### LOVD-version 3000-290 ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = FRMPD4) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "FRMPD4" "FERM and PDZ domain containing 4" "X" "p22.31" "unknown" "NG_016419.1" "UD_132118690862" "" "https://www.LOVD.nl/FRMPD4" "" "1" "29007" "9758" "300838" "1" "1" "1" "1" "This gene sequence variant database has been initiated based on the data reported by Tarpey et al. (2009) A systematic, large-scale resequencing screen of the X-chromosome coding exons in mental retardation. Nat.Genet. 41: 535-543. Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "https://databases.lovd.nl/shared/refseq/FRMPD4_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2018-10-14 13:05:11" "00000" "2023-03-30 11:53:03" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000900" "FRMPD4" "FERM and PDZ domain containing 4" "001" "NM_014728.3" "" "NP_055543.2" "" "" "" "-506" "7959" "3969" "12156585" "12742642" "00000" "2012-09-13 12:58:06" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05739" "MRX104" "mental retardation, X-linked, type 104 (MRX104)" "XL" "300983" "" "" "" "00006" "2020-05-11 15:10:33" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "FRMPD4" "05739" ## Individuals ## Do not remove or alter this header ## ## Count = 13 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00000209" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00173275" "" "" "" "17" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173276" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173277" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00173278" "" "" "" "1" "" "00124" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "19377476-Pat?" "00183177" "" "" "" "5" "" "00006" "{PMID:Hu 2016:25644381}" "family, 5 affected, 2 unaffected heterozygous carrier females" "M" "" "" "" "0" "" "" "" "25644381-FamP58" "00183178" "" "" "" "1" "" "00006" "{PMID:Hu 2016:25644381}" "de novo" "M" "" "" "" "0" "" "" "" "25644381-FamL87" "00303634" "" "" "" "2" "" "03671" "{PMID:Piard 2018:29267967}" "2-generation family, 2 affected, unaffected carrier mother, mildly affected carrier sister" "M" "yes" "" ">18y" "0" "" "" "White" "Family 3 P8" "00303635" "" "" "00303634" "1" "" "03671" "{PMID:Piard 2018:29267967}" "" "M" "yes" "" ">04y" "0" "" "" "White" "Family 3 P9" "00303636" "" "" "" "1" "" "03671" "{PMID:Piard 2018:29267967}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "yes" "" ">11y" "0" "" "" "White" "Family 4 P10" "00303642" "" "" "" "2" "" "03671" "{PMID:Piard 2018:29267967}" "2-generation family, 2 affected, unaffected carrier mother" "M" "yes" "" ">17y" "0" "" "" "White" "Family 2 P6" "00303643" "" "" "00303642" "1" "" "03671" "{PMID:Piard 2018:29267967}" "brother P6" "M" "yes" "" ">48y" "0" "" "" "White" "Family 2 P7" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 13 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00000209" "01157" "00173275" "00187" "00173276" "00187" "00173277" "00187" "00173278" "00187" "00183177" "00187" "00183178" "00187" "00303634" "00139" "00303635" "00139" "00303636" "00139" "00303642" "00139" "00303643" "00139" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00187, 01157, 05739 ## Count = 13 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "0000038984" "01157" "00000209" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), prolactin deficiency, age sonographic determination testicular volume 21.36y, testicular volume right/left 30/26 (8.5–18.3ml)" "" "" "07y04m" "" "" "" "" "" "" "" "0000138139" "00187" "00173275" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "MRX" "0000138140" "00187" "00173276" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "MRX" "0000138141" "00187" "00173277" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "MRX" "0000138142" "00187" "00173278" "00124" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "MRX" "0000143931" "00187" "00183177" "00006" "Familial, X-linked recessive" "" "mild to severe ID with variable seizures, lack of speech or poor speech, behavioral problems" "" "" "" "" "" "" "" "" "" "mental retardation" "0000143932" "00187" "00183178" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "mental retardation" "0000230698" "00139" "00303634" "03671" "Familial, X-linked" "18y" "Delayed gross motor development (HP:0002194); Delayed speech and language development (HP:0000750); Intellectual disability, moderate (HP:0002342); Hyperactivity (HP:0000752); Ataxia (HP:0001251); Strabismus (HP:0000486); Seizure (HP:0001250)" "" "" "" "" "FRMPD4" "" "" "" "" "" "0000230699" "00139" "00303635" "03671" "Familial, X-linked" "04y" "Delayed gross motor development (HP:0002194); Delayed speech and language development (HP:0000750); Intellectual disability, moderate (HP:0002342); Hyperactivity (HP:0000752); Ataxia (HP:0001251); Strabismus (HP:0000486); Seizure (HP:0001250)" "" "" "" "" "FRMPD4" "" "" "" "" "" "0000230700" "00139" "00303636" "03671" "Familial, X-linked" "11y" "Delayed gross motor development (HP:0002194); Delayed speech and language development (HP:0000750); Intellectual disability (HP:0002342); Autism (HP:0000717);Strabismus (HP:0000486); Frontal upsweep of hair (HP:0002236); Trigonocephaly (HP:0000243); Wide nasal bridge (HP:0000431)" "" "" "" "" "FRMPD4" "" "" "" "" "" "0000230706" "00139" "00303642" "03671" "Familial, X-linked" "17y" "Delayed speech and language development (HP:0000750); Intellectual disability, moderate (HP:0002342); Hyperactivity (HP:0000752); Ataxia (HP:0001251); Strabismus (HP:0000486); Seizure (HP:0001250); Autism (HP:0000717)" "" "" "" "" "FRMPD4" "" "" "" "" "" "0000230707" "00139" "00303643" "03671" "Familial, X-linked" ">17y" "Delayed speech and language development (HP:0000750); Intellectual disability, moderate (HP:0002342); Hyperactivity (HP:0000752); Ataxia (HP:0001251); Strabismus (HP:0000486); Seizure (HP:0001250); Autism (HP:0000717)" "" "" "" "" "FRMPD4" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 13 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000000210" "00000209" "1" "00037" "00001" "2012-09-13 12:09:36" "" "" "SEQ-NG-I" "DNA" "" "" "0000174158" "00173275" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:34:20" "SEQ" "DNA" "" "" "0000174159" "00173276" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000174160" "00173277" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000174161" "00173278" "1" "00124" "00006" "2009-04-08 14:01:02" "00006" "2009-05-19 12:33:15" "SEQ" "DNA" "" "" "0000184135" "00183177" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000184136" "00183178" "1" "00006" "00006" "2018-10-14 12:07:53" "" "" "SEQ;SEQ-NG" "DNA" "" "WES-X chromosome" "0000304762" "00303634" "1" "03671" "03671" "2020-06-17 13:16:37" "" "" "SEQ" "DNA" "" "" "0000304763" "00303635" "1" "03671" "03671" "2020-06-17 13:23:17" "" "" "SEQ" "DNA" "" "" "0000304764" "00303636" "1" "03671" "03671" "2020-06-17 13:28:54" "" "" "SEQ" "DNA" "" "" "0000304769" "00303642" "1" "03671" "03671" "2020-06-17 17:37:22" "" "" "SEQ" "DNA" "" "" "0000304770" "00303643" "1" "03671" "03671" "2020-06-17 17:47:02" "" "" "SEQ" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 11 "{{screeningid}}" "{{geneid}}" "0000174158" "GLRA2" "0000174159" "GLRA4" "0000174160" "GPR64" "0000174161" "GPR64" "0000184135" "FRMPD4" "0000184136" "FRMPD4" "0000304762" "FRMPD4" "0000304763" "FRMPD4" "0000304764" "FRMPD4" "0000304769" "FRMPD4" "0000304770" "FRMPD4" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 99 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000001789" "20" "50" "X" "12728260" "12728267" "del" "0" "00037" "FRMPD4_000006" "g.12728260_12728267del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12710141_12710148del" "" "VUS" "" "0000002784" "0" "50" "X" "12725042" "12725042" "del" "0" "00037" "FRMPD4_000023" "g.12725042del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12706923del" "" "VUS" "" "0000002785" "20" "50" "X" "12728252" "12728259" "del" "0" "00037" "FRMPD4_000021" "g.12728252_12728259del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12710133_12710140del" "" "VUS" "" "0000006314" "20" "50" "X" "12516480" "12516480" "subst" "0" "00037" "FRMPD4_000020" "g.12516480A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12498361A>G" "" "VUS" "" "0000006315" "20" "50" "X" "12722616" "12722616" "subst" "0.992683" "00037" "FRMPD4_000017" "g.12722616C>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12704497C>G" "" "VUS" "" "0000006316" "20" "50" "X" "12737146" "12737146" "subst" "0" "00037" "FRMPD4_000008" "g.12737146G>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12719027G>T" "" "VUS" "" "0000006317" "20" "50" "X" "12739294" "12739294" "subst" "0" "00037" "FRMPD4_000011" "g.12739294A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12721175A>G" "" "VUS" "" "0000006318" "20" "50" "X" "12740118" "12740118" "subst" "0" "00037" "FRMPD4_000014" "g.12740118T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12721999T>C" "" "VUS" "" "0000008375" "20" "50" "X" "12722616" "12722616" "subst" "0.992683" "00037" "FRMPD4_000017" "g.12722616C>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12704497C>G" "" "VUS" "" "0000008376" "0" "50" "X" "12725060" "12725060" "dup" "0" "00037" "FRMPD4_000003" "g.12725060dup" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12706941dup" "" "VUS" "" "0000008377" "20" "50" "X" "12728260" "12728267" "del" "0" "00037" "FRMPD4_000006" "g.12728260_12728267del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12710141_12710148del" "" "VUS" "" "0000008378" "20" "50" "X" "12737146" "12737146" "subst" "0" "00037" "FRMPD4_000008" "g.12737146G>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12719027G>T" "" "VUS" "" "0000008379" "20" "50" "X" "12739294" "12739294" "subst" "0" "00037" "FRMPD4_000011" "g.12739294A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12721175A>G" "" "VUS" "" "0000008380" "20" "50" "X" "12740118" "12740118" "subst" "0" "00037" "FRMPD4_000014" "g.12740118T>C" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12721999T>C" "" "VUS" "" "0000010790" "0" "50" "X" "12725042" "12725042" "del" "0" "00037" "FRMPD4_000023" "g.12725042del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12706923del" "" "VUS" "" "0000010791" "20" "50" "X" "12728252" "12728259" "del" "0" "00037" "FRMPD4_000021" "g.12728252_12728259del" "" "" "" "" "" "Germline" "" "" "" "" "" "g.12710133_12710140del" "" "VUS" "" "0000254320" "0" "30" "X" "12736436" "12736436" "subst" "0" "01943" "FRMPD4_000043" "g.12736436A>T" "" "" "" "FRMPD4(NM_014728.3):c.3491A>T (p.D1164V, p.(Asp1164Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12718317A>T" "" "likely benign" "" "0000254384" "0" "30" "X" "12734626" "12734626" "subst" "0.0000447793" "01943" "FRMPD4_000031" "g.12734626A>G" "" "" "" "FRMPD4(NM_014728.3):c.2048A>G (p.E683G, p.(Glu683Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12716507A>G" "" "likely benign" "" "0000254835" "0" "30" "X" "12735177" "12735177" "subst" "0.000670146" "01943" "FRMPD4_000034" "g.12735177A>G" "" "" "" "FRMPD4(NM_014728.3):c.2599A>G (p.N867D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12717058A>G" "" "likely benign" "" "0000280921" "0" "10" "X" "12722616" "12722616" "subst" "0.992683" "02325" "FRMPD4_000017" "g.12722616C>G" "" "" "" "FRMPD4(NM_014728.3):c.1197+12C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12704497C>G" "" "benign" "" "0000287946" "0" "10" "X" "12725059" "12725060" "del" "0" "01943" "FRMPD4_000028" "g.12725059_12725060del" "" "" "" "FRMPD4(NM_014728.3):c.1287+25_1287+26delTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12706940_12706941del" "" "benign" "" "0000287947" "0" "30" "X" "12725060" "12725060" "del" "0" "01943" "FRMPD4_000027" "g.12725060del" "" "" "" "FRMPD4(NM_014728.3):c.1287+26delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12706941del" "" "likely benign" "" "0000287948" "0" "30" "X" "12725752" "12725752" "subst" "0.000135492" "01943" "FRMPD4_000029" "g.12725752C>G" "" "" "" "FRMPD4(NM_014728.3):c.1452C>G (p.L484=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12707633C>G" "" "likely benign" "" "0000287949" "0" "30" "X" "12734650" "12734650" "subst" "0.000240695" "01943" "FRMPD4_000032" "g.12734650G>T" "" "" "" "FRMPD4(NM_014728.3):c.2072G>T (p.G691V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12716531G>T" "" "likely benign" "" "0000287950" "0" "30" "X" "12735218" "12735218" "subst" "0.0000484813" "01943" "FRMPD4_000035" "g.12735218C>T" "" "" "" "FRMPD4(NM_014728.3):c.2640C>T (p.S880=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12717099C>T" "" "likely benign" "" "0000287951" "0" "30" "X" "12735862" "12735862" "subst" "0.0000560658" "01943" "FRMPD4_000039" "g.12735862G>C" "" "" "" "FRMPD4(NM_014728.3):c.2917G>C (p.A973P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12717743G>C" "" "likely benign" "" "0000287952" "0" "30" "X" "12736390" "12736390" "subst" "0.0000447933" "01943" "FRMPD4_000042" "g.12736390C>T" "" "" "" "FRMPD4(NM_014728.3):c.3445C>T (p.R1149C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12718271C>T" "" "likely benign" "" "0000287953" "0" "30" "X" "12736658" "12736658" "subst" "0.000185039" "01943" "FRMPD4_000045" "g.12736658C>T" "" "" "" "FRMPD4(NM_014728.3):c.3713C>T (p.P1238L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12718539C>T" "" "likely benign" "" "0000287954" "0" "30" "X" "12632958" "12632958" "subst" "0.0000169325" "01943" "FRMPD4_000025" "g.12632958C>T" "" "" "" "FRMPD4(NM_014728.3):c.380C>T (p.P127L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12614839C>T" "" "likely benign" "" "0000287955" "0" "50" "X" "12516819" "12516819" "subst" "0.00000566961" "01943" "FRMPD4_000024" "g.12516819G>C" "" "" "" "FRMPD4(NM_014728.3):c.62G>C (p.G21A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12498700G>C" "" "VUS" "" "0000333166" "0" "30" "X" "12632966" "12632966" "subst" "0.000916502" "01804" "FRMPD4_000026" "g.12632966G>A" "" "" "" "FRMPD4(NM_014728.3):c.388G>A (p.A130T, p.(Ala130Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12614847G>A" "" "likely benign" "" "0000333168" "0" "30" "X" "12734626" "12734626" "subst" "0.0000447793" "01804" "FRMPD4_000031" "g.12734626A>G" "" "" "" "FRMPD4(NM_014728.3):c.2048A>G (p.E683G, p.(Glu683Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12716507A>G" "" "likely benign" "" "0000333169" "0" "50" "X" "12734856" "12734856" "subst" "0" "01804" "FRMPD4_000033" "g.12734856C>T" "" "" "" "FRMPD4(NM_014728.3):c.2278C>T (p.(Leu760Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12716737C>T" "" "VUS" "" "0000333171" "0" "50" "X" "12735823" "12735823" "subst" "0.000342001" "01804" "FRMPD4_000036" "g.12735823G>A" "" "" "" "FRMPD4(NM_014728.3):c.2878G>A (p.A960T, p.(Ala960Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12717704G>A" "" "VUS" "" "0000333173" "0" "50" "X" "12735859" "12735859" "subst" "0.000341984" "01804" "FRMPD4_000038" "g.12735859G>T" "" "" "" "FRMPD4(NM_014728.3):c.2914G>T (p.(Ala972Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12717740G>T" "" "VUS" "" "0000333175" "0" "50" "X" "12736345" "12736345" "subst" "0.0000111943" "01804" "FRMPD4_000041" "g.12736345C>T" "" "" "" "FRMPD4(NM_014728.3):c.3400C>T (p.(Pro1134Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12718226C>T" "" "VUS" "" "0000333176" "0" "50" "X" "12736510" "12736510" "subst" "0" "01804" "FRMPD4_000044" "g.12736510C>T" "" "" "" "FRMPD4(NM_014728.3):c.3565C>T (p.(Arg1189Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.12718391C>T" "" "VUS" "" "0000400931" "1" "30" "X" "12725701" "12725701" "subst" "0.193336" "00124" "FRMPD4_000047" "g.12725701C>G" "17/208 cases" "{PMID:Tarpey 2009:19377476}" "" "V467V" "recurrent, found 17 times" "Germline" "" "" "0" "" "" "g.12707582C>G" "" "likely benign" "" "0000400932" "1" "30" "X" "12735813" "12735813" "subst" "0" "00124" "FRMPD4_000048" "g.12735813C>T" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "S956S" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.12717694C>T" "" "likely benign" "" "0000400933" "1" "30" "X" "12736882" "12736882" "subst" "0.00182258" "00124" "FRMPD4_000049" "g.12736882C>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "R1313R" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.12718763C>A" "" "likely benign" "" "0000400934" "1" "30" "X" "12692997" "12692997" "subst" "0.0000168163" "00124" "FRMPD4_000046" "g.12692997G>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "S146S" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.12674878G>A" "" "likely benign" "" "0000408104" "21" "90" "X" "12734429" "12734429" "del" "0" "00006" "FRMPD4_000051" "g.12734429del" "" "{PMID:Hu 2016:25644381}" "" "Cys618Valfs*8" "" "Germline" "yes" "" "0" "" "" "g.12716310del" "" "pathogenic (recessive)" "" "0000408105" "20" "90" "X" "12734235" "12734235" "subst" "0" "00006" "FRMPD4_000050" "g.12734235T>C" "" "{PMID:Hu 2016:25644381}" "" "Cys553Arg" "" "De novo" "" "" "0" "" "" "g.12716116T>C" "" "pathogenic (recessive)" "" "0000573385" "0" "30" "X" "12632966" "12632966" "subst" "0.000916502" "01943" "FRMPD4_000026" "g.12632966G>A" "" "" "" "FRMPD4(NM_014728.3):c.388G>A (p.A130T, p.(Ala130Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12614847G>A" "" "likely benign" "" "0000573390" "0" "50" "X" "12722594" "12722594" "subst" "0" "01943" "FRMPD4_000053" "g.12722594C>A" "" "" "" "FRMPD4(NM_014728.3):c.1187C>A (p.P396Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12704475C>A" "" "VUS" "" "0000573391" "0" "50" "X" "12725019" "12725019" "subst" "0" "01804" "FRMPD4_000054" "g.12725019C>G" "" "" "" "FRMPD4(NM_014728.3):c.1272C>G (p.(Phe424Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12706900C>G" "" "VUS" "" "0000573392" "0" "30" "X" "12728585" "12728585" "subst" "0" "02327" "FRMPD4_000055" "g.12728585G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12710466G>A" "" "likely benign" "" "0000573395" "0" "30" "X" "12734821" "12734821" "subst" "0.0000839316" "01943" "FRMPD4_000058" "g.12734821C>G" "" "" "" "FRMPD4(NM_014728.3):c.2243C>G (p.A748G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12716702C>G" "" "likely benign" "" "0000573397" "0" "30" "X" "12735823" "12735823" "subst" "0.000342001" "01943" "FRMPD4_000036" "g.12735823G>A" "" "" "" "FRMPD4(NM_014728.3):c.2878G>A (p.A960T, p.(Ala960Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12717704G>A" "" "likely benign" "" "0000573398" "0" "30" "X" "12736012" "12736012" "subst" "0.0000951235" "02325" "FRMPD4_000060" "g.12736012T>C" "" "" "" "FRMPD4(NM_014728.3):c.3067T>C (p.C1023R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12717893T>C" "" "likely benign" "" "0000573399" "0" "30" "X" "12736213" "12736213" "subst" "0.0000671543" "01943" "FRMPD4_000061" "g.12736213A>G" "" "" "" "FRMPD4(NM_014728.3):c.3268A>G (p.S1090G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12718094A>G" "" "likely benign" "" "0000573401" "0" "30" "X" "12736383" "12736383" "subst" "0.000610186" "01943" "FRMPD4_000063" "g.12736383A>C" "" "" "" "FRMPD4(NM_014728.3):c.3438A>C (p.Q1146H, p.(Gln1146His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12718264A>C" "" "likely benign" "" "0000573402" "0" "30" "X" "12736383" "12736383" "subst" "0.000610186" "01804" "FRMPD4_000063" "g.12736383A>C" "" "" "" "FRMPD4(NM_014728.3):c.3438A>C (p.Q1146H, p.(Gln1146His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12718264A>C" "" "likely benign" "" "0000573403" "0" "30" "X" "12736436" "12736436" "subst" "0" "01804" "FRMPD4_000043" "g.12736436A>T" "" "" "" "FRMPD4(NM_014728.3):c.3491A>T (p.D1164V, p.(Asp1164Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12718317A>T" "" "likely benign" "" "0000573405" "0" "30" "X" "12736758" "12736758" "subst" "0.000156828" "01943" "FRMPD4_000065" "g.12736758C>T" "" "" "" "FRMPD4(NM_014728.3):c.3813C>T (p.H1271=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12718639C>T" "" "likely benign" "" "0000618974" "0" "30" "X" "12725698" "12725698" "subst" "0.000247831" "01943" "FRMPD4_000067" "g.12725698C>T" "" "" "" "FRMPD4(NM_014728.3):c.1398C>T (p.H466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12707579C>T" "" "likely benign" "" "0000618975" "0" "30" "X" "12728649" "12728649" "subst" "0.000214136" "01943" "FRMPD4_000068" "g.12728649G>T" "" "" "" "FRMPD4(NM_014728.3):c.1602G>T (p.Q534H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12710530G>T" "" "likely benign" "" "0000618976" "0" "30" "X" "12734516" "12734516" "subst" "0.0000111946" "01943" "FRMPD4_000070" "g.12734516G>A" "" "" "" "FRMPD4(NM_014728.3):c.1938G>A (p.P646=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12716397G>A" "" "likely benign" "" "0000618977" "0" "30" "X" "12734825" "12734825" "subst" "0.00000559513" "01943" "FRMPD4_000071" "g.12734825G>A" "" "" "" "FRMPD4(NM_014728.3):c.2247G>A (p.E749=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12716706G>A" "" "likely benign" "" "0000618978" "0" "30" "X" "12734828" "12734828" "subst" "0.0000279783" "01943" "FRMPD4_000072" "g.12734828C>T" "" "" "" "FRMPD4(NM_014728.3):c.2250C>T (p.D750=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12716709C>T" "" "likely benign" "" "0000624408" "0" "30" "X" "12712534" "12712534" "subst" "0" "01943" "FRMPD4_000066" "g.12712534A>G" "" "" "" "FRMPD4(NM_014728.3):c.894A>G (p.L298=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12694415A>G" "" "likely benign" "" "0000624409" "0" "30" "X" "12734378" "12734378" "subst" "0" "01943" "FRMPD4_000069" "g.12734378C>T" "" "" "" "FRMPD4(NM_014728.3):c.1800C>T (p.A600=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12716259C>T" "" "likely benign" "" "0000659073" "0" "30" "X" "12736042" "12736042" "subst" "0.0000279811" "01804" "FRMPD4_000073" "g.12736042G>A" "" "" "" "FRMPD4(NM_014728.3):c.3097G>A (p.(Asp1033Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.12717923G>A" "" "likely benign" "" "0000668268" "21" "90" "X" "12712496" "12712496" "subst" "0" "03671" "FRMPD4_000074" "g.12712496C>T" "" "{PMID:Piard 2018:29267967}" "" "" "" "Germline" "" "" "0" "" "" "g.12694377C>T" "" "likely pathogenic (recessive)" "" "0000668269" "21" "90" "X" "12712496" "12712496" "subst" "0" "03671" "FRMPD4_000074" "g.12712496C>T" "" "{PMID:Piard 2018:29267967}" "" "" "" "Germline" "" "" "0" "" "" "g.12694377C>T" "" "likely pathogenic (recessive)" "" "0000668270" "0" "90" "X" "12734235" "12734235" "subst" "0" "03671" "FRMPD4_000050" "g.12734235T>C" "" "{PMID:Piard 2018:29267967}" "" "" "" "De novo" "" "" "0" "" "" "g.12716116T>C" "" "likely pathogenic (recessive)" "" "0000668275" "21" "90" "X" "12514000" "12515801" "del" "0" "03671" "FRMPD4_000075" "g.(12514000_12515801)_(12581900_1258300)del" "" "{PMID:Piard 2018:29267967}" "" "chrX:12515801–12581900del hg19" "∼66 Kb microdeletion exon 2" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000668276" "21" "90" "X" "12514000" "12515801" "del" "0" "03671" "FRMPD4_000075" "g.(12514000_12515801)_(12581900_1258300)del" "" "{PMID:Piard 2018:29267967}" "" "chrX:12515801–12581900del hg19" "∼66 Kb microdeletion exon 2" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000682074" "0" "30" "X" "12724940" "12724940" "subst" "0.0000299303" "01943" "FRMPD4_000076" "g.12724940C>T" "" "" "" "FRMPD4(NM_014728.3):c.1198-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682075" "0" "30" "X" "12734299" "12734299" "subst" "0" "01804" "FRMPD4_000077" "g.12734299A>C" "" "" "" "FRMPD4(NM_014728.3):c.1721A>C (p.(Asp574Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693327" "0" "10" "X" "12632974" "12632974" "subst" "0" "01943" "FRMPD4_000078" "g.12632974C>A" "" "" "" "FRMPD4(NM_014728.3):c.396C>A (p.P132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000693328" "0" "30" "X" "12724971" "12724971" "subst" "0.000720594" "01943" "FRMPD4_000079" "g.12724971T>C" "" "" "" "FRMPD4(NM_014728.3):c.1224T>C (p.H408=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693329" "0" "50" "X" "12728612" "12728612" "subst" "0" "02325" "FRMPD4_000080" "g.12728612T>C" "" "" "" "FRMPD4(NM_014728.3):c.1565T>C (p.I522T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693330" "0" "30" "X" "12734339" "12734339" "subst" "0.000134348" "01943" "FRMPD4_000081" "g.12734339G>A" "" "" "" "FRMPD4(NM_014728.3):c.1761G>A (p.M587I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728389" "0" "70" "X" "12516876" "12516898" "del" "0" "02329" "FRMPD4_000052" "g.12516876_12516898del" "" "" "" "FRMPD4(NM_014728.3):c.119_141delAGATGACGGCAAACCGAGATGGG (p.E40Afs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000728392" "0" "50" "X" "12627982" "12627982" "subst" "0" "02327" "FRMPD4_000082" "g.12627982G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728394" "0" "30" "X" "12728571" "12728571" "subst" "0.000688975" "01943" "FRMPD4_000083" "g.12728571G>T" "" "" "" "FRMPD4(NM_014728.3):c.1524G>T (p.T508=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728395" "0" "50" "X" "12735121" "12735121" "subst" "0" "01943" "FRMPD4_000084" "g.12735121C>T" "" "" "" "FRMPD4(NM_014728.3):c.2543C>T (p.S848F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728396" "0" "30" "X" "12735131" "12735131" "subst" "0.0000224904" "01943" "FRMPD4_000085" "g.12735131C>T" "" "" "" "FRMPD4(NM_014728.3):c.2553C>T (p.D851=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000728397" "0" "50" "X" "12735193" "12735193" "subst" "0" "02329" "FRMPD4_000059" "g.12735193C>T" "" "" "" "FRMPD4(NM_014728.3):c.2615C>T (p.T872M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728398" "0" "30" "X" "12736882" "12736882" "subst" "0.00182258" "01943" "FRMPD4_000049" "g.12736882C>A" "" "" "" "FRMPD4(NM_014728.3):c.3937C>A (p.R1313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809851" "0" "50" "X" "12728525" "12728525" "subst" "0.0000056755" "02325" "FRMPD4_000086" "g.12728525C>T" "" "" "" "FRMPD4(NM_014728.3):c.1478C>T (p.T493M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809852" "0" "30" "X" "12734426" "12734426" "subst" "0.0000168482" "01943" "FRMPD4_000087" "g.12734426C>A" "" "" "" "FRMPD4(NM_014728.3):c.1848C>A (p.A616=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809853" "0" "30" "X" "12734861" "12734861" "subst" "0" "01943" "FRMPD4_000088" "g.12734861G>C" "" "" "" "FRMPD4(NM_014728.3):c.2283G>C (p.V761=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809854" "0" "30" "X" "12735017" "12735017" "subst" "0" "01943" "FRMPD4_000089" "g.12735017C>A" "" "" "" "FRMPD4(NM_014728.3):c.2439C>A (p.G813=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809855" "0" "30" "X" "12735786" "12735786" "subst" "0.000649187" "01943" "FRMPD4_000090" "g.12735786A>G" "" "" "" "FRMPD4(NM_014728.3):c.2841A>G (p.A947=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809856" "0" "30" "X" "12736324" "12736324" "subst" "0.000341389" "01943" "FRMPD4_000091" "g.12736324G>A" "" "" "" "FRMPD4(NM_014728.3):c.3379G>A (p.E1127K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856324" "0" "90" "X" "12734429" "12734429" "del" "0" "02325" "FRMPD4_000051" "g.12734429del" "" "" "" "FRMPD4(NM_014728.3):c.1851delC (p.C618Vfs*8)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000856325" "0" "50" "X" "12735799" "12735799" "subst" "0" "02327" "FRMPD4_000094" "g.12735799G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856326" "0" "50" "X" "12736108" "12736108" "subst" "0" "02327" "FRMPD4_000095" "g.12736108G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856327" "0" "30" "X" "12736648" "12736648" "subst" "0.000420665" "01943" "FRMPD4_000096" "g.12736648G>A" "" "" "" "FRMPD4(NM_014728.3):c.3703G>A (p.V1235M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867020" "0" "30" "X" "12708406" "12708406" "subst" "0.000591786" "01943" "FRMPD4_000092" "g.12708406G>A" "" "" "" "FRMPD4(NM_014728.3):c.774G>A (p.T258=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000867022" "0" "50" "X" "12735750" "12735750" "subst" "0.00000559428" "02329" "FRMPD4_000093" "g.12735750G>A" "" "" "" "FRMPD4(NM_001368401.1):c.2781G>A (p.M927I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867023" "0" "30" "X" "12736659" "12736659" "subst" "0" "01943" "FRMPD4_000097" "g.12736659G>C" "" "" "" "FRMPD4(NM_014728.3):c.3714G>C (p.P1238=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895915" "0" "30" "X" "12734503" "12734503" "subst" "0.000128748" "02325" "FRMPD4_000030" "g.12734503C>T" "" "" "" "FRMPD4(NM_014728.3):c.1925C>T (p.A642V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895916" "0" "30" "X" "12734650" "12734650" "subst" "0.000240695" "02325" "FRMPD4_000032" "g.12734650G>T" "" "" "" "FRMPD4(NM_014728.3):c.2072G>T (p.G691V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915598" "0" "50" "X" "12728575" "12728575" "subst" "0" "02327" "FRMPD4_000098" "g.12728575G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000915599" "0" "50" "X" "12736421" "12736421" "subst" "0" "02325" "FRMPD4_000099" "g.12736421C>G" "" "" "" "FRMPD4(NM_014728.3):c.3476C>G (p.S1159*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000922206" "0" "50" "X" "12734835" "12734835" "subst" "0" "03779" "chrX_018818" "g.12734835G>A" "" "" "" "" "" "Unknown" "" "rs775114807" "0" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes FRMPD4 ## Count = 99 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000001789" "00000900" "50" "1471" "-258" "1471" "-251" "c.1471-258_1471-251del" "r.(=)" "p.(=)" "" "0000002784" "00000900" "50" "1287" "8" "1287" "8" "c.1287+8del" "r.(=)" "p.(=)" "" "0000002785" "00000900" "50" "1471" "-266" "1471" "-259" "c.1471-266_1471-259del" "r.(=)" "p.(=)" "" "0000006314" "00000900" "50" "42" "-319" "42" "-319" "c.42-319A>G" "r.(=)" "p.(=)" "" "0000006315" "00000900" "50" "1197" "12" "1197" "12" "c.1197+12C>G" "r.(=)" "p.(=)" "" "0000006316" "00000900" "50" "3964" "237" "3964" "237" "c.3964+237G>T" "r.(=)" "p.(=)" "" "0000006317" "00000900" "50" "4611" "0" "4611" "0" "c.*642A>G" "r.(=)" "p.(=)" "" "0000006318" "00000900" "50" "5435" "0" "5435" "0" "c.*1466T>C" "r.(=)" "p.(=)" "" "0000008375" "00000900" "50" "1197" "12" "1197" "12" "c.1197+12C>G" "r.(=)" "p.(=)" "" "0000008376" "00000900" "50" "1287" "26" "1287" "26" "c.1287+26dup" "r.(=)" "p.(=)" "" "0000008377" "00000900" "50" "1471" "-258" "1471" "-251" "c.1471-258_1471-251del" "r.(=)" "p.(=)" "" "0000008378" "00000900" "50" "3964" "237" "3964" "237" "c.3964+237G>T" "r.(=)" "p.(=)" "" "0000008379" "00000900" "50" "4611" "0" "4611" "0" "c.*642A>G" "r.(=)" "p.(=)" "" "0000008380" "00000900" "50" "5435" "0" "5435" "0" "c.*1466T>C" "r.(=)" "p.(=)" "" "0000010790" "00000900" "50" "1287" "8" "1287" "8" "c.1287+8del" "r.(=)" "p.(=)" "" "0000010791" "00000900" "50" "1471" "-266" "1471" "-259" "c.1471-266_1471-259del" "r.(=)" "p.(=)" "" "0000254320" "00000900" "30" "3491" "0" "3491" "0" "c.3491A>T" "r.(?)" "p.(Asp1164Val)" "" "0000254384" "00000900" "30" "2048" "0" "2048" "0" "c.2048A>G" "r.(?)" "p.(Glu683Gly)" "" "0000254835" "00000900" "30" "2599" "0" "2599" "0" "c.2599A>G" "r.(?)" "p.(Asn867Asp)" "" "0000280921" "00000900" "10" "1197" "12" "1197" "12" "c.1197+12C>G" "r.(=)" "p.(=)" "" "0000287946" "00000900" "10" "1287" "25" "1287" "26" "c.1287+25_1287+26del" "r.(=)" "p.(=)" "" "0000287947" "00000900" "30" "1287" "26" "1287" "26" "c.1287+26del" "r.(=)" "p.(=)" "" "0000287948" "00000900" "30" "1452" "0" "1452" "0" "c.1452C>G" "r.(?)" "p.(Leu484=)" "" "0000287949" "00000900" "30" "2072" "0" "2072" "0" "c.2072G>T" "r.(?)" "p.(Gly691Val)" "" "0000287950" "00000900" "30" "2640" "0" "2640" "0" "c.2640C>T" "r.(?)" "p.(Ser880=)" "" "0000287951" "00000900" "30" "2917" "0" "2917" "0" "c.2917G>C" "r.(?)" "p.(Ala973Pro)" "" "0000287952" "00000900" "30" "3445" "0" "3445" "0" "c.3445C>T" "r.(?)" "p.(Arg1149Cys)" "" "0000287953" "00000900" "30" "3713" "0" "3713" "0" "c.3713C>T" "r.(?)" "p.(Pro1238Leu)" "" "0000287954" "00000900" "30" "380" "0" "380" "0" "c.380C>T" "r.(?)" "p.(Pro127Leu)" "" "0000287955" "00000900" "50" "62" "0" "62" "0" "c.62G>C" "r.(?)" "p.(Gly21Ala)" "" "0000333166" "00000900" "30" "388" "0" "388" "0" "c.388G>A" "r.(?)" "p.(Ala130Thr)" "" "0000333168" "00000900" "30" "2048" "0" "2048" "0" "c.2048A>G" "r.(?)" "p.(Glu683Gly)" "" "0000333169" "00000900" "50" "2278" "0" "2278" "0" "c.2278C>T" "r.(?)" "p.(Leu760Phe)" "" "0000333171" "00000900" "50" "2878" "0" "2878" "0" "c.2878G>A" "r.(?)" "p.(Ala960Thr)" "" "0000333173" "00000900" "50" "2914" "0" "2914" "0" "c.2914G>T" "r.(?)" "p.(Ala972Ser)" "" "0000333175" "00000900" "50" "3400" "0" "3400" "0" "c.3400C>T" "r.(?)" "p.(Pro1134Ser)" "" "0000333176" "00000900" "50" "3565" "0" "3565" "0" "c.3565C>T" "r.(?)" "p.(Arg1189Cys)" "" "0000400931" "00000900" "30" "1401" "0" "1401" "0" "c.1401C>G" "r.(?)" "p.(=)" "13" "0000400932" "00000900" "30" "2868" "0" "2868" "0" "c.2868C>T" "r.(?)" "p.(=)" "16" "0000400933" "00000900" "30" "3937" "0" "3937" "0" "c.3937C>A" "r.(?)" "p.(=)" "16" "0000400934" "00000900" "30" "438" "0" "438" "0" "c.438G>A" "r.(?)" "p.(=)" "5" "0000408104" "00000900" "90" "1851" "0" "1851" "0" "c.1851del" "r.(?)" "p.(Cys618Valfs*8)" "15" "0000408105" "00000900" "90" "1657" "0" "1657" "0" "c.1657T>C" "r.(?)" "p.(Cys553Arg)" "15" "0000573385" "00000900" "30" "388" "0" "388" "0" "c.388G>A" "r.(?)" "p.(Ala130Thr)" "" "0000573390" "00000900" "50" "1187" "0" "1187" "0" "c.1187C>A" "r.(?)" "p.(Pro396Gln)" "" "0000573391" "00000900" "50" "1272" "0" "1272" "0" "c.1272C>G" "r.(?)" "p.(Phe424Leu)" "" "0000573392" "00000900" "30" "1538" "0" "1538" "0" "c.1538G>A" "r.(?)" "p.(Arg513Gln)" "" "0000573395" "00000900" "30" "2243" "0" "2243" "0" "c.2243C>G" "r.(?)" "p.(Ala748Gly)" "" "0000573397" "00000900" "30" "2878" "0" "2878" "0" "c.2878G>A" "r.(?)" "p.(Ala960Thr)" "" "0000573398" "00000900" "30" "3067" "0" "3067" "0" "c.3067T>C" "r.(?)" "p.(Cys1023Arg)" "" "0000573399" "00000900" "30" "3268" "0" "3268" "0" "c.3268A>G" "r.(?)" "p.(Ser1090Gly)" "" "0000573401" "00000900" "30" "3438" "0" "3438" "0" "c.3438A>C" "r.(?)" "p.(Gln1146His)" "" "0000573402" "00000900" "30" "3438" "0" "3438" "0" "c.3438A>C" "r.(?)" "p.(Gln1146His)" "" "0000573403" "00000900" "30" "3491" "0" "3491" "0" "c.3491A>T" "r.(?)" "p.(Asp1164Val)" "" "0000573405" "00000900" "30" "3813" "0" "3813" "0" "c.3813C>T" "r.(?)" "p.(His1271=)" "" "0000618974" "00000900" "30" "1398" "0" "1398" "0" "c.1398C>T" "r.(?)" "p.(His466=)" "" "0000618975" "00000900" "30" "1602" "0" "1602" "0" "c.1602G>T" "r.(?)" "p.(Gln534His)" "" "0000618976" "00000900" "30" "1938" "0" "1938" "0" "c.1938G>A" "r.(?)" "p.(Pro646=)" "" "0000618977" "00000900" "30" "2247" "0" "2247" "0" "c.2247G>A" "r.(?)" "p.(Glu749=)" "" "0000618978" "00000900" "30" "2250" "0" "2250" "0" "c.2250C>T" "r.(?)" "p.(Asp750=)" "" "0000624408" "00000900" "30" "894" "0" "894" "0" "c.894A>G" "r.(?)" "p.(Leu298=)" "" "0000624409" "00000900" "30" "1800" "0" "1800" "0" "c.1800C>T" "r.(?)" "p.(Ala600=)" "" "0000659073" "00000900" "30" "3097" "0" "3097" "0" "c.3097G>A" "r.(?)" "p.(Asp1033Asn)" "" "0000668268" "00000900" "90" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286*)" "" "0000668269" "00000900" "90" "856" "0" "856" "0" "c.856C>T" "r.(?)" "p.(Arg286*)" "" "0000668270" "00000900" "90" "1657" "0" "1657" "0" "c.1657T>C" "r.(?)" "p.(Cys553Arg)" "" "0000668275" "00000900" "90" "42" "-998" "159" "-45940" "c.(42-2799_42-998)_(159-45940_159-44840)del" "r.?" "p.(Arg16_His54del)" "1i_2i" "0000668276" "00000900" "90" "42" "-998" "159" "-45940" "c.(42-2799_42-998)_(159-45940_159-44840)del" "r.?" "p.(Arg16_His54del)" "1i_2i" "0000682074" "00000900" "30" "1198" "-5" "1198" "-5" "c.1198-5C>T" "r.spl?" "p.?" "" "0000682075" "00000900" "30" "1721" "0" "1721" "0" "c.1721A>C" "r.(?)" "p.(Asp574Ala)" "" "0000693327" "00000900" "10" "396" "0" "396" "0" "c.396C>A" "r.(?)" "p.(Pro132=)" "" "0000693328" "00000900" "30" "1224" "0" "1224" "0" "c.1224T>C" "r.(?)" "p.(His408=)" "" "0000693329" "00000900" "50" "1565" "0" "1565" "0" "c.1565T>C" "r.(?)" "p.(Ile522Thr)" "" "0000693330" "00000900" "30" "1761" "0" "1761" "0" "c.1761G>A" "r.(?)" "p.(Met587Ile)" "" "0000728389" "00000900" "70" "119" "0" "141" "0" "c.119_141del" "r.(?)" "p.(Glu40AlafsTer15)" "" "0000728392" "00000900" "50" "301" "0" "301" "0" "c.301G>C" "r.(?)" "p.(Val101Leu)" "" "0000728394" "00000900" "30" "1524" "0" "1524" "0" "c.1524G>T" "r.(?)" "p.(Thr508=)" "" "0000728395" "00000900" "50" "2543" "0" "2543" "0" "c.2543C>T" "r.(?)" "p.(Ser848Phe)" "" "0000728396" "00000900" "30" "2553" "0" "2553" "0" "c.2553C>T" "r.(?)" "p.(Asp851=)" "" "0000728397" "00000900" "50" "2615" "0" "2615" "0" "c.2615C>T" "r.(?)" "p.(Thr872Met)" "" "0000728398" "00000900" "30" "3937" "0" "3937" "0" "c.3937C>A" "r.(?)" "p.(Arg1313=)" "" "0000809851" "00000900" "50" "1478" "0" "1478" "0" "c.1478C>T" "r.(?)" "p.(Thr493Met)" "" "0000809852" "00000900" "30" "1848" "0" "1848" "0" "c.1848C>A" "r.(?)" "p.(Ala616=)" "" "0000809853" "00000900" "30" "2283" "0" "2283" "0" "c.2283G>C" "r.(?)" "p.(Val761=)" "" "0000809854" "00000900" "30" "2439" "0" "2439" "0" "c.2439C>A" "r.(?)" "p.(Gly813=)" "" "0000809855" "00000900" "30" "2841" "0" "2841" "0" "c.2841A>G" "r.(?)" "p.(Ala947=)" "" "0000809856" "00000900" "30" "3379" "0" "3379" "0" "c.3379G>A" "r.(?)" "p.(Glu1127Lys)" "" "0000856324" "00000900" "90" "1851" "0" "1851" "0" "c.1851del" "r.(?)" "p.(Cys618Valfs*8)" "" "0000856325" "00000900" "50" "2854" "0" "2854" "0" "c.2854G>A" "r.(?)" "p.(Glu952Lys)" "" "0000856326" "00000900" "50" "3163" "0" "3163" "0" "c.3163G>A" "r.(?)" "p.(Ala1055Thr)" "" "0000856327" "00000900" "30" "3703" "0" "3703" "0" "c.3703G>A" "r.(?)" "p.(Val1235Met)" "" "0000867020" "00000900" "30" "774" "0" "774" "0" "c.774G>A" "r.(?)" "p.(Thr258=)" "" "0000867022" "00000900" "50" "2805" "0" "2805" "0" "c.2805G>A" "r.(?)" "p.(Met935Ile)" "" "0000867023" "00000900" "30" "3714" "0" "3714" "0" "c.3714G>C" "r.(?)" "p.(Pro1238=)" "" "0000895915" "00000900" "30" "1925" "0" "1925" "0" "c.1925C>T" "r.(?)" "p.(Ala642Val)" "" "0000895916" "00000900" "30" "2072" "0" "2072" "0" "c.2072G>T" "r.(?)" "p.(Gly691Val)" "" "0000915598" "00000900" "50" "1528" "0" "1528" "0" "c.1528G>A" "r.(?)" "p.(Gly510Arg)" "" "0000915599" "00000900" "50" "3476" "0" "3476" "0" "c.3476C>G" "r.(?)" "p.(Ser1159*)" "" "0000922206" "00000900" "50" "2257" "0" "2257" "0" "c.2257G>A" "r.(?)" "p.(Glu753Lys)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 27 "{{screeningid}}" "{{variantid}}" "0000000209" "0000001789" "0000000209" "0000002784" "0000000209" "0000002785" "0000000209" "0000006314" "0000000209" "0000006315" "0000000209" "0000006316" "0000000209" "0000006317" "0000000209" "0000006318" "0000000210" "0000008375" "0000000210" "0000008376" "0000000210" "0000008377" "0000000210" "0000008378" "0000000210" "0000008379" "0000000210" "0000008380" "0000000210" "0000010790" "0000000210" "0000010791" "0000174158" "0000400931" "0000174159" "0000400932" "0000174160" "0000400933" "0000174161" "0000400934" "0000184135" "0000408104" "0000184136" "0000408105" "0000304762" "0000668268" "0000304763" "0000668269" "0000304764" "0000668270" "0000304769" "0000668275" "0000304770" "0000668276"