### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = FOXL2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "FOXL2" "forkhead box L2" "3" "q23" "unknown" "NG_012454.1" "UD_132119116207" "" "https://www.LOVD.nl/FOXL2" "" "1" "1092" "668" "605597" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/FOXL2_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-04-20 14:32:32" "00006" "2025-12-06 12:44:15" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00008097" "FOXL2" "forkhead box L2" "001" "NM_023067.3" "" "NP_075555.1" "" "" "" "-418" "2499" "1131" "138665982" "138663066" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01193" "BPES" "blepharophimosis, ptosis, and epicanthus inversus (BPES)" "AD;AR" "110100" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-04-20 14:30:33" "02809" "POF3" "ovarian failure, premature, type 3 (POF3)" "AD" "608996" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-04-20 14:31:07" "04187" "POF" "ovarian failure, premature (POF)" "" "" "" "" "" "00006" "2015-02-14 15:50:12" "00006" "2015-12-08 23:53:05" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05472" "HYDM" "mole, hydatidiform, recurrent (HYDM)" "" "" "" "" "" "00006" "2018-09-29 23:17:06" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{geneid}}" "{{diseaseid}}" "FOXL2" "01193" "FOXL2" "02809" "FOXL2" "04187" ## Individuals ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00299430" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" "00390264" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G001014" "00454559" "" "" "" "1" "" "00764" "" "" "F" "" "" "" "0" "" "" "" "" "00470363" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" "00470712" "" "" "" "1" "" "03948" "" "" "F" "no" "Morocco" "" "0" "" "" "" "patient" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 5 "{{individualid}}" "{{diseaseid}}" "00299430" "01193" "00390264" "04214" "00454559" "05472" "00470363" "00198" "00470712" "04187" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01193, 02809, 04187, 04214, 05472 ## Count = 3 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000283802" "04214" "00390264" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "retinal disease" "" "0000355512" "01535" "00470363" "03544" "Isolated (sporadic)" "" "HP:0000581, HP:0000508" "" "" "" "" "" "" "" "" "" "" "" "0000355606" "04187" "00470712" "03948" "Unknown" "" "Secondary amenorrhea" "39" "" "" "" "" "" "" "" "" "Premature ovarian insufficiency" "" ## Screenings ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000300540" "00299430" "1" "01741" "01741" "2020-04-15 09:24:47" "" "" "SEQ" "DNA" "" "" "0000391505" "00390264" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing" "0000456172" "00454559" "1" "00764" "00764" "2024-09-14 15:44:40" "" "" "SEQ-NG-I" "DNA" "" "" "0000472030" "00470363" "1" "03544" "03544" "2025-12-02 12:53:37" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000472379" "00470712" "1" "03948" "03948" "2025-12-05 18:04:12" "" "" "SEQ-NG" "DNA" "blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{geneid}}" "0000300540" "FOXL2" "0000391505" "FOXL2" "0000456172" "FOXL2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 25 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000272308" "0" "50" "3" "138666298" "138666298" "subst" "0.000523133" "01943" "C3orf72_000001" "g.138666298G>C" "" "" "" "C3orf72(NM_001040061.2):c.92G>C (p.R31P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.138947456G>C" "" "VUS" "" "0000287861" "0" "50" "3" "138664847" "138664847" "subst" "0.000163645" "01943" "FOXL2_000002" "g.138664847C>T" "" "" "" "FOXL2(NM_023067.3):c.718G>A (p.(Gly240Ser)), FOXL2(NM_023067.4):c.718G>A (p.G240S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.138946005C>T" "" "VUS" "" "0000518065" "0" "30" "3" "138664494" "138664494" "subst" "0.000522671" "01943" "C3orf72_000002" "g.138664494A>G" "" "" "" "FOXL2(NM_023067.4):c.1071T>C (p.H357=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138945652A>G" "" "likely benign" "" "0000518066" "0" "50" "3" "138664847" "138664847" "subst" "0.000163645" "01804" "FOXL2_000002" "g.138664847C>T" "" "" "" "FOXL2(NM_023067.3):c.718G>A (p.(Gly240Ser)), FOXL2(NM_023067.4):c.718G>A (p.G240S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946005C>T" "" "VUS" "" "0000518067" "0" "30" "3" "138664862" "138664862" "subst" "0" "01804" "C3orf72_000003" "g.138664862C>T" "" "" "" "FOXL2(NM_023067.3):c.703G>A (p.(Gly235Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946020C>T" "" "likely benign" "" "0000518068" "0" "30" "3" "138664911" "138664911" "subst" "0" "01943" "C3orf72_000004" "g.138664911G>A" "" "" "" "FOXL2(NM_023067.4):c.654C>T (p.C218=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946069G>A" "" "likely benign" "" "0000518069" "0" "90" "3" "138665182" "138665182" "subst" "0" "02327" "C3orf72_000005" "g.138665182C>T" "" "" "" "FOXL2(NM_023067.4):c.383G>A (p.W128*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138946340C>T" "" "pathogenic" "" "0000654813" "0" "30" "3" "138664657" "138664657" "subst" "0" "01943" "C3orf72_000006" "g.138664657G>C" "" "" "" "FOXL2(NM_023067.4):c.908C>G (p.A303G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.138945815G>C" "" "likely benign" "" "0000663252" "0" "90" "3" "138665063" "138665063" "del" "0" "01741" "FOXL2_000005" "g.138665063del" "" "" "" "505delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.138946221del" "" "pathogenic" "" "0000801022" "0" "90" "3" "138664915" "138664915" "subst" "0" "02327" "C3orf72_000007" "g.138664915G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000821254" "0" "70" "3" "138664872" "138664901" "dup" "0" "00000" "FOXL2_000006" "g.138664872_138664901dup" "" "{PMID:Turro 2020:32581362}" "" "FOXL2 c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC, p.Ala225_Ala234dup" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.138946030_138946059dup" "" "likely pathogenic" "" "0000850151" "0" "30" "3" "138664845" "138664845" "subst" "0" "01943" "C3orf72_000008" "g.138664845G>T" "" "" "" "FOXL2(NM_023067.4):c.720C>A (p.G240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858824" "0" "50" "3" "138664893" "138664895" "del" "0" "02325" "C3orf72_000009" "g.138664893_138664895del" "" "" "" "FOXL2(NM_023067.4):c.672_674delAGC (p.A234del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000858825" "0" "50" "3" "138664931" "138664931" "subst" "0.000137106" "01943" "C3orf72_000010" "g.138664931G>C" "" "" "" "FOXL2(NM_023067.4):c.634C>G (p.P212A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000975606" "0" "90" "3" "138664910" "138664910" "subst" "0" "02327" "C3orf72_000011" "g.138664910G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000993328" "0" "30" "3" "138664508" "138664508" "subst" "0" "01804" "C3orf72_000012" "g.138664508G>T" "" "" "" "FOXL2(NM_023067.3):c.1057C>A (p.(Leu353Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993329" "0" "50" "3" "138664684" "138664684" "subst" "0" "01804" "C3orf72_000013" "g.138664684G>A" "" "" "" "FOXL2(NM_023067.3):c.881C>T (p.(Pro294Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000993330" "0" "30" "3" "138664784" "138664784" "subst" "0" "01804" "C3orf72_000014" "g.138664784C>A" "" "" "" "FOXL2(NM_023067.3):c.781G>T (p.(Val261Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000993331" "0" "70" "3" "138664878" "138664892" "del" "0" "01804" "C3orf72_000015" "g.138664878_138664892del" "" "" "" "FOXL2(NM_023067.3):c.684_698delAGCTGCGGCTGCAGC (p.(Ala229_Ala233del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001008354" "3" "70" "3" "138665065" "138665065" "subst" "0" "00764" "FOXL2_000007" "g.138665065A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.138946223A>G" "" "VUS" "" "0001013820" "0" "90" "3" "138665182" "138665182" "subst" "0" "02329" "C3orf72_000005" "g.138665182C>T" "" "" "" "FOXL2(NM_023067.4):c.383G>A (p.W128*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001045880" "0" "50" "3" "138665099" "138665099" "subst" "0" "02325" "C3orf72_000016" "g.138665099G>A" "" "" "" "FOXL2(NM_023067.4):c.466C>T (p.P156S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001045881" "0" "50" "3" "138665100" "138665100" "subst" "0" "02325" "C3orf72_000017" "g.138665100C>A" "" "" "" "FOXL2(NM_023067.4):c.465G>T (p.P155=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001060433" "0" "70" "3" "138665314" "138665314" "subst" "0" "03544" "FOXL2_000008" "g.138665314A>T" "" "" "" "" "Uniprot Variant VAR_046492\r\n(web.expasy.org/variant_pages/VAR_046492.html)" "Germline" "" "" "0" "" "" "g.138946472A>T" "" "likely pathogenic" "ACMG" "0001060952" "0" "70" "3" "138665005" "138665005" "subst" "2.32002E-5" "03948" "FOXL2_000009" "g.138665005C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.138946163C>T" "" "likely pathogenic (dominant)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes FOXL2 ## Count = 25 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000272308" "00008097" "50" "-734" "0" "-734" "0" "c.-734C>G" "r.(?)" "p.(=)" "" "0000287861" "00008097" "50" "718" "0" "718" "0" "c.718G>A" "r.(?)" "p.(Gly240Ser)" "" "0000518065" "00008097" "30" "1071" "0" "1071" "0" "c.1071T>C" "r.(?)" "p.(His357=)" "" "0000518066" "00008097" "50" "718" "0" "718" "0" "c.718G>A" "r.(?)" "p.(Gly240Ser)" "" "0000518067" "00008097" "30" "703" "0" "703" "0" "c.703G>A" "r.(?)" "p.(Gly235Ser)" "" "0000518068" "00008097" "30" "654" "0" "654" "0" "c.654C>T" "r.(?)" "p.(Cys218=)" "" "0000518069" "00008097" "90" "383" "0" "383" "0" "c.383G>A" "r.(?)" "p.(Trp128Ter)" "" "0000654813" "00008097" "30" "908" "0" "908" "0" "c.908C>G" "r.(?)" "p.(Ala303Gly)" "" "0000663252" "00008097" "90" "505" "0" "505" "0" "c.505del" "r.(?)" "p.(Ala169Profs*102)" "" "0000801022" "00008097" "90" "650" "0" "650" "0" "c.650C>T" "r.(?)" "p.(Ser217Phe)" "" "0000821254" "00008097" "70" "672" "0" "701" "0" "c.672_701dup" "r.(?)" "p.(Ala225_Ala234dup)" "" "0000850151" "00008097" "30" "720" "0" "720" "0" "c.720C>A" "r.(?)" "p.(Gly240=)" "" "0000858824" "00008097" "50" "672" "0" "674" "0" "c.672_674del" "r.(?)" "p.(Ala234del)" "" "0000858825" "00008097" "50" "634" "0" "634" "0" "c.634C>G" "r.(?)" "p.(Pro212Ala)" "" "0000975606" "00008097" "90" "655" "0" "655" "0" "c.655C>T" "r.(?)" "p.(Gln219*)" "" "0000993328" "00008097" "30" "1057" "0" "1057" "0" "c.1057C>A" "r.(?)" "p.(Leu353Ile)" "" "0000993329" "00008097" "50" "881" "0" "881" "0" "c.881C>T" "r.(?)" "p.(Pro294Leu)" "" "0000993330" "00008097" "30" "781" "0" "781" "0" "c.781G>T" "r.(?)" "p.(Val261Leu)" "" "0000993331" "00008097" "70" "684" "0" "698" "0" "c.684_698del" "r.(?)" "p.(Ala230_Ala234del)" "" "0001008354" "00008097" "70" "500" "0" "500" "0" "c.500T>C" "r.(?)" "p.(Phe167Ser)" "" "0001013820" "00008097" "90" "383" "0" "383" "0" "c.383G>A" "r.(?)" "p.(Trp128Ter)" "" "0001045880" "00008097" "50" "466" "0" "466" "0" "c.466C>T" "r.(?)" "p.(Pro156Ser)" "" "0001045881" "00008097" "50" "465" "0" "465" "0" "c.465G>T" "r.(?)" "p.(=)" "" "0001060433" "00008097" "70" "251" "0" "251" "0" "c.251T>A" "r.(?)" "p.(Ile84Asn)" "1" "0001060952" "00008097" "70" "560" "0" "560" "0" "c.560G>A" "r.(?)" "p.(Gly187Asp)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 5 "{{screeningid}}" "{{variantid}}" "0000300540" "0000663252" "0000391505" "0000821254" "0000456172" "0001008354" "0000472030" "0001060433" "0000472379" "0001060952"