### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = FOXL2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "FOXL2" "forkhead box L2" "3" "q23" "unknown" "NG_012454.1" "UD_132119116207" "" "https://www.LOVD.nl/FOXL2" "" "1" "1092" "668" "605597" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/FOXL2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-04-20 14:32:32" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00008097" "FOXL2" "forkhead box L2" "001" "NM_023067.3" "" "NP_075555.1" "" "" "" "-418" "2499" "1131" "138665982" "138663066" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "01193" "BPES" "blepharophimosis, ptosis, and epicanthus inversus (BPES)" "AD;AR" "110100" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-04-20 14:30:33" "02809" "POF3" "ovarian failure, premature, type 3 (POF3)" "AD" "608996" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-04-20 14:31:07" "04187" "POF" "ovarian failure, premature (POF)" "" "" "" "" "" "00006" "2015-02-14 15:50:12" "00006" "2015-12-08 23:53:05" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05472" "HYDM" "mole, hydatidiform, recurrent (HYDM)" "" "" "" "" "" "00006" "2018-09-29 23:17:06" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "FOXL2" "01193" "FOXL2" "02809" "FOXL2" "04187" ## Individuals ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00299430" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" "00390264" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001014" "00454559" "" "" "" "1" "" "00764" "" "" "F" "" "" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{individualid}}" "{{diseaseid}}" "00299430" "01193" "00390264" "04214" "00454559" "05472" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 01193, 02809, 04187, 04214, 05472 ## Count = 1 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000283802" "04214" "00390264" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" ## Screenings ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000300540" "00299430" "1" "01741" "01741" "2020-04-15 09:24:47" "" "" "SEQ" "DNA" "" "" "0000391505" "00390264" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000456172" "00454559" "1" "00764" "00764" "2024-09-14 15:44:40" "" "" "SEQ-NG-I" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{geneid}}" "0000300540" "FOXL2" "0000391505" "FOXL2" "0000456172" "FOXL2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 23 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000272308" "0" "50" "3" "138666298" "138666298" "subst" "0.000523133" "01943" "C3orf72_000001" "g.138666298G>C" "" "" "" "C3orf72(NM_001040061.2):c.92G>C (p.R31P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.138947456G>C" "" "VUS" "" "0000287861" "0" "50" "3" "138664847" "138664847" "subst" "0.000163645" "01943" "FOXL2_000002" "g.138664847C>T" "" "" "" "FOXL2(NM_023067.3):c.718G>A (p.(Gly240Ser)), FOXL2(NM_023067.4):c.718G>A (p.G240S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.138946005C>T" "" "VUS" "" "0000518065" "0" "30" "3" "138664494" "138664494" "subst" "0.000522671" "01943" "C3orf72_000002" "g.138664494A>G" "" "" "" "FOXL2(NM_023067.4):c.1071T>C (p.H357=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138945652A>G" "" "likely benign" "" "0000518066" "0" "50" "3" "138664847" "138664847" "subst" "0.000163645" "01804" "FOXL2_000002" "g.138664847C>T" "" "" "" "FOXL2(NM_023067.3):c.718G>A (p.(Gly240Ser)), FOXL2(NM_023067.4):c.718G>A (p.G240S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946005C>T" "" "VUS" "" "0000518067" "0" "30" "3" "138664862" "138664862" "subst" "0" "01804" "C3orf72_000003" "g.138664862C>T" "" "" "" "FOXL2(NM_023067.3):c.703G>A (p.(Gly235Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946020C>T" "" "likely benign" "" "0000518068" "0" "30" "3" "138664911" "138664911" "subst" "0" "01943" "C3orf72_000004" "g.138664911G>A" "" "" "" "FOXL2(NM_023067.4):c.654C>T (p.C218=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946069G>A" "" "likely benign" "" "0000518069" "0" "90" "3" "138665182" "138665182" "subst" "0" "02327" "C3orf72_000005" "g.138665182C>T" "" "" "" "FOXL2(NM_023067.4):c.383G>A (p.W128*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946340C>T" "" "pathogenic" "" "0000654813" "0" "30" "3" "138664657" "138664657" "subst" "0" "01943" "C3orf72_000006" "g.138664657G>C" "" "" "" "FOXL2(NM_023067.4):c.908C>G (p.A303G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138945815G>C" "" "likely benign" "" "0000663252" "0" "90" "3" "138665063" "138665063" "del" "0" "01741" "FOXL2_000005" "g.138665063del" "" "" "" "505delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.138946221del" "" "pathogenic" "" "0000801022" "0" "90" "3" "138664915" "138664915" "subst" "0" "02327" "C3orf72_000007" "g.138664915G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000821254" "0" "70" "3" "138664872" "138664901" "dup" "0" "00000" "FOXL2_000006" "g.138664872_138664901dup" "" "{PMID:Turro 2020:32581362}" "" "FOXL2 c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC, p.Ala225_Ala234dup" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.138946030_138946059dup" "" "likely pathogenic" "" "0000850151" "0" "30" "3" "138664845" "138664845" "subst" "0" "01943" "C3orf72_000008" "g.138664845G>T" "" "" "" "FOXL2(NM_023067.4):c.720C>A (p.G240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858824" "0" "50" "3" "138664893" "138664895" "del" "0" "02325" "C3orf72_000009" "g.138664893_138664895del" "" "" "" "FOXL2(NM_023067.4):c.672_674delAGC (p.A234del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858825" "0" "50" "3" "138664931" "138664931" "subst" "0.000137106" "01943" "C3orf72_000010" "g.138664931G>C" "" "" "" "FOXL2(NM_023067.4):c.634C>G (p.P212A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975606" "0" "90" "3" "138664910" "138664910" "subst" "0" "02327" "C3orf72_000011" "g.138664910G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000993328" "0" "30" "3" "138664508" "138664508" "subst" "0" "01804" "C3orf72_000012" "g.138664508G>T" "" "" "" "FOXL2(NM_023067.3):c.1057C>A (p.(Leu353Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993329" "0" "50" "3" "138664684" "138664684" "subst" "0" "01804" "C3orf72_000013" "g.138664684G>A" "" "" "" "FOXL2(NM_023067.3):c.881C>T (p.(Pro294Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000993330" "0" "30" "3" "138664784" "138664784" "subst" "0" "01804" "C3orf72_000014" "g.138664784C>A" "" "" "" "FOXL2(NM_023067.3):c.781G>T (p.(Val261Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993331" "0" "70" "3" "138664878" "138664892" "del" "0" "01804" "C3orf72_000015" "g.138664878_138664892del" "" "" "" "FOXL2(NM_023067.3):c.684_698delAGCTGCGGCTGCAGC (p.(Ala229_Ala233del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001008354" "3" "70" "3" "138665065" "138665065" "subst" "0" "00764" "FOXL2_000007" "g.138665065A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.138946223A>G" "" "VUS" "" "0001013820" "0" "90" "3" "138665182" "138665182" "subst" "0" "02329" "C3orf72_000005" "g.138665182C>T" "" "" "" "FOXL2(NM_023067.4):c.383G>A (p.W128*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001045880" "0" "50" "3" "138665099" "138665099" "subst" "0" "02325" "C3orf72_000016" "g.138665099G>A" "" "" "" "FOXL2(NM_023067.4):c.466C>T (p.P156S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045881" "0" "50" "3" "138665100" "138665100" "subst" "0" "02325" "C3orf72_000017" "g.138665100C>A" "" "" "" "FOXL2(NM_023067.4):c.465G>T (p.P155=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes FOXL2 ## Count = 23 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000272308" "00008097" "50" "-734" "0" "-734" "0" "c.-734C>G" "r.(?)" "p.(=)" "" "0000287861" "00008097" "50" "718" "0" "718" "0" "c.718G>A" "r.(?)" "p.(Gly240Ser)" "" "0000518065" "00008097" "30" "1071" "0" "1071" "0" "c.1071T>C" "r.(?)" "p.(His357=)" "" "0000518066" "00008097" "50" "718" "0" "718" "0" "c.718G>A" "r.(?)" "p.(Gly240Ser)" "" "0000518067" "00008097" "30" "703" "0" "703" "0" "c.703G>A" "r.(?)" "p.(Gly235Ser)" "" "0000518068" "00008097" "30" "654" "0" "654" "0" "c.654C>T" "r.(?)" "p.(Cys218=)" "" "0000518069" "00008097" "90" "383" "0" "383" "0" "c.383G>A" "r.(?)" "p.(Trp128Ter)" "" "0000654813" "00008097" "30" "908" "0" "908" "0" "c.908C>G" "r.(?)" "p.(Ala303Gly)" "" "0000663252" "00008097" "90" "505" "0" "505" "0" "c.505del" "r.(?)" "p.(Ala169Profs*102)" "" "0000801022" "00008097" "90" "650" "0" "650" "0" "c.650C>T" "r.(?)" "p.(Ser217Phe)" "" "0000821254" "00008097" "70" "672" "0" "701" "0" "c.672_701dup" "r.(?)" "p.(Ala225_Ala234dup)" "" "0000850151" "00008097" "30" "720" "0" "720" "0" "c.720C>A" "r.(?)" "p.(Gly240=)" "" "0000858824" "00008097" "50" "672" "0" "674" "0" "c.672_674del" "r.(?)" "p.(Ala234del)" "" "0000858825" "00008097" "50" "634" "0" "634" "0" "c.634C>G" "r.(?)" "p.(Pro212Ala)" "" "0000975606" "00008097" "90" "655" "0" "655" "0" "c.655C>T" "r.(?)" "p.(Gln219*)" "" "0000993328" "00008097" "30" "1057" "0" "1057" "0" "c.1057C>A" "r.(?)" "p.(Leu353Ile)" "" "0000993329" "00008097" "50" "881" "0" "881" "0" "c.881C>T" "r.(?)" "p.(Pro294Leu)" "" "0000993330" "00008097" "30" "781" "0" "781" "0" "c.781G>T" "r.(?)" "p.(Val261Leu)" "" "0000993331" "00008097" "70" "684" "0" "698" "0" "c.684_698del" "r.(?)" "p.(Ala230_Ala234del)" "" "0001008354" "00008097" "70" "500" "0" "500" "0" "c.500T>C" "r.(?)" "p.(Phe167Ser)" "" "0001013820" "00008097" "90" "383" "0" "383" "0" "c.383G>A" "r.(?)" "p.(Trp128Ter)" "" "0001045880" "00008097" "50" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Pro156Ser)" "" "0001045881" "00008097" "50" "465" "0" "465" "0" "c.465G>T" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{variantid}}" "0000300540" "0000663252" "0000391505" "0000821254" "0000456172" "0001008354"