "00198" "00058631" "00187" "00058632" "00187" "00058633" "00187" "00058634" "00187" "00058640" "00770" "00058641" "00770" "00058642" "00770" "00058643" "00770" "00058644" "00770" "00058645" "00770" "00058646" "00770" "00058647" "00770" "00058648" "00770" "00058649" "00770" "00058650" "00770" "00058651" "00770" "00058652" "00770" "00058653" "00770" "00058654" "00770" "00058655" "00770" "00058656" "00770" "00058657" "00770" "00058658" "00770" "00058659" "00770" "00058660" "00770" "00058661" "00770" "00058662" "00770" "00058663" "00770" "00058664" "00770" "00058665" "00770" "00058666" "00770" "00058667" "00770" "00058668" "00770" "00058669" "00770" "00058670" "00770" "00058671" "00770" "00058672" "00770" "00058673" "00770" "00058674" "00770" "00058675" "00770" "00058676" "00770" "00183151" "00187" "00311873" "00180" "00311874" "00180" "00324344" "00198" "00390722" "05611" "00415908" "00770" "00426122" "00139" "00433379" "00770" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00180, 00187, 00198, 00770, 01157, 05611 ## Count = 51 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000037155" "00198" "00050543" "00006" "Isolated (sporadic)" "" "abnormality of the cardiovascular system, severe expressive language delay, delayed speech and language development, hypopigmented skin patches, contracture of the metacarpophalangeal joint of the 3rd finger, global developmental delay, hyperactivity, autism" "" "" "" "" "" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "" "" "0000045222" "00187" "00058631" "00124" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045223" "00187" "00058632" "00124" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045224" "00187" "00058633" "00124" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045225" "00187" "00058634" "00124" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045231" "00770" "00058640" "01533" "Familial" "29y" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045232" "00770" "00058641" "01533" "Familial" "9y" "short stature(121cm o5th percentile), joint hypermobility, small and short hands and feet, brachydactyly and Camptodactyly" "" "" "" "" "" "" "" "" "" "" "" "" "0000045233" "00770" "00058642" "01533" "Familial" "9y" "short stature (121cm o5th percentile), joint hypermobility, small and short hands and feet, brachydactyly and camptodactyly" "" "" "" "" "" "" "" "" "" "" "" "" "0000045234" "00770" "00058643" "01533" "Familial" "11y" "impairment in expressive language and speech articulation difficulties, emotional behaviour problems with occasional temper tantrums, short stature (132.5 cm; 5th percentile), moderate rhizomelia of upper and lower limbs, short hands with cutaneous syndactyly of fingers, a surgically corrected right-sided cryptorchidism and over-riding scrotum. Craniofacial findings included relative macrocephaly, frontal bossing, hypertelorism (inner canthal distance 3.5 cm; 497th percentile – outer canthal distance 11 cm; 497th percentile), down slant of palpebral fissures, short nose with anteverted nostrils, wide philtrum and thin upper lip" "" "" "" "" "" "" "" "" "" "" "" "" "0000045235" "00770" "00058644" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Short fifth finger/Clinod, Abnormal auricles, Broad feet, Cryptorchidism," "" "" "" "" "" "" "" "" "" "" "" "" "0000045236" "00770" "00058645" "01533" "Unknown" "21y" "dysmorphic facial appearance, shawl scrotum and short stature, hypertelorism (inner canthal distance 3.9 cm; 497th percentile – outer canthal distance 11.5 cm; 497th percentile), left palpebral ptosis and strabismus, a short neck, camptodactyly and brachydactyly" "" "" "" "" "" "" "" "" "" "" "" "" "0000045237" "00770" "00058646" "01533" "Unknown" "15y" "he is a boy of short stature (151 cm; 3th centile) with OFC of 54 cm (25th centile), widow’s peak, synophrys, inner canthal distance of 3.5 cm (90th centile) and outer canthal distance 10 cm (97th centile). Dysmorphic features include downslanting palpebral fissures, palpebral ptosis, short and convex nose, long philtrum, right maxillary hypoplasia with right microtia, curved linear dimple below the lower lip, short neck, pectus excavatum, brachydactyly with mild soft tissue webbing between the fingers, single crease in the fifth fingers" "" "" "" "" "" "" "" "" "" "" "" "" "0000045238" "00770" "00058647" "01533" "Unknown" "1y4m" "unusual facial appearance and short stature. hypertelorism (inner canthal distance 3.9 cm; 497th percentile – outer canthal distance 11.5 cm; 497th percentile), antimongoloid slant of palpebral fissures, widow’s peak, small nose with anteverted nares, long philtrum, cutaneous syndactyly with brachydactyly and clinodactyly of the Vth fingers, transverse palmar crease. The child also had a shawl scrotum, right cryptorchidism, a small right inguinal hernia and an umbilical hernia." "" "" "" "" "" "" "" "" "" "" "" "" "0000045239" "00770" "00058648" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Widow\'s peak, Abnormal auricles," "" "" "" "" "" "" "" "" "" "" "" "" "0000045240" "00770" "00058649" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Interdigital webbing, Camptodactily, Widow\'s peak, Ptosis, Broad feet, Cryptorchidism, ingui./umbilical hernia," "" "" "" "" "" "" "" "" "" "" "" "" "0000045241" "00770" "00058650" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Crease below lower lip, Interdigital webbing, Short fifth finger/Clinod, Camptodactily, Ptosis, Downward slant palp., Broad feet," "" "" "" "" "" "" "" "" "" "" "" "" "0000045242" "00770" "00058651" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Crease below lower lip, Short fifth finger/Clinod, Widow\'s peak, Ptosis, Abnormal auricles, ingui./umbilical hernia," "" "" "" "" "" "" "" "" "" "" "" "" "0000045243" "00770" "00058652" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Crease below lower lip, Short fifth finger/Clinod, Widow\'s peak, Ptosis, Downward slant palp., Broad feet, Prominent umbilicus," "" "" "" "" "" "" "" "" "" "" "" "" "0000045244" "00770" "00058653" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Crease below lower lip, Short fifth finger/Clinod, Camptodactily, Widow\'s peak, Downward slant palp., Abnormal auricles, Joint hyperextension, Broad feet, Cryptorchidism," "" "" "" "" "" "" "" "" "" "" "" "" "0000045245" "00770" "00058654" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Crease below lower lip, Interdigital webbing, Short fifth finger/Clinod, Widow\'s peak, Abnormal auricles, Joint hyperextension, Broad feet, Cryptorchidism," "" "" "" "" "" "" "" "" "" "" "" "" "0000045246" "00770" "00058655" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Short fifth finger/Clinod, Camptodactily, Broad feet, Cryptorchidism," "" "" "" "" "" "" "" "" "" "" "" "" "0000045247" "00770" "00058656" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Crease below lower lip, Widow\'s peak, Downward slant palp., Abnormal auricles, Broad feet," "" "" "" "" "" "" "" "" "" "" "" "" "0000045248" "00770" "00058657" "01533" "Unknown" "" "hypertelorism, short nose/ Ant. Nares, Short broad hands, Short stature, Shawl scrotum, Interdigital webbing, Short fifth finger/Clinod, Camptodactily, Widow\'s peak, Cryptorchidism," "" "" "" "" "" "" "" "" "" "" "" "" "0000045249" "00770" "00058658" "01533" "Familial" "3y" "round face, hypertelorism, epicanthic folds, widow’s peak, small nose with anteverted nares, long philtrum, cutaneous syndactyly with brachydactyly and clinodactyly of the IVth and Vth fingers, right inguinal hernia, umbilical hernia, shawl scrotum, short stature and bilateral varus metatarsus" "" "" "" "" "" "" "" "" "" "" "" "" "0000045250" "00770" "00058659" "01533" "Familial" "16y" "short stature (159 cm, 3rd centile), low weight (48 kg, 5th centile), and normal cephalic circumference (54 cm). Inner canthal distance was 2.7 cm (5th centile), interpupillary distance was 5 cm (5th centile), and outer canthal distance was 9.5 cm (90th centile). downslanting palpebral fissures with bilateral ptosis and strabismus, broad and bulbous nose, medial extension of eyebrows, dysmorphic and low set auricles, maxillary hypoplasia, ogival palatus, protuberant lips, and relative micrognathia. He was hypotonic and had hyperextensible joints. He had brachydactyly (middle finger length 7 cm, 3rd centile; palm length 10 cm, 25th centile) with mild webbing between the third and fourth fingers and bilateral single transverse palmar creases. There was a prominent umbilicus and a narrow chest with pectus excavatus. Hypernasal speech was noted." "" "" "" "" "" "" "" "" "" "" "" "" "0000045251" "00770" "00058660" "01533" "Familial" "10y" "short stature (125 cm; 3rd percentile) and mild learning and behavioural disabilities (hyperactivity and attention deficit). Clinical examination revealed hypertelorism (inner canthal distance 3.5 cm; 97th percentile – outer canthal distance 9.5 cm; 97th percentile), left palpebral ptosis, short nose with anteverted nostrils, long philtrum, posteriorly angulated low-set ears, prominent umbilicus, hyperextensible joints and brachydactyly with cutaneous II–V syndactyly" "" "" "" "" "" "" "" "" "" "" "" "" "0000045252" "00770" "00058661" "01533" "Familial" "7y" "long face, telecanthus (inner canthal distance 3.7 cm; 497th percentile – outer canthal distance 8.5 cm; 80th percentile), short nose with anteverted nostrils, long philtrum, micrognatia and posteriorly angulated low-set ears. He had short stature (105 cm; o3th percentile), pectus excavatum, hyperextensible joints, brachydactyly with cutaneous I–V syndactyly, single palmar creases, hypospadias and right cryptorchidism" "" "" "" "" "" "" "" "" "" "" "" "" "0000045253" "00770" "00058662" "01533" "Unknown" "4y6m" "widow’s peak, hypertelorism, epicanthic folds, down-slanting palpebral fissures with bilateral palpebral ptosis, short and broad nose with anteverted nostrils, IVth and Vth fingers camptodactyly, shawl scrotum and inguinal hernias" "" "" "" "" "" "" "" "" "" "" "" "" "0000045254" "00770" "00058663" "01533" "Unknown" "16y" "hypertelorism , slight downward slant palpebral fissures, short nose, broad philtrum, broad mouth, short broad hand, shawl scrotum . The patient has progressed through puberty satisfactorily attaining a normal height (175 cm)." "" "" "" "" "" "" "" "" "" "" "" "" "0000045255" "00770" "00058664" "01533" "Familial" "2y" "short stature (87 cm, 32 S.D.) and normal intelligence with round faces, prominent foreheads with widow\'s peak, hypertelorism, antimongoloid slant of palpebral fessures, bilateral ptosis, hypoplasia of the midface, short and broad nose with anteverted nostrils and long broad philtrum, small hands and feet; the typical genital appearance reported in AAS (shawl scrotum) was not evident, while bilateral criptorchidism had been surgically corrected" "" "" "" "" "" "" "" "" "" "" "" "" "0000045256" "00770" "00058665" "01533" "Unknown" "13y" "Short stature, Frontal bossing, Hypertelorism, Blepharoptosis, Broad hands and feet , Short fingers, Interdigital webbing, Hyperextensible proximal interphalangeal joints , Flexion of distal interphalangeal joints, Shawl scrotum , Attention deficit/hyperactivity disorder" "" "" "" "" "" "" "" "" "" "" "" "" "0000045257" "00770" "00058666" "01533" "Unknown" "4y" "Aspergersyndrome; short stature, Frontal bossing, Hypertelorism, Broad hands and feet, Short fingers, Interdigital webbing, Hyperextensible proximal interphalangeal joints, Flexion of distal interphalangeal joints, Shawl scrotum" "" "" "" "" "" "" "" "" "" "" "" "" "0000045258" "00770" "00058667" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045259" "00770" "00058668" "01533" "Familial" "8y" "shawl scrotum, pectus excavatum, unilateral clinodactyly V, and a characteristic over-extension of the proximal joint with flexion of the distal joint of the fingers. His toes II–IV displayed a valgus deviation, and the spacing between the first and second toe was increased and a unilateral brain malformation" "" "" "" "" "" "" "" "" "" "" "" "" "0000045260" "00770" "00058669" "01533" "Familial" "" "Short stature, relative macrocephaly and a strikingly similar face with ocular hypertelorism, down- slanting palpebral fissures, ptosis of the upper eyelids, flat philtrum, bow shape of the upper lip and pointed chin. They also had brachydactyly, typical hyperextensibility of the proximal and incomplete extensibility of the distal interphalangeal joints, and transverse palmar crease. Also noted were umbilical hernia, dorsal groove of the penis." "" "" "" "" "" "" "" "" "" "" "" "" "0000045261" "00770" "00058670" "01533" "Familial" "" "Short stature, relative macrocephaly and a strikingly similar face with ocular hypertelorism, down- slanting palpebral fissures, ptosis of the upper eyelids, flat philtrum, bow shape of the upper lip and pointed chin. They also had brachydactyly, typical hyperextensibility of the proximal and incomplete extensibility of the distal interphalangeal joints, and transverse palmar crease. Also noted were inguinal hernia, dorsal and shawl scrotum ." "" "" "" "" "" "" "" "" "" "" "" "" "0000045262" "00770" "00058671" "01533" "Familial" "3y" "Short stature, widow’s peak, hypertelorism, downslanting palpebral fissures, ptosis of the upper eyelids and a short nose with anteverted nares, brachydactyly and cutaneous syndactyly of both hands and a shawl scrotum." "" "" "" "" "" "" "" "" "" "" "" "" "0000045263" "00770" "00058672" "01533" "Familial" "2y" "weight and height a just below the 3rd centile, round face, hypertelorism, ptosis of eyelids, and small nose with upturned nares. The philtrum was wide and the auricles were hypoplastic at their upper segment. He had pigeon chest. The fingers were short, with syndactyly of all fingers and camptodactyly of 3rd finger. A bilateral transverse line was present on both palms, and a single flexion crease was found on both 5th fingers. A shawl scrotum was present with otherwise normal genitalia." "" "" "" "" "" "" "" "" "" "" "" "" "0000045264" "00770" "00058673" "01533" "Unknown" "1y3m" "Ptosis and camptodactyly, his weight was less than 5th percentile, height was 1st percentile and head circumference was 25th percentile. Posteriorly rotated ears, bilateral ptosis, ocular hypertelorism, downslanting palpebral fissures, small upturned nose, high arched palate, bilateral camptodactyly involving 3rd, 4th, and 5th fingers and mild shawl scrotum with right inguinal hernia." "" "" "" "" "" "" "" "" "" "" "" "" "0000045265" "00770" "00058674" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045266" "00770" "00058675" "01533" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000045267" "00770" "00058676" "00006" "Familial, X-linked recessive" "" "Short stature, hypertelorism, brachydactyly, Shawl scrotum, Unguinal hernia, Joint laxity." "" "" "" "" "" "" "" "" "" "" "" "" "0000143905" "00187" "00183151" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "" "mental retardation" "" "0000237121" "00180" "00311873" "00006" "Familial, X-linked recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "AAS" "Robinow syndrome" "" "0000237122" "00180" "00311874" "00006" "Familial, X-linked recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "AAS" "Robinow syndrome" "" "0000242887" "00198" "00324344" "01807" "Unknown" "" "Microcephaly (HP:0000252); Intellectual disability (HP:0001249); Muscular hypotonia (HP:0001252); Global developmental delay (HP:0001263); Failure to thrive (HP:0001508); Genu recurvatum (HP:0002816); Short stature (HP:0004322)" "" "" "" "" "" "" "" "" "" "" "" "" "0000284210" "05611" "00390722" "00006" "Familial, autosomal dominant" "15y6m" "intrauterine growth retardation (-2.2 SD); short stature (-2.0 SD); developmental delay; myopia, hypermetropia, ptosis; thick eyebrows, prominent eyelashes, flat nasal bridge, short nose, broad nasal root and tip, anteverted nares, thick alae nasi, broad philtrum, high and broad forehead and slightly posteriorly rotated ears; mild 5th finger clinodactyly, small nails on his 2nd toes, mild joint laxity; feeding difficulties" "" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000307680" "00770" "00415908" "01164" "Familial, X-linked recessive" "04y" "Delayed speech and language development, Shawl scrotum" "" "" "" "" "" "" "" "" "" "" "" "" "0000317272" "00139" "00426122" "00006" "Familial, X-linked recessive" "6y" "" "" "" "" "" "" "" "" "" "" "Mental retardation, X-linked syndromic 16" "intellectual disability" "" "0000323899" "00770" "00433379" "01164" "Unknown" "31y" "clinical Aarskog-Scott syndrome," "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 51 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000050488" "00050543" "1" "00006" "00006" "2015-09-27 16:16:40" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000058593" "00058631" "1" "00124" "00124" "2009-04-08 14:01:02" "00006" "2010-12-11 21:24:24" "SEQ" "DNA" "" "" "0000058594" "00058632" "1" "00124" "00124" "2009-04-08 14:01:02" "00006" "2010-12-11 21:27:30" "SEQ" "DNA" "" "" "0000058595" "00058633" "1" "00124" "00124" "2009-04-08 14:01:02" "00006" "2010-12-11 21:28:35" "SEQ" "DNA" "" "" "0000058596" "00058634" "1" "00124" "00124" "2009-04-08 14:01:02" "00006" "2010-12-11 21:26:28" "SEQ" "DNA" "" "" "0000058602" "00058640" "1" "01533" "01533" "2010-02-10 11:14:46" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058603" "00058641" "1" "01533" "01533" "2010-02-16 16:36:14" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058604" "00058642" "1" "01533" "01533" "2010-02-16 16:36:14" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058605" "00058643" "1" "01533" "01533" "2010-02-16 16:36:14" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058606" "00058644" "1" "01533" "01533" "2010-02-16 16:36:14" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058607" "00058645" "1" "01533" "01533" "2010-02-16 16:36:14" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058608" "00058646" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC" "DNA" "" "" "0000058609" "00058647" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2011-06-08 21:18:59" "SEQ;SSCA" "DNA" "" "" "0000058610" "00058648" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058611" "00058649" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058612" "00058650" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058613" "00058651" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058614" "00058652" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058615" "00058653" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058616" "00058654" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058617" "00058655" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058618" "00058656" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058619" "00058657" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058620" "00058658" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058621" "00058659" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058622" "00058660" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058623" "00058661" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058624" "00058662" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058625" "00058663" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058626" "00058664" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-12 10:18:30" "SEQ;SSCA" "DNA" "" "" "0000058627" "00058665" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SEQ" "DNA" "" "" "0000058628" "00058666" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SEQ" "DNA" "" "" "0000058629" "00058667" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-12 10:16:31" "SEQ;SSCA" "DNA" "" "" "0000058630" "00058668" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "DHPLC;SEQ" "DNA" "" "" "0000058631" "00058669" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-12 10:20:43" "SEQ;SSCA" "DNA" "" "" "0000058632" "00058670" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-12 10:22:08" "SEQ;SSCA" "DNA" "" "" "0000058633" "00058671" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SSCA;SEQ" "DNA" "" "" "0000058634" "00058672" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "SEQ" "DNA" "15" "" "0000058635" "00058673" "1" "01533" "01533" "2010-02-16 16:36:15" "00006" "2010-12-11 21:13:29" "PCR" "DNA" "1_18" "" "0000058636" "00058674" "1" "01533" "01533" "2010-03-08 09:48:25" "00006" "2010-12-11 20:49:27" "SEQ" "DNA" "10i" "" "0000058637" "00058675" "1" "01533" "01533" "2010-03-08 09:50:01" "00006" "2010-12-11 20:49:27" "SEQ" "DNA" "8" "" "0000058638" "00058676" "1" "00006" "00006" "2012-07-03 15:14:49" "00006" "2016-02-02 23:01:50" "RT-PCR;SEQ" "DNA;RNA" "12i" "" "0000184109" "00183151" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000313045" "00311873" "1" "00006" "00006" "2020-09-29 16:10:21" "" "" "SEQ" "DNA" "" "" "0000313046" "00311874" "1" "00006" "00006" "2020-09-29 16:10:21" "" "" "SEQ" "DNA" "" "" "0000325534" "00324344" "1" "01807" "01807" "2020-12-07 15:33:01" "" "" "SEQ" "DNA" "" "" "0000391963" "00390722" "1" "00006" "00006" "2021-11-11 17:06:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000417189" "00415908" "1" "01164" "01164" "2022-08-17 16:15:21" "" "" "SEQ-NG-I" "DNA" "" "" "0000427442" "00426122" "1" "00006" "00006" "2022-11-28 11:02:11" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000434833" "00433379" "1" "01164" "01164" "2023-03-07 12:14:51" "" "" "SEQ-NG-I" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 47 "{{screeningid}}" "{{geneid}}" "0000050488" "FGD1" "0000058593" "FGD1" "0000058594" "FGD1" "0000058595" "FGD1" "0000058596" "FGD1" "0000058602" "FGD1" "0000058603" "FGD1" "0000058604" "FGD1" "0000058605" "FGD1" "0000058606" "FGD1" "0000058607" "FGD1" "0000058608" "FGD1" "0000058609" "FGD1" "0000058610" "FGD1" "0000058611" "FGD1" "0000058612" "FGD1" "0000058613" "FGD1" "0000058614" "FGD1" "0000058615" "FGD1" "0000058616" "FGD1" "0000058617" "FGD1" "0000058618" "FGD1" "0000058619" "FGD1" "0000058620" "FGD1" "0000058621" "FGD1" "0000058622" "FGD1" "0000058623" "FGD1" "0000058624" "FGD1" "0000058625" "FGD1" "0000058626" "FGD1" "0000058627" "FGD1" "0000058628" "FGD1" "0000058629" "FGD1" "0000058630" "FGD1" "0000058631" "FGD1" "0000058632" "FGD1" "0000058633" "FGD1" "0000058634" "FGD1" "0000058635" "FGD1" "0000058636" "FGD1" "0000058637" "FGD1" "0000058638" "FGD1" "0000184109" "FGD1" "0000313045" "FGD1" "0000313046" "FGD1" "0000417189" "FGD1" "0000434833" "FGD1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 149 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000009030" "0" "30" "X" "54483083" "54483083" "dup" "0" "00037" "FGD1_000037" "g.54483083dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.54456650dup" "" "likely benign" "" "0000010989" "0" "30" "X" "54471920" "54471920" "del" "0" "00037" "FGD1_000038" "g.54471920del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.54445487del" "" "likely benign" "" "0000079468" "21" "90" "X" "54476713" "54476713" "subst" "0" "00006" "FGD1_000036" "g.54476713G>T" "" "{PMID:DDDS 2015:25533962}, {DOI:DDDS 2015:10.1038/nature14135}" "" "" "" "Germline" "" "" "0" "" "" "g.54450280G>T" "" "pathogenic" "" "0000089193" "1" "55" "X" "54521756" "54521756" "subst" "0.0105423" "00124" "FGD1_000001" "g.54521756G>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.54495323G>A" "" "VUS" "" "0000089194" "1" "35" "X" "54476149" "54476149" "subst" "0.072832" "00124" "FGD1_000002" "g.54476149A>G" "3/208 cases" "{PMID:Tarpey 2009:19377476}" "" "p.T697T" "recurrent, found 3 times" "Germline" "" "" "0" "" "" "g.54449716A>G" "" "likely benign" "" "0000089195" "1" "35" "X" "54476104" "54476104" "subst" "0.0657096" "00124" "FGD1_000003" "g.54476104T>C" "3/208 cases" "{PMID:Tarpey 2009:19377476}" "" "p.P712P" "recurrent, found 2 times" "Germline" "" "" "0" "" "" "g.54449671T>C" "" "likely benign" "" "0000089196" "1" "55" "X" "54496615" "54496615" "subst" "0.000298884" "00124" "FGD1_000004" "g.54496615G>A" "1/2018 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.54470182G>A" "" "VUS" "" "0000089202" "21" "95" "X" "54497146" "54497146" "dup" "0" "01533" "FGD1_000005" "g.54497146dup" "?" "{PMID:Fryns 1992:01605221}" "+PspGI, -TspRI" "528 insC, p176fsX16" "" "Germline" "" "" "0" "" "" "g.54470713dup" "" "pathogenic" "" "0000089203" "21" "95" "X" "54497146" "54497146" "dup" "0" "01533" "FGD1_000005" "g.54497146dup" "?" "{PMID:Orrico 2004:14560308}" "+PspGI, -TspRI" "528 insC, p176fsX16" "" "Germline" "" "" "0" "" "" "g.54470713dup" "" "pathogenic" "" "0000089204" "21" "95" "X" "54497146" "54497146" "dup" "0" "01533" "FGD1_000005" "g.54497146dup" "?" "{PMID:Orrico 2004:14560308}" "+PspGI, -TspRI" "528 insC, p176fsX16" "" "Germline" "" "" "0" "" "" "g.54470713dup" "" "pathogenic" "" "0000089205" "21" "95" "X" "54497061" "54497061" "subst" "0" "01533" "FGD1_000006" "g.54497061C>A" "?" "{PMID:Orrico 2004:14560308}" "+FokI, -CviKI_1" "614 G>T, S205I" "" "Germline" "" "" "0" "" "" "g.54470628C>A" "" "pathogenic" "" "0000089206" "0" "95" "X" "54496744" "54496744" "del" "0" "01533" "FGD1_000007" "g.54496744del" "?" "{PMID:Orrico 2010:20082460}" "+Sau96I, -Cac8I" "806 delC, L268fsX359" "" "Germline" "" "" "0" "" "" "g.54470311del" "" "pathogenic" "" "0000089207" "0" "95" "X" "54496577" "54496608" "del" "0" "01533" "FGD1_000008" "g.54496577_54496608del" "?" "{PMID:Orrico 2004:14560308}" "-EaeI, -BslI" "944 975 del 32, P314fsX325" "this mutation most probably arose de novo as it was not present in his mother and sister." "De novo" "" "" "0" "" "" "g.54470144_54470175del" "" "pathogenic" "" "0000089208" "0" "95" "X" "54496604" "54496605" "ins" "0" "01533" "FGD1_000009" "g.54496604_54496605insG" "?" "{PMID:Orrico 2007:17152066}" "+MnlI" "945 insC, P315fsX319" "The absence of the mutation in the maternal grandmother and in three maternal aunts suggests that the mutation likely occurred de novo or from a parental mosaicism." "De novo" "" "" "0" "" "" "g.54470171_54470172insG" "" "pathogenic" "" "0000089209" "0" "95" "X" "54496572" "54496572" "del" "0" "01533" "FGD1_000010" "g.54496572del" "?" "{PMID:Orrico 2004:14560308}" "-" "982delC, P327fsX359" "The 982delC mutation was not present in his phenotypically normal mother. As he is the only affected member in his family, the mutation possibly arose de novo or from a maternal germline mosaicism." "De novo" "" "" "0" "" "" "g.54470139del" "" "pathogenic" "" "0000089210" "0" "95" "X" "54494352" "54494352" "subst" "0" "01533" "FGD1_000011" "g.54494352C>T" "?" "{PMID:Orrico 2010:20082460}" "+AlwNI, -HpaII" "1205 G>A, R402Q" "" "Germline" "" "" "0" "" "" "g.54467919C>T" "" "pathogenic" "" "0000089211" "0" "95" "X" "54491930" "54491930" "subst" "0" "01533" "FGD1_000012" "g.54491930A>T" "?" "{PMID:Orrico 2010:20082460}" "+HpyCH4III" "1590 T>A, Y530X" "" "Germline" "" "" "0" "" "" "g.54465497A>T" "" "pathogenic" "" "0000089212" "0" "95" "X" "54491900" "54491900" "del" "0" "01533" "FGD1_000013" "g.54491900del" "?" "{PMID:Orrico 2010:20082460}" "-" "1620 delC, P539fsX550" "" "Germline" "" "" "0" "" "" "g.54465467del" "" "pathogenic" "" "0000089213" "0" "95" "X" "54482964" "54482964" "subst" "0" "01533" "FGD1_000014" "g.54482964G>C" "?" "{PMID:Orrico 2010:20082460}" "+TspRI, -TaqI" "1673 C>G, S558W" "" "Germline" "" "" "0" "" "" "g.54456531G>C" "" "pathogenic" "" "0000089214" "0" "95" "X" "54482122" "54482122" "subst" "0" "01533" "FGD1_000015" "g.54482122T>G" "?" "{PMID:Orrico 2010:20082460}" "" "IVS11 c.1935+3A>C, splicing" "" "Germline" "" "" "0" "" "" "g.54455689T>G" "" "pathogenic" "" "0000089215" "0" "95" "X" "54481930" "54481930" "subst" "0" "01533" "FGD1_000016" "g.54481930G>A" "?" "{PMID:Orrico 2010:20082460}" "-MnlI, -TaqI" "1966 C>T, R656X" "" "Germline" "" "" "0" "" "" "g.54455497G>A" "" "pathogenic" "" "0000089216" "0" "95" "X" "54481930" "54481930" "subst" "0" "01533" "FGD1_000016" "g.54481930G>A" "?" "{PMID:Orrico 2010:20082460}" "-MnlI, -TaqI" "1966 C>T, R656X" "" "Germline" "" "" "0" "" "" "g.54455497G>A" "" "pathogenic" "" "0000089217" "0" "95" "X" "54481930" "54481930" "subst" "0" "01533" "FGD1_000016" "g.54481930G>A" "?" "{PMID:Orrico 2010:20082460}" "-MnlI, -TaqI" "1966 C>T, R656X" "" "Germline" "" "" "0" "" "" "g.54455497G>A" "" "pathogenic" "" "0000089218" "0" "95" "X" "54476728" "54476730" "del" "0" "01533" "FGD1_000017" "g.54476728_54476730del" "?" "{PMID:Orrico 2010:20082460}" "-" "2020_2022 delGAG, E674del(inframe)" "" "Germline" "" "" "0" "" "" "g.54450295_54450297del" "" "pathogenic" "" "0000089219" "0" "95" "X" "54475608" "54475608" "subst" "0" "01533" "FGD1_000018" "g.54475608T>C" "?" "{PMID:Orrico 2010:20082460}" "-" "2242 A>G, K748E" "" "Germline" "" "" "0" "" "" "g.54449175T>C" "" "pathogenic" "" "0000089220" "21" "95" "X" "54495272" "54495272" "subst" "0" "01533" "FGD1_000019" "g.54495272T>G" "?" "{PMID:Orrico 2004:14560308}" "+HhaI, -Bsp1286I" "1139 A>C, E380A" "" "Germline" "" "" "0" "" "" "g.54468839T>G" "" "pathogenic" "" "0000089221" "21" "95" "X" "54494334" "54494334" "subst" "0" "01533" "FGD1_000020" "g.54494334C>T" "?" "{PMID:Orrico 2005:14560308}" "+DdeI, -NlaIV" "1223 G>A, R408Q" "" "Germline" "" "" "0" "" "" "g.54467901C>T" "" "pathogenic" "" "0000089222" "21" "95" "X" "54494238" "54494241" "del" "0" "01533" "FGD1_000021" "g.54494238_54494241del" "?" "{PMID:Orrico 2004:14560308}" "-MwoI, -AluI" "1316_1319 del AGCT, P438fsX470" "" "Germline" "" "" "0" "" "" "g.54467805_54467808del" "" "pathogenic" "" "0000089223" "21" "95" "X" "54494238" "54494241" "del" "0" "01533" "FGD1_000021" "g.54494238_54494241del" "?" "{PMID:Orrico 2004:14560308}" "-MwoI, -AluI" "1316_1319 del AGCT, P438fsX470" "" "Germline" "" "" "0" "" "" "g.54467805_54467808del" "" "pathogenic" "" "0000089224" "0" "95" "X" "54494229" "54494229" "subst" "0" "01533" "FGD1_000022" "g.54494229C>T" "?" "{PMID:Orrico 2004:14560308}" "-HinP1I -HhaI" "1328 G>A, R443H" "" "Germline" "" "" "0" "" "" "g.54467796C>T" "" "pathogenic" "" "0000089225" "0" "95" "X" "54473794" "54473794" "del" "0" "01533" "FGD1_000023" "g.54473794del" "?" "{PMID:Orrico 2004:14560308}" "-" "2530 delG, F843fsX862" "" "Germline" "" "" "0" "" "" "g.54447361del" "" "pathogenic" "" "0000089226" "0" "95" "X" "54482666" "54482666" "subst" "0" "01533" "FGD1_000024" "g.54482666C>T" "?" "{PMID:Orrico 2000:14560308}, {OMIM300546:0002}" "-" "1829G>A, R610Q" "" "Germline" "" "" "0" "" "" "g.54456233C>T" "" "pathogenic" "" "0000089227" "0" "95" "X" "54494229" "54494229" "subst" "0" "01533" "FGD1_000025" "g.54494229C>A" "?" "{PMID:Kaname 2006:16688726}" "-HinP1I -HhaI" "1328 G>T, R443L" "" "Germline" "" "" "0" "" "" "g.54467796C>A" "" "pathogenic" "" "0000089228" "0" "95" "X" "54475629" "54475629" "subst" "0" "01533" "FGD1_000026" "g.54475629C>A" "?" "{PMID:Kaname 2006:16688726}" "+BsrI, -NlaIV" "2221 G>T, E741X" "" "Germline" "" "" "0" "" "" "g.54449196C>A" "" "pathogenic" "" "0000089229" "0" "95" "X" "54492233" "54492234" "ins" "0" "01533" "FGD1_000027" "g.54492233_54492234insC" "?" "{PMID:Pasteris 1994:07954831}, {OMIM300546:0001}" "+TaqI, -Hpy188III" "insG after 2122 (L464fsX469)" "" "Germline" "" "" "0" "" "" "g.54465800_54465801insC" "" "pathogenic" "" "0000089230" "21" "95" "X" "54492230" "54492230" "subst" "0" "01533" "FGD1_000028" "g.54492230T>C" "?" "{PMID:Bottani 2007:17847065}" "-Hpy188III" "1396 A>G, M466V" "" "Germline" "" "" "0" "" "" "g.54465797T>C" "" "pathogenic" "" "0000089231" "21" "95" "X" "54491955" "54491955" "subst" "0" "01533" "FGD1_000029" "g.54491955C>T" "?" "{PMID:Schwartz 2000:11093277}, {OMIM300546:0003}" "-MwoI, -FauI" "G2296A, R522H" "" "Germline" "" "" "0" "" "" "g.54465522C>T" "" "pathogenic" "" "0000089232" "21" "95" "X" "54491955" "54491955" "subst" "0" "01533" "FGD1_000029" "g.54491955C>T" "?" "{PMID:Schwartz 2000:11093277}, {OMIM300546:0003}" "-MwoI, -FauI" "G2296A, R522H" "" "Germline" "" "" "0" "" "" "g.54465522C>T" "" "pathogenic" "" "0000089233" "0" "95" "X" "54476706" "54482978" "del" "0" "01533" "FGD1_000030" "g.54476706_54482978del" "" "{PMID:Schwartz 2000:11093277}" "BsaI-" "ex9-12del, gross deletion" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.54450273_54456545del" "" "pathogenic" "" "0000089234" "21" "95" "X" "54475661" "54475661" "del" "0" "01533" "FGD1_000031" "g.54475661del" "?" "{PMID:Shalev 2006:16353258}" "-BslI" "2189 delA, E730fsX862" "" "Germline" "" "" "0" "" "" "g.54449228del" "" "pathogenic" "" "0000089235" "0" "95" "X" "54472543" "54521865" "del" "0" "01533" "FGD1_000032" "g.54472543_54521865del" "" "{PMID:Bedoyan 2009:19110080}" "" "complete deletion" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.54446110_54495432del" "" "pathogenic" "" "0000089236" "0" "55" "X" "54482652" "54482652" "subst" "0" "01533" "FGD1_000033" "g.54482652C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.54456219C>A" "" "VUS" "" "0000089237" "0" "55" "X" "54491965" "54491965" "subst" "0" "01533" "FGD1_000034" "g.54491965G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.54465532G>T" "" "VUS" "" "0000089238" "21" "99" "X" "54476770" "54476770" "del" "0" "00006" "FGD1_000035" "g.54476770del" "" "{PMID:Aten 2013:23169394}" "" "" "splicing near complete, no NMD observed" "Germline" "yes" "" "0" "" "" "g.54450337del" "" "pathogenic" "" "0000280772" "0" "30" "X" "54497833" "54497833" "subst" "0.00132056" "02325" "FGD1_000055" "g.54497833C>T" "" "" "" "FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54471400C>T" "" "likely benign" "" "0000280773" "0" "30" "X" "54496615" "54496615" "subst" "0.000298884" "02325" "FGD1_000004" "g.54496615G>A" "" "" "" "FGD1(NM_004463.2):c.935C>T (p.P312L, p.(Pro312Leu)), FGD1(NM_004463.3):c.935C>T (p.P312L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470182G>A" "" "likely benign" "" "0000283170" "0" "50" "X" "54475682" "54475682" "subst" "0" "02329" "FGD1_000043" "g.54475682C>T" "" "" "" "FGD1(NM_004463.2):c.2168G>A (p.(Arg723Gln)), FGD1(NM_004463.3):c.2168G>A (p.R723Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54449249C>T" "" "VUS" "" "0000283910" "0" "10" "X" "54521869" "54521869" "subst" "0.245443" "02326" "FGD1_000056" "g.54521869C>G" "" "" "" "FGD1(NM_004463.3):c.-4G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54495436C>G" "" "benign" "" "0000283911" "0" "10" "X" "54521756" "54521756" "subst" "0.0105423" "02326" "FGD1_000001" "g.54521756G>A" "" "" "" "FGD1(NM_004463.2):c.110C>T (p.(Ala37Val)), FGD1(NM_004463.3):c.110C>T (p.A37V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54495323G>A" "" "benign" "" "0000283912" "0" "30" "X" "54494208" "54494208" "subst" "0.000940768" "02326" "FGD1_000049" "g.54494208G>A" "" "" "" "FGD1(NM_004463.3):c.1340+9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54467775G>A" "" "likely benign" "" "0000283913" "0" "10" "X" "54476590" "54476590" "subst" "0" "02326" "FGD1_000046" "g.54476590G>C" "" "" "" "FGD1(NM_004463.3):c.2046+114C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54450157G>C" "" "benign" "" "0000283914" "0" "30" "X" "54473857" "54473857" "subst" "0" "02326" "FGD1_000041" "g.54473857C>T" "" "" "" "FGD1(NM_004463.3):c.2467G>A (p.V823I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54447424C>T" "" "likely benign" "" "0000283915" "0" "30" "X" "54497833" "54497833" "subst" "0.00132056" "02326" "FGD1_000055" "g.54497833C>T" "" "" "" "FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54471400C>T" "" "likely benign" "" "0000283916" "0" "30" "X" "54496874" "54496874" "subst" "0.00267438" "02326" "FGD1_000053" "g.54496874C>T" "" "" "" "FGD1(NM_004463.2):c.676G>A (p.A226T, p.(Ala226Thr)), FGD1(NM_004463.3):c.676G>A (p.A226T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470441C>T" "" "likely benign" "" "0000283917" "0" "30" "X" "54496615" "54496615" "subst" "0.000298884" "02326" "FGD1_000004" "g.54496615G>A" "" "" "" "FGD1(NM_004463.2):c.935C>T (p.P312L, p.(Pro312Leu)), FGD1(NM_004463.3):c.935C>T (p.P312L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470182G>A" "" "likely benign" "" "0000287374" "0" "90" "X" "54494353" "54494353" "subst" "0" "01943" "FGD1_000050" "g.54494353G>A" "" "" "" "FGD1(NM_004463.2):c.1204C>T (p.R402W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54467920G>A" "" "pathogenic" "" "0000287375" "0" "30" "X" "54492162" "54492162" "subst" "0.000151051" "01943" "FGD1_000047" "g.54492162G>A" "" "" "" "FGD1(NM_004463.2):c.1464C>T (p.S488=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54465729G>A" "" "likely benign" "" "0000287376" "0" "50" "X" "54472606" "54472606" "subst" "0" "01943" "FGD1_000039" "g.54472606G>A" "" "" "" "FGD1(NM_004463.2):c.2822C>T (p.P941L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54446173G>A" "" "VUS" "" "0000287377" "0" "30" "X" "54496874" "54496874" "subst" "0.00267438" "01943" "FGD1_000053" "g.54496874C>T" "" "" "" "FGD1(NM_004463.2):c.676G>A (p.A226T, p.(Ala226Thr)), FGD1(NM_004463.3):c.676G>A (p.A226T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470441C>T" "" "likely benign" "" "0000334275" "0" "10" "X" "54472699" "54472699" "subst" "0.00148347" "01804" "FGD1_000040" "g.54472699C>T" "" "" "" "FGD1(NM_004463.2):c.2729G>A (p.R910Q, p.(Arg910Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54446266C>T" "" "benign" "" "0000334277" "0" "50" "X" "54475682" "54475682" "subst" "0" "01804" "FGD1_000043" "g.54475682C>T" "" "" "" "FGD1(NM_004463.2):c.2168G>A (p.(Arg723Gln)), FGD1(NM_004463.3):c.2168G>A (p.R723Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54449249C>T" "" "VUS" "" "0000334279" "0" "50" "X" "54492214" "54492214" "subst" "0" "01804" "FGD1_000048" "g.54492214A>G" "" "" "" "FGD1(NM_004463.2):c.1412T>C (p.(Val471Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54465781A>G" "" "VUS" "" "0000334280" "0" "50" "X" "54496838" "54496838" "subst" "0" "01804" "FGD1_000052" "g.54496838G>A" "" "" "" "FGD1(NM_004463.2):c.712C>T (p.(Pro238Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470405G>A" "" "VUS" "" "0000334281" "0" "30" "X" "54496874" "54496874" "subst" "0.00267438" "01804" "FGD1_000053" "g.54496874C>T" "" "" "" "FGD1(NM_004463.2):c.676G>A (p.A226T, p.(Ala226Thr)), FGD1(NM_004463.3):c.676G>A (p.A226T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470441C>T" "" "likely benign" "" "0000334282" "0" "50" "X" "54497145" "54497145" "subst" "0" "01804" "FGD1_000054" "g.54497145A>G" "" "" "" "FGD1(NM_004463.2):c.530T>C (p.(Leu177Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470712A>G" "" "VUS" "" "0000341414" "0" "10" "X" "54521756" "54521756" "subst" "0.0105423" "02327" "FGD1_000001" "g.54521756G>A" "" "" "" "FGD1(NM_004463.2):c.110C>T (p.(Ala37Val)), FGD1(NM_004463.3):c.110C>T (p.A37V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54495323G>A" "" "benign" "" "0000341550" "0" "90" "X" "54476192" "54476192" "subst" "0" "02327" "FGD1_000058" "g.54476192G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54449759G>T" "" "pathogenic" "" "0000341856" "0" "10" "X" "54497833" "54497833" "subst" "0.00132056" "02327" "FGD1_000055" "g.54497833C>T" "" "" "" "FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54471400C>T" "" "benign" "" "0000342160" "0" "90" "X" "54497098" "54497098" "subst" "0" "02327" "FGD1_000063" "g.54497098G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54470665G>A" "" "pathogenic" "" "0000343045" "0" "90" "X" "54491964" "54491964" "subst" "0" "02327" "FGD1_000059" "g.54491964C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54465531C>T" "" "pathogenic" "" "0000343216" "0" "90" "X" "54481930" "54481930" "subst" "0" "02327" "FGD1_000016" "g.54481930G>A" "" "" "" "FGD1(NM_004463.3):c.1966C>T (p.(Arg656*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54455497G>A" "" "pathogenic" "" "0000343735" "0" "30" "X" "54495275" "54495275" "subst" "5.69113E-6" "02327" "FGD1_000061" "g.54495275T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54468842T>C" "" "likely benign" "" "0000347200" "0" "70" "X" "54492001" "54492001" "subst" "0" "02327" "FGD1_000060" "g.54492001G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.54465568G>C" "" "likely pathogenic" "" "0000408078" "21" "90" "X" "54476728" "54476730" "del" "0" "00006" "FGD1_000065" "g.54476728_54476730del" "" "{PMID:Hu 2016:25644381}" "" "FGD1 E676del" "" "Germline" "yes" "" "0" "" "" "g.54450295_54450297del" "" "pathogenic" "" "0000576716" "0" "30" "X" "54469894" "54469894" "subst" "0.00461063" "01804" "FGD1_000066" "g.54469894T>C" "" "" "" "TSR2(NM_058163.1):c.234T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54443461T>C" "" "likely benign" "" "0000576717" "0" "10" "X" "54472699" "54472699" "subst" "0.00148347" "01943" "FGD1_000040" "g.54472699C>T" "" "" "" "FGD1(NM_004463.2):c.2729G>A (p.R910Q, p.(Arg910Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54446266C>T" "" "benign" "" "0000576718" "0" "50" "X" "54475366" "54475366" "subst" "0" "01943" "FGD1_000067" "g.54475366C>T" "" "" "" "FGD1(NM_004463.2):c.2309G>A (p.R770H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54448933C>T" "" "VUS" "" "0000576719" "0" "30" "X" "54475582" "54475582" "subst" "0.000588998" "01943" "FGD1_000068" "g.54475582G>A" "" "" "" "FGD1(NM_004463.2):c.2268C>T (p.C756=), FGD1(NM_004463.3):c.2268C>T (p.C756=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54449149G>A" "" "likely benign" "" "0000576720" "0" "50" "X" "54475682" "54475682" "subst" "0" "02325" "FGD1_000043" "g.54475682C>T" "" "" "" "FGD1(NM_004463.2):c.2168G>A (p.(Arg723Gln)), FGD1(NM_004463.3):c.2168G>A (p.R723Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54449249C>T" "" "VUS" "" "0000576722" "0" "30" "X" "54476198" "54476198" "subst" "9.00901E-5" "02326" "FGD1_000069" "g.54476198G>T" "" "" "" "FGD1(NM_004463.3):c.2047-5C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54449765G>T" "" "likely benign" "" "0000576723" "0" "30" "X" "54476707" "54476707" "subst" "0.000195749" "02326" "FGD1_000070" "g.54476707G>A" "" "" "" "FGD1(NM_004463.2):c.2043C>T (p.V681=), FGD1(NM_004463.3):c.2043C>T (p.V681=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54450274G>A" "" "likely benign" "" "0000576724" "0" "90" "X" "54483001" "54483002" "del" "0" "02327" "FGD1_000071" "g.54483001_54483002del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54456568_54456569del" "" "pathogenic" "" "0000576725" "0" "70" "X" "54491974" "54491974" "subst" "0" "02327" "FGD1_000072" "g.54491974G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54465541G>A" "" "likely pathogenic" "" "0000576726" "0" "50" "X" "54492139" "54492139" "subst" "0" "01943" "FGD1_000073" "g.54492139T>C" "" "" "" "FGD1(NM_004463.2):c.1487A>G (p.H496R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54465706T>C" "" "VUS" "" "0000576728" "0" "50" "X" "54496524" "54496524" "subst" "0" "02327" "FGD1_000075" "g.54496524C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54470091C>G" "" "VUS" "" "0000576730" "0" "30" "X" "54497833" "54497833" "subst" "0.00132056" "01943" "FGD1_000055" "g.54497833C>T" "" "" "" "FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54471400C>T" "" "likely benign" "" "0000576731" "0" "30" "X" "54497833" "54497833" "subst" "0.00132056" "01804" "FGD1_000055" "g.54497833C>T" "" "" "" "FGD1(NM_004463.2):c.395G>A (p.R132Q, p.(Arg132Gln)), FGD1(NM_004463.3):c.395G>A (p.R132Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54471400C>T" "" "likely benign" "" "0000619723" "0" "30" "X" "54482932" "54482932" "subst" "1.6911E-5" "02326" "FGD1_000078" "g.54482932G>A" "" "" "" "FGD1(NM_004463.3):c.1695+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54456499G>A" "" "likely benign" "" "0000619724" "0" "50" "X" "54496778" "54496778" "subst" "3.56163E-5" "01943" "FGD1_000079" "g.54496778C>T" "" "" "" "FGD1(NM_004463.2):c.772G>A (p.E258K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54470345C>T" "" "VUS" "" "0000619726" "0" "30" "X" "54521665" "54521665" "subst" "0" "01804" "FGD1_000080" "g.54521665G>T" "" "" "" "FGD1(NM_004463.2):c.201C>A (p.(Ser67Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54495232G>T" "" "likely benign" "" "0000619727" "0" "30" "X" "54521732" "54521732" "subst" "0" "01943" "FGD1_000081" "g.54521732C>T" "" "" "" "FGD1(NM_004463.2):c.134G>A (p.R45H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54495299C>T" "" "likely benign" "" "0000619728" "0" "50" "X" "54521781" "54521781" "subst" "9.92654E-5" "01943" "FGD1_000082" "g.54521781C>G" "" "" "" "FGD1(NM_004463.2):c.85G>C (p.A29P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54495348C>G" "" "VUS" "" "0000624675" "0" "30" "X" "54475361" "54475361" "subst" "6.89255E-5" "01943" "FGD1_000077" "g.54475361C>T" "" "" "" "FGD1(NM_004463.2):c.2314G>A (p.V772I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54448928C>T" "" "likely benign" "" "0000659393" "0" "90" "X" "54482662" "54482662" "subst" "0" "02327" "FGD1_000083" "g.54482662G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54456229G>T" "" "pathogenic" "" "0000659394" "0" "30" "X" "54496730" "54496730" "subst" "0" "01943" "FGD1_000084" "g.54496730C>T" "" "" "" "FGD1(NM_004463.2):c.820G>A (p.D274N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.54470297C>T" "" "likely benign" "" "0000682533" "0" "30" "X" "54466866" "54466866" "subst" "0" "01943" "FGD1_000085" "g.54466866T>C" "" "" "" "TSR2(NM_058163.2):c.12T>C (p.A4=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682534" "0" "70" "X" "54472700" "54472700" "subst" "0" "02327" "FGD1_000086" "g.54472700G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000682535" "0" "30" "X" "54475380" "54475380" "subst" "0" "01943" "FGD1_000087" "g.54475380G>A" "" "" "" "FGD1(NM_004463.2):c.2295C>T (p.S765=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682536" "0" "30" "X" "54475582" "54475582" "subst" "0.000588998" "02326" "FGD1_000068" "g.54475582G>A" "" "" "" "FGD1(NM_004463.2):c.2268C>T (p.C756=), FGD1(NM_004463.3):c.2268C>T (p.C756=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682537" "0" "70" "X" "54476194" "54476194" "subst" "0" "02327" "FGD1_000088" "g.54476194C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000682538" "0" "70" "X" "54482148" "54482149" "ins" "0" "01804" "FGD1_000089" "g.54482148_54482149insGG" "" "" "" "FGD1(NM_004463.2):c.1912_1913insCC (p.(Arg638ProfsTer5))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000682539" "0" "30" "X" "54496574" "54496574" "subst" "1.71124E-5" "01943" "FGD1_000090" "g.54496574C>T" "" "" "" "FGD1(NM_004463.2):c.976G>A (p.D326N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682540" "0" "30" "X" "54496855" "54496855" "subst" "0" "01804" "FGD1_000091" "g.54496855G>A" "" "" "" "FGD1(NM_004463.2):c.695C>T (p.(Pro232Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682541" "0" "50" "X" "54497112" "54497112" "subst" "0" "02326" "FGD1_000092" "g.54497112A>T" "" "" "" "FGD1(NM_004463.3):c.563T>A (p.L188Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682542" "0" "30" "X" "54497129" "54497129" "subst" "0" "02326" "FGD1_000093" "g.54497129A>T" "" "" "" "FGD1(NM_004463.3):c.546T>A (p.P182=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682543" "0" "50" "X" "54521753" "54521753" "subst" "0" "01804" "FGD1_000094" "g.54521753G>C" "" "" "" "FGD1(NM_004463.2):c.113C>G (p.(Ser38Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693670" "0" "30" "X" "54467146" "54467146" "subst" "0" "01943" "FGD1_000095" "g.54467146G>A" "" "" "" "TSR2(NM_058163.2):c.105G>A (p.G35=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693671" "0" "30" "X" "54496615" "54496615" "subst" "0.000298884" "01943" "FGD1_000004" "g.54496615G>A" "" "" "" "FGD1(NM_004463.2):c.935C>T (p.P312L, p.(Pro312Leu)), FGD1(NM_004463.3):c.935C>T (p.P312L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000694771" "0" "90" "X" "54496658" "54496658" "dup" "0" "00006" "FGD1_000096" "g.54496658dup" "" "{PMID:White 2018:29276006}" "" "" "" "Germline" "" "" "0" "" "" "g.54470225dup" "" "pathogenic (recessive)" "" "0000694772" "0" "90" "X" "54497148" "54497148" "dup" "0" "00006" "FGD1_000064" "g.54497148dup" "" "{PMID:White 2018:29276006}" "" "" "" "Germline" "" "" "0" "" "" "g.54470715dup" "" "pathogenic (recessive)" "" "0000708549" "3" "90" "X" "54472693" "54472693" "subst" "0" "01807" "FGD1_000097" "g.54472693C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000729062" "0" "90" "X" "54476123" "54476124" "del" "0" "02329" "FGD1_000045" "g.54476123_54476124del" "" "" "" "FGD1(NM_004463.3):c.2116_2117delAG (p.R706Gfs*3)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000729063" "0" "30" "X" "54476707" "54476707" "subst" "0.000195749" "01943" "FGD1_000070" "g.54476707G>A" "" "" "" "FGD1(NM_004463.2):c.2043C>T (p.V681=), FGD1(NM_004463.3):c.2043C>T (p.V681=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000729064" "0" "90" "X" "54494229" "54494229" "subst" "0" "02327" "FGD1_000022" "g.54494229C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000729065" "0" "30" "X" "54495247" "54495247" "subst" "0" "01943" "FGD1_000098" "g.54495247G>A" "" "" "" "FGD1(NM_004463.2):c.1164C>T (p.Y388=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000729066" "0" "90" "X" "54496587" "54496612" "del" "0" "02329" "FGD1_000051" "g.54496587_54496612del" "" "" "" "FGD1(NM_004463.3):c.939_964delGCCCCCTGCCCTGGCTAGTGTGCCTG (p.P314Cfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000729067" "0" "50" "X" "54496661" "54496661" "subst" "0" "01943" "FGD1_000099" "g.54496661T>A" "" "" "" "FGD1(NM_004463.2):c.889A>T (p.T297S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810542" "0" "30" "X" "54473804" "54473804" "subst" "3.3634E-5" "01943" "FGD1_000100" "g.54473804C>T" "" "" "" "FGD1(NM_004463.2):c.2520G>A (p.K840=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810543" "0" "50" "X" "54473819" "54473819" "subst" "1.12245E-5" "01943" "FGD1_000101" "g.54473819G>A" "" "" "" "FGD1(NM_004463.2):c.2505C>T (p.G835=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810544" "0" "30" "X" "54482633" "54482633" "subst" "0.00050111" "02326" "FGD1_000102" "g.54482633A>G" "" "" "" "FGD1(NM_004463.3):c.1842+20T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810545" "0" "50" "X" "54491895" "54491895" "subst" "0" "01943" "FGD1_000103" "g.54491895T>C" "" "" "" "FGD1(NM_004463.2):c.1625A>G (p.K542R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000810546" "0" "30" "X" "54491903" "54491903" "subst" "0.00056125" "01943" "FGD1_000104" "g.54491903C>T" "" "" "" "FGD1(NM_004463.2):c.1617G>A (p.P539=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000810547" "0" "30" "X" "54521585" "54521585" "subst" "0.000209588" "01804" "FGD1_000105" "g.54521585T>C" "" "" "" "FGD1(NM_004463.2):c.281A>G (p.(His94Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000822038" "21" "50" "X" "54475581" "54475581" "subst" "0" "00006" "FGD1_000106" "g.54475581C>T" "" "{PMID:Gazdagh 2019:29698805}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000856712" "0" "50" "X" "54475379" "54475379" "subst" "0" "02325" "FGD1_000107" "g.54475379C>T" "" "" "" "FGD1(NM_004463.3):c.2296G>A (p.E766K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856713" "0" "30" "X" "54497828" "54497828" "subst" "5.59491E-6" "01804" "FGD1_000111" "g.54497828G>A" "" "" "" "FGD1(NM_004463.2):c.400C>T (p.(Arg134Cys)), FGD1(NM_004463.3):c.400C>T (p.R134C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856714" "0" "30" "X" "54521797" "54521797" "subst" "0" "01943" "FGD1_000112" "g.54521797C>T" "" "" "" "FGD1(NM_004463.2):c.69G>A (p.P23=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867472" "0" "70" "X" "54491965" "54491965" "subst" "0" "02329" "FGD1_000108" "g.54491965G>A" "" "" "" "FGD1(NM_004463.3):c.1555C>T (p.R519C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000867473" "0" "30" "X" "54496518" "54496518" "subst" "0" "01804" "FGD1_000109" "g.54496518G>C" "" "" "" "FGD1(NM_004463.2):c.1032C>G (p.(Asp344Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867474" "0" "30" "X" "54497198" "54497198" "subst" "0" "01804" "FGD1_000110" "g.54497198A>C" "" "" "" "FGD1(NM_004463.2):c.482-5T>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000876763" "0" "70" "X" "54473810" "54473810" "subst" "0" "01164" "FGD1_000113" "g.54473810C>T" "" "" "" "" "" "Germline" "?" "" "" "" "" "g.54447377C>T" "" "likely pathogenic (recessive)" "ACMG" "0000896300" "0" "50" "X" "54492272" "54492272" "subst" "0" "02327" "FGD1_000114" "g.54492272G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000904802" "20" "70" "X" "54482795" "54482795" "subst" "0" "00006" "FGD1_000115" "g.54482795C>T" "" "{PMID:Al-Kasbi 2022:36344539}" "" "" "" "Germline" "" "" "0" "" "" "g.54456362C>T" "" "VUS" "" "0000915742" "0" "30" "X" "54496615" "54496615" "subst" "0.000298884" "01804" "FGD1_000004" "g.54496615G>A" "" "" "" "FGD1(NM_004463.2):c.935C>T (p.P312L, p.(Pro312Leu)), FGD1(NM_004463.3):c.935C>T (p.P312L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915743" "0" "30" "X" "54521775" "54521775" "subst" "0" "01804" "FGD1_000116" "g.54521775C>A" "" "" "" "FGD1(NM_004463.2):c.91G>T (p.(Ala31Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000920726" "0" "70" "X" "54491882" "54491882" "subst" "0" "01164" "FGD1_000117" "g.54491882A>G" "" "" "" "" "ACMG: PVS1, PM2_SUP" "Germline" "?" "" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG" "0000951778" "0" "50" "X" "54492242" "54492242" "subst" "0" "02329" "FGD1_000118" "g.54492242G>A" "" "" "" "FGD1(NM_004463.3):c.1384C>T (p.P462S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951779" "0" "30" "X" "54521756" "54521756" "subst" "0.0105423" "01804" "FGD1_000001" "g.54521756G>A" "" "" "" "FGD1(NM_004463.2):c.110C>T (p.(Ala37Val)), FGD1(NM_004463.3):c.110C>T (p.A37V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984761" "0" "50" "X" "54467324" "54467324" "subst" "0" "01804" "FGD1_000119" "g.54467324G>A" "" "" "" "TSR2(NM_001346790.2):c.-105G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984762" "0" "30" "X" "54470494" "54470494" "subst" "0.000173623" "01804" "FGD1_000120" "g.54470494T>C" "" "" "" "TSR2(NM_058163.3):c.318T>C (p.(Ala106=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984764" "0" "50" "X" "54492218" "54492218" "subst" "0" "02327" "FGD1_000122" "g.54492218A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006873" "0" "50" "X" "54473775" "54473775" "subst" "0" "02327" "FGD1_000123" "g.54473775G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001006874" "0" "30" "X" "54482153" "54482153" "subst" "0" "02327" "FGD1_000124" "g.54482153C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044417" "0" "90" "X" "54481930" "54481930" "subst" "0" "01804" "FGD1_000016" "g.54481930G>A" "" "" "" "FGD1(NM_004463.3):c.1966C>T (p.(Arg656*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001044418" "0" "30" "X" "54496565" "54496565" "subst" "0" "02326" "FGD1_000125" "g.54496565G>A" "" "" "" "FGD1(NM_004463.3):c.985C>T (p.R329W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001044419" "0" "30" "X" "54497828" "54497828" "subst" "5.59491E-6" "02326" "FGD1_000111" "g.54497828G>A" "" "" "" "FGD1(NM_004463.2):c.400C>T (p.(Arg134Cys)), FGD1(NM_004463.3):c.400C>T (p.R134C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046872" "0" "90" "X" "54497155" "54497155" "dup" "0" "02325" "FGD1_000064" "g.54497155dup" "" "" "" "FGD1(NM_004463.3):c.527dupC (p.L177Tfs*40)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001057342" "0" "30" "X" "54481969" "54481969" "subst" "0" "01804" "FGD1_000126" "g.54481969A>T" "" "" "" "FGD1(NM_004463.3):c.1936-9T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001057343" "0" "50" "X" "54521798" "54521798" "subst" "1.21951E-5" "01804" "FGD1_000127" "g.54521798G>C" "" "" "" "FGD1(NM_004463.3):c.68C>G (p.(Pro23Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes FGD1 ## Count = 149 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000009030" "00001217" "30" "1637" "-72" "1637" "-72" "c.1637-72dup" "r.(=)" "p.(=)" "8i" "0000010989" "00001217" "30" "3509" "0" "3509" "0" "c.*623del" "r.(=)" "p.(=)" "18" "0000079468" "00001217" "90" "2037" "0" "2037" "0" "c.2037C>A" "r.(?)" "p.(Asp679Glu)" "13" "0000089193" "00001217" "55" "110" "0" "110" "0" "c.110C>T" "r.(?)" "p.(Ala37Val)" "1" "0000089194" "00001217" "35" "2091" "0" "2091" "0" "c.2091T>C" "r.(?)" "p.(=)" "14" "0000089195" "00001217" "35" "2136" "0" "2136" "0" "c.2136A>G" "r.(?)" "p.(=)" "14" "0000089196" "00001217" "55" "935" "0" "935" "0" "c.935C>T" "r.(?)" "p.(Pro312Leu)" "4" "0000089202" "00001217" "95" "529" "0" "529" "0" "c.529dup" "r.(?)" "p.(Leu177Profs*40)" "3" "0000089203" "00001217" "95" "529" "0" "529" "0" "c.529dup" "r.(?)" "p.(Leu177Profs*40)" "3" "0000089204" "00001217" "95" "529" "0" "529" "0" "c.529dup" "r.(?)" "p.(Leu177Profs*40)" "3" "0000089205" "00001217" "95" "614" "0" "614" "0" "c.614G>T" "r.(?)" "p.(Ser205Ile)" "3" "0000089206" "00001217" "95" "806" "0" "806" "0" "c.806del" "r.(?)" "p.(Ala269Valfs*91)" "4" "0000089207" "00001217" "95" "944" "0" "975" "0" "c.944_975del" "r.(?)" "p.(Pro315Argfs*11)" "4" "0000089208" "00001217" "95" "945" "0" "946" "0" "c.945_946insC" "r.(?)" "p.(Ala316Argfs*4)" "4" "0000089209" "00001217" "95" "982" "0" "982" "0" "c.982del" "r.(?)" "p.(His328Thrfs*32)" "4" "0000089210" "00001217" "95" "1205" "0" "1205" "0" "c.1205G>A" "r.(?)" "p.(Arg402Gln)" "6" "0000089211" "00001217" "95" "1590" "0" "1590" "0" "c.1590T>A" "r.(?)" "p.(Tyr530*)" "8" "0000089212" "00001217" "95" "1620" "0" "1620" "0" "c.1620del" "r.(?)" "p.(Asp540Glufs*11)" "8" "0000089213" "00001217" "95" "1673" "0" "1673" "0" "c.1673C>G" "r.(?)" "p.(Ser558Trp)" "9" "0000089214" "00001217" "95" "1935" "3" "1935" "3" "c.1935+3A>C" "r.spl?" "p.?" "11i" "0000089215" "00001217" "95" "1966" "0" "1966" "0" "c.1966C>T" "r.(?)" "p.(Arg656*)" "12" "0000089216" "00001217" "95" "1966" "0" "1966" "0" "c.1966C>T" "r.(?)" "p.(Arg656*)" "12" "0000089217" "00001217" "95" "1966" "0" "1966" "0" "c.1966C>T" "r.(?)" "p.(Arg656*)" "12" "0000089218" "00001217" "95" "2026" "0" "2028" "0" "c.2026_2028del" "r.(?)" "p.(Glu676del)" "13" "0000089219" "00001217" "95" "2242" "0" "2242" "0" "c.2242A>G" "r.(?)" "p.(Lys748Glu)" "15" "0000089220" "00001217" "95" "1139" "0" "1139" "0" "c.1139A>C" "r.(?)" "p.(Glu380Ala)" "5" "0000089221" "00001217" "95" "1223" "0" "1223" "0" "c.1223G>A" "r.(?)" "p.(Arg408Gln)" "6" "0000089222" "00001217" "95" "1318" "0" "1321" "0" "c.1318_1321del" "r.(?)" "p.(Leu440Argfs*31)" "6" "0000089223" "00001217" "95" "1318" "0" "1321" "0" "c.1318_1321del" "r.(?)" "p.(Leu440Argfs*31)" "6" "0000089224" "00001217" "95" "1328" "0" "1328" "0" "c.1328G>A" "r.(?)" "p.(Arg443His)" "6" "0000089225" "00001217" "95" "2530" "0" "2530" "0" "c.2530del" "r.(?)" "p.(Val844Trpfs*19)" "17" "0000089226" "00001217" "95" "1829" "0" "1829" "0" "c.1829G>A" "r.(?)" "p.(Arg610Gln)" "10" "0000089227" "00001217" "95" "1328" "0" "1328" "0" "c.1328G>T" "r.(?)" "p.(Arg443Leu)" "6" "0000089228" "00001217" "95" "2221" "0" "2221" "0" "c.2221G>T" "r.(?)" "p.(Glu741*)" "15" "0000089229" "00001217" "95" "1392" "0" "1393" "0" "c.1392_1393insG" "r.(?)" "p.(Lys465Glufs*5)" "7" "0000089230" "00001217" "95" "1396" "0" "1396" "0" "c.1396A>G" "r.(?)" "p.(Met466Val)" "7" "0000089231" "00001217" "95" "1565" "0" "1565" "0" "c.1565G>A" "r.(?)" "p.(Arg522His)" "8" "0000089232" "00001217" "95" "1565" "0" "1565" "0" "c.1565G>A" "r.(?)" "p.(Arg522His)" "8" "0000089233" "00001217" "95" "1659" "1" "2044" "-1" "c.1659+?_2044-?del" "r.(?)" "p.0?" "9_13" "0000089234" "00001217" "95" "2192" "0" "2192" "0" "c.2192del" "r.(?)" "p.(Lys731Argfs*132)" "15" "0000089235" "00001217" "95" "1" "-1" "2885" "1" "c.1-?_2885+?del" "r.0?" "p.0?" "_1_18_" "0000089236" "00001217" "55" "1842" "1" "1842" "1" "c.1842+1G>T" "r.spl?" "p.?" "10i" "0000089237" "00001217" "55" "1555" "0" "1555" "0" "c.1555C>A" "r.(?)" "p.(Arg519Ser)" "8" "0000089238" "00001217" "99" "2016" "-35" "2016" "-35" "c.2016-35del" "r.2016_2046del" "p.Thr673Profs*7" "12i" "0000280772" "00001217" "30" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Arg132Gln)" "" "0000280773" "00001217" "30" "935" "0" "935" "0" "c.935C>T" "r.(?)" "p.(Pro312Leu)" "" "0000283170" "00001217" "50" "2168" "0" "2168" "0" "c.2168G>A" "r.(?)" "p.(Arg723Gln)" "" "0000283910" "00001217" "10" "-4" "0" "-4" "0" "c.-4G>C" "r.(?)" "p.(=)" "" "0000283911" "00001217" "10" "110" "0" "110" "0" "c.110C>T" "r.(?)" "p.(Ala37Val)" "" "0000283912" "00001217" "30" "1340" "9" "1340" "9" "c.1340+9C>T" "r.(=)" "p.(=)" "" "0000283913" "00001217" "10" "2046" "114" "2046" "114" "c.2046+114C>G" "r.(=)" "p.(=)" "" "0000283914" "00001217" "30" "2467" "0" "2467" "0" "c.2467G>A" "r.(?)" "p.(Val823Ile)" "" "0000283915" "00001217" "30" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Arg132Gln)" "" "0000283916" "00001217" "30" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "" "0000283917" "00001217" "30" "935" "0" "935" "0" "c.935C>T" "r.(?)" "p.(Pro312Leu)" "" "0000287374" "00001217" "90" "1204" "0" "1204" "0" "c.1204C>T" "r.(?)" "p.(Arg402Trp)" "" "0000287375" "00001217" "30" "1464" "0" "1464" "0" "c.1464C>T" "r.(?)" "p.(Ser488=)" "" "0000287376" "00001217" "50" "2822" "0" "2822" "0" "c.2822C>T" "r.(?)" "p.(Pro941Leu)" "" "0000287377" "00001217" "30" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "" "0000334275" "00001217" "10" "2729" "0" "2729" "0" "c.2729G>A" "r.(?)" "p.(Arg910Gln)" "" "0000334277" "00001217" "50" "2168" "0" "2168" "0" "c.2168G>A" "r.(?)" "p.(Arg723Gln)" "" "0000334279" "00001217" "50" "1412" "0" "1412" "0" "c.1412T>C" "r.(?)" "p.(Val471Ala)" "" "0000334280" "00001217" "50" "712" "0" "712" "0" "c.712C>T" "r.(?)" "p.(Pro238Ser)" "" "0000334281" "00001217" "30" "676" "0" "676" "0" "c.676G>A" "r.(?)" "p.(Ala226Thr)" "" "0000334282" "00001217" "50" "530" "0" "530" "0" "c.530T>C" "r.(?)" "p.(Leu177Pro)" "" "0000341414" "00001217" "10" "110" "0" "110" "0" "c.110C>T" "r.(?)" "p.(Ala37Val)" "" "0000341550" "00001217" "90" "2048" "0" "2048" "0" "c.2048C>A" "r.(?)" "p.(Ala683Asp)" "" "0000341856" "00001217" "10" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Arg132Gln)" "" "0000342160" "00001217" "90" "577" "0" "577" "0" "c.577C>T" "r.(?)" "p.(Arg193Ter)" "" "0000343045" "00001217" "90" "1556" "0" "1556" "0" "c.1556G>A" "r.(?)" "p.(Arg519His)" "" "0000343216" "00001217" "90" "1966" "0" "1966" "0" "c.1966C>T" "r.(?)" "p.(Arg656Ter)" "" "0000343735" "00001217" "30" "1136" "0" "1136" "0" "c.1136A>G" "r.(?)" "p.(Asn379Ser)" "" "0000347200" "00001217" "70" "1519" "0" "1519" "0" "c.1519C>G" "r.(?)" "p.(Leu507Val)" "" "0000408078" "00001217" "00" "2026" "0" "2028" "0" "c.2026_2028del" "r.(?)" "p.(Glu676del)" "" "0000576716" "00001217" "30" "5534" "0" "5534" "0" "c.*2648A>G" "r.(=)" "p.(=)" "" "0000576717" "00001217" "10" "2729" "0" "2729" "0" "c.2729G>A" "r.(?)" "p.(Arg910Gln)" "" "0000576718" "00001217" "50" "2309" "0" "2309" "0" "c.2309G>A" "r.(?)" "p.(Arg770His)" "" "0000576719" "00001217" "30" "2268" "0" "2268" "0" "c.2268C>T" "r.(?)" "p.(Cys756=)" "" "0000576720" "00001217" "50" "2168" "0" "2168" "0" "c.2168G>A" "r.(?)" "p.(Arg723Gln)" "" "0000576722" "00001217" "30" "2047" "-5" "2047" "-5" "c.2047-5C>A" "r.spl?" "p.?" "" "0000576723" "00001217" "30" "2043" "0" "2043" "0" "c.2043C>T" "r.(?)" "p.(Val681=)" "" "0000576724" "00001217" "90" "1637" "0" "1638" "0" "c.1637_1638del" "r.(?)" "p.(Lys546IlefsTer24)" "" "0000576725" "00001217" "70" "1546" "0" "1546" "0" "c.1546C>T" "r.(?)" "p.(Pro516Ser)" "" "0000576726" "00001217" "50" "1487" "0" "1487" "0" "c.1487A>G" "r.(?)" "p.(His496Arg)" "" "0000576728" "00001217" "50" "1026" "0" "1026" "0" "c.1026G>C" "r.(?)" "p.(Glu342Asp)" "" "0000576730" "00001217" "30" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Arg132Gln)" "" "0000576731" "00001217" "30" "395" "0" "395" "0" "c.395G>A" "r.(?)" "p.(Arg132Gln)" "" "0000619723" "00001217" "30" "1695" "10" "1695" "10" "c.1695+10C>T" "r.(=)" "p.(=)" "" "0000619724" "00001217" "50" "772" "0" "772" "0" "c.772G>A" "r.(?)" "p.(Glu258Lys)" "" "0000619726" "00001217" "30" "201" "0" "201" "0" "c.201C>A" "r.(?)" "p.(Ser67Arg)" "" "0000619727" "00001217" "30" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Arg45His)" "" "0000619728" "00001217" "50" "85" "0" "85" "0" "c.85G>C" "r.(?)" "p.(Ala29Pro)" "" "0000624675" "00001217" "30" "2314" "0" "2314" "0" "c.2314G>A" "r.(?)" "p.(Val772Ile)" "" "0000659393" "00001217" "90" "1833" "0" "1833" "0" "c.1833C>A" "r.(?)" "p.(Tyr611Ter)" "" "0000659394" "00001217" "30" "820" "0" "820" "0" "c.820G>A" "r.(?)" "p.(Asp274Asn)" "" "0000682533" "00001217" "30" "8562" "0" "8562" "0" "c.*5676A>G" "r.(=)" "p.(=)" "" "0000682534" "00001217" "70" "2728" "0" "2728" "0" "c.2728C>T" "r.(?)" "p.(Arg910Ter)" "" "0000682535" "00001217" "30" "2295" "0" "2295" "0" "c.2295C>T" "r.(?)" "p.(Ser765=)" "" "0000682536" "00001217" "30" "2268" "0" "2268" "0" "c.2268C>T" "r.(?)" "p.(Cys756=)" "" "0000682537" "00001217" "70" "2047" "-1" "2047" "-1" "c.2047-1G>A" "r.spl?" "p.?" "" "0000682538" "00001217" "70" "1912" "0" "1913" "0" "c.1912_1913insCC" "r.(?)" "p.(Arg638ProfsTer5)" "" "0000682539" "00001217" "30" "976" "0" "976" "0" "c.976G>A" "r.(?)" "p.(Asp326Asn)" "" "0000682540" "00001217" "30" "695" "0" "695" "0" "c.695C>T" "r.(?)" "p.(Pro232Leu)" "" "0000682541" "00001217" "50" "563" "0" "563" "0" "c.563T>A" "r.(?)" "p.(Leu188Gln)" "" "0000682542" "00001217" "30" "546" "0" "546" "0" "c.546T>A" "r.(?)" "p.(Pro182=)" "" "0000682543" "00001217" "50" "113" "0" "113" "0" "c.113C>G" "r.(?)" "p.(Ser38Trp)" "" "0000693670" "00001217" "30" "8282" "0" "8282" "0" "c.*5396C>T" "r.(=)" "p.(=)" "" "0000693671" "00001217" "30" "935" "0" "935" "0" "c.935C>T" "r.(?)" "p.(Pro312Leu)" "" "0000694771" "00001217" "90" "892" "0" "892" "0" "c.892dup" "r.(?)" "p.(Cys298Leufs*5)" "" "0000694772" "00001217" "90" "527" "0" "527" "0" "c.527dup" "r.(?)" "p.(Leu177Thrfs*40)" "" "0000708549" "00001217" "90" "2735" "0" "2735" "0" "c.2735G>A" "r.(?)" "p.(Trp912Ter)" "" "0000729062" "00001217" "90" "2116" "0" "2117" "0" "c.2116_2117del" "r.(?)" "p.(Arg706GlyfsTer3)" "" "0000729063" "00001217" "30" "2043" "0" "2043" "0" "c.2043C>T" "r.(?)" "p.(Val681=)" "" "0000729064" "00001217" "90" "1328" "0" "1328" "0" "c.1328G>A" "r.(?)" "p.(Arg443His)" "" "0000729065" "00001217" "30" "1164" "0" "1164" "0" "c.1164C>T" "r.(?)" "p.(Tyr388=)" "" "0000729066" "00001217" "90" "939" "0" "964" "0" "c.939_964del" "r.(?)" "p.(Pro314CysfsTer14)" "" "0000729067" "00001217" "50" "889" "0" "889" "0" "c.889A>T" "r.(?)" "p.(Thr297Ser)" "" "0000810542" "00001217" "30" "2520" "0" "2520" "0" "c.2520G>A" "r.(?)" "p.(Lys840=)" "" "0000810543" "00001217" "50" "2505" "0" "2505" "0" "c.2505C>T" "r.(?)" "p.(Gly835=)" "" "0000810544" "00001217" "30" "1842" "20" "1842" "20" "c.1842+20T>C" "r.(=)" "p.(=)" "" "0000810545" "00001217" "50" "1625" "0" "1625" "0" "c.1625A>G" "r.(?)" "p.(Lys542Arg)" "" "0000810546" "00001217" "30" "1617" "0" "1617" "0" "c.1617G>A" "r.(?)" "p.(Pro539=)" "" "0000810547" "00001217" "30" "281" "0" "281" "0" "c.281A>G" "r.(?)" "p.(His94Arg)" "" "0000822038" "00001217" "50" "2269" "0" "2269" "0" "c.2269G>A" "r.(?)" "p.(Gly757Arg)" "" "0000856712" "00001217" "50" "2296" "0" "2296" "0" "c.2296G>A" "r.(?)" "p.(Glu766Lys)" "" "0000856713" "00001217" "30" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134Cys)" "" "0000856714" "00001217" "30" "69" "0" "69" "0" "c.69G>A" "r.(?)" "p.(Pro23=)" "" "0000867472" "00001217" "70" "1555" "0" "1555" "0" "c.1555C>T" "r.(?)" "p.(Arg519Cys)" "" "0000867473" "00001217" "30" "1032" "0" "1032" "0" "c.1032C>G" "r.(?)" "p.(Asp344Glu)" "" "0000867474" "00001217" "30" "482" "-5" "482" "-5" "c.482-5T>G" "r.spl?" "p.?" "" "0000876763" "00001217" "70" "2514" "0" "2514" "0" "c.2514G>A" "r.(?)" "p.(Trp838*)" "" "0000896300" "00001217" "50" "1354" "0" "1354" "0" "c.1354C>T" "r.(?)" "p.(Arg452Cys)" "" "0000904802" "00001217" "70" "1700" "0" "1700" "0" "c.1700G>A" "r.(?)" "p.(Arg567Gln)" "_1" "0000915742" "00001217" "30" "935" "0" "935" "0" "c.935C>T" "r.(?)" "p.(Pro312Leu)" "" "0000915743" "00001217" "30" "91" "0" "91" "0" "c.91G>T" "r.(?)" "p.(Ala31Ser)" "" "0000920726" "00001217" "70" "1636" "2" "1636" "2" "c.1636+2T>C" "r.spl?" "p.?" "" "0000951778" "00001217" "50" "1384" "0" "1384" "0" "c.1384C>T" "r.(?)" "p.(Pro462Ser)" "" "0000951779" "00001217" "30" "110" "0" "110" "0" "c.110C>T" "r.(?)" "p.(Ala37Val)" "" "0000984761" "00001217" "50" "8104" "0" "8104" "0" "c.*5218C>T" "r.(=)" "p.(=)" "" "0000984762" "00001217" "30" "4934" "0" "4934" "0" "c.*2048A>G" "r.(=)" "p.(=)" "" "0000984764" "00001217" "50" "1408" "0" "1408" "0" "c.1408T>C" "r.(?)" "p.(Tyr470His)" "" "0001006873" "00001217" "50" "2549" "0" "2549" "0" "c.2549C>G" "r.(?)" "p.(Pro850Arg)" "" "0001006874" "00001217" "30" "1907" "0" "1907" "0" "c.1907G>A" "r.(?)" "p.(Arg636Gln)" "" "0001044417" "00001217" "90" "1966" "0" "1966" "0" "c.1966C>T" "r.(?)" "p.(Arg656Ter)" "" "0001044418" "00001217" "30" "985" "0" "985" "0" "c.985C>T" "r.(?)" "p.(Arg329Trp)" "" "0001044419" "00001217" "30" "400" "0" "400" "0" "c.400C>T" "r.(?)" "p.(Arg134Cys)" "" "0001046872" "00001217" "90" "527" "0" "527" "0" "c.527dup" "r.(?)" "p.(Leu177ThrfsTer40)" "" "0001057342" "00001217" "30" "1936" "-9" "1936" "-9" "c.1936-9T>A" "r.(=)" "p.(=)" "" "0001057343" "00001217" "50" "68" "0" "68" "0" "c.68C>G" "r.(?)" "p.(Pro23Arg)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 52 "{{screeningid}}" "{{variantid}}" "0000000210" "0000009030" "0000000210" "0000010989" "0000050488" "0000079468" "0000058593" "0000089193" "0000058594" "0000089194" "0000058595" "0000089195" "0000058596" "0000089196" "0000058602" "0000089202" "0000058603" "0000089203" "0000058604" "0000089204" "0000058605" "0000089205" "0000058606" "0000089206" "0000058607" "0000089207" "0000058608" "0000089208" "0000058609" "0000089209" "0000058610" "0000089210" "0000058611" "0000089211" "0000058612" "0000089212" "0000058613" "0000089213" "0000058614" "0000089214" "0000058615" "0000089215" "0000058616" "0000089216" "0000058617" "0000089217" "0000058618" "0000089218" "0000058619" "0000089219" "0000058620" "0000089220" "0000058621" "0000089221" "0000058622" "0000089222" "0000058623" "0000089223" "0000058624" "0000089224" "0000058625" "0000089225" "0000058626" "0000089226" "0000058627" "0000089227" "0000058628" "0000089228" "0000058629" "0000089229" "0000058630" "0000089230" "0000058631" "0000089231" "0000058632" "0000089232" "0000058633" "0000089233" "0000058634" "0000089234" "0000058635" "0000089235" "0000058636" "0000089236" "0000058637" "0000089237" "0000058638" "0000089238" "0000184109" "0000408078" "0000313045" "0000694771" "0000313046" "0000694772" "0000325534" "0000708549" "0000391963" "0000822038" "0000417189" "0000876763" "0000427442" "0000904802" "0000434833" "0000920726"