### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = FZD4)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"FZD4" "frizzled family receptor 4" "11" "q14-q21" "unknown" "NG_011752.1" "UD_132084474161" "" "https://www.LOVD.nl/FZD4" "" "1" "4042" "8322" "604579" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases..Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/FZD4_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2010-04-29 00:00:00" "00006" "2020-01-10 09:05:51" "00000" "2025-11-01 13:22:20"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00008236" "FZD4" "frizzled family receptor 4" "001" "NM_012193.3" "" "NP_036325.2" "" "" "" "-313" "7081" "1614" "86666440" "86656717" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 9
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00116" "ND" "Norrie disease" "XLR" "310600" "" "" "" "00001" "2013-03-13 14:01:08" "00006" "2022-12-31 11:13:32"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"01327" "EVR1" "vitreoretinopathy, exudative, type 1 (EVR1)" "AD" "133780" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-04-30 09:58:15"
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"04240" "EVR;FEVR" "vitreoretinopathy, exudative (EVR; familial FVER))" "" "" "" "" "" "00006" "2015-04-10 12:38:11" "00006" "2019-07-31 13:55:30"
"05123" "SMA" "atrophy, muscular, spinal (SMA)" "" "" "" "" "" "00006" "2016-01-24 01:41:54" "" ""
"05301" "ROP" "retinopathy of prematurity (ROP)" "" "" "" "" "" "00006" "2017-07-06 15:07:07" "" ""
"05342" "CAKUT" "kidney and urinary tract, anomalies, congenital (CAKUT)" "" "" "" "" "" "00006" "2017-11-10 19:49:59" "00006" "2017-11-10 19:51:20"
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 3
"{{geneid}}" "{{diseaseid}}"
"FZD4" "01327"
"FZD4" "04240"
"FZD4" "05301"
## Individuals ## Do not remove or alter this header ##
## Count = 558
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00106555" "" "" "" "1" "" "01251" "{PMID:Nikopoulos 2010:20340138}" "" "" "" "" "" "0" "" "" "" ""
"00106556" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106557" "" "" "" "1" "" "00006" "{PMID: Kondo 2003:14507768}" "2 generation family, 1 affected, unaffected non carrier parents" "F" "" "Jamaica" "" "0" "" "" "" "Fam5PatII1"
"00106558" "" "" "" "1" "" "00006" "Boonstra 2009" "" "" "" "" "" "0" "" "" "" ""
"00106559" "" "" "" "1" "" "01251" "{PMID:Nikopoulos 2010:20340138}" "" "" "" "" "" "0" "" "" "" ""
"00106560" "" "" "" "1" "" "00006" "Muller 2008" "" "" "" "" "" "0" "" "" "" ""
"00106561" "" "" "" "1" "" "00006" "Boonstra 2009" "" "" "" "" "" "0" "" "" "" ""
"00106562" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106563" "" "" "" "1" "" "00006" "{PMID:Robitaille 2002:12172548}, {DOI:Robitaille 2002:10.1038/ng957}" "" "" "" "" "" "0" "" "" "" "12172548-Fam2"
"00106564" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106565" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106566" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106567" "" "" "" "1" "" "01251" "{PMID:Nikopoulos 2010:20340138}" "" "" "" "" "" "0" "" "" "" ""
"00106568" "" "" "" "1" "" "00006" "Kondo 2003" "" "" "" "" "" "0" "" "" "" ""
"00106569" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106570" "" "" "" "1" "" "00006" "Robitaille 2009" "" "" "" "" "" "0" "" "" "" ""
"00106571" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106572" "" "" "" "1" "" "00006" "Omoto 2004" "" "" "" "" "" "0" "" "" "" ""
"00106573" "" "" "" "1" "" "00006" "Ells 2010" "" "" "" "" "" "0" "" "" "" ""
"00106574" "" "" "" "1" "" "01251" "{PMID:Nikopoulos 2010:20340138}" "" "" "" "" "" "0" "" "" "" ""
"00106576" "" "" "" "1" "" "00006" "Boonstra 2009" "" "" "" "" "" "0" "" "" "" ""
"00106577" "" "" "" "1" "" "00006" "MacDonald 2005" "" "" "" "" "" "0" "" "" "" ""
"00106578" "" "" "" "1" "" "00006" "Qin 2005" "" "" "" "" "" "0" "" "" "" ""
"00106579" "" "" "" "1" "" "00006" "Yoshida 2004" "" "" "" "" "" "0" "" "" "" ""
"00106580" "" "" "" "1" "" "00006" "Qin 2005" "" "" "" "" "" "0" "" "" "" ""
"00106581" "" "" "" "1" "" "00006" "Ells 2010" "" "" "" "" "" "0" "" "" "" ""
"00106582" "" "" "" "1" "" "00006" "Kondo 2003" "" "" "" "" "" "0" "" "" "" ""
"00106583" "" "" "" "1" "" "00006" "Boonstra 2009" "" "" "" "" "" "0" "" "" "" ""
"00106584" "" "" "" "2" "" "00006" "{PMID: Kondo 2003:14507768}" "2-generation family, affected mother/son" "F" "" "" "" "0" "" "" "" "Fam4PatI1"
"00106585" "" "" "" "1" "" "00006" "Muller 2008" "" "" "" "" "" "0" "" "" "" ""
"00106586" "" "" "" "1" "" "00006" "Toomes 2004b" "" "" "" "" "" "0" "" "" "" ""
"00106587" "" "" "" "1" "" "01251" "{PMID:Nikopoulos 2010:20340138}" "" "" "" "" "" "0" "" "" "" ""
"00106588" "" "" "" "29" "" "00006" "{PMID:Robitaille 2002:12172548}, {DOI:Robitaille 2002:10.1038/ng957}" "3-generation family, 29 affecteds (16F, 13M)" "F;M" "no" "Canada" "" "0" "" "" "British" "12172548-Fam"
"00265202" "" "" "" "2" "" "03382" "{PMID:Tian 2019:30820142}" "2-generation family, affected father/son" "M" "?" "China" "04y" "0" "yes" "" "" "FamAPatient 1 (son)"
"00265204" "" "" "00265202" "1" "" "03382" "{PMID:Tian 2019:30820142 }" "affected father" "M" "?" "China" "?" "0" "no" "" "" "FamAPat2 (father)"
"00265205" "" "" "" "2" "" "03382" "{PMID: Tian 2019: 30820142}" "2-generation family, affected father/son" "M" "?" "China" "03y" "0" "yes" "" "" "FamBPat3 (son)"
"00265206" "" "" "00265205" "1" "" "03382" "{PMID: Tian 2019 : 30820142}" "2-generation family, affected father/son" "M" "?" "China" "?" "0" "" "" "" "FamB Patient 4 Tian 2019 (father)"
"00265211" "" "" "" "2" "" "03382" "{PMID: Tian 2019 :30820142}" "2-generation family, affetced father/son" "M" "?" "China" "03y" "0" "" "" "" "FamC Patient 5 Tian 2019 (son)"
"00265241" "" "" "00265211" "1" "" "03382" "{PMID:Tian 2019 : 30820142 }" "2-generation family,affected father/son" "M" "?" "China" "?" "0" "" "" "" "FamC Patient 6 Tian 2019 (father)"
"00265242" "" "" "" "2" "" "03382" "{PMID:Tian 2019:30820142}" "2-generation family, affected father/son" "M" "?" "China" "02y" "0" "yes" "" "" "FamD Patient 7 Tian 2019 (son)"
"00265243" "" "" "00265242" "1" "" "03382" "{PMID:Tian 2019:30820142}" "2-generation family, affected father/son" "M" "?" "China" "?" "0" "" "" "" "FamD Patient 8 Tian 2019 (father)"
"00265244" "" "" "" "2" "" "03382" "{PMID:Montecinos-Contreras 2016:27746066 }" "2-generation family, affected mother/son" "M" "?" "Mexico" "13y" "0" "yes" "" "" "Patient 1 Montecinos-Contreras 2016 (son"
"00265246" "" "" "00265244" "1" "" "03382" "{PMID:Montecinos-Contreras 2016:27746066 }" "2-generation family, affected mother/son" "F" "?" "Mexico" "53y" "0" "yes" "" "" "Patient 2 Montecinos-Contreras 2016 (mother)"
"00265248" "" "" "" "2" "" "03382" "{PMID:Khan 2016: 27668459}" "2-generation family, unaffected parents/sisters, two affected brothers" "M" "?" "United Arab Emirates" "?" "0" "" "" "" "Patient 1 Khan 2016"
"00265249" "" "" "00265248" "1" "" "03382" "{PMID:Khan 2016:27668459}" "2-generation family, unaffected parents/sisters, two affected brothers" "M" "?" "United Arab Emirates" "?" "0" "no" "" "" "Patient 2 Khan 2016"
"00265288" "" "" "" "2" "" "03382" "{PMID: Yang 2018:30537745 }" "2-generation family, affected father/son" "M" "no" "China" "07y" "0" "yes" "" "" "Patient 1 Yang 2018 (son)"
"00265289" "" "" "00265288" "1" "" "03382" "{PMID: Yang 2018:30537745 }" "2-generation family, affected father/son" "M" "?" "China" "32y" "0" "yes" "" "" "Patient 2 Yang 2018 (father)"
"00265291" "" "" "" "1" "" "03382" "{PMID:Fei 2015: 26530129 }" "" "F" "no" "China" "02y" "0" "yes" "" "Han" "3027001"
"00265292" "" "" "" "1" "" "03382" "{PMID:Fei 2015:26530129 }" "" "F" "no" "China" "03y" "0" "yes" "" "Han" "3060001"
"00274215" "" "" "" "1" "" "03382" "{PMID: Kondo 2009:18161623 }" "2-generation family, affected father/mother/daughter, father and mother asymptomatic" "F" "no" "Japan" "20y" "0" "" "" "" "Patient 1 Kondo 2009"
"00274222" "" "" "" "1" "" "03382" "{PMID: Yoshida 2004:15488808 }" "2-generation family, affected father/daughter" "F" "no" "Japan" "13y" "0" "" "" "" "Patient 1 Yoshida 2004"
"00274320" "" "" "" "2" "" "03383" "{PMID:Wu 2016:26908610}" "2 generation family, 2 affected (1 non-penetrant carrier)" "M" "no" "Taiwan" "" "0" "" "" "" "E1 II:1"
"00274321" "" "" "" "5" "" "03383" "{PMID:Wu 2016:26908610}" "4 generation family, 5 affected (4 nonpenetrant carriers)" "F" "no" "Taiwan" "" "0" "" "" "" "E10 III:10"
"00274891" "" "" "" "1" "" "03382" "{PMID:Iwata 2019:31294129 }" "sister of proband had FEVR in infancy and required photocoagulation" "M" "no" "Japan" "03y" "0" "" "" "" "Patient 1 Iwata 2019"
"00275005" "" "" "" "1" "" "03382" "{PMID:Bochicchio 2017:28850050 }" "" "F" "no" "Italy" "28y" "0" "" "" "Hispanic" "Patient 1 Bochicchio 2017"
"00275007" "" "" "" "1" "" "03382" "{PMID:Mammo 2015:26109022}" "" "M" "no" "Taiwan" "00y08m" "0" "" "" "" "Patient 1 Mammo 2015"
"00275439" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "3-generation family, mutation-carrying grandfather, father and elder sister all asympotmatic" "M" "" "China" "04y" "0" "" "" "Southern Chinese" "Patient 1 Tang 2016"
"00275442" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, mutation-carrying mother and brother completely asymptomatic" "F" "no" "China" "14y" "0" "" "" "Souther Chinese" "Patient 2 Tang 2016"
"00275444" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "" "M" "no" "China" "13y" "0" "" "" "Southern Chinese" "Patient 3 Tang 2016"
"00275446" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "mutation-carrying father and paternal uncle are clinically healthy with avascularity, mutation-carrying paternal aunt clinically healthy without any sign of retinopathy" "M" "no" "China" "11y" "0" "" "" "Southern Chinese" "Patient 4 Tang 2016"
"00275448" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation, affected but asymptomatic father" "M" "no" "China" "06y" "0" "" "" "Southern Chinese" "Patient 5 Tang 2016"
"00275450" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected father/elder brother" "M" "no" "China" "08y" "0" "" "" "Southern Chinese" "Patient 6 Tang 2016"
"00275451" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, mutation-carrying mother/elder sister, elder sister asymptomatic" "F" "no" "China" "00y07m" "0" "" "" "Southern Chinese" "Patient 7 Tang 2016"
"00275453" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, mutation-carrying mother/sister both asymptomatic" "M" "no" "China" "08y" "0" "" "" "Southern Chinese" "Patient 8 Tang 2016"
"00275454" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "" "F" "no" "China" "26y" "0" "" "" "Southern Chinese" "Patient 9 Tang 2016"
"00275455" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, mother affected but asymptomatic" "F" "no" "China" "03y" "0" "" "" "Southern Chinese" "Patient 10 Tang 2016"
"00275457" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "" "M" "no" "China" "08y" "0" "" "" "Southern Chinese" "Patient 11 Tang 2016"
"00275458" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected father/son" "M" "no" "China" "15y" "0" "" "" "Southern Chinese" "Patient 12 Tang 2016"
"00275459" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "" "M" "no" "China" "12y" "0" "" "" "Southern Chinese" "Patient 13 Tang 2016"
"00275460" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "" "M" "no" "China" "10y" "0" "" "" "Southern Chinese" "Patient 14 Tang 2016"
"00275462" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected both children" "M" "no" "China" "10y" "0" "" "" "Southern Chinese" "Patient 15 Tang 2016"
"00275463" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected father/mother and two sons" "M" "no" "China" "15y" "0" "" "" "Southern Chinese" "Patient 16 Tang 2016"
"00275464" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected mother/son" "M" "no" "China" "05y" "0" "" "" "Southern Chinese" "Patient 17 Tang 2016"
"00275465" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected mother/daughter" "F" "no" "China" "00y02m" "0" "" "" "Southern Chinese" "Patient 18 Tang 2016"
"00275466" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected mother/son" "M" "no" "China" "02y" "0" "" "" "Southern Chinese" "Patient 19 Tang 2016"
"00275467" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "2-generation family, affected mother/som" "M" "no" "China" "04y" "0" "" "" "Southern Chinese" "Patient 20 Tang 2016"
"00275468" "" "" "" "1" "" "03382" "{PMID:Tang 2016:27555740 }" "" "M" "no" "China" "00y06m" "0" "" "" "Southern Chinese" "Patient 21 Tang 2016"
"00275469" "" "" "" "1" "" "03382" "{PMID:Omoto 2004:15370539 }" "2-generation family, affected mother/daughter/son" "F" "no" "Japan" "06y" "0" "" "" "" "Patient 1 Omoto 2004"
"00275470" "" "" "" "1" "" "03382" "{PMID:Omoto 2004:15370539 }" "2-generation family, affected mother/daughter" "F" "no" "Japan" "01y01m" "0" "" "" "" "Patient 2 Omoto 2004"
"00275471" "" "" "" "1" "" "03382" "{PMID:MacDonald 2005:15733276}" "" "?" "no" "(United States)" "?" "0" "" "" "" "Patient 1 MacDonald 2005"
"00275472" "" "" "" "1" "" "03382" "{PMID:MacDonald 2005:15733276}" "" "?" "no" "(United States)" "?" "0" "" "" "" "Patient 2 MacDonald 2005"
"00275476" "" "" "" "4" "" "03382" "{PMID:Edwards 2012:22574936}" "6-generation family, affected III:11, III:12, III:15, V:16" "F" "no" "Australia" "75y" "0" "" "" "English" "Patient 1 Edwards 2012"
"00275478" "" "" "00275476" "1" "" "03382" "{PMID:Edwards 2012:22574936}" "6-generation family, affected III:11, III:12, III:15, V:16" "M" "no" "Australia" "78y" "0" "" "" "English" "Patient 2 Edwards 2012"
"00275479" "" "" "00275476" "1" "" "03382" "{PMID:Edwards 2012:22574936}" "6-generation family, affected III:11, III:12, III:15, V:16" "M" "no" "Australia" "62y" "0" "" "" "English" "Patient 3 Edwards 2012"
"00275480" "" "" "00275476" "1" "" "03382" "{PMID:Edwards 2012:22574936}" "6-generation family, affected III:11, III:12, III:15, V:16" "M" "no" "Australia" "13y" "0" "" "" "English" "Patient 4 Edwards 2012"
"00275481" "" "" "" "1" "" "03382" "{PMID:Robitaille 2009:19172507 }\r\n{PMID:Robitaille 2002:12172548 }" "3-generation family, affected maternal grandmother and aunt" "F" "no" "Canada" "09y" "0" "" "" "" "Patient 1 Robitaille 2009"
"00275483" "" "" "" "1" "" "03382" "{PMID:Robitaille 2002:12172548 }" "" "?" "?" "" "?" "0" "" "" "European" "Patient 2 Robitaille 2002"
"00275698" "" "" "" "2" "" "03382" "{PMID:Nallathambi 2006:17093393}" "4-generation family, affected father/son" "M" "yes" "India" "18y" "0" "" "" "" "Fam1PatIV3(Pat16)"
"00275699" "" "" "00275698" "1" "" "03382" "{PMID:Nallathambi 2006:17093393}" "father" "M" "no" "India" "46y" "0" "" "" "" "Fam1PatIII6(Pat26)"
"00275700" "" "" "" "5" "" "03382" "{PMID:Nallathambi 2006:17093393}" "4-generation family, 5 affected (5M)" "M" "no" "India" "55y" "0" "" "" "" "Fam2PatII5(Pat36)"
"00275701" "" "" "00275700" "1" "" "03382" "{PMID:Nallathambi 2006:17093393}" "cousin" "M" "no" "India" "28y" "0" "" "" "" "Fam2PatIII5(Pat46)"
"00275702" "" "" "00275700" "1" "" "03382" "{PMID:Nallathambi 2006:17093393}" "cousin" "M" "no" "India" "22y" "0" "" "" "" "Fam2PatIII7(Pat56)"
"00275704" "" "" "00275700" "1" "" "03382" "{PMID:Nallathambi 2006:17093393}" "cousin" "M" "no" "India" "13y" "0" "" "" "" "Fam2PatIII8(Pat66)"
"00275705" "" "" "00275700" "1" "" "03382" "{PMID:Nallathambi 2006:17093393}" "son" "M" "no" "India" "34y" "0" "" "" "" "Fam2PatIII12(Pat76)"
"00275706" "" "" "" "1" "" "03382" "{PMID:Nallathambi 2006:17093393}" "3-generation family, proband only affected member" "M" "no" "India" "53y" "0" "" "" "" "Fam3PatII1(Pat86)"
"00275707" "" "" "" "1" "" "03382" "{PMID:Kondo 2003:14507768}" "3-generation family, 4 affected (4M)" "M" "no" "Japan" "" "0" "" "" "" "Fam1PatIII1"
"00275828" "" "" "" "1" "" "03382" "{PMID:Kondo 2003:14507768}" "3-generation family, affected father/paternal uncle/brother/sister but only proband (brother) with symptoms" "M" "no" "Japan" "" "0" "" "" "" "Fam2PatIII1"
"00275831" "" "" "" "6" "" "03382" "{PMID:Jia 2010:20938005}" "4-generation family, 6 affected (3F, 3M) father/paternal aunt/paternal uncle, cousins (2) and siblings (2)" "F" "no" "China" "" "0" "" "" "" "Fam1"
"00275833" "" "" "" "1" "" "03382" "{PMID:Jia 2010:20938005}" "3-generation family, affected only the proband" "F" "" "China" "00y08m" "" "" "" "" "Fam2"
"00275835" "" "" "" "2" "" "03382" "{PMID:Jia 2010:20938005}" "3-generation family, 2 affected mother/son, parents carriers for two different mutations but asymptomatic" "F" "no" "China" "35y" "0" "" "" "" "Fam14"
"00275836" "" "" "" "2" "" "03382" "{PMID:Jia 2010:20938005}" "3-generation family, affected mother/son" "M" "no" "China" "00y06m" "0" "" "" "" "Fam15"
"00275837" "" "" "" "2" "" "03382" "{PMID:Jia 2010:20938005}" "3-generation family, affected father/son" "M" "no" "China" "00y10m" "0" "" "" "" "Fam7"
"00285934" "" "" "" "3" "" "03382" "{PMID: Jia 2010: 20938005 }" "2-generation family, affected mother/son, maternal uncle with history of retinal detachment" "M" "" "China" "00y06m" "0" "" "" "" "Fam8"
"00285935" "" "" "" "3" "" "03382" "{PMID: Jia 2010: 20938005 }" "2-generation family, father/daughter affected, father without symptoms but perilineal nephew diagnosed with FEVR" "F" "" "China" "00y09m" "0" "" "" "" "Fam9"
"00285938" "" "" "" "2" "" "03382" "{PMID: Jia 2010: 20938005 }" "2-generation family, affected mother/daughter" "F" "no" "China" "?" "0" "" "" "" "Fam10"
"00285940" "" "" "" "3" "" "03382" "{PMID: Jia 2010: 20938005 }" "3-generation family, 3 affected (3M) father/son and paternal uncle" "M" "no" "China" "04y" "0" "" "" "" "Fam11"
"00286030" "" "" "" "3" "" "03382" "{PMID: Jia 2010: 20938005 }" "2-generation family, 3 affected (2F, M) father/daughter and paternal aunt" "F" "no" "China" "05y" "0" "" "" "" "Fam12"
"00286031" "" "" "" "2" "" "03382" "{PMID: Jia 2010: 20938005 }" "3-generation family, 2 affected (F, M) mother/son" "M" "" "China" "02y" "0" "" "" "" "Fam13"
"00286931" "" "" "" "1" "" "03561" "{PMID:Xu 2019:31765079}" "2 generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "China" "" "0" "" "" "Chinese" "Fam1PatII1"
"00287035" "" "" "" "2" "" "03561" "{PMID:Xu 2019:31765079}" "2-generation family, affected father daughter" "F" "?" "China" "" "0" "" "" "Chinese" "Fam2PatII1"
"00287036" "" "" "00287035" "1" "" "03561" "{PMID:Xu 2019:31765079}" "father" "M" "-" "(China)" "" "0" "" "" "Chinese" "Fam2PatI1"
"00287038" "" "" "" "2" "" "03561" "{PMID:Xu 2019:31765079}" "2-generation family, affected father/son" "M" "?" "China" "" "0" "" "" "Chinese" "Fam3PatII2"
"00287039" "" "" "00287038" "1" "" "03561" "{PMID:Xu 2019:31765079}" "father" "M" "?" "China" "" "0" "" "" "Chinese" "Fam3PatI1"
"00287040" "" "" "" "2" "" "03561" "{PMID:Xu 2019:31765079}" "2-generation family, affected mother/daughter" "F" "?" "China" "" "0" "" "" "Chinese" "Fam4PatII1"
"00287041" "" "" "00287040" "1" "" "03561" "{PMID:Xu 2019:31765079}" "mother" "F" "" "China" "" "0" "" "" "Chinese" "Fam4PatI2"
"00287042" "" "" "" "2" "" "03561" "{PMID:Xu 2019:31765079}" "2-generation family, affected mother/daughter" "F" "?" "China" "" "0" "" "" "Chinese" "Fam5PatII1"
"00287043" "" "" "00287042" "1" "" "03561" "{PMID:Xu 2019:31765079}" "mother" "F" "" "China" "" "0" "" "" "Chinese" "Fam5PatI2"
"00287045" "" "" "" "2" "" "03561" "{PMID:Xu 2019:31765079}" "2-generation family, affected father/son" "M" "?" "China" "" "0" "" "" "Chinese" "Fam6PatII1"
"00287046" "" "" "00287045" "1" "" "03561" "{PMID:Xu 2019:31765079}" "father" "M" "?" "China" "" "0" "" "" "Chinese" "Fam6PatI1"
"00287048" "" "" "" "2" "" "03561" "{PMID:Xu 2019:31765079}" "2-generation family, affected father/son" "M" "" "China" "" "0" "" "" "Chinese" "Fam7PatII1"
"00287049" "" "" "00287048" "1" "" "03561" "{PMID:Xu 2019:31765079}" "father" "M" "?" "China" "" "0" "" "" "Chinese" "Fam7PatI1"
"00290555" "" "" "" "244" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00290556" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00290557" "" "" "" "117" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304324" "" "" "" "5" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00304325" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00309170" "" "" "" "1" "" "00004" "{PMID:Sharon 2019:31456290}" "1 IRD family" "" "" "Israel" "" "0" "" "" "" ""
"00316099" "" "" "" "2" "" "00006" "{PMID:Heidet 2017:28566479}" "affected patient and 1st degree relative (BO)" "" "" "France" "" "0" "" "" "" "K135"
"00328389" "" "" "" "1" "" "00000" "{PMID:Zhou 2018:29453956}" "" "" "" "China" "" "0" "" "" "" "690933"
"00333377" "" "" "" "1" "" "00000" "{PMID:Huang 2017:28867931}" "" "F" "" "China" "" "0" "" "" "" "Pat9"
"00333451" "" "" "" "1" "" "00000" "{PMID:Iarossi 2017:28758032}" "2-generation family, 1 affected, carrier mother" "M" "" "Italy" "" "0" "" "" "" "Fam1"
"00333452" "" "" "" "1" "" "00000" "{PMID:Iarossi 2017:28758032}" "2-generation family, 1 affected, carrier father" "M" "" "Italy" "" "0" "" "" "" "Fam2"
"00333453" "" "" "" "2" "" "00000" "{PMID:Iarossi 2017:28758032}" "2-generation family, affected mother/son" "F;M" "" "Italy" "" "0" "" "" "" "Fam3"
"00335198" "" "" "" "3" "" "00006" "{PMID:Schatz 2017:28211206}" "2-generation family, affected mother, daughter and son" "F" "" "Morocco" "" "0" "" "" "" "FamPatI2"
"00335199" "" "" "00335198" "1" "" "00006" "{PMID:Schatz 2017:28211206}" "daughter" "F" "" "Morocco" "" "0" "" "" "" "FamPatII1"
"00335200" "" "" "00335198" "1" "" "00006" "{PMID:Schatz 2017:28211206}" "son" "M" "" "Morocco" "" "0" "" "" "" "FamPatII2"
"00358956" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "M" "" "Switzerland" "" "0" "" "" "" "Case71703"
"00358969" "" "" "" "1" "" "00000" "{PMID:Tiwari 2016:27353947}" "see paper" "F" "" "Switzerland" "" "0" "" "" "" "Case71133"
"00358983" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam1"
"00358984" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam2"
"00358985" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam3"
"00358986" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam4"
"00358987" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam5"
"00358988" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam6"
"00358989" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam7"
"00358990" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam8"
"00358991" "" "" "" "1" "" "00000" "{PMID:Musada 2016:27316669}" "see paper" "" "" "India" "" "0" "" "" "" "Fam9"
"00359050" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "familial segregation analysis requested" "" "" "" "" "0" "" "" "" "12006042"
"00359051" "" "" "" "1" "" "00000" "{PMID:Ellingford 2016:27208204}" "patient" "" "" "" "" "0" "" "" "" "12000347"
"00362892" "" "" "" "1" "" "00000" "{PMID:Weisschuh 2016:26766544}" "family" "" "" "Germany" "" "0" "" "" "" "BD121"
"00363346" "" "" "" "1" "" "00000" "{PMID:Sun 2015:26747767}" "proband" "" "" "China" "" "0" "" "" "" "HM344"
"00363638" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "11DG0114"
"00363817" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat1"
"00363818" "" "" "" "2" "" "00000" "{PMID:Seo 2015:26244290}" "family, 2 affected" "F" "" "Korea" "" "0" "" "" "" "FamPat2-1"
"00363819" "" "" "00363818" "1" "" "00000" "{PMID:Seo 2015:26244290}" "relative" "M" "" "Korea" "" "0" "" "" "" "FamPat2-2"
"00363820" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat3"
"00363821" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat4"
"00363822" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat5"
"00363823" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "F" "" "Korea" "" "0" "" "" "" "Pat6"
"00363824" "" "" "" "2" "" "00000" "{PMID:Seo 2015:26244290}" "family, 2 affected" "F" "" "Korea" "" "0" "" "" "" "FamPat7-1"
"00363825" "" "" "00363824" "1" "" "00000" "{PMID:Seo 2015:26244290}" "relative" "F" "" "Korea" "" "0" "" "" "" "FamPat7-2"
"00363826" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat8"
"00363827" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "F" "" "Korea" "" "0" "" "" "" "Pat9"
"00363828" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat10"
"00363829" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "F" "" "Korea" "" "0" "" "" "" "Pat11"
"00363830" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat12"
"00363831" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "" "M" "" "Korea" "" "0" "" "" "" "Pat13"
"00363837" "" "" "" "1" "" "00000" "{PMID:Seo 2015:26244290}" "FEVR patients" "" "" "Korea" "" "0" "" "" "" "patient"
"00373418" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1080001"
"00373419" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1347002"
"00373420" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "14045002"
"00373421" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "720001"
"00373422" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "874001"
"00373423" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1344012"
"00373424" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "7067001"
"00373442" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1027001"
"00373443" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1399004"
"00373444" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1737001"
"00373445" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "2679002"
"00373446" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1076003"
"00373447" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "1328003"
"00373463" "" "" "" "1" "" "00000" "{PMID:Salvo 2015:25711638}" "family" "" "" "United States" "" "0" "" "" "" "16312001"
"00373957" "" "" "" "2" "" "00006" "{PMID:Stiegel 2013:25390515}" "family, 2 affected sibs" "" "" "United States" "" "0" "" "" "" "family"
"00375418" "" "" "" "1" "" "00000" "{PMID:Katagiri 2014:25268133}" "family" "" "" "Japan" "" "0" "" "" "" "RP#010"
"00376517" "" "" "" "1" "" "00000" "{PMID:Boonstra 2009:1932484}" "8/20 Families" "" "" "" "" "0" "" "" "" ""
"00376518" "" "" "" "1" "" "00000" "{PMID:Boonstra 2009:1932484}" "" "" "" "" "" "0" "" "" "" ""
"00376519" "" "" "" "1" "" "00000" "{PMID:Boonstra 2009:1932484}" "" "" "" "" "" "0" "" "" "" ""
"00376520" "" "" "" "1" "" "00000" "{PMID:Boonstra 2009:1932484}" "" "" "" "" "" "0" "" "" "" ""
"00379494" "" "" "" "1" "" "00000" "{PMID:Zhou 2011:29453956}" "" "" "" "China" "" "0" "" "" "" ""
"00379783" "" "" "" "1" "" "03508" "" "" "M" "" "Korea, South (Republic)" "" "" "" "" "" "IR_GH_0147"
"00380263" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "F" "" "China" "" "0" "" "" "" ""
"00380264" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "M" "" "China" "" "0" "" "" "" ""
"00380265" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "F" "" "China" "" "0" "" "" "" ""
"00380266" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "M" "" "China" "" "0" "" "" "" ""
"00380267" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "M" "" "China" "" "0" "" "" "" ""
"00380268" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "F" "" "China" "" "0" "" "" "" ""
"00380269" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "F" "" "China" "" "0" "" "" "" ""
"00380270" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "M" "" "China" "" "0" "" "" "" ""
"00380271" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "M" "" "China" "" "0" "" "" "" ""
"00380272" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "F" "" "China" "" "0" "" "" "" ""
"00380273" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "F" "" "China" "" "0" "" "" "" ""
"00380274" "" "" "" "1" "" "00000" "{PMID:Yang-2012:23077402}" "" "M" "" "China" "" "0" "" "" "" ""
"00380748" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "M" "" "China" "" "0" "" "" "" "1"
"00380749" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "F" "" "China" "" "0" "" "" "" "2"
"00380750" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "M" "" "China" "" "0" "" "" "" "3"
"00380751" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "F" "" "China" "" "0" "" "" "" "4"
"00380752" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "F" "" "China" "" "0" "" "" "" "5"
"00380753" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "M" "" "China" "" "0" "" "" "" "6"
"00380754" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "F" "" "China" "" "0" "" "" "" "7"
"00380757" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "M" "" "China" "" "0" "" "" "" "10"
"00380758" "" "" "" "1" "" "00000" "{PMID:Li 2018:30097784}" "" "F" "" "China" "" "0" "" "" "" "11"
"00381091" "" "" "" "1" "" "00000" "{PMID:Kondo-2013:23441120}" "The father of patient carried the p.H69Y change and no sign of FEVR was found." "M" "no" "" "" "0" "" "" "Japanese" ""
"00381092" "" "" "" "1" "" "00000" "{PMID:Kondo-2013:23441120}" "" "M" "no" "" "" "0" "" "" "Japanese" ""
"00381093" "" "" "" "1" "" "00000" "{PMID:Kondo-2013:23441120}" "" "F" "no" "" "" "0" "" "" "Japanese" ""
"00381094" "" "" "" "1" "" "00000" "{PMID:Kondo-2013:23441120}" "The mother of patient #N4001 did not carry the p.Y211H change and had no ocular symptoms or family history of FEVR but had minimal vascular changes without retinal avascularization in the eyes and had macular macrovessels in the left eye." "M" "no" "" "" "0" "" "" "Japanese" ""
"00381976" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151224C01201"
"00381977" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160331C00101"
"00381978" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160406C01601"
"00381979" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160505C00601"
"00381980" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151012C00801"
"00381981" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151012C01001"
"00381982" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151029C03901"
"00381983" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151201C02501"
"00381984" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160201C00901"
"00381985" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160321C03001g"
"00381986" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160324C03601c"
"00381987" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160517C03501"
"00381988" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160621C07901"
"00381989" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160728C04101"
"00381990" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160728C04201"
"00381991" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151127C00201"
"00381992" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160428C00101"
"00381993" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160513C01201"
"00381994" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160729C00501"
"00381995" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160926C00701"
"00381996" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "2015-S07652"
"00381997" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150616C01001"
"00381998" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150702C01201"
"00381999" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150713C02201"
"00382000" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150722C02601"
"00382001" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150731C00501"
"00382002" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150827C01001b"
"00382003" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C150914C04401"
"00382004" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151112C01501e"
"00382005" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151204C00101"
"00382006" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C151224C01101"
"00382007" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160104C04601"
"00382008" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160122C00801"
"00382009" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160201C00801d"
"00382010" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160219C00601"
"00382011" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160229C01601"
"00382012" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160322C01501"
"00382013" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160325C00101"
"00382014" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160413C00601"
"00382015" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160414C00601"
"00382016" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160513C00301"
"00382017" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160517C00501"
"00382018" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160524C00101"
"00382019" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160527C00701"
"00382020" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160620C00701"
"00382021" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160718C04701f"
"00382022" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160809C01901"
"00382023" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160809C07501"
"00382024" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160826C00601"
"00382025" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160826C01301a"
"00382026" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160829C05101"
"00382027" "" "" "" "1" "" "00000" "{PMID:Li 2018:30452590}" "" "?" "" "China" "" "0" "" "" "" "C160926C00501"
"00382627" "" "" "" "1" "" "00000" "{PMID:Liu 2019:30474316}" "Family 2, case 2" "M" "" "China" "" "0" "" "" "" "Family_2_II-1"
"00382628" "" "" "" "1" "" "00000" "{PMID:Liu 2019:30474316}" "Family 2, mother of case 2" "F" "" "China" "" "0" "" "" "" "Family_2_I-2"
"00382629" "" "" "" "1" "" "00000" "{PMID:Liu 2019:30474316}" "Family 2, brother of case 2 (tested at 19 weeks gestation)" "M" "" "China" "" "0" "" "" "" "Family_2_II-2"
"00382763" "" "" "" "1" "" "00000" "{PMID:Qin-2005:15981244}" "" "M" "no" "Japan" "" "0" "" "" "Japanese" ""
"00382774" "" "" "" "2" "" "00000" "{PMID:Qin-2005:15981244}" "" "" "no" "Japan" "" "0" "" "" "Japanese" ""
"00382775" "" "" "" "1" "" "00000" "{PMID:Qin-2005:15981244}" "" "" "no" "Japan" "" "0" "" "" "Japanese" ""
"00382776" "" "" "" "1" "" "00000" "{PMID:Qin-2005:15981244}" "" "" "no" "Japan" "" "0" "" "" "Japanese" ""
"00382777" "" "" "" "1" "" "00000" "{PMID:Qin-2005:15981244}" "" "" "no" "Japan" "" "0" "" "" "Japanese" ""
"00382778" "" "" "" "1" "" "00000" "{PMID:Qin-2005:15981244}" "" "" "no" "Japan" "" "0" "" "" "Japanese" ""
"00382779" "" "" "" "1" "" "00000" "{PMID:Qin-2005:15981244}" "" "" "no" "Japan" "" "0" "" "" "Japanese" ""
"00383524" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383525" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383526" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383527" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383528" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383529" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383530" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383531" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383532" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383533" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383534" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383535" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383536" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383537" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383538" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383539" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383540" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383541" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31299183}" "" "" "" "China" "" "0" "" "" "" "?"
"00383638" "" "" "" "1" "" "00000" "{PMID:Chen 2019:31237656}" "proband, family 285, individual II:1" "M" "no" "China" "" "0" "" "" "" "285_II:1"
"00383639" "" "" "" "2" "" "00000" "{PMID:Chen 2019:31237656}" "proband, family 340, individual II:1" "F" "no" "China" "" "0" "" "" "" "340_II:1"
"00383640" "" "" "00383639" "1" "" "00000" "{PMID:Chen 2019:31237656}" "mother, family 340, individual I:2" "F" "no" "China" "" "0" "" "" "" "340_I:2"
"00383641" "" "" "" "1" "" "00000" "{PMID:Chen 2019:31237656}" "proband, family RD020, individual II:1" "F" "no" "China" "" "0" "" "" "" "RD020_II:1"
"00383642" "" "" "" "2" "" "00000" "{PMID:Chen 2019:31237656}" "proband, family RD029, individual II:1" "F" "no" "China" "" "0" "" "" "" "RD029_II:1"
"00383643" "" "" "00383642" "1" "" "00000" "{PMID:Chen 2019:31237656}" "father, family RD029, individual I:1" "M" "no" "China" "" "0" "" "" "" "RD029_I:1"
"00383722" "" "" "" "1" "" "00000" "{PMID:Tian 2019:31169861}" "" "?" "" "China" "" "0" "" "" "" "12"
"00383723" "" "" "" "1" "" "00000" "{PMID:Tian 2019:31169861}" "" "?" "" "China" "" "0" "" "" "" "13"
"00383724" "" "" "" "1" "" "00000" "{PMID:Tian 2019:31169861}" "" "?" "" "China" "" "0" "" "" "" "14"
"00383725" "" "" "" "1" "" "00000" "{PMID:Tian 2019:31169861}" "" "?" "" "China" "" "0" "" "" "" "15"
"00384246" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13140"
"00384256" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13210"
"00384257" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13214"
"00384263" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13282"
"00384284" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13415"
"00384307" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "13578"
"00384317" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13645"
"00384340" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13767"
"00384344" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "13792"
"00384373" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14062"
"00384375" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14064"
"00384376" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14065"
"00384377" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14068"
"00384393" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14174"
"00384397" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14191"
"00384450" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14630"
"00384454" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14642"
"00384459" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14660"
"00384467" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "M" "" "China" "" "0" "" "" "" "14731"
"00384492" "" "" "" "1" "" "00000" "{PMID:Wang 2019:31106028}" "" "F" "" "China" "" "0" "" "" "" "14901"
"00385162" "" "" "" "1" "" "00000" "{PMID:Jiman 2020:31836858}" "" "M" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "55"
"00385791" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "4"
"00385792" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "14"
"00385793" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "26"
"00385794" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "29"
"00385795" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "37"
"00385796" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "38"
"00385797" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "43"
"00385798" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "254"
"00385799" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "422"
"00385800" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "434"
"00385801" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "446"
"00385802" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "452"
"00385803" "" "" "" "1" "" "00000" "{PMID:Chen 2020:31987760}" "" "?" "" "China" "" "0" "" "" "" "458"
"00388060" "" "" "" "1" "" "00000" "{PMID:Rao 2017:28494495}" "" "M" "" "China" "" "0" "" "" "" "F20"
"00388062" "" "" "" "1" "" "00000" "{PMID:Rao 2017:28494495}" "" "F" "" "China" "" "0" "" "" "" "F23"
"00388238" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 2, only family numbers mentioned in the paper" "M" "" "China" "" "0" "" "" "" "2"
"00388239" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "mother of 2.1, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "2"
"00388240" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 3, only family numbers mentioned in the paper" "M" "" "China" "" "0" "" "" "" "3"
"00388241" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "mother of 3.1, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "3"
"00388242" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 4, only family numbers mentioned in the paper" "M" "" "China" "" "0" "" "" "" "4"
"00388243" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "mother of 4.1, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "4"
"00388244" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 5, only family numbers mentioned in the paper" "M" "" "China" "" "0" "" "" "" "5"
"00388245" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "mother of 5.1, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "5"
"00388248" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 7, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "7"
"00388249" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "father of 7.1, only family numbers mentioned in the paper" "M" "" "China" "" "0" "" "" "" "7"
"00388250" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 8, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "8"
"00388251" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "father of 8.1, only family numbers mentioned in the paper" "M" "" "China" "" "0" "" "" "" "8"
"00388252" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "proband, family 9, only family numbers mentioned in the paper" "?" "" "China" "" "0" "" "" "" "9"
"00388253" "" "" "" "1" "" "00000" "{PMID:Wang 2021:32238352}" "sister of 9.1, only family numbers mentioned in the paper" "F" "" "China" "" "0" "" "" "" "9"
"00390265" "" "" "" "1" "" "00000" "{PMID:Turro 2020:32581362}" "only individuals with mutations in retinal disease genes from this publication were inserted into LOVD" "?" "" "(United Kingdom (Great Britain))" "" "0" "" "" "" "G005179"
"00391798" "" "" "" "1" "" "00000" "{PMID:Li 2020:32884843}" "" "F" "" "" "" "0" "" "" "" "7"
"00391799" "" "" "" "1" "" "00000" "{PMID:Li 2020:32884843}" "" "M" "" "" "" "0" "" "" "" "8"
"00393624" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393642" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393771" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393774" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "M" "" "" "" "0" "" "" "" ""
"00393814" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00393833" "" "" "" "1" "" "00000" "{PMID:Liu-2020:33090715}" "" "F" "" "" "" "0" "" "" "" ""
"00416994" "" "" "" "1" "" "00000" "{PMID:Shastry 2004:14560311}" "proband" "F" "" "" "" "0" "" "" "" "patient I-1"
"00416995" "" "" "" "1" "" "00000" "{PMID:Shastry 2004:14560311}" "proband\'s daughter 2" "F" "" "" "" "0" "" "" "" "patient II-2"
"00416996" "" "" "" "1" "" "00000" "{PMID:Shastry 2004:14560311}" "proband\'s daughter 3" "F" "" "" "" "0" "" "" "" "patient II-3"
"00416997" "" "" "" "1" "" "00000" "{PMID:Shastry 2004:14560311}" "proband\'s son" "M" "" "" "" "0" "" "" "" "patient II-4"
"00416998" "" "" "" "1" "" "00000" "{PMID:Shastry 2004:14560311}" "proband\'s son\'s son 2" "M" "" "" "" "0" "" "" "" "patient III-2"
"00417164" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; isolated G36D patient" "" "" "" "" "0" "" "" "" "isolated G36D patient"
"00417165" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M105T, individual 1; proband" "F" "" "" "" "0" "" "" "British" "family M105T, individual 1"
"00417166" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M105T, individual 2; proband\'s sister" "F" "" "" "" "0" "" "" "British" "family M105T, individual 2"
"00417167" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M105T, individual 3; proband\'s sister\'s daughter" "F" "" "" "" "0" "" "" "British" "family M105T, individual 3"
"00417168" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 1; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 1"
"00417169" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 2; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 2"
"00417170" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 3; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 3"
"00417171" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 4; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 4"
"00417172" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 5; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 5"
"00417173" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 6; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 6"
"00417174" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 7; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 7"
"00417175" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 8; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 8"
"00417176" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family M157V, individual 9; large American family, four generations, nine affecteds, wide spectrum of phenotypes; three of these affected individuals, FEVR was diagnosed only by fluorescein angiography, and they had no clinical problems, whereas other affected individuals had a more severe range of phenotypes, including macular folds and retinal detachments" "" "" "" "" "0" "" "" "American" "family M157V, individual 9"
"00417177" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c957delG, individual II:2" "M" "" "" "" "0" "" "" "Australian" "family c957delG, individual II"
"00417178" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c957delG, individual I:1" "M" "" "" "" "0" "" "" "Australian" "family c957delG, individual I"
"00417179" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c957delG, individual I:2" "M" "" "" "" "0" "" "" "Australian" "family c957delG, individual I"
"00417180" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; patient described as isolated, but mother also had symptoms; isolated S497F patient" "F" "" "" "" "0" "" "" "British" "isolated S497F patient"
"00417181" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1498delA, individual 1 (proband\'s father)" "" "" "" "" "0" "" "" "British" "family c1498delA, individual 1"
"00417182" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1498delA, individual 1 (proband)" "M" "" "" "" "0" "" "" "British" "family c1498delA, individual 2"
"00417183" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1501-1502delCT; three generations family, 12 affected members - may be related to the one described originally in Robitaille et al., 2002;" "" "" "" "" "0" "" "" "North American family" "family c1501-1502delCT"
"00417184" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1501-1502delCT; three generations family, 12 affected members - may be related to the one described originally in Robitaille et al., 2002;" "" "" "" "" "0" "" "" "North American family" "family c1501-1502delCT"
"00417185" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1501-1502delCT; three generations family, 12 affected members - may be related to the one described originally in Robitaille et al., 2002;" "" "" "" "" "0" "" "" "North American family" "family c1501-1502delCT"
"00417186" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1501-1502delCT; three generations family, 12 affected members - may be related to the one described originally in Robitaille et al., 2002;" "" "" "" "" "0" "" "" "North American family" "family c1501-1502delCT"
"00417187" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1501-1502delCT; three generations family, 12 affected members - may be related to the one described originally in Robitaille et al., 2002;" "" "" "" "" "0" "" "" "North American family" "family c1501-1502delCT"
"00417188" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family c1501-1502delCT; three generations family, 12 affected members - may be related to the one described originally in Robitaille et al., 2002;" "" "" "" "" "0" "" "" "North American family" "family c1501-1502delCT"
"00417189" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family Q505X, individual II:1" "M" "" "" "" "0" "" "" "Australian" "family Q505X, individual II:1"
"00417190" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family Q505X, individual II:2" "F" "" "" "" "0" "" "" "Australian" "family Q505X, individual II:2"
"00417191" "" "" "" "1" "" "00000" "{PMID:Toomes 2004:15223780}" "family numbers and patient numbers unavailable; family Q505X, individual III:5" "M" "" "" "" "0" "" "" "Australian" "family Q505X, individual III:5"
"00417210" "" "" "" "1" "" "00000" "{PMID:Li 2006:17103440}" "" "F" "" "" "3y4m" "0" "" "" "Southeast Asian" "?"
"00417219" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_II:13 (12)"
"00417220" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_III:3 (3)"
"00417221" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_III:9 (5)"
"00417222" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "M" "" "" "" "0" "" "" "" "I_III:12 (8)"
"00417223" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_III:14 (10)"
"00417224" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_III:17 (13)"
"00417225" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "M" "" "" "" "0" "" "" "" "I_IV:1 (1)"
"00417226" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "M" "" "" "" "0" "" "" "" "I_IV:5 (5)"
"00417227" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_IV:8 (7)"
"00417228" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_IV:11 (10)"
"00417229" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_IV:13 (12)"
"00417230" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_V:2 (1)"
"00417231" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_V:5 (2)"
"00417232" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_V:6 (3)"
"00417233" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; no numbering in the publication" "M" "" "" "" "0" "" "" "" "I_V:7"
"00417234" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "I_V:8 (4)"
"00417235" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; no numbering in the publication" "F" "" "" "" "0" "" "" "" "I_V:9"
"00417236" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family I; no numbering in the publication" "M" "" "" "" "0" "" "" "" "I_VI:2"
"00417237" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family II; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "II_I:3 (3)"
"00417238" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family II; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "M" "" "" "" "0" "" "" "" "II_I:4 (4)"
"00417239" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family II; numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "II_II:3 (3)"
"00417240" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family II; proband\'s mother (index patient); numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "II_III:3 (3)"
"00417241" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family II; proband\'s twin sister (index patient); numbering does not match the actual position in the pedigree, number: family_position (publication number)" "F" "" "" "" "0" "" "" "" "II_IV:2 (2)"
"00417242" "" "" "" "1" "" "00000" "{PMID:Muller 2008:17899116}" "family II; proband (index patient); numbering does not match the actual position in the pedigree, number: family_position (publication number)" "M" "" "" "" "0" "" "fractionated disseminated laser coagulation of the avascular areas (diode laser via head ophthalmoscope, approx. 1000 spots, 200 ms, 500-800 mW, 20 dpt magnifying glass) in 2 sessions under anesthesia" "" "II_IV:3 (3)"
"00417255" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "1"
"00417256" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "2"
"00417257" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "3"
"00417258" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "4"
"00417259" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "5"
"00417260" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "6"
"00417261" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "father of 6 (mentioned in the paper, no numbering)" "M" "" "" "" "0" "" "" "" "6-2"
"00417262" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "7"
"00417263" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "father of 7 (mentioned in the paper, no numbering)" "M" "" "" "" "0" "" "" "" "7-2"
"00417264" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "8"
"00417265" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "9"
"00417266" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "10"
"00417267" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "twin of 10 (mentioned in the paper, no numbering)" "" "" "" "" "0" "" "" "" "10-2"
"00417268" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "mother of 10 and 10-2 (mentioned in the paper, no numbering)" "F" "" "" "" "0" "" "" "" "10-3"
"00417269" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "11"
"00417270" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "mother of 11 (mentioned in the paper, no numbering)" "F" "" "" "" "0" "" "" "" "11-2"
"00417271" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "12"
"00417272" "" "" "" "1" "" "00000" "{PMID:Drenser 2009:20008721}" "" "" "" "" "" "0" "" "" "" "13"
"00417273" "" "" "" "1" "" "00000" "{PMID:Ells 2010:20141357}" "father and the sibling: no signs of FEVR or similar retinal disease" "" "" "" "" "0" "" "" "white" "?"
"00417274" "" "" "" "1" "" "00000" "{PMID:Ells 2010:20141357}" "family unavailable to participate" "" "" "" "" "0" "" "" "white" "?"
"00417275" "" "" "" "1" "" "00000" "{PMID:Ells 2010:20141357}" "mutation absent in the Caucasian mother and present in the Chinese father; fundus in both parents normal" "F" "" "" "" "0" "" "" "white/Chinese" "?"
"00417298" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "singleton III-1; parents not available to participate in the study" "" "" "" "" "0" "" "" "" "III-1"
"00417299" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree IV: family not available to participate in the study" "" "" "" "" "0" "" "" "Canadian" "IV-1"
"00417300" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "singleton V-1; parents declined participation" "" "" "" "" "0" "" "" "Canadian" "V-1"
"00417301" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "singleton VI-1; parents not available to participate in the study" "F" "" "" "" "0" "" "" "" "VI-1"
"00417302" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "singleton VII-1; parents not available to participate in the study" "F" "" "" "" "0" "" "" "" "VII-1"
"00417303" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "singleton VIII; parents not available to participate in the study" "F" "" "" "" "0" "" "" "" "VIII-1"
"00417304" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree IX, affected brother and father not available for testing" "F" "" "" "" "0" "" "" "Indian" "IX-1"
"00417305" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "F" "" "" "" "0" "" "" "Finnish" "X_I 2"
"00417306" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "M" "" "" "" "0" "" "" "Finnish" "X_II 1"
"00417307" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "M" "" "" "" "0" "" "" "Finnish" "X_II 3"
"00417308" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "M" "" "" "" "0" "" "" "Finnish" "X_II 4"
"00417309" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "M" "" "" "" "0" "" "" "Finnish" "X_II 6"
"00417310" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "M" "" "" "" "0" "" "" "Finnish" "X_II 10"
"00417311" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "F" "" "" "" "0" "" "" "Finnish" "X_II 11"
"00417312" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree X" "M" "" "" "" "0" "" "" "Finnish" "X_II 12"
"00417313" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "singleton XI" "" "" "" "" "0" "" "" "white" "XI-1"
"00417314" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree XII" "F" "" "" "" "0" "" "" "Japanese" "XII_II 1"
"00417315" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree XII" "F" "" "" "" "0" "" "" "Japanese" "XII_II 2"
"00417316" "" "" "" "1" "" "00000" "{PMID:Robitaille 2011:21097938}" "pedigree XII" "M" "" "" "" "0" "" "" "Japanese" "XII_II 3"
"00417318" "" "" "" "1" "" "00006" "{PMID:Jia 2010:20938005}" "3-generation family, 3 affected (2F, M), mother/daughter/son" "M" "" "China" "" "0" "" "" "" "Fam3"
"00417319" "" "" "" "3" "" "00006" "{PMID:Jia 2010:20938005}" "3-generation family, 3 affected (2F, M), grandfather/mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam4"
"00417320" "" "" "" "2" "" "00006" "{PMID:Jia 2010:20938005}" "2-generation family, 2 affected (2F), mother/daughter" "F" "" "China" "" "0" "" "" "" "Fam5"
"00417321" "" "" "" "2" "" "00006" "{PMID:Jia 2010:20938005}" "3-generation family, 2 affected (F, M) father/daughter" "F" "" "China" "" "0" "" "" "" "Fam6"
"00417352" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "1"
"00417353" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "2"
"00417354" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "3"
"00417355" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "4-1"
"00417356" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "4-2"
"00417357" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "5"
"00417358" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "6"
"00417359" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "7"
"00417360" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "8"
"00417361" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "9"
"00417362" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "8-1"
"00417363" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "9-1"
"00417364" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "10"
"00417365" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "11"
"00417366" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "12"
"00417367" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "13"
"00417368" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "14"
"00417369" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "15"
"00417370" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "15-1"
"00417371" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "16"
"00417372" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "17"
"00417373" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "" "" "" "" "" "0" "" "" "" "18"
"00417374" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "19"
"00417375" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "20"
"00417376" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "21"
"00417377" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "22"
"00417378" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "23"
"00417379" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "24"
"00417380" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "25"
"00417381" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "26"
"00417382" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "27"
"00417383" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "28"
"00417384" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "29"
"00417385" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "30"
"00417386" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "31"
"00417387" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "32"
"00417388" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "33"
"00417389" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "34"
"00417390" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "35"
"00417391" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "36"
"00417392" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "37"
"00417393" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "38"
"00417394" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "39"
"00417395" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutation combination found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "40"
"00417396" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "41"
"00417397" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "42"
"00417398" "" "" "" "1" "" "00000" "{PMID:Dailey 2015:26119001}" "20 families, 24 members: mutations found in familial exudative vitreoretinopathy, retinopathy of prematurity, persistent fetal vasculature syndrome, Norrie disease, healthy full-term infants" "" "" "" "" "0" "" "" "" "43"
"00417414" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417415" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417416" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417417" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417418" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417419" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417420" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417421" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417422" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "M" "" "" "" "0" "" "" "" "?"
"00417423" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "F" "" "" "" "0" "" "" "" "?"
"00417424" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "F" "" "" "" "0" "" "" "" "?"
"00417425" "" "" "" "1" "" "00000" "{PMID:Kondo 2018:29135315}" "" "F" "" "" "" "0" "" "" "" "?"
"00417428" "" "" "" "1" "" "00000" "{PMID:Zhang 2019:30882657}" "" "M" "" "" "" "0" "" "standard phacoemulsification both eyes; compound neomycin sulfate eye drops, gatifloxacin eye drops, and diclofenac sodium eye drops 4 times per day; brinzolamide eye drops 3 times a day, when the patient showed high intraocular pressure" "" "?"
"00417441" "" "" "" "4" "" "00000" "{PMID:Zhang 2010:21177847}" "3-generation family, 4 affected (F, 3M)" "M" "" "" "" "0" "" "" "" "FamA_II:1"
"00417442" "" "" "00417441" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "sister" "F" "" "" "" "0" "" "" "" "FamA_II:3"
"00417443" "" "" "00417441" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "son" "M" "" "" "" "0" "" "" "" "FamA_III:1"
"00417444" "" "" "00417441" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "nephew" "M" "" "" "" "0" "" "" "" "FamA_III:3"
"00417445" "" "" "" "5" "" "00000" "{PMID:Zhang 2010:21177847}" "3-generation family, 5 affectd (2F, 3M)" "M" "" "" "" "0" "" "" "" "FamB_I:1"
"00417446" "" "" "00417445" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "daughter" "F" "" "" "" "0" "" "" "" "FamB_II:1"
"00417447" "" "" "00417445" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "daughter" "F" "" "" "" "0" "" "" "" "FamB_II:2"
"00417448" "" "" "00417445" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "grandson" "M" "" "" "" "0" "" "" "" "FamB_III:1"
"00417449" "" "" "00417445" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "grandson" "M" "" "" "" "0" "" "" "" "FamB_III:3"
"00417450" "" "" "" "3" "" "00000" "{PMID:Zhang 2010:21177847}" "4-generation family, 3 affectd (3M)" "M" "" "" "" "0" "" "" "" "FamC_II:2"
"00417451" "" "" "00417450" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "son" "M" "" "" "" "0" "" "" "" "FamC_III:1"
"00417452" "" "" "00417450" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "grandson" "M" "" "" "" "0" "" "" "" "FamC_IV:1"
"00417453" "" "" "" "7" "" "00000" "{PMID:Zhang 2010:21177847}" "3-generation family, 7 affectd (F, 6M)" "M" "" "" "" "0" "" "" "" "FamD_II:1"
"00417454" "" "" "00417453" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "brother" "M" "" "" "" "0" "" "" "" "FamD_II:6"
"00417455" "" "" "00417453" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "son" "M" "" "" "" "0" "" "" "" "FamD_III:1"
"00417456" "" "" "00417453" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "nephew" "M" "" "" "" "0" "" "" "" "FamD_III:3"
"00417457" "" "" "00417453" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "nephew" "M" "" "" "" "0" "" "" "" "FamD_III:5"
"00417458" "" "" "00417453" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "nephew" "M" "" "" "" "0" "" "" "" "FamD_III:6"
"00417459" "" "" "" "4" "" "00000" "{PMID:Zhang 2010:21177847}" "3-generation family, 4 affectd (F, 3M)" "F" "" "" "" "0" "" "" "" "FamE_II:1"
"00417460" "" "" "00417459" "1" "" "00000" "{PMID:Zhang 2010:21177847}" "mother" "M" "" "" "" "0" "" "" "" "FamE_III:2"
"00417493" "" "" "" "4" "" "00006" "{PMID: Kondo 2003:14507768}" "3-generation family, 4 affected (2F, 2M)" "F" "" "Japan" "" "0" "" "" "" "Fam3PatII1"
"00418721" "" "" "" "1" "" "00006" "{PMID:Kondo 2003:14507768}" "2-generation family, 1 affected, unaffected parents" "F" "" "Japan" "" "0" "" "" "" "Pat6"
"00418722" "" "" "" "2" "" "00006" "{PMID:Kondo 2003:14507768}" "healthy controls" "" "" "Japan" "" "0" "" "" "" ""
"00421569" "" "" "" "1" "" "00000" "{PMID:Lu 2020:32889247}" "iPSC line EHTJUi002-A generated from umbilical cord blood mononuclear cells (UCBMCs) of a neonate with heterozygous mutation" "" "" "" "" "0" "" "" "" "?"
"00421570" "" "" "" "1" "" "00000" "{PMID:Zamani 2020:32201676}" "parents first cousins" "F" "" "Iran" "" "0" "" "" "Iranian of Fars ethnicity" "?"
"00421571" "" "" "" "1" "" "00000" "{PMID:Staropoli 2020:31978232}" "" "M" "" "" "" "0" "" "" "" "?"
"00444280" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat39"
"00444281" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat40"
"00444282" "" "" "" "1" "" "00006" "{PMID:Moon 2021:35052368}" "" "" "" "Korea" "" "0" "" "" "" "Pat41"
"00447200" "" "" "" "4" "" "00006" "{PMID:Weisschuh 2024:37734845}" "family, >3 affected" "F" "" "Germany" "" "0" "" "" "" "MISC-267"
"00447205" "" "" "" "1" "" "00006" "{PMID:Weisschuh 2024:37734845}" "patient" "M" "" "Germany" "" "0" "" "" "" "MISC-295"
"00458997" "" "" "" "1" "" "00006" "{PMID:Jimenez 2022:36362148}" "" "M" "" "United States" "" "0" "" "" "" "Pat3"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 561
"{{individualid}}" "{{diseaseid}}"
"00106555" "04240"
"00106556" "04240"
"00106557" "04240"
"00106558" "04240"
"00106559" "04240"
"00106560" "04240"
"00106561" "04240"
"00106562" "04240"
"00106563" "04240"
"00106564" "04240"
"00106565" "04240"
"00106566" "04240"
"00106567" "04240"
"00106568" "04240"
"00106569" "04240"
"00106570" "04240"
"00106571" "04240"
"00106572" "04240"
"00106573" "05301"
"00106574" "04240"
"00106576" "04240"
"00106577" "04240"
"00106578" "04240"
"00106579" "04240"
"00106580" "04240"
"00106581" "05301"
"00106582" "04240"
"00106583" "04240"
"00106584" "04240"
"00106585" "04240"
"00106586" "04240"
"00106587" "04240"
"00106588" "04240"
"00265202" "04240"
"00265204" "04240"
"00265205" "04240"
"00265206" "04240"
"00265211" "04240"
"00265241" "04240"
"00265242" "04240"
"00265243" "04240"
"00265244" "01327"
"00265246" "01327"
"00265248" "04240"
"00265249" "04240"
"00265288" "04240"
"00265289" "04240"
"00265291" "04240"
"00265292" "04240"
"00274215" "04240"
"00274222" "04240"
"00274320" "01327"
"00274320" "04240"
"00274321" "01327"
"00274321" "04240"
"00274891" "01327"
"00275005" "01327"
"00275007" "01327"
"00275007" "05123"
"00275439" "01327"
"00275442" "01327"
"00275444" "01327"
"00275446" "01327"
"00275448" "01327"
"00275450" "01327"
"00275451" "01327"
"00275453" "01327"
"00275454" "01327"
"00275455" "01327"
"00275457" "01327"
"00275458" "01327"
"00275459" "01327"
"00275460" "01327"
"00275462" "01327"
"00275463" "01327"
"00275464" "01327"
"00275465" "01327"
"00275466" "01327"
"00275467" "01327"
"00275468" "01327"
"00275469" "04240"
"00275470" "01327"
"00275471" "01327"
"00275472" "05301"
"00275476" "04240"
"00275478" "04240"
"00275479" "04240"
"00275480" "04240"
"00275481" "04240"
"00275483" "04240"
"00275698" "04240"
"00275699" "04240"
"00275700" "04240"
"00275701" "04240"
"00275702" "04240"
"00275704" "04240"
"00275705" "04240"
"00275706" "04240"
"00275707" "04240"
"00275828" "04240"
"00275831" "04240"
"00275833" "04240"
"00275835" "04240"
"00275836" "04240"
"00275837" "04240"
"00285934" "04240"
"00285935" "04240"
"00285938" "04240"
"00285940" "04240"
"00286030" "04240"
"00286031" "04240"
"00286931" "01327"
"00287035" "01327"
"00287036" "01327"
"00287038" "01327"
"00287039" "01327"
"00287040" "01327"
"00287041" "01327"
"00287042" "01327"
"00287043" "01327"
"00287045" "01327"
"00287046" "01327"
"00287048" "01327"
"00287049" "01327"
"00290555" "00198"
"00290556" "00198"
"00290557" "00198"
"00304324" "00198"
"00304325" "00198"
"00309170" "04214"
"00316099" "05342"
"00328389" "04214"
"00333377" "04214"
"00333451" "04214"
"00333452" "04214"
"00333453" "04214"
"00335198" "04214"
"00335199" "04214"
"00335200" "04214"
"00358956" "04214"
"00358969" "04214"
"00358983" "04214"
"00358984" "04214"
"00358985" "04214"
"00358986" "04214"
"00358987" "04214"
"00358988" "04214"
"00358989" "04214"
"00358990" "04214"
"00358991" "04214"
"00359050" "04214"
"00359051" "04214"
"00362892" "04214"
"00363346" "04214"
"00363638" "04214"
"00363817" "04214"
"00363818" "04214"
"00363819" "04214"
"00363820" "04214"
"00363821" "04214"
"00363822" "04214"
"00363823" "04214"
"00363824" "04214"
"00363825" "04214"
"00363826" "04214"
"00363827" "04214"
"00363828" "04214"
"00363829" "04214"
"00363830" "04214"
"00363831" "04214"
"00363837" "04214"
"00373418" "04214"
"00373419" "04214"
"00373420" "04214"
"00373421" "04214"
"00373422" "04214"
"00373423" "04214"
"00373424" "04214"
"00373442" "04214"
"00373443" "04214"
"00373444" "04214"
"00373445" "04214"
"00373446" "04214"
"00373447" "04214"
"00373463" "04214"
"00373957" "04214"
"00375418" "04214"
"00376517" "04214"
"00376518" "04214"
"00376519" "04214"
"00376520" "04214"
"00379494" "04214"
"00379783" "04240"
"00380263" "04214"
"00380264" "04214"
"00380265" "04214"
"00380266" "04214"
"00380267" "04214"
"00380268" "04214"
"00380269" "04214"
"00380270" "04214"
"00380271" "04214"
"00380272" "04214"
"00380273" "04214"
"00380274" "04214"
"00380748" "04214"
"00380749" "04214"
"00380750" "04214"
"00380751" "04214"
"00380752" "04214"
"00380753" "04214"
"00380754" "04214"
"00380757" "04214"
"00380758" "04214"
"00381091" "04214"
"00381092" "04214"
"00381093" "04214"
"00381094" "04214"
"00381976" "04214"
"00381977" "04214"
"00381978" "04214"
"00381979" "04214"
"00381980" "04214"
"00381981" "04214"
"00381982" "04214"
"00381983" "04214"
"00381984" "04214"
"00381985" "04214"
"00381986" "04214"
"00381987" "04214"
"00381988" "04214"
"00381989" "04214"
"00381990" "04214"
"00381991" "04214"
"00381992" "04214"
"00381993" "04214"
"00381994" "04214"
"00381995" "04214"
"00381996" "04214"
"00381997" "04214"
"00381998" "04214"
"00381999" "04214"
"00382000" "04214"
"00382001" "04214"
"00382002" "04214"
"00382003" "04214"
"00382004" "04214"
"00382005" "04214"
"00382006" "04214"
"00382007" "04214"
"00382008" "04214"
"00382009" "04214"
"00382010" "04214"
"00382011" "04214"
"00382012" "04214"
"00382013" "04214"
"00382014" "04214"
"00382015" "04214"
"00382016" "04214"
"00382017" "04214"
"00382018" "04214"
"00382019" "04214"
"00382020" "04214"
"00382021" "04214"
"00382022" "04214"
"00382023" "04214"
"00382024" "04214"
"00382025" "04214"
"00382026" "04214"
"00382027" "04214"
"00382627" "04214"
"00382628" "04214"
"00382629" "04214"
"00382763" "04214"
"00382774" "04214"
"00382775" "04214"
"00382776" "04214"
"00382777" "04214"
"00382778" "04214"
"00382779" "04214"
"00383524" "04214"
"00383525" "04214"
"00383526" "04214"
"00383527" "04214"
"00383528" "04214"
"00383529" "04214"
"00383530" "04214"
"00383531" "04214"
"00383532" "04214"
"00383533" "04214"
"00383534" "04214"
"00383535" "04214"
"00383536" "04214"
"00383537" "04214"
"00383538" "04214"
"00383539" "04214"
"00383540" "04214"
"00383541" "04214"
"00383638" "04214"
"00383639" "04214"
"00383640" "04214"
"00383641" "04214"
"00383642" "04214"
"00383643" "04214"
"00383722" "04214"
"00383723" "04214"
"00383724" "04214"
"00383725" "04214"
"00384246" "04214"
"00384256" "04214"
"00384257" "04214"
"00384263" "04214"
"00384284" "04214"
"00384307" "04214"
"00384317" "04214"
"00384340" "04214"
"00384344" "04214"
"00384373" "04214"
"00384375" "04214"
"00384376" "04214"
"00384377" "04214"
"00384393" "04214"
"00384397" "04214"
"00384450" "04214"
"00384454" "04214"
"00384459" "04214"
"00384467" "04214"
"00384492" "04214"
"00385162" "04214"
"00385791" "04214"
"00385792" "04214"
"00385793" "04214"
"00385794" "04214"
"00385795" "04214"
"00385796" "04214"
"00385797" "04214"
"00385798" "04214"
"00385799" "04214"
"00385800" "04214"
"00385801" "04214"
"00385802" "04214"
"00385803" "04214"
"00388060" "04214"
"00388062" "04214"
"00388238" "04214"
"00388239" "04214"
"00388240" "04214"
"00388241" "04214"
"00388242" "04214"
"00388243" "04214"
"00388244" "04214"
"00388245" "04214"
"00388248" "04214"
"00388249" "04214"
"00388250" "04214"
"00388251" "04214"
"00388252" "04214"
"00388253" "04214"
"00390265" "04214"
"00391798" "04214"
"00391799" "04214"
"00393624" "04214"
"00393642" "04214"
"00393771" "04214"
"00393774" "04214"
"00393814" "04214"
"00393833" "04214"
"00416994" "01327"
"00416995" "01327"
"00416996" "01327"
"00416997" "01327"
"00416998" "01327"
"00417164" "01327"
"00417165" "01327"
"00417166" "01327"
"00417167" "01327"
"00417168" "01327"
"00417169" "01327"
"00417170" "01327"
"00417171" "01327"
"00417172" "01327"
"00417173" "01327"
"00417174" "01327"
"00417175" "01327"
"00417176" "01327"
"00417177" "01327"
"00417178" "01327"
"00417179" "01327"
"00417180" "01327"
"00417181" "01327"
"00417182" "01327"
"00417183" "01327"
"00417184" "01327"
"00417185" "01327"
"00417186" "01327"
"00417187" "01327"
"00417188" "01327"
"00417189" "01327"
"00417190" "01327"
"00417191" "01327"
"00417210" "00198"
"00417219" "01327"
"00417220" "01327"
"00417221" "01327"
"00417222" "01327"
"00417223" "01327"
"00417224" "01327"
"00417225" "01327"
"00417226" "01327"
"00417227" "01327"
"00417228" "01327"
"00417229" "01327"
"00417230" "01327"
"00417231" "01327"
"00417232" "01327"
"00417233" "01327"
"00417234" "01327"
"00417235" "01327"
"00417236" "01327"
"00417237" "01327"
"00417238" "01327"
"00417239" "01327"
"00417240" "01327"
"00417241" "01327"
"00417242" "01327"
"00417255" "01327"
"00417256" "01327"
"00417257" "01327"
"00417258" "01327"
"00417259" "01327"
"00417260" "01327"
"00417261" "01327"
"00417262" "01327"
"00417263" "01327"
"00417264" "01327"
"00417265" "01327"
"00417266" "05301"
"00417267" "05301"
"00417268" "05301"
"00417269" "05301"
"00417270" "05301"
"00417271" "05301"
"00417272" "05301"
"00417273" "05301"
"00417274" "05301"
"00417275" "05301"
"00417298" "01327"
"00417299" "01327"
"00417300" "01327"
"00417301" "01327"
"00417302" "01327"
"00417303" "01327"
"00417304" "01327"
"00417305" "01327"
"00417306" "01327"
"00417307" "01327"
"00417308" "01327"
"00417309" "01327"
"00417310" "01327"
"00417311" "01327"
"00417312" "01327"
"00417313" "01327"
"00417314" "01327"
"00417315" "01327"
"00417316" "01327"
"00417318" "04240"
"00417319" "04240"
"00417320" "04240"
"00417321" "01327"
"00417352" "01327"
"00417353" "04214"
"00417354" "01327"
"00417355" "01327"
"00417356" "01327"
"00417357" "01327"
"00417358" "01327"
"00417359" "01327"
"00417360" "01327"
"00417361" "01327"
"00417362" "01327"
"00417363" "01327"
"00417364" "04214"
"00417365" "01327"
"00417366" "04214"
"00417367" "04214"
"00417368" "01327"
"00417369" "01327"
"00417370" "01327"
"00417371" "05301"
"00417372" "01327"
"00417373" "01327"
"00417374" "01327"
"00417375" "01327"
"00417376" "01327"
"00417377" "01327"
"00417378" "01327"
"00417379" "01327"
"00417380" "01327"
"00417381" "01327"
"00417382" "01327"
"00417383" "01327"
"00417384" "05301"
"00417385" "05301"
"00417386" "05301"
"00417387" "05301"
"00417388" "05301"
"00417389" "05301"
"00417390" "05301"
"00417391" "01327"
"00417392" "01327"
"00417393" "01327"
"00417394" "00116"
"00417395" "05301"
"00417396" "05301"
"00417397" "05301"
"00417398" "01327"
"00417414" "01327"
"00417415" "01327"
"00417416" "01327"
"00417417" "01327"
"00417418" "01327"
"00417419" "01327"
"00417420" "01327"
"00417421" "01327"
"00417422" "01327"
"00417423" "01327"
"00417424" "01327"
"00417425" "01327"
"00417428" "04214"
"00417441" "04214"
"00417442" "04214"
"00417443" "04214"
"00417444" "04214"
"00417445" "04214"
"00417446" "04214"
"00417447" "04214"
"00417448" "04214"
"00417449" "04214"
"00417450" "04214"
"00417451" "04214"
"00417452" "04214"
"00417453" "04214"
"00417454" "04214"
"00417455" "04214"
"00417456" "04214"
"00417457" "04214"
"00417458" "04214"
"00417459" "04214"
"00417460" "04214"
"00417493" "04240"
"00418721" "04240"
"00418722" "00000"
"00421569" "04214"
"00421570" "04214"
"00421571" "04214"
"00444280" "04214"
"00444281" "04214"
"00444282" "04214"
"00447200" "00198"
"00447205" "00198"
"00458997" "04214"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00116, 00198, 01327, 04214, 04240, 05123, 05301, 05342
## Count = 547
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000084360" "04240" "00106555" "01251" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084361" "04240" "00106556" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084362" "04240" "00106557" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084363" "04240" "00106558" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084364" "04240" "00106559" "01251" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084365" "04240" "00106560" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084366" "04240" "00106561" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084367" "04240" "00106562" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084368" "04240" "00106563" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084369" "04240" "00106564" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084370" "04240" "00106565" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084371" "04240" "00106566" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084372" "04240" "00106567" "01251" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084373" "04240" "00106568" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084374" "04240" "00106569" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084375" "04240" "00106570" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084376" "04240" "00106571" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084377" "04240" "00106572" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084378" "05301" "00106573" "00006" "Familial, autosomal dominant" "" "retinopathy of prematurity (ROP)" "" "" "" "" "" "" "" "" "" "" ""
"0000084379" "04240" "00106574" "01251" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084381" "04240" "00106576" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084382" "04240" "00106577" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084383" "04240" "00106578" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084384" "04240" "00106579" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084385" "04240" "00106580" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084386" "05301" "00106581" "00006" "Isolated (sporadic)" "" "retinopathy of prematurity (ROP)" "" "" "" "" "" "" "" "" "" "" ""
"0000084387" "04240" "00106582" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084388" "04240" "00106583" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084389" "04240" "00106584" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084390" "04240" "00106585" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084391" "04240" "00106586" "00006" "Isolated (sporadic)" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084392" "04240" "00106587" "01251" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000084393" "04240" "00106588" "00006" "Familial, autosomal dominant" "" "familial exudative vitreoretinopathy (FEVR)" "" "" "" "" "" "" "" "" "" "" ""
"0000203030" "04240" "00265202" "03382" "Familial" "04y" "Retinal detachment HP:0000541" "?" "04y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203032" "04240" "00265204" "03382" "Unknown" "?" "" "?" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203033" "04240" "00265205" "03382" "Familial" "03y" "Falciform retinal fold HP:0001493" "" "03y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203035" "04240" "00265211" "03382" "Familial" "03y" "Norrie Disease with Choroidal Atrophy OMIM:310600" "?" "03y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203063" "04240" "00265206" "03382" "Unknown" "?" "" "?" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203064" "04240" "00265241" "03382" "Unknown" "?" "" "?" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203065" "04240" "00265242" "03382" "Familial" "02y" "Retinal folds HP:0008052" "" "02y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203066" "04240" "00265243" "03382" "Unknown" "?" "Peripheral retinal avascularization HP:0007685" "?" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203067" "01327" "00265244" "03382" "Familial, autosomal dominant" "13y" "Peripheral retinal avascularization HP:0007685" "?" "13y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203068" "01327" "00265246" "03382" "Familial, autosomal dominant" "53y" "Peripheral retinal avascularization HP:0007685" "?" "53y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203069" "04240" "00265248" "03382" "Familial, autosomal recessive" "?" "Leukocoria HP:0000555\r\nRetinal detachment HP:0000541" "00y" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203070" "04240" "00265249" "03382" "Familial, autosomal recessive" "?" "Leukocoria HP:0000555 \r\nRetinal detachment HP:0000541" "00y" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203085" "04240" "00265288" "03382" "Familial, autosomal dominant" "07y" "Peripheral retinal avascularization HP:0007685\r\nRetinal fold HP:0008052" "03y" "07y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203086" "04240" "00265289" "03382" "Familial, autosomal dominant" "32y" "Peripheral retinal avascularization HP:0007685\r\nRetinal fold HP:0008052" "?" "32y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203087" "04240" "00265291" "03382" "Isolated (sporadic)" "02y" "Retinal fold HP:0008052\r\nRetinal detachment HP:0000541\r\nGlaucoma HP:0000501\r\nCataract HP:0000518" "" "02y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000203089" "04240" "00265292" "03382" "Familial" "03y" "Cataract HP:0000518\r\nVitreous hemorrhage HP:0007902" "?" "03y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000209162" "04240" "00274215" "03382" "Familial, autosomal dominant" "20y" "Vitreoretinopathy HP:0007773\r\nLeukocoria HP:0000555\r\nFalciform retinal fold HP:0001493\r\nRemnants of the hyaloid vascular system HP:0007968\r\nPhthisis bulbi HP:0000667\r\nPeripheral retinal avascularization HP:0007685" "00y05m" "00y05m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000209167" "04240" "00274222" "03382" "Familial, autosomal dominant" "01y" "Esotropia HP:0000565\r\nRetinal detachment HP:0000541\r\nRetinal hole HP:0011530" "01y" "01y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000209265" "04240" "00274320" "03383" "Familial, autosomal dominant" "" "exudative vitreoretinopathy (HP:0030490)" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy type 1 (EVR-1; familial)" "familial exudative vitreoretinopathy" ""
"0000209266" "04240" "00274321" "03383" "Familial, autosomal dominant" "" "exudative vitreoretinopathy (HP:0030490)" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy type 1 (EVR-1; familial)" "familial exudative vitreoretinopathy" ""
"0000209630" "01327" "00274891" "03382" "Unknown" "00y00m07d" "Peripheral retinal avascularization HP:0007685\r\nVitreous hemorrhage HP:0007902\r\nVitreomacular traction HP:0031151" "00y00m" "00y00m07d" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000209631" "01327" "00275005" "03382" "Unknown" "28y" "Esotropia HP:0000565\r\nCorneal opacity HP:0007957\r\nRetinal neovascularization HP:0030666" "28y" "28y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000209632" "01327" "00275007" "03382" "Familial, autosomal dominant" "00y08m" "Leukocoria HP:0000555\r\nAnterior chamber synechiae HP:0007833\r\nPeripheral retinal avascularization HP:0007685" "00y08m" "00y08m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210065" "01327" "00275439" "03382" "Familial, autosomal dominant" "04y" "Retinal fold HP:0008052\r\nPeripheral retinal avascularization HP:0007685" "04y" "04y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210067" "01327" "00275442" "03382" "Familial, autosomal dominant" "14y" "Peripheral retinal avascularization HP:0007685\r\nRetinal detachment HP:0000541" "14y" "14y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210069" "01327" "00275444" "03382" "Familial, autosomal dominant" "13y" "Retinal fold HP:0008052" "13y" "13y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210071" "01327" "00275446" "03382" "Familial, autosomal dominant" "11y" "Retinal detachment HP:0000541\r\nEctopic fovea HP:0025007" "11y" "11y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210073" "01327" "00275448" "03382" "Familial, autosomal dominant" "06y" "Ectopic fovea HP:0025007\r\nRetinal fold HP:0008052" "06y" "06y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210075" "01327" "00275450" "03382" "Familial, autosomal dominant" "08y" "Retinal fold HP:0008052" "08y" "08y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210076" "01327" "00275451" "03382" "Familial, autosomal dominant" "00y07m" "Retinal fold HP:0008052" "00y07m" "00y07m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210077" "01327" "00275453" "03382" "Familial, autosomal dominant" "08y" "Retinal fold HP:0008052\r\nPeripheral retinal avascularization HP:0007685\r\nRetinal neovascularization HP:0030666" "08y" "08y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210079" "01327" "00275454" "03382" "Familial, autosomal dominant" "26y" "Retinal neovascularization HP:0030666\r\nPeripheral retinal avascularization HP:0007685\r\nVitreous hemorrhage HP:0007902" "26y" "26y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210080" "01327" "00275455" "03382" "Familial, autosomal dominant" "03y" "Retinal fold HP:0008052" "03y" "03y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210081" "01327" "00275457" "03382" "Familial, autosomal dominant" "08y" "Retinal fold HP:0008052" "08y" "08y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210082" "01327" "00275458" "03382" "Familial, autosomal dominant" "15y" "Ectopic fovea HP:0025007" "15y" "15y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210083" "01327" "00275459" "03382" "Familial, autosomal dominant" "12y" "Retinal fold HP:0008052" "12y" "12y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210085" "01327" "00275460" "03382" "Familial, autosomal dominant" "10y" "" "10y" "10y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210087" "01327" "00275462" "03382" "Familial, autosomal dominant" "10y" "" "10y" "10y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210088" "01327" "00275463" "03382" "Familial, autosomal dominant" "15y" "" "15y" "15y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210089" "01327" "00275464" "03382" "Familial, autosomal dominant" "05y" "" "05y" "05y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210090" "01327" "00275465" "03382" "Familial, autosomal dominant" "00y05m" "" "00y05m" "00y05m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210091" "01327" "00275466" "03382" "Familial, autosomal dominant" "02y" "" "02y" "02y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210092" "01327" "00275467" "03382" "Familial, autosomal dominant" "04y" "" "04y" "04y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210093" "01327" "00275468" "03382" "Familial, autosomal dominant" "00y06m" "" "00y06m" "00y06m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210094" "04240" "00275469" "03382" "Familial, autosomal dominant" "06y" "Peripheral retinal avascularization HP:0007685\r\nTractional retinal detachment HP:0007917\r\nFalciform retinal fold HP:0001493" "06y" "06y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210095" "01327" "00275470" "03382" "Familial, autosomal dominant" "01y01m" "Remnants of the hyaloid vascular system HP:0007968\r\nExotropia HP:0000577\r\nRetinal fold HP:0008052" "01y01m" "01y01m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210096" "01327" "00275471" "03382" "Familial, autosomal dominant" "?" "" "?" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210097" "05301" "00275472" "03382" "Familial, autosomal dominant" "?" "" "?" "" "" "" "" "" "" "" "Retinopathy of Prematurity" "Retinopathy of Prematurity" ""
"0000210098" "04240" "00275476" "03382" "Familial, autosomal dominant" "61y" "Retinal detachment HP:0000541" "61y" "61y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210099" "04240" "00275478" "03382" "Familial, autosomal dominant" "67y" "Retinal detachment HP:0000541" "67y" "67y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210100" "04240" "00275479" "03382" "Familial, autosomal dominant" "50y" "Retinal detachment HP:0000541" "50y" "50y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210101" "04240" "00275480" "03382" "Familial, autosomal dominant" "01y" "Retinal detachment HP:0000541" "01y" "01y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210102" "04240" "00275481" "03382" "Familial, autosomal dominant" "00y02m" "Peripheral retinal avascularization HP:0007685\r\nAnterior chamber synechiae HP:0007833\r\nRetinal detachment HP:0000541" "00y02m" "00y02m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210104" "04240" "00275483" "03382" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210213" "05123" "00275007" "00006" "Unknown" "" "diagnosed with spinal muscular atrophy with SMN1 deletion" "" "" "" "" "" "" "" "" "" "" ""
"0000210296" "04240" "00275698" "03382" "Familial, autosomal dominant" "18y" "Lattice retinal degeneration HP:0007992\r\nPeripheral retinal avascularization HP:0007685\r\nMacilar ectopia" "?" "18y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210297" "04240" "00275699" "03382" "Familial, autosomal dominant" "46y" "Typical FEVR symptoms" "?" "46y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210298" "04240" "00275700" "03382" "Familial, autosomal dominant" "55y" "typical FEVR features" "?" "55y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210299" "04240" "00275701" "03382" "Familial, autosomal dominant" "28y" "Peripheral retinal avascularization HP:0007685" "" "28y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210300" "04240" "00275702" "03382" "Familial, autosomal dominant" "22y" "Peripheral retinal avascularization HP:0007685\r\nRetinal hole HP:0011530\r\nRetinal detachment HP:0000541" "" "22y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210302" "04240" "00275704" "03382" "Familial, autosomal dominant" "13y" "Peripheral retinal avascularization HP:0007685\r\nRetinal hole HP:0011530\r\nRetinal detachment HP:0000541\r\nRetinal neovascularization HP:0030666\r\nectopia" "" "13y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210303" "04240" "00275705" "03382" "Familial, autosomal dominant" "34y" "Retinal hole HP:0011530\r\nPeripheral retinal avascularization HP:0007685" "" "34y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210304" "04240" "00275706" "03382" "Familial, autosomal dominant" "53y" "Retinal neovascularization HP:0030666\r\nPeripheral retinal avascularization HP:0007685\r\nRetinal hole HP:0011530" "" "53y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210305" "04240" "00275707" "03382" "Familial, autosomal dominant" "04y" "Vitreous floaters HP:0100832\r\nFalciform retinal fold HP:0001493\r\nRetinal exudate HP:0001147\r\nEctopic fovea HP:0025007" "" "04y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210426" "04240" "00275828" "03382" "Familial, autosomal dominant" "18y" "Ectopic fovea HP:0025007\r\nRetinal exudate HP:0001147\r\nRetinal hole HP:0011530\r\nRetinal detachment HP:0000541\r\nRetinal fold HP:0008052\r\nCorneal opacity HP:0007957" "" "18y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210429" "04240" "00275831" "03382" "Familial, autosomal dominant" "" "Typical presentation of FEVR" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210431" "04240" "00275833" "03382" "Isolated (sporadic)" "00y08m" "Nystagmus HP:0000639\r\nRetinal detachment HP:0000541" "" "00y08m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210432" "04240" "00275835" "03382" "Familial, autosomal dominant" "35y" "Falciform retinal fold HP:0001493" "" "35y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210433" "04240" "00275836" "03382" "Familial, autosomal dominant" "00y06m" "Leukocoria HP:0000555\r\nTractional retinal detachment HP:0007917" "" "00y06m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000210434" "04240" "00275837" "03382" "Familial, autosomal dominant" "00y10m" "Retinal fold HP:0008052\r\nPeripheral retinal avascularization HP:0007685" "" "00y10m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000219799" "04240" "00285934" "03382" "Familial, autosomal dominant" "00y06m" "Vitreous floaters HP:0100832\r\nRetinal exudate HP:0001147" "00y06m" "00y06m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000219800" "04240" "00285935" "03382" "Familial, autosomal dominant" "00y09m" "Remnants of the hyaloid vascular system HP:0007968\r\nRetinal fold HP:0008052" "" "00y09m" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000219803" "04240" "00285938" "03382" "Familial, autosomal dominant" "?" "\"typical FEVR symptoms\"" "?" "?" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000219805" "04240" "00285940" "03382" "Familial, autosomal dominant" "04y" "Peripheral retinal avascularization HP:0007685\r\nPreretinal Fibrosis" "" "04y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000219895" "04240" "00286030" "03382" "Familial, autosomal dominant" "05y" "Retinal fold HP:0008052\r\nmacular ectopia" "" "05y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000219896" "04240" "00286031" "03382" "Familial, autosomal dominant" "02y" "Retinal fold HP:0008052" "" "02y" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy" "Norrie-like retinopathy" ""
"0000220784" "01327" "00286931" "03561" "Unknown" "05y" "axial length (OD/OS, mm): 17.3/22.8\r\nintraocular pressure (OD/OS, mmHg): 15/19" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220785" "01327" "00287035" "03561" "Familial" "02y" "Axial length (OD/OS, mm): 21.4/24.3\r\nIntraocular pressure (OD/OS, mmHg): 13/13\r\n\"The proband is a 2-year-old girl whose right retina exhibited a falciform fold under the temporal side, while the left one has a region without vessels and a crease beside the optic disc with vascular branches and thin vessels on the brim\"" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220786" "01327" "00287036" "03561" "Familial" "34y" "" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220787" "01327" "00287038" "03561" "Familial" "02y" "the proband is a 2-year-old boy with falciform retinal detachment and dragged disc" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220788" "01327" "00287039" "03561" "Familial" "32y" "" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220789" "01327" "00287040" "03561" "Familial" "03y" "axial length (OD/OS, mm): 15/16.6\r\nintraocular pressur (OD/OS, mmHg): 7/3\r\n\"the proband is a 3-year-old girl who exhibited retinal detachment and a vitreous haemorrhage phenotype with an abnormal result in the ultrasound examination" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220790" "01327" "00287041" "03561" "Familial" "39y" "" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220791" "01327" "00287042" "03561" "Familial" "01y" "axial length (OD/OS, mm): 22.2/21.2\r\nintraocular pressure (OD/OS, mmHg): 10/8\r\n\"the proband exhibited a typical FEVR phenotype with a falciform fold connected to the back of crystal structures, retinal detachment on the infratemporal side and vitreous opacity.\"" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220792" "01327" "00287043" "03561" "Familial" "30y" "" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220794" "01327" "00287045" "03561" "Familial" "01y" "axial length (OD/OS, mm): 22.3/18\r\nintraocular pressure (OD/OS, mmHg): 7/3\r\n\"the proband has falciform fold con-\r\nnected to the back with proliferating crystal structures.\"" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220795" "01327" "00287046" "03561" "Familial" "36y" "\"the proband\'s father is FEVR patient, and has falciform folds connected to the back with proliferating crystal structures.\"" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220796" "01327" "00287048" "03561" "Familial" "01y" "axial length (OD/OS, mm): 20/20\r\nintraocular pressure (OD/OS, mmHg):5/4\r\n\"the proband suffered from a dragged disc disconnected from the back, where there were crystals and vitreous opacity\"" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000220798" "01327" "00287049" "03561" "Familial" "37y" "\"the affected father had a vitreous haemorrhage phenotype\"" "" "" "" "" "" "" "" "" "FEVR" "" ""
"0000234490" "04214" "00309170" "00004" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "FEVR" ""
"0000239846" "05342" "00316099" "00006" "Unknown" "" "unilateral kidney agenesis; preauricular pit" "" "" "" "" "" "" "" "" "" "unilateral kidney agenesis" ""
"0000246615" "04214" "00328389" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia" ""
"0000251564" "04214" "00333377" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000251636" "04214" "00333451" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000251637" "04214" "00333452" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000251638" "04214" "00333453" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000252913" "04214" "00335198" "00006" "Unknown" "" "see paper" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000252914" "04214" "00335199" "00006" "Unknown" "" "see paper" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000252915" "04214" "00335200" "00006" "Unknown" "" "see paper" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000254254" "04214" "00358956" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "cone-rod dystrophy" ""
"0000254267" "04214" "00358969" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Leber Congenital Amaurosis" ""
"0000254281" "04214" "00358983" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254282" "04214" "00358984" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254283" "04214" "00358985" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254284" "04214" "00358986" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254285" "04214" "00358987" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254286" "04214" "00358988" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254287" "04214" "00358989" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254288" "04214" "00358990" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254289" "04214" "00358991" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254347" "04214" "00359050" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000254348" "04214" "00359051" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000258258" "04214" "00362892" "00000" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000258711" "04214" "00363346" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early onset high myopia" ""
"0000258988" "04214" "00363638" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy with/out retinal detachment" ""
"0000259164" "04214" "00363817" "00000" "Familial, autosomal dominant" "41m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259165" "04214" "00363818" "00000" "Familial, autosomal dominant" "40m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259166" "04214" "00363819" "00000" "Familial, autosomal dominant" "6m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259167" "04214" "00363820" "00000" "Familial, autosomal dominant" "10m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259168" "04214" "00363821" "00000" "Familial, autosomal dominant" "90m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259169" "04214" "00363822" "00000" "Familial, autosomal dominant" "2m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259170" "04214" "00363823" "00000" "Familial, autosomal dominant" "8m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259171" "04214" "00363824" "00000" "Familial, autosomal dominant" "82m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259172" "04214" "00363825" "00000" "Familial, autosomal dominant" "16m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259173" "04214" "00363826" "00000" "Familial, autosomal dominant" "45m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259174" "04214" "00363827" "00000" "Familial, autosomal dominant" "14m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259175" "04214" "00363828" "00000" "Familial, autosomal dominant" "23m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259176" "04214" "00363829" "00000" "Familial, autosomal dominant" "10m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259177" "04214" "00363830" "00000" "Familial, autosomal dominant" "30m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000259178" "04214" "00363831" "00000" "Familial, autosomal dominant" "49m" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268694" "04214" "00373418" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268695" "04214" "00373419" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268696" "04214" "00373420" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268697" "04214" "00373421" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268698" "04214" "00373422" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268699" "04214" "00373423" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268700" "04214" "00373424" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268718" "04214" "00373442" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268719" "04214" "00373443" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268720" "04214" "00373444" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268721" "04214" "00373445" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268722" "04214" "00373446" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268723" "04214" "00373447" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000268739" "04214" "00373463" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000269166" "04214" "00373957" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000270632" "04214" "00375418" "00000" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" ""
"0000271724" "04214" "00376517" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Exudative Vitreoretinopathy" ""
"0000271725" "04214" "00376518" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Exudative Vitreoretinopathy" ""
"0000271726" "04214" "00376519" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Exudative Vitreoretinopathy" ""
"0000271727" "04214" "00376520" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Exudative Vitreoretinopathy" ""
"0000273367" "04214" "00379494" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "early-onset high myopia (eoHM)" ""
"0000273638" "04240" "00379783" "03508" "Familial, autosomal dominant" "" "HP:0032037,\tHP:0000613,\tHP:0008046" "" "" "" "" "" "" "" "" "" "vitreoretinopathy, exudative (EVR; familial FVER))" ""
"0000274114" "04214" "00380263" "00000" "Familial" "20y" "LE: Retinal detachment, Avascular zone, Peripheral fibrous proliferation, Neovascularization/ RE: Increased branching of peripheral vessels" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274115" "04214" "00380264" "00000" "Familial" "52y" "LE: Increased branching of peripheral vessels/ RE: Increased branching of peripheral vessels" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274116" "04214" "00380265" "00000" "Familial" "21y" "LE: Increased branching of peripheral vessels/ RE: Increased branching of peripheral vessels" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274117" "04214" "00380266" "00000" "Familial" "5y" "LE: Temporal dragging of optic disc/ RE: Increased branching of peripheral vessels" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274118" "04214" "00380267" "00000" "Familial" "36y" "LE: Increased branching of peripheral vessels, Avascular zone/ RE: Increased branching of peripheral vessels, Avascular zone" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274119" "04214" "00380268" "00000" "Isolated (sporadic)" "4y" "LE: Temporal dragging of optic disc, Peripheral fibrous proliferation/ RE: Temporal dragging of optic disc" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274120" "04214" "00380269" "00000" "Isolated (sporadic)" "4y" "LE: Temporal dragging of optic disc, Peripheral fibrous proliferation/ RE: Straightening of temporal arcades" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274121" "04214" "00380270" "00000" "Familial" "9y" "LE: Avascular zone, Peripheral fibrous proliferation, Brushlike peripheral ves- sels,/ RE: Retrolenticular fibrotic mass, Lens dislocation" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274122" "04214" "00380271" "00000" "Familial" "39y" "LE: Avascular zone, Brushlike peripheral ves- sels, Neovascularization,/ RE: Avascular zone, Brushlike peripheral ves- sels, Neovascularization," "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274123" "04214" "00380272" "00000" "Familial" "14y" "LE: Straightening of temporal arcades/ RE: Retinal detachment, Temporal dragging of optic disc" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274124" "04214" "00380273" "00000" "Familial" "2y" "LE:/ RE: Temporal dragging of optic disc" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274125" "04214" "00380274" "00000" "Familial" "26y" "LE: Temporal dragging of optic disc, Brushlike peripheral ves- sels, Avascular zone, Peripheral exudates/ RE: Increased branching of peripheral vessels" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274601" "04214" "00380748" "00000" "Familial, autosomal dominant" "3y11m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274602" "04214" "00380749" "00000" "Familial, autosomal dominant" "1y9m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274603" "04214" "00380750" "00000" "Familial, autosomal dominant" "1y1m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274604" "04214" "00380751" "00000" "Familial, autosomal dominant" "19y" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274605" "04214" "00380752" "00000" "Familial, autosomal dominant" "7m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274606" "04214" "00380753" "00000" "Familial, autosomal dominant" "4m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274607" "04214" "00380754" "00000" "Familial, autosomal dominant" "7m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274610" "04214" "00380757" "00000" "Familial, autosomal dominant" "9m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274611" "04214" "00380758" "00000" "Familial, autosomal dominant" "2y7m" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000274942" "04214" "00381091" "00000" "Familial" "7m" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity." ""
"0000274943" "04214" "00381092" "00000" "Familial" "7m" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity." ""
"0000274944" "04214" "00381093" "00000" "Familial" "6m" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity." ""
"0000274945" "04214" "00381094" "00000" "Familial" "5m" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity." ""
"0000275818" "04214" "00381976" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275819" "04214" "00381977" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275820" "04214" "00381978" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275821" "04214" "00381979" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275822" "04214" "00381980" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275823" "04214" "00381981" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275824" "04214" "00381982" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275825" "04214" "00381983" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275826" "04214" "00381984" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275827" "04214" "00381985" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275828" "04214" "00381986" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275829" "04214" "00381987" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275830" "04214" "00381988" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275831" "04214" "00381989" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275832" "04214" "00381990" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275833" "04214" "00381991" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275834" "04214" "00381992" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275835" "04214" "00381993" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275836" "04214" "00381994" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275837" "04214" "00381995" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275838" "04214" "00381996" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275839" "04214" "00381997" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275840" "04214" "00381998" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275841" "04214" "00381999" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275842" "04214" "00382000" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275843" "04214" "00382001" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275844" "04214" "00382002" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275845" "04214" "00382003" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275846" "04214" "00382004" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275847" "04214" "00382005" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275848" "04214" "00382006" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275849" "04214" "00382007" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275850" "04214" "00382008" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275851" "04214" "00382009" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275852" "04214" "00382010" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275853" "04214" "00382011" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275854" "04214" "00382012" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275855" "04214" "00382013" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275856" "04214" "00382014" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275857" "04214" "00382015" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275858" "04214" "00382016" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275859" "04214" "00382017" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275860" "04214" "00382018" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275861" "04214" "00382019" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275862" "04214" "00382020" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275863" "04214" "00382021" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275864" "04214" "00382022" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275865" "04214" "00382023" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275866" "04214" "00382024" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275867" "04214" "00382025" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275868" "04214" "00382026" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000275869" "04214" "00382027" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000276476" "04214" "00382627" "00000" "Familial, autosomal dominant" "" "" "4m" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000276477" "04214" "00382628" "00000" "Familial, autosomal dominant" "32y" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000276478" "04214" "00382629" "00000" "Familial, autosomal dominant" "" "" "0m" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000276619" "04214" "00382763" "00000" "Familial, autosomal dominant" "" "" "20y" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000276630" "04214" "00382774" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000276631" "04214" "00382775" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000276632" "04214" "00382776" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy, simplex" ""
"0000276633" "04214" "00382777" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000276634" "04214" "00382778" "00000" "Familial" "" "" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy, simplex" ""
"0000276635" "04214" "00382779" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "exudative vitreoretinopathy" ""
"0000277309" "04214" "00383524" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277310" "04214" "00383525" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277311" "04214" "00383526" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277312" "04214" "00383527" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277313" "04214" "00383528" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277314" "04214" "00383529" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277315" "04214" "00383530" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277316" "04214" "00383531" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277317" "04214" "00383532" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277318" "04214" "00383533" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277319" "04214" "00383534" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277320" "04214" "00383535" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277321" "04214" "00383536" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277322" "04214" "00383537" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277323" "04214" "00383538" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277324" "04214" "00383539" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277325" "04214" "00383540" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277326" "04214" "00383541" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" ""
"0000277423" "04214" "00383638" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy-associated rhegmatogenous retinal detachment" ""
"0000277424" "04214" "00383639" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy-associated rhegmatogenous retinal detachment" ""
"0000277425" "04214" "00383640" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy-associated rhegmatogenous retinal detachment" ""
"0000277426" "04214" "00383641" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy-associated rhegmatogenous retinal detachment" ""
"0000277427" "04214" "00383642" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy-associated rhegmatogenous retinal detachment" ""
"0000277428" "04214" "00383643" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy-associated rhegmatogenous retinal detachment" ""
"0000277507" "04214" "00383722" "00000" "Familial, autosomal dominant" "" "Total RD, unilateral, OD" "8m" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "persistent fetal vasculature syndrome" ""
"0000277508" "04214" "00383723" "00000" "Familial, autosomal dominant" "" "Total RD, unilateral, OS" "1y" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "persistent fetal vasculature syndrome" ""
"0000277509" "04214" "00383724" "00000" "Isolated (sporadic)" "" "Temporal, unilateral, OS" "7m" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "Familial exudative vitreoretinopathy" ""
"0000277510" "04214" "00383725" "00000" "Isolated (sporadic)" "" "Peripheral, unilateral, OD" "11y" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "Maculopathy" ""
"0000278031" "04214" "00384246" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy" ""
"0000278041" "04214" "00384256" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278042" "04214" "00384257" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy" ""
"0000278048" "04214" "00384263" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Low vision" ""
"0000278069" "04214" "00384284" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278092" "04214" "00384307" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" ""
"0000278102" "04214" "00384317" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278125" "04214" "00384340" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278129" "04214" "00384344" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278158" "04214" "00384373" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Myopia+retinal detachment" ""
"0000278160" "04214" "00384375" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Low vision" ""
"0000278161" "04214" "00384376" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278162" "04214" "00384377" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278178" "04214" "00384393" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278182" "04214" "00384397" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy?" ""
"0000278235" "04214" "00384450" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "Retinal folds" ""
"0000278239" "04214" "00384454" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathyou?" ""
"0000278244" "04214" "00384459" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathy" ""
"0000278252" "04214" "00384467" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "family exudative vitreoretinopathyou?" ""
"0000278277" "04214" "00384492" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "retinal detachment+family exudative vitreoretinopathy?" ""
"0000278958" "04214" "00385162" "00000" "Familial, autosomal dominant" "1y1m" "HP:0007973:Retinal dysplasia; HP:0000541:Retinal detachment; (Bilateral vitreo-retinal dysplasia); HP:0000618:Blindness; HP:0000407:Sensorineural hearing impairment; HP:0001250:Seizures; HP:0000718:Aggressive behaviour" "" "" "" "" "" "" "" "" "" "FEVR" ""
"0000279600" "04214" "00385791" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279601" "04214" "00385792" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279602" "04214" "00385793" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279603" "04214" "00385794" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279604" "04214" "00385795" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279605" "04214" "00385796" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279606" "04214" "00385797" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279607" "04214" "00385798" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279608" "04214" "00385799" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279609" "04214" "00385800" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279610" "04214" "00385801" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279611" "04214" "00385802" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000279612" "04214" "00385803" "00000" "Familial, autosomal dominant" "" "normal vision, asymptomatic, fundus fluorescein angiography detected lesions which were confined to the peripheral retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "familial exudative vitreoretinopathy" ""
"0000281654" "04214" "00388060" "00000" "Isolated (sporadic)" "" "Microphthalmia" "2m" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000281656" "04214" "00388062" "00000" "Familial, autosomal recessive" "26y" "" "" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy (FEVR)" ""
"0000281797" "04214" "00388238" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):0/5b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281798" "04214" "00388239" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1a/1a" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281799" "04214" "00388240" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):5b/0" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281800" "04214" "00388241" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1b/1b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281801" "04214" "00388242" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):0/5b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281802" "04214" "00388243" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1b/1b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281803" "04214" "00388244" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):5a/0" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281804" "04214" "00388245" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1a/1b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281807" "04214" "00388248" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1a/5a" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281808" "04214" "00388249" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):2b/0" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281809" "04214" "00388250" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1b/5a" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281810" "04214" "00388251" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):0/2a" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281811" "04214" "00388252" "00000" "Familial, autosomal dominant" "" "stage (right eye/left eye):1a/5b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000281812" "04214" "00388253" "00000" "Familial, autosomal dominant" "" "unilateral FEVR, stage (right eye/left eye):0/5b" "" "" "" "" "" "" "" "" "Familial exudative vitreoretinopathy" "" ""
"0000283803" "04214" "00390265" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" "retinal disease" ""
"0000285112" "04214" "00391798" "00000" "Familial, autosomal dominant" "" "birth weight: 2500g, lesion stage right/left eye: 1/5, intraocular pressure: 18/10, abnormal fundus in mother" "" "" "" "" "" "" "" "" "ROPER (retinopathy of prematurity vs familial exudative vitreoretinopathy)" "retinopathy of prematurity, atypical" ""
"0000285113" "04214" "00391799" "00000" "Familial, autosomal dominant" "" "birth weight: 3500g, lesion stage right/left eye: 4b/1, intraocular pressure: 9/8, abnormal fundus in brother" "" "" "" "" "" "" "" "" "ROPER (retinopathy of prematurity vs familial exudative vitreoretinopathy)" "retinopathy of prematurity, atypical" ""
"0000286830" "04214" "00393624" "00000" "Isolated (sporadic)" "13y" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy (FEVR)" ""
"0000286848" "04214" "00393642" "00000" "Isolated (sporadic)" "9y" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy (FEVR)" ""
"0000286977" "04214" "00393771" "00000" "Isolated (sporadic)" "35y" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy (FEVR)" ""
"0000286980" "04214" "00393774" "00000" "Isolated (sporadic)" "7y" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy (FEVR)" ""
"0000287020" "04214" "00393814" "00000" "Isolated (sporadic)" "32y" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy (FEVR)" ""
"0000287039" "04214" "00393833" "00000" "Isolated (sporadic)" "27y" "" "" "" "" "" "" "" "" "" "" "Familial Exudative Vitreoretinopathy (FEVR)" ""
"0000308505" "02234" "00416994" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308506" "02234" "00416995" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308507" "02234" "00416996" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308508" "02234" "00416997" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308509" "02234" "00416998" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308674" "01327" "00417164" "00000" "Isolated (sporadic)" "" "no detailed clinical data" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308675" "01327" "00417165" "00000" "Familial, autosomal dominant" "" "presented to the clinic as an emergency case with a left macula-off rhegmatogenous retinal detachment (successfully repaired); inadequate vascularization of the peripheral temporal retina; best corrected visual acuity right, left eye: 6/9, 6/ 12-1" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308676" "01327" "00417166" "00000" "Familial, autosomal dominant" "" "severely affected, resulting in partial blindness" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308677" "01327" "00417167" "00000" "Familial, autosomal dominant" "" "blind from a very young age, due to bilateral retinal detachment" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308678" "01327" "00417168" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308679" "01327" "00417169" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308680" "01327" "00417170" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308681" "01327" "00417171" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308682" "01327" "00417172" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308683" "01327" "00417173" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308684" "01327" "00417174" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308685" "01327" "00417175" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308686" "01327" "00417176" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308687" "01327" "00417177" "00000" "Familial, autosomal dominant" "4y" "4y: peripheral retinal fold in the left eye associated with retinal traction; left eye: areas of preretinal fibrosis, both eyes: characteristic deficient vascularization of the peripheral retina; poor vision: best corrected visual acuity right, left eye: 6/48, 2/58" "" "" "8m" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308688" "01327" "00417178" "00000" "Familial, autosomal dominant" "" "asymptomatic" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308689" "01327" "00417179" "00000" "Familial, autosomal dominant" "6y" "asymptomatic (presymptomatic?)" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308690" "01327" "00417180" "00000" "Isolated (sporadic)" "" "disc-dragging in both eyes and localized retinal elevation temporally in both eyes with hemorrhage and gliosis; exudation present temporal to the left fovea; mother had dragged discs, and temporal sectors of pigment change typical of FEVR" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308691" "01327" "00417181" "00000" "Familial, autosomal dominant" "" "very little vision (hand movements only) in the left eye - microphthalmic with evidence of posterior lenticonus with lens opacity, a degenerative vitreous with a band extending from a small pale optic disc head with extensive chorioretinal mottling and attenuated retinal vasculature; right eye: was highly myopic with some cortical lens opacities vitreous was degenerative with a small myopic optic disc and diffuse nonspecific pigmentary changes in the retina; also has characteristics suggestive of additional disea" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308692" "01327" "00417182" "00000" "Familial, autosomal dominant" "" "mildly affected but able to drive; childhood surgery for strabismus, amblyopic left eye; detailed examination of his left eye was difficult because of lens opacities, but he had some linear circumferential vitreous opacities with areas of tractional retinal detachment and subretinal exudation" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308693" "01327" "00417183" "00000" "Familial, autosomal dominant" "" "full-term, uncomplicated pregnancy; temporal dragging of the macula and optic nerve, widespread peripheral retinal avascularity, and extraretinal neovascularization" "" "" "20d" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308694" "01327" "00417184" "00000" "Familial, autosomal dominant" "" "whole family description: manifested ophthalmic features within the first decade of life, most severely visually disabled by the second decade; untreated members of this family had bilateral cicatrized tractional retinal detachments with subretinal cholesterol crystals and chronic intraretinal exudates, no asymptomatic carriers of this mutation were identified, but only 6 affecteds had DNA analysis" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308695" "01327" "00417185" "00000" "Familial, autosomal dominant" "" "whole family description: manifested ophthalmic features within the first decade of life, most severely visually disabled by the second decade; untreated members of this family had bilateral cicatrized tractional retinal detachments with subretinal cholesterol crystals and chronic intraretinal exudates, no asymptomatic carriers of this mutation were identified, but only 6 affecteds had DNA analysis" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308696" "01327" "00417186" "00000" "Familial, autosomal dominant" "" "whole family description: manifested ophthalmic features within the first decade of life, most severely visually disabled by the second decade; untreated members of this family had bilateral cicatrized tractional retinal detachments with subretinal cholesterol crystals and chronic intraretinal exudates, no asymptomatic carriers of this mutation were identified, but only 6 affecteds had DNA analysis" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308697" "01327" "00417187" "00000" "Familial, autosomal dominant" "" "whole family description: manifested ophthalmic features within the first decade of life, most severely visually disabled by the second decade; untreated members of this family had bilateral cicatrized tractional retinal detachments with subretinal cholesterol crystals and chronic intraretinal exudates, no asymptomatic carriers of this mutation were identified, but only 6 affecteds had DNA analysis" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308698" "01327" "00417188" "00000" "Familial, autosomal dominant" "" "whole family description: manifested ophthalmic features within the first decade of life, most severely visually disabled by the second decade; untreated members of this family had bilateral cicatrized tractional retinal detachments with subretinal cholesterol crystals and chronic intraretinal exudates, no asymptomatic carriers of this mutation were identified, but only 6 affecteds had DNA analysis" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308699" "01327" "00417189" "00000" "Familial, autosomal dominant" "" "leukocoria (a white mass behind the pupil due to a total retinal detachment)" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308700" "01327" "00417190" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308701" "01327" "00417191" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308725" "00198" "00417210" "00000" "Isolated (sporadic)" "3y4m" "37-week gestation complicated by intrauterine growth retardation; birth weight: 1.95 kg, 3rd centile; birth length and head circumference: between the 10th and 25th centiles; postnatal growth: extremely poor, resulting in severe failure to thrive, short stature, and marked microcephaly; bilateral exudative vitreoretinopathy; clefting of the secondary palate; mild facial dysmorphism including a broad forehead, microganathia, upslanting palpebral fissures, long eyelashes, and slightly anteverted nares; skeletal and minor limb anomalies: arachnodactyly of the fingers and toes, digitalized thumbs, polysyndactyly of the right 5th toe, transverse palmar creases, pectus carinatum, and a non-communicating sacral dimple/sinus; other physical anomalies: an anteriorly placed anus, labial fusion at the posterior fourchette; severe global developmental delay and hypotonia; magnetic resonance imaging of the brain: normal; 1y9m: electroencephalogram: mild to moderate generalized slowing without epileptiform abnormalities; echocardiogram of the heart: normal; significant gastroesophageal reflux which caused several episodes of aspiration pneumonia; 3y2m: developed purpuric papules on the limbs following a mildly febrile upper respiratory infection, soon showed signs of pneumonia and pulmonary edema which quickly progressed to respiratory failure; skin biopsy of the lesions showed leukocytoclastic vasculitis without evidence of microorganisms or embolizations; extensive examination did not reveal any infectious or thromboembolic cause of the vasculitis - treated with steroids, to which she responded well, and weaned off mechanical ventilation and eventually discharged, during a slow steroid taper, the vasculitis recurred after another mild fever, and the patient died of respiratory failure due to pulmonary edema and hemorrhage at 3y4m; neither parents had EVR on formal ophthalmologic evaluation; however, the mother had non-specific retinal pigmentary alterations (no intravenous fluorescein angiography) heterozygous for two nucleotide changes, c.97C > T (P33S, CCG to TCG) and c.502C > T in FZD4 which the proband did not inherit" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy with multiple abnormalities: growth retardation, facial anomalies, cleft palate, and minor digital anomalies" "" ""
"0000308732" "01327" "00417219" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308733" "01327" "00417220" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308734" "01327" "00417221" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308735" "01327" "00417222" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308736" "01327" "00417223" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308737" "01327" "00417224" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308738" "01327" "00417225" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308739" "01327" "00417226" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308740" "01327" "00417227" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308741" "01327" "00417228" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308742" "01327" "00417229" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308743" "01327" "00417230" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308744" "01327" "00417231" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308745" "01327" "00417232" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308746" "01327" "00417233" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308747" "01327" "00417234" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308748" "01327" "00417235" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308749" "01327" "00417236" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308750" "01327" "00417237" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308751" "01327" "00417238" "00000" "Familial, autosomal dominant" "" "clinically described in Laqua et al.., 1980" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308752" "01327" "00417239" "00000" "Familial, autosomal dominant" "55y" "51y: unilateral blindness; unilateral total detachment of the retina with secondary divergent strabismus diagnosed in the right eye with a mature cataract; left eye: incomplete circular peripheral laser scars with full visual acuity and had been treated 11 years earlier (at the age of 41) in another clinic for suspected Wagner disease (ruled out because there was no peripheral degeneration); peripheral retina: circularly avascular with a wide temporal zone, temporally stretched vascular course with a proliferative fibrotic peripheral vascularization edge and striated vitreous compression papillary to temporal with a still adherent Weiss ring; left eye: electroretinogram: normal; panel D15 color spot test: unremarkable; 55y: no progression in the 4-year follow-up" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308753" "01327" "00417240" "00000" "Familial, autosomal dominant" "36y" "31y: best corrected visual acuity one functional eye: 1.0 with unilateral myopia magna and deep amblyopia with meter chart visual acuity; temporal laser coagulation had been performed 8 years ago; retina: peripheral avascular areas on both sides when the temporal vascular arches were stretched; electroretinogram and electrooculogram: were performed to rule out hereditary retinal dystrophy - standard response within the 95% percentile according to the ISCEV standard; Arden quotient: normal; panel D15 color spot test: unremarkable in the functional eye; 36y: reduced visual acuity to 0.3; vitreofoveal traction at the onset of vitreous detachment with resolution of the foveal depression in optical coherence tomography, after 2 months spontaneous posterior vitreous detachment with visual acuity increasing to 0.8" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308754" "01327" "00417241" "00000" "Familial, autosomal dominant" "8y" "no history of premature birth or oxygen administration; full visual acuity; fundoscopy: temporal stretched vascular arch without avascular areas which remained stable in the 4-year follow-up period" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308755" "01327" "00417242" "00000" "Familial, autosomal dominant" "8y" "4y: best corrected visual acuity right/left eye: 0.4 / 0.5; fundoscopy: fibrotic ridge with exudates and peripherally avascular retinal surfaces on both sides temporally as well as residual vitreous hemorrhage; fractionated disseminated laser coagulation of the avascular areas (diode laser via head ophthalmoscope, approx. 1000 spots, 200 ms, 500-800 mW, 20 dpt magnifying glass) was performed in 2 sessions under anesthesia; over 4 years visual acuity right/left eye: 0.8 / 0.6 on the left in the following check-u" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308770" "01327" "00417255" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4b" "7d" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308771" "01327" "00417256" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4a; rhegmatogenous retinal detachment" "0m" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308772" "01327" "00417257" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4b" "28d" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308773" "01327" "00417258" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4b" "1m" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308774" "01327" "00417259" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 2; rhegmatogenous retinal detachment" "7y" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308775" "01327" "00417260" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 5" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308776" "01327" "00417261" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308777" "01327" "00417262" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 5" "4m" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308778" "01327" "00417263" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308779" "01327" "00417264" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4b" "1y" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308780" "01327" "00417265" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4b" "7m" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308781" "05301" "00417266" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 5; multiple comorbidities and poor health" "" "" "" "" "" "" "" "" "aggressive posterior retinopathy of prematurity" "" ""
"0000308782" "05301" "00417267" "00000" "Familial, autosomal dominant" "" "asymptomatic twin, had an uneventful course with no systemic maladies" "" "" "" "" "" "" "" "" "aggressive posterior retinopathy of prematurity" "" ""
"0000308783" "05301" "00417268" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "aggressive posterior retinopathy of prematurity" "" ""
"0000308784" "05301" "00417269" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 5; sole surviving triplet" "" "" "" "" "" "" "" "" "aggressive posterior retinopathy of prematurity" "" ""
"0000308785" "05301" "00417270" "00000" "Familial, autosomal dominant" "" "fluorescein angiography: peripheral avascular zone can be appreciated" "" "" "" "" "" "" "" "" "aggressive posterior retinopathy of prematurity" "" ""
"0000308786" "05301" "00417271" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 4b" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308787" "05301" "00417272" "00000" "Familial, autosomal dominant" "" "highest stage of disease: 1" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308788" "05301" "00417273" "00000" "Familial, autosomal dominant" "" "born at 28 weeks of gestational age, birth weight of 880 grams; required laser treatment for threshold retinopathy of prematurity at 92 days of life; required only one laser treatment to each eye and the retinopathy of prematurity regressed rapidly with no cicatricial sequela" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308789" "05301" "00417274" "00000" "Familial, autosomal dominant" "" "born at 26 weeks of gestational age, birth weight of 780 grams; treated for threshold retinopathy of prematurity at 78d of life; required only one laser treatment to each eye and the retinopathy of prematurity regressed with no cicatricial sequela" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308790" "05301" "00417275" "00000" "Familial, autosomal dominant" "" "born at 24 weeks of gestational age, birth weight of 650 grams; required initial retinal laser surgery to each eye at 68 days of life and then required a second laser treatment to both eyes for progression of neovascular retinopathy of prematurity; mild cicatricial changes from the retinopathy of prematurity, such as mild straightening of temporal arcade vessels and high myopia (-9.00 diopters in both eyes); twin brother bearing no mutation; required two laser treatments as opposed to her brother who only required one treatment" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308797" "01327" "00417298" "00000" "Familial, autosomal dominant" "5y" "best corrected visual acuity right, left eye: 6/18, light perception; glasses prescription right / left eye: -8.50+3.00x100 / -4.00+1.50x60; strabismus: LT; cataract right / left eye: no / no; dilated fundus examination right / left eye:4 / 5; intravenous fluorescein angiography: no; treatment: laser, vitrectomy both eyes, scleral buckle left eye" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308798" "01327" "00417299" "00000" "Familial, autosomal dominant" "1y" "best corrected visual acuity right, left eye: Fix and follow, no light perception; glasses prescription right / left eye: -3.50+3.00x120 / not applicable; strabismus: LET; cataract right / left eye: no / yes; dilated fundus examination right / left eye:1 / 6; intravenous fluorescein angiography: yes; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308799" "01327" "00417300" "00000" "Familial, autosomal dominant" "14y" "best corrected visual acuity right, left eye: 20/80, no light perception; glasses prescription right / left eye: plano / not applicable; strabismus: LET; cataract right / left eye: no / yes; dilated fundus examination right / left eye:4 / 6; intravenous fluorescein angiography: no; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308800" "01327" "00417301" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity right, left eye: 6/37.5, 6/4.8; glasses prescription right / left eye: -2.00+0.25x90 / -4.25+1.25x107; strabismus: none; cataract right / left eye: yes / no; dilated fundus examination right / left eye:3 / 0; intravenous fluorescein angiography: no; treatment: iright eyeine plaque radiotherapy right eye" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308801" "01327" "00417302" "00000" "Familial, autosomal dominant" "4y" "best corrected visual acuity right, left eye: 6/6, 6/15; glasses prescription right / left eye: -1.00+1.50x135 / -1.00+3.00x110; strabismus: LT; cataract right / left eye: no / no; dilated fundus examination right / left eye:4 / 0; intravenous fluorescein angiography: no; treatment: laser left eye" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308802" "01327" "00417303" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity right, left eye: 6/9.6, counting fingers at 1 meter; glasses prescription right / left eye: -1.75+1.00x180 / -2; strabismus: LET; cataract right / left eye: no / no; dilated fundus examination right / left eye:4 / 4; intravenous fluorescein angiography: yes; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308803" "01327" "00417304" "00000" "Familial, autosomal dominant" "33y" "best corrected visual acuity right, left eye: 6/6, light perception; glasses prescription right / left eye: \"\"myopia\"\" / not applicab le; strabismus: LET; cataract right / left eye: no / yes; dilated fundus examination right / left eye:2 / 5; treatment: vitrectomy, buckle, cryotherapy, c3f8, lensectomy, repeat vitrectomy, silicone oil, laser" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308804" "01327" "00417305" "00000" "Familial, autosomal dominant" "48y" "best corrected visual acuity right, left eye: 6/7.5, 6/60; glasses prescription right / left eye: -4.00+3.25x75 / -7.50+1.00x70; strabismus: LET; cataract right / left eye: no / no; dilated fundus examination right / left eye:0 / 3; intravenous fluorescein angiography: no; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308805" "01327" "00417306" "00000" "Familial, autosomal dominant" "22y" "best corrected visual acuity right, left eye: 6/3, 6/4.8; glasses prescription right / left eye: x / ; strabismus: none; cataract right / left eye: no / ; dilated fundus examination right / left eye:3 / 0; intravenous fluorescein angiography: no; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308806" "01327" "00417307" "00000" "Familial, autosomal dominant" "20y" "best corrected visual acuity right, left eye: 6/6, 6/7.5; glasses prescription right / left eye: -1.50+0.25x115 / -3.25+1.75x24; strabismus: ; cataract right / left eye: / ; dilated fundus examination right / left eye: / ; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308807" "01327" "00417308" "00000" "Familial, autosomal dominant" "19y" "best corrected visual acuity right, left eye: 6/60, 6/6; glasses prescription right / left eye: -2 .00+0.75x100 / plano+1.50x110; strabismus: RT; cataract right / left eye: / ; dilated fundus examination right / left eye:4 / 4; intravenous fluorescein angiography: no; treatment: laser" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308808" "01327" "00417309" "00000" "Familial, autosomal dominant" "16y" "best corrected visual acuity right, left eye: 6/4.8, 6/4.8; glasses prescription right / left eye: -0.50+0.75x90 / +0.50+0.50x90; strabismus: none; cataract right / left eye: no / no; dilated fundus examination right / left eye:0 / 0; intravenous fluorescein angiography: no; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308809" "01327" "00417310" "00000" "Familial, autosomal dominant" "9y" "best corrected visual acuity right, left eye: 6/3.8, no light perception; glasses prescription right / left eye: -1 / not applicable; strabismus: none; cataract right / left eye: no / no; dilated fundus examination right / left eye:5 / 6; intravenous fluorescein angiography: no; treatment: laser, cryotherapy, scleral buckle, vitrectomy right eye" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308810" "01327" "00417311" "00000" "Familial, autosomal dominant" "7y" "best corrected visual acuity right, left eye: 6/19, 6/12; glasses prescription right / left eye: +2.50+0.75x65 / +1.25+1.00x90; strabismus: none; cataract right / left eye: no / no; dilated fundus examination right / left eye:4 / 0; intravenous fluorescein angiography: no; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308811" "01327" "00417312" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity right, left eye: 6/4.8, 6/6; glasses prescription right / left eye: +1.25+0.50x90 / +1.25+0.50x90; strabismus: LET; cataract right / left eye: no / no; dilated fundus examination right / left eye:0 / 0; intravenous fluorescein angiography: no; treatment: none" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308812" "01327" "00417313" "00000" "Familial, autosomal dominant" "4y" "best corrected visual acuity right, left eye: \"\"Lea card at 6\"\", 20/125; glasses prescription right / left eye: x / ; strabismus: none; cataract right / left eye: no / no; dilated fundus examination right / left eye:5 / ; intravenous fluorescein angiography: no; treatment: laser" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308813" "01327" "00417314" "00000" "Familial, autosomal dominant" "19y" "best corrected visual acuity right, left eye: counting fingers, 6/6; glasses prescription right / left eye: -6.25 / -5.25; strabismus: Yes; cataract right / left eye: no / no; dilated fundus examination right / left eye:5 / 4; intravenous fluorescein angiography: yes; treatment: previous retina detachment repair right eye" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308814" "01327" "00417315" "00000" "Familial, autosomal dominant" "18y" "best corrected visual acuity right, left eye: 6/19, counting fingers; glasses prescription right / left eye: -2 / plano; strabismus: none; cataract right / left eye: no / yes; dilated fundus examination right / left eye:4 / 5; intravenous fluorescein angiography: yes; treatment: retina detachment left eye likely previously treated with laser" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308815" "01327" "00417316" "00000" "Familial, autosomal dominant" "14y" "best corrected visual acuity right, left eye: 6/60, 6/7.5; glasses prescription right / left eye: -400 / -1.5; strabismus: T; cataract right / left eye: no / no; dilated fundus examination right / left eye:4 / 0; intravenous fluorescein angiography: yes; treatment: x" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308839" "01327" "00417352" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308840" "04214" "00417353" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "persistent fetal vasculature syndrome" "" ""
"0000308841" "01327" "00417354" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308842" "01327" "00417355" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308843" "01327" "00417356" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308844" "01327" "00417357" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "possible familial exudative vitreoretinopathy" "" ""
"0000308845" "01327" "00417358" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308846" "01327" "00417359" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308847" "01327" "00417360" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308848" "01327" "00417361" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308849" "01327" "00417362" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308850" "01327" "00417363" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308851" "04214" "00417364" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "persistent fetal vasculature syndrome" "" ""
"0000308852" "01327" "00417365" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308853" "04214" "00417366" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "persistent fetal vasculature syndrome" "" ""
"0000308854" "04214" "00417367" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "persistent fetal vasculature syndrome" "" ""
"0000308855" "01327" "00417368" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "possible familial exudative vitreoretinopathy" "" ""
"0000308856" "01327" "00417369" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308857" "01327" "00417370" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308858" "05301" "00417371" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308859" "01327" "00417372" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308860" "01327" "00417373" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308861" "01327" "00417374" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308862" "01327" "00417375" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308863" "01327" "00417376" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308864" "01327" "00417377" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308865" "01327" "00417378" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308866" "01327" "00417379" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308867" "01327" "00417380" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308868" "01327" "00417381" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308869" "01327" "00417382" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308870" "01327" "00417383" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308871" "05301" "00417384" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308872" "05301" "00417385" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308873" "05301" "00417386" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308874" "05301" "00417387" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308875" "05301" "00417388" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308876" "05301" "00417389" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308877" "05301" "00417390" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308878" "01327" "00417391" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "possible familial exudative vitreoretinopathy" "" ""
"0000308879" "01327" "00417392" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "possible familial exudative vitreoretinopathy" "" ""
"0000308880" "01327" "00417393" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "possible familial exudative vitreoretinopathy" "" ""
"0000308881" "00116" "00417394" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "Norrie disease/bilateral persistent fetal vasculature syndrome" "" ""
"0000308882" "05301" "00417395" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308883" "05301" "00417396" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308884" "05301" "00417397" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "retinopathy of prematurity" "" ""
"0000308885" "01327" "00417398" "00000" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308900" "01327" "00417414" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 1" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308901" "01327" "00417415" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 2" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308902" "01327" "00417416" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 3" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308903" "01327" "00417417" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 4" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308904" "01327" "00417418" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 5" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308905" "01327" "00417419" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 6" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308906" "01327" "00417420" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 7" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308907" "01327" "00417421" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 8" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308908" "01327" "00417422" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 9" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308909" "01327" "00417423" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 10" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308910" "01327" "00417424" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 11" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308911" "01327" "00417425" "00000" "Unknown" "" "whole group description: inheritance: familial 5, sporadic 7; age at first visit: infant( les than 1 y) 4, juvenile (1-15 y) 7; elder (more than 15 y) 1 disease stage: 1 - 3, 2 - 1, 3 - 1, 4 - 6, 5 - 12" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308914" "04214" "00417428" "00000" "Isolated (sporadic)" "11y" "no syndromes or associations detected, ocular examination of family members: no abnormalities; uncorrected and best-corrected visual acuity right eye: 20/500 and 20/200, respectively, left eye: 20/400 and could not be corrected; refractive correction in diopters (dpt) right/left eye: -8.50 dpt -2.00 x5 / -10.00 dpt -2.00 x 05; intraocular pressure right/left eye: 23/20 mm Hg; cornea, anterior chamber, and iris: normal; lens opacities categorized into C0N1P3 according to the lens opacities classification system II; surgery: phacoemulsification both eyes; on postoperative 1 week, the fundus examination after mydriasis: bilateral excavated macular coloboma about 1.5 x 1.5 disc diameter in size of the right eye and 2 x 2 disc diameter in size of the left eye, boundary of the defect legible; large choroidal vessels visible at the base and some pigment clumps located in the area around the defect in both eyes; optic discs of both eyes pale, cup to disc ratio about 0.5:1; optical coherence tomography: retina thinner than normal in macular region, multifocal electroretinography: no significant peak value; postoperative 1 day, intraocular pressure right/left eye: 28/29 mm Hg returned to normal after using brinzolamide eye drops; UCVA: 20/100 both eyes; BCVA: 20/70 both eyes" "" "" "blurred vision in both eyes from childhood" "" "" "" "" "" "congenital pigmented macular coloboma in combination with congenital cataract in both eyes" "" ""
"0000308927" "04214" "00417441" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308928" "04214" "00417442" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308929" "04214" "00417443" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308930" "04214" "00417444" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308931" "04214" "00417445" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308932" "04214" "00417446" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308933" "04214" "00417447" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308934" "04214" "00417448" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308935" "04214" "00417449" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308936" "04214" "00417450" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308937" "04214" "00417451" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308938" "04214" "00417452" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308939" "04214" "00417453" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308940" "04214" "00417454" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308941" "04214" "00417455" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308942" "04214" "00417456" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308943" "04214" "00417457" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308944" "04214" "00417458" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308945" "04214" "00417459" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308946" "04214" "00417460" "00000" "Familial, autosomal dominant" "" "" "" "" "" "no discernible activation of the luciferase reporter" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000308975" "04240" "00417493" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "EVR5" "familial exudative vitreoretinopathy" ""
"0000312775" "04214" "00421569" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000312776" "04214" "00421570" "00000" "Familial, autosomal recessive" "20y" "strabismus, horizontal nystagmus, decreased visual acuity and retinal defects; left eye: no light perception, unable to distinguish light from dark, right eye: vascular changes, aneurysmal telangiectasia, vascular leakage, eczema retinal, and tractional retinal detachment on the nasal side of the retina" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000312777" "04214" "00421571" "00000" "Familial, autosomal dominant" "01y01m" "nystagmus; at presentation, could fix and follow in both eyes; no skin markings or rashes; examination under anesthesia and fluorescein angiography of the right eye: macular scar, epiretinal membrane, and incomplete peripheral vascularization with inferior leakage, left eye: leaking fibrovascular stalk extending from the disc to the posterior capsule of the lens with incorporation of temporal retina and incomplete peripheral vascularization; both eyes - straightening of vessels; similar findings on ultrasound and optical coherence tomography; axial length: 21.4 mm in the right eye and 20.8 mm in the left eye; corneal diameter: 11 mm in both eyes; laser indirect ophthalmoscopy with argon (500 mW) to avascular areas in both eyes; 6m later: improvement in leakage in the right eye and stable leakage in the left eye; additional laser treatment right eye and sub-Tenon\'s triamcinolone acetonide injected in both eyes" "00y06m" "" "nystagmus" "" "" "" "" "" "familial exudative vitreoretinopathy" "" ""
"0000333533" "04214" "00444280" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000333534" "04214" "00444281" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000333535" "04214" "00444282" "00006" "Familial, X-linked recessive" "" "" "" "" "" "" "" "" "" "" "" "familial exudative vitreoretinopathy" ""
"0000336399" "00198" "00447200" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "eye diseaes" ""
"0000336404" "00198" "00447205" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "eye diseaes" ""
"0000347427" "04214" "00458997" "00006" "Unknown" "11y" "see paper; ..., spherical equivalent error -5D OU" "02y" "" "" "" "" "" "" "" "" "" ""
## Screenings ## Do not remove or alter this header ##
## Count = 558
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000107025" "00106555" "0" "01251" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107026" "00106556" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107027" "00106557" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107028" "00106558" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107029" "00106559" "0" "01251" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107030" "00106560" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107031" "00106561" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107032" "00106562" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107033" "00106563" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107034" "00106564" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107035" "00106565" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107036" "00106566" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107037" "00106567" "0" "01251" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107038" "00106568" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107039" "00106569" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107040" "00106570" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107041" "00106571" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107042" "00106572" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107043" "00106573" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107044" "00106574" "0" "01251" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107046" "00106576" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107047" "00106577" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107048" "00106578" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107049" "00106579" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107050" "00106580" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107051" "00106581" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107052" "00106582" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107053" "00106583" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107054" "00106584" "1" "00006" "00006" "2010-06-06 16:39:21" "00006" "2022-10-04 21:38:24" "SEQ" "DNA" "" ""
"0000107055" "00106585" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107056" "00106586" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107057" "00106587" "0" "01251" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000107058" "00106588" "0" "00006" "00006" "2010-06-06 16:39:21" "" "" "SEQ" "DNA" "" ""
"0000266322" "00265202" "1" "03382" "03382" "2019-09-13 21:23:36" "" "" "SEQ-NG" "DNA" "peripheral blood" "whole genome sequencing"
"0000266324" "00265204" "1" "03382" "03382" "2019-09-14 13:47:45" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266325" "00265205" "1" "03382" "03382" "2019-09-14 14:03:06" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266326" "00265206" "1" "03382" "03382" "2019-09-14 15:06:01" "03382" "2019-09-14 15:17:16" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266360" "00265211" "1" "03382" "03382" "2019-09-17 17:59:23" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266361" "00265241" "1" "03382" "03382" "2019-09-17 18:21:11" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266362" "00265242" "1" "03382" "03382" "2019-09-17 18:50:17" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266363" "00265243" "1" "03382" "03382" "2019-09-17 20:04:08" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266364" "00265244" "1" "03382" "03382" "2019-09-17 20:14:17" "" "" "SEQ-NG" "DNA" "?" ""
"0000266365" "00265246" "1" "03382" "03382" "2019-09-17 20:26:15" "" "" "SEQ-NG" "DNA" "?" ""
"0000266367" "00265248" "1" "03382" "03382" "2019-09-17 21:54:30" "" "" "SEQ" "DNA" "venous blood" ""
"0000266369" "00265249" "1" "03382" "03382" "2019-09-17 22:14:23" "" "" "SEQ" "DNA" "venous blood" ""
"0000266407" "00265288" "1" "03382" "03382" "2019-09-19 11:12:10" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266408" "00265289" "1" "03382" "03382" "2019-09-19 11:23:42" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000266409" "00265291" "1" "03382" "03382" "2019-09-19 11:48:41" "" "" "SEQ-NG" "DNA" "blood" ""
"0000266411" "00265292" "1" "03382" "03382" "2019-09-19 11:56:50" "" "" "SEQ-NG" "DNA" "peripheral blood" ""
"0000275373" "00274215" "1" "03382" "03382" "2019-12-25 10:24:00" "" "" "?" "DNA" "?" ""
"0000275378" "00274222" "1" "03382" "03382" "2019-12-25 19:30:03" "" "" "?" "DNA" "blood" ""
"0000275478" "00274320" "1" "03383" "03383" "2019-12-28 23:19:44" "" "" "SEQ" "DNA" "" "gene panel"
"0000275479" "00274321" "1" "03383" "03383" "2019-12-28 23:30:14" "" "" "SEQ" "DNA" "" "gene panel"
"0000276163" "00274891" "1" "03382" "03382" "2020-01-03 15:43:22" "" "" "?" "DNA" "" ""
"0000276165" "00275005" "1" "03382" "03382" "2020-01-03 15:58:00" "03382" "2020-01-03 16:05:55" "?" "DNA" "" ""
"0000276167" "00275007" "1" "03382" "03382" "2020-01-03 16:20:14" "" "" "?" "DNA" "" ""
"0000276599" "00275439" "1" "03382" "03382" "2020-01-04 16:13:46" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276601" "00275442" "1" "03382" "03382" "2020-01-04 16:20:56" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276603" "00275444" "1" "03382" "03382" "2020-01-04 16:27:00" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276605" "00275446" "1" "03382" "03382" "2020-01-04 16:35:12" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276607" "00275448" "1" "03382" "03382" "2020-01-04 16:43:57" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276609" "00275450" "1" "03382" "03382" "2020-01-04 16:50:20" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276610" "00275451" "1" "03382" "03382" "2020-01-04 16:55:10" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276611" "00275453" "1" "03382" "03382" "2020-01-04 17:10:54" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276613" "00275454" "1" "03382" "03382" "2020-01-04 17:31:07" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276614" "00275455" "1" "03382" "03382" "2020-01-04 17:36:08" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276616" "00275457" "1" "03382" "03382" "2020-01-04 17:55:57" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276617" "00275458" "1" "03382" "03382" "2020-01-04 18:02:04" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276618" "00275459" "1" "03382" "03382" "2020-01-04 18:08:24" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276619" "00275460" "1" "03382" "03382" "2020-01-04 18:15:22" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276621" "00275462" "1" "03382" "03382" "2020-01-04 18:24:17" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276622" "00275463" "1" "03382" "03382" "2020-01-04 18:32:48" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276623" "00275464" "1" "03382" "03382" "2020-01-04 18:39:15" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276624" "00275465" "1" "03382" "03382" "2020-01-04 18:44:37" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276625" "00275466" "1" "03382" "03382" "2020-01-04 18:47:46" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276626" "00275467" "1" "03382" "03382" "2020-01-04 18:50:45" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276627" "00275468" "1" "03382" "03382" "2020-01-04 18:53:26" "" "" "SEQ-NG-I" "DNA" "buccal swabs/blood" ""
"0000276628" "00275469" "1" "03382" "03382" "2020-01-04 19:28:50" "" "" "SEQ-PB" "DNA" "blood" ""
"0000276629" "00275470" "1" "03382" "03382" "2020-01-04 19:35:25" "" "" "SEQ-PB" "DNA" "blood" ""
"0000276630" "00275471" "1" "03382" "03382" "2020-01-04 19:50:15" "" "" "SEQ-NG" "DNA" "blood" ""
"0000276631" "00275472" "1" "03382" "03382" "2020-01-04 19:57:49" "" "" "SEQ-NG" "DNA" "blood" ""
"0000276635" "00275476" "1" "03382" "03382" "2020-01-04 20:42:02" "" "" "?" "DNA" "buccal swabs/blood" ""
"0000276637" "00275478" "1" "03382" "03382" "2020-01-04 20:49:22" "" "" "?" "DNA" "buccal swabs/blood" ""
"0000276638" "00275479" "1" "03382" "03382" "2020-01-04 20:55:12" "" "" "?" "DNA" "buccal swabs/blood" ""
"0000276639" "00275480" "1" "03382" "03382" "2020-01-04 20:58:55" "" "" "?" "DNA" "buccal swabs/blood" ""
"0000276640" "00275481" "1" "03382" "03382" "2020-01-04 21:22:31" "" "" "?" "DNA" "" ""
"0000276642" "00275483" "1" "03382" "03382" "2020-01-04 22:16:35" "" "" "?" "DNA" "" ""
"0000276852" "00275698" "1" "03382" "03382" "2020-01-18 14:12:09" "" "" "?" "DNA" "blood" ""
"0000276853" "00275699" "1" "03382" "03382" "2020-01-18 14:19:05" "" "" "?" "DNA" "blood" ""
"0000276854" "00275700" "1" "03382" "03382" "2020-01-18 14:27:39" "" "" "?;-;ARMS;arrayCGH;arraySEQ;arraySNP" "DNA" "blood" ""
"0000276855" "00275701" "1" "03382" "03382" "2020-01-18 14:35:59" "" "" "?" "DNA" "blood" ""
"0000276856" "00275702" "1" "03382" "03382" "2020-01-18 14:40:59" "" "" "?" "DNA" "blood" ""
"0000276858" "00275704" "1" "03382" "03382" "2020-01-18 15:01:45" "" "" "?" "DNA" "blood" ""
"0000276859" "00275705" "1" "03382" "03382" "2020-01-18 15:06:14" "" "" "?" "DNA" "blood" ""
"0000276860" "00275706" "1" "03382" "03382" "2020-01-18 15:10:52" "" "" "?" "DNA" "blood" ""
"0000276861" "00275707" "1" "03382" "03382" "2020-01-18 15:42:13" "" "" "?" "DNA" "blood" ""
"0000276982" "00275828" "1" "03382" "03382" "2020-01-18 16:30:22" "" "" "?" "DNA" "blood" ""
"0000276985" "00275831" "1" "03382" "03382" "2020-01-18 17:46:11" "" "" "?" "DNA" "whole blood" ""
"0000276987" "00275833" "1" "03382" "03382" "2020-01-18 18:43:43" "" "" "?" "DNA" "whole blood" ""
"0000276988" "00275835" "1" "03382" "03382" "2020-01-18 18:59:03" "" "" "?" "DNA" "blood" ""
"0000276989" "00275836" "1" "03382" "03382" "2020-01-18 19:09:44" "" "" "?" "DNA" "blood" ""
"0000276990" "00275837" "1" "03382" "03382" "2020-01-18 19:36:48" "" "" "?" "DNA" "blood" ""
"0000287092" "00285934" "1" "03382" "03382" "2020-02-09 13:30:03" "" "" "?" "DNA" "blood" ""
"0000287093" "00285935" "1" "03382" "03382" "2020-02-09 13:44:38" "" "" "?" "DNA" "blood" ""
"0000287095" "00285938" "1" "03382" "03382" "2020-02-09 14:32:54" "" "" "?" "DNA" "blood" ""
"0000287099" "00285940" "1" "03382" "03382" "2020-02-09 15:06:35" "" "" "?" "DNA" "blood" ""
"0000287189" "00286030" "1" "03382" "03382" "2020-02-09 16:25:16" "" "" "?" "DNA" "blood" ""
"0000287190" "00286031" "1" "03382" "03382" "2020-02-09 16:47:22" "" "" "?" "DNA" "blood" ""
"0000288096" "00286931" "1" "03561" "03561" "2020-02-11 13:28:45" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288200" "00287035" "1" "03561" "03561" "2020-02-11 13:48:01" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288201" "00287036" "1" "03561" "03561" "2020-02-11 14:08:17" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288202" "00287038" "1" "03561" "03561" "2020-02-11 14:19:12" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288203" "00287039" "1" "03561" "03561" "2020-02-11 14:24:01" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288204" "00287040" "1" "03561" "03561" "2020-02-11 14:28:47" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288205" "00287041" "1" "03561" "03561" "2020-02-11 14:32:37" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288206" "00287042" "1" "03561" "03561" "2020-02-11 14:37:14" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288207" "00287043" "1" "03561" "03561" "2020-02-11 14:40:35" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288209" "00287045" "1" "03561" "03561" "2020-02-11 14:48:19" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288210" "00287046" "1" "03561" "03561" "2020-02-11 14:52:43" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288211" "00287048" "1" "03561" "03561" "2020-02-11 14:57:29" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000288213" "00287049" "1" "03561" "03561" "2020-02-11 15:01:20" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "Sanger sequencing"
"0000291723" "00290555" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000291724" "00290556" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000291725" "00290557" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305453" "00304324" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000305454" "00304325" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000310315" "00309170" "1" "00004" "00006" "2020-08-28 13:59:40" "" "" "SEQ" "DNA" "" ""
"0000317281" "00316099" "1" "00006" "00006" "2020-11-02 19:29:22" "" "" "SEQ;SEQ-NG" "DNA" "" "330-gene panel"
"0000329603" "00328389" "1" "00000" "00006" "2021-01-27 14:27:38" "" "" "SEQ-NG" "DNA" "" "WES"
"0000334602" "00333377" "1" "00000" "00006" "2021-02-25 11:19:20" "" "" "SEQ;SEQ-NG" "DNA" "" "790-gene panel"
"0000334676" "00333451" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000334677" "00333452" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000334678" "00333453" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" ""
"0000336427" "00335198" "1" "00006" "00006" "2021-03-04 11:52:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000336428" "00335199" "1" "00006" "00006" "2021-03-04 11:52:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000336429" "00335200" "1" "00006" "00006" "2021-03-04 11:52:48" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000360193" "00358956" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360206" "00358969" "1" "00000" "00006" "2021-03-18 12:15:00" "" "" "SEQ-NG" "DNA" "" "WES"
"0000360220" "00358983" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360221" "00358984" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360222" "00358985" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360223" "00358986" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360224" "00358987" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360225" "00358988" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360226" "00358989" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360227" "00358990" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360228" "00358991" "1" "00000" "00006" "2021-03-18 13:20:30" "" "" "SEQ" "DNA" "" "FZD4, LRP5, TSPAN12"
"0000360288" "00359050" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000360289" "00359051" "1" "00000" "00006" "2021-03-18 16:44:20" "" "" "SEQ" "DNA" "" "105-gene panel"
"0000364120" "00362892" "1" "00000" "00006" "2021-04-23 19:25:57" "" "" "SEQ-NG" "DNA" "" "WES"
"0000364574" "00363346" "1" "00000" "00006" "2021-04-26 18:22:04" "" "" "SEQ-NG" "DNA" "" "WES"
"0000364866" "00363638" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel"
"0000365045" "00363817" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365046" "00363818" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365047" "00363819" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365048" "00363820" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365049" "00363821" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365050" "00363822" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365051" "00363823" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365052" "00363824" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365053" "00363825" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365054" "00363826" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365055" "00363827" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365056" "00363828" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365057" "00363829" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365058" "00363830" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365059" "00363831" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000365065" "00363837" "1" "00000" "00006" "2021-04-30 10:20:18" "" "" "SEQ" "DNA" "" ""
"0000374653" "00373418" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374654" "00373419" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374655" "00373420" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374656" "00373421" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374657" "00373422" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374658" "00373423" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374659" "00373424" "1" "00000" "00006" "2021-05-14 15:17:31" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374677" "00373442" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374678" "00373443" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374679" "00373444" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374680" "00373445" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374681" "00373446" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374682" "00373447" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000374698" "00373463" "1" "00000" "00006" "2021-05-14 15:31:46" "" "" "SEQ-NG" "DNA" "" "163-gene panel"
"0000375189" "00373957" "1" "00006" "00006" "2021-05-21 16:14:10" "" "" "SEQ-NG" "DNA" "" ""
"0000376615" "00375418" "1" "00000" "00006" "2021-06-04 09:36:04" "" "" "SEQ-NG" "DNA" "" "WES"
"0000377722" "00376517" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ" "DNA" "blood" ""
"0000377723" "00376518" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ" "DNA" "blood" ""
"0000377724" "00376519" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ" "DNA" "blood" ""
"0000377725" "00376520" "1" "00000" "00008" "2021-06-25 02:22:54" "" "" "SEQ" "DNA" "blood" ""
"0000380694" "00379494" "1" "00000" "00008" "2021-08-05 00:17:46" "" "" "SEQ" "DNA" "blood" "WES"
"0000380986" "00379783" "1" "03508" "03508" "2021-08-09 10:29:12" "" "" "SEQ-NG-I" "DNA" "" ""
"0000381477" "00380263" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381478" "00380264" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381479" "00380265" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381480" "00380266" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381481" "00380267" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381482" "00380268" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381483" "00380269" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381484" "00380270" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381485" "00380271" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381486" "00380272" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381487" "00380273" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381488" "00380274" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ" "DNA" "blood" ""
"0000381962" "00380748" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381963" "00380749" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381964" "00380750" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381965" "00380751" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381966" "00380752" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381967" "00380753" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381968" "00380754" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381971" "00380757" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000381972" "00380758" "1" "00000" "03840" "2021-08-23 12:02:42" "" "" "SEQ-NG" "DNA" "blood" ""
"0000382305" "00381091" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382306" "00381092" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382307" "00381093" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000382308" "00381094" "1" "00000" "00008" "2021-08-25 12:56:54" "" "" "SEQ;PCR" "DNA" "blood" ""
"0000383192" "00381976" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383193" "00381977" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383194" "00381978" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383195" "00381979" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383196" "00381980" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383197" "00381981" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383198" "00381982" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383199" "00381983" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383200" "00381984" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383201" "00381985" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383202" "00381986" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383203" "00381987" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383204" "00381988" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383205" "00381989" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383206" "00381990" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383207" "00381991" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383208" "00381992" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383209" "00381993" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383210" "00381994" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383211" "00381995" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383212" "00381996" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383213" "00381997" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383214" "00381998" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383215" "00381999" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383216" "00382000" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383217" "00382001" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383218" "00382002" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383219" "00382003" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383220" "00382004" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383221" "00382005" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383222" "00382006" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383223" "00382007" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383224" "00382008" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383225" "00382009" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383226" "00382010" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383227" "00382011" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383228" "00382012" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383229" "00382013" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383230" "00382014" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383231" "00382015" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383232" "00382016" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383233" "00382017" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383234" "00382018" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383235" "00382019" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383236" "00382020" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383237" "00382021" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383238" "00382022" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383239" "00382023" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383240" "00382024" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383241" "00382025" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383242" "00382026" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383243" "00382027" "1" "00000" "03840" "2021-09-07 10:02:56" "" "" "SEQ-NG" "DNA" "blood" ""
"0000383841" "00382627" "1" "00000" "03840" "2021-09-09 12:48:24" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000383842" "00382628" "1" "00000" "03840" "2021-09-09 12:48:24" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000383843" "00382629" "1" "00000" "03840" "2021-09-09 12:48:24" "" "" "SEQ-NG;SEQ" "DNA" "amniotic fluid" ""
"0000383979" "00382763" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000383990" "00382774" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000383991" "00382775" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000383992" "00382776" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000383993" "00382777" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000383994" "00382778" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000383995" "00382779" "1" "00000" "00008" "2021-09-13 01:01:20" "" "" "PCR;SEQ" "DNA" "blood" ""
"0000384749" "00383524" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384750" "00383525" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384751" "00383526" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384752" "00383527" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384753" "00383528" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384754" "00383529" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384755" "00383530" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384756" "00383531" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384757" "00383532" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384758" "00383533" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384759" "00383534" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384760" "00383535" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384761" "00383536" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384762" "00383537" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384763" "00383538" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384764" "00383539" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384765" "00383540" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384766" "00383541" "1" "00000" "03840" "2021-09-29 12:07:04" "" "" "SEQ-NG" "DNA" "blood" ""
"0000384863" "00383638" "1" "00000" "03840" "2021-09-29 12:15:15" "" "" "SEQ-NG;SEQ" "DNA" "blood" "paediatric disease gene panel"
"0000384864" "00383639" "1" "00000" "03840" "2021-09-29 12:15:15" "" "" "SEQ-NG;SEQ" "DNA" "blood" "paediatric disease gene panel"
"0000384865" "00383640" "1" "00000" "03840" "2021-09-29 12:15:15" "" "" "SEQ" "DNA" "blood" "paediatric disease gene panel"
"0000384866" "00383641" "1" "00000" "03840" "2021-09-29 12:15:15" "" "" "SEQ-NG;SEQ" "DNA" "blood" "paediatric disease gene panel"
"0000384867" "00383642" "1" "00000" "03840" "2021-09-29 12:15:15" "" "" "SEQ-NG;SEQ" "DNA" "blood" "paediatric disease gene panel"
"0000384868" "00383643" "1" "00000" "03840" "2021-09-29 12:15:15" "" "" "SEQ" "DNA" "blood" "paediatric disease gene panel"
"0000384947" "00383722" "1" "00000" "03840" "2021-09-29 12:31:11" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000384948" "00383723" "1" "00000" "03840" "2021-09-29 12:31:11" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000384949" "00383724" "1" "00000" "03840" "2021-09-29 12:31:11" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000384950" "00383725" "1" "00000" "03840" "2021-09-29 12:31:11" "" "" "SEQ-NG;SEQ" "DNA" "blood" ""
"0000385471" "00384246" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385481" "00384256" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385482" "00384257" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385488" "00384263" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385509" "00384284" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385532" "00384307" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385542" "00384317" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385565" "00384340" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385569" "00384344" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385598" "00384373" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385600" "00384375" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385601" "00384376" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385602" "00384377" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385618" "00384393" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385622" "00384397" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385675" "00384450" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385679" "00384454" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385684" "00384459" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385692" "00384467" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000385717" "00384492" "1" "00000" "03840" "2021-09-29 13:19:55" "" "" "SEQ-NG" "DNA" "blood" "panel of 126 genes"
"0000386391" "00385162" "1" "00000" "03840" "2021-10-08 17:29:22" "" "" "SEQ-NG-I" "DNA" "" "105 genes panel"
"0000387019" "00385791" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387020" "00385792" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387021" "00385793" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387022" "00385794" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387023" "00385795" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387024" "00385796" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387025" "00385797" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387026" "00385798" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387027" "00385799" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387028" "00385800" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387029" "00385801" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387030" "00385802" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000387031" "00385803" "1" "00000" "03840" "2021-10-15 13:34:46" "" "" "SEQ-NG" "DNA" "blood" "custom genetic pediatric retinal disease panel (Tang et al., 2017)"
"0000389299" "00388060" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "SEQ" "DNA" "blood" ""
"0000389301" "00388062" "1" "00000" "00008" "2021-11-02 00:52:48" "00008" "2021-11-04 08:55:19" "SEQ" "DNA" "blood" ""
"0000389477" "00388238" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389478" "00388239" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389479" "00388240" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389480" "00388241" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389481" "00388242" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389482" "00388243" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389483" "00388244" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389484" "00388245" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389487" "00388248" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389488" "00388249" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389489" "00388250" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389490" "00388251" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389491" "00388252" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000389492" "00388253" "1" "00000" "03840" "2021-11-03 10:13:08" "" "" "SEQ-NG" "DNA" "blood" "targeted next-generation sequencing in six FEVR known genes"
"0000391506" "00390265" "1" "00000" "03840" "2021-11-10 12:02:36" "" "" "SEQ-NG-I" "DNA" "blood" "whole genome sequencing"
"0000393041" "00391798" "1" "00000" "03840" "2021-11-19 11:12:21" "" "" "SEQ-NG" "DNA" "blood" ""
"0000393042" "00391799" "1" "00000" "03840" "2021-11-19 11:12:21" "" "" "SEQ-NG" "DNA" "blood" ""
"0000394872" "00393624" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000394890" "00393642" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395019" "00393771" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395022" "00393774" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395062" "00393814" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000395081" "00393833" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "" "hereditary eye disease enrichment panel (HEDEP)"
"0000418277" "00416994" "1" "00000" "03840" "2022-09-12 15:23:17" "" "" "SEQ" "DNA" "blood" ""
"0000418278" "00416995" "1" "00000" "03840" "2022-09-12 15:23:17" "" "" "SEQ" "DNA" "blood" ""
"0000418279" "00416996" "1" "00000" "03840" "2022-09-12 15:23:17" "" "" "SEQ" "DNA" "blood" ""
"0000418280" "00416997" "1" "00000" "03840" "2022-09-12 15:23:17" "" "" "SEQ" "DNA" "blood" ""
"0000418281" "00416998" "1" "00000" "03840" "2022-09-12 15:23:17" "" "" "SEQ" "DNA" "blood" ""
"0000418446" "00417164" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418447" "00417165" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418448" "00417166" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418449" "00417167" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418450" "00417168" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418451" "00417169" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418452" "00417170" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418453" "00417171" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418454" "00417172" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418455" "00417173" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418456" "00417174" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418457" "00417175" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418458" "00417176" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418459" "00417177" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418460" "00417178" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418461" "00417179" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418462" "00417180" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418463" "00417181" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418464" "00417182" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418465" "00417183" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418466" "00417184" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418467" "00417185" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418468" "00417186" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418469" "00417187" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418470" "00417188" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418471" "00417189" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418472" "00417190" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418473" "00417191" "1" "00000" "03840" "2022-09-13 15:10:40" "" "" "SEQ" "DNA" "blood" ""
"0000418498" "00417210" "1" "00000" "03840" "2022-09-14 10:30:26" "" "" "FISH;STR;arraySNP;arrayCGH;SEQ" "DNA" "blood" ""
"0000418510" "00417219" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418511" "00417220" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418512" "00417221" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418513" "00417222" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418514" "00417223" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418515" "00417224" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418516" "00417225" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418517" "00417226" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418518" "00417227" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418519" "00417228" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418520" "00417229" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418521" "00417230" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418522" "00417231" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418523" "00417232" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418524" "00417233" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418525" "00417234" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418526" "00417235" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418527" "00417236" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418528" "00417237" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418529" "00417238" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418530" "00417239" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418531" "00417240" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418532" "00417241" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418533" "00417242" "1" "00000" "03840" "2022-09-14 14:39:02" "" "" "SEQ" "DNA" "blood" ""
"0000418547" "00417255" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418548" "00417256" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418549" "00417257" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418550" "00417258" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418551" "00417259" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418552" "00417260" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418553" "00417261" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418554" "00417262" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418555" "00417263" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418556" "00417264" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418557" "00417265" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418558" "00417266" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418559" "00417267" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418560" "00417268" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418561" "00417269" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418562" "00417270" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418563" "00417271" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418564" "00417272" "1" "00000" "03840" "2022-09-14 19:29:54" "" "" "SEQ" "DNA" "blood" ""
"0000418565" "00417273" "1" "00000" "03840" "2022-09-14 20:33:53" "" "" "SEQ" "DNA" "blood" ""
"0000418566" "00417274" "1" "00000" "03840" "2022-09-14 20:33:53" "" "" "SEQ" "DNA" "blood" ""
"0000418567" "00417275" "1" "00000" "03840" "2022-09-14 20:33:53" "" "" "SEQ" "DNA" "blood" ""
"0000418590" "00417298" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418591" "00417299" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418592" "00417300" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418593" "00417301" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418594" "00417302" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418595" "00417303" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418596" "00417304" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418597" "00417305" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418598" "00417306" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418599" "00417307" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418600" "00417308" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418601" "00417309" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418602" "00417310" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418603" "00417311" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418604" "00417312" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418605" "00417313" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418606" "00417314" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418607" "00417315" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418608" "00417316" "1" "00000" "03840" "2022-09-15 12:25:42" "" "" "SEQ" "DNA" "blood" ""
"0000418610" "00417318" "1" "00006" "00006" "2022-09-15 14:07:59" "" "" "SEQ" "DNA" "" ""
"0000418611" "00417319" "1" "00006" "00006" "2022-09-15 14:10:42" "" "" "SEQ" "DNA" "" ""
"0000418612" "00417320" "1" "00006" "00006" "2022-09-15 14:12:26" "" "" "SEQ" "DNA" "" ""
"0000418613" "00417321" "1" "00006" "00006" "2022-09-15 14:14:44" "" "" "SEQ" "DNA" "" ""
"0000418644" "00417352" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418645" "00417353" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418646" "00417354" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418647" "00417355" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418648" "00417356" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418649" "00417357" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418650" "00417358" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418651" "00417359" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418652" "00417360" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418653" "00417361" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418654" "00417362" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418655" "00417363" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418656" "00417364" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418657" "00417365" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418658" "00417366" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418659" "00417367" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418660" "00417368" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418661" "00417369" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418662" "00417370" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418663" "00417371" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418664" "00417372" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418665" "00417373" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418666" "00417374" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418667" "00417375" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418668" "00417376" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418669" "00417377" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418670" "00417378" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418671" "00417379" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418672" "00417380" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418673" "00417381" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418674" "00417382" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418675" "00417383" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418676" "00417384" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418677" "00417385" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418678" "00417386" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418679" "00417387" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418680" "00417388" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418681" "00417389" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418682" "00417390" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418683" "00417391" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418684" "00417392" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418685" "00417393" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418686" "00417394" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418687" "00417395" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418688" "00417396" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418689" "00417397" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418690" "00417398" "1" "00000" "03840" "2022-09-15 20:29:02" "" "" "SEQ" "DNA" "blood" ""
"0000418707" "00417414" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418708" "00417415" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418709" "00417416" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418710" "00417417" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418711" "00417418" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418712" "00417419" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418713" "00417420" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418714" "00417421" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418715" "00417422" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418716" "00417423" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418717" "00417424" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418718" "00417425" "1" "00000" "03840" "2022-09-16 11:43:47" "" "" "SEQ" "DNA" "blood" ""
"0000418721" "00417428" "1" "00000" "03840" "2022-09-16 12:30:21" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418734" "00417441" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418735" "00417442" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418736" "00417443" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418737" "00417444" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418738" "00417445" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418739" "00417446" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418740" "00417447" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418741" "00417448" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418742" "00417449" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418743" "00417450" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418744" "00417451" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418745" "00417452" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418746" "00417453" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418747" "00417454" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418748" "00417455" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418749" "00417456" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418750" "00417457" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418751" "00417458" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418752" "00417459" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418753" "00417460" "1" "00000" "03840" "2022-09-16 15:35:34" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "capture panel of the genes related to congenital cataract and retinal diseases"
"0000418786" "00417493" "1" "00006" "00006" "2022-09-18 12:25:43" "" "" "SEQ" "DNA" "" ""
"0000420017" "00418721" "1" "00006" "00006" "2022-10-04 21:42:27" "" "" "SEQ" "DNA" "" ""
"0000420018" "00418722" "1" "00006" "00006" "2022-10-04 21:45:35" "" "" "SEQ" "DNA" "" ""
"0000422880" "00421569" "1" "00000" "03840" "2022-11-07 15:04:33" "" "" "SEQ" "DNA" "cell line" "iPSC line EHTJUi002-A generated from umbilical cord blood mononuclear cells"
"0000422881" "00421570" "1" "00000" "03840" "2022-11-07 15:05:51" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "whole exome sequencing"
"0000422882" "00421571" "1" "00000" "03840" "2022-11-07 15:07:09" "" "" "SEQ-NG;SEQ" "DNA" "blood" "MVL Vision Panel (v2), 581 genes associated with inherited retinal dystrophies"
"0000445854" "00444280" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000445855" "00444281" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000445856" "00444282" "1" "00006" "00006" "2023-12-21 19:04:03" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
"0000448777" "00447200" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000448782" "00447205" "1" "00006" "00006" "2024-01-26 09:49:02" "" "" "SEQ-NG" "DNA" "" "WGS"
"0000460618" "00458997" "1" "00006" "00006" "2024-12-23 14:26:30" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 472
"{{screeningid}}" "{{geneid}}"
"0000107025" "FZD4"
"0000107026" "FZD4"
"0000107027" "FZD4"
"0000107028" "FZD4"
"0000107029" "FZD4"
"0000107030" "FZD4"
"0000107031" "FZD4"
"0000107032" "FZD4"
"0000107033" "FZD4"
"0000107034" "FZD4"
"0000107035" "FZD4"
"0000107036" "FZD4"
"0000107037" "FZD4"
"0000107038" "FZD4"
"0000107039" "FZD4"
"0000107040" "FZD4"
"0000107041" "FZD4"
"0000107042" "FZD4"
"0000107043" "FZD4"
"0000107044" "FZD4"
"0000107046" "FZD4"
"0000107047" "FZD4"
"0000107048" "FZD4"
"0000107049" "FZD4"
"0000107050" "FZD4"
"0000107051" "FZD4"
"0000107052" "FZD4"
"0000107053" "FZD4"
"0000107054" "FZD4"
"0000107055" "FZD4"
"0000107056" "FZD4"
"0000107057" "FZD4"
"0000107058" "FZD4"
"0000266367" "COL10A1"
"0000266367" "COL18A1"
"0000266367" "COL1A1"
"0000266367" "COL2A1"
"0000266367" "FZD4"
"0000266367" "KCNJ13"
"0000266367" "LRP5"
"0000266367" "NDP"
"0000266367" "RS1"
"0000266367" "TSPAN12"
"0000266367" "ZNF408"
"0000266369" "C10orf10"
"0000266369" "COL10A1"
"0000266369" "COL18A1"
"0000266369" "COL1A1"
"0000266369" "COL2A1"
"0000266369" "FZD4"
"0000266369" "KCNK13"
"0000266369" "LRP5"
"0000266369" "NDP"
"0000266369" "RS1"
"0000266369" "TSPAN12"
"0000266369" "ZNF408"
"0000275478" "FZD4"
"0000275478" "LRP5"
"0000275478" "NDP"
"0000275478" "TSPAN12"
"0000275478" "ZNF408"
"0000275479" "FZD4"
"0000275479" "LRP5"
"0000275479" "NDP"
"0000275479" "TSPAN12"
"0000275479" "ZNF408"
"0000276165" "FZD4"
"0000276165" "LRP5"
"0000276165" "NDP"
"0000276165" "TSPAN12"
"0000310315" "FZD4"
"0000317281" "EYA1"
"0000317281" "FZD4"
"0000329603" "FZD4"
"0000334602" "FZD4"
"0000334676" "FZD4"
"0000334677" "FZD4"
"0000334678" "FZD4"
"0000336427" "FZD4"
"0000336427" "TSPAN12"
"0000336428" "FZD4"
"0000336428" "TSPAN12"
"0000336429" "FZD4"
"0000336429" "TSPAN12"
"0000364120" "FZD4"
"0000364574" "FZD4"
"0000364866" "FZD4"
"0000365045" "FZD4"
"0000365046" "FZD4"
"0000365047" "FZD4"
"0000365048" "FZD4"
"0000365049" "FZD4"
"0000365050" "FZD4"
"0000365051" "FZD4"
"0000365052" "FZD4"
"0000365053" "FZD4"
"0000365054" "FZD4"
"0000365055" "FZD4"
"0000365056" "FZD4"
"0000365057" "FZD4"
"0000365058" "FZD4"
"0000365059" "FZD4"
"0000365065" "FZD4"
"0000374677" "FZD4"
"0000374678" "FZD4"
"0000374679" "FZD4"
"0000374680" "FZD4"
"0000374681" "FZD4"
"0000374682" "FZD4"
"0000374698" "FZD4"
"0000377722" "FZD4"
"0000377723" "FZD4"
"0000377724" "FZD4"
"0000377725" "FZD4"
"0000380694" "FZD4"
"0000381477" "FZD4"
"0000381478" "FZD4"
"0000381479" "FZD4"
"0000381480" "FZD4"
"0000381481" "FZD4"
"0000381482" "FZD4"
"0000381483" "FZD4"
"0000381484" "FZD4"
"0000381485" "FZD4"
"0000381486" "FZD4"
"0000381487" "FZD4"
"0000381488" "FZD4"
"0000381962" "LRP5"
"0000381963" "LRP5"
"0000381964" "LRP5"
"0000381965" "LRP5"
"0000381966" "LRP5"
"0000381967" "LRP5"
"0000381968" "LRP5"
"0000381971" "FZD4"
"0000381972" "FZD4"
"0000382305" "FZD4"
"0000382306" "FZD4"
"0000382307" "FZD4"
"0000382308" "FZD4"
"0000383192" "FZD4"
"0000383193" "FZD4"
"0000383194" "FZD4"
"0000383195" "FZD4"
"0000383196" "FZD4"
"0000383197" "FZD4"
"0000383198" "FZD4"
"0000383199" "FZD4"
"0000383200" "FZD4"
"0000383201" "FZD4"
"0000383202" "FZD4"
"0000383203" "FZD4"
"0000383204" "FZD4"
"0000383205" "FZD4"
"0000383206" "FZD4"
"0000383207" "FZD4"
"0000383208" "FZD4"
"0000383209" "FZD4"
"0000383210" "FZD4"
"0000383211" "FZD4"
"0000383212" "FZD4"
"0000383213" "FZD4"
"0000383214" "FZD4"
"0000383215" "FZD4"
"0000383216" "FZD4"
"0000383217" "FZD4"
"0000383218" "FZD4"
"0000383219" "FZD4"
"0000383220" "FZD4"
"0000383221" "FZD4"
"0000383222" "FZD4"
"0000383223" "FZD4"
"0000383224" "FZD4"
"0000383225" "FZD4"
"0000383226" "FZD4"
"0000383227" "FZD4"
"0000383228" "FZD4"
"0000383229" "FZD4"
"0000383230" "FZD4"
"0000383231" "FZD4"
"0000383232" "FZD4"
"0000383233" "FZD4"
"0000383234" "FZD4"
"0000383235" "FZD4"
"0000383236" "FZD4"
"0000383237" "FZD4"
"0000383238" "FZD4"
"0000383239" "FZD4"
"0000383240" "FZD4"
"0000383241" "FZD4"
"0000383242" "FZD4"
"0000383243" "FZD4"
"0000383841" "FZD4"
"0000383842" "FZD4"
"0000383843" "FZD4"
"0000383979" "LRP5"
"0000383990" "FZD4"
"0000383991" "FZD4"
"0000383992" "FZD4"
"0000383993" "FZD4"
"0000383994" "FZD4"
"0000383995" "FZD4"
"0000384749" "FZD4"
"0000384750" "FZD4"
"0000384751" "FZD4"
"0000384752" "FZD4"
"0000384753" "FZD4"
"0000384754" "FZD4"
"0000384755" "FZD4"
"0000384756" "FZD4"
"0000384757" "FZD4"
"0000384758" "FZD4"
"0000384759" "FZD4"
"0000384760" "FZD4"
"0000384761" "FZD4"
"0000384762" "FZD4"
"0000384763" "FZD4"
"0000384764" "FZD4"
"0000384765" "FZD4"
"0000384766" "FZD4"
"0000384947" "FZD4"
"0000384948" "FZD4"
"0000384949" "FZD4"
"0000384950" "FZD4"
"0000385471" "FZD4"
"0000385481" "FZD4"
"0000385482" "FZD4"
"0000385488" "FZD4"
"0000385509" "FZD4"
"0000385532" "FZD4"
"0000385542" "FZD4"
"0000385565" "FZD4"
"0000385569" "FZD4"
"0000385598" "FZD4"
"0000385600" "FZD4"
"0000385601" "FZD4"
"0000385602" "FZD4"
"0000385618" "FZD4"
"0000385622" "FZD4"
"0000385675" "FZD4"
"0000385679" "FZD4"
"0000385684" "FZD4"
"0000385692" "FZD4"
"0000385717" "FZD4"
"0000386391" "FZD4"
"0000387019" "FZD4"
"0000387020" "FZD4"
"0000387021" "FZD4"
"0000387022" "FZD4"
"0000387023" "FZD4"
"0000387024" "FZD4"
"0000387025" "FZD4"
"0000387026" "FZD4"
"0000387027" "FZD4"
"0000387028" "FZD4"
"0000387029" "FZD4"
"0000387030" "FZD4"
"0000387031" "FZD4"
"0000389299" "FZD4"
"0000389301" "FZD4"
"0000389477" "FZD4"
"0000389478" "FZD4"
"0000389479" "FZD4"
"0000389480" "FZD4"
"0000389481" "FZD4"
"0000389482" "FZD4"
"0000389483" "FZD4"
"0000389484" "FZD4"
"0000389487" "FZD4"
"0000389488" "FZD4"
"0000389489" "FZD4"
"0000389490" "FZD4"
"0000389491" "FZD4"
"0000389492" "FZD4"
"0000391506" "FZD4"
"0000393041" "FZD4"
"0000393042" "FZD4"
"0000394872" "FZD4"
"0000394890" "FZD4"
"0000395019" "FZD4"
"0000395022" "FZD4"
"0000395062" "FZD4"
"0000395081" "FZD4"
"0000418277" "FZD4"
"0000418278" "FZD4"
"0000418279" "FZD4"
"0000418280" "FZD4"
"0000418281" "FZD4"
"0000418446" "FZD4"
"0000418447" "FZD4"
"0000418448" "FZD4"
"0000418449" "FZD4"
"0000418450" "FZD4"
"0000418451" "FZD4"
"0000418452" "FZD4"
"0000418453" "FZD4"
"0000418454" "FZD4"
"0000418455" "FZD4"
"0000418456" "FZD4"
"0000418457" "FZD4"
"0000418458" "FZD4"
"0000418459" "FZD4"
"0000418460" "FZD4"
"0000418461" "FZD4"
"0000418462" "FZD4"
"0000418463" "FZD4"
"0000418464" "FZD4"
"0000418465" "FZD4"
"0000418466" "FZD4"
"0000418467" "FZD4"
"0000418468" "FZD4"
"0000418469" "FZD4"
"0000418470" "FZD4"
"0000418471" "FZD4"
"0000418472" "FZD4"
"0000418473" "FZD4"
"0000418498" "FZD4"
"0000418510" "FZD4"
"0000418511" "FZD4"
"0000418512" "FZD4"
"0000418513" "FZD4"
"0000418514" "FZD4"
"0000418515" "FZD4"
"0000418516" "FZD4"
"0000418517" "FZD4"
"0000418518" "FZD4"
"0000418519" "FZD4"
"0000418520" "FZD4"
"0000418521" "FZD4"
"0000418522" "FZD4"
"0000418523" "FZD4"
"0000418524" "FZD4"
"0000418525" "FZD4"
"0000418526" "FZD4"
"0000418527" "FZD4"
"0000418528" "FZD4"
"0000418529" "FZD4"
"0000418530" "FZD4"
"0000418531" "FZD4"
"0000418532" "FZD4"
"0000418533" "FZD4"
"0000418547" "FZD4"
"0000418548" "FZD4"
"0000418549" "FZD4"
"0000418550" "FZD4"
"0000418551" "FZD4"
"0000418552" "FZD4"
"0000418553" "FZD4"
"0000418554" "FZD4"
"0000418555" "FZD4"
"0000418556" "FZD4"
"0000418557" "FZD4"
"0000418558" "FZD4"
"0000418559" "FZD4"
"0000418560" "FZD4"
"0000418561" "FZD4"
"0000418562" "FZD4"
"0000418563" "FZD4"
"0000418564" "FZD4"
"0000418565" "FZD4"
"0000418566" "FZD4"
"0000418567" "FZD4"
"0000418590" "FZD4"
"0000418591" "FZD4"
"0000418592" "FZD4"
"0000418593" "FZD4"
"0000418594" "FZD4"
"0000418595" "FZD4"
"0000418596" "FZD4"
"0000418597" "FZD4"
"0000418598" "FZD4"
"0000418599" "FZD4"
"0000418600" "FZD4"
"0000418601" "FZD4"
"0000418602" "FZD4"
"0000418603" "FZD4"
"0000418604" "FZD4"
"0000418605" "FZD4"
"0000418606" "FZD4"
"0000418607" "FZD4"
"0000418608" "FZD4"
"0000418610" "FZD4"
"0000418611" "FZD4"
"0000418612" "FZD4"
"0000418613" "FZD4"
"0000418644" "FZD4"
"0000418645" "FZD4"
"0000418646" "FZD4"
"0000418647" "FZD4"
"0000418648" "FZD4"
"0000418649" "FZD4"
"0000418650" "FZD4"
"0000418651" "FZD4"
"0000418652" "FZD4"
"0000418653" "FZD4"
"0000418654" "FZD4"
"0000418655" "FZD4"
"0000418656" "FZD4"
"0000418657" "FZD4"
"0000418658" "FZD4"
"0000418659" "FZD4"
"0000418660" "FZD4"
"0000418661" "FZD4"
"0000418662" "FZD4"
"0000418663" "FZD4"
"0000418664" "FZD4"
"0000418665" "FZD4"
"0000418666" "FZD4"
"0000418667" "FZD4"
"0000418668" "FZD4"
"0000418669" "FZD4"
"0000418670" "FZD4"
"0000418671" "FZD4"
"0000418672" "FZD4"
"0000418673" "FZD4"
"0000418674" "FZD4"
"0000418675" "FZD4"
"0000418676" "FZD4"
"0000418677" "FZD4"
"0000418678" "FZD4"
"0000418679" "FZD4"
"0000418680" "FZD4"
"0000418681" "FZD4"
"0000418682" "FZD4"
"0000418683" "FZD4"
"0000418684" "FZD4"
"0000418685" "FZD4"
"0000418686" "FZD4"
"0000418687" "FZD4"
"0000418688" "FZD4"
"0000418689" "FZD4"
"0000418690" "FZD4"
"0000418707" "FZD4"
"0000418708" "FZD4"
"0000418709" "FZD4"
"0000418710" "FZD4"
"0000418711" "FZD4"
"0000418712" "FZD4"
"0000418713" "FZD4"
"0000418714" "FZD4"
"0000418715" "FZD4"
"0000418716" "FZD4"
"0000418717" "FZD4"
"0000418718" "FZD4"
"0000418721" "FZD4"
"0000418734" "FZD4"
"0000418735" "FZD4"
"0000418736" "FZD4"
"0000418737" "FZD4"
"0000418738" "FZD4"
"0000418739" "FZD4"
"0000418740" "FZD4"
"0000418741" "FZD4"
"0000418742" "FZD4"
"0000418743" "FZD4"
"0000418744" "FZD4"
"0000418745" "FZD4"
"0000418746" "FZD4"
"0000418747" "FZD4"
"0000418748" "FZD4"
"0000418749" "FZD4"
"0000418750" "FZD4"
"0000418751" "FZD4"
"0000418752" "FZD4"
"0000418753" "FZD4"
"0000418786" "FZD4"
"0000420017" "FZD4"
"0000420018" "FZD4"
"0000422880" "FZD4"
"0000422881" "FZD4"
"0000422882" "FZD4"
"0000460618" "FZD4"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 636
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000172767" "1" "90" "11" "86662942" "86662942" "subst" "0" "01251" "FZD4_000002" "g.86662942C>A" "1/8" "{PMID:Nikopoulos 2010:20340138}" "" "" "0/100 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951900C>A" "" "pathogenic" ""
"0000172768" "1" "90" "11" "86662842" "86662842" "del" "0" "00006" "FZD4_000003" "g.86662842del" "1/40" "Toomes 2004b" "" "" "0/200 control chromosomes" "Germline" "" "" "0" "" "" "g.86951800del" "" "pathogenic" ""
"0000172769" "0" "90" "11" "86662841" "86662841" "subst" "0" "00006" "FZD4_000004" "g.86662841C>T" "" "{PMID: Kondo 2003:14507768}" "" "" "0/80 control chromosomes" "De novo" "" "" "0" "" "" "g.86951799C>T" "" "pathogenic (dominant)" ""
"0000172770" "1" "90" "11" "86662841" "86662841" "subst" "0" "00006" "FZD4_000004" "g.86662841C>T" "1/24" "Boonstra 2009" "" "" "0/300 control chromosomes" "Germline" "" "" "0" "" "" "g.86951799C>T" "" "pathogenic" ""
"0000172771" "1" "90" "11" "86662518" "86662521" "del" "0" "01251" "FZD4_000005" "g.86662518_86662521del" "1/8" "{PMID:Nikopoulos 2010:20340138}" "" "" "0/100 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000172772" "1" "90" "11" "86662509" "86662513" "del" "0" "00006" "FZD4_000006" "g.86662509_86662513del" "1/2l" "Muller 2008" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "pathogenic" ""
"0000172773" "1" "90" "11" "86662310" "86662310" "subst" "0" "00006" "FZD4_000007" "g.86662310C>T" "1/20" "Boonstra 2009" "" "" "0/80 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951268C>T" "" "pathogenic" ""
"0000172774" "1" "90" "11" "86662303" "86662303" "del" "0" "00006" "FZD4_000008" "g.86662303del" "1/40" "Toomes 2004b" "" "" "0/200 control chromosomes" "Germline" "" "" "0" "" "" "g.86951261del" "" "pathogenic" ""
"0000172775" "1" "90" "11" "86662298" "86662299" "del" "0" "00006" "FZD4_000009" "g.86662298_86662299del" "1/2 families" "{PMID:Robitaille 2002:12172548}, {DOI:Robitaille 2002:10.1038/ng957}, {OMIM604579:0002}" "" "" "0/306 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "pathogenic" ""
"0000172776" "1" "90" "11" "86662298" "86662299" "del" "0" "00006" "FZD4_000009" "g.86662298_86662299del" "1/40" "Toomes 2004b" "" "" "0/200 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "pathogenic" ""
"0000172777" "1" "90" "11" "86662285" "86662285" "subst" "0" "00006" "FZD4_000010" "g.86662285G>A" "1/40" "Toomes 2004b" "" "" "0/200 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951243G>A" "" "pathogenic" ""
"0000172778" "1" "90" "11" "86666021" "86666021" "subst" "0" "00006" "FZD4_000011" "g.86666021C>T" "1/40" "Toomes 2004b" "" "" "0/400 control chromosomes" "Germline" "" "" "0" "" "" "g.86954979C>T" "" "pathogenic" ""
"0000172779" "1" "90" "11" "86666010" "86666010" "subst" "0.000284438" "01251" "FZD4_000012" "g.86666010C>G" "1/8" "{PMID:Nikopoulos 2010:20340138}" "" "" "0/100 control chromosomes; carries pathogenic variant LRP5:c.4489-1G>A" "Germline" "" "" "0" "" "" "g.86954968C>G" "" "pathogenic" ""
"0000172780" "1" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00006" "FZD4_000013" "g.86663485T>C" "1/24" "Kondo 2003" "" "" "0/300 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000172781" "1" "90" "11" "86663484" "86663484" "subst" "0" "00006" "FZD4_000014" "g.86663484A>G" "1/40" "Toomes 2004b" "" "" "0/400 control chromosomes" "Germline" "" "" "0" "" "" "g.86952442A>G" "" "pathogenic" ""
"0000172782" "1" "90" "11" "86663457" "86663457" "subst" "0" "00006" "FZD4_000015" "g.86663457A>G" "1/2" "Robitaille 2009" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952415A>G" "" "pathogenic" ""
"0000172783" "1" "90" "11" "86663329" "86663329" "subst" "0" "00006" "FZD4_000016" "g.86663329T>C" "1/40" "Toomes 2004b" "" "" "0/400 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "pathogenic" ""
"0000172784" "1" "90" "11" "86663257" "86663257" "subst" "0" "00006" "FZD4_000017" "g.86663257A>G" "1/2" "Omoto 2004" "" "" "0/240 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86952215A>G" "" "pathogenic" ""
"0000172785" "1" "90" "11" "86663189" "86663189" "subst" "0" "00006" "FZD4_000018" "g.86663189C>G" "1/104" "Ells 2010" "" "" "0/346 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86952147C>G" "" "pathogenic" ""
"0000172786" "1" "90" "11" "86663187" "86663187" "subst" "0" "01251" "FZD4_000019" "g.86663187C>T" "1/8" "{PMID:Nikopoulos 2010:20340138}" "" "" "0/100 control chromosomes" "Germline" "" "" "0" "" "" "g.86952145C>T" "" "pathogenic" ""
"0000172788" "1" "90" "11" "86663130" "86663130" "subst" "0" "00006" "FZD4_000021" "g.86663130A>T" "1/20" "Boonstra 2009" "" "" "0/80 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86952088A>T" "" "pathogenic" ""
"0000172789" "1" "90" "11" "86663032" "86663032" "subst" "0.000528279" "00006" "FZD4_000022" "g.86663032T>C" "1/20" "MacDonald 2005" "" "" "0/200 control chromosomes" "Germline" "" "" "0" "" "" "g.86951990T>C" "" "pathogenic" ""
"0000172790" "1" "90" "11" "86662793" "86662793" "subst" "0" "00006" "FZD4_000023" "g.86662793C>G" "1/56" "Qin 2005" "" "" "0/300 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951751C>G" "" "pathogenic" ""
"0000172791" "1" "90" "11" "86662774" "86662774" "subst" "0" "00006" "FZD4_000024" "g.86662774T>C" "1/1" "Yoshida 2004" "" "" "0/120 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951732T>C" "" "pathogenic" ""
"0000172792" "1" "90" "11" "86662774" "86662774" "subst" "0" "00006" "FZD4_000024" "g.86662774T>C" "1/56" "Qin 2005" "" "" "0/300 control chromosomes" "Germline" "" "" "0" "" "" "g.86951732T>C" "" "pathogenic" ""
"0000172793" "1" "90" "11" "86662689" "86662689" "subst" "0" "00006" "FZD4_000025" "g.86662689G>C" "1/104" "Ells 2010" "" "" "0/346 control chromosomes" "Germline" "" "" "0" "" "" "g.86951647G>C" "" "pathogenic" ""
"0000172794" "1" "90" "11" "86662548" "86662548" "subst" "1.21819E-5" "00006" "FZD4_000026" "g.86662548C>T" "2/24" "Kondo 2003" "" "" "0/300 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951506C>T" "" "pathogenic" ""
"0000172795" "1" "90" "11" "86662465" "86662465" "subst" "0" "00006" "FZD4_000027" "g.86662465T>G" "1/20" "Boonstra 2009" "" "" "0/80 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951423T>G" "" "pathogenic" ""
"0000172796" "21" "90" "11" "86662335" "86662335" "subst" "0" "00006" "FZD4_000028" "g.86662335C>T" "1/24" "{PMID: Kondo 2003:14507768}" "" "" "0/300 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951293C>T" "" "pathogenic" ""
"0000172797" "1" "90" "11" "86662324" "86662324" "subst" "0" "00006" "FZD4_000029" "g.86662324C>G" "1/2" "Muller 2008" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "pathogenic" ""
"0000172798" "1" "90" "11" "86662308" "86662308" "subst" "0" "00006" "FZD4_000030" "g.86662308G>A" "1/40" "Toomes 2004b" "" "" "0/400 control chromosomes" "Germline" "" "" "0" "" "" "g.86951266G>A" "" "pathogenic" ""
"0000172799" "1" "90" "11" "86662225" "86662225" "subst" "0" "01251" "FZD4_000031" "g.86662225C>G" "1/8" "{PMID:Nikopoulos 2010:20340138}" "" "" "0/100 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951183C>G" "" "pathogenic" ""
"0000172800" "1" "90" "11" "86662316" "86662321" "del" "0" "00006" "FZD4_000032" "g.86662316_86662321del" "1/2 families" "{PMID:Robitaille 2002:12172548}, {DOI:Robitaille 2002:10.1038/ng957}, {OMIM604579:0001}" "" "1479_1484delGTGGAT" "0/306 control chromosomes" "Germline" "yes" "" "0" "" "" "g.86951274_86951279del" "" "pathogenic" ""
"0000276923" "0" "10" "11" "86662631" "86662631" "subst" "0" "02330" "FZD4_000034" "g.86662631C>G" "" "" "" "FZD4(NM_012193.4):c.1167G>C (p.G389=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951589C>G" "" "benign" ""
"0000276924" "0" "10" "11" "86666080" "86666080" "subst" "0.000255876" "02330" "FZD4_000036" "g.86666080G>A" "" "" "" "FZD4(NM_012193.4):c.48C>T (p.G16=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86955038G>A" "" "benign" ""
"0000288015" "0" "50" "11" "86666081" "86666081" "subst" "9.4097E-5" "01943" "FZD4_000037" "g.86666081C>T" "" "" "" "FZD4(NM_012193.3):c.47G>A (p.G16D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86955039C>T" "" "VUS" ""
"0000322441" "0" "50" "11" "86519158" "86519158" "subst" "3.25423E-5" "01804" "PRSS23_000001" "g.86519158C>T" "" "" "" "PRSS23(NM_007173.4):c.473C>T (p.(Thr158Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86808116C>T" "" "VUS" ""
"0000322442" "0" "50" "11" "86519468" "86519468" "subst" "0.000491838" "01804" "PRSS23_000002" "g.86519468G>A" "" "" "" "PRSS23(NM_007173.4):c.783G>A (p.(Met261Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86808426G>A" "" "VUS" ""
"0000342433" "0" "50" "11" "86663041" "86663041" "subst" "1.21962E-5" "02327" "FZD4_000041" "g.86663041G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951999G>A" "" "VUS" ""
"0000344307" "0" "90" "11" "86663187" "86663187" "subst" "0" "02327" "FZD4_000019" "g.86663187C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86952145C>T" "" "pathogenic" ""
"0000344835" "0" "30" "11" "86662536" "86662536" "subst" "0" "02327" "FZD4_000038" "g.86662536T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951494T>G" "" "likely benign" ""
"0000345327" "0" "90" "11" "86662942" "86662942" "subst" "0" "02327" "FZD4_000002" "g.86662942C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951900C>A" "" "pathogenic" ""
"0000345400" "0" "50" "11" "86666010" "86666010" "subst" "0.000284438" "02327" "FZD4_000012" "g.86666010C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86954968C>G" "" "VUS" ""
"0000348234" "0" "10" "11" "86663296" "86663296" "subst" "0.0184442" "02327" "FZD4_000042" "g.86663296G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86952254G>A" "" "benign" ""
"0000348390" "0" "10" "11" "86666031" "86666031" "subst" "0.0169315" "02327" "FZD4_000033" "g.86666031G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86954989G>A" "" "benign" ""
"0000349521" "0" "70" "11" "86662465" "86662465" "subst" "0" "02327" "FZD4_000027" "g.86662465T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951423T>G" "" "likely pathogenic" ""
"0000349773" "0" "90" "11" "86662841" "86662841" "subst" "0" "02327" "FZD4_000004" "g.86662841C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951799C>T" "" "pathogenic" ""
"0000349780" "0" "90" "11" "86662794" "86662794" "subst" "0" "02327" "FZD4_000040" "g.86662794C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951752C>T" "" "pathogenic" ""
"0000349813" "0" "70" "11" "86662310" "86662310" "subst" "0" "02327" "FZD4_000007" "g.86662310C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.86951268C>T" "" "likely pathogenic" ""
"0000546005" "0" "50" "11" "86662206" "86662206" "subst" "0" "02330" "FZD4_000043" "g.86662206T>C" "" "" "" "FZD4(NM_012193.4):c.1592A>G (p.K531R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86951164T>C" "" "VUS" ""
"0000546006" "0" "50" "11" "86662237" "86662237" "subst" "4.06088E-6" "02327" "FZD4_000044" "g.86662237T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86951195T>C" "" "VUS" ""
"0000546007" "0" "50" "11" "86662559" "86662559" "subst" "8.12143E-6" "02330" "FZD4_000045" "g.86662559C>G" "" "" "" "FZD4(NM_012193.4):c.1239G>C (p.L413F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86951517C>G" "" "VUS" ""
"0000546008" "0" "10" "11" "86662646" "86662646" "subst" "1.62431E-5" "02330" "FZD4_000046" "g.86662646G>A" "" "" "" "FZD4(NM_012193.4):c.1152C>T (p.L384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86951604G>A" "" "benign" ""
"0000546009" "0" "50" "11" "86662789" "86662789" "subst" "7.31202E-5" "01943" "FZD4_000047" "g.86662789G>T" "" "" "" "FZD4(NM_012193.3):c.1009C>A (p.H337N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86951747G>T" "" "VUS" ""
"0000546010" "0" "10" "11" "86662853" "86662853" "subst" "4.06517E-6" "02330" "FZD4_000048" "g.86662853G>A" "" "" "" "FZD4(NM_012193.4):c.945C>T (p.A315=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86951811G>A" "" "benign" ""
"0000546013" "0" "30" "11" "86665923" "86665923" "subst" "0.000513326" "01943" "FZD4_000035" "g.86665923G>A" "" "" "" "FZD4(NM_012193.3):c.205C>T (p.H69Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86954881G>A" "" "likely benign" ""
"0000546014" "0" "50" "11" "86665951" "86665951" "subst" "3.28127E-5" "02330" "FZD4_000049" "g.86665951G>T" "" "" "" "FZD4(NM_012193.4):c.177C>A (p.N59K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86954909G>T" "" "VUS" ""
"0000546015" "0" "90" "11" "86666089" "86666098" "del" "0" "02327" "FZD4_000050" "g.86666089_86666098del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86955047_86955056del" "" "pathogenic" ""
"0000546016" "0" "30" "11" "86666139" "86666139" "subst" "0.00251325" "02330" "FZD4_000051" "g.86666139G>T" "" "" "" "FZD4(NM_012193.4):c.-12C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86955097G>T" "" "likely benign" ""
"0000596940" "11" "70" "11" "86662609" "86662613" "del" "0" "03382" "FZD4_000053" "g.86662609_86662613del" "1/621" "{PMID: Tian et al 2019: 30820142}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951567_86951571del" "" "likely pathogenic" ""
"0000596942" "0" "70" "11" "86662609" "86662613" "del" "0" "03382" "FZD4_000053" "g.86662609_86662613del" "" "{PMID: Tian et al 2019: 30820142}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951567_86951571del" "" "likely pathogenic" ""
"0000596988" "11" "90" "11" "86662578" "86662578" "del" "0" "03382" "FZD4_000052" "g.86662578del" "1/621" "{PMID: Tian et al 2019: 30820142}" "" "1220delC" "" "Germline" "yes" "" "0" "" "" "g.86951536del" "" "pathogenic (dominant)" ""
"0000596989" "0" "70" "11" "86662578" "86662578" "del" "0" "03382" "FZD4_000052" "g.86662578del" "" "{PMID:Tian 2019:30820142}" "" "1220delC" "" "Germline" "yes" "" "0" "" "" "g.86951536del" "" "likely pathogenic" ""
"0000597021" "11" "90" "11" "86662893" "86662893" "subst" "0" "03382" "FZD4_000054" "g.86662893C>T" "1/621" "{PMID:Tian 2019:30820142}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951851C>T" "" "pathogenic" ""
"0000597022" "0" "90" "11" "86662893" "86662893" "subst" "0" "03382" "FZD4_000054" "g.86662893C>T" "" "{PMID: Tian et al 2019: 30820142}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951851C>T" "" "pathogenic" ""
"0000597023" "11" "70" "11" "86662473" "86662473" "subst" "0" "03382" "FZD4_000055" "g.86662473A>T" "1/621" "{PMID: Tian et al 2019: 30820142}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951431A>T" "" "likely pathogenic" ""
"0000597024" "0" "70" "11" "86662473" "86662473" "subst" "0" "03382" "FZD4_000055" "g.86662473A>T" "" "{PMID: Tian 2019: 30820142}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951431A>T" "" "likely pathogenic" ""
"0000597025" "21" "90" "11" "86662324" "86662324" "del" "0" "03382" "FZD4_000056" "g.86662324del" "" "{PMID:Montecinos-Contreras 2016 : 27746066 }" "" "1474delG" "" "Germline" "yes" "" "0" "" "" "g.86951282del" "" "pathogenic" ""
"0000597026" "0" "70" "11" "86662324" "86662324" "del" "0" "03382" "FZD4_000056" "g.86662324del" "" "{PMID:Montecinos-Contreras 2016:27746066 }" "" "1474delG" "" "Germline" "yes" "" "0" "" "" "g.86951282del" "" "likely pathogenic" ""
"0000597027" "3" "90" "11" "86666089" "86666098" "del" "0" "03382" "FZD4_000050" "g.86666089_86666098del" "" "{PMID: TKhan 2016: 27668459}" "" "40_49delCCCGGGGGCG" "" "Germline" "yes" "" "0" "" "" "g.86955047_86955056del" "" "pathogenic" ""
"0000597028" "3" "90" "11" "86666089" "86666098" "del" "0" "03382" "FZD4_000050" "g.86666089_86666098del" "" "{PMID: Khan 2016: 27668459}" "" "40_49delCCCGGGGGCG" "" "Germline" "yes" "" "0" "" "" "g.86955047_86955056del" "" "pathogenic" ""
"0000597073" "0" "90" "11" "86663049" "86663049" "subst" "0" "03382" "FZD4_000058" "g.86663049T>C" "" "{PMID: Yang et al 2018: 30537745}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952007T>C" "" "pathogenic" ""
"0000597074" "0" "90" "11" "86663049" "86663049" "subst" "0" "03382" "FZD4_000058" "g.86663049T>C" "" "{PMID:Yang 2018:30537745 }" "" "g.86952007T>C" "" "Germline" "yes" "" "0" "" "" "g.86952007T>C" "" "pathogenic" ""
"0000597075" "0" "90" "11" "86662292" "86662292" "del" "0" "03382" "FZD4_000057" "g.86662292del" "1/61" "{PMID:Fei 2015:26530129 }" "" "1506delC" "" "De novo" "yes" "" "0" "" "" "g.86951250del" "" "pathogenic" ""
"0000597076" "0" "90" "11" "86663398" "86663398" "subst" "0" "03382" "FZD4_000059" "g.86663398C>A" "1/61" "{PMID:Fei 2015:26530129 }" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952356C>A" "" "pathogenic" ""
"0000613772" "0" "30" "11" "86663069" "86663069" "subst" "8.54103E-5" "01943" "FZD4_000060" "g.86663069G>A" "" "" "" "FZD4(NM_012193.3):c.729C>T (p.I243=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86952027G>A" "" "likely benign" ""
"0000613773" "0" "30" "11" "86665830" "86665835" "dup" "0" "02330" "FZD4_000061" "g.86665830_86665835dup" "" "" "" "FZD4(NM_012193.4):c.285+18_285+23dupCACCCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.86954788_86954793dup" "" "likely benign" ""
"0000629371" "3" "90" "11" "86662548" "86662548" "subst" "1.21819E-5" "03382" "FZD4_000026" "g.86662548C>T" "" "{PMID: Kondo 2009:18161623 }" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951506C>T" "" "pathogenic" ""
"0000629499" "21" "50" "11" "86663485" "86663485" "subst" "2.03973E-5" "03383" "FZD4_000013" "g.86663485T>C" "" "{PMID:Wu 2016:26908610}" "" "" "mother maternal carrier" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "VUS" ""
"0000629500" "21" "50" "11" "86662518" "86662521" "del" "0" "03383" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wu 2016:26908610}" "" "1282_1285delGACA" "mother nonpenetrant carrier" "Germline" "yes" "" "0" "" "" "" "" "VUS" ""
"0000629678" "11" "90" "11" "86662772" "86662772" "subst" "0" "03382" "FZD4_000068" "g.86662772C>T" "" "{PMID: Yoshida 2004: 15488808 }" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951730C>T" "" "pathogenic" ""
"0000630279" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "03382" "FZD4_000013" "g.86663485T>C" "" "{PMID: Iwata 2019:31294129 }" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000630280" "0" "50" "11" "86662980" "86662980" "subst" "0" "03382" "FZD4_000070" "g.86662980A>C" "" "{PMID:Bochiccio 2017:28850050 }" "" "" "" "Unknown" "yes" "" "0" "" "" "g.86951938A>C" "" "VUS" ""
"0000630281" "0" "70" "11" "86662326" "86662326" "subst" "0" "03382" "FZD4_000066" "g.86662326G>C" "" "{PMID: Bochiccio 2017:28850050 }" "" "" "" "Unknown" "yes" "" "0" "" "" "g.86951284G>C" "" "likely pathogenic" ""
"0000630724" "11" "90" "11" "86662824" "86662827" "del" "0" "03382" "FZD4_000069" "g.86662824_86662827del" "" "{PMID:Tang 2015:27555740 }" "" "975_978delCACT T326fsX356" "" "Germline" "yes" "" "0" "" "" "g.86951782_86951785del" "" "pathogenic" ""
"0000630726" "21" "90" "11" "86662824" "86662827" "del" "0" "03382" "FZD4_000069" "g.86662824_86662827del" "" "{PMID:Tang 2015:27555740 }" "" "975_978delCACT" "" "Germline" "yes" "" "0" "" "" "g.86951782_86951785del" "" "pathogenic" ""
"0000630728" "0" "90" "11" "86662324" "86662324" "del" "0" "03382" "FZD4_000056" "g.86662324del" "" "{PMID:Tang 2015:27555740 }" "" "1475delG G492fsX512" "" "De novo" "" "" "0" "" "" "g.86951282del" "" "pathogenic" ""
"0000630730" "0" "90" "11" "86662746" "86662766" "del" "0" "03382" "FZD4_000067" "g.86662746_86662766del" "" "{PMID:Tang 2015:27555740 }" "" "1034_1054delCTTATTTCCACATTGCAGCCT S345_A351del" "" "Germline" "yes" "" "0" "" "" "g.86951704_86951724del" "" "pathogenic" ""
"0000630732" "0" "90" "11" "86665994" "86665994" "subst" "0" "03382" "FZD4_000074" "g.86665994C>T" "" "{PMID:Tang 2015:27555740 }" "" "C45Y" "" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "pathogenic" ""
"0000630734" "11" "90" "11" "86665995" "86665995" "subst" "0" "03382" "FZD4_000075" "g.86665995A>G" "" "{PMID:Tang 2015:27555740 }" "" "C45R" "" "Germline" "yes" "" "0" "" "" "g.86954953A>G" "" "pathogenic" ""
"0000630735" "21" "90" "11" "86665995" "86665995" "subst" "0" "03382" "FZD4_000076" "g.86665995A>T" "" "{PMID:Tang 2015:27555740 }" "" "C45S" "" "Germline" "yes" "" "0" "" "" "g.86954953A>T" "" "pathogenic" ""
"0000630736" "0" "90" "11" "86665970" "86665970" "subst" "0" "03382" "FZD4_000073" "g.86665970C>G" "" "{PMID:Tang 2016:27555740 }" "" "C53S" "" "Germline" "yes" "" "0" "" "" "g.86954928C>G" "" "pathogenic" ""
"0000630737" "0" "90" "11" "86665905" "86665905" "subst" "0" "03382" "FZD4_000072" "g.86665905C>T" "" "{PMID:Tang 2016:27555740 }" "" "A75T" "" "Unknown" "yes" "" "0" "" "" "g.86954863C>T" "" "pathogenic" ""
"0000630738" "0" "90" "11" "86665860" "86665860" "subst" "0" "03382" "FZD4_000071" "g.86665860A>G" "" "{PMID:Tang 2016:27555740 }" "" "C90R" "" "Germline" "yes" "" "0" "" "" "g.86954818A>G" "" "pathogenic" ""
"0000630740" "0" "90" "11" "86666021" "86666021" "subst" "0" "03382" "FZD4_000011" "g.86666021C>T" "" "{PMID:Tang 2016:27555740 }" "" "G36D" "" "Germline" "yes" "" "0" "" "" "g.86954979C>T" "" "pathogenic" ""
"0000630741" "0" "90" "11" "86662841" "86662841" "subst" "0" "03382" "FZD4_000004" "g.86662841C>T" "" "{PMID:Tang 2016:27555740 }" "" "W319X" "" "Germline" "yes" "" "0" "" "" "g.86951799C>T" "" "pathogenic" ""
"0000630743" "0" "90" "11" "86662303" "86662303" "del" "0" "03382" "FZD4_000008" "g.86662303del" "" "{PMID:Tang 2016:27555740 }" "" "1498delA T500fsX512" "" "De novo" "yes" "" "0" "" "" "g.86951261del" "" "pathogenic" ""
"0000630744" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "03382" "FZD4_000013" "g.86663485T>C" "" "{PMID:Tang 2016:27555740 }" "" "M105V" "" "De novo" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000630745" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "03382" "FZD4_000013" "g.86663485T>C" "" "{PMID:Tang 2016:27555740 }" "" "M105V" "" "De novo" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000630746" "0" "90" "11" "86662518" "86662521" "del" "0" "03382" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Tang 2016:27555740 }" "" "1282_1285delGACA D428fsX429" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000630747" "21" "90" "11" "86662518" "86662521" "del" "0" "03382" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Tang 2016:27555740 }" "" "1282_1285delGACA D428fsX429" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000630748" "21" "90" "11" "86662518" "86662521" "del" "0" "03382" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Tang 2016:27555740 }" "" "1282_1285delGACA D428fsX429" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000630749" "21" "90" "11" "86662518" "86662521" "del" "0" "03382" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Tang 2016:27555740 }" "" "1282_1285delGACA D428fsX429" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000630750" "21" "90" "11" "86662518" "86662521" "del" "0" "03382" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Tang 2016:27555740 }" "" "1282_1285delGACA D428fsX429" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000630751" "0" "90" "11" "86662518" "86662521" "del" "0" "03382" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Tang 2016:27555740 }" "" "1282_1285delGACA D428fsX429" "" "De novo" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000630752" "21" "90" "11" "86665923" "86665923" "subst" "0.000513326" "03382" "FZD4_000035" "g.86665923G>A" "" "{PMID:Omoto 2004:15370539 }" "" "p.H69Y" "" "Germline" "yes" "" "0" "" "" "g.86954881G>A" "" "pathogenic" ""
"0000630753" "21" "90" "11" "86663257" "86663257" "subst" "0" "03382" "FZD4_000017" "g.86663257A>G" "" "{PMID:Omoto 2004:15370539 }" "" "p.C181R" "" "Germline" "yes" "" "0" "" "" "g.86952215A>G" "" "pathogenic" ""
"0000630754" "0" "90" "11" "86666031" "86666031" "subst" "0.0169315" "03382" "FZD4_000033" "g.86666031G>A" "" "{PMID:MacDonald 2005:15733276}" "" "P33S" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.86954989G>A" "" "pathogenic" ""
"0000630755" "0" "90" "11" "86663296" "86663296" "subst" "0.0184442" "03382" "FZD4_000042" "g.86663296G>A" "" "{PMID:MacDonald :15733276}" "" "P168S" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.86952254G>A" "" "pathogenic" ""
"0000630756" "0" "90" "11" "86663032" "86663032" "subst" "0.000528279" "03382" "FZD4_000022" "g.86663032T>C" "" "{PMID:MacDonald 2005:15733276}" "" "I256V" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.86951990T>C" "" "pathogenic" ""
"0000630760" "0" "90" "11" "86662842" "86662842" "del" "0" "03382" "FZD4_000003" "g.86662842del" "" "{PMID:Edwards 2012:22574936}" "" "957delG" "" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "pathogenic" ""
"0000630762" "0" "90" "11" "86662842" "86662842" "del" "0" "03382" "FZD4_000003" "g.86662842del" "" "{PMID:Edwards 2012:22574936}" "" "957delG" "" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "pathogenic" ""
"0000630763" "0" "90" "11" "86662842" "86662842" "del" "0" "03382" "FZD4_000003" "g.86662842del" "" "{PMID:Edwards 2012:22574936}" "" "957delG" "" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "pathogenic" ""
"0000630764" "10" "90" "11" "86662842" "86662842" "del" "0" "03382" "FZD4_000003" "g.86662842del" "" "{PMID:Edwards 2012:22574936}" "" "957delG" "" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "pathogenic" ""
"0000630765" "21" "90" "11" "86662316" "86662321" "del" "0" "03382" "FZD4_000032" "g.86662316_86662321del" "" "{PMID:Robitaille 2009:19172507 } \r\n{PMID:Robitaille 2002:12172548 }" "" "1479_1484delGTGGAT" "" "Germline" "yes" "" "0" "" "" "g.86951274_86951279del" "" "pathogenic" ""
"0000630766" "0" "90" "11" "86662298" "86662299" "del" "0" "03382" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Robitaille 2002:12172548 }" "" "1501_1502delCT" "" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "pathogenic" ""
"0000630884" "0" "90" "11" "86665842" "86666440" "del" "0" "03382" "FZD4_000077" "g.(86663513_86665842)_(86666440_?)del" "" "{PMID:Mammo 2015:26109022}" "" "del exon 1" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.(86952471_86954800)_(86955398_?)del" "" "pathogenic (dominant)" ""
"0000631002" "11" "90" "11" "86666031" "86666031" "subst" "0.0169315" "03382" "FZD4_000033" "g.86666031G>A" "" "{PMID:Nallathambi 2006:17093393}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "pathogenic (dominant)" ""
"0000631003" "0" "90" "11" "86666031" "86666031" "subst" "0.0169315" "03382" "FZD4_000033" "g.86666031G>A" "" "{PMID:Nallathambi 2006:17093393}" "" "" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.86954989G>A" "" "pathogenic (dominant)" ""
"0000631004" "0" "90" "11" "86663188" "86663188" "subst" "0" "03382" "FZD4_000020" "g.86663188A>G" "" "{PMID:Nallathambi 2006:17093393}" "" "916T>C" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000631005" "10" "90" "11" "86663188" "86663188" "subst" "0" "03382" "FZD4_000020" "g.86663188A>G" "" "{PMID:Nallathambi 2006:17093393}" "" "916T>C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000631007" "11" "90" "11" "86663188" "86663188" "subst" "0" "03382" "FZD4_000020" "g.86663188A>G" "" "{PMID:Nallathambi 2006:17093393}" "" "916T>C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000631008" "10" "90" "11" "86663188" "86663188" "subst" "0" "03382" "FZD4_000020" "g.86663188A>G" "" "{PMID:Nallathambi 2006:17093393}" "" "916T>C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000631009" "11" "90" "11" "86663188" "86663188" "subst" "0" "03382" "FZD4_000020" "g.86663188A>G" "" "{PMID:Nallathambi 2006:17093393}" "" "916T>C" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000631010" "0" "90" "11" "86665877" "86665884" "delins" "0" "03382" "FZD4_000081" "g.86665877_86665884delinsTGCAGCTCGGCGTACTGGATGAGCTGC" "" "{PMID:Nallathambi 2006:17093393}" "" "244_251del8ins27" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.86954835_86954842delinsTGCAGCTCGGCGTACTGGATGAGCTGC" "" "pathogenic (dominant)" ""
"0000631011" "11" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "03382" "FZD4_000013" "g.86663485T>C" "" "{PMID: Kondo 2003:14507768}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic (dominant)" ""
"0000631372" "11" "90" "11" "86662548" "86662548" "subst" "1.21819E-5" "03382" "FZD4_000026" "g.86662548C>T" "" "{PMID: Kondo 2003:14507768}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951506C>T" "" "pathogenic (!)" ""
"0000631732" "0" "90" "11" "86666063" "86666063" "subst" "4.18554E-6" "03382" "FZD4_000082" "g.86666063C>T" "" "{PMID:Jia 2010:20938005}" "" "p. G22E" "" "De novo" "yes" "" "0" "" "" "g.86955021C>T" "" "pathogenic" ""
"0000631734" "11" "90" "11" "86665923" "86665923" "subst" "0.000513326" "03382" "FZD4_000035" "g.86665923G>A" "" "{PMID:Jia 2010:20938005}" "" "H69Y" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000631735" "21" "90" "11" "86663260" "86663260" "subst" "0" "03382" "FZD4_000080" "g.86663260C>T" "" "{PMID:Jia 2010:20938005}" "" "E180K" "" "Germline" "yes" "" "0" "" "" "g.86952218C>T" "" "pathogenic" ""
"0000631736" "21" "90" "11" "86665923" "86665923" "subst" "0.000513326" "03382" "FZD4_000035" "g.86665923G>A" "" "{PMID:Jia 2010:20938005}" "" "H69Y" "" "Germline" "yes" "" "0" "" "" "g.86954881G>A" "" "pathogenic" ""
"0000631737" "11" "90" "11" "86662310" "86662310" "subst" "0" "03382" "FZD4_000007" "g.86662310C>T" "" "{PMID:Jia 2010:20938005}" "" "p.W496X" "" "Germline" "yes" "" "0" "" "" "g.86951268C>T" "" "pathogenic" ""
"0000631740" "11" "90" "11" "86663088" "86663088" "subst" "0" "03382" "FZD4_000079" "g.86663088G>C" "" "{PMID:Jia 2010:20938005}" "" "T237R" "" "Germline" "yes" "" "0" "" "" "g.86952046G>C" "" "pathogenic" ""
"0000642878" "21" "90" "11" "86663041" "86663041" "subst" "1.21962E-5" "03382" "FZD4_000041" "g.86663041G>A" "" "{PMID: Jia 2010:20938005}" "" "R253C" "" "Germline" "yes" "" "0" "" "" "g.86951999G>A" "" "pathogenic" ""
"0000642879" "0" "90" "11" "86662815" "86662815" "subst" "0" "03382" "FZD4_000086" "g.86662815A>G" "" "{PMID: Jia 2010: 20938005 }" "" "F3288" "" "Germline" "yes" "" "0" "" "" "g.86951773A>G" "" "pathogenic" ""
"0000642882" "21" "90" "11" "86662783" "86662783" "subst" "0" "03382" "FZD4_000085" "g.86662783C>T" "" "{PMID: Jia 2010: 20938005 }" "" "A339T" "" "Germline" "yes" "" "0" "" "" "g.86951741C>T" "" "pathogenic" ""
"0000642975" "11" "90" "11" "86662390" "86662390" "subst" "0" "03382" "FZD4_000084" "g.86662390C>T" "" "{PMID: Jia 2010: 20938005 }" "" "D470N" "" "Germline" "yes" "" "0" "" "" "g.86951348C>T" "" "pathogenic" ""
"0000642977" "11" "90" "11" "86662390" "86662390" "subst" "0" "03382" "FZD4_000084" "g.86662390C>T" "" "{PMID: Jia 2010: 20938005 }" "" "D470N" "" "Germline" "yes" "" "" "" "" "g.86951348C>T" "" "pathogenic" ""
"0000642978" "21" "90" "11" "86662326" "86662326" "subst" "0" "03382" "FZD4_000083" "g.86662326G>T" "" "{PMID: Jia 2010: 20938005 }" "" "D470N" "" "Germline" "yes" "" "0" "" "" "g.86951284G>T" "" "pathogenic" ""
"0000643898" "0" "90" "11" "86665946" "86665946" "subst" "0" "03561" "FZD4_000092" "g.86665946G>A" "1/68 patients, 0/500 individual controls" "" "" "" "" "De novo" "-" "" "0" "" "" "g.86954904G>A" "" "pathogenic (dominant)" ""
"0000644065" "11" "90" "11" "86665923" "86665923" "subst" "0.000513326" "03561" "FZD4_000035" "g.86665923G>A" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "rs80358282" "0" "" "" "g.86954881G>A" "143141" "pathogenic (dominant)" ""
"0000644066" "0" "90" "11" "86665923" "86665923" "subst" "0.000513326" "03561" "FZD4_000035" "g.86665923G>A" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "rs80358282" "" "" "" "g.86954881G>A" "143141" "VUS" ""
"0000644067" "11" "90" "11" "86665904" "86665921" "del" "0" "03561" "FZD4_000091" "g.86665904_86665921del" "2/68 patients , 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954862_86954879del" "" "pathogenic (dominant)" ""
"0000644068" "0" "90" "11" "86665904" "86665921" "del" "0" "03561" "FZD4_000091" "g.86665904_86665921del" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954862_86954879del" "" "pathogenic (dominant)" ""
"0000644069" "21" "90" "11" "86665864" "86665864" "subst" "0" "03561" "FZD4_000090" "g.86665864G>T" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954822G>T" "" "pathogenic (dominant)" ""
"0000644070" "0" "90" "11" "86665864" "86665864" "subst" "0" "03561" "FZD4_000090" "g.86665864G>T" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954822G>T" "" "pathogenic (dominant)" ""
"0000644071" "21" "90" "11" "86663454" "86663454" "subst" "0" "03561" "FZD4_000089" "g.86663454C>A" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952412C>A" "" "pathogenic (dominant)" ""
"0000644072" "0" "90" "11" "86663454" "86663454" "subst" "0" "03561" "FZD4_000089" "g.86663454C>A" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952412C>A" "" "pathogenic (dominant)" ""
"0000644073" "11" "90" "11" "86663120" "86663120" "subst" "0" "03561" "FZD4_000088" "g.86663120C>T" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "rs80358289" "0" "" "" "g.86952078C>T" "" "pathogenic (dominant)" ""
"0000644075" "0" "90" "11" "86663120" "86663120" "subst" "0" "03561" "FZD4_000088" "g.86663120C>T" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "rs80358289" "0" "" "" "g.86952078C>T" "" "pathogenic (dominant)" ""
"0000644076" "11" "90" "11" "86662488" "86662488" "subst" "0" "03561" "FZD4_000087" "g.86662488A>G" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "rs1329697206" "0" "" "" "g.86951446A>G" "" "pathogenic (dominant)" ""
"0000644077" "0" "90" "11" "86662488" "86662488" "subst" "0" "03561" "FZD4_000087" "g.86662488A>G" "2/68 patients, 0/500 individual controls" "{PMID:Xu 2019:31765079}" "" "" "" "Germline" "yes" "rs1329697206" "0" "" "" "g.86951446A>G" "" "pathogenic (dominant)" ""
"0000648412" "1" "30" "11" "86659524" "86659524" "subst" "0" "03575" "FZD4_000093" "g.86659524G>A" "244/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "244 heterozygous; {DB:CLININrs11234890}" "Germline" "" "rs11234890" "0" "" "" "g.86948482G>A" "" "likely benign" ""
"0000648413" "1" "90" "11" "86663032" "86663032" "subst" "0.000528279" "03575" "FZD4_000022" "g.86663032T>C" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs104894223}" "Germline" "" "rs104894223" "0" "" "" "g.86951990T>C" "" "pathogenic" ""
"0000648414" "1" "30" "11" "86663296" "86663296" "subst" "0.0184442" "03575" "FZD4_000042" "g.86663296G>A" "117/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "117 heterozygous; {DB:CLININrs61735303}" "Germline" "" "rs61735303" "0" "" "" "g.86952254G>A" "" "likely benign" ""
"0000669141" "3" "30" "11" "86659524" "86659524" "subst" "0" "03575" "FZD4_000093" "g.86659524G>A" "5/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "5 homozygous; {DB:CLININrs11234890}" "Germline" "" "rs11234890" "0" "" "" "g.86948482G>A" "" "likely benign" ""
"0000669142" "3" "30" "11" "86663296" "86663296" "subst" "0.0184442" "03575" "FZD4_000042" "g.86663296G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs61735303}" "Germline" "" "rs61735303" "0" "" "" "g.86952254G>A" "" "likely benign" ""
"0000685226" "0" "70" "9" "86663449" "86663449" "subst" "0" "00004" "FZD4_000094" "g.86663449A>G" "1/2420 IRD families" "{PMID:Sharon 2019:31456290}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "ACMG"
"0000699915" "0" "50" "11" "86662471" "86662471" "subst" "0" "00006" "FZD4_000167" "g.86662471G>T" "" "{PMID:Heidet 2017:28566479}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" ""
"0000713951" "1" "90" "11" "86662294" "86662300" "del" "0" "00000" "FZD4_000062" "g.86662294_86662300del" "" "{PMID:Zhou 2018:29453956}" "" "1498_1504del (500_502del)" "" "Germline" "" "" "0" "" "" "g.86951252_86951258del" "" "pathogenic (dominant)" ""
"0000732533" "1" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Huang 2017:28867931}" "" "" "" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000732656" "21" "90" "11" "86665851" "86665851" "subst" "0" "00000" "FZD4_000097" "g.86665851G>A" "" "{PMID:Iarossi 2017:28758032}" "" "" "" "Germline" "" "" "0" "" "" "g.86954809G>A" "" "pathogenic" ""
"0000732657" "11" "90" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Iarossi 2017:28758032}" "" "" "" "Germline" "" "" "0" "" "" "g.86952214C>T" "" "pathogenic" ""
"0000732658" "21" "70" "11" "86663187" "86663187" "subst" "0" "00000" "FZD4_000095" "g.86663187C>A" "" "{PMID:Iarossi 2017:28758032}" "" "" "" "Germline" "" "" "0" "" "" "g.86952145C>A" "" "likely pathogenic" ""
"0000735799" "0" "90" "11" "86663449" "86663449" "subst" "4.06712E-6" "00006" "FZD4_000094" "g.86663449A>G" "" "{PMID:Schatz 2017:28211206}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000735801" "11" "90" "11" "86663449" "86663449" "subst" "4.06712E-6" "00006" "FZD4_000094" "g.86663449A>G" "" "{PMID:Schatz 2017:28211206}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000735803" "11" "90" "11" "86663449" "86663449" "subst" "4.06712E-6" "00006" "FZD4_000094" "g.86663449A>G" "" "{PMID:Schatz 2017:28211206}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000760000" "0" "50" "11" "86663442" "86663442" "subst" "0" "00000" "FZD4_000102" "g.86663442C>A" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.86952400C>A" "" "VUS" ""
"0000760052" "0" "50" "11" "86666010" "86666010" "subst" "0.000284438" "00000" "FZD4_000012" "g.86666010C>G" "" "{PMID:Tiwari 2016:27353947}" "" "" "" "Germline" "" "" "0" "" "" "g.86954968C>G" "" "VUS" ""
"0000760108" "0" "90" "11" "86663457" "86663457" "subst" "0" "00000" "FZD4_000103" "g.86663457A>C" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86952415A>C" "" "pathogenic" ""
"0000760109" "0" "90" "11" "86662407" "86662407" "dup" "0" "00000" "FZD4_000099" "g.86662407dup" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86951365dup" "" "pathogenic" ""
"0000760110" "11" "90" "11" "86662185" "86662185" "subst" "0" "00000" "FZD4_000098" "g.86662185T>G" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86951143T>G" "" "pathogenic" ""
"0000760111" "0" "90" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Musada 2016:27316669}" "" "1286-1290delAGTTA" "" "Germline" "" "" "0" "" "" "g.86951467_86951471del" "" "pathogenic" ""
"0000760112" "0" "90" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Musada 2016:27316669}" "" "1286-1290delAGTTA" "" "Germline" "" "" "0" "" "" "g.86951467_86951471del" "" "pathogenic" ""
"0000760113" "0" "90" "11" "86663328" "86663328" "subst" "0" "00000" "FZD4_000101" "g.86663328A>G" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86952286A>G" "" "pathogenic" ""
"0000760114" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000760115" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000760116" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Musada 2016:27316669}" "" "" "" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000760125" "21" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Musada 2016:27316669}" "" "1282_1285delGACA/1286-1290delAGTTA" "" "Germline" "" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000760180" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Ellingford 2016:27208204}" "" "1282_1285delGACA" "" "Germline" "" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000760181" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000760435" "0" "50" "11" "86662837" "86662837" "subst" "0" "00000" "FZD4_000100" "g.86662837C>T" "" "{PMID:Ellingford 2016:27208204}" "" "" "" "Germline" "" "" "0" "" "" "g.86951795C>T" "" "VUS" ""
"0000764882" "1" "70" "11" "86663134" "86663134" "subst" "0" "00000" "FZD4_000104" "g.86663134A>G" "" "{PMID:Weisschuh 2016:26766544}" "" "664A>G" "" "Germline" "" "" "0" "" "" "g.86952092A>G" "" "likely pathogenic (dominant)" ""
"0000765439" "1" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "1/596 chromosomes" "{PMID:Sun 2015:26747767}" "" "" "not in 624 control chromosomes" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000765808" "0" "70" "11" "86663449" "86663449" "subst" "4.06712E-6" "00000" "FZD4_000094" "g.86663449A>G" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.86952407A>G" "" "likely pathogenic" ""
"0000765997" "1" "70" "11" "86665968" "86665968" "subst" "0" "00000" "FZD4_000110" "g.86665968G>A" "" "{PMID:Seo 2015:26244290}" "" "" "" "Germline" "" "" "0" "" "" "g.86954926G>A" "" "likely pathogenic (dominant)" ""
"0000765998" "1" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Seo 2015:26244290}" "" "" "not in 358 control alleles" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic (dominant)" ""
"0000765999" "1" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Seo 2015:26244290}" "" "" "not in 358 control alleles" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic (dominant)" ""
"0000766000" "1" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Seo 2015:26244290}" "" "" "not in 358 control alleles" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic (dominant)" ""
"0000766001" "1" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Seo 2015:26244290}" "" "" "not in 358 control alleles" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic (dominant)" ""
"0000766002" "1" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Seo 2015:26244290}" "" "" "not in 358 control alleles" "Germline" "" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic (dominant)" ""
"0000766003" "1" "70" "11" "86663342" "86663342" "subst" "0" "00000" "FZD4_000109" "g.86663342G>C" "" "{PMID:Seo 2015:26244290}" "" "" "not in 362 control alleles" "Germline" "" "" "0" "" "" "g.86952300G>C" "" "likely pathogenic (dominant)" ""
"0000766004" "1" "70" "11" "86663328" "86663328" "subst" "0" "00000" "FZD4_000101" "g.86663328A>G" "" "{PMID:Seo 2015:26244290}" "" "" "not in 368 control alleles" "Germline" "yes" "" "0" "" "" "g.86952286A>G" "" "likely pathogenic (dominant)" ""
"0000766005" "1" "70" "11" "86663328" "86663328" "subst" "0" "00000" "FZD4_000101" "g.86663328A>G" "" "{PMID:Seo 2015:26244290}" "" "" "not in 368 control alleles" "Germline" "yes" "" "0" "" "" "g.86952286A>G" "" "likely pathogenic (dominant)" ""
"0000766006" "1" "70" "11" "86663260" "86663261" "del" "0" "00000" "FZD4_000108" "g.86663260_86663261del" "" "{PMID:Seo 2015:26244290}" "" "539_540delAG" "" "Germline" "" "" "0" "" "" "g.86952218_86952219del" "" "likely pathogenic (dominant)" ""
"0000766007" "1" "70" "11" "86663122" "86663122" "subst" "0" "00000" "FZD4_000106" "g.86663122A>T" "" "{PMID:Seo 2015:26244290}" "" "" "not in 358 control alleles" "Germline" "" "" "0" "" "" "g.86952080A>T" "" "likely pathogenic (dominant)" ""
"0000766008" "1" "70" "11" "86662588" "86662589" "del" "0" "00000" "FZD4_000105" "g.86662588_86662589del" "" "{PMID:Seo 2015:26244290}" "" "1210_1211delTT" "" "Germline" "" "" "0" "" "" "g.86951546_86951547del" "" "likely pathogenic (dominant)" ""
"0000766009" "1" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Seo 2015:26244290}" "" "1282_1285delGACA" "" "Germline" "" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic (dominant)" ""
"0000766010" "1" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Seo 2015:26244290}" "" "1282_1285delGACA" "" "Germline" "" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic (dominant)" ""
"0000766011" "1" "70" "11" "86656717" "86666440" "del" "0" "00000" "FZD4_000000" "g.(?_86656717)_(86666440_?)del" "" "{PMID:Seo 2015:26244290}" "" "whole gene deletion" "" "Germline" "" "" "0" "" "" "g.(?_86945675)_(86955398_?)del" "" "likely pathogenic (dominant)" ""
"0000766017" "1" "30" "11" "86663124" "86663147" "dup" "0" "00000" "FZD4_000107" "g.86663124_86663147dup" "1/51 patients" "{PMID:Seo 2015:26244290}" "" "653_676dup24" "not in 360 control alleles" "Germline" "" "" "0" "" "" "g.86952082_86952105dup" "" "likely benign" ""
"0000785466" "0" "90" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Salvo 2015:25711638}" "" "" "yes" "Germline" "" "rs80358303" "0" "" "" "g.86951256_86951257del" "" "pathogenic" ""
"0000785467" "0" "90" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "rs80358303" "0" "" "" "g.86951256_86951257del" "" "pathogenic" ""
"0000785468" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Salvo 2015:25711638}" "" "" "yes" "Germline" "" "rs80358295" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000785469" "0" "90" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "rs80358286" "0" "" "" "g.86952287T>C" "" "pathogenic" ""
"0000785470" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "rs80358284" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000785471" "0" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "rs80358288" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000785472" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "rs80358284" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000785490" "0" "90" "11" "86663135" "86663136" "ins" "0" "00000" "FZD4_000113" "g.86663135_86663136insT" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86952093_86952094insT" "" "pathogenic" ""
"0000785491" "0" "90" "11" "86662293" "86662294" "del" "0" "00000" "FZD4_000112" "g.86662293_86662294del" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86951251_86951252del" "" "pathogenic" ""
"0000785492" "0" "90" "11" "86662310" "86662310" "subst" "0" "00000" "FZD4_000007" "g.86662310C>T" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86951268C>T" "" "pathogenic" ""
"0000785493" "0" "90" "11" "86666004" "86666004" "subst" "0" "00000" "FZD4_000114" "g.86666004C>A" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86954962C>A" "" "pathogenic" ""
"0000785494" "0" "90" "11" "86666010" "86666010" "subst" "0" "00000" "FZD4_000115" "g.86666010C>A" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86954968C>A" "" "pathogenic" ""
"0000785495" "0" "90" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86954952C>T" "" "pathogenic" ""
"0000785511" "0" "90" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Salvo 2015:25711638}" "" "" "" "Germline" "" "" "0" "" "" "g.86951167C>T" "" "pathogenic" ""
"0000786522" "10" "90" "11" "86663510" "86663510" "del" "0" "00006" "FZD4_000116" "g.86663510del" "" "{PMID:Stiegel 2013:25390515}" "" "288delC" "" "Germline" "" "" "0" "" "" "g.86952468del" "" "pathogenic" ""
"0000788408" "0" "50" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Katagiri 2014:25268133}" "" "G1589A" "" "Germline" "" "rs201256460" "0" "" "" "g.86951167C>T" "" "VUS" ""
"0000790147" "0" "70" "11" "86662841" "86662841" "subst" "0" "00000" "FZD4_000004" "g.86662841C>T" "" "{PMID:Boonstra 2009:1932484}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790148" "0" "70" "11" "86662310" "86662310" "subst" "0" "00000" "FZD4_000007" "g.86662310C>T" "" "{PMID:Boonstra 2009:1932484}" "" "1448G>A (p.Trp496)" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790149" "0" "70" "11" "86662465" "86662465" "subst" "0" "00000" "FZD4_000027" "g.86662465T>G" "" "{PMID:Boonstra 2009:1932484}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000790150" "0" "70" "11" "86663130" "86663130" "subst" "0" "00000" "FZD4_000021" "g.86663130A>T" "" "{PMID:Boonstra 2009:1932484}" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000793846" "0" "70" "11" "86662292" "86662298" "del" "0" "00000" "FZD4_000062" "g.86662292_86662298del" "" "{PMID:Zhou-2011:21677794}" "" "c.1498_1504del" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794247" "0" "70" "11" "86665968" "86665968" "subst" "0" "03508" "FZD4_000110" "g.86665968G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "pathogenic" "ACMG"
"0000794937" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "2/49 families" "{PMID:Yang-2012:23077402}" "" "c.313A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794938" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "2/49 families" "{PMID:Yang-2012:23077402}" "" "c.313A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794939" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "2/49 families" "{PMID:Yang-2012:23077402}" "" "c.313A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794940" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "2/49 families" "{PMID:Yang-2012:23077402}" "" "c.313A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794941" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "2/49 families" "{PMID:Yang-2012:23077402}" "" "c.313A>G" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794942" "0" "70" "11" "86663167" "86663167" "subst" "2.03575E-5" "00000" "FZD4_000119" "g.86663167A>G" "1/49 families; 0/96 controls" "{PMID:Yang-2012:23077402}" "" "c.631T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794943" "0" "70" "11" "86662513" "86662516" "del" "0" "00000" "FZD4_000118" "g.86662513_86662516delTGTC" "1/49 families; 0/96 controls" "{PMID:Yang-2012:23077402}" "" "c.1282_1285delGACA" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794944" "0" "70" "11" "86662316" "86662316" "subst" "0" "00000" "FZD4_000117" "g.86662316C>T" "1/49 families; 0/96 controls" "{PMID:Yang-2012:23077402}" "" "c.1482G>A" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794945" "0" "70" "11" "86662316" "86662316" "subst" "0" "00000" "FZD4_000117" "g.86662316C>T" "1/49 families; 0/96 controls" "{PMID:Yang-2012:23077402}" "" "c.1482G>A" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794946" "0" "70" "11" "86662316" "86662316" "subst" "0" "00000" "FZD4_000117" "g.86662316C>T" "1/49 families; 0/96 controls" "{PMID:Yang-2012:23077402}" "" "c.1482G>A" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794947" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "1/49 families" "{PMID:Yang-2012:23077402}" "" "c.1513C>T" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000794948" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "1/49 families" "{PMID:Yang-2012:23077402}" "" "c.1513C>T" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" ""
"0000795589" "11" "70" "11" "86662335" "86662335" "subst" "0" "00000" "FZD4_000028" "g.86662335C>T" "" "{PMID:Surl 2020:32165824}" "" "c.1463G>A, p.G488D" "" "Germline" "yes" "" "0" "" "" "g.86951293C>T" "" "likely pathogenic" "ACMG"
"0000795590" "21" "50" "11" "86663322" "86663322" "subst" "0" "00000" "FZD4_000121" "g.86663322A>G" "" "{PMID:Surl 2020:32165824}" "" "c.476T>C, p.M159T" "" "Germline" "yes" "" "0" "" "" "g.86952280A>G" "" "VUS" "ACMG"
"0000795593" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Surl 2020:32165824}" "" "c.1282_1285del, p.D428fs" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000795594" "21" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Surl 2020:32165824}" "" "c.313A>G, p.M105V" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" "ACMG"
"0000795595" "11" "50" "11" "86665946" "86665946" "subst" "0" "00000" "FZD4_000092" "g.86665946G>A" "" "{PMID:Surl 2020:32165824}" "" "c.182C>T, p.T61I" "" "Germline" "yes" "" "0" "" "" "g.86954904G>A" "" "VUS" "ACMG"
"0000795596" "21" "90" "11" "86662316" "86662316" "subst" "0" "00000" "FZD4_000117" "g.86662316C>T" "" "{PMID:Surl 2020:32165824}" "" "c.1482 G>A, p.W494X" "" "Germline" "yes" "" "0" "" "" "g.86951274C>T" "" "pathogenic" "ACMG"
"0000795597" "21" "50" "11" "86662720" "86662720" "subst" "0" "00000" "FZD4_000120" "g.86662720T>A" "" "{PMID:Surl 2020:32165824}" "" "c.1078A>T, p.1360F" "" "Germline" "yes" "" "0" "" "" "g.86951678T>A" "" "VUS" "ACMG"
"0000795598" "11" "50" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Surl 2020:32165824}" "" "c.1589G>A, p.G530E" "" "Germline" "yes" "" "0" "" "" "g.86951167C>T" "" "VUS" "ACMG"
"0000795599" "21" "50" "11" "86665845" "86665845" "subst" "0" "00000" "FZD4_000123" "g.86665845G>C" "" "{PMID:Surl 2020:32165824}" "" "c.283C>G, p.Q95E" "" "Germline" "yes" "" "0" "" "" "g.86954803G>C" "" "VUS" "ACMG"
"0000795603" "11" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Surl 2020:32165824}" "" "c.205C>T, p.H69Y" "" "Germline" "yes" "" "0" "" "" "g.86954881G>A" "" "VUS" "ACMG"
"0000796063" "0" "90" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Kondo-2013:23441120}" "" "c.205C>T" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796064" "0" "90" "11" "86663418" "86663418" "subst" "8.12519E-6" "00000" "FZD4_000122" "g.86663418C>T" "" "{PMID:Kondo-2013:23441120}" "" "c.380G>A" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796065" "0" "90" "11" "86663167" "86663167" "subst" "2.03575E-5" "00000" "FZD4_000119" "g.86663167A>G" "" "{PMID:Kondo-2013:23441120}" "" "c.631T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000796066" "0" "90" "11" "86663167" "86663167" "subst" "2.03575E-5" "00000" "FZD4_000119" "g.86663167A>G" "" "{PMID:Kondo-2013:23441120}" "" "c.631T>C" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000797253" "0" "50" "11" "86665946" "86665946" "subst" "0" "00000" "FZD4_000092" "g.86665946G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "De novo" "?" "" "0" "" "" "g.86954904G>A" "" "VUS" ""
"0000797254" "0" "90" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "De novo" "?" "" "0" "" "" "g.86952214C>T" "" "pathogenic" ""
"0000797255" "0" "50" "11" "86663457" "86663457" "subst" "0" "00000" "FZD4_000138" "g.86663457A>T" "" "{PMID:Li 2018:30452590}" "" "" "" "De novo" "?" "" "0" "" "" "g.86952415A>T" "" "VUS" ""
"0000797256" "0" "50" "11" "86662293" "86662294" "ins" "0" "00000" "FZD4_000127" "g.86662293_86662294insTCCAACA" "" "{PMID:Li 2018:30452590}" "" "" "" "De novo" "?" "" "0" "" "" "g.86951251_86951252insTCCAACA" "" "VUS" ""
"0000797257" "21" "10" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86951167C>T" "" "benign" ""
"0000797258" "11" "10" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86951167C>T" "" "benign" ""
"0000797259" "11" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000797260" "21" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000797261" "21" "50" "11" "86666089" "86666098" "del" "0" "00000" "FZD4_000050" "g.86666089_86666098del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86955047_86955056del" "" "VUS" ""
"0000797262" "11" "10" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86951167C>T" "" "benign" ""
"0000797263" "21" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000797264" "11" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000797265" "21" "50" "11" "86663320" "86663320" "subst" "0" "00000" "FZD4_000136" "g.86663320C>G" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86952278C>G" "" "VUS" ""
"0000797266" "21" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000797267" "21" "10" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "no" "" "0" "" "" "g.86951167C>T" "" "benign" ""
"0000797268" "21" "10" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "?" "" "0" "" "" "g.86951167C>T" "" "benign" ""
"0000797269" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797270" "21" "10" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "?" "" "0" "" "" "g.86951167C>T" "" "benign" ""
"0000797271" "11" "50" "11" "86665926" "86665926" "del" "0" "00000" "FZD4_000141" "g.86665926del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "?" "" "0" "" "" "g.86954884del" "" "VUS" ""
"0000797272" "11" "50" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000143" "g.86665994C>G" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "?" "" "0" "" "" "g.86954952C>G" "" "VUS" ""
"0000797273" "21" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000797274" "21" "90" "11" "86663052" "86663052" "dup" "0" "00000" "FZD4_000133" "g.86663052dup" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952010dup" "" "pathogenic" ""
"0000797275" "21" "90" "11" "86662788" "86662788" "dup" "0" "00000" "FZD4_000129" "g.86662788dup" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951746dup" "" "pathogenic" ""
"0000797276" "21" "90" "11" "86665970" "86665970" "del" "0" "00000" "FZD4_000142" "g.86665970del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954928del" "" "pathogenic" ""
"0000797277" "21" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000797278" "21" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797279" "21" "90" "11" "86663097" "86663097" "subst" "0" "00000" "FZD4_000134" "g.86663097G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952055G>A" "" "pathogenic" ""
"0000797280" "11" "90" "11" "86662473" "86662473" "subst" "0" "00000" "FZD4_000055" "g.86662473A>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951431A>T" "" "pathogenic" ""
"0000797281" "21" "90" "11" "86663041" "86663041" "subst" "1.21962E-5" "00000" "FZD4_000041" "g.86663041G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951999G>A" "" "pathogenic" ""
"0000797282" "11" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000797283" "21" "90" "11" "86665904" "86665904" "subst" "0" "00000" "FZD4_000140" "g.86665904G>C" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954862G>C" "" "pathogenic" ""
"0000797284" "21" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000797285" "21" "90" "11" "86662310" "86662310" "subst" "0" "00000" "FZD4_000007" "g.86662310C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951268C>T" "" "pathogenic" ""
"0000797286" "21" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" ""
"0000797287" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797288" "21" "90" "11" "86663481" "86663481" "subst" "0" "00000" "FZD4_000139" "g.86663481C>G" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952439C>G" "" "pathogenic" ""
"0000797289" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797290" "11" "90" "11" "86662867" "86662867" "dup" "0" "00000" "FZD4_000132" "g.86662867dup" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951825dup" "" "pathogenic" ""
"0000797291" "21" "90" "11" "86665904" "86665921" "del" "0" "00000" "FZD4_000091" "g.86665904_86665921del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954862_86954879del" "" "pathogenic" ""
"0000797292" "21" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797293" "11" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000797294" "11" "90" "11" "86662893" "86662893" "subst" "0" "00000" "FZD4_000054" "g.86662893C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951851C>T" "" "pathogenic" ""
"0000797295" "11" "90" "11" "86662865" "86662884" "del" "0" "00000" "FZD4_000131" "g.86662865_86662884del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951823_86951842del" "" "pathogenic" ""
"0000797296" "11" "90" "11" "86662609" "86662613" "del" "0" "00000" "FZD4_000053" "g.86662609_86662613del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951567_86951571del" "" "pathogenic" ""
"0000797297" "11" "90" "11" "86662488" "86662488" "subst" "0" "00000" "FZD4_000087" "g.86662488A>G" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951446A>G" "" "pathogenic" ""
"0000797298" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797299" "21" "90" "11" "86663416" "86663416" "subst" "0" "00000" "FZD4_000137" "g.86663416A>G" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952374A>G" "" "pathogenic" ""
"0000797300" "11" "90" "11" "86665904" "86665921" "del" "0" "00000" "FZD4_000091" "g.86665904_86665921del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86954862_86954879del" "" "pathogenic" ""
"0000797301" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000797302" "11" "90" "11" "86663157" "86663178" "del" "0" "00000" "FZD4_000135" "g.86663157_86663178del" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952115_86952136del" "" "pathogenic" ""
"0000797303" "21" "90" "11" "86663398" "86663398" "subst" "0" "00000" "FZD4_000059" "g.86663398C>A" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86952356C>A" "" "pathogenic" ""
"0000797304" "11" "90" "11" "86662817" "86662817" "subst" "0" "00000" "FZD4_000130" "g.86662817C>T" "" "{PMID:Li 2018:30452590}" "" "" "" "Germline" "yes" "" "0" "" "" "g.86951775C>T" "" "pathogenic" ""
"0000798121" "21" "70" "11" "86662788" "86662788" "dup" "0" "00000" "FZD4_000129" "g.86662788dup" "" "{PMID:Liu 2019:30474316}" "" "c.1010dupA" "" "Germline" "yes" "" "0" "" "" "g.86951746dup" "" "likely pathogenic" ""
"0000798122" "0" "70" "11" "86662788" "86662788" "dup" "0" "00000" "FZD4_000129" "g.86662788dup" "" "{PMID:Liu 2019:30474316}" "" "c.1010dupA" "" "Germline" "yes" "" "0" "" "" "g.86951746dup" "" "likely pathogenic" ""
"0000798123" "21" "70" "11" "86662788" "86662788" "dup" "0" "00000" "FZD4_000129" "g.86662788dup" "" "{PMID:Liu 2019:30474316}" "" "c.1010dupA" "" "Germline" "yes" "" "0" "" "" "g.86951746dup" "" "likely pathogenic" ""
"0000798390" "0" "90" "11" "86662548" "86662548" "subst" "0" "00000" "FZD4_000128" "g.86662548C>G" "2/56 patients; 0/150 controls" "{PMID:Qin-2005:15981244}" "" "c.1250G>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798402" "0" "90" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "2/56 patients; 2/150 controls" "{PMID:Qin-2005:15981244}" "" "c.205C>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798403" "0" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "1/56 patients; 0/150 controls" "{PMID:Qin-2005:15981244}" "" "c.313A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798404" "0" "90" "11" "86662841" "86662841" "subst" "0" "00000" "FZD4_000004" "g.86662841C>T" "1/56 patients; 0/150 controls" "{PMID:Qin-2005:15981244}" "" "c.957G>A" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798405" "0" "90" "11" "86662793" "86662793" "subst" "0" "00000" "FZD4_000023" "g.86662793C>G" "1/56 patients; 0/150 controls" "{PMID:Qin-2005:15981244}" "" "c.1005G>C" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798406" "0" "90" "11" "86662774" "86662774" "subst" "0" "00000" "FZD4_000024" "g.86662774T>C" "1/56 patients; 0/150 controls" "{PMID:Qin-2005:15981244}" "" "c.1024A>G" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000798407" "0" "90" "11" "86662335" "86662335" "subst" "0" "00000" "FZD4_000028" "g.86662335C>T" "1/56 patients; 0/150 controls" "{PMID:Qin-2005:15981244}" "" "c.1463G>A" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000805458" "0" "70" "11" "86662488" "86662488" "del" "0" "02330" "FZD4_000144" "g.86662488del" "" "" "" "FZD4(NM_012193.4):c.1311delT (p.I437Mfs*15)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000811541" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1282_1285delGACA, Asp428Serfs" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000811542" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1282_1285delGACA, Asp428Serfs" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000811543" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1282_1285delGACA, Asp428Serfs" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000811544" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1282_1285delGACA, Asp428Serfs" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000811545" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1282_1285delGACA, Asp428Serfs" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000811546" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1282_1285delGACA, Asp428Serfs" "" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000811547" "0" "70" "11" "86662324" "86662324" "del" "0" "00000" "FZD4_000056" "g.86662324del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1475delG, Gly492Alafs" "" "Germline" "?" "" "0" "" "" "g.86951282del" "" "likely pathogenic" ""
"0000811548" "0" "70" "11" "86662324" "86662324" "del" "0" "00000" "FZD4_000056" "g.86662324del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1475delG, Gly492Alafs" "" "Germline" "?" "" "0" "" "" "g.86951282del" "" "likely pathogenic" ""
"0000811549" "0" "70" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Wang 2019:31299183}" "" "FZD4 134G?>?A, Cys45Tyr" "" "Germline" "?" "" "0" "" "" "g.86954952C>T" "" "likely pathogenic" ""
"0000811550" "0" "70" "11" "86666021" "86666021" "subst" "0" "00000" "FZD4_000011" "g.86666021C>T" "" "{PMID:Wang 2019:31299183}" "" "FZD4 107G?>?A, Gly36Asp" "" "Germline" "?" "" "0" "" "" "g.86954979C>T" "" "likely pathogenic" ""
"0000811551" "0" "70" "11" "86665905" "86665905" "subst" "0" "00000" "FZD4_000072" "g.86665905C>T" "" "{PMID:Wang 2019:31299183}" "" "FZD4 223G?>?A, Ala75Thr" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954863C>T" "" "likely pathogenic" ""
"0000811552" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1589G?>?A, G530E" "" "Germline" "?" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000811553" "0" "70" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Wang 2019:31299183}" "" "FZD4 205C?>?T, His69Tyr" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954881G>A" "" "likely pathogenic" ""
"0000811554" "0" "70" "11" "86663314" "86663314" "del" "0" "00000" "FZD4_000150" "g.86663314del" "" "{PMID:Wang 2019:31299183}" "" "FZD4 485del, Pro162fs" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952272del" "" "likely pathogenic" ""
"0000811555" "0" "70" "11" "86665990" "86665990" "dup" "0" "00000" "FZD4_000156" "g.86665990dup" "" "{PMID:Wang 2019:31299183}" "" "FZD4 141dup, Ile48fs" "" "Germline" "?" "" "0" "" "" "g.86954948dup" "" "likely pathogenic" ""
"0000811556" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Wang 2019:31299183}" "" "FZD4 313A?>?G, Met105Val" "" "Germline" "?" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000811557" "0" "70" "11" "86663342" "86663342" "subst" "0" "00000" "FZD4_000151" "g.86663342G>T" "" "{PMID:Wang 2019:31299183}" "" "FZD4 456C?>?A, Asn152Lys" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952300G>T" "" "likely pathogenic" ""
"0000811558" "0" "70" "11" "86662799" "86662802" "dup" "0" "00000" "FZD4_000146" "g.86662799_86662802dup" "" "{PMID:Wang 2019:31299183}" "" "FZD4 1000-1001insCTCA, Lys334fs" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951757_86951760dup" "" "likely pathogenic" ""
"0000811681" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Chen 2019:31237656}" "" "1996G>A, Asp666Asn" "" "Germline" "?" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000811682" "21" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Chen 2019:31237656}" "" "1589G>A, Gly530Glu" "" "Germline" "yes" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000811683" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Chen 2019:31237656}" "" "1589G>A, Gly530Glu" "" "Germline" "yes" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000811684" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Chen 2019:31237656}" "" "1589G>A, Gly530Glu" "" "Germline" "?" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000811685" "11" "70" "11" "86663082" "86663082" "subst" "0" "00000" "FZD4_000147" "g.86663082A>G" "" "{PMID:Chen 2019:31237656}" "" "313A>G, Met105Val" "" "Germline" "yes" "" "0" "" "" "g.86952040A>G" "" "likely pathogenic" ""
"0000811686" "0" "70" "11" "86663082" "86663082" "subst" "0" "00000" "FZD4_000147" "g.86663082A>G" "" "{PMID:Chen 2019:31237656}" "" "313A>G, Met105Val" "" "Germline" "yes" "" "0" "" "" "g.86952040A>G" "" "likely pathogenic" ""
"0000811785" "0" "70" "11" "86665904" "86665921" "del" "0" "00000" "FZD4_000091" "g.86665904_86665921del" "" "{PMID:Tian 2019:31169861}" "" "c.217-234del;p.73-78dela" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954862_86954879del" "" "likely pathogenic" ""
"0000811786" "0" "70" "11" "86663052" "86663052" "dup" "0" "00000" "FZD4_000133" "g.86663052dup" "" "{PMID:Tian 2019:31169861}" "" "c.747dupC;p.Y250fsa" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952010dup" "" "likely pathogenic" ""
"0000811787" "0" "70" "11" "86663112" "86663112" "subst" "0" "00000" "FZD4_000148" "g.86663112A>G" "" "{PMID:Tian 2019:31169861}" "" "c.686T>C; p.L229Pa" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952070A>G" "" "likely pathogenic" ""
"0000811788" "0" "70" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Tian 2019:31169861}" "" "c.C205T;p.H69Y" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954881G>A" "" "likely pathogenic" ""
"0000812532" "0" "70" "11" "86663457" "86663457" "subst" "0" "00000" "FZD4_000015" "g.86663457A>G" "" "{PMID:Wang 2019:31106028}" "" "c.341A>G, p.(Ile114Thr)" "error in annotation: NM_012193.3(FZD4):c.341A>G instead of T>C, heterozygous" "Germline" "yes" "" "0" "" "" "g.86952415A>G" "" "likely pathogenic" ""
"0000812545" "0" "70" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Wang 2019:31106028}" "" "c.134C>T, p.(Cys45Tyr)" "error in annotation: NM_012193.3(FZD4):c.134C>T instead of G>A, heterozygous" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "likely pathogenic" ""
"0000812546" "0" "90" "11" "86662320" "86662321" "dup" "0" "00000" "FZD4_000145" "g.86662320_86662321dup" "" "{PMID:Wang 2019:31106028}" "" "c.1477_1478dup, p.(Met493Ilefs*21)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86951278_86951279dup" "" "pathogenic" ""
"0000812553" "0" "70" "11" "86663473" "86663475" "del" "0" "00000" "FZD4_000153" "g.86663473_86663475del" "" "{PMID:Wang 2019:31106028}" "" "c.326_328del, p.(Lys109del)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952431_86952433del" "" "likely pathogenic" ""
"0000812581" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Wang 2019:31106028}" "" "c.205G>A, p.(His69Tyr)" "error in annotation: NM_012193.3(FZD4):c.205G>A instead of C>T, heterozygous" "Germline" "yes" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000812610" "0" "70" "11" "86663041" "86663041" "subst" "1.21962E-5" "00000" "FZD4_000041" "g.86663041G>A" "" "{PMID:Wang 2019:31106028}" "" "c.757G>A, p.(Arg253Cys)" "error in annotation: NM_012193.3(FZD4):c.757G>A instead of C>T, heterozygous" "Germline" "yes" "" "0" "" "" "g.86951999G>A" "" "likely pathogenic" ""
"0000812621" "0" "90" "11" "86663290" "86663290" "dup" "0" "00000" "FZD4_000149" "g.86663290dup" "" "{PMID:Wang 2019:31106028}" "" "c.509dup, p.(His171Serfs*19)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952248dup" "" "pathogenic" ""
"0000812650" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Wang 2019:31106028}" "" "c.1589G>A, p.(Gly530Glu)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000812656" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Wang 2019:31106028}" "" "c.313T>C, p.(Met105Val)" "error in annotation: NM_012193.3(FZD4):c.313T>C instead of A>G, heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000812689" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Wang 2019:31106028}" "" "c.1589C>T, p.(Gly530Glu)" "error in annotation: NM_012193.3(FZD4):c.1589C>T instead of G>A, heterozygous" "Germline" "?" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000812691" "0" "90" "11" "86666077" "86666078" "ins" "0" "00000" "FZD4_000157" "g.86666077_86666078insCGCCCCCGGG" "" "{PMID:Wang 2019:31106028}" "" "c.51_52insCCGGGGGCGC, p.(Gly18Profs*115)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86955035_86955036insCGCCCCCGGG" "" "pathogenic" ""
"0000812692" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31106028}" "" "c.1282_1285del, p.(Asp428Serfs*2)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000812693" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2019:31106028}" "" "c.1282_1285del, p.(Asp428Serfs*2)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" ""
"0000812712" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Wang 2019:31106028}" "" "c.313T>C, p.(Met105Val)" "error in annotation: NM_012193.3(FZD4):c.313T>C instead of A>G, heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000812716" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Wang 2019:31106028}" "" "c.1589C>T, p.(Gly530Glu)" "error in annotation: NM_012193.3(FZD4):c.1589C>T instead of G>A, heterozygous" "Germline" "yes" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000812777" "0" "90" "11" "86665986" "86665986" "dup" "0" "00000" "FZD4_000155" "g.86665986dup" "" "{PMID:Wang 2019:31106028}" "" "c.142dup, p.(Ile48Asnfs*82)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86954944dup" "" "pathogenic" ""
"0000812782" "0" "90" "11" "86663418" "86663418" "del" "0" "00000" "FZD4_000152" "g.86663418del" "" "{PMID:Wang 2019:31106028}" "" "c.380del, p.(Arg127Profs*6)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952376del" "" "pathogenic" ""
"0000812788" "0" "70" "11" "86663482" "86663482" "subst" "0" "00000" "FZD4_000154" "g.86663482A>G" "" "{PMID:Wang 2019:31106028}" "" "c.316A>G, p.(Cys106Arg)" "error in annotation: NM_012193.3(FZD4):c.316A>G instead of T>C, heterozygous" "De novo" "yes" "" "0" "" "" "g.86952440A>G" "" "likely pathogenic" ""
"0000812798" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Wang 2019:31106028}" "" "c.313A>G, p.(Met105Val)" "error in annotation: NM_012193.3(FZD4):c.313T>C instead of A>G," "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000812829" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Wang 2019:31106028}" "" "c.1589C>T, p.(Gly530Glu)" "error in annotation: NM_012193.3(FZD4):c.1589C>T intead of G>A, heterozygous" "Germline" "yes" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000813886" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Jiman 2020:31836858}" "" "FZD4;NM_012193.3;c.[313A>G];[313=];p.[(Met105Val)];[(Met105=)](causeofADFEVR)" "heterozygous" "Unknown" "?" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000814872" "1" "70" "11" "86662746" "86662766" "del" "0" "00000" "FZD4_000067" "g.86662746_86662766del" "" "{PMID:Chen 2020:31987760}" "" "1034_1054delCTTATTTCCACATTGCAGCCT, Ser345Trpfs" "error in annotation: c.1034_1054del is an in-frame and not a frameshift deletion causing p.(Ser345_Ala351del) and not p.(Ser345fs)" "Germline" "yes" "" "0" "" "" "g.86951704_86951724del" "" "likely pathogenic" ""
"0000814873" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Chen 2020:31987760}" "" "1282_1285delGACA, Asp428Serfs*2" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000814874" "0" "70" "11" "86665995" "86665995" "subst" "0" "00000" "FZD4_000075" "g.86665995A>G" "" "{PMID:Chen 2020:31987760}" "" "133T>C, Cys45Arg" "" "Germline" "yes" "" "0" "" "" "g.86954953A>G" "" "likely pathogenic" ""
"0000814875" "0" "70" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Chen 2020:31987760}" "" "134G>A, Cys45Tyr" "" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "likely pathogenic" ""
"0000814876" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Chen 2020:31987760}" "" "1282_1285delGACA, Asp428Serfs*2" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000814877" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Chen 2020:31987760}" "" "1282_1285delGACA, Asp428Serfs*2" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000814878" "0" "70" "11" "86665995" "86665995" "subst" "0" "00000" "FZD4_000076" "g.86665995A>T" "" "{PMID:Chen 2020:31987760}" "" "133T>A, Cys45Ser" "" "Germline" "yes" "" "0" "" "" "g.86954953A>T" "" "likely pathogenic" ""
"0000814879" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Chen 2020:31987760}" "" "1282_1285delGACA, Asp428Serfs*2" "" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000814880" "0" "70" "11" "86662799" "86662802" "dup" "0" "00000" "FZD4_000146" "g.86662799_86662802dup" "" "{PMID:Chen 2020:31987760}" "" "1000_1001insCTCA, Lys334fs" "error in annotation: c.1000_1001insCTCA mapped to c.997_1000dup" "Germline" "yes" "" "0" "" "" "g.86951757_86951760dup" "" "likely pathogenic" ""
"0000814881" "0" "70" "11" "86663041" "86663041" "subst" "1.21962E-5" "00000" "FZD4_000041" "g.86663041G>A" "" "{PMID:Chen 2020:31987760}" "" "757C>T, Arg253Cys" "" "Germline" "yes" "" "0" "" "" "g.86951999G>A" "" "likely pathogenic" ""
"0000814882" "0" "70" "11" "86666010" "86666010" "subst" "0" "00000" "FZD4_000115" "g.86666010C>A" "" "{PMID:Chen 2020:31987760}" "" "118G>T, Glu40X" "" "Germline" "yes" "" "0" "" "" "g.86954968C>A" "" "likely pathogenic" ""
"0000814883" "0" "70" "11" "86665844" "86665844" "subst" "0" "00000" "FZD4_000158" "g.86665844T>A" "" "{PMID:Chen 2020:31987760}" "" "284A>T, Gln95Leu" "" "Germline" "yes" "" "0" "" "" "g.86954802T>A" "" "likely pathogenic" ""
"0000814884" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Chen 2020:31987760}" "" "313A>G, Met105Val" "" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000818244" "0" "90" "11" "86662513" "86662516" "del" "8.12123E-6" "00000" "FZD4_000005" "g.86662513_86662516del" "" "{PMID:Rao 2017:28494495}" "" "c.1282_1285delGACA" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818246" "20" "90" "11" "86665901" "86665901" "del" "0" "00000" "FZD4_000160" "g.86665901delT" "" "{PMID:Rao 2017:28494495}" "" "c.227delA" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" ""
"0000818563" "21" "90" "11" "86663052" "86663052" "dup" "0" "00000" "FZD4_000133" "g.86663052dup" "" "{PMID:Wang 2021:32238352}" "" "c.747dupC, p.Y250fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86952010dup" "" "pathogenic" "ACMG"
"0000818564" "0" "90" "11" "86663052" "86663052" "dup" "0" "00000" "FZD4_000133" "g.86663052dup" "" "{PMID:Wang 2021:32238352}" "" "c.747dupC, p.Y250fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86952010dup" "" "pathogenic" "ACMG"
"0000818565" "21" "90" "11" "86665904" "86665921" "del" "0" "00000" "FZD4_000091" "g.86665904_86665921del" "" "{PMID:Wang 2021:32238352}" "" "c.217_234del, p.73_78del" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86954862_86954879del" "" "pathogenic" "ACMG"
"0000818566" "0" "90" "11" "86665904" "86665921" "del" "0" "00000" "FZD4_000091" "g.86665904_86665921del" "" "{PMID:Wang 2021:32238352}" "" "c.217_234del, p.73_78del" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86954862_86954879del" "" "pathogenic" "ACMG"
"0000818567" "21" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2021:32238352}" "" "c.1282_1285del, p.D428fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000818568" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2021:32238352}" "" "c.1282_1285del, p.D428fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000818569" "21" "50" "11" "86662470" "86662470" "subst" "0" "00000" "FZD4_000159" "g.86662470A>G" "" "{PMID:Wang 2021:32238352}" "" "c.1328T>C, p.L443P" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951428A>G" "" "VUS" "ACMG"
"0000818570" "0" "50" "11" "86662470" "86662470" "subst" "0" "00000" "FZD4_000159" "g.86662470A>G" "" "{PMID:Wang 2021:32238352}" "" "c.1328T>C, p.L443P" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951428A>G" "" "VUS" "ACMG"
"0000818573" "11" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2021:32238352}" "" "c.1282_1285del, p.D428fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000818574" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2021:32238352}" "" "c.1282_1285del, p.D428fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000818575" "11" "70" "11" "86662609" "86662613" "del" "0" "00000" "FZD4_000053" "g.86662609_86662613del" "" "{PMID:Wang 2021:32238352}" "" "c.1188_1192del, p.F396fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951567_86951571del" "" "likely pathogenic" "ACMG"
"0000818576" "0" "70" "11" "86662609" "86662613" "del" "0" "00000" "FZD4_000053" "g.86662609_86662613del" "" "{PMID:Wang 2021:32238352}" "" "c.1188_1192del, p.F396fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951567_86951571del" "" "likely pathogenic" "ACMG"
"0000818577" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2021:32238352}" "" "c.1282_1285del, p.D428fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000818578" "0" "90" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Wang 2021:32238352}" "" "c.1282_1285del, p.D428fs" "retrospective study, duplicates plausible" "Germline" "yes" "" "0" "" "" "g.86951476_86951479del" "" "pathogenic" "ACMG"
"0000821255" "0" "70" "11" "86663514" "86663514" "subst" "0" "00000" "FZD4_000161" "g.86663514T>A" "" "{PMID:Turro 2020:32581362}" "" "FZD4 c.286-2A>T," "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952472T>A" "" "likely pathogenic" ""
"0000823627" "21" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Li 2020:32884843}" "" "FZD4 c.313A>G, p.M105V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "pathogenic" "ACMG"
"0000823628" "11" "90" "11" "86666089" "86666098" "del" "0" "00000" "FZD4_000050" "g.86666089_86666098del" "" "{PMID:Li 2020:32884843}" "" "FZD4 c.40_49del, p.P14fs" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86955047_86955056del" "" "pathogenic" "ACMG"
"0000825939" "0" "70" "11" "86662476" "86662476" "subst" "4.06075E-6" "00000" "FZD4_000162" "g.86662476G>A" "" "{PMID:Liu-2020:33090715}" "" "c.1322C>T" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" ""
"0000825969" "0" "70" "11" "86662513" "86662516" "del" "8.12123E-6" "00000" "FZD4_000005" "g.86662513_86662516del" "" "{PMID:Liu-2020:33090715}" "" "c.1282_1285delGACA" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" ""
"0000826172" "0" "70" "11" "86663255" "86663255" "subst" "0" "00000" "FZD4_000164" "g.86663255A>T" "" "{PMID:Liu-2020:33090715}" "" "c.543T>A" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" ""
"0000826176" "0" "70" "11" "86662606" "86662610" "del" "0" "00000" "FZD4_000053" "g.86662606_86662610del" "" "{PMID:Liu-2020:33090715}" "" "c.1188_1192delTACTT" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" ""
"0000826239" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Liu-2020:33090715}" "" "c.313A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" ""
"0000826267" "0" "70" "11" "86662665" "86662665" "subst" "1.21831E-5" "00000" "FZD4_000163" "g.86662665T>C" "" "{PMID:Liu-2020:33090715}" "" "c.1133A>G" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (dominant)" ""
"0000862737" "0" "50" "11" "86662543" "86662543" "subst" "0" "01943" "FZD4_000165" "g.86662543T>C" "" "" "" "FZD4(NM_012193.3):c.1255A>G (p.N419D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000878028" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Shastry 2004:14560311}" "" "\"\"a segregating 2 bp deletion in the FZD-4 gene (Robitaile 2002)\"\"" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878029" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Shastry 2004:14560311}" "" "\"\"a segregating 2 bp deletion in the FZD-4 gene (Robitaile 2002)\"\"" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878030" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Shastry 2004:14560311}" "" "\"\"a segregating 2 bp deletion in the FZD-4 gene (Robitaile 2002)\"\"" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878031" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Shastry 2004:14560311}" "" "\"\"a segregating 2 bp deletion in the FZD-4 gene (Robitaile 2002)\"\"" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878032" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Shastry 2004:14560311}" "" "\"\"a segregating 2 bp deletion in the FZD-4 gene (Robitaile 2002)\"\"" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878215" "0" "70" "11" "86666021" "86666021" "subst" "0" "00000" "FZD4_000011" "g.86666021C>T" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c107G>A, G36D" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954979C>T" "" "likely pathogenic" ""
"0000878216" "0" "70" "11" "86663484" "86663484" "subst" "0" "00000" "FZD4_000014" "g.86663484A>G" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c314T>C, M105T" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952442A>G" "" "likely pathogenic" ""
"0000878217" "0" "70" "11" "86663484" "86663484" "subst" "0" "00000" "FZD4_000014" "g.86663484A>G" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c314T>C, M105T" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952442A>G" "" "likely pathogenic" ""
"0000878218" "0" "70" "11" "86663484" "86663484" "subst" "0" "00000" "FZD4_000014" "g.86663484A>G" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c314T>C, M105T" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952442A>G" "" "likely pathogenic" ""
"0000878219" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878220" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878221" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878222" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878223" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878224" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878225" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878226" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878227" "0" "70" "11" "86663329" "86663329" "subst" "0" "00000" "FZD4_000016" "g.86663329T>C" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c469A>G, M157V" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952287T>C" "" "likely pathogenic" ""
"0000878228" "0" "70" "11" "86662842" "86662842" "del" "0" "00000" "FZD4_000003" "g.86662842del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c957de1G, W319fsX323" "not fully penetrant, 6-year old (maybe presymptomatic) brother and father asymptomatic; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "likely pathogenic" ""
"0000878229" "0" "70" "11" "86662842" "86662842" "del" "0" "00000" "FZD4_000003" "g.86662842del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c957de1G, W319fsX323" "not fully penetrant, 6-yearold maybe presymptomatic brother and father asymptomatic; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "likely pathogenic" ""
"0000878230" "0" "70" "11" "86662842" "86662842" "del" "0" "00000" "FZD4_000003" "g.86662842del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c957de1G, W319fsX323" "not fully penetrant, 6-yearold maybe presymptomatic brother and father asymptomatic; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951800del" "" "likely pathogenic" ""
"0000878231" "0" "70" "11" "86662308" "86662308" "subst" "0" "00000" "FZD4_000030" "g.86662308G>A" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1490C>T, S497F" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951266G>A" "" "likely pathogenic" ""
"0000878232" "0" "70" "11" "86662303" "86662303" "del" "0" "00000" "FZD4_000008" "g.86662303del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1498de1A, T500fsX512" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951261del" "" "likely pathogenic" ""
"0000878233" "0" "70" "11" "86662303" "86662303" "del" "0" "00000" "FZD4_000008" "g.86662303del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1498de1A, T500fsX512" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951261del" "" "likely pathogenic" ""
"0000878234" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1501-1502de1CT, L501fsX533" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878235" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1501-1502de1CT, L501fsX533" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878236" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1501-1502de1CT, L501fsX533" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878237" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1501-1502de1CT, L501fsX533" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878238" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1501-1502de1CT, L501fsX533" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878239" "0" "70" "11" "86662298" "86662299" "del" "0" "00000" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1501-1502de1CT, L501fsX533" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951256_86951257del" "" "likely pathogenic" ""
"0000878240" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1513C>T, Q505X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951243G>A" "" "likely pathogenic" ""
"0000878241" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1513C>T, Q505X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951243G>A" "" "likely pathogenic" ""
"0000878242" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "" "{PMID:Toomes 2004:15223780}" "" "FZD4 c1513C>T, Q505X" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951243G>A" "" "likely pathogenic" ""
"0000878296" "10" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878297" "20" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878298" "10" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878299" "10" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878300" "10" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878301" "10" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878302" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878303" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878304" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878305" "11" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878306" "11" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878307" "11" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878308" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878309" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878310" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878311" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878312" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878313" "21" "70" "11" "86662324" "86662324" "subst" "0" "00000" "FZD4_000029" "g.86662324C>G" "" "{PMID:Muller 2008:17899116}" "" "FZD4 p.G492R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic" ""
"0000878314" "0" "70" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Muller 2008:17899116}" "" "FZD4 c.1286del5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "likely pathogenic" ""
"0000878315" "0" "70" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Muller 2008:17899116}" "" "FZD4 c.1286del5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "likely pathogenic" ""
"0000878316" "21" "70" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Muller 2008:17899116}" "" "FZD4 c.1286del5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "likely pathogenic" ""
"0000878317" "21" "70" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Muller 2008:17899116}" "" "FZD4 c.1286del5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "likely pathogenic" ""
"0000878318" "21" "70" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Muller 2008:17899116}" "" "FZD4 c.1286del5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "likely pathogenic" ""
"0000878319" "21" "70" "11" "86662509" "86662513" "del" "0" "00000" "FZD4_000006" "g.86662509_86662513del" "" "{PMID:Muller 2008:17899116}" "" "FZD4 c.1286del5" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951467_86951471del" "" "likely pathogenic" ""
"0000878338" "0" "70" "11" "86663449" "86663449" "subst" "4.06712E-6" "00000" "FZD4_000094" "g.86663449A>G" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b349 (TGC>CGC), C117R" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952407A>G" "" "likely pathogenic" ""
"0000878339" "0" "70" "11" "86663449" "86663449" "subst" "4.06712E-6" "00000" "FZD4_000094" "g.86663449A>G" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b349 (TGC>CGC), C117R" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952407A>G" "" "likely pathogenic" ""
"0000878340" "0" "70" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b542 (TGT>TAT), C181Y" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952214C>T" "" "likely pathogenic" ""
"0000878341" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b1513 (CAG>TAG), Q505X" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951243G>A" "" "likely pathogenic" ""
"0000878342" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878343" "11" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878344" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878345" "11" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878346" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878347" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878348" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878349" "21" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878350" "21" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878351" "21" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878352" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878353" "21" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878354" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878355" "0" "70" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "likely pathogenic" ""
"0000878356" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878357" "11" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878358" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878359" "11" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878360" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878361" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878362" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878363" "21" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878364" "21" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878365" "21" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878366" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878367" "21" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878368" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878369" "0" "70" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "" "{PMID:Drenser 2009:20008721}" "" "FZD4 b97 (CCG>TCG), b502 (CCC>TCC), P33S/P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "likely pathogenic" ""
"0000878371" "0" "50" "11" "86662689" "86662689" "subst" "0" "00000" "FZD4_000025" "g.86662689G>C" "" "{PMID:Ells 2010:20141357}" "" "FZD4 p.Ala370Gly (c.1109C>G)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86951647G>C" "" "association" ""
"0000878372" "0" "50" "11" "86663189" "86663189" "subst" "0" "00000" "FZD4_000178" "g.86663189C>A" "0/173 Caucasian controls" "{PMID:Ells 2010:20141357}" "" "FZD4 p.Lys203Asn (c.609G>T)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86952147C>A" "" "association" ""
"0000878373" "0" "50" "11" "86662402" "86662402" "subst" "3.65571E-5" "00000" "FZD4_000171" "g.86662402G>A" "" "{PMID:Ells 2010:20141357}" "" "FZD4 p.Arg466Trp (c.1396C>T)" "heterozygous" "Germline" "no" "" "0" "" "" "g.86951360G>A" "" "association" ""
"0000878397" "0" "70" "11" "86663482" "86663482" "subst" "0" "00000" "FZD4_000180" "g.86663482A>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.1487G>A, p.C106G" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952440A>C" "" "likely pathogenic" ""
"0000878398" "0" "70" "11" "86663328" "86663328" "subst" "0" "00000" "FZD4_000179" "g.86663328A>T" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.470T>A, p.M157K" "heterozygous" "Germline" "?" "" "0" "" "" "g.86952286A>T" "" "likely pathogenic" ""
"0000878399" "0" "70" "11" "86663328" "86663328" "subst" "0" "00000" "FZD4_000179" "g.86663328A>T" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.470T>A, p.M157K" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952286A>T" "" "likely pathogenic" ""
"0000878400" "0" "70" "11" "86663165" "86663165" "del" "0" "00000" "FZD4_000177" "g.86663165del" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.633delC, p.Y211fsX" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952123del" "" "likely pathogenic" ""
"0000878401" "0" "70" "11" "86662518" "86662521" "del" "0" "00000" "FZD4_000005" "g.86662518_86662521del" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.1282_1285del, p.D428fsX1" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951476_86951479del" "" "likely pathogenic" ""
"0000878402" "0" "70" "11" "86662290" "86662290" "dup" "0" "00000" "FZD4_000168" "g.86662290dup" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.1508_1509insC, p.T503fsX31" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951248dup" "" "likely pathogenic" ""
"0000878403" "0" "70" "11" "86662335" "86662335" "subst" "0" "00000" "FZD4_000170" "g.86662335C>A" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.1463G>T, p.G488V" "heterozygous" "Germline" "?" "" "0" "" "" "g.86951293C>A" "" "likely pathogenic" ""
"0000878404" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878405" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878406" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878407" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878408" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878409" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878410" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878411" "0" "70" "11" "86663485" "86663485" "subst" "2.03973E-5" "00000" "FZD4_000013" "g.86663485T>C" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.313A>G, p.M105V" "no nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952443T>C" "" "likely pathogenic" ""
"0000878412" "0" "70" "11" "86662311" "86662311" "subst" "0" "00000" "FZD4_000169" "g.86662311C>T" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.1487G>A, p.W496X" "no nucleotide annotation, extrapolated from protein, sequence and databases - can also be c.1488G>A; heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951269C>T" "" "likely pathogenic" ""
"0000878413" "0" "70" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.678G>A, p.W226X" "no nucleotide annotation, extrapolated from protein, sequence and databases - can also be c.677G>A; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952078C>T" "" "likely pathogenic" ""
"0000878414" "0" "70" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.678G>A, p.W226X" "no nucleotide annotation, extrapolated from protein, sequence and databases - can also be c.677G>A; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952078C>T" "" "likely pathogenic" ""
"0000878415" "0" "70" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Robitaille 2011:21097938}" "" "FZD4 c.678G>A, p.W226X" "no nucleotide annotation, extrapolated from protein, sequence and databases - can also be c.677G>A; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952078C>T" "" "likely pathogenic" ""
"0000878417" "1" "90" "11" "86666089" "86666098" "del" "0" "00006" "FZD4_000050" "g.86666089_86666098del" "" "{PMID:Jia 2010:20938005}" "" "39-49delCCCGGGGGCG (P14fsX57)" "" "Germline" "yes" "" "0" "" "" "g.86955047_86955056del" "" "pathogenic (dominant)" ""
"0000878418" "21" "90" "11" "86665923" "86665923" "subst" "0.000513326" "00006" "FZD4_000035" "g.86665923G>A" "" "{PMID:Jia 2010:20938005}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000878419" "21" "90" "11" "86665923" "86665923" "subst" "0.000513326" "00006" "FZD4_000035" "g.86665923G>A" "" "{PMID:Jia 2010:20938005}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000878420" "21" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00006" "FZD4_000013" "g.86663485T>C" "" "{PMID:Jia 2010:20938005}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000878421" "11" "90" "11" "86663485" "86663485" "subst" "2.03973E-5" "00006" "FZD4_000013" "g.86663485T>C" "" "{PMID:Jia 2010:20938005}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic" ""
"0000878429" "0" "90" "11" "77962352" "114014790" "del" "0" "00006" "FZD4_000166" "g.(?_77962352)_(114014790_?)del" "" "{PMID:Li 2006:17103440}" "" "" "hg17 35Mb interstitial deletion 11q14.1-q23.2 (77.64 to 113.52 Mb) and 1.14Mb deletion 16q22.3 (72.18 to 73.32 Mb)" "De novo" "" "" "0" "" "46,XX,t(5;8)(p15.3;p23.1),der(11)t(11;16)(q23.3;q22.3)del(11)(q14.1q23.2)inv(11;16)(p15;q24),der(16)t(11;16)(q23.3;q22.3)del(16)(q22.3q23.1)" "g.(?_78251306)_(114144068_?)del" "" "pathogenic" ""
"0000878455" "0" "70" "11" "0" "0" "" "0" "00000" "FZD4_000000" "g.?" "" "{PMID:Dailey 2015:26119001}" "" "Del/inser c.40" "described only as Del/ins c.40 - not possible to pinpoint the actual variant; heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.?" "" "likely pathogenic" ""
"0000878456" "0" "70" "11" "86665885" "86665886" "ins" "0" "00000" "FZD4_000181" "g.86665885_86665886insC" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.242insG" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954843_86954844insC" "" "likely pathogenic" ""
"0000878457" "0" "70" "11" "86665977" "86665977" "subst" "0" "00000" "FZD4_000184" "g.86665977A>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.151T>A, S51T" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954935A>T" "" "likely pathogenic" ""
"0000878458" "0" "70" "11" "86665959" "86665959" "subst" "0" "00000" "FZD4_000183" "g.86665959C>A" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.169G>T, G57C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954917C>A" "" "likely pathogenic" ""
"0000878459" "0" "70" "11" "86665959" "86665959" "subst" "0" "00000" "FZD4_000183" "g.86665959C>A" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.169G>T, G57C" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86954917C>A" "" "likely pathogenic" ""
"0000878460" "0" "70" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.205C>T, H69Y" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954881G>A" "" "likely pathogenic" ""
"0000878461" "0" "70" "11" "86663449" "86663449" "subst" "4.06712E-6" "00000" "FZD4_000094" "g.86663449A>G" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.349T>C, C117R" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952407A>G" "" "likely pathogenic" ""
"0000878462" "0" "70" "11" "86663449" "86663449" "subst" "4.06712E-6" "00000" "FZD4_000094" "g.86663449A>G" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.349T>C, C117R" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952407A>G" "" "likely pathogenic" ""
"0000878463" "0" "70" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.542G>A, C181Y" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952214C>T" "" "likely pathogenic" ""
"0000878464" "0" "70" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.542G>A, C181Y" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952214C>T" "" "likely pathogenic" ""
"0000878465" "0" "70" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.542G>A, C181Y" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952214C>T" "" "likely pathogenic" ""
"0000878466" "0" "70" "11" "86663256" "86663256" "subst" "0" "00000" "FZD4_000096" "g.86663256C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.542G>A, C181Y" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952214C>T" "" "likely pathogenic" ""
"0000878467" "0" "70" "11" "86663148" "86663148" "subst" "0" "00000" "FZD4_000176" "g.86663148T>C" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.650A>G, E217G" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952106T>C" "" "likely pathogenic" ""
"0000878468" "3" "70" "11" "86663040" "86663040" "subst" "2.84537E-5" "00000" "FZD4_000175" "g.86663040C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.758G>A, R253H (homo)" "homozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951998C>T" "" "likely pathogenic" ""
"0000878469" "0" "70" "11" "86662964" "86662964" "subst" "0" "00000" "FZD4_000174" "g.86662964T>C" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.834A>G, E278E" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951922T>C" "" "likely pathogenic" ""
"0000878470" "0" "70" "11" "86662964" "86662964" "subst" "0" "00000" "FZD4_000174" "g.86662964T>C" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.834A>G, E278E" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951922T>C" "" "likely pathogenic" ""
"0000878471" "0" "70" "11" "86662794" "86662794" "subst" "0" "00000" "FZD4_000040" "g.86662794C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.1004G>A, W335X" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951752C>T" "" "likely pathogenic" ""
"0000878472" "0" "70" "11" "86662724" "86662724" "subst" "0" "00000" "FZD4_000173" "g.86662724T>G" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.1074A>C, K358N" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951682T>G" "" "likely pathogenic" ""
"0000878473" "0" "70" "11" "86662724" "86662724" "subst" "0" "00000" "FZD4_000173" "g.86662724T>G" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.1074A>C, K358N" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86951682T>G" "" "likely pathogenic" ""
"0000878474" "0" "70" "11" "86662527" "86662527" "subst" "0" "00000" "FZD4_000172" "g.86662527C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.1271G>A, G424E" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951485C>T" "" "likely pathogenic" ""
"0000878475" "0" "70" "11" "86662285" "86662285" "subst" "0" "00000" "FZD4_000010" "g.86662285G>A" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.1513C>T, Q505X" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951243G>A" "" "likely pathogenic" ""
"0000878476" "0" "70" "11" "86662209" "86662209" "subst" "0.000158368" "00000" "FZD4_000111" "g.86662209C>T" "" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.1589G>A, G530E" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86951167C>T" "" "likely pathogenic" ""
"0000878477" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878478" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878479" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878480" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878481" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878482" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878483" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878484" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878485" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878486" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878487" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878488" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878489" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878490" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878491" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878492" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878493" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878494" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878495" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878496" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878497" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878498" "0" "50" "11" "86666031" "86666031" "subst" "0.0169315" "00000" "FZD4_000033" "g.86666031G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T, P33S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86954989G>A" "" "association" ""
"0000878499" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.502C>T, P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878500" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.502C>T, P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878501" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.502C>T, P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878502" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878503" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878504" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878505" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878506" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878507" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878508" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878509" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878510" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878511" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878512" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878513" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878514" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878515" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878516" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878517" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878518" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878519" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878520" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878521" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878522" "0" "50" "11" "86663296" "86663296" "subst" "0.0184442" "00000" "FZD4_000042" "g.86663296G>A" "mutations P33S and P168S (alone or in combination): 5.4% (28/520) of the subjects: FEVR, 10.7% ROP, 3.1% healthy full-term infants" "{PMID:Dailey 2015:26119001}" "" "FZD4 c.97C>T;c.502C>T, P33S;P168S" "heterozygous" "Germline/De novo (untested)" "?" "" "0" "" "" "g.86952254G>A" "" "association" ""
"0000878544" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878545" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878546" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878547" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878548" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878549" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878550" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878551" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878552" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878553" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878554" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878555" "0" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "Japanese population: 1.21% (n = 1,157); high compared with the frequencies of other populations in the public databases; 0.02%" "{PMID:Kondo 2018:29135315}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous; risk allele; previous publications - reporter assay showed that the p.H69Y variant caused a mild but significant reduction of the signaling activity; cell surface binding assay with Norrin showed that p.H69Y had impaired cell surface binding" "Unknown" "?" "" "0" "" "" "g.86954881G>A" "" "association" ""
"0000878558" "21" "50" "11" "86665923" "86665923" "subst" "0.000513326" "00000" "FZD4_000035" "g.86665923G>A" "" "{PMID:Zhang 2019:30882657}" "" "FZD4 c.205C>T (p.H69Y)" "heterozygous" "Germline" "?" "" "0" "" "" "g.86954881G>A" "" "VUS" ""
"0000878575" "0" "90" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 444G->A (C45Y)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "pathogenic" ""
"0000878576" "0" "90" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 444G->A (C45Y)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "pathogenic" ""
"0000878577" "11" "90" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 444G->A (C45Y)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "pathogenic" ""
"0000878578" "21" "90" "11" "86665994" "86665994" "subst" "0" "00000" "FZD4_000074" "g.86665994C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 444G->A (C45Y)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954952C>T" "" "pathogenic" ""
"0000878579" "0" "90" "11" "86665955" "86665955" "subst" "0" "00000" "FZD4_000182" "g.86665955T>C" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 479A->G (Y58C)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954913T>C" "" "pathogenic" ""
"0000878580" "11" "90" "11" "86665955" "86665955" "subst" "0" "00000" "FZD4_000182" "g.86665955T>C" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 479A->G (Y58C)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954913T>C" "" "pathogenic" ""
"0000878581" "11" "90" "11" "86665955" "86665955" "subst" "0" "00000" "FZD4_000182" "g.86665955T>C" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 479A->G (Y58C)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954913T>C" "" "pathogenic" ""
"0000878582" "21" "90" "11" "86665955" "86665955" "subst" "0" "00000" "FZD4_000182" "g.86665955T>C" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 479A->G (Y58C)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954913T>C" "" "pathogenic" ""
"0000878583" "21" "90" "11" "86665955" "86665955" "subst" "0" "00000" "FZD4_000182" "g.86665955T>C" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 479A->G (Y58C)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86954913T>C" "" "pathogenic" ""
"0000878584" "0" "90" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 984G->A (W226X)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952078C>T" "" "pathogenic" ""
"0000878585" "11" "90" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 984G->A (W226X)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952078C>T" "" "pathogenic" ""
"0000878586" "11" "90" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 984G->A (W226X)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952078C>T" "" "pathogenic" ""
"0000878587" "20" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 916T->C (C204R)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000878588" "20" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 916T->C (C204R)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000878589" "11" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 916T->C (C204R)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000878590" "11" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 916T->C (C204R)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000878591" "11" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 916T->C (C204R)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000878592" "11" "90" "11" "86663188" "86663188" "subst" "0" "00000" "FZD4_000020" "g.86663188A>G" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 916T->C (C204R)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86952146A>G" "" "pathogenic" ""
"0000878593" "0" "90" "11" "86662311" "86662311" "subst" "0" "00000" "FZD4_000169" "g.86662311C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 1794G->A (W496X)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951269C>T" "" "pathogenic" ""
"0000878594" "11" "90" "11" "86662311" "86662311" "subst" "0" "00000" "FZD4_000169" "g.86662311C>T" "" "{PMID:Zhang 2010:21177847}" "" "FZD4 1794G->A (W496X)" "obsolete nucleotide annotation, extrapolated from protein, sequence and databases; heterozygous" "Germline" "yes" "" "0" "" "" "g.86951269C>T" "" "pathogenic" ""
"0000878636" "21" "90" "11" "86662548" "86662548" "subst" "0" "00006" "FZD4_000026" "g.86662548C>T" "" "{PMID:Kondo 2003:14507768}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" ""
"0000880247" "11" "70" "11" "86665923" "86665923" "subst" "0.000513326" "00006" "FZD4_000035" "g.86665923G>A" "" "{PMID:Kondo 2003:14507768}" "" "" "variant may have some causative effects" "Germline" "" "" "0" "" "" "" "" "VUS (!)" ""
"0000880248" "0" "70" "11" "86665923" "86665923" "subst" "0.000513326" "00006" "FZD4_000035" "g.86665923G>A" "" "{PMID:Kondo 2003:14507768}" "" "" "may have some causative effects" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "VUS (!)" ""
"0000880249" "0" "70" "11" "86665923" "86665923" "subst" "0.000513326" "00006" "FZD4_000035" "g.86665923G>A" "2/150 controls" "{PMID:Kondo 2003:14507768}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS (!)" ""
"0000890208" "0" "30" "11" "86662859" "86662859" "subst" "3.25182E-5" "02330" "FZD4_000185" "g.86662859T>C" "" "" "" "FZD4(NM_012193.4):c.939A>G (p.G313=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000898131" "0" "70" "11" "86663120" "86663120" "subst" "0" "00000" "FZD4_000088" "g.86663120C>T" "" "{PMID:Lu 2020:32889247}" "" "FZD4 p.W226X (c.678G > A)" "heterozygous" "In vitro (cloned)" "?" "" "0" "" "" "g.86952078C>T" "" "likely pathogenic" ""
"0000898132" "3" "90" "11" "86662561" "86662561" "subst" "0" "00000" "FZD4_000186" "g.86662561A>C" "" "{PMID:Zamani 2020:32201676}" "" "FZD4 c.1237T>G" "homozygous" "Germline" "yes" "" "0" "" "" "g.86951519A>C" "" "pathogenic" ""
"0000898134" "21" "70" "11" "86663371" "86663372" "del" "0" "00000" "FZD4_000187" "g.86663371_86663372del" "" "{PMID:Staropoli 2020:31978232}" "" "FZD4 c.427_428delCT, p.Leu143TyrfsX22 (L143YfsX22)" "heterozygous" "Germline" "yes" "" "0" "" "" "g.86952329_86952330del" "" "likely pathogenic (dominant)" ""
"0000954039" "21" "70" "11" "86663046" "86663046" "subst" "0" "00006" "FZD4_000188" "g.86663046G>C" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.86952004G>C" "" "likely pathogenic" ""
"0000954040" "0" "90" "11" "86665923" "86665923" "subst" "0.000513326" "00006" "FZD4_000035" "g.86665923G>A" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.86954881G>A" "" "pathogenic" ""
"0000954041" "0" "90" "11" "86663328" "86663328" "subst" "0" "00006" "FZD4_000101" "g.86663328A>G" "" "{PMID:Moon 2021:35052368}" "" "" "" "Germline" "" "" "0" "" "" "g.86952286A>G" "" "pathogenic" ""
"0000958263" "1" "70" "11" "86662324" "86662324" "subst" "0" "00006" "FZD4_000029" "g.86662324C>G" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PP3, PM2, PP5_STRONG" "Germline" "" "" "0" "" "" "g.86951282C>G" "" "likely pathogenic (dominant)" "ACMG"
"0000958268" "1" "90" "11" "86662298" "86662299" "del" "0" "00006" "FZD4_000009" "g.86662298_86662299del" "" "{PMID:Weisschuh 2024:37734845}" "" "" "ACMG PM2, PVS1_STRONG, PP5_STRONG" "Germline" "" "" "0" "" "" "g.86951256_86951257del" "" "pathogenic" "ACMG"
"0000966623" "0" "90" "11" "86662842" "86662842" "subst" "0" "02327" "FZD4_000189" "g.86662842C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000999533" "0" "50" "11" "86663061" "86663061" "subst" "0" "01804" "FZD4_000190" "g.86663061G>A" "" "" "" "FZD4(NM_012193.3):c.737C>T (p.(Ser246Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001019628" "0" "90" "11" "86666106" "86666106" "del" "0" "00006" "FZD4_000191" "g.86666106del" "" "{PMID:Jimenez 2022:36362148}" "" "23delC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.86955064del" "" "likely pathogenic (dominant)" ""
"0001038829" "0" "50" "11" "86662458" "86662458" "subst" "0" "01804" "FZD4_000192" "g.86662458G>C" "" "" "" "FZD4(NM_012193.4):c.1340C>G (p.(Pro447Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001054030" "0" "50" "11" "86662602" "86662602" "subst" "1.21819E-5" "02327" "FZD4_000193" "g.86662602A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes FZD4
## Count = 636
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000172767" "00008236" "90" "856" "0" "856" "0" "c.856G>T" "r.(?)" "p.(Glu286*)" "2"
"0000172768" "00008236" "90" "957" "0" "957" "0" "c.957del" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000172769" "00008236" "90" "957" "0" "957" "0" "c.957G>A" "r.(?)" "p.(Trp319*)" "2"
"0000172770" "00008236" "90" "957" "0" "957" "0" "c.957G>A" "r.(?)" "p.(Trp319*)" "2"
"0000172771" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000172772" "00008236" "90" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "2"
"0000172773" "00008236" "90" "1488" "0" "1488" "0" "c.1488G>A" "r.(?)" "p.(Trp496*)" "2"
"0000172774" "00008236" "90" "1498" "0" "1498" "0" "c.1498del" "r.(?)" "p.(Thr500Leufs*13)" "2"
"0000172775" "00008236" "90" "1501" "0" "1502" "0" "c.1501_1502del" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000172776" "00008236" "90" "1501" "0" "1502" "0" "c.1501_1502del" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000172777" "00008236" "90" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" "2"
"0000172778" "00008236" "90" "107" "0" "107" "0" "c.107G>A" "r.(?)" "p.(Gly36Asp)" "1"
"0000172779" "00008236" "90" "118" "0" "118" "0" "c.118G>C" "r.(?)" "p.(Glu40Gln)" "1"
"0000172780" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000172781" "00008236" "90" "314" "0" "314" "0" "c.314T>C" "r.(?)" "p.(Met105Thr)" "2"
"0000172782" "00008236" "90" "341" "0" "341" "0" "c.341T>C" "r.(?)" "p.(Ile114Thr)" "2"
"0000172783" "00008236" "90" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000172784" "00008236" "90" "541" "0" "541" "0" "c.541T>C" "r.(?)" "p.(Cys181Arg)" "2"
"0000172785" "00008236" "90" "609" "0" "609" "0" "c.609G>C" "r.(?)" "p.(Lys203Asn)" "2"
"0000172786" "00008236" "90" "611" "0" "611" "0" "c.611G>A" "r.(?)" "p.(Cys204Tyr)" "2"
"0000172788" "00008236" "90" "668" "0" "668" "0" "c.668T>A" "r.(?)" "p.(Met223Lys)" "2"
"0000172789" "00008236" "90" "766" "0" "766" "0" "c.766A>G" "r.(?)" "p.(Ile256Val)" "2"
"0000172790" "00008236" "90" "1005" "0" "1005" "0" "c.1005G>C" "r.(?)" "p.(Trp335Cys)" "2"
"0000172791" "00008236" "90" "1024" "0" "1024" "0" "c.1024A>G" "r.(?)" "p.(Met342Val)" "2"
"0000172792" "00008236" "90" "1024" "0" "1024" "0" "c.1024A>G" "r.(?)" "p.(Met342Val)" "2"
"0000172793" "00008236" "90" "1109" "0" "1109" "0" "c.1109C>G" "r.(?)" "p.(Ala370Gly)" "2"
"0000172794" "00008236" "90" "1250" "0" "1250" "0" "c.1250G>A" "r.(?)" "p.(Arg417Gln)" "2"
"0000172795" "00008236" "90" "1333" "0" "1333" "0" "c.1333A>C" "r.(?)" "p.(Thr445Pro)" "2"
"0000172796" "00008236" "90" "1463" "0" "1463" "0" "c.1463G>A" "r.(?)" "p.(Gly488Asp)" "2"
"0000172797" "00008236" "90" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "2"
"0000172798" "00008236" "90" "1490" "0" "1490" "0" "c.1490C>T" "r.(?)" "p.(Ser497Phe)" "2"
"0000172799" "00008236" "90" "1573" "0" "1573" "0" "c.1573G>C" "r.(?)" "p.(Gly525Arg)" "2"
"0000172800" "00008236" "90" "1479" "0" "1484" "0" "c.1479_1484del" "r.(?)" "p.(Met493_Trp494del)" "2"
"0000276923" "00008236" "10" "1167" "0" "1167" "0" "c.1167G>C" "r.(?)" "p.(Gly389=)" ""
"0000276924" "00008236" "10" "48" "0" "48" "0" "c.48C>T" "r.(?)" "p.(Gly16=)" ""
"0000288015" "00008236" "50" "47" "0" "47" "0" "c.47G>A" "r.(?)" "p.(Gly16Asp)" ""
"0000322441" "00008236" "50" "144640" "0" "144640" "0" "c.*143026G>A" "r.(=)" "p.(=)" ""
"0000322442" "00008236" "50" "144330" "0" "144330" "0" "c.*142716C>T" "r.(=)" "p.(=)" ""
"0000342433" "00008236" "50" "757" "0" "757" "0" "c.757C>T" "r.(?)" "p.(Arg253Cys)" ""
"0000344307" "00008236" "90" "611" "0" "611" "0" "c.611G>A" "r.(?)" "p.(Cys204Tyr)" ""
"0000344835" "00008236" "30" "1262" "0" "1262" "0" "c.1262A>C" "r.(?)" "p.(Gln421Pro)" ""
"0000345327" "00008236" "90" "856" "0" "856" "0" "c.856G>T" "r.(?)" "p.(Glu286Ter)" ""
"0000345400" "00008236" "50" "118" "0" "118" "0" "c.118G>C" "r.(?)" "p.(Glu40Gln)" ""
"0000348234" "00008236" "10" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000348390" "00008236" "10" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000349521" "00008236" "70" "1333" "0" "1333" "0" "c.1333A>C" "r.(?)" "p.(Thr445Pro)" ""
"0000349773" "00008236" "90" "957" "0" "957" "0" "c.957G>A" "r.(?)" "p.(Trp319Ter)" ""
"0000349780" "00008236" "90" "1004" "0" "1004" "0" "c.1004G>A" "r.(?)" "p.(Trp335Ter)" ""
"0000349813" "00008236" "70" "1488" "0" "1488" "0" "c.1488G>A" "r.(?)" "p.(Trp496Ter)" ""
"0000546005" "00008236" "50" "1592" "0" "1592" "0" "c.1592A>G" "r.(?)" "p.(Lys531Arg)" ""
"0000546006" "00008236" "50" "1561" "0" "1561" "0" "c.1561A>G" "r.(?)" "p.(Lys521Glu)" ""
"0000546007" "00008236" "50" "1239" "0" "1239" "0" "c.1239G>C" "r.(?)" "p.(Leu413Phe)" ""
"0000546008" "00008236" "10" "1152" "0" "1152" "0" "c.1152C>T" "r.(?)" "p.(Leu384=)" ""
"0000546009" "00008236" "50" "1009" "0" "1009" "0" "c.1009C>A" "r.(?)" "p.(His337Asn)" ""
"0000546010" "00008236" "10" "945" "0" "945" "0" "c.945C>T" "r.(?)" "p.(Ala315=)" ""
"0000546013" "00008236" "30" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000546014" "00008236" "50" "177" "0" "177" "0" "c.177C>A" "r.(?)" "p.(Asn59Lys)" ""
"0000546015" "00008236" "90" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Pro14SerfsTer44)" ""
"0000546016" "00008236" "30" "-12" "0" "-12" "0" "c.-12C>A" "r.(?)" "p.(=)" ""
"0000596940" "00008236" "70" "1188" "0" "1192" "0" "c.1188_1192del" "r.(?)" "p.(Phe396Leufs*61)" ""
"0000596942" "00008236" "70" "1188" "0" "1192" "0" "c.1188_1192del" "r.(?)" "p.(Phe396Leufs*61)" ""
"0000596988" "00008236" "90" "1220" "0" "1220" "0" "c.1220del" "r.(?)" "p.(Ala407Valfs*24)" ""
"0000596989" "00008236" "70" "1220" "0" "1220" "0" "c.1220del" "r.(?)" "p.(Ala407Valfs*24)" ""
"0000597021" "00008236" "90" "905" "0" "905" "0" "c.905G>A" "r.(?)" "p.(Cys302Tyr)" ""
"0000597022" "00008236" "90" "905" "0" "905" "0" "c.905G>A" "r.(?)" "p.(Cys302Tyr)" ""
"0000597023" "00008236" "70" "1325" "0" "1325" "0" "c.1325T>A" "r.(?)" "p.(Val442Glu)" ""
"0000597024" "00008236" "70" "1325" "0" "1325" "0" "c.1325T>A" "r.(?)" "p.(Val442Glu)" ""
"0000597025" "00008236" "90" "1475" "0" "1475" "0" "c.1475del" "r.(?)" "p.(Gly492Alafs*21)" ""
"0000597026" "00008236" "70" "1475" "0" "1475" "0" "c.1475del" "r.(?)" "p.(Gly492Alafs*21)" ""
"0000597027" "00008236" "90" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Pro14Serfs*44)" ""
"0000597028" "00008236" "90" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Pro14Serfs*44)" ""
"0000597073" "00008236" "90" "749" "0" "749" "0" "c.749A>G" "r.(?)" "p.(Tyr250Cys)" ""
"0000597074" "00008236" "90" "749" "0" "749" "0" "c.749A>G" "r.(?)" "p.(Tyr250Cys)" ""
"0000597075" "00008236" "90" "1506" "0" "1506" "0" "c.1506del" "r.(?)" "p.(His502Glnfs*11)" ""
"0000597076" "00008236" "90" "400" "0" "400" "0" "c.400G>T" "r.(?)" "p.(Glu134*)" ""
"0000613772" "00008236" "30" "729" "0" "729" "0" "c.729C>T" "r.(?)" "p.(Ile243=)" ""
"0000613773" "00008236" "30" "285" "18" "285" "23" "c.285+18_285+23dup" "r.(=)" "p.(=)" ""
"0000629371" "00008236" "90" "1250" "0" "1250" "0" "c.1250G>A" "r.(?)" "p.(Arg417Gln)" ""
"0000629499" "00008236" "50" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000629500" "00008236" "50" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000629678" "00008236" "90" "1026" "0" "1026" "0" "c.1026G>A" "r.(?)" "p.(Met342Val)" ""
"0000630279" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000630280" "00008236" "50" "818" "0" "818" "0" "c.818T>G" "r.(?)" "p.(Leu273Arg)" ""
"0000630281" "00008236" "70" "1472" "0" "1472" "0" "c.1472C>G" "r.(?)" "p.(Ser491*)" ""
"0000630724" "00008236" "90" "975" "0" "978" "0" "c.975_978del" "r.(?)" "p.(Thr326Glyfs*31)" "2"
"0000630726" "00008236" "90" "975" "0" "978" "0" "c.975_978del" "r.(?)" "p.(Thr326Glyfs*31)" "2"
"0000630728" "00008236" "90" "1475" "0" "1475" "0" "c.1475del" "r.(?)" "p.(Gly492Alafs*21)" "2"
"0000630730" "00008236" "90" "1034" "0" "1054" "0" "c.1034_1054del" "r.(?)" "p.(Ser345_Ala351del)" "2"
"0000630732" "00008236" "90" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" "1"
"0000630734" "00008236" "90" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Cys45Arg)" "1"
"0000630735" "00008236" "90" "133" "0" "133" "0" "c.133T>A" "r.(?)" "p.(Cys45Ser)" "1"
"0000630736" "00008236" "90" "158" "0" "158" "0" "c.158G>C" "r.(?)" "p.(Cys53Ser)" "1"
"0000630737" "00008236" "90" "223" "0" "223" "0" "c.223G>A" "r.(?)" "p.(Ala75Thr)" "1"
"0000630738" "00008236" "90" "268" "0" "268" "0" "c.268T>C" "r.(?)" "p.(Cys90Arg)" "1"
"0000630740" "00008236" "90" "107" "0" "107" "0" "c.107G>A" "r.(?)" "p.(Gly36Asp)" "1"
"0000630741" "00008236" "90" "957" "0" "957" "0" "c.957G>A" "r.(?)" "p.(Trp319*)" ""
"0000630743" "00008236" "90" "1498" "0" "1498" "0" "c.1498del" "r.(?)" "p.(Thr500Leufs*13)" ""
"0000630744" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000630745" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000630746" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000630747" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000630748" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000630749" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000630750" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000630751" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000630752" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000630753" "00008236" "90" "541" "0" "541" "0" "c.541T>C" "r.(?)" "p.(Cys181Arg)" "2"
"0000630754" "00008236" "90" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000630755" "00008236" "90" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000630756" "00008236" "90" "766" "0" "766" "0" "c.766A>G" "r.(?)" "p.(Ile256Val)" ""
"0000630760" "00008236" "90" "957" "0" "957" "0" "c.957del" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000630762" "00008236" "90" "957" "0" "957" "0" "c.957del" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000630763" "00008236" "90" "957" "0" "957" "0" "c.957del" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000630764" "00008236" "90" "957" "0" "957" "0" "c.957del" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000630765" "00008236" "90" "1479" "0" "1484" "0" "c.1479_1484del" "r.(?)" "p.(Met493_Trp494del)" "2"
"0000630766" "00008236" "90" "1501" "0" "1502" "0" "c.1501_1502del" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000630884" "00008236" "90" "0" "0" "0" "0" "c.-313_(285+1_286-1)[0]" "r.0?" "p.0?" "_1_1i"
"0000631002" "00008236" "90" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000631003" "00008236" "90" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000631004" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" ""
"0000631005" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" ""
"0000631007" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" ""
"0000631008" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" ""
"0000631009" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" ""
"0000631010" "00008236" "90" "244" "0" "251" "0" "c.244_251delinsGCAGCTCATCCAGTACGCCGAGCTGCA" "r.(?)" "p.(Phe82Alafs*54)" ""
"0000631011" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000631372" "00008236" "90" "1250" "0" "1250" "0" "c.1250G>A" "r.(?)" "p.(Arg417Gln)" ""
"0000631732" "00008236" "90" "65" "0" "65" "0" "c.65G>A" "r.(?)" "p.(Gly22Glu)" ""
"0000631734" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000631735" "00008236" "90" "538" "0" "538" "0" "c.538G>A" "r.(?)" "p.(Glu180Lys)" ""
"0000631736" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000631737" "00008236" "90" "1488" "0" "1488" "0" "c.1488G>A" "r.(?)" "p.(Trp496*)" ""
"0000631740" "00008236" "90" "710" "0" "710" "0" "c.710C>G" "r.(?)" "p.(Thr237Arg)" ""
"0000642878" "00008236" "90" "757" "0" "757" "0" "c.757C>T" "r.(?)" "p.(Arg253Cys)" ""
"0000642879" "00008236" "90" "983" "0" "983" "0" "c.983T>C" "r.(?)" "p.(Phe328Ser)" ""
"0000642882" "00008236" "90" "1015" "0" "1015" "0" "c.1015G>A" "r.(?)" "p.(Ala339Thr)" ""
"0000642975" "00008236" "90" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Asp470Asn)" ""
"0000642977" "00008236" "90" "1408" "0" "1408" "0" "c.1408G>A" "r.(?)" "p.(Asp470Asn)" ""
"0000642978" "00008236" "90" "1472" "0" "1472" "0" "c.1472C>A" "r.(?)" "p.(Ser491*)" ""
"0000643898" "00008236" "90" "182" "0" "182" "0" "c.182C>T" "r.(?)" "p.(Thr61Ile)" "1"
"0000644065" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000644066" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000644067" "00008236" "90" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" "1"
"0000644068" "00008236" "90" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" "1"
"0000644069" "00008236" "90" "264" "0" "264" "0" "c.264C>A" "r.(?)" "p.(Tyr88*)" "1"
"0000644070" "00008236" "90" "264" "0" "264" "0" "c.264C>A" "r.(?)" "p.(Tyr88*)" "1"
"0000644071" "00008236" "90" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Gly115Val)" "2"
"0000644072" "00008236" "90" "344" "0" "344" "0" "c.344G>T" "r.(?)" "p.(Gly115Val)" "2"
"0000644073" "00008236" "90" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226*)" "2"
"0000644075" "00008236" "90" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226*)" "2"
"0000644076" "00008236" "90" "1310" "0" "1310" "0" "c.1310T>C" "r.(?)" "p.(Ile437Thr)" "2"
"0000644077" "00008236" "90" "1310" "0" "1310" "0" "c.1310T>C" "r.(?)" "p.(Ile437Thr)" "2"
"0000648412" "00008236" "30" "4274" "0" "4274" "0" "c.*2660C>T" "r.(=)" "p.(=)" ""
"0000648413" "00008236" "90" "766" "0" "766" "0" "c.766A>G" "r.(?)" "p.(Ile256Val)" ""
"0000648414" "00008236" "30" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000669141" "00008236" "30" "4274" "0" "4274" "0" "c.*2660C>T" "r.(=)" "p.(=)" ""
"0000669142" "00008236" "30" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000685226" "00008236" "70" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000699915" "00008236" "50" "1327" "0" "1327" "0" "c.1327C>A" "r.(?)" "p.(Leu443Met)" ""
"0000713951" "00008236" "90" "1500" "0" "1506" "0" "c.1500_1506del" "r.(?)" "p.(Leu501Argfs*10)" ""
"0000732533" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000732656" "00008236" "90" "277" "0" "277" "0" "c.277C>T" "r.(?)" "p.(Gln93Ter)" ""
"0000732657" "00008236" "90" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" ""
"0000732658" "00008236" "70" "611" "0" "611" "0" "c.611G>T" "r.(?)" "p.(Cys204Phe)" ""
"0000735799" "00008236" "90" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000735801" "00008236" "90" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000735803" "00008236" "90" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000760000" "00008236" "50" "356" "0" "356" "0" "c.356G>T" "r.(?)" "p.(Gly119Val)" ""
"0000760052" "00008236" "50" "118" "0" "118" "0" "c.118G>C" "r.(?)" "p.(Glu40Gln)" ""
"0000760108" "00008236" "90" "341" "0" "341" "0" "c.341T>G" "r.(?)" "p.(Ile114Ser)" "2"
"0000760109" "00008236" "90" "1395" "0" "1396" "0" "c.1395_1396insT" "r.(?)" "p.(Arg466SerfsTer6)" "2"
"0000760110" "00008236" "90" "1613" "0" "1613" "0" "c.1613A>C" "r.(?)" "p.(Ter538SerextTer2)" "2"
"0000760111" "00008236" "90" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429ArgfsTer28)" "2"
"0000760112" "00008236" "90" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429ArgfsTer28)" "2"
"0000760113" "00008236" "90" "470" "0" "470" "0" "c.470T>C" "r.(?)" "p.(Met157Thr)" "2"
"0000760114" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000760115" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000760116" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000760125" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000760180" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000760181" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000760435" "00008236" "50" "961" "0" "961" "0" "c.961G>A" "r.(?)" "p.(Val321Ile)" ""
"0000764882" "00008236" "70" "664" "0" "664" "0" "c.664T>C" "r.(?)" "p.(Trp222Arg)" ""
"0000765439" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000765808" "00008236" "70" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000765997" "00008236" "70" "160" "0" "160" "0" "c.160C>T" "r.(?)" "p.(Gln54Ter)" ""
"0000765998" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000765999" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000766000" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000766001" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000766002" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000766003" "00008236" "70" "456" "0" "456" "0" "c.456C>G" "r.(?)" "p.(Asn152Lys)" ""
"0000766004" "00008236" "70" "470" "0" "470" "0" "c.470T>C" "r.(?)" "p.(Met157Thr)" ""
"0000766005" "00008236" "70" "470" "0" "470" "0" "c.470T>C" "r.(?)" "p.(Met157Thr)" ""
"0000766006" "00008236" "70" "539" "0" "540" "0" "c.539_540del" "r.(?)" "p.(Glu180ValfsTer9)" ""
"0000766007" "00008236" "70" "676" "0" "676" "0" "c.676T>A" "r.(?)" "p.(Trp226Arg)" ""
"0000766008" "00008236" "70" "1210" "0" "1211" "0" "c.1210_1211del" "r.(?)" "p.(Leu404ValfsTer54)" ""
"0000766009" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000766010" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000766011" "00008236" "70" "0" "0" "0" "0" "c.-313_*5467{0}" "r.0" "p.0" "_1_2_"
"0000766017" "00008236" "30" "653" "0" "676" "0" "c.653_676dup" "r.(?)" "p.(Phe218_Val225dup)" ""
"0000785466" "00008236" "90" "1501" "0" "1502" "0" "c.1501_1502del" "r.(?)" "p.(Leu501SerfsTer33)" ""
"0000785467" "00008236" "90" "1501" "0" "1502" "0" "c.1501_1502del" "r.(?)" "p.(Leu501SerfsTer33)" ""
"0000785468" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000785469" "00008236" "90" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" ""
"0000785470" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000785471" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" ""
"0000785472" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000785490" "00008236" "90" "662" "0" "663" "0" "c.662_663insA" "r.(?)" "p.(Trp222LeufsTer26)" ""
"0000785491" "00008236" "90" "1507" "0" "1508" "0" "c.1507_1508del" "r.(?)" "p.(Thr503ValfsTer31)" ""
"0000785492" "00008236" "90" "1488" "0" "1488" "0" "c.1488G>A" "r.(?)" "p.(Trp496Ter)" ""
"0000785493" "00008236" "90" "124" "0" "124" "0" "c.124G>T" "r.(?)" "p.(Glu42Ter)" ""
"0000785494" "00008236" "90" "118" "0" "118" "0" "c.118G>T" "r.(?)" "p.(Glu40Ter)" ""
"0000785495" "00008236" "90" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" ""
"0000785511" "00008236" "90" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000786522" "00008236" "90" "288" "0" "288" "0" "c.288del" "r.(?)" "p.(Phe97Serfs*36)" ""
"0000788408" "00008236" "50" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" "2"
"0000790147" "00008236" "70" "957" "0" "957" "0" "c.957G>A" "r.(?)" "p.(Trp319*)" "2"
"0000790148" "00008236" "70" "1488" "0" "1488" "0" "c.1488G>A" "r.(?)" "p.(Trp496*)" "2"
"0000790149" "00008236" "70" "1333" "0" "1333" "0" "c.1333A>C" "r.(?)" "p.(Thr445Pro)" "2"
"0000790150" "00008236" "70" "668" "0" "668" "0" "c.668T>A" "r.(?)" "p.(Met223Lys)" "2"
"0000793846" "00008236" "70" "1500" "0" "1506" "0" "c.1500_1506del" "r.(?)" "p.(Leu501Argfs*10)" "2"
"0000794247" "00008236" "70" "160" "0" "160" "0" "c.160C>T" "r.(?)" "p.(Gln54*)" ""
"0000794937" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000794938" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000794939" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000794940" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000794941" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000794942" "00008236" "70" "631" "0" "631" "0" "c.631T>C" "r.(?)" "p.(Tyr211His)" "2"
"0000794943" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285delGACA" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000794944" "00008236" "70" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Trp494*)" "2"
"0000794945" "00008236" "70" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Trp494*)" "2"
"0000794946" "00008236" "70" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Trp494*)" "2"
"0000794947" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" "2"
"0000794948" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" "2"
"0000795589" "00008236" "70" "1463" "0" "1463" "0" "c.1463G>A" "r.(?)" "p.(Gly488Asp)" "2"
"0000795590" "00008236" "50" "476" "0" "476" "0" "c.476T>C" "r.(?)" "p.(Met159Thr)" "2"
"0000795593" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000795594" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000795595" "00008236" "50" "182" "0" "182" "0" "c.182C>T" "r.(?)" "p.(Thr61Ile)" "1"
"0000795596" "00008236" "90" "1482" "0" "1482" "0" "c.1482G>A" "r.(?)" "p.(Trp494*)" "2"
"0000795597" "00008236" "50" "1078" "0" "1078" "0" "c.1078A>T" "r.(?)" "p.(Ile360Phe)" "2"
"0000795598" "00008236" "50" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" "2"
"0000795599" "00008236" "50" "283" "0" "283" "0" "c.283C>G" "r.(?)" "p.(Gln95Glu)" "1"
"0000795603" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000796063" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000796064" "00008236" "90" "380" "0" "380" "0" "c.380G>A" "r.(?)" "p.(Arg127His)" "2"
"0000796065" "00008236" "90" "631" "0" "631" "0" "c.631T>C" "r.(?)" "p.(Tyr211His)" "2"
"0000796066" "00008236" "90" "631" "0" "631" "0" "c.631T>C" "r.(?)" "p.(Tyr211His)" "2"
"0000797253" "00008236" "50" "182" "0" "182" "0" "c.182C>T" "r.(?)" "p.(Thr61Ile)" ""
"0000797254" "00008236" "90" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" ""
"0000797255" "00008236" "50" "341" "0" "341" "0" "c.341T>A" "r.(?)" "p.(Ile114Asn)" ""
"0000797256" "00008236" "50" "1504" "0" "1505" "0" "c.1504_1505insTGTTGGA" "r.(?)" "p.(His502LeufsTer35)" ""
"0000797257" "00008236" "10" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000797258" "00008236" "10" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000797259" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000797260" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000797261" "00008236" "50" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Pro14SerfsTer44)" ""
"0000797262" "00008236" "10" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000797263" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000797264" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000797265" "00008236" "50" "478" "0" "478" "0" "c.478G>C" "r.(?)" "p.(Glu160Gln)" ""
"0000797266" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000797267" "00008236" "10" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000797268" "00008236" "10" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000797269" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797270" "00008236" "10" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000797271" "00008236" "50" "204" "0" "204" "0" "c.204del" "r.(?)" "p.(His69ThrfsTer11)" ""
"0000797272" "00008236" "50" "134" "0" "134" "0" "c.134G>C" "r.(?)" "p.(Cys45Ser)" ""
"0000797273" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000797274" "00008236" "90" "747" "0" "747" "0" "c.747dup" "r.(?)" "p.(Tyr250LeufsTer3)" ""
"0000797275" "00008236" "90" "1010" "0" "1010" "0" "c.1010dup" "r.(?)" "p.(His337GlnfsTer2)" ""
"0000797276" "00008236" "90" "158" "0" "158" "0" "c.158del" "r.(?)" "p.(Cys53SerfsTer8)" ""
"0000797277" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000797278" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797279" "00008236" "90" "701" "0" "701" "0" "c.701C>T" "r.(?)" "p.(Thr234Ile)" ""
"0000797280" "00008236" "90" "1325" "0" "1325" "0" "c.1325T>A" "r.(?)" "p.(Val442Glu)" ""
"0000797281" "00008236" "90" "757" "0" "757" "0" "c.757C>T" "r.(?)" "p.(Arg253Cys)" ""
"0000797282" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000797283" "00008236" "90" "224" "0" "224" "0" "c.224C>G" "r.(?)" "p.(Ala75Gly)" ""
"0000797284" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000797285" "00008236" "90" "1488" "0" "1488" "0" "c.1488G>A" "r.(?)" "p.(Trp496Ter)" ""
"0000797286" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000797287" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797288" "00008236" "90" "317" "0" "317" "0" "c.317G>C" "r.(?)" "p.(Cys106Ser)" ""
"0000797289" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797290" "00008236" "90" "936" "0" "936" "0" "c.936dup" "r.(?)" "p.(Gly313TrpfsTer26)" ""
"0000797291" "00008236" "90" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" ""
"0000797292" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797293" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000797294" "00008236" "90" "905" "0" "905" "0" "c.905G>A" "r.(?)" "p.(Cys302Tyr)" ""
"0000797295" "00008236" "90" "917" "0" "936" "0" "c.917_936del" "r.(?)" "p.(Phe306TrpfsTer26)" ""
"0000797296" "00008236" "90" "1188" "0" "1192" "0" "c.1188_1192del" "r.(?)" "p.(Phe396LeufsTer61)" ""
"0000797297" "00008236" "90" "1310" "0" "1310" "0" "c.1310T>C" "r.(?)" "p.(Ile437Thr)" ""
"0000797298" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797299" "00008236" "90" "382" "0" "382" "0" "c.382T>C" "r.(?)" "p.(Cys128Arg)" ""
"0000797300" "00008236" "90" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" ""
"0000797301" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428SerfsTer2)" ""
"0000797302" "00008236" "90" "621" "0" "642" "0" "c.621_642del" "r.(?)" "p.(Asp207GlufsTer26)" ""
"0000797303" "00008236" "90" "400" "0" "400" "0" "c.400G>T" "r.(?)" "p.(Glu134Ter)" ""
"0000797304" "00008236" "90" "981" "0" "981" "0" "c.981G>A" "r.(?)" "p.(Trp327Ter)" ""
"0000798121" "00008236" "70" "1010" "0" "1010" "0" "c.1010dup" "r.(?)" "p.(His337Glnfs*2)" "2"
"0000798122" "00008236" "70" "1010" "0" "1010" "0" "c.1010dup" "r.(?)" "p.(His337Glnfs*2)" "2"
"0000798123" "00008236" "70" "1010" "0" "1010" "0" "c.1010dup" "r.(?)" "p.(His337Glnfs*2)" "2"
"0000798390" "00008236" "90" "1250" "0" "1250" "0" "c.1250G>C" "r.(?)" "p.(Arg417Pro)" "2"
"0000798402" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000798403" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000798404" "00008236" "90" "957" "0" "957" "0" "c.957G>A" "r.(?)" "p.(Trp319*)" "2"
"0000798405" "00008236" "90" "1005" "0" "1005" "0" "c.1005G>C" "r.(?)" "p.(Trp335Cys)" "2"
"0000798406" "00008236" "90" "1024" "0" "1024" "0" "c.1024A>G" "r.(?)" "p.(Met342Val)" "2"
"0000798407" "00008236" "90" "1463" "0" "1463" "0" "c.1463G>A" "r.(?)" "p.(Gly488Asp)" "2"
"0000805458" "00008236" "70" "1311" "0" "1311" "0" "c.1311del" "r.(?)" "p.(Ile437Metfs*15)" ""
"0000811541" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000811542" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000811543" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000811544" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000811545" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000811546" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000811547" "00008236" "70" "1475" "0" "1475" "0" "c.1475del" "r.(?)" "p.(Gly492Alafs*21)" "2"
"0000811548" "00008236" "70" "1475" "0" "1475" "0" "c.1475del" "r.(?)" "p.(Gly492Alafs*21)" "2"
"0000811549" "00008236" "70" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" "1"
"0000811550" "00008236" "70" "107" "0" "107" "0" "c.107G>A" "r.(?)" "p.(Gly36Asp)" "1"
"0000811551" "00008236" "70" "223" "0" "223" "0" "c.223G>A" "r.(?)" "p.(Ala75Thr)" "1"
"0000811552" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" "1"
"0000811553" "00008236" "70" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000811554" "00008236" "70" "485" "0" "485" "0" "c.485del" "r.(?)" "p.(Pro162Glnfs*33)" "2"
"0000811555" "00008236" "70" "141" "0" "141" "0" "c.141dup" "r.(?)" "p.(Ile48Hisfs*82)" "1"
"0000811556" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000811557" "00008236" "70" "456" "0" "456" "0" "c.456C>A" "r.(?)" "p.(Asn152Lys)" "2"
"0000811558" "00008236" "70" "997" "0" "1000" "0" "c.997_1000dup" "r.(?)" "p.(Lys334Thrfs*6)" "2"
"0000811681" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000811682" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000811683" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000811684" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000811685" "00008236" "70" "716" "0" "716" "0" "c.716T>C" "r.(?)" "p.(Leu239Pro)" ""
"0000811686" "00008236" "70" "716" "0" "716" "0" "c.716T>C" "r.(?)" "p.(Leu239Pro)" ""
"0000811785" "00008236" "70" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" ""
"0000811786" "00008236" "70" "747" "0" "747" "0" "c.747dup" "r.(?)" "p.(Tyr250LeufsTer3)" ""
"0000811787" "00008236" "70" "686" "0" "686" "0" "c.686T>C" "r.(?)" "p.(Leu229Pro)" ""
"0000811788" "00008236" "70" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000812532" "00008236" "70" "341" "0" "341" "0" "c.341T>C" "r.(?)" "p.(Ile114Thr)" ""
"0000812545" "00008236" "70" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" ""
"0000812546" "00008236" "90" "1477" "0" "1478" "0" "c.1477_1478dup" "r.(?)" "p.(Met493Ilefs*21)" ""
"0000812553" "00008236" "70" "326" "0" "328" "0" "c.326_328del" "r.(?)" "p.(Lys109del)" ""
"0000812581" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000812610" "00008236" "70" "757" "0" "757" "0" "c.757C>T" "r.(?)" "p.(Arg253Cys)" ""
"0000812621" "00008236" "90" "509" "0" "509" "0" "c.509dup" "r.(?)" "p.(His171Serfs*19)" ""
"0000812650" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000812656" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000812689" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000812691" "00008236" "90" "51" "0" "52" "0" "c.51_52insCCGGGGGCGC" "r.(?)" "p.(Gly18Profs*115)" ""
"0000812692" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000812693" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000812712" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000812716" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000812777" "00008236" "90" "142" "0" "142" "0" "c.142dup" "r.(?)" "p.(Ile48Asnfs*82)" ""
"0000812782" "00008236" "90" "380" "0" "380" "0" "c.380del" "r.(?)" "p.(Arg127Profs*6)" ""
"0000812788" "00008236" "70" "316" "0" "316" "0" "c.316T>C" "r.(?)" "p.(Cys106Arg)" ""
"0000812798" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000812829" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" ""
"0000813886" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000814872" "00008236" "70" "1034" "0" "1054" "0" "c.1034_1054delCTTATTTCCACATTGCAGCCT" "r.(?)" "p.(Ser345_Ala351del)" ""
"0000814873" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285delGACA" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000814874" "00008236" "70" "133" "0" "133" "0" "c.133T>C" "r.(?)" "p.(Cys45Arg)" ""
"0000814875" "00008236" "70" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" ""
"0000814876" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285delGACA" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000814877" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285delGACA" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000814878" "00008236" "70" "133" "0" "133" "0" "c.133T>A" "r.(?)" "p.(Cys45Ser)" ""
"0000814879" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285delGACA" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000814880" "00008236" "70" "1000" "0" "1001" "0" "c.1000_1001insCTCA" "r.(?)" "p.(Lys334Thrfs*6)" ""
"0000814881" "00008236" "70" "757" "0" "757" "0" "c.757C>T" "r.(?)" "p.(Arg253Cys)" ""
"0000814882" "00008236" "70" "118" "0" "118" "0" "c.118G>T" "r.(?)" "p.(Glu40*)" ""
"0000814883" "00008236" "70" "284" "0" "284" "0" "c.284A>T" "r.(?)" "p.(Gln95Leu)" ""
"0000814884" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000818244" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000818246" "00008236" "90" "227" "0" "227" "0" "c.227delA" "r.(?)" "p.(Glu76Glyfs*4)" "1"
"0000818563" "00008236" "90" "747" "0" "747" "0" "c.747dupC" "r.(?)" "p.(Tyr250Leufs*3)" ""
"0000818564" "00008236" "90" "747" "0" "747" "0" "c.747dupC" "r.(?)" "p.(Tyr250Leufs*3)" ""
"0000818565" "00008236" "90" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" ""
"0000818566" "00008236" "90" "217" "0" "234" "0" "c.217_234del" "r.(?)" "p.(Thr73_Gln78del)" ""
"0000818567" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000818568" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000818569" "00008236" "50" "1328" "0" "1328" "0" "c.1328T>C" "r.(?)" "p.(Leu443Pro)" ""
"0000818570" "00008236" "50" "1328" "0" "1328" "0" "c.1328T>C" "r.(?)" "p.(Leu443Pro)" ""
"0000818573" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000818574" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000818575" "00008236" "70" "1188" "0" "1192" "0" "c.1188_1192del" "r.(?)" "p.(Phe396Leufs*61)" ""
"0000818576" "00008236" "70" "1188" "0" "1192" "0" "c.1188_1192del" "r.(?)" "p.(Phe396Leufs*61)" ""
"0000818577" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000818578" "00008236" "90" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000821255" "00008236" "70" "286" "-2" "286" "-2" "c.286-2A>T" "r.spl" "p.(?)" ""
"0000823627" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000823628" "00008236" "90" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Pro14SerfsTer44)" "1"
"0000825939" "00008236" "70" "1322" "0" "1322" "0" "c.1322C>T" "r.(?)" "p.(Ser441Leu)" "2"
"0000825969" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" "2"
"0000826172" "00008236" "70" "543" "0" "543" "0" "c.543T>A" "r.(?)" "p.(Cys181*)" "2"
"0000826176" "00008236" "70" "1188" "0" "1192" "0" "c.1188_1192del" "r.(?)" "p.(Phe396Leufs*61)" "2"
"0000826239" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" "2"
"0000826267" "00008236" "70" "1133" "0" "1133" "0" "c.1133A>G" "r.(?)" "p.(Tyr378Cys)" "2"
"0000862737" "00008236" "50" "1255" "0" "1255" "0" "c.1255A>G" "r.(?)" "p.(Asn419Asp)" ""
"0000878028" "00008236" "70" "1501" "0" "1502" "0" "c.1501_1502delCT" "r.(?)" "p.(Leu501Serfs*33)" ""
"0000878029" "00008236" "70" "1501" "0" "1502" "0" "c.1501_1502delCT" "r.(?)" "p.(Leu501Serfs*33)" ""
"0000878030" "00008236" "70" "1501" "0" "1502" "0" "c.1501_1502delCT" "r.(?)" "p.(Leu501Serfs*33)" ""
"0000878031" "00008236" "70" "1501" "0" "1502" "0" "c.1501_1502delCT" "r.(?)" "p.(Leu501Serfs*33)" ""
"0000878032" "00008236" "70" "1501" "0" "1502" "0" "c.1501_1502delCT" "r.(?)" "p.(Leu501Serfs*33)" ""
"0000878215" "00008236" "70" "107" "0" "107" "0" "c.107G>A" "r.(?)" "p.(Gly36Asp)" "1"
"0000878216" "00008236" "70" "314" "0" "314" "0" "c.314T>C" "r.(?)" "p.(Met105Thr)" "2"
"0000878217" "00008236" "70" "314" "0" "314" "0" "c.314T>C" "r.(?)" "p.(Met105Thr)" "2"
"0000878218" "00008236" "70" "314" "0" "314" "0" "c.314T>C" "r.(?)" "p.(Met105Thr)" "2"
"0000878219" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878220" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878221" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878222" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878223" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878224" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878225" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878226" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878227" "00008236" "70" "469" "0" "469" "0" "c.469A>G" "r.(?)" "p.(Met157Val)" "2"
"0000878228" "00008236" "70" "957" "0" "957" "0" "c.957delG" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000878229" "00008236" "70" "957" "0" "957" "0" "c.957delG" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000878230" "00008236" "70" "957" "0" "957" "0" "c.957delG" "r.(?)" "p.(Trp319Cysfs*5)" "2"
"0000878231" "00008236" "70" "1490" "0" "1490" "0" "c.1490C>T" "r.(?)" "p.(Ser497Phe)" "2"
"0000878232" "00008236" "70" "" "0" "" "0" "c.1498de1A" "r.(?)" "p.(Thr500Leufs*13)" "2"
"0000878233" "00008236" "70" "" "0" "" "0" "c.1498de1A" "r.(?)" "p.(Thr500Leufs*13)" "2"
"0000878234" "00008236" "70" "" "0" "" "0" "c.1501_1502de1CT" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000878235" "00008236" "70" "" "0" "" "0" "c.1501_1502de1CT" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000878236" "00008236" "70" "" "0" "" "0" "c.1501_1502de1CT" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000878237" "00008236" "70" "" "0" "" "0" "c.1501_1502de1CT" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000878238" "00008236" "70" "" "0" "" "0" "c.1501_1502de1CT" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000878239" "00008236" "70" "" "0" "" "0" "c.1501_1502de1CT" "r.(?)" "p.(Leu501Serfs*33)" "2"
"0000878240" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" "2"
"0000878241" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" "2"
"0000878242" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" "2"
"0000878296" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878297" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878298" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878299" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878300" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878301" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878302" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878303" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878304" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878305" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878306" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878307" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878308" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878309" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878310" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878311" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878312" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878313" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" "1"
"0000878314" "00008236" "70" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "1"
"0000878315" "00008236" "70" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "1"
"0000878316" "00008236" "70" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "1"
"0000878317" "00008236" "70" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "1"
"0000878318" "00008236" "70" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "1"
"0000878319" "00008236" "70" "1286" "0" "1290" "0" "c.1286_1290del" "r.(?)" "p.(Lys429Argfs*28)" "1"
"0000878338" "00008236" "70" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000878339" "00008236" "70" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" ""
"0000878340" "00008236" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" ""
"0000878341" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505*)" ""
"0000878342" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878343" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878344" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878345" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878346" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878347" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878348" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878349" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878350" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878351" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878352" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878353" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878354" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878355" "00008236" "70" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" ""
"0000878356" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878357" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878358" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878359" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878360" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878361" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878362" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878363" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878364" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878365" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878366" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878367" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878368" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878369" "00008236" "70" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" ""
"0000878371" "00008236" "50" "1109" "0" "1109" "0" "c.1109C>G" "r.(?)" "p.(Ala370Gly)" ""
"0000878372" "00008236" "50" "609" "0" "609" "0" "c.609G>T" "r.(?)" "p.(Lys203Asn)" ""
"0000878373" "00008236" "50" "1396" "0" "1396" "0" "c.1396C>T" "r.(?)" "p.(Arg466Trp)" ""
"0000878397" "00008236" "70" "316" "0" "316" "0" "c.316T>G" "r.(?)" "p.(Cys106Gly)" ""
"0000878398" "00008236" "70" "470" "0" "470" "0" "c.470T>A" "r.(?)" "p.(Met157Lys)" ""
"0000878399" "00008236" "70" "470" "0" "470" "0" "c.470T>A" "r.(?)" "p.(Met157Lys)" ""
"0000878400" "00008236" "70" "633" "0" "633" "0" "c.633del" "r.(?)" "p.(Tyr211Ter)" ""
"0000878401" "00008236" "70" "1282" "0" "1285" "0" "c.1282_1285del" "r.(?)" "p.(Asp428Serfs*2)" ""
"0000878402" "00008236" "70" "1508" "0" "1508" "0" "c.1508dup" "r.(?)" "p.(Trp504Valfs*31)" ""
"0000878403" "00008236" "70" "1463" "0" "1463" "0" "c.1463G>T" "r.(?)" "p.(Gly488Val)" ""
"0000878404" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878405" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878406" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878407" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878408" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878409" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878410" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878411" "00008236" "70" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878412" "00008236" "70" "1487" "0" "1487" "0" "c.1487G>A" "r.(?)" "p.(Trp496Ter)" ""
"0000878413" "00008236" "70" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226Ter)" ""
"0000878414" "00008236" "70" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226Ter)" ""
"0000878415" "00008236" "70" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226Ter)" ""
"0000878417" "00008236" "90" "40" "0" "49" "0" "c.40_49del" "r.(?)" "p.(Pro14Serfs*44)" ""
"0000878418" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000878419" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000878420" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878421" "00008236" "90" "313" "0" "313" "0" "c.313A>G" "r.(?)" "p.(Met105Val)" ""
"0000878429" "00008236" "90" "0" "0" "0" "0" "c.-313_*5467{0}" "r.0" "p.0" "_1_2_"
"0000878455" "00008236" "70" "0" "0" "0" "0" "c.?" "r.(?)" "p.?" "1"
"0000878456" "00008236" "70" "242" "0" "242" "0" "c.242insG" "r.(?)" "p.(Thr83HisfsTer47)" "1"
"0000878457" "00008236" "70" "151" "0" "151" "0" "c.151T>A" "r.(?)" "p.(Ser51Thr)" "1"
"0000878458" "00008236" "70" "169" "0" "169" "0" "c.169G>T" "r.(?)" "p.(Gly57Cys)" "1"
"0000878459" "00008236" "70" "169" "0" "169" "0" "c.169G>T" "r.(?)" "p.(Gly57Cys)" "1"
"0000878460" "00008236" "70" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878461" "00008236" "70" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" "2"
"0000878462" "00008236" "70" "349" "0" "349" "0" "c.349T>C" "r.(?)" "p.(Cys117Arg)" "2"
"0000878463" "00008236" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" "2"
"0000878464" "00008236" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" "2"
"0000878465" "00008236" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" "2"
"0000878466" "00008236" "70" "542" "0" "542" "0" "c.542G>A" "r.(?)" "p.(Cys181Tyr)" "2"
"0000878467" "00008236" "70" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Glu217Gly)" "2"
"0000878468" "00008236" "70" "758" "0" "758" "0" "c.758G>A" "r.(?)" "p.(Arg253His)" "2"
"0000878469" "00008236" "70" "834" "0" "834" "0" "c.834A>G" "r.(?)" "p.(Glu278=)" "2"
"0000878470" "00008236" "70" "834" "0" "834" "0" "c.834A>G" "r.(?)" "p.(Glu278=)" "2"
"0000878471" "00008236" "70" "1004" "0" "1004" "0" "c.1004G>A" "r.(?)" "p.(Trp335Ter)" "2"
"0000878472" "00008236" "70" "1074" "0" "1074" "0" "c.1074A>C" "r.(?)" "p.(Lys358Asn)" "2"
"0000878473" "00008236" "70" "1074" "0" "1074" "0" "c.1074A>C" "r.(?)" "p.(Lys358Asn)" "2"
"0000878474" "00008236" "70" "1271" "0" "1271" "0" "c.1271G>A" "r.(?)" "p.(Gly424Glu)" "2"
"0000878475" "00008236" "70" "1513" "0" "1513" "0" "c.1513C>T" "r.(?)" "p.(Gln505Ter)" "2"
"0000878476" "00008236" "70" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Gly530Glu)" "2"
"0000878477" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878478" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878479" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878480" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878481" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878482" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878483" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878484" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878485" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878486" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878487" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878488" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878489" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878490" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878491" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878492" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878493" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878494" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878495" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878496" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878497" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878498" "00008236" "50" "97" "0" "97" "0" "c.97C>T" "r.(?)" "p.(Pro33Ser)" "1"
"0000878499" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878500" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878501" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878502" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878503" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878504" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878505" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878506" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878507" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878508" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878509" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878510" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878511" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878512" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878513" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878514" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878515" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878516" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878517" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878518" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878519" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878520" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878521" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878522" "00008236" "50" "502" "0" "502" "0" "c.502C>T" "r.(?)" "p.(Pro168Ser)" "2"
"0000878544" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878545" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878546" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878547" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878548" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878549" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878550" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878551" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878552" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878553" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878554" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878555" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878558" "00008236" "50" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" "1"
"0000878575" "00008236" "90" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" "1"
"0000878576" "00008236" "90" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" "1"
"0000878577" "00008236" "90" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" "1"
"0000878578" "00008236" "90" "134" "0" "134" "0" "c.134G>A" "r.(?)" "p.(Cys45Tyr)" "1"
"0000878579" "00008236" "90" "173" "0" "173" "0" "c.173A>G" "r.(?)" "p.(Tyr58Cys)" "1"
"0000878580" "00008236" "90" "173" "0" "173" "0" "c.173A>G" "r.(?)" "p.(Tyr58Cys)" "1"
"0000878581" "00008236" "90" "173" "0" "173" "0" "c.173A>G" "r.(?)" "p.(Tyr58Cys)" "1"
"0000878582" "00008236" "90" "173" "0" "173" "0" "c.173A>G" "r.(?)" "p.(Tyr58Cys)" "1"
"0000878583" "00008236" "90" "173" "0" "173" "0" "c.173A>G" "r.(?)" "p.(Tyr58Cys)" "1"
"0000878584" "00008236" "90" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226*)" "1"
"0000878585" "00008236" "90" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226*)" "1"
"0000878586" "00008236" "90" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226*)" "1"
"0000878587" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" "1"
"0000878588" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" "1"
"0000878589" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" "1"
"0000878590" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" "1"
"0000878591" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" "1"
"0000878592" "00008236" "90" "610" "0" "610" "0" "c.610T>C" "r.(?)" "p.(Cys204Arg)" "1"
"0000878593" "00008236" "90" "1487" "0" "1487" "0" "c.1487G>A" "r.(?)" "p.(Trp496*)" "1"
"0000878594" "00008236" "90" "1487" "0" "1487" "0" "c.1487G>A" "r.(?)" "p.(Trp496*)" "1"
"0000878636" "00008236" "90" "1250" "0" "1250" "0" "c.1250G>A" "r.(?)" "p.(Arg417Gln)" ""
"0000880247" "00008236" "70" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000880248" "00008236" "70" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000880249" "00008236" "70" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000890208" "00008236" "30" "939" "0" "939" "0" "c.939A>G" "r.(?)" "p.(Gly313=)" ""
"0000898131" "00008236" "70" "678" "0" "678" "0" "c.678G>A" "r.(?)" "p.(Trp226*)" ""
"0000898132" "00008236" "90" "1237" "0" "1237" "0" "c.1237T>G" "r.(?)" "p.(Leu413Val)" ""
"0000898134" "00008236" "70" "427" "0" "428" "0" "c.427_428delCT" "r.(?)" "p.(Leu143Glufs*21)" ""
"0000954039" "00008236" "70" "752" "0" "752" "0" "c.752C>G" "r.(?)" "p.(Pro251Arg)" ""
"0000954040" "00008236" "90" "205" "0" "205" "0" "c.205C>T" "r.(?)" "p.(His69Tyr)" ""
"0000954041" "00008236" "90" "470" "0" "470" "0" "c.470T>C" "r.(?)" "p.(Met157Thr)" ""
"0000958263" "00008236" "70" "1474" "0" "1474" "0" "c.1474G>C" "r.(?)" "p.(Gly492Arg)" ""
"0000958268" "00008236" "90" "1501" "0" "1502" "0" "c.1501_1502del" "r.(?)" "p.(Leu501SerfsTer33)" ""
"0000966623" "00008236" "90" "956" "0" "956" "0" "c.956G>A" "r.(?)" "p.(Trp319*)" ""
"0000999533" "00008236" "50" "737" "0" "737" "0" "c.737C>T" "r.(?)" "p.(Ser246Phe)" ""
"0001019628" "00008236" "90" "23" "0" "23" "0" "c.23del" "r.(?)" "p.(Pro8ArgfsTer53)" ""
"0001038829" "00008236" "50" "1340" "0" "1340" "0" "c.1340C>G" "r.(?)" "p.(Pro447Arg)" ""
"0001054030" "00008236" "50" "1196" "0" "1196" "0" "c.1196T>C" "r.(?)" "p.(Leu399Ser)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 601
"{{screeningid}}" "{{variantid}}"
"0000107025" "0000172767"
"0000107026" "0000172768"
"0000107027" "0000172769"
"0000107028" "0000172770"
"0000107029" "0000172771"
"0000107030" "0000172772"
"0000107031" "0000172773"
"0000107032" "0000172774"
"0000107033" "0000172775"
"0000107034" "0000172776"
"0000107035" "0000172777"
"0000107036" "0000172778"
"0000107037" "0000172779"
"0000107038" "0000172780"
"0000107039" "0000172781"
"0000107040" "0000172782"
"0000107041" "0000172783"
"0000107042" "0000172784"
"0000107043" "0000172785"
"0000107044" "0000172786"
"0000107046" "0000172788"
"0000107047" "0000172789"
"0000107048" "0000172790"
"0000107049" "0000172791"
"0000107050" "0000172792"
"0000107051" "0000172793"
"0000107052" "0000172794"
"0000107053" "0000172795"
"0000107054" "0000172796"
"0000107054" "0000880247"
"0000107055" "0000172797"
"0000107056" "0000172798"
"0000107057" "0000172799"
"0000107058" "0000172800"
"0000266322" "0000596940"
"0000266324" "0000596942"
"0000266325" "0000596988"
"0000266326" "0000596989"
"0000266360" "0000597021"
"0000266361" "0000597022"
"0000266362" "0000597023"
"0000266363" "0000597024"
"0000266364" "0000597025"
"0000266365" "0000597026"
"0000266367" "0000597027"
"0000266369" "0000597028"
"0000266407" "0000597073"
"0000266408" "0000597074"
"0000266409" "0000597075"
"0000266411" "0000597076"
"0000275373" "0000629371"
"0000275378" "0000629678"
"0000275478" "0000629499"
"0000275479" "0000629500"
"0000276163" "0000630279"
"0000276165" "0000630280"
"0000276165" "0000630281"
"0000276167" "0000630884"
"0000276599" "0000630724"
"0000276601" "0000630726"
"0000276603" "0000630728"
"0000276605" "0000630730"
"0000276607" "0000630732"
"0000276609" "0000630734"
"0000276610" "0000630735"
"0000276611" "0000630736"
"0000276613" "0000630737"
"0000276614" "0000630738"
"0000276616" "0000630740"
"0000276617" "0000630741"
"0000276618" "0000630743"
"0000276619" "0000630744"
"0000276621" "0000630745"
"0000276622" "0000630746"
"0000276623" "0000630747"
"0000276624" "0000630748"
"0000276625" "0000630749"
"0000276626" "0000630750"
"0000276627" "0000630751"
"0000276628" "0000630752"
"0000276629" "0000630753"
"0000276630" "0000630754"
"0000276630" "0000630755"
"0000276631" "0000630756"
"0000276635" "0000630760"
"0000276637" "0000630762"
"0000276638" "0000630763"
"0000276639" "0000630764"
"0000276640" "0000630765"
"0000276642" "0000630766"
"0000276852" "0000631002"
"0000276853" "0000631003"
"0000276854" "0000631004"
"0000276855" "0000631005"
"0000276856" "0000631007"
"0000276858" "0000631008"
"0000276859" "0000631009"
"0000276860" "0000631010"
"0000276861" "0000631011"
"0000276982" "0000631372"
"0000276985" "0000878417"
"0000276987" "0000631732"
"0000276988" "0000631734"
"0000276988" "0000631735"
"0000276989" "0000631736"
"0000276989" "0000631737"
"0000276990" "0000631740"
"0000287092" "0000642878"
"0000287093" "0000642879"
"0000287095" "0000642882"
"0000287099" "0000642975"
"0000287189" "0000642977"
"0000287190" "0000642978"
"0000288096" "0000643898"
"0000288200" "0000644065"
"0000288201" "0000644066"
"0000288202" "0000644067"
"0000288203" "0000644068"
"0000288204" "0000644069"
"0000288205" "0000644070"
"0000288206" "0000644071"
"0000288207" "0000644072"
"0000288209" "0000644073"
"0000288210" "0000644075"
"0000288211" "0000644076"
"0000288213" "0000644077"
"0000291723" "0000648412"
"0000291724" "0000648413"
"0000291725" "0000648414"
"0000305453" "0000669141"
"0000305454" "0000669142"
"0000310315" "0000685226"
"0000317281" "0000699915"
"0000329603" "0000713951"
"0000334602" "0000732533"
"0000334676" "0000732656"
"0000334677" "0000732657"
"0000334678" "0000732658"
"0000336427" "0000735799"
"0000336428" "0000735801"
"0000336429" "0000735803"
"0000360193" "0000760000"
"0000360206" "0000760052"
"0000360220" "0000760108"
"0000360221" "0000760109"
"0000360222" "0000760110"
"0000360222" "0000760125"
"0000360223" "0000760111"
"0000360224" "0000760112"
"0000360225" "0000760113"
"0000360226" "0000760114"
"0000360227" "0000760115"
"0000360228" "0000760116"
"0000360288" "0000760180"
"0000360288" "0000760435"
"0000360289" "0000760181"
"0000364120" "0000764882"
"0000364574" "0000765439"
"0000364866" "0000765808"
"0000365045" "0000765997"
"0000365046" "0000765998"
"0000365047" "0000765999"
"0000365048" "0000766000"
"0000365049" "0000766001"
"0000365050" "0000766002"
"0000365051" "0000766003"
"0000365052" "0000766004"
"0000365053" "0000766005"
"0000365054" "0000766006"
"0000365055" "0000766007"
"0000365056" "0000766008"
"0000365057" "0000766009"
"0000365058" "0000766010"
"0000365059" "0000766011"
"0000365065" "0000766017"
"0000374653" "0000785466"
"0000374654" "0000785467"
"0000374655" "0000785468"
"0000374656" "0000785469"
"0000374657" "0000785470"
"0000374658" "0000785471"
"0000374659" "0000785472"
"0000374677" "0000785490"
"0000374678" "0000785491"
"0000374679" "0000785492"
"0000374680" "0000785493"
"0000374681" "0000785494"
"0000374682" "0000785495"
"0000374698" "0000785511"
"0000375189" "0000786522"
"0000376615" "0000788408"
"0000377722" "0000790147"
"0000377723" "0000790148"
"0000377724" "0000790149"
"0000377725" "0000790150"
"0000380694" "0000793846"
"0000380986" "0000794247"
"0000381477" "0000794937"
"0000381478" "0000794938"
"0000381479" "0000794939"
"0000381480" "0000794940"
"0000381481" "0000794941"
"0000381482" "0000794942"
"0000381483" "0000794943"
"0000381484" "0000794944"
"0000381485" "0000794945"
"0000381486" "0000794946"
"0000381487" "0000794947"
"0000381488" "0000794948"
"0000381962" "0000795593"
"0000381963" "0000795594"
"0000381964" "0000795595"
"0000381965" "0000795596"
"0000381966" "0000795597"
"0000381967" "0000795598"
"0000381968" "0000795599"
"0000381971" "0000795589"
"0000381972" "0000795590"
"0000381972" "0000795603"
"0000382305" "0000796063"
"0000382306" "0000796064"
"0000382307" "0000796065"
"0000382308" "0000796066"
"0000383192" "0000797253"
"0000383193" "0000797254"
"0000383194" "0000797255"
"0000383195" "0000797256"
"0000383196" "0000797257"
"0000383197" "0000797258"
"0000383198" "0000797259"
"0000383199" "0000797260"
"0000383200" "0000797261"
"0000383201" "0000797262"
"0000383202" "0000797263"
"0000383203" "0000797264"
"0000383204" "0000797265"
"0000383205" "0000797266"
"0000383206" "0000797267"
"0000383207" "0000797268"
"0000383208" "0000797269"
"0000383209" "0000797270"
"0000383210" "0000797271"
"0000383211" "0000797272"
"0000383212" "0000797273"
"0000383213" "0000797274"
"0000383214" "0000797275"
"0000383215" "0000797276"
"0000383216" "0000797277"
"0000383217" "0000797278"
"0000383218" "0000797279"
"0000383219" "0000797280"
"0000383220" "0000797281"
"0000383221" "0000797282"
"0000383222" "0000797283"
"0000383223" "0000797284"
"0000383224" "0000797285"
"0000383225" "0000797286"
"0000383226" "0000797287"
"0000383227" "0000797288"
"0000383228" "0000797289"
"0000383229" "0000797290"
"0000383230" "0000797291"
"0000383231" "0000797292"
"0000383232" "0000797293"
"0000383233" "0000797294"
"0000383234" "0000797295"
"0000383235" "0000797296"
"0000383236" "0000797297"
"0000383237" "0000797298"
"0000383238" "0000797299"
"0000383239" "0000797300"
"0000383240" "0000797301"
"0000383241" "0000797302"
"0000383242" "0000797303"
"0000383243" "0000797304"
"0000383841" "0000798121"
"0000383842" "0000798122"
"0000383843" "0000798123"
"0000383979" "0000798390"
"0000383990" "0000798402"
"0000383991" "0000798403"
"0000383992" "0000798404"
"0000383993" "0000798405"
"0000383994" "0000798406"
"0000383995" "0000798407"
"0000384749" "0000811541"
"0000384750" "0000811542"
"0000384751" "0000811543"
"0000384752" "0000811544"
"0000384753" "0000811545"
"0000384754" "0000811546"
"0000384755" "0000811547"
"0000384756" "0000811548"
"0000384757" "0000811549"
"0000384758" "0000811550"
"0000384759" "0000811551"
"0000384760" "0000811552"
"0000384761" "0000811553"
"0000384762" "0000811554"
"0000384763" "0000811555"
"0000384764" "0000811556"
"0000384765" "0000811557"
"0000384766" "0000811558"
"0000384863" "0000811681"
"0000384864" "0000811682"
"0000384865" "0000811683"
"0000384866" "0000811684"
"0000384867" "0000811685"
"0000384868" "0000811686"
"0000384947" "0000811785"
"0000384948" "0000811786"
"0000384949" "0000811787"
"0000384950" "0000811788"
"0000385471" "0000812532"
"0000385481" "0000812545"
"0000385482" "0000812546"
"0000385488" "0000812553"
"0000385509" "0000812581"
"0000385532" "0000812610"
"0000385542" "0000812621"
"0000385565" "0000812650"
"0000385569" "0000812656"
"0000385598" "0000812689"
"0000385600" "0000812691"
"0000385601" "0000812692"
"0000385602" "0000812693"
"0000385618" "0000812712"
"0000385622" "0000812716"
"0000385675" "0000812777"
"0000385679" "0000812782"
"0000385684" "0000812788"
"0000385692" "0000812798"
"0000385717" "0000812829"
"0000386391" "0000813886"
"0000387019" "0000814872"
"0000387020" "0000814873"
"0000387021" "0000814874"
"0000387022" "0000814875"
"0000387023" "0000814876"
"0000387024" "0000814877"
"0000387025" "0000814878"
"0000387026" "0000814879"
"0000387027" "0000814880"
"0000387028" "0000814881"
"0000387029" "0000814882"
"0000387030" "0000814883"
"0000387031" "0000814884"
"0000389299" "0000818244"
"0000389301" "0000818246"
"0000389477" "0000818563"
"0000389478" "0000818564"
"0000389479" "0000818565"
"0000389480" "0000818566"
"0000389481" "0000818567"
"0000389482" "0000818568"
"0000389483" "0000818569"
"0000389484" "0000818570"
"0000389487" "0000818573"
"0000389488" "0000818574"
"0000389489" "0000818575"
"0000389490" "0000818576"
"0000389491" "0000818577"
"0000389492" "0000818578"
"0000391506" "0000821255"
"0000393041" "0000823627"
"0000393042" "0000823628"
"0000394872" "0000825939"
"0000394890" "0000825969"
"0000395019" "0000826172"
"0000395022" "0000826176"
"0000395062" "0000826239"
"0000395081" "0000826267"
"0000418277" "0000878028"
"0000418278" "0000878029"
"0000418279" "0000878030"
"0000418280" "0000878031"
"0000418281" "0000878032"
"0000418446" "0000878215"
"0000418447" "0000878216"
"0000418448" "0000878217"
"0000418449" "0000878218"
"0000418450" "0000878219"
"0000418451" "0000878220"
"0000418452" "0000878221"
"0000418453" "0000878222"
"0000418454" "0000878223"
"0000418455" "0000878224"
"0000418456" "0000878225"
"0000418457" "0000878226"
"0000418458" "0000878227"
"0000418459" "0000878228"
"0000418460" "0000878229"
"0000418461" "0000878230"
"0000418462" "0000878231"
"0000418463" "0000878232"
"0000418464" "0000878233"
"0000418465" "0000878234"
"0000418466" "0000878235"
"0000418467" "0000878236"
"0000418468" "0000878237"
"0000418469" "0000878238"
"0000418470" "0000878239"
"0000418471" "0000878240"
"0000418472" "0000878241"
"0000418473" "0000878242"
"0000418498" "0000878429"
"0000418510" "0000878296"
"0000418511" "0000878297"
"0000418512" "0000878298"
"0000418513" "0000878299"
"0000418514" "0000878300"
"0000418515" "0000878301"
"0000418516" "0000878302"
"0000418517" "0000878303"
"0000418518" "0000878304"
"0000418519" "0000878305"
"0000418520" "0000878306"
"0000418521" "0000878307"
"0000418522" "0000878308"
"0000418523" "0000878309"
"0000418524" "0000878310"
"0000418525" "0000878311"
"0000418526" "0000878312"
"0000418527" "0000878313"
"0000418528" "0000878314"
"0000418529" "0000878315"
"0000418530" "0000878316"
"0000418531" "0000878317"
"0000418532" "0000878318"
"0000418533" "0000878319"
"0000418547" "0000878338"
"0000418548" "0000878339"
"0000418549" "0000878340"
"0000418550" "0000878341"
"0000418551" "0000878342"
"0000418551" "0000878356"
"0000418552" "0000878343"
"0000418552" "0000878357"
"0000418553" "0000878344"
"0000418553" "0000878358"
"0000418554" "0000878345"
"0000418554" "0000878359"
"0000418555" "0000878346"
"0000418555" "0000878360"
"0000418556" "0000878347"
"0000418556" "0000878361"
"0000418557" "0000878348"
"0000418557" "0000878362"
"0000418558" "0000878349"
"0000418558" "0000878363"
"0000418559" "0000878350"
"0000418559" "0000878364"
"0000418560" "0000878351"
"0000418560" "0000878365"
"0000418561" "0000878352"
"0000418561" "0000878366"
"0000418562" "0000878353"
"0000418562" "0000878367"
"0000418563" "0000878354"
"0000418563" "0000878368"
"0000418564" "0000878355"
"0000418564" "0000878369"
"0000418565" "0000878371"
"0000418566" "0000878372"
"0000418567" "0000878373"
"0000418590" "0000878397"
"0000418591" "0000878398"
"0000418592" "0000878399"
"0000418593" "0000878400"
"0000418594" "0000878401"
"0000418595" "0000878402"
"0000418596" "0000878403"
"0000418597" "0000878404"
"0000418598" "0000878405"
"0000418599" "0000878406"
"0000418600" "0000878407"
"0000418601" "0000878408"
"0000418602" "0000878409"
"0000418603" "0000878410"
"0000418604" "0000878411"
"0000418605" "0000878412"
"0000418606" "0000878413"
"0000418607" "0000878414"
"0000418608" "0000878415"
"0000418610" "0000878418"
"0000418611" "0000878419"
"0000418612" "0000878420"
"0000418613" "0000878421"
"0000418644" "0000878455"
"0000418645" "0000878456"
"0000418646" "0000878457"
"0000418647" "0000878458"
"0000418648" "0000878459"
"0000418649" "0000878460"
"0000418650" "0000878461"
"0000418651" "0000878462"
"0000418652" "0000878463"
"0000418653" "0000878464"
"0000418654" "0000878465"
"0000418655" "0000878466"
"0000418656" "0000878467"
"0000418657" "0000878468"
"0000418658" "0000878469"
"0000418659" "0000878470"
"0000418660" "0000878471"
"0000418661" "0000878472"
"0000418662" "0000878473"
"0000418663" "0000878474"
"0000418664" "0000878475"
"0000418665" "0000878476"
"0000418666" "0000878477"
"0000418666" "0000878502"
"0000418667" "0000878478"
"0000418667" "0000878503"
"0000418668" "0000878479"
"0000418668" "0000878504"
"0000418669" "0000878480"
"0000418669" "0000878505"
"0000418670" "0000878481"
"0000418670" "0000878506"
"0000418671" "0000878482"
"0000418671" "0000878507"
"0000418672" "0000878483"
"0000418672" "0000878508"
"0000418673" "0000878484"
"0000418673" "0000878509"
"0000418674" "0000878485"
"0000418674" "0000878510"
"0000418675" "0000878486"
"0000418675" "0000878511"
"0000418676" "0000878487"
"0000418676" "0000878512"
"0000418677" "0000878488"
"0000418677" "0000878513"
"0000418678" "0000878489"
"0000418678" "0000878514"
"0000418679" "0000878490"
"0000418679" "0000878515"
"0000418680" "0000878491"
"0000418680" "0000878516"
"0000418681" "0000878492"
"0000418681" "0000878517"
"0000418682" "0000878493"
"0000418682" "0000878518"
"0000418683" "0000878494"
"0000418683" "0000878519"
"0000418684" "0000878495"
"0000418684" "0000878520"
"0000418685" "0000878496"
"0000418685" "0000878521"
"0000418686" "0000878497"
"0000418686" "0000878522"
"0000418687" "0000878498"
"0000418688" "0000878499"
"0000418689" "0000878500"
"0000418690" "0000878501"
"0000418707" "0000878544"
"0000418708" "0000878545"
"0000418709" "0000878546"
"0000418710" "0000878547"
"0000418711" "0000878548"
"0000418712" "0000878549"
"0000418713" "0000878550"
"0000418714" "0000878551"
"0000418715" "0000878552"
"0000418716" "0000878553"
"0000418717" "0000878554"
"0000418718" "0000878555"
"0000418721" "0000878558"
"0000418734" "0000878575"
"0000418735" "0000878576"
"0000418736" "0000878577"
"0000418737" "0000878578"
"0000418738" "0000878579"
"0000418739" "0000878580"
"0000418740" "0000878581"
"0000418741" "0000878582"
"0000418742" "0000878583"
"0000418743" "0000878584"
"0000418744" "0000878585"
"0000418745" "0000878586"
"0000418746" "0000878587"
"0000418747" "0000878588"
"0000418748" "0000878589"
"0000418749" "0000878590"
"0000418750" "0000878591"
"0000418751" "0000878592"
"0000418752" "0000878593"
"0000418753" "0000878594"
"0000418786" "0000878636"
"0000420017" "0000880248"
"0000420018" "0000880249"
"0000422880" "0000898131"
"0000422881" "0000898132"
"0000422882" "0000898134"
"0000445854" "0000954039"
"0000445855" "0000954040"
"0000445856" "0000954041"
"0000448777" "0000958263"
"0000448782" "0000958268"
"0000460618" "0001019628"