### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = GAA)
# charset = UTF-8

## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{name}}"	"{{chromosome}}"	"{{chrom_band}}"	"{{imprinting}}"	"{{refseq_genomic}}"	"{{refseq_UD}}"	"{{reference}}"	"{{url_homepage}}"	"{{url_external}}"	"{{allow_download}}"	"{{id_hgnc}}"	"{{id_entrez}}"	"{{id_omim}}"	"{{show_hgmd}}"	"{{show_genecards}}"	"{{show_genetests}}"	"{{show_orphanet}}"	"{{note_index}}"	"{{note_listing}}"	"{{refseq}}"	"{{refseq_url}}"	"{{disclaimer}}"	"{{disclaimer_text}}"	"{{header}}"	"{{header_align}}"	"{{footer}}"	"{{footer_align}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{updated_by}}"	"{{updated_date}}"
"GAA"	"glucosidase, alpha; acid"	"17"	"q25.2-q25.3"	"no"	"LRG_673"	"UD_132118563567"	""	"https://www.LOVD.nl/GAA"	"Pompe disease research ErasmusMC <https://www.erasmusmc.nl/klinische_genetica/research/lijnen/pompe_center>"	"1"	"4065"	"2548"	"606800"	"1"	"1"	"1"	"1"	"<font color=#FF0000>This database is maintained by the <a href=\"https://www.erasmusmc.nl/klinische_genetica/research/lijnen/pompe_center/\" target=\"_blank\">Pompe Center Erasmus MC</a></font>.\r\nThe database was originally established by <b>Marian Kroos</b> and <b>Arnold Reuser</b>. In 2017 curatorship was transferred to Marianne Hoogeveen Westerveld and Pim Pijnappel.\r\nEstablishment of this gene variant database (LSDB) was supported by the <a href=\'http://www.LUMC.nl\' target=\'_blank\'>Leiden University Medical Center (LUMC)</a>, Leiden, Nederland."	""	"g"	"http://databases.lovd.nl/shared/refseq/GAA_codingDNA.html"	"1"	""	"<a href=\"https://www.erasmusmc.nl/klinische_genetica/research/lijnen/pompe_center/\" target=\"_blank\">Pompe Center Erasmus MC</a><br>\r\n<a href=\"http://cluster15.erasmusmc.nl/klgn/pompe/dna.html\" target=\"_blank\"><img src=\"docs/GAA_gene.png\"></a><br>\r\n<a href=\"http://cluster15.erasmusmc.nl/klgn/pompe/protein.html\" target=\"_blank\"><img src=\"docs/GAA_protein.png\"></a>"	"-1"	""	"-1"	"00002"	"2005-04-03 00:00:00"	"00006"	"2019-12-30 09:35:14"	"00006"	"2025-11-07 14:42:36"


## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}"	"{{geneid}}"	"{{name}}"	"{{id_mutalyzer}}"	"{{id_ncbi}}"	"{{id_ensembl}}"	"{{id_protein_ncbi}}"	"{{id_protein_ensembl}}"	"{{id_protein_uniprot}}"	"{{remarks}}"	"{{position_c_mrna_start}}"	"{{position_c_mrna_end}}"	"{{position_c_cds_end}}"	"{{position_g_mrna_start}}"	"{{position_g_mrna_end}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00024242"	"GAA"	"transcript variant 1"	"002"	"NM_000152.3"	""	"NP_000143.2"	""	""	""	"-367"	"3408"	"2859"	"78075355"	"78093679"	"00006"	"2017-03-17 15:51:30"	""	""


## Diseases ## Do not remove or alter this header ##
## Count = 18
"{{id}}"	"{{symbol}}"	"{{name}}"	"{{inheritance}}"	"{{id_omim}}"	"{{tissues}}"	"{{features}}"	"{{remarks}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"
"00000"	"Healthy/Control"	"Healthy individual / control"	""	""	""	""	""	"00000"	"2012-07-26 17:29:43"	""	""
"00128"	"CF"	"cystic fibrosis (CF)"	"AR"	"219700"	""	""	""	"00006"	"2013-05-14 09:22:43"	"00006"	"2021-12-10 21:51:32"
"00141"	"LGMD2"	"dystrophy, muscular, limb-girdle, autosomal recessive, type 2 (LGMD-2)"	""	""	""	""	""	"00006"	"2013-06-10 21:06:19"	"00006"	"2021-12-11 13:56:28"
"00198"	"?"	"unclassified / mixed"	""	""	""	""	""	"00006"	"2013-09-13 14:21:47"	"00006"	"2024-11-23 09:38:12"
"00244"	"MYOP"	"myopathy (MYOP)"	""	""	""	""	""	"00006"	"2013-10-12 23:00:55"	"00006"	"2019-06-19 11:52:31"
"01273"	"hCK"	"hyperCKemia (hCK, elevated serum creatine phosphokinase)"	"AD"	"123320"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01473"	"OPMD"	"dystrophy, muscular, oculopharyngeal (OPMD)"	"AD"	"164300"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"01822"	"GSD2"	"storage disease, glycogen, type II (GSD-2, Pompe disease)"	"AR"	"232300"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2021-12-10 21:51:32"
"02492"	"LGMDR4;LGMD2E"	"dystrophy, muscular, limb-girdle, autosomal recessive, type 4 (LGMD2E)"	"AR"	"604286"	""	""	""	"00006"	"2014-09-25 23:29:40"	"00006"	"2024-01-12 20:50:55"
"04216"	"GSD"	"storage disease, glycogen (GSD)"	""	""	""	""	""	"00006"	"2015-03-05 15:32:25"	""	""
"04327"	"CRS"	"craniosynostosis (CRS)"	""	""	""	""	""	"00006"	"2015-09-12 20:59:03"	""	""
"05121"	"MD"	"dystrophy, muscular (MD)"	""	""	""	""	""	"00006"	"2016-01-24 01:27:29"	""	""
"05126"	"LGMD"	"dystrophy, muscular, limb-girdle (LGMD)"	""	""	""	""	""	"00006"	"2016-01-26 06:05:36"	""	""
"05166"	"SUD"	"death, sudden, unexplained (SUD)"	""	""	""	""	""	"00006"	"2016-05-19 16:34:23"	"00006"	"2018-09-11 12:14:13"
"05320"	"BMD"	"dystrophy, muscular, Becker type (BMD)"	"XLR"	"300376"	""	""	""	"00006"	"2017-09-01 12:37:01"	"00006"	"2021-12-10 21:51:32"
"05324"	"DMD"	"dystrophy, muscular, Duchenne type (DMD)"	"XLR"	"310200"	""	""	""	"00006"	"2017-09-01 17:41:21"	"00006"	"2021-12-10 21:51:32"
"05427"	"ADPKD"	"kidney, polycystic, disease, autosomal dominant (ADPKD)"	""	""	""	""	""	"00006"	"2018-05-08 22:37:08"	""	""
"05618"	"NMD"	"neuromuscular disorder (NMD)"	""	""	""	""	""	"00006"	"2019-07-02 19:46:12"	""	""


## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}"	"{{diseaseid}}"
"GAA"	"01822"
"GAA"	"04216"


## Individuals ## Do not remove or alter this header ##
## Count = 1476
"{{id}}"	"{{fatherid}}"	"{{motherid}}"	"{{panelid}}"	"{{panel_size}}"	"{{license}}"	"{{owned_by}}"	"{{Individual/Reference}}"	"{{Individual/Remarks}}"	"{{Individual/Gender}}"	"{{Individual/Consanguinity}}"	"{{Individual/Origin/Geographic}}"	"{{Individual/Age_of_death}}"	"{{Individual/VIP}}"	"{{Individual/Data_av}}"	"{{Individual/Treatment}}"	"{{Individual/Origin/Population}}"	"{{Individual/Individual_ID}}"
"00000004"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000031"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	"0"	""	""	""	""
"00000033"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	"0"	""	""	""	""
"00000039"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	"0"	""	""	""	""
"00000048"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	"0"	""	""	""	""
"00000057"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000075"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000076"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000083"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00000084"	""	""	""	"1"	""	"00004"	"{PMID:Bell 2011:21228398}"	""	""	""	""	""	""	""	""	""	""
"00100967"	""	""	""	"1"	""	"01938"	"{PMID:Kostera-Pruszczyk 2006:16531044}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100968"	""	""	""	"1"	""	"01942"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100969"	""	""	""	"1"	""	"01942"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100970"	""	""	""	"1"	""	"01942"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100971"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2203258}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100972"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100973"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100974"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8401535}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100975"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100976"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1994:7881422}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100977"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100978"	""	""	""	"1"	""	"01938"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100979"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1991:1898413}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100980"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100981"	""	""	""	"1"	""	"01938"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100982"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100983"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8401535}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100984"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100985"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100986"	""	""	""	"1"	""	"01938"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100987"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100988"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100989"	""	""	""	"1"	""	"00006"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100990"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100991"	""	""	""	"1"	""	"01938"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100992"	""	""	""	"1"	""	"01938"	"{PMID:Martiniuk 1990:2111708}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100993"	""	""	""	"1"	""	"01938"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100994"	""	""	""	"1"	""	"01938"	"{PMID:Hoefsloot 1990:2268276}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100995"	""	""	""	"1"	""	"01938"	"{PMID:Zhong 1991:1652892}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	""	""	"0"	""	""	""	"?"
"00100996"	""	""	""	"2"	""	"01938"	"{PMID:Hermans 1991:1898413}, {OMIM606800:0003}"	"2-generation family, 2 affecteds, unaffected heterozygous carrier parents"	""	"yes"	"India"	""	"0"	""	""	""	"?"
"00100997"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8401535}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100998"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00100999"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8401535}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101000"	""	""	""	"1"	""	"01938"	"{PMID:Tsujino 2000:11053688}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101001"	""	""	""	"1"	""	"01938"	"{PMID:Shieh 1994:8051927}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101002"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101003"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8486380}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101004"	""	""	""	"1"	""	"01938"	"{PMID:Adams 1997:9259196}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101005"	""	""	""	"1"	""	"01938"	"{PMID:Shieh 1998:9554747}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101006"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101007"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8401535}"	"2-generation family, 1 affected, unaffected heterozygous carrier parents"	""	""	""	""	"0"	""	""	""	"?"
"00101008"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	""	""	""	"09521422-PatC"
"00101009"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8401535}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101010"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101011"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8486380}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101012"	""	""	""	"1"	""	"01938"	"{PMID:Castro-Gago 1999:10528311}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101013"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101014"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101015"	""	""	""	"1"	""	"01938"	"{PMID:Becker 1998:9529346}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101016"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101017"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8486380}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101018"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8094613}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101019"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1993:8486380}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101020"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1994:7881422}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101021"	""	""	""	"1"	""	"01938"	"{PMID:Kroos 1995:8558570}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101022"	""	""	""	"1"	""	"01938"	"{PMID:Hirschhorn 1999:9950376}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101023"	""	""	""	"1"	""	"01938"	"{PMID:Boerkoel 1995:7717400}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101024"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994b:7881425}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101025"	""	""	""	"1"	""	"01938"	"{PMID:Kroos 1995:8558570}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101026"	""	""	""	"1"	""	"01938"	"{PMID:Stroppiano 2001:11343339}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101027"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994b:7881425}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101028"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994c:7981676}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101029"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994:7866409}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101030"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101031"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1994:7881422}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101032"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994c:7981676}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101033"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101034"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994c:7981676}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101035"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101036"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1994c:7981676}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101037"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101038"	""	""	""	"1"	""	"01938"	"{PMID:Dagnino 2000:10899751}"	""	""	""	"Italy"	""	"0"	""	""	"Sicilian"	"?"
"00101041"	""	""	""	"1"	""	"01938"	"{PMID:Van der Kraan 1994:7945303}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101044"	""	""	""	"1"	""	"01938"	"{PMID:Hirschhorn 1999:9950376}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101045"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101046"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1997:9425285}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101047"	""	""	""	"1"	""	"01938"	"{PMID:Raben 1995:7603531}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101048"	""	""	""	"1"	""	"01938"	"{PMID:Boerkoel 1995:7717400}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101049"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101050"	""	""	""	"1"	""	"01938"	"{PMID:Boerkoel 1995:7717400}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101051"	""	""	""	"1"	""	"01938"	"{PMID:Boerkoel 1995:7717400}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101052"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101053"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101054"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101055"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	""	""	""	"09521422-PatB"
"00101056"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101057"	""	""	""	"1"	""	"01938"	"{PMID:Lin 1995:7695647}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101058"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101059"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	""	""	""	"09521422-PatA"
"00101060"	""	""	""	"1"	""	"01938"	"{PMID:Reuser 1995:7603530}, {PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	""	""	""	"09521422-PatD"
"00101061"	""	""	""	"1"	""	"01938"	"{PMID:Raben 1995:7603531}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101062"	""	""	""	"1"	""	"01938"	"{PMID:Reuser  1995:7603530}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101063"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101064"	""	""	""	"1"	""	"01938"	"{PMID:Shieh 1996:8604985}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101065"	""	""	""	"1"	""	"01938"	"{PMID:Tsujino 2000:11053688}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101066"	""	""	""	"1"	""	"01938"	"{PMID:Tsunoda 1996:8834250}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101067"	""	""	""	"1"	""	"01938"	"{PMID:Nicolino 1997:9196050}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101068"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101069"	""	""	""	"1"	""	"01938"	"{PMID:Kroos 1997:9266392}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101070"	""	""	""	"1"	""	"01938"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101071"	""	""	""	"1"	""	"01938"	"{PMID:Adams 1997:9259196}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101072"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 1997:9425285}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101073"	""	""	""	"1"	""	"01938"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101074"	""	""	""	"1"	""	"01938"	"{PMID:Beesley 1998:10206684}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101075"	""	""	""	"1"	""	"01938"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101076"	""	""	""	"1"	""	"01938"	"{PMID:Kroos 1998:9660056}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101077"	""	""	""	"1"	""	"01938"	"{PMID:Beesley 1998:10206684}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101078"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101079"	""	""	""	"1"	""	"01938"	"{PMID:Kroos 1998:9660056}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101080"	""	""	""	"1"	""	"01938"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101081"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101082"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101083"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101084"	""	""	""	"1"	""	"01938"	"{PMID:Tsujino 2000:11053688}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101085"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101086"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101087"	""	""	""	"1"	""	"01941"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101088"	""	""	""	"1"	""	"01938"	"{PMID:Becker 1998:9529346}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101089"	""	""	""	"1"	""	"01938"	"{PMID:Beesley 1998:10206684}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101090"	""	""	""	"1"	""	"01938"	"{PMID:Beesley 1998:10206684}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101091"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101092"	""	""	""	"1"	""	"01938"	"{PMID:Beesley 1998:10206684}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101093"	""	""	""	"1"	""	"01938"	"{PMID:Becker 1998:9529346}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101094"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1999:10377006}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101095"	""	""	""	"1"	""	"01938"	"{PMID:Castro-Gago 1999:10528311}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101096"	""	""	""	"1"	""	"01938"	"{PMID:Talsma 2002:11927738}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101097"	""	""	""	"1"	""	"01938"	"{PMID:Raben 1999:10189220}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101098"	""	""	""	"1"	""	"01938"	"{PMID:Raben 1999:10189220}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101099"	""	""	""	"1"	""	"01938"	"{PMID:Raben 1999:10189220}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101100"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101101"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101102"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101103"	""	""	""	"1"	""	"01938"	"{PMID:Huie 1999:10071199}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101104"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101105"	""	""	""	"1"	""	"01938"	"{PMID:Ko 1999:10338092}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101106"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101107"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101108"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101109"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101110"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101111"	""	""	""	"1"	""	"01938"	"{PMID:Tsujino 2000:11053688}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101112"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101113"	""	""	""	"1"	""	"01938"	"{PMID:Laforet 2000:11071489}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101114"	""	""	""	"1"	""	"01938"	"2001 ASHG"	""	""	""	""	""	"0"	""	""	""	"?"
"00101115"	""	""	""	"1"	""	"01938"	"{PMID:Stroppiano 2001:11343339}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101116"	""	""	""	"1"	""	"01938"	"2001 ASHG"	""	""	""	""	""	"0"	""	""	""	"?"
"00101117"	""	""	""	"1"	""	"01938"	"2001 ASHG"	""	""	""	""	""	"0"	""	""	""	"?"
"00101118"	""	""	""	"1"	""	"01938"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101119"	""	""	""	"1"	""	"01938"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101120"	""	""	""	"1"	""	"01938"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101121"	""	""	""	"1"	""	"01938"	"{PMID:Bodamer 2002:12213618}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101122"	""	""	""	"1"	""	"01938"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101123"	""	""	""	"1"	""	"01938"	"{PMID:Huie 2002:11854868}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101124"	""	""	""	"1"	""	"01938"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101125"	""	""	""	"1"	""	"01938"	"{PMID:Bodamer 2002:12213618}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101126"	""	""	""	"1"	""	"01938"	"{PMID:Huie 2002:11854868}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101127"	""	""	""	"1"	""	"01938"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101128"	""	""	""	"1"	""	"01938"	"{PMID:Huie 2002:11854868}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101129"	""	""	""	"1"	""	"01938"	"{PMID:Pittis 2003:12923862}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101130"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101131"	""	""	""	"1"	""	"01938"	"2003"	""	""	""	""	""	"0"	""	""	""	"?"
"00101132"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101133"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101134"	""	""	""	"1"	""	"01938"	"{PMID:Pittis 2003:12923862}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101135"	""	""	""	"1"	""	"01938"	"{PMID:Lam 2003:12601120}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101136"	""	""	""	"1"	""	"01938"	"{PMID:Lam 2003:12601120}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101137"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101138"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101139"	""	""	""	"1"	""	"01938"	"{PMID:Pittis 2003:12923862}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101140"	""	""	""	"1"	""	"01938"	"{PMID:Pipo 2003:14643388}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101141"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101142"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101143"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Israel"	""	"0"	""	""	"Arab"	"Pat12"
"00101144"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101145"	""	""	""	"1"	""	"01938"	"{PMID:Chandler 1991:1895140}, {PMID:Hermans 2004:14695532}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"01895140, 14695532-Pat28"
"00101146"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2004:14972326}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101147"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101148"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101149"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101150"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101151"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101152"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2004:14972326}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101153"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101154"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101155"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101156"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101157"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101158"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101159"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101160"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101161"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101162"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101163"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101164"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101165"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101166"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2004:14972326}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101167"	""	""	""	"1"	""	"01938"	"{PMID:Hermans 2004:14695532}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101168"	""	""	""	"1"	""	"01938"	"{PMID:Kroos 2004:15145338}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101169"	""	""	""	"1"	""	"01938"	"{PMID:Anneser 2005:15668445}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101171"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101172"	""	""	""	"1"	""	"01938"	"{PMID:Dou 2006:16782080}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101173"	""	""	""	"1"	""	"01942"	"{PMID:Kishnani 2006:16860134}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101174"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101175"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101176"	""	""	""	"1"	""	"01938"	"{PMID:Amartino 2006:16433701}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101177"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101178"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101179"	""	""	""	"1"	""	"01938"	"2006"	""	""	""	""	""	"0"	""	""	""	"?"
"00101180"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101181"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101182"	""	""	""	"1"	""	"01938"	"2006"	""	""	""	""	""	"0"	""	""	""	"?"
"00101183"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101184"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101185"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101186"	""	""	""	"1"	""	"01938"	"{PMID:Kishnani 2006:16860134}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101187"	""	""	""	"1"	""	"01938"	"2006"	""	""	""	""	""	"0"	""	""	""	"?"
"00101188"	""	""	""	"1"	""	"01938"	"2006"	""	""	""	""	""	"0"	""	""	""	"?"
"00101189"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101190"	""	""	""	"1"	""	"01938"	"{PMID:Amartino 2006:16433701}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101191"	""	""	""	"1"	""	"01938"	"{PMID:Montalvo 2006:16917947}"	""	""	""	""	""	"0"	""	""	""	"?"
"00101192"	""	""	""	"1"	""	"01938"	""	""	"M"	""	"Mexico"	""	"0"	""	""	"Mexican"	"CASE 1"
"00101193"	""	""	""	"1"	""	"01938"	""	""	""	""	""	""	"0"	""	""	""	"mail"
"00101194"	""	""	""	"1"	""	"01938"	""	""	"M"	"?"	"Costa Rica"	""	"0"	""	""	""	"1"
"00101195"	""	""	""	"1"	""	"01938"	""	""	"F"	"?"	"Costa Rica"	""	"0"	""	""	""	"2"
"00101196"	""	""	""	"1"	""	"01938"	""	""	"M"	"?"	"Costa Rica"	""	"0"	""	""	""	"3"
"00101197"	""	""	""	"1"	""	"01938"	""	""	"F"	"?"	"Costa Rica"	""	"0"	""	""	""	"4"
"00101198"	""	""	""	"1"	""	"00006"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	""	""	""	"09521422-PatE"
"00101199"	""	""	""	"1"	""	"00006"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	""	""	""	"09521422-PatF"
"00180906"	""	""	""	"1"	""	"01601"	""	""	"M"	"?"	"Denmark"	"18y"	"0"	""	""	""	"15"
"00183081"	""	""	""	"1"	""	"01939"	"Labrijn-Marks et al, submitted"	""	""	"yes"	"Netherlands"	""	"0"	""	""	""	"PatB"
"00183082"	""	""	""	"1"	""	"01939"	"Labrijn-Marks et al, submitted"	""	""	""	"Netherlands"	"<00y02m14d"	"0"	""	""	""	"PatC"
"00183083"	""	""	""	"1"	""	"01939"	"Labrijn-Marks et al, submitted"	""	""	""	"Netherlands"	""	"0"	""	""	""	"PatD"
"00183084"	""	""	""	"1"	""	"01939"	"Labrijn-Marks et al, submitted"	""	""	""	"Netherlands"	""	"0"	""	""	""	"PatE"
"00219483"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219489"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219502"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219551"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219569"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219575"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219581"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219582"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	"F"	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219584"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219605"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219621"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219622"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219633"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219634"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219659"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219660"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219666"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219677"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219680"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219716"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219724"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219736"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219756"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219763"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219766"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219770"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219784"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219796"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219815"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219817"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219838"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219854"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219866"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219871"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219880"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219882"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219888"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219890"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219922"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219923"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219929"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219930"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219931"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219950"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219953"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00219957"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220044"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220051"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220065"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220072"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220094"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220168"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220176"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220228"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220281"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220317"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220330"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220386"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220390"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220397"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220446"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220463"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220481"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220482"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220487"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220503"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220506"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220511"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220520"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220539"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220554"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220571"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220573"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220577"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220585"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220593"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220594"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220604"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220605"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220610"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220653"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220665"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220668"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220677"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220687"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220700"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220707"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220708"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220733"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220738"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220746"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220759"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220787"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220790"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220792"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220796"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220803"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220819"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220823"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220847"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220858"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220903"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220911"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220912"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220932"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00220978"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221005"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221012"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221028"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221034"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221054"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221060"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221084"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221085"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221091"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221136"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221148"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221155"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221157"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221191"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221194"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221197"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221201"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221212"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221216"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221217"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221282"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221301"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221306"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221315"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221334"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221344"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221366"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221383"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221407"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221448"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221449"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221456"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221470"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221484"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221493"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221498"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221511"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221520"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221521"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221528"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221529"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221533"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221535"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221582"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221597"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221623"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221634"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221652"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221682"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221686"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221706"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221735"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221737"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221743"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221760"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221767"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221793"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221809"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221843"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221845"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221851"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221867"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221878"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221900"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221922"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221934"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221946"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221951"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00221990"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222019"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222023"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222030"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222061"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222074"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222075"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222078"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	"M"	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222086"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222109"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222111"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222132"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222137"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222138"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222158"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222182"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222208"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222210"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222229"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222233"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222238"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222239"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222243"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222266"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222271"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222279"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222330"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222353"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222356"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222363"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222370"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222373"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222380"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222384"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222390"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222394"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222403"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222413"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222446"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222456"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222458"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222464"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222475"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222498"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222515"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222518"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222539"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222553"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222578"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222605"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222626"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222637"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222642"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222671"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222681"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222687"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222695"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222709"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222716"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00222742"	""	""	""	"1"	""	"00430"	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"(United States)"	""	"0"	""	""	""	"30564623-Pat"
"00228668"	""	""	""	"1"	""	"00006"	"{PMID:Oitan 2018:29778277}"	""	"M"	""	"Japan"	""	"0"	""	""	""	"patient"
"00234476"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234477"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234478"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234479"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234480"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234481"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234482"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234483"	""	""	""	"1"	""	"01940"	"{PMID:Liao 2014:24513544}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234484"	""	""	""	"1"	""	"01940"	"{PMID:Stepien 2016:26873529}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234485"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234486"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234487"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234488"	""	""	""	"1"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234489"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234490"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234491"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234492"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234493"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234494"	""	""	""	"1"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234495"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	"F"	""	"Korea"	"7y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234496"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}, {PMID:Park 2006:17092519}"	""	"F"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234497"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Asian"	""
"00234498"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234499"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234500"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234501"	""	""	""	"3"	""	"01940"	"{PMID:Stepien 2016:26873529}"	"family, 3 affected (M/M/F)"	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234502"	""	""	""	"1"	""	"01940"	"{PMID:Raben 1999:10189220}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00234503"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African/Northern Europe"	""
"00234504"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234505"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234506"	""	""	""	"1"	""	"01940"	"{PMID:Elder 2013:23601496}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234507"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234508"	""	""	""	"1"	""	"01940"	"{PMID:Reuser 1995:7603530}"	""	""	""	"Belgium"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234509"	""	""	""	"1"	""	"01940"	"{PMID:Tsunoda 1996:8834250}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234510"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234511"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234512"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234513"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234514"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234515"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	"Mexico"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234516"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234517"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234518"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234519"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234520"	""	""	""	"1"	""	"01940"	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234521"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234522"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234523"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234524"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234525"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234526"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234527"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234528"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234529"	""	""	""	"1"	""	"01940"	"{PMID:Van den Hout 2004:15121988}"	""	"F"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234530"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234531"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234532"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234533"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234534"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234535"	""	""	""	"2"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234536"	""	""	""	"1"	""	"01940"	"{PMID:Amarinthnukrowh 2010:21039225}"	""	"F"	""	"Thailand"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234537"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234538"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234539"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234540"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234541"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234542"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234543"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234544"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00234545"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234546"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234547"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234548"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234549"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234550"	""	""	""	"1"	""	"01940"	"{PMID:Beesley 1998:10206684}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234551"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234552"	""	""	""	"2"	""	"01940"	"{PMID:Beesley 1998:10206684}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234553"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234554"	""	""	""	"1"	""	"01940"	"{PMID:Labrousse 2010:20080426}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234555"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234556"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African/Northern Europe"	""
"00234557"	""	""	""	"4"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Middle Eastern"	""
"00234558"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234559"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234560"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234561"	""	""	""	"3"	""	"01940"	"{PMID:Becker 1998:9529346}"	"family, 3 affected (?/F/M)"	"F;M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Africa (1)/African American (2)"	""
"00234562"	""	""	""	"2"	""	"01940"	"{PMID:Nino 2013:23430493}"	"family, 2 affected males"	"M"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234563"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234564"	""	""	""	"1"	""	"01940"	"{PMID:Hahn 2015:25626711}"	""	"F"	""	"Germany"	"3y1m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234565"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234566"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234567"	""	""	""	"1"	""	"01940"	"{PMID:Beesley 1998:10206684}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234568"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234569"	""	""	""	"2"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234570"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234571"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234572"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234573"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234574"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234575"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234576"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234577"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234578"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234579"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234580"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234581"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234582"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234583"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234584"	""	""	""	"2"	""	"01940"	"{PMID:Labrousse 2010:20080426}"	"family, 2 affected males"	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234585"	""	""	""	"1"	""	"01940"	"{PMID:Ng 2013:24027232}"	""	"F"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234586"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234587"	""	""	""	"2"	""	"01940"	"{PMID:Beesley 1998:10206684}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234588"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234589"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234590"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234591"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234592"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234593"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234594"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234595"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234596"	""	""	""	"1"	""	"01940"	"{PMID:Talsma 2002:11927738}"	""	"F"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234597"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234598"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234599"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00234600"	""	""	""	"1"	""	"01940"	"{PMID:Zhong 1991:1652892}"	""	"F"	""	"Mexico"	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234601"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234602"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234603"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234604"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234605"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234606"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234607"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234608"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234609"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234610"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234611"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234612"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234613"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234614"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234615"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234616"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234617"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234618"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234619"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234620"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234621"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234622"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234623"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234624"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234625"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234626"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234627"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234628"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234629"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234630"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234631"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234632"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234633"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234634"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234635"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234636"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234637"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234638"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234639"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234640"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234641"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234642"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234643"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234644"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234645"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234646"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234647"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234648"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234649"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234650"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234651"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234652"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234653"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234654"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234655"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234656"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234657"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234658"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234659"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234660"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234661"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234662"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234663"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234664"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234665"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234666"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234667"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234668"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234669"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234670"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234671"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234672"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234673"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234674"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234675"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234676"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234677"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234678"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234679"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234680"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234681"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234682"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234683"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234684"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234685"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234686"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234687"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234688"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234689"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234690"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234691"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234692"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234693"	""	""	""	"1"	""	"01940"	""	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234694"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234695"	""	""	""	"1"	""	"01940"	"{PMID:Nino 2013:23430493}"	""	"F"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234696"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234697"	""	""	""	"1"	""	"01940"	"{PMID:Musumeci 2015:26231297}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234698"	""	""	""	"1"	""	"01940"	"{PMID:Musumeci 2015:26231297}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234699"	""	""	""	"1"	""	"01940"	"{PMID:Musumeci 2015:26231297}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234700"	""	""	""	"1"	""	"01940"	"{PMID:Musumeci 2015:26231297}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234701"	""	""	""	"2"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234702"	""	""	""	"1"	""	"01940"	"{PMID:Sharma 2005:15986226}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234703"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234704"	""	""	""	"2"	""	"01940"	"{PMID:Musumeci 2015:26231297}"	"family, 2 affected males"	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234705"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234706"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"Portugal"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234707"	""	""	""	"2"	""	"01940"	"{PMID:Golden-Grant 2015:25677830}"	"family, 2 affected females"	"F;M"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234708"	""	""	""	"3"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 3 affected (M/F/F)"	"F;M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234709"	""	""	""	"3"	""	"01940"	"{PMID:Grzesiuk 2010:20464284}"	"family, 3 affected (F/M/M)"	"F;M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234710"	""	""	""	"1"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234711"	""	""	""	"1"	""	"01940"	"{PMID:Nino 2013:23430493}"	""	"M"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234712"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234713"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2004:14972326}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234714"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	"20y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234715"	""	""	""	"1"	""	"01940"	"{PMID:Loureiro Neves 2013:24016645}"	""	"F"	""	"Portugal"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234716"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Syria"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234717"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234718"	""	""	""	"2"	""	"01940"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234719"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"M"	""	"Spain;Italy"	"13m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234720"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234721"	""	""	""	"1"	""	"01940"	"{PMID:Rohrbach 2010:20882352}"	""	"F"	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234722"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 1997:9266392}"	""	""	""	"Pakistan"	"11m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234723"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Portugal"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234724"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234725"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2010:19775921}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Arab"	""
"00234726"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234727"	""	""	""	"1"	""	"01940"	"{PMID:Isayama 2014:24872213}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234728"	""	""	""	"1"	""	"01940"	"{PMID:Alansari 2013:24273659}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Arab"	""
"00234729"	""	""	""	"1"	""	"01940"	"{PMID:Hamdan 2008:19067231}"	""	"M"	""	"United Arab Emirates"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234730"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"South Africa"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234731"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Austria"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234732"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Hispanic"	""
"00234733"	""	""	""	"1"	""	"01940"	"{PMID:Bergsma 2015:25243733}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234734"	""	""	""	"1"	""	"01940"	"{PMID:Morales 2015:26160551}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234735"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Afghanistan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234736"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Afghanistan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234737"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2006:16838077}"	""	"F"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234738"	""	""	""	"2"	""	"01940"	"{PMID:Hermans 1991:1898413}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234739"	""	""	""	"2"	""	"01940"	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234740"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234741"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1994:7881422}"	""	"F"	""	"Netherlands"	"51y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234742"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"South Africa"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234743"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234744"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234745"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234746"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234747"	""	""	""	"1"	""	"01940"	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234748"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234749"	""	""	""	"1"	""	"01940"	"{PMID:Aryani 2014:24976573}"	""	"M"	""	"Iran"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234750"	""	""	""	"1"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234751"	""	""	""	"1"	""	"01940"	"{PMID:Deodato 2014:23620524}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234752"	""	""	""	"1"	""	"01940"	"{PMID:Pipo 2003:14643388}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234753"	""	""	""	"1"	""	"01940"	"{PMID:Nabatame 2009:18495398}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234754"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234755"	""	""	""	"2"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 2 affected (F/M)"	"F;M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234756"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234757"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234758"	""	""	""	"1"	""	"01940"	"{PMID:But 2009:19966354}"	""	"M"	""	"Pakistan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234759"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2006:16860134}"	""	"M"	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	"Asian"	""
"00234760"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"India"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234761"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"M"	""	"Italy"	"2y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234762"	""	""	""	"1"	""	"01940"	"{PMID:Del Rizzo 2010:20830524}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234763"	""	""	""	"1"	""	"01940"	"{PMID:Lin 1995:7695647}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234764"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234765"	""	""	""	"1"	""	"01940"	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234766"	""	""	""	"17"	""	"01940"	"{PMID:Shieh 1998:9554747}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234767"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234768"	""	""	""	"11"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234769"	""	""	""	"3"	""	"01940"	"{PMID:Amarinthnukrowh 2010:21039225}"	"family, 3 affected females"	"F"	""	"Thailand"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234770"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Portugal"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234771"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1998:9535769}"	""	""	""	"Portugal"	""	"0"	"shared by Pompe Center Rotterdam"	""	"Azores island"	""
"00234772"	""	""	""	"2"	""	"01940"	"{PMID:Esmer 2013:24399866}"	"family, 2 affected males"	"M"	""	"Mexico"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234773"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234774"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1998:9535769}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234775"	""	""	""	"2"	""	"01940"	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234776"	""	""	""	"1"	""	"01940"	"{PMID:Aykut 2014:25026126}"	""	"F"	""	"Turkey"	"12m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234777"	""	""	""	"1"	""	"01940"	"{PMID:Galehdari 2013:23360637}"	""	"M"	""	"Iran"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234778"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	"22m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234779"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1999:10071199}"	""	""	""	"Bangladesh"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234780"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234781"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234782"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234783"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234784"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234785"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1997:9425285}"	""	""	""	"South Africa"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234786"	""	""	""	"1"	""	"01940"	"{PMID:Banugaria 2013:23825616}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234787"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234788"	""	""	""	"2"	""	"01940"	"{PMID:Kroos 1995:8558570}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234789"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234790"	""	""	""	"5"	""	"01940"	"{PMID:Becker 1998:9529346}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Africa (2)/African American (3)"	""
"00234791"	""	""	""	"1"	""	"01940"	"{PMID:Messinger 2012:22237443}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00234792"	""	""	""	"1"	""	"01940"	"{PMID:Elder 2013:23601496}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00234793"	""	""	""	"1"	""	"01940"	"{PMID:Alansari 2013:24273659}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Arab"	""
"00234794"	""	""	""	"1"	""	"01940"	"{PMID:Pereira 2008:18535739}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234795"	""	""	""	"3"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 3 affected (F/M/F)"	"F;M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234796"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Pakistan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234797"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234798"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Afghanistan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234799"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234800"	""	""	""	"3"	""	"01940"	"{PMID:Hermans 1998:9521422}"	""	""	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234801"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234802"	""	""	""	"1"	""	"01940"	"{PMID:Broomfield 2016:26497565}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234803"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234804"	""	""	""	"1"	""	"01940"	"{PMID:Messinger 2012:22237443}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234805"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Israel"	""	"0"	"shared by Pompe Center Rotterdam"	""	"Arab"	""
"00234806"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"F"	""	"Italy"	"8m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234807"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2004:14972326}"	""	"F"	""	"Italy"	"8m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234808"	""	""	""	"1"	""	"01940"	"{PMID:Banugaria 2013:23825616}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Asian"	""
"00234809"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234810"	""	""	""	"2"	""	"01940"	"{PMID:Pittis 2008:18429042}"	"family, 2 affected females"	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234811"	""	""	""	"1"	""	"01940"	"{PMID:Van den Hout 2004:15121988}"	""	"F"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234812"	""	""	""	"5"	""	"01940"	"{PMID:Kroos 1995:8558570}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234813"	""	""	""	"1"	""	"01940"	"{PMID:Banugaria 2013:23825616}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African Canadian"	""
"00234814"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234815"	""	""	""	"2"	""	"01940"	"{PMID:Tsuburaya 2012:22196155}"	"family, 2 affected (M/F)"	"F;M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234816"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	"8m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234817"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Middle Eastern"	""
"00234818"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234819"	""	""	""	"2"	""	"01940"	"{PMID:Mechtler 2012:22133539}"	"family, 2 affected males"	"M"	""	"Austria"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234820"	""	""	""	"1"	""	"01940"	"{PMID:Hahn 2015:25626711}"	""	"M"	""	"Germany"	"3y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234821"	""	""	""	"1"	""	"01940"	"{PMID:Shin 2006:17027861}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234822"	""	""	""	"1"	""	"01940"	"{PMID:Elder 2013:23601496}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Hispanic"	""
"00234823"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Lebanon"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234824"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234825"	""	""	""	"2"	""	"01940"	"{PMID:Andreassen 2014:24685124}"	"family, 2 affected males"	"M"	""	"Denmark"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234826"	""	""	""	"1"	""	"01940"	"{PMID:Quenardelle 2015:25451853}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234827"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234828"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234829"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234830"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234831"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234832"	""	""	""	"2"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	"family, 2 affected males"	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234833"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234834"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234835"	""	""	""	"2"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234836"	""	""	""	"2"	""	"01940"	"{PMID:Horvath 2015:25155446}"	"family, 2 affected males"	"M"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234837"	""	""	""	"1"	""	"01940"	"{PMID:Sacconi 2010:20559845}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234838"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234839"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234840"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234841"	""	""	""	"1"	""	"01940"	"{PMID:Amartino 2006:16433701}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234842"	""	""	""	"2"	""	"01940"	"{PMID:Herzog 2012:22676651}"	"family, 2 affected (M/F)"	"F;M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234843"	""	""	""	"1"	""	"01940"	"{PMID:Wens 2012:23000108}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234844"	""	""	""	"1"	""	"01940"	"{PMID:Ravaglia 2012:22704482}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234845"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234846"	""	""	""	"1"	""	"01940"	"{PMID:Remiche 2014:24158270}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234847"	""	""	""	"2"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	"family, 2 affected males"	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234848"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234849"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234850"	""	""	""	"1"	""	"01940"	"{PMID:Horvath 2015:25155446}"	""	"M"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234851"	""	""	""	"1"	""	"01940"	"{PMID:Hobson-Webb 2015:25835646}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234852"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234853"	""	""	""	"1"	""	"01940"	"{PMID:Musumeci 2016:25783438}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234854"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234855"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234856"	""	""	""	"1"	""	"01940"	"{PMID:Musumeci 2012:22958975}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234857"	""	""	""	"2"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	"family, 2 affected males"	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234858"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234859"	""	""	""	"1"	""	"01940"	"{PMID:Schneider 2013:23160972}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234860"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234861"	""	""	""	"1"	""	"01940"	"{PMID:Remiche 2014:24158270}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234862"	""	""	""	"1"	""	"01940"	"{PMID:Horvath 2015:25155446}"	""	"F"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234863"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234864"	""	""	""	"1"	""	"01940"	"{PMID:Montagnese 2015:25673129}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234865"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1994:7881425}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234866"	""	""	""	"2"	""	"01940"	"{PMID:Gesquiere-Dando 2015:25703594}"	"family, 2 affected females"	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234867"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234868"	""	""	""	"1"	""	"01940"	"{PMID:Crescimanno 2015:25908581}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234869"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234870"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234871"	""	""	""	"1"	""	"01940"	"{PMID:Carlier 2011:21803581}"	""	""	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234872"	""	""	""	"1"	""	"01940"	"{PMID:Bergsma 2015:25243733}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234873"	""	""	""	"1"	""	"01940"	"{PMID:Case 2008:18930676}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234874"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234875"	""	""	""	"1"	""	"01940"	"{PMID:Schneider 2013:23160972}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234876"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234877"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234878"	""	""	""	"1"	""	"01940"	"{PMID:Alcantara-Ortigoza 2010:20350966}"	""	"M"	""	"Mexico"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234879"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234880"	""	""	""	"1"	""	"01940"	"{PMID:Ravaglia 2012:22704482}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234881"	""	""	""	"1"	""	"01940"	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234882"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Switzerland;Ecuador"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234883"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234884"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234885"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234886"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234887"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234888"	""	""	""	"1"	""	"01940"	"{PMID:Shin 2006:17027861}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234889"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234890"	""	""	""	"1"	""	"01940"	"{PMID:Bandyopadhyay 2015:25846667}"	""	"F"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234891"	""	""	""	"1"	""	"01940"	"{PMID:Hofstra 2004:14695533}"	""	""	""	"Australia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234892"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234893"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234894"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234895"	""	""	""	"1"	""	"01940"	"{PMID:Carlier 2011:21803581}"	""	""	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234896"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234897"	""	""	""	"1"	""	"01940"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234898"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234899"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234900"	""	""	""	"1"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234901"	""	""	""	"1"	""	"01940"	"{PMID:Sacconi 2010:20559845}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234902"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234903"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234904"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234905"	""	""	""	"3"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 3 affected (M/F/M)"	"F;M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234906"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234907"	""	""	""	"1"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234908"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234909"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234910"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234911"	""	""	""	"1"	""	"01940"	"{PMID:Terzis 2012:23146291}"	""	"M"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234912"	""	""	""	"1"	""	"01940"	"{PMID:Papadimas 2012:23843830}"	""	"M"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234913"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234914"	""	""	""	"1"	""	"01940"	"{PMID:Orlikowski 2011:21550241}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234915"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234916"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2006:16838077}"	""	"M"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234917"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Romania"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234918"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234919"	""	""	""	"2"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234920"	""	""	""	"1"	""	"01940"	"{PMID:Stepien 2016:26873529}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234921"	""	""	""	"1"	""	"01940"	"{PMID:Schneider 2013:23160972}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234922"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234923"	""	""	""	"2"	""	"01940"	"{PMID:Herzog 2012:22676651}"	"family, 2 affected females"	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234924"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234925"	""	""	""	"2"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	"family, 2 affected females"	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234926"	""	""	""	"7"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	"family, 7 affected (3F, 4M)"	"F;M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234927"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234928"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234929"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234930"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234931"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234932"	""	""	""	"1"	""	"01940"	"{PMID:Ravaglia 2012:22704482}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234933"	""	""	""	"1"	""	"01940"	"{PMID:van der Beek 2008:18757064}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234934"	""	""	""	"1"	""	"01940"	"{PMID:El-Gharbawy 2011:21605996}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234935"	""	""	""	"2"	""	"01940"	"{PMID:Remiche 2014:24158270}"	"family, 2 affected (M/F)"	"F;M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234936"	""	""	""	"2"	""	"01940"	"{PMID:van Capelle 2016:27189384}"	"family, 2 affected (M/F)"	"F;M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234937"	""	""	""	"1"	""	"01940"	"{PMID:van der Beek 2008:18757064}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234938"	""	""	""	"1"	""	"01940"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234939"	""	""	""	"2"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white (1)/Anglo-Canadian (1)"	""
"00234940"	""	""	""	"2"	""	"01940"	"{PMID:Sacconi 2010:20559845}"	"family, 2 affected males"	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234941"	""	""	""	"1"	""	"01940"	"{PMID:Boerkoel 1995:7717400}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234942"	""	""	""	"2"	""	"01940"	"{PMID:Huie 1994:7881425}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234943"	""	""	""	"5"	""	"01940"	"{PMID:Kroos 1995:8558570}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234944"	""	""	""	"3"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234945"	""	""	""	"2"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	"family, 2 affected males"	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234946"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234947"	""	""	""	"3"	""	"01940"	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234948"	""	""	""	"1"	""	"01940"	"{PMID:Nino 2013:23430493}"	""	"M"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234949"	""	""	""	"2"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 2 affected (F/M)"	"F;M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234950"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234951"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234952"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234953"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234954"	""	""	""	"1"	""	"01940"	"{PMID:Angelini 2007:17470141}"	""	"M"	""	"Italy"	"57y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234955"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234956"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234957"	""	""	""	"1"	""	"01940"	"{PMID:Wagner 2013:23062590}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234958"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234959"	""	""	""	"1"	""	"01940"	"{PMID:Kostera-Pruszczyk 2006:16531044}"	""	"M"	""	"Poland"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234960"	""	""	""	"1"	""	"01940"	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234961"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234962"	""	""	""	"1"	""	"01940"	"{PMID:Peric 2014:24338761}"	""	"M"	""	"Serbia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234963"	""	""	""	"1"	""	"01940"	"{PMID:Schneider 2013:23160972}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234964"	""	""	""	"3"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234965"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234966"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2006:16838077}"	""	"M"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234967"	""	""	""	"3"	""	"01940"	"{PMID:Palmer 2007:17056254}"	"family, 3 affected (M/M/F)"	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234968"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234969"	""	""	""	"1"	""	"01940"	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234970"	""	""	""	"2"	""	"01940"	"{PMID:Nicolino 1997:9196050}"	"family, 2 affected females"	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234971"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234972"	""	""	""	"10"	""	"01940"	"{PMID:Wokke 1995:7668832}"	"family, 10 affected (6F, 4M)"	"F;M"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234973"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234974"	""	""	""	"6"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	"family, 6 affected (3F, 3M)"	"F;M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234975"	""	""	""	"1"	""	"01940"	"{PMID:Nino 2013:23430493}"	""	"F"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234976"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234977"	""	""	""	"2"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white (1)/Anglo-Canadian (1)"	""
"00234978"	""	""	""	"11"	""	"01940"	"{PMID:Kroos 1995:8558570}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234979"	""	""	""	"3"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	"family, 3 affected (2F, M)"	"F;M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234980"	""	""	""	"2"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	"family, 2 affected females"	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234981"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234982"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"South America"	""
"00234983"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234984"	""	""	""	"1"	""	"01940"	"{PMID:Orlikowski 2011:21550241}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234985"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234986"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234987"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"M"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234988"	""	""	""	"1"	""	"01940"	"{PMID:Sacconi 2010:20559845}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234989"	""	""	""	"1"	""	"01940"	"{PMID:Spada 2013:23566438}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234990"	""	""	""	"1"	""	"01940"	"{PMID:Sacconi 2010:20559845}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234991"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234992"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234993"	""	""	""	"1"	""	"01940"	"{PMID:Dubrovsky 2013:23463700}"	""	"M"	""	"Argentina"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234994"	""	""	""	"1"	""	"01940"	"{PMID:Pardo 2015:25911022}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00234995"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234996"	""	""	""	"2"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234997"	""	""	""	"1"	""	"01940"	"{PMID:Spada 2013:23566438}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234998"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00234999"	""	""	""	"2"	""	"01940"	"{PMID:Tecellioglu 2015:26622091}"	"family, 2 affected (M/F)"	"F;M"	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235000"	""	""	""	"1"	""	"01940"	"{PMID:van der Beek 2008:18757064}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235001"	""	""	""	"1"	""	"01940"	"{PMID:Stepien 2016:26873529}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235002"	""	""	""	"1"	""	"01940"	"{PMID:Echaniz-Laguna 2015:25786784}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235003"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2006:16838077}"	""	"F"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235004"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235005"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 1998:9660056}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235006"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235007"	""	""	""	"3"	""	"01940"	"{PMID:Nino 2013:23430493}"	"family, 3 affected (F/M/M)"	"F;M"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235008"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235009"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235010"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235011"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235012"	""	""	""	"1"	""	"01940"	"{PMID:Orlikowski 2011:21550241}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235013"	""	""	""	"1"	""	"01940"	"{PMID:Bergsma 2015:25243733}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235014"	""	""	""	"1"	""	"01940"	"{PMID:Manwaring 2012:21687968}"	""	"M"	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235015"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235016"	""	""	""	"1"	""	"01940"	"{PMID:Nino 2013:23430493}"	""	"M"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235017"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Turkey"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235018"	""	""	""	"2"	""	"01940"	"{PMID:Loureiro Neves 2013:24016645}"	"family, 2 affected females"	"F"	""	"Portugal"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235019"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235020"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235021"	""	""	""	"2"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235022"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235023"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235024"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235025"	""	""	""	"1"	""	"01940"	"{PMID:Adams 1997:9259196}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African american/ white"	""
"00235026"	""	""	""	"2"	""	"01940"	"{PMID:Lam 2003:12601120}"	"family, 2 affected males"	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235027"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235028"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235029"	""	""	""	"1"	""	"01940"	"{PMID:Prater 2012:22538254}, {PMID:Prater 2013:23787031}, {PMID:Kishnani 2007:17151339}, {PMID:Palermo 2012:22658377}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Hispanic"	""
"00235030"	""	""	""	"1"	""	"01940"	"{PMID:Cardone 2008:19046416}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235031"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Asian"	""
"00235032"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235033"	""	""	""	"1"	""	"01940"	"{PMID:Messinger 2012:22237443}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235034"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2006:16860134}"	""	"M"	""	""	"2y10m"	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235035"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}"	""	"M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235036"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235037"	""	""	""	"7"	""	"01940"	"{PMID:Sampaolo 2013:24107549}"	"family, 7 affected (4F, 3M)"	"F;M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235038"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235039"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235040"	""	""	""	"1"	""	"01940"	"{PMID:Huie 2002:11854868}"	""	""	""	"El Salvador"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235041"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235042"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235043"	""	""	""	"2"	""	"01940"	"{PMID:Chien 2015:25466677}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235044"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235045"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235046"	""	""	""	"1"	""	"01940"	"{PMID:Amartino 2006:16433701}"	""	"M"	""	"Argentina"	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235047"	""	""	""	"1"	""	"01940"	"{PMID:Nilsson 2014:24384324}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235048"	""	""	""	"2"	""	"01940"	"{PMID:Fernandez-Hojas 2002:11738358}, {PMID:Gort 2007:17616415}"	"family, 2 affected (M/?)"	""	""	"Spain"	"<2y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235049"	""	""	""	"2"	""	"01940"	"{PMID:Dlamini 2008:18434155}"	"family, 2 affected females"	"F"	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235050"	""	""	""	"1"	""	"01940"	"{PMID:Bergsma 2015:25243733}"	""	"F"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235051"	""	""	""	"1"	""	"01940"	"{PMID:Ding 2015:26310554}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235052"	""	""	""	"1"	""	"01940"	"{PMID:Fujimoto 2013:24190153}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235053"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	"M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235054"	""	""	""	"1"	""	"01940"	"{PMID:Ishigaki 2012:21704464}"	""	"F"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235055"	""	""	""	"2"	""	"01940"	"{PMID:Nabatame 2009:18495398}"	"family, 2 affected females"	"F"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235056"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	"F"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235057"	""	""	""	"1"	""	"01940"	"{PMID:Kobayashi 2010:20202878}"	""	"M"	""	"Japan"	"29y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235058"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}"	""	"F"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235059"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235060"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	"F"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235061"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235062"	""	""	""	"1"	""	"01940"	"{PMID:Raben 1999:10189220}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00235063"	""	""	""	"1"	""	"01940"	"{PMID:Raben 1999:10189220}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00235064"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235065"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235066"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235067"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"South Africa"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235068"	""	""	""	"1"	""	"01940"	"{PMID:Hu 2015:25612604}"	""	"M"	""	"China"	"10m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235069"	""	""	""	"1"	""	"01940"	"{PMID:Elder 2013:23601496}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Hispanic"	""
"00235070"	""	""	""	"2"	""	"01940"	"{PMID:Liu 2014:25526786}"	"family, 2 affected females"	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235071"	""	""	""	"1"	""	"01940"	"{PMID:Yang 2014:24243590}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235072"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Indoamerican-Spanish"	""
"00235073"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235074"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2015:25466677}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235075"	""	""	""	"2"	""	"01940"	"{PMID:Shieh 1996:8604985}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235076"	""	""	""	"2"	""	"01940"	"{PMID:Shieh 1998:9554747}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235077"	""	""	""	"3"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235078"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235079"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2014:24706590}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235080"	""	""	""	"1"	""	"01940"	"{PMID:Stroppiano 2001:11343339}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235081"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	"10m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235082"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1994:7981676}"	""	"F"	""	"Canada"	"<2y"	"0"	"shared by Pompe Center Rotterdam"	""	"French-Canadian;Portuguese-Scandinavian"	""
"00235083"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235084"	""	""	""	"1"	""	"01940"	"{PMID:Fu 2014:24269976}"	""	"M"	""	"China"	"<19m"	"0"	"shared by Pompe Center Rotterdam"	""	"Northern China"	""
"00235085"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2006:16860134}"	""	"M"	""	""	"14m21d"	"0"	"shared by Pompe Center Rotterdam"	""	"Asian"	""
"00235086"	""	""	""	"1"	""	"01940"	"{PMID:Schneider 2013:23160972}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235087"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235088"	""	""	""	"1"	""	"01940"	"{PMID:Stepien 2016:26873529}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235089"	""	""	""	"1"	""	"01940"	"{PMID:Orlikowski 2011:21550241}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235090"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"M"	""	"Spain"	"6m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235091"	""	""	""	"1"	""	"01940"	"{PMID:Fu 2014:24269976}"	""	"M"	""	"China"	"<19m"	"0"	"shared by Pompe Center Rotterdam"	""	"Northern China"	""
"00235092"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235093"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235094"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235095"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235096"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235097"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235098"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235099"	""	""	""	"1"	""	"01940"	"{PMID:Labrousse 2010:20080426}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235100"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235101"	""	""	""	"1"	""	"01940"	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235102"	""	""	""	"1"	""	"01940"	"{PMID:Korpela 2009:19472353}"	""	"F"	""	"Finland"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235103"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235104"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235105"	""	""	""	"1"	""	"01940"	"{PMID:Alejaldre 2012:22980766}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235106"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2006:16838077}"	""	"F"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235107"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235108"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235109"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235110"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235111"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235112"	""	""	""	"2"	""	"01940"	"{PMID:Park 2013:23884227}"	"family, 2 affected (F/M)"	"F;M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235113"	""	""	""	"1"	""	"01940"	"{PMID:Herzog 2012:22676651}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235114"	""	""	""	"1"	""	"01940"	"{PMID:Palermo 2012:22658377}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235115"	""	""	""	"1"	""	"01940"	"{PMID:Ishigaki 2012:21676566}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235116"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235117"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235118"	""	""	""	"1"	""	"01940"	"{PMID:Ding 2015:26310554}"	""	"F"	""	"China"	"1y5m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235119"	""	""	""	"2"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 2 affected males"	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235120"	""	""	""	"1"	""	"01940"	"{PMID:Pipo 2003:14643388}"	""	"F"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235121"	""	""	""	"1"	""	"01940"	"{PMID:Broomfield 2016:26497565}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235122"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235123"	""	""	""	"1"	""	"01940"	"{PMID:Van den Hout 2004:15121988}"	""	"M"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235124"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	""	""	"Canada"	""	"0"	"shared by Pompe Center Rotterdam"	""	"French-Canadian;Ireland"	""
"00235125"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235126"	""	""	""	"1"	""	"01940"	"{PMID:Muraoka 2011:22185990}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235127"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235128"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235129"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235130"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235131"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235132"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235133"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2006:16860134}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Asian"	""
"00235134"	""	""	""	"1"	""	"01940"	"{PMID:Remiche 2014:24158270}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235135"	""	""	""	"1"	""	"01940"	"{PMID:Park 2006:17092519}"	""	"M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235136"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235137"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235138"	""	""	""	"1"	""	"01940"	"{PMID:Ding 2015:26310554}"	""	"F"	""	"China"	"1y10m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235139"	""	""	""	"1"	""	"01940"	"{PMID:Khan 2013:23430500}"	""	"M"	""	"Canada"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235140"	""	""	""	"1"	""	"01940"	"{PMID:McCready 2007:17723315}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235141"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1993:8401535}, {PMID:Trend 1985:3865697}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235142"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235143"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1998:9535769}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Celtic"	""
"00235144"	""	""	""	"1"	""	"01940"	"{PMID:Elder 2013:23601496}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Hispanic"	""
"00235145"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2004:15145338}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235146"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	"12m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235147"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235148"	""	""	""	"2"	""	"01940"	"{PMID:Shieh 1998:9554747}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235149"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235150"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2015:25466677}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235151"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	"15m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235152"	""	""	""	"2"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235153"	""	""	""	"2"	""	"01940"	"{PMID:Liu 2014:25526786}"	"family, 2 affected (M/F)"	"F;M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235154"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235155"	""	""	""	"1"	""	"01940"	"{PMID:Yang 2016:26685070}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235156"	""	""	""	"1"	""	"01940"	"{PMID:Yang 2014:24243590}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235157"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	"31m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235158"	""	""	""	"1"	""	"01940"	"{PMID:Ko 1999:10338092}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235159"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1993:8094613}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African american"	""
"00235160"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	"12m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235161"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2015:25466677}, {PMID:Chien 2009:19948615}, {PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235162"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1994:7981676}"	""	"F"	""	"Canada"	""	"0"	"shared by Pompe Center Rotterdam"	""	"French-Canadian"	""
"00235163"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2006:16860134}"	""	"F"	""	""	"2y1m"	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235164"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235165"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2004:14972326}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235166"	""	""	""	"2"	""	"01940"	"{PMID:Stenger 2015:26167453}"	"family, 2 affected males"	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00235167"	""	""	""	"1"	""	"01940"	"{PMID:Qiu 2007:18211760}"	""	"F"	""	"China"	"10y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235168"	""	""	""	"1"	""	"01940"	"{PMID:Nino 2013:23430493}"	""	"M"	""	"Colombia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235169"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235170"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"M"	""	"Italy"	"1y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235171"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235172"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235173"	""	""	""	"2"	""	"01940"	"{PMID:Sampaolo 2013:24107549}"	"family, 2 affected males"	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235174"	""	""	""	"1"	""	"01940"	"{PMID:Palmer 2007:17056254}"	""	"M"	""	"Spain;Italy"	"10m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235175"	""	""	""	"3"	""	"01940"	"{PMID:Liu 2014:25526786}"	"family, 3 affected (M/F/F)"	"F;M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235176"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235177"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235178"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235179"	""	""	""	"1"	""	"01940"	"{PMID:Boerkoel 1995:7717400}"	""	"M"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235180"	""	""	""	"2"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	"family, 2 affected females"	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235181"	""	""	""	"1"	""	"01940"	"{PMID:Becker 1998:9529346}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"Africa"	""
"00235182"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 2006:16838077}"	""	"M"	""	"Greece"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235183"	""	""	""	"1"	""	"01940"	"{PMID:Yang 2011:21757382}"	""	""	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235184"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235185"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Australia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235186"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235187"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235188"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235189"	""	""	""	"2"	""	"01940"	"{PMID:Rozdzynska-Swiatkowska 2016:26253708}"	"family, 2 affected (M/F)"	"F;M"	""	"Poland"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235190"	""	""	""	"2"	""	"01940"	"{PMID:Turaca 2015:25681614}"	""	""	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235191"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235192"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"F"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235193"	""	""	""	"1"	""	"01940"	"{PMID:Fu 2014:24269976}"	""	"F"	""	"China"	"<19m"	"0"	"shared by Pompe Center Rotterdam"	""	"South China"	""
"00235194"	""	""	""	"1"	""	"01940"	"{PMID:Kroos 1998:9660056}"	""	"F"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235195"	""	""	""	"1"	""	"01940"	"{PMID:Loureiro Neves 2013:24016645}"	""	"F"	""	"Portugal"	"5y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235196"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2012:22252923}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235197"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235198"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235199"	""	""	""	"1"	""	"01940"	"{PMID:Labrousse 2010:20080426}"	""	"F"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235200"	""	""	""	"1"	""	"01940"	"{PMID:Fu Liong 2014:25093132}"	""	"F"	""	"Malaysia"	""	"0"	"shared by Pompe Center Rotterdam"	""	"Malaysian Chinese"	""
"00235201"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"F"	""	"Italy"	"4y4m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235202"	""	""	""	"2"	""	"01940"	"{PMID:Liu 2014:25526786}"	"family, 2 affected (F/M)"	"F;M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235203"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235204"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235205"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235206"	""	""	""	"1"	""	"01940"	"{PMID:Gort 2007:17616415}"	""	""	""	"Spain"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235207"	""	""	""	"1"	""	"01940"	"{PMID:Van den Hout 2004:15121988}"	""	"F"	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235208"	""	""	""	"1"	""	"01940"	"<a href=\'http://raredisorders.imedpub.com/muscle-mri-in-classic-infantilepompe-disease.php?aid=6697\'>Wens 2015</a>"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235209"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235210"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235211"	""	""	""	"1"	""	"01940"	"{PMID:Messinger 2012:22237443}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235212"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235213"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 1994:7881422}"	""	"F"	""	"Netherlands"	"18y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235214"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1999:10377006}"	""	"M"	""	""	"14m"	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235215"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Australia"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235216"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	"M"	""	"Netherlands"	"14y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235217"	""	""	""	"1"	""	"01940"	"{PMID:Manwaring 2012:21687968}"	""	"F"	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235218"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235219"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235220"	""	""	""	"1"	""	"01940"	"{PMID:Swarr 2012:23430912}"	""	"M"	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235221"	""	""	""	"1"	""	"01940"	"{PMID:Kindel 2012:22555271}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235222"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235223"	""	""	""	"4"	""	"01940"	"{PMID:Kroos 1995:8558570}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235224"	""	""	""	"1"	""	"01940"	"{PMID:Banugaria 2013:23825616}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00235225"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235226"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2003:12923862}"	""	"M"	""	"Italy"	"3y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235227"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235228"	""	""	""	"1"	""	"01940"	"{PMID:Wens 2012:23000108}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235229"	""	""	""	"2"	""	"01940"	"{PMID:Kroos 1998:9660056}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235230"	""	""	""	"2"	""	"01940"	"{PMID:Khallaf 2013:23430560}"	"family, 2 affected (M/F)"	"F;M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"African American"	""
"00235231"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235232"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235233"	""	""	""	"1"	""	"01940"	"{PMID:Kobayashi 2010:20202878}"	""	"F"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235234"	""	""	""	"1"	""	"01940"	"{PMID:Maimaiti 2009:19609281}"	""	"M"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235235"	""	""	""	"1"	""	"01940"	"{PMID:Park 2015:25388776}"	""	""	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235236"	""	""	""	"1"	""	"01940"	"{PMID:Guevara-Campos 2013:24008937}"	""	"M"	""	"Venezuela"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235237"	""	""	""	"2"	""	"01940"	"{PMID:Wens 2012:23000108}"	"family, 2 affected males"	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235238"	""	""	""	"1"	""	"01940"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	"F"	""	"Spain"	"4m14d"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235239"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235240"	""	""	""	"1"	""	"01940"	"{PMID:Elder 2013:23601496}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235241"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	""	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235242"	""	""	""	"1"	""	"01940"	"{PMID:Bonnefoy 2008:18995995}"	""	"M"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235243"	""	""	""	"1"	""	"01940"	"{PMID:Fernandez-Hojas 2002:11738358}"	""	"F"	""	"Spain"	"10m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235244"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235245"	""	""	""	"1"	""	"01940"	"{PMID:Zouheir Habbal 2013:23632174}"	""	"M"	""	"Lebanon"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235246"	""	""	""	"1"	""	"01940"	"{PMID:Pipo 2003:14643388}"	""	"F"	""	"Japan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235247"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2003:12923862}"	""	"M"	""	"Italy"	"4y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235248"	""	""	""	"1"	""	"01940"	"{PMID:Aykut 2014:25026126}"	""	"F"	""	"Turkey"	"2y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235249"	""	""	""	"1"	""	"01940"	"{PMID:Montalvo 2006:16917947}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235250"	""	""	""	"1"	""	"01940"	"{PMID:Nilsson 2014:24384324}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235251"	""	""	""	"1"	""	"01940"	"{PMID:Muller-Felber 2007:17643989}"	""	"F"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235252"	""	""	""	"1"	""	"01940"	"{PMID:Anneser 2005:15668445}"	""	"F"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235253"	""	""	""	"1"	""	"01940"	"{PMID:Hermans 2004:14695532}"	""	""	""	"Afghanistan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235254"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235255"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2010:19775921}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235256"	""	""	""	"1"	""	"01940"	"{PMID:Banugaria 2012:22365055}"	""	"M"	""	""	"4y2m"	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235257"	""	""	""	"1"	""	"01940"	"{PMID:Kishnani 2010:19775921}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235258"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235259"	""	""	""	"1"	""	"01940"	"{PMID:Huie 1998:9535769}"	""	"M"	""	"United States"	"44y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235260"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235261"	""	""	""	"1"	""	"01940"	"{PMID:Fu 2014:24269976}"	""	"F"	""	"China"	"<19m"	"0"	"shared by Pompe Center Rotterdam"	""	"South China"	""
"00235262"	""	""	""	"1"	""	"01940"	"{PMID:Nascimbeni 2008:18285536}"	""	"F"	""	"Italy"	"4y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235263"	""	""	""	"1"	""	"01940"	"{PMID:Oba-Shinjo 2009:19588081}"	""	"M"	""	"Brazil"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235264"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"F"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235265"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235266"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235267"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235268"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}"	""	"M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235269"	""	""	""	"1"	""	"01940"	"{PMID:Park 2006:17092519}"	""	"M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235270"	""	""	""	"1"	""	"01940"	"{PMID:Qiu 2007:18211760}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235271"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2013:24169249}"	""	"F"	""	"China"	"1y2m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235272"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2003:12923862}"	""	"M"	""	"Italy"	"4m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235273"	""	""	""	"1"	""	"01940"	"{PMID:Orlikowski 2011:21550241}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235274"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235275"	""	""	""	"1"	""	"01940"	"{PMID:Bodamer 2002:1221361815}, {PMID:Hermans 2004:14695532}"	""	"M"	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235276"	""	""	""	"1"	""	"01940"	"{PMID:Fu 2014:24269976}"	""	"F"	""	"China"	"<19m"	"0"	"shared by Pompe Center Rotterdam"	""	"South China"	""
"00235277"	""	""	""	"1"	""	"01940"	"{PMID:Wens 2012:23000108}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235278"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"M"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235279"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235280"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235281"	""	""	""	"1"	""	"01940"	"{PMID:Park 2013:23884227}"	""	"M"	""	"Korea"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235282"	""	""	""	"1"	""	"01940"	"{PMID:Castro-Gago 1999:10528311}"	""	"M"	""	"Dominican Republic"	""	"0"	"shared by Pompe Center Rotterdam"	""	"white"	""
"00235283"	""	""	""	"1"	""	"01940"	"{PMID:Pittis 2008:18429042}"	""	"M"	""	"Italy"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235284"	""	""	""	"1"	""	"01940"	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235285"	""	""	""	"1"	""	"01940"	"{PMID:Wan 2008:18458862}"	""	""	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235286"	""	""	""	"1"	""	"01940"	"{PMID:Raben 1995:7603531}"	""	""	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235287"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"F"	""	"France"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235288"	""	""	""	"1"	""	"01940"	"{PMID:Markic 2014:24337590}"	""	"F"	""	"Croatia (Hrvatska)"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235289"	""	""	""	"3"	""	"01940"	"{PMID:Kroos 1998:9660056}"	""	""	""	"Netherlands"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235290"	""	""	""	"1"	""	"01940"	"{PMID:Bali 2011:21484825}"	""	""	""	"United States"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235291"	""	""	""	"1"	""	"01940"	"{PMID:Vill 2015:25455803}"	""	""	""	"Germany"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235292"	""	""	""	"1"	""	"01940"	"{PMID:Laforet 2000:11071489}"	""	"M"	""	""	""	"0"	"shared by Pompe Center Rotterdam"	""	"North Africa"	""
"00235293"	""	""	""	"1"	""	"01940"	"{PMID:Dou 2006:16782080}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235294"	""	""	""	"2"	""	"01940"	"{PMID:Pittis 2003:12923862}"	"family, 2 affected (M/F)"	"F;M"	""	"Italy"	"3y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235295"	""	""	""	"1"	""	"01940"	"{PMID:Ding 2015:26310554}"	""	"F"	""	"China"	"1y"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235296"	""	""	""	"1"	""	"01940"	"{PMID:Aminoso 2013:23402890}"	""	"M"	""	"Spain"	"17m"	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235297"	""	""	""	"1"	""	"01940"	"{PMID:Liu 2014:25526786}"	""	"F"	""	"China"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235298"	""	""	""	"3"	""	"01940"	"{PMID:Chien 2011:21232767}"	"family, 3 affected (M/F/M)"	"F;M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00235299"	""	""	""	"1"	""	"01940"	"{PMID:Chien 2011:21232767}"	""	"M"	""	"Taiwan"	""	"0"	"shared by Pompe Center Rotterdam"	""	""	""
"00246696"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246697"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246698"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246699"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246700"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246701"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246702"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246703"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246704"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246705"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246706"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246707"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246708"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246709"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246710"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246711"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246859"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246860"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246861"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246862"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246863"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246864"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246865"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246866"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246867"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246868"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246869"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246870"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246871"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246872"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246873"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246874"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246875"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246877"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246878"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246879"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246880"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246881"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246882"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246883"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246884"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246885"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246886"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246887"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246888"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246889"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246891"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246893"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246894"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246895"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246896"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246897"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00246899"	""	""	""	"1"	""	"03362"	"manuscript submitted, 2019"	""	""	""	""	""	"0"	""	""	""	""
"00248150"	""	""	""	"1"	""	"01164"	""	""	"M"	""	""	""	"0"	""	""	""	""
"00274311"	""	""	""	"1"	""	"00006"	"{PMID:Reddy 2017:27708273}"	""	"M"	""	"United States"	""	"0"	""	""	"Wales/England"	"Fam1117"
"00274406"	""	""	""	"1"	""	"00006"	"{PMID:Park 2017:27363342}"	""	"F"	""	"Korea"	""	"0"	""	""	""	"Pat13"
"00274407"	""	""	""	"1"	""	"00006"	"{PMID:Park 2017:27363342}"	""	"M"	""	"Korea"	""	"0"	""	""	""	"Pat110"
"00274408"	""	""	""	"1"	""	"00006"	"{PMID:Park 2017:27363342}"	""	"F"	""	"Korea"	""	"0"	""	""	""	"Pat141"
"00291874"	""	""	""	"8"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291875"	""	""	""	"34"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291876"	""	""	""	"3"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291877"	""	""	""	"55"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291878"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291879"	""	""	""	"199"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00291880"	""	""	""	"3"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00295523"	""	""	""	"1"	""	"03625"	""	""	"F"	""	"China"	""	"0"	""	""	""	""
"00295526"	""	""	""	"1"	""	"03625"	""	""	"F"	""	""	""	"0"	""	""	""	""
"00295527"	""	""	""	"1"	""	"03625"	""	""	"F"	""	"China"	""	"0"	""	""	""	""
"00301608"	""	""	""	"1"	""	"03678"	""	"compound heterozygous patient"	"F"	""	"Greece"	"67y"	""	""	""	""	""
"00304607"	""	""	""	"1"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00304608"	""	""	""	"10"	""	"03575"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	"analysis 2794 individuals (India)"	""	""	"India"	""	"0"	""	""	""	""
"00305685"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	"68y"	"0"	""	"2y enzyme replacement therapy"	""	"Pat1"
"00305686"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"4y enzyme replacement therapy"	""	"Pat2"
"00305687"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"8y enzyme replacement therapy"	""	"Pat3"
"00305688"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat4"
"00305689"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"2y enzyme replacement therapy"	""	"Pat5"
"00305690"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"7y enzyme replacement therapy"	""	"Pat6"
"00305691"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"4y enzyme replacement therapy"	""	"Pat7"
"00305692"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	"?"	"0"	""	"3y enzyme replacement therapy"	""	"Pat8"
"00305693"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat9"
"00305694"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	"?"	"0"	""	"8y enzyme replacement therapy"	""	"Pat10"
"00305695"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat11"
"00305696"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"14y enzyme replacement therapy"	""	"Pat12"
"00305697"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"2y enzyme replacement therapy"	""	"Pat13"
"00305698"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	"62y"	"0"	""	"2y enzyme replacement therapy"	""	"Pat14"
"00305699"	""	""	""	"2"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"family, 2 affected, Pat1"	"M"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat15"
"00305700"	""	""	"00305699"	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"Pat2"	"M"	""	"Belgium"	""	"0"	""	"11y enzyme replacement therapy"	""	"Pat16"
"00305701"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"9y enzyme replacement therapy"	""	"Pat17"
"00305702"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"12y enzyme replacement therapy"	""	"Pat18"
"00305703"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"10y enzyme replacement therapy"	""	"Pat19"
"00305704"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"9y enzyme replacement therapy"	""	"Pat20"
"00305705"	""	""	""	"2"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"family, 2 affected, Pat1"	"M"	""	"Belgium"	""	"0"	""	"10y enzyme replacement therapy"	""	"Pat21"
"00305706"	""	""	"00305705"	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"Pat2"	"M"	""	"Belgium"	""	"0"	""	"9y enzyme replacement therapy"	""	"Pat22"
"00305707"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"7y enzyme replacement therapy"	""	"Pat23"
"00305708"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"12y enzyme replacement therapy"	""	"Pat24"
"00305709"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"8y enzyme replacement therapy"	""	"Pat25"
"00305710"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"6y enzyme replacement therapy"	""	"Pat26"
"00305711"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"5y enzyme replacement therapy"	""	"Pat27"
"00305712"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"3y enzyme replacement therapy"	""	"Pat28"
"00305713"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"14y enzyme replacement therapy"	""	"Pat29"
"00305714"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat30"
"00305715"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat31"
"00305716"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"13y enzyme replacement therapy"	""	"Pat32"
"00305717"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"11y enzyme replacement therapy"	""	"Pat33"
"00305718"	""	""	""	"2"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"family, 2 affected, Pat1"	"M"	""	"Belgium"	""	"0"	""	"12y enzyme replacement therapy"	""	"Pat34"
"00305719"	""	""	"00305718"	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"Pat2"	"F"	""	"Belgium"	"78y"	"0"	""	""	""	"Pat35"
"00305720"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"11y enzyme replacement therapy"	""	"Pat36"
"00305721"	""	""	""	"2"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"family, 2 affected, Pat1"	"M"	""	"Belgium"	""	"0"	""	"10y enzyme replacement therapy"	""	"Pat37"
"00305722"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"9y enzyme replacement therapy"	""	"Pat38"
"00305723"	""	""	"00305721"	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	"Pat2"	"F"	""	"Belgium"	""	"0"	""	"7y enzyme replacement therapy"	""	"Pat39"
"00305724"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"3y enzyme replacement therapy"	""	"Pat40"
"00305725"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"2y enzyme replacement therapy"	""	"Pat41"
"00305726"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"5y enzyme replacement therapy"	""	"Pat42"
"00305727"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"11y enzyme replacement therapy"	""	"Pat43"
"00305728"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"7y enzyme replacement therapy"	""	"Pat44"
"00305729"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	"65y"	"0"	""	"7y enzyme replacement therapy"	""	"Pat45"
"00305730"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"8y enzyme replacement therapy"	""	"Pat46"
"00305731"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"11y enzyme replacement therapy"	""	"Pat47"
"00305732"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"14y enzyme replacement therapy"	""	"Pat48"
"00305733"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"2y enzyme replacement therapy"	""	"Pat49"
"00305734"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"M"	""	"Belgium"	""	"0"	""	"3y enzyme replacement therapy"	""	"Pat50"
"00305735"	""	""	""	"1"	""	"00006"	"{PMID:Vanherpe 2020:32248831}"	""	"F"	""	"Belgium"	""	"0"	""	"4m enzyme replacement therapy"	""	"Pat51"
"00306730"	""	""	""	"1"	""	"00766"	"{PMID:Bergsma 2021:33168984}"	""	""	""	""	""	"0"	""	""	""	"Pat1"
"00306731"	""	""	""	"1"	""	"00766"	"Takahashi 2016, {PMID:Bergsma 2021:33168984}"	""	""	""	"Japan"	""	"0"	""	""	""	"Pat2"
"00306732"	""	""	""	"1"	""	"00766"	"{PMID:Bergsma 2021:33168984}"	""	""	""	""	""	"0"	""	""	""	"Pat4"
"00306733"	""	""	""	"1"	""	"00766"	"{PMID:Bergsma 2021:33168984}"	""	""	""	""	""	"0"	""	""	""	"Pat3"
"00307084"	""	""	""	"1"	""	"00766"	"{PMID:Bergsma 2021:33168984}"	""	"-"	""	""	""	"0"	""	""	""	"control"
"00314310"	""	""	""	"8"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314311"	""	""	""	"2"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314312"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314313"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314314"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314315"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314316"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314317"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314318"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314319"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314320"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00314321"	""	""	""	"1"	""	"00006"	"{PMID:Topf 2020:32528171}"	"analysis 1001 patients with unexplained limb-girdle weakness"	""	""	""	""	"0"	""	""	""	""
"00374320"	""	""	""	"1"	""	"00006"	"{PMID:Ganapathy 2019:31069529}"	""	""	""	"India"	""	"0"	""	""	""	"S-3714"
"00380811"	""	""	""	"1"	""	"00000"	"{PMID:Nair 2018:30293248}"	""	"?"	""	"Lebanon"	""	"0"	""	""	""	"?"
"00388003"	""	""	""	"1"	""	"04146"	"{PMID:Chakravorty 2020:33250842}"	""	"M"	"?"	"India"	""	""	""	""	""	"Pat112"
"00388671"	""	""	""	"1"	""	"00006"	"{PMID:Chakravorty 2020:33250842}"	""	"F"	""	"India"	""	"0"	""	""	"India"	"Pat72"
"00388672"	""	""	""	"1"	""	"00006"	"{PMID:Chakravorty 2020:33250842}"	""	"M"	""	"India"	""	"0"	""	""	"India"	"Pat73"
"00388691"	""	""	""	"1"	""	"00006"	"{PMID:Chakravorty 2020:33250842}"	""	"F"	""	"India"	""	"0"	""	""	"India"	"Pat42"
"00404984"	""	""	""	"1"	""	"00006"	"{PMID:Chawla 2022:34864681}"	""	"M"	"yes"	"India"	""	"0"	""	""	""	"Pat1"
"00404985"	""	""	""	"1"	""	"00006"	"{PMID:Chawla 2022:34864681}"	""	"M"	"yes"	"India"	""	"0"	""	""	""	"Pat2"
"00404986"	""	""	""	"1"	""	"00006"	"{PMID:Chawla 2022:34864681}"	""	"M"	"no"	"India"	""	"0"	""	""	""	"Pat3"
"00404987"	""	""	""	"1"	""	"00006"	"{PMID:Chawla 2022:34864681}"	""	"M"	"no"	"India"	""	"0"	""	""	""	"Pat4"
"00404988"	""	""	""	"1"	""	"00006"	"{PMID:Chawla 2022:34864681}"	""	"F"	""	"India"	""	"0"	""	""	""	"Pat5"
"00413105"	""	""	""	"1"	""	"00006"	"{PMID:Cerino 2022:35741838}"	"analysis 82 myopathy patients"	""	""	"Chile"	""	"0"	""	""	""	"P34/Myo096"
"00413135"	""	""	""	"1"	""	"00006"	"{PMID:Cerino 2022:35741838}"	"analysis 82 myopathy patients"	""	""	"Chile"	""	"0"	""	""	""	"P78/Myo154"
"00413456"	""	""	""	"1"	""	"00006"	"{PMID:He 2022:35722482}"	""	"M"	""	"China"	""	"0"	""	""	""	"Pat1"
"00413457"	""	""	""	"1"	""	"00006"	"{PMID:He 2022:35722482}"	""	"M"	""	"China"	""	"0"	""	""	""	"Pat2"
"00414481"	""	""	""	"1"	""	"00000"	"{PMID:Sun 2018:30076350}"	""	"M"	""	"China"	""	"0"	""	""	""	"WHP148"
"00418602"	""	""	""	"4"	""	"00006"	"{PMID:Bertoli-Avella 2022:34952832}"	"4-generation family, 4 affected (F, 3M), unaffected heterozygous carrier parents/relatives"	"M"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"Fam7b"
"00418603"	""	""	"00418602"	"1"	""	"00006"	"{PMID:Bertoli-Avella 2022:34952832}"	"sister"	"F"	"yes"	"Saudi Arabia"	""	"0"	""	""	""	"Fam7s"
"00426977"	""	""	""	"1"	""	"00006"	"{PMID:Reiner 2022:36459106}"	"carrier screening 73,755 controls"	""	""	"United States"	""	"0"	""	""	""	""
"00426978"	""	""	""	"1"	""	"00006"	"{PMID:Reiner 2022:36459106}"	"carrier screening 73,755 controls"	""	""	"United States"	""	"0"	""	""	""	""
"00427052"	""	""	""	"1"	""	"00006"	"{PMID:Reiner 2022:36459106}"	"carrier screening 73,755 controls"	""	""	"United States"	""	"0"	""	""	""	""
"00427053"	""	""	""	"1"	""	"00006"	"{PMID:Reiner 2022:36459106}"	"carrier screening 73,755 controls"	""	""	"United States"	""	"0"	""	""	""	""
"00427054"	""	""	""	"1"	""	"00006"	"{PMID:Reiner 2022:36459106}"	"carrier screening 73,755 controls"	""	""	"United States"	""	"0"	""	""	""	""
"00427980"	""	""	""	"1"	""	"00006"	"{PMID:Bournazos 2022:34906502}"	"family, 1 affected"	""	""	"Australia"	""	"0"	""	""	""	"A036"
"00442664"	""	""	""	"1"	""	"00006"	"{PMID:Westra 2019:31127727}"	""	"F"	""	""	""	"0"	""	""	""	"Pat36"
"00453583"	""	""	""	"1"	""	"00454"	""	"Patient has an initial diagnoses of LOPD"	"F"	""	"Argentina"	""	""	""	""	""	"#33DM"
"00454543"	""	""	""	"1"	""	"00006"	"{PMID:Xie 2024:39198981}"	"patient"	"M"	""	"China"	""	"0"	""	"not treated"	""	"Pat288"
"00454544"	""	""	""	"1"	""	"00006"	"{PMID:Xie 2024:39198981}"	"patient"	"M"	""	"China"	""	"0"	""	"not treated"	""	"Pat289"
"00456257"	""	""	""	"1"	""	"00006"	"{PMID:Fernandez-Marmiesse 2014:24767253}"	""	"M"	""	"Spain"	""	"0"	""	""	""	"Pat35"
"00457664"	""	""	""	"1"	""	"00006"	"{PMID:Lord 2024:39243181}"	""	""	""	"United Kingdom (Great Britain)"	""	"0"	""	""	""	"PatGAA"
"00460252"	""	""	""	"1"	""	"00006"	"{PMID:Marti 2025:39666917}"	"patient, no family history"	""	""	"Spain"	""	"0"	""	""	""	"Pat23"
"00460264"	""	""	""	"1"	""	"00006"	"{PMID:Marti 2025:39666917}"	"patient, no family history"	""	""	"Spain"	""	"0"	""	""	""	"Pat35"
"00468229"	""	""	""	"1"	""	"00006"	"{PMID:Ayala-Ramirez 2025:41066171}"	"patient"	"M"	""	"Colombia"	""	"0"	""	""	""	"Pat182"
"00468233"	""	""	""	"1"	""	"00006"	"{PMID:Ayala-Ramirez 2025:41066171}"	"patient"	"M"	""	"Colombia"	""	"0"	""	""	""	"Pat120"
"00468242"	""	""	""	"1"	""	"00006"	"{PMID:Ayala-Ramirez 2025:41066171}"	"patient"	"M"	""	"Colombia"	""	"0"	""	""	""	"Pat159"


## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 1470
"{{individualid}}"	"{{diseaseid}}"
"00000039"	"05427"
"00100967"	"01822"
"00100968"	"00000"
"00100969"	"00000"
"00100970"	"00000"
"00100971"	"00000"
"00100972"	"00000"
"00100973"	"00000"
"00100974"	"00000"
"00100975"	"00000"
"00100976"	"00000"
"00100977"	"00000"
"00100978"	"01822"
"00100979"	"00000"
"00100980"	"00000"
"00100981"	"00000"
"00100982"	"00000"
"00100983"	"00000"
"00100984"	"00000"
"00100985"	"00000"
"00100986"	"00000"
"00100987"	"00000"
"00100988"	"00000"
"00100989"	"00000"
"00100990"	"00000"
"00100991"	"00000"
"00100992"	"00000"
"00100993"	"00000"
"00100994"	"00000"
"00100995"	"01822"
"00100996"	"01822"
"00100997"	"00000"
"00100998"	"00000"
"00100999"	"00000"
"00101000"	"01822"
"00101001"	"01822"
"00101002"	"01822"
"00101003"	"01822"
"00101004"	"01822"
"00101005"	"01822"
"00101006"	"01822"
"00101007"	"01822"
"00101008"	"01822"
"00101009"	"00000"
"00101010"	"00000"
"00101011"	"00000"
"00101012"	"01822"
"00101013"	"01822"
"00101014"	"01822"
"00101015"	"01822"
"00101016"	"00000"
"00101017"	"00000"
"00101018"	"00000"
"00101019"	"00000"
"00101020"	"01822"
"00101021"	"01822"
"00101022"	"01822"
"00101023"	"01822"
"00101024"	"01822"
"00101025"	"01822"
"00101026"	"01822"
"00101027"	"01822"
"00101028"	"01822"
"00101029"	"01822"
"00101030"	"01822"
"00101031"	"01822"
"00101032"	"01822"
"00101033"	"01822"
"00101034"	"00000"
"00101035"	"00000"
"00101036"	"00000"
"00101037"	"00000"
"00101038"	"01822"
"00101041"	"01822"
"00101044"	"01822"
"00101045"	"00000"
"00101046"	"00000"
"00101047"	"01822"
"00101048"	"00000"
"00101049"	"01822"
"00101050"	"00000"
"00101051"	"00000"
"00101052"	"01822"
"00101053"	"00000"
"00101054"	"01822"
"00101055"	"01822"
"00101056"	"00000"
"00101057"	"01822"
"00101058"	"01822"
"00101059"	"01822"
"00101060"	"01822"
"00101061"	"01822"
"00101062"	"00000"
"00101063"	"01822"
"00101064"	"01822"
"00101065"	"01822"
"00101066"	"01822"
"00101067"	"01822"
"00101068"	"01822"
"00101069"	"01822"
"00101070"	"01822"
"00101071"	"01822"
"00101072"	"01822"
"00101073"	"01822"
"00101074"	"01822"
"00101075"	"01822"
"00101076"	"01822"
"00101077"	"01822"
"00101078"	"01822"
"00101079"	"01822"
"00101080"	"01822"
"00101081"	"01822"
"00101082"	"01822"
"00101083"	"01822"
"00101084"	"01822"
"00101085"	"01822"
"00101086"	"01822"
"00101087"	"01822"
"00101088"	"00000"
"00101089"	"01822"
"00101090"	"01822"
"00101091"	"01822"
"00101092"	"01822"
"00101093"	"01822"
"00101094"	"01822"
"00101095"	"01822"
"00101096"	"01822"
"00101097"	"01822"
"00101098"	"01822"
"00101099"	"01822"
"00101100"	"01822"
"00101101"	"01822"
"00101102"	"01822"
"00101103"	"01822"
"00101104"	"01822"
"00101105"	"01822"
"00101106"	"01822"
"00101107"	"01822"
"00101108"	"01822"
"00101109"	"01822"
"00101110"	"01822"
"00101111"	"01822"
"00101112"	"01822"
"00101113"	"01822"
"00101114"	"01822"
"00101115"	"01822"
"00101116"	"01822"
"00101117"	"01822"
"00101118"	"01822"
"00101119"	"01822"
"00101120"	"01822"
"00101121"	"01822"
"00101122"	"01822"
"00101123"	"01822"
"00101124"	"00198"
"00101125"	"01822"
"00101126"	"00000"
"00101127"	"01822"
"00101128"	"01822"
"00101129"	"01822"
"00101130"	"01822"
"00101131"	"01822"
"00101132"	"00000"
"00101133"	"00000"
"00101134"	"01822"
"00101135"	"01822"
"00101136"	"01822"
"00101137"	"01822"
"00101138"	"01822"
"00101139"	"01822"
"00101140"	"00000"
"00101141"	"01822"
"00101142"	"01822"
"00101143"	"01822"
"00101144"	"00000"
"00101145"	"01822"
"00101146"	"01822"
"00101147"	"01822"
"00101148"	"01822"
"00101149"	"01822"
"00101150"	"01822"
"00101151"	"01822"
"00101152"	"01822"
"00101153"	"01822"
"00101154"	"01822"
"00101155"	"01822"
"00101156"	"01822"
"00101157"	"01822"
"00101158"	"01822"
"00101159"	"01822"
"00101160"	"01822"
"00101161"	"01822"
"00101162"	"01822"
"00101163"	"01822"
"00101164"	"00000"
"00101165"	"01822"
"00101166"	"01822"
"00101167"	"01822"
"00101168"	"01822"
"00101169"	"00198"
"00101171"	"01822"
"00101172"	"01822"
"00101173"	"01822"
"00101174"	"01822"
"00101175"	"00198"
"00101176"	"01822"
"00101177"	"01822"
"00101178"	"01822"
"00101179"	"01822"
"00101180"	"00198"
"00101181"	"01822"
"00101182"	"01822"
"00101183"	"01822"
"00101184"	"01822"
"00101185"	"01822"
"00101186"	"01822"
"00101187"	"01822"
"00101188"	"01822"
"00101189"	"01822"
"00101190"	"01822"
"00101191"	"00198"
"00101192"	"00198"
"00101193"	"00244"
"00101194"	"01822"
"00101195"	"01822"
"00101196"	"01822"
"00101197"	"01822"
"00101198"	"01822"
"00101199"	"01822"
"00180906"	"05166"
"00183081"	"04216"
"00183082"	"04216"
"00183083"	"04216"
"00183084"	"04216"
"00219483"	"05126"
"00219489"	"05126"
"00219502"	"05126"
"00219551"	"05126"
"00219569"	"05126"
"00219575"	"05126"
"00219581"	"05126"
"00219582"	"05126"
"00219584"	"05126"
"00219605"	"05126"
"00219621"	"05126"
"00219622"	"05126"
"00219633"	"05126"
"00219634"	"05126"
"00219659"	"05126"
"00219660"	"05126"
"00219666"	"05126"
"00219677"	"05126"
"00219680"	"05126"
"00219716"	"05126"
"00219724"	"05126"
"00219736"	"04327"
"00219736"	"05126"
"00219756"	"00000"
"00219756"	"05126"
"00219763"	"00000"
"00219763"	"05126"
"00219766"	"05126"
"00219770"	"05126"
"00219784"	"05126"
"00219796"	"05126"
"00219815"	"05126"
"00219817"	"05126"
"00219838"	"05126"
"00219854"	"05126"
"00219866"	"05126"
"00219871"	"05126"
"00219880"	"05126"
"00219882"	"05126"
"00219888"	"05126"
"00219890"	"05126"
"00219922"	"05126"
"00219923"	"05126"
"00219929"	"05126"
"00219930"	"05126"
"00219931"	"05126"
"00219950"	"05126"
"00219953"	"05126"
"00219957"	"05126"
"00220044"	"05126"
"00220051"	"05126"
"00220065"	"05126"
"00220072"	"05126"
"00220094"	"05126"
"00220168"	"05126"
"00220176"	"05126"
"00220228"	"05126"
"00220281"	"05126"
"00220317"	"05126"
"00220330"	"05126"
"00220386"	"05126"
"00220390"	"05126"
"00220397"	"05126"
"00220446"	"05126"
"00220463"	"05126"
"00220481"	"05126"
"00220482"	"05126"
"00220487"	"05126"
"00220503"	"05126"
"00220506"	"05126"
"00220511"	"05126"
"00220520"	"05126"
"00220539"	"05126"
"00220554"	"05126"
"00220571"	"05126"
"00220573"	"05126"
"00220577"	"05126"
"00220585"	"05126"
"00220593"	"05126"
"00220594"	"05126"
"00220604"	"05126"
"00220605"	"05126"
"00220610"	"05126"
"00220653"	"05126"
"00220665"	"05126"
"00220668"	"05126"
"00220677"	"05126"
"00220687"	"05126"
"00220700"	"05126"
"00220707"	"05126"
"00220708"	"05126"
"00220733"	"05126"
"00220738"	"05126"
"00220746"	"05126"
"00220759"	"05126"
"00220787"	"05126"
"00220790"	"05126"
"00220792"	"05126"
"00220796"	"05126"
"00220803"	"05126"
"00220819"	"05126"
"00220823"	"05126"
"00220847"	"05126"
"00220858"	"05126"
"00220903"	"05126"
"00220911"	"05126"
"00220912"	"05126"
"00220932"	"05126"
"00220978"	"05126"
"00221005"	"05126"
"00221012"	"05126"
"00221028"	"05126"
"00221034"	"05126"
"00221054"	"05126"
"00221060"	"05126"
"00221084"	"05126"
"00221085"	"05126"
"00221091"	"05126"
"00221136"	"05126"
"00221148"	"05126"
"00221155"	"05126"
"00221157"	"05126"
"00221191"	"05126"
"00221194"	"05126"
"00221197"	"05126"
"00221201"	"05126"
"00221212"	"05126"
"00221216"	"05126"
"00221217"	"05126"
"00221282"	"05126"
"00221301"	"05126"
"00221306"	"05126"
"00221315"	"05126"
"00221334"	"05126"
"00221344"	"05126"
"00221366"	"05126"
"00221383"	"05126"
"00221407"	"05126"
"00221448"	"05126"
"00221449"	"05126"
"00221456"	"05126"
"00221470"	"05126"
"00221484"	"05126"
"00221493"	"05126"
"00221498"	"05126"
"00221511"	"05126"
"00221520"	"05126"
"00221521"	"05126"
"00221528"	"05126"
"00221529"	"05126"
"00221533"	"05126"
"00221535"	"05126"
"00221582"	"05126"
"00221597"	"05126"
"00221623"	"05126"
"00221634"	"05126"
"00221652"	"05126"
"00221682"	"05126"
"00221686"	"05126"
"00221706"	"05126"
"00221735"	"05126"
"00221737"	"05126"
"00221743"	"05126"
"00221760"	"05126"
"00221767"	"05126"
"00221793"	"05126"
"00221809"	"05126"
"00221843"	"05126"
"00221845"	"05126"
"00221851"	"05126"
"00221867"	"05126"
"00221878"	"05126"
"00221900"	"05126"
"00221922"	"05126"
"00221934"	"05126"
"00221946"	"05126"
"00221951"	"05126"
"00221990"	"05126"
"00222019"	"05126"
"00222023"	"05126"
"00222030"	"05126"
"00222061"	"05126"
"00222074"	"05126"
"00222075"	"05126"
"00222078"	"05126"
"00222086"	"05126"
"00222109"	"05126"
"00222111"	"05126"
"00222132"	"05126"
"00222137"	"05126"
"00222138"	"05126"
"00222158"	"05126"
"00222182"	"05126"
"00222208"	"05126"
"00222210"	"05126"
"00222229"	"05126"
"00222233"	"05126"
"00222238"	"05126"
"00222239"	"05126"
"00222243"	"05126"
"00222266"	"05126"
"00222271"	"05126"
"00222279"	"05126"
"00222330"	"05126"
"00222353"	"05126"
"00222356"	"05126"
"00222363"	"05126"
"00222370"	"05126"
"00222373"	"05126"
"00222380"	"05126"
"00222384"	"05126"
"00222390"	"05126"
"00222394"	"05126"
"00222403"	"05126"
"00222413"	"05126"
"00222446"	"05126"
"00222456"	"05126"
"00222458"	"05126"
"00222464"	"05126"
"00222475"	"05126"
"00222498"	"05126"
"00222515"	"05126"
"00222518"	"05126"
"00222539"	"05126"
"00222553"	"05126"
"00222578"	"05126"
"00222605"	"05126"
"00222626"	"05126"
"00222637"	"05126"
"00222642"	"05126"
"00222671"	"05126"
"00222681"	"05126"
"00222687"	"05126"
"00222695"	"05126"
"00222709"	"05126"
"00222716"	"05126"
"00222742"	"05126"
"00228668"	"01822"
"00228668"	"05320"
"00234476"	"00000"
"00234477"	"00000"
"00234478"	"00000"
"00234479"	"00000"
"00234480"	"00000"
"00234481"	"00000"
"00234482"	"00000"
"00234483"	"01822"
"00234484"	"01822"
"00234485"	"01822"
"00234486"	"01822"
"00234487"	"01822"
"00234488"	"01822"
"00234489"	"00000"
"00234490"	"01822"
"00234491"	"00000"
"00234492"	"01822"
"00234493"	"00000"
"00234494"	"01822"
"00234495"	"01822"
"00234496"	"01822"
"00234497"	"01822"
"00234498"	"00000"
"00234499"	"01822"
"00234500"	"00000"
"00234501"	"01822"
"00234502"	"01822"
"00234503"	"01822"
"00234504"	"01822"
"00234505"	"01822"
"00234506"	"01822"
"00234507"	"00000"
"00234508"	"01822"
"00234509"	"01822"
"00234510"	"01822"
"00234511"	"01822"
"00234512"	"01822"
"00234513"	"01822"
"00234514"	"01822"
"00234515"	"01822"
"00234516"	"01822"
"00234517"	"00000"
"00234518"	"01822"
"00234519"	"01822"
"00234520"	"01822"
"00234521"	"00000"
"00234522"	"01822"
"00234523"	"01822"
"00234524"	"01822"
"00234525"	"00000"
"00234526"	"01822"
"00234527"	"00000"
"00234528"	"00000"
"00234529"	"01822"
"00234530"	"00000"
"00234531"	"00000"
"00234532"	"00000"
"00234533"	"01822"
"00234534"	"01822"
"00234535"	"01822"
"00234536"	"01822"
"00234537"	"00000"
"00234538"	"00000"
"00234539"	"00000"
"00234540"	"00000"
"00234541"	"00000"
"00234542"	"00000"
"00234543"	"00000"
"00234544"	"01822"
"00234545"	"00000"
"00234546"	"00000"
"00234547"	"01822"
"00234548"	"00000"
"00234549"	"00000"
"00234550"	"01822"
"00234551"	"01822"
"00234552"	"01822"
"00234553"	"01822"
"00234554"	"01822"
"00234555"	"01822"
"00234556"	"01822"
"00234557"	"01822"
"00234558"	"01822"
"00234559"	"01822"
"00234560"	"01822"
"00234561"	"01822"
"00234562"	"01822"
"00234563"	"01822"
"00234564"	"01822"
"00234565"	"01822"
"00234566"	"00000"
"00234567"	"01822"
"00234568"	"00000"
"00234569"	"01822"
"00234570"	"00000"
"00234571"	"00000"
"00234572"	"01822"
"00234573"	"00000"
"00234574"	"01822"
"00234575"	"00000"
"00234576"	"01822"
"00234577"	"00000"
"00234578"	"00000"
"00234579"	"00000"
"00234580"	"00000"
"00234581"	"01822"
"00234582"	"00000"
"00234583"	"00000"
"00234584"	"01822"
"00234585"	"01822"
"00234586"	"01822"
"00234587"	"01822"
"00234588"	"00000"
"00234589"	"00000"
"00234590"	"00000"
"00234591"	"00000"
"00234592"	"00000"
"00234593"	"00000"
"00234594"	"00000"
"00234595"	"00000"
"00234596"	"01822"
"00234597"	"01822"
"00234598"	"00000"
"00234599"	"01822"
"00234600"	"01822"
"00234601"	"00000"
"00234602"	"00000"
"00234603"	"00000"
"00234604"	"00000"
"00234605"	"00000"
"00234606"	"00000"
"00234607"	"00000"
"00234608"	"00000"
"00234609"	"00000"
"00234610"	"00000"
"00234611"	"00000"
"00234612"	"00000"
"00234613"	"00000"
"00234614"	"00000"
"00234615"	"00000"
"00234616"	"00000"
"00234617"	"00000"
"00234618"	"00000"
"00234619"	"00000"
"00234620"	"00000"
"00234621"	"00000"
"00234622"	"00000"
"00234623"	"00000"
"00234624"	"00000"
"00234625"	"00000"
"00234626"	"00000"
"00234627"	"00000"
"00234628"	"00000"
"00234629"	"00000"
"00234630"	"00000"
"00234631"	"00000"
"00234632"	"00000"
"00234633"	"00000"
"00234634"	"00000"
"00234635"	"00000"
"00234636"	"00000"
"00234637"	"00000"
"00234638"	"00000"
"00234639"	"00000"
"00234640"	"00000"
"00234641"	"00000"
"00234642"	"00000"
"00234643"	"00000"
"00234644"	"00000"
"00234645"	"00000"
"00234646"	"00000"
"00234647"	"00000"
"00234648"	"00000"
"00234649"	"00000"
"00234650"	"00000"
"00234651"	"00000"
"00234652"	"00000"
"00234653"	"00000"
"00234654"	"00000"
"00234655"	"00000"
"00234656"	"00000"
"00234657"	"00000"
"00234658"	"00000"
"00234659"	"00000"
"00234660"	"00000"
"00234661"	"00000"
"00234662"	"00000"
"00234663"	"00000"
"00234664"	"00000"
"00234665"	"00000"
"00234666"	"00000"
"00234667"	"00000"
"00234668"	"00000"
"00234669"	"00000"
"00234670"	"00000"
"00234671"	"00000"
"00234672"	"00000"
"00234673"	"00000"
"00234674"	"00000"
"00234675"	"00000"
"00234676"	"00000"
"00234677"	"00000"
"00234678"	"00000"
"00234679"	"00000"
"00234680"	"00000"
"00234681"	"00000"
"00234682"	"00000"
"00234683"	"00000"
"00234684"	"00000"
"00234685"	"00000"
"00234686"	"00000"
"00234687"	"00000"
"00234688"	"00000"
"00234689"	"00000"
"00234690"	"00000"
"00234691"	"00000"
"00234692"	"00000"
"00234693"	"00000"
"00234694"	"01822"
"00234695"	"01822"
"00234696"	"01822"
"00234697"	"01822"
"00234698"	"01822"
"00234699"	"01822"
"00234700"	"01822"
"00234701"	"01822"
"00234702"	"01822"
"00234703"	"01822"
"00234704"	"01822"
"00234705"	"01822"
"00234706"	"01822"
"00234707"	"01822"
"00234708"	"01822"
"00234709"	"01822"
"00234710"	"01822"
"00234711"	"01822"
"00234712"	"01822"
"00234713"	"01822"
"00234714"	"01822"
"00234715"	"01822"
"00234716"	"01822"
"00234717"	"01822"
"00234718"	"01822"
"00234719"	"01822"
"00234720"	"01822"
"00234721"	"01822"
"00234722"	"01822"
"00234723"	"01822"
"00234724"	"01822"
"00234725"	"01822"
"00234726"	"01822"
"00234727"	"01822"
"00234728"	"01822"
"00234729"	"01822"
"00234730"	"01822"
"00234731"	"01822"
"00234732"	"01822"
"00234733"	"01822"
"00234734"	"01822"
"00234735"	"01822"
"00234736"	"01822"
"00234737"	"01822"
"00234738"	"01822"
"00234739"	"01822"
"00234740"	"01822"
"00234741"	"01822"
"00234742"	"01822"
"00234743"	"01822"
"00234744"	"01822"
"00234745"	"01822"
"00234746"	"01822"
"00234747"	"01822"
"00234748"	"01822"
"00234749"	"01822"
"00234750"	"01822"
"00234751"	"01822"
"00234752"	"01822"
"00234753"	"01822"
"00234754"	"01822"
"00234755"	"01822"
"00234756"	"01822"
"00234757"	"01822"
"00234758"	"01822"
"00234759"	"01822"
"00234760"	"01822"
"00234761"	"01822"
"00234762"	"01822"
"00234763"	"01822"
"00234764"	"01822"
"00234765"	"01822"
"00234766"	"01822"
"00234767"	"01822"
"00234768"	"01822"
"00234769"	"01822"
"00234770"	"01822"
"00234771"	"01822"
"00234772"	"01822"
"00234773"	"01822"
"00234774"	"01822"
"00234775"	"01822"
"00234776"	"01822"
"00234777"	"01822"
"00234778"	"01822"
"00234779"	"01822"
"00234780"	"01822"
"00234781"	"01822"
"00234782"	"01822"
"00234783"	"01822"
"00234784"	"01822"
"00234785"	"01822"
"00234786"	"01822"
"00234787"	"01822"
"00234788"	"01822"
"00234789"	"01822"
"00234790"	"01822"
"00234791"	"01822"
"00234792"	"01822"
"00234793"	"01822"
"00234794"	"01822"
"00234795"	"01822"
"00234796"	"01822"
"00234797"	"01822"
"00234798"	"01822"
"00234799"	"01822"
"00234800"	"01822"
"00234801"	"01822"
"00234802"	"01822"
"00234803"	"01822"
"00234804"	"01822"
"00234805"	"01822"
"00234806"	"01822"
"00234807"	"01822"
"00234808"	"01822"
"00234809"	"01822"
"00234810"	"01822"
"00234811"	"01822"
"00234812"	"01822"
"00234813"	"01822"
"00234814"	"01822"
"00234815"	"01822"
"00234816"	"01822"
"00234817"	"01822"
"00234818"	"01822"
"00234819"	"01822"
"00234820"	"01822"
"00234821"	"01822"
"00234822"	"01822"
"00234823"	"01822"
"00234824"	"01822"
"00234825"	"01822"
"00234826"	"01822"
"00234827"	"01822"
"00234828"	"01822"
"00234829"	"01822"
"00234830"	"01822"
"00234831"	"01822"
"00234832"	"01822"
"00234833"	"01822"
"00234834"	"01822"
"00234835"	"01822"
"00234836"	"01822"
"00234837"	"01822"
"00234838"	"01822"
"00234839"	"01822"
"00234840"	"01822"
"00234841"	"01822"
"00234842"	"01822"
"00234843"	"01822"
"00234844"	"01822"
"00234845"	"01822"
"00234846"	"01822"
"00234847"	"01822"
"00234848"	"01822"
"00234849"	"01822"
"00234850"	"01822"
"00234851"	"01822"
"00234852"	"01822"
"00234853"	"01822"
"00234854"	"01822"
"00234855"	"01822"
"00234856"	"01822"
"00234857"	"01822"
"00234858"	"01822"
"00234859"	"01822"
"00234860"	"01822"
"00234861"	"01822"
"00234862"	"01822"
"00234863"	"01822"
"00234864"	"01822"
"00234865"	"01822"
"00234866"	"01822"
"00234867"	"01822"
"00234868"	"01822"
"00234869"	"01822"
"00234870"	"01822"
"00234871"	"01822"
"00234872"	"01822"
"00234873"	"01822"
"00234874"	"01822"
"00234875"	"01822"
"00234876"	"01822"
"00234877"	"01822"
"00234878"	"01822"
"00234879"	"01822"
"00234880"	"01822"
"00234881"	"01822"
"00234882"	"01822"
"00234883"	"01822"
"00234884"	"01822"
"00234885"	"01822"
"00234886"	"01822"
"00234887"	"01822"
"00234888"	"01822"
"00234889"	"01822"
"00234890"	"01822"
"00234891"	"01822"
"00234892"	"01822"
"00234893"	"01822"
"00234894"	"01822"
"00234895"	"01822"
"00234896"	"01822"
"00234897"	"01822"
"00234898"	"01822"
"00234899"	"01822"
"00234900"	"01822"
"00234901"	"01822"
"00234902"	"01822"
"00234903"	"01822"
"00234904"	"01822"
"00234905"	"01822"
"00234906"	"01822"
"00234907"	"01822"
"00234908"	"01822"
"00234909"	"01822"
"00234910"	"01822"
"00234911"	"01822"
"00234912"	"01822"
"00234913"	"01822"
"00234914"	"01822"
"00234915"	"01822"
"00234916"	"01822"
"00234917"	"01822"
"00234918"	"01822"
"00234919"	"01822"
"00234920"	"01822"
"00234921"	"01822"
"00234922"	"01822"
"00234923"	"01822"
"00234924"	"01822"
"00234925"	"01822"
"00234926"	"01822"
"00234927"	"01822"
"00234928"	"01822"
"00234929"	"01822"
"00234930"	"01822"
"00234931"	"01822"
"00234932"	"01822"
"00234933"	"01822"
"00234934"	"01822"
"00234935"	"01822"
"00234936"	"01822"
"00234937"	"01822"
"00234938"	"01822"
"00234939"	"01822"
"00234940"	"01822"
"00234941"	"01822"
"00234942"	"01822"
"00234943"	"01822"
"00234944"	"01822"
"00234945"	"01822"
"00234946"	"01822"
"00234947"	"01822"
"00234948"	"01822"
"00234949"	"01822"
"00234950"	"01822"
"00234951"	"01822"
"00234952"	"01822"
"00234953"	"01822"
"00234954"	"01822"
"00234955"	"01822"
"00234956"	"01822"
"00234957"	"01822"
"00234958"	"01822"
"00234959"	"01822"
"00234960"	"01822"
"00234961"	"01822"
"00234962"	"01822"
"00234963"	"01822"
"00234964"	"01822"
"00234965"	"01822"
"00234966"	"01822"
"00234967"	"01822"
"00234968"	"01822"
"00234969"	"01822"
"00234970"	"01822"
"00234971"	"01822"
"00234972"	"01822"
"00234973"	"01822"
"00234974"	"01822"
"00234975"	"01822"
"00234976"	"01822"
"00234977"	"01822"
"00234978"	"01822"
"00234979"	"01822"
"00234980"	"01822"
"00234981"	"01822"
"00234982"	"01822"
"00234983"	"01822"
"00234984"	"01822"
"00234985"	"01822"
"00234986"	"01822"
"00234987"	"01822"
"00234988"	"01822"
"00234989"	"01822"
"00234990"	"01822"
"00234991"	"01822"
"00234992"	"01822"
"00234993"	"01822"
"00234994"	"01822"
"00234995"	"01822"
"00234996"	"01822"
"00234997"	"01822"
"00234998"	"01822"
"00234999"	"01822"
"00235000"	"01822"
"00235001"	"01822"
"00235002"	"01822"
"00235003"	"01822"
"00235004"	"01822"
"00235005"	"01822"
"00235006"	"01822"
"00235007"	"01822"
"00235008"	"01822"
"00235009"	"01822"
"00235010"	"01822"
"00235011"	"01822"
"00235012"	"01822"
"00235013"	"01822"
"00235014"	"01822"
"00235015"	"01822"
"00235016"	"01822"
"00235017"	"01822"
"00235018"	"01822"
"00235019"	"01822"
"00235020"	"01822"
"00235021"	"01822"
"00235022"	"01822"
"00235023"	"01822"
"00235024"	"01822"
"00235025"	"01822"
"00235026"	"01822"
"00235027"	"01822"
"00235028"	"01822"
"00235029"	"01822"
"00235030"	"01822"
"00235031"	"01822"
"00235032"	"01822"
"00235033"	"01822"
"00235034"	"01822"
"00235035"	"01822"
"00235036"	"01822"
"00235037"	"01822"
"00235038"	"01822"
"00235039"	"01822"
"00235040"	"01822"
"00235041"	"01822"
"00235042"	"01822"
"00235043"	"01822"
"00235044"	"01822"
"00235045"	"01822"
"00235046"	"01822"
"00235047"	"01822"
"00235048"	"01822"
"00235049"	"01822"
"00235050"	"01822"
"00235051"	"01822"
"00235052"	"01822"
"00235053"	"01822"
"00235054"	"01822"
"00235055"	"01822"
"00235056"	"01822"
"00235057"	"01822"
"00235058"	"01822"
"00235059"	"01822"
"00235060"	"01822"
"00235061"	"01822"
"00235062"	"01822"
"00235063"	"01822"
"00235064"	"01822"
"00235065"	"01822"
"00235066"	"01822"
"00235067"	"01822"
"00235068"	"01822"
"00235069"	"01822"
"00235070"	"01822"
"00235071"	"01822"
"00235072"	"01822"
"00235073"	"01822"
"00235074"	"01822"
"00235075"	"01822"
"00235076"	"01822"
"00235077"	"01822"
"00235078"	"01822"
"00235079"	"01822"
"00235080"	"01822"
"00235081"	"01822"
"00235082"	"01822"
"00235083"	"01822"
"00235084"	"01822"
"00235085"	"01822"
"00235086"	"01822"
"00235087"	"01822"
"00235088"	"01822"
"00235089"	"01822"
"00235090"	"01822"
"00235091"	"01822"
"00235092"	"01822"
"00235093"	"01822"
"00235094"	"01822"
"00235095"	"01822"
"00235096"	"01822"
"00235097"	"01822"
"00235098"	"01822"
"00235099"	"01822"
"00235100"	"01822"
"00235101"	"01822"
"00235102"	"01822"
"00235103"	"01822"
"00235104"	"01822"
"00235105"	"01822"
"00235106"	"01822"
"00235107"	"01822"
"00235108"	"01822"
"00235109"	"01822"
"00235110"	"01822"
"00235111"	"01822"
"00235112"	"01822"
"00235113"	"01822"
"00235114"	"01822"
"00235115"	"01822"
"00235116"	"01822"
"00235117"	"01822"
"00235118"	"01822"
"00235119"	"01822"
"00235120"	"01822"
"00235121"	"01822"
"00235122"	"01822"
"00235123"	"01822"
"00235124"	"01822"
"00235125"	"01822"
"00235126"	"01822"
"00235127"	"01822"
"00235128"	"01822"
"00235129"	"01822"
"00235130"	"01822"
"00235131"	"01822"
"00235132"	"01822"
"00235133"	"01822"
"00235134"	"01822"
"00235135"	"01822"
"00235136"	"01822"
"00235137"	"01822"
"00235138"	"01822"
"00235139"	"01822"
"00235140"	"01822"
"00235141"	"01822"
"00235142"	"01822"
"00235143"	"01822"
"00235144"	"01822"
"00235145"	"01822"
"00235146"	"01822"
"00235147"	"01822"
"00235148"	"01822"
"00235149"	"01822"
"00235150"	"01822"
"00235151"	"01822"
"00235152"	"01822"
"00235153"	"01822"
"00235154"	"01822"
"00235155"	"01822"
"00235156"	"01822"
"00235157"	"01822"
"00235158"	"01822"
"00235159"	"01822"
"00235160"	"01822"
"00235161"	"01822"
"00235162"	"01822"
"00235163"	"01822"
"00235164"	"01822"
"00235165"	"01822"
"00235166"	"01822"
"00235167"	"01822"
"00235168"	"01822"
"00235169"	"01822"
"00235170"	"01822"
"00235171"	"01822"
"00235172"	"01822"
"00235173"	"01822"
"00235174"	"01822"
"00235175"	"01822"
"00235176"	"01822"
"00235177"	"01822"
"00235178"	"01822"
"00235179"	"01822"
"00235180"	"01822"
"00235181"	"01822"
"00235182"	"01822"
"00235183"	"01822"
"00235184"	"01822"
"00235185"	"01822"
"00235186"	"01822"
"00235187"	"01822"
"00235188"	"01822"
"00235189"	"01822"
"00235190"	"01822"
"00235191"	"01822"
"00235192"	"01822"
"00235193"	"01822"
"00235194"	"01822"
"00235195"	"01822"
"00235196"	"01822"
"00235197"	"01822"
"00235198"	"01822"
"00235199"	"01822"
"00235200"	"01822"
"00235201"	"01822"
"00235202"	"01822"
"00235203"	"01822"
"00235204"	"01822"
"00235205"	"01822"
"00235206"	"01822"
"00235207"	"01822"
"00235208"	"01822"
"00235209"	"01822"
"00235210"	"01822"
"00235211"	"01822"
"00235212"	"01822"
"00235213"	"01822"
"00235214"	"01822"
"00235215"	"01822"
"00235216"	"01822"
"00235217"	"01822"
"00235218"	"01822"
"00235219"	"01822"
"00235220"	"01822"
"00235221"	"01822"
"00235222"	"01822"
"00235223"	"01822"
"00235224"	"01822"
"00235225"	"01822"
"00235226"	"01822"
"00235227"	"01822"
"00235228"	"01822"
"00235229"	"01822"
"00235230"	"01822"
"00235231"	"01822"
"00235232"	"01822"
"00235233"	"01822"
"00235234"	"01822"
"00235235"	"01822"
"00235236"	"01822"
"00235237"	"01822"
"00235238"	"01822"
"00235239"	"01822"
"00235240"	"01822"
"00235241"	"01822"
"00235242"	"01822"
"00235243"	"01822"
"00235244"	"01822"
"00235245"	"01822"
"00235246"	"01822"
"00235247"	"01822"
"00235248"	"01822"
"00235249"	"01822"
"00235250"	"01822"
"00235251"	"01822"
"00235252"	"01822"
"00235253"	"01822"
"00235254"	"01822"
"00235255"	"01822"
"00235256"	"01822"
"00235257"	"01822"
"00235258"	"01822"
"00235259"	"01822"
"00235260"	"01822"
"00235261"	"01822"
"00235262"	"01822"
"00235263"	"01822"
"00235264"	"01822"
"00235265"	"01822"
"00235266"	"01822"
"00235267"	"01822"
"00235268"	"01822"
"00235269"	"01822"
"00235270"	"01822"
"00235271"	"01822"
"00235272"	"01822"
"00235273"	"01822"
"00235274"	"01822"
"00235275"	"01822"
"00235276"	"01822"
"00235277"	"01822"
"00235278"	"01822"
"00235279"	"01822"
"00235280"	"01822"
"00235281"	"01822"
"00235282"	"01822"
"00235283"	"01822"
"00235284"	"01822"
"00235285"	"01822"
"00235286"	"01822"
"00235287"	"01822"
"00235288"	"01822"
"00235289"	"01822"
"00235290"	"01822"
"00235291"	"01822"
"00235292"	"01822"
"00235293"	"01822"
"00235294"	"01822"
"00235295"	"01822"
"00235296"	"01822"
"00235297"	"01822"
"00235298"	"01822"
"00235299"	"01822"
"00246696"	"01822"
"00246697"	"01822"
"00246698"	"01822"
"00246699"	"01822"
"00246700"	"01822"
"00246701"	"01822"
"00246702"	"01822"
"00246703"	"01822"
"00246704"	"01822"
"00246705"	"01822"
"00246706"	"01822"
"00246707"	"01822"
"00246708"	"01822"
"00246709"	"01822"
"00246710"	"01822"
"00246711"	"01822"
"00246859"	"01822"
"00246860"	"01822"
"00246861"	"01822"
"00246862"	"04216"
"00246863"	"01822"
"00246864"	"01822"
"00246865"	"01822"
"00246866"	"01822"
"00246867"	"01822"
"00246868"	"01822"
"00246869"	"01822"
"00246870"	"01822"
"00246871"	"01822"
"00246872"	"01822"
"00246873"	"01822"
"00246874"	"01822"
"00246875"	"01822"
"00246877"	"01822"
"00246878"	"01822"
"00246879"	"01822"
"00246880"	"01822"
"00246881"	"01822"
"00246882"	"01822"
"00246883"	"01822"
"00246884"	"01822"
"00246885"	"01822"
"00246886"	"01822"
"00246887"	"01822"
"00246888"	"01822"
"00246889"	"01822"
"00246891"	"01822"
"00246893"	"01822"
"00246894"	"01822"
"00246895"	"01822"
"00246896"	"01822"
"00246897"	"01822"
"00246899"	"01822"
"00274311"	"05126"
"00274406"	"05121"
"00274407"	"05121"
"00274408"	"05121"
"00291874"	"00198"
"00291875"	"00198"
"00291876"	"00198"
"00291877"	"00198"
"00291878"	"00198"
"00291879"	"00198"
"00291880"	"00198"
"00295523"	"01822"
"00295526"	"01822"
"00295527"	"01822"
"00301608"	"00141"
"00304607"	"00198"
"00304608"	"00198"
"00305685"	"04216"
"00305686"	"04216"
"00305687"	"04216"
"00305688"	"04216"
"00305689"	"04216"
"00305690"	"04216"
"00305691"	"04216"
"00305692"	"04216"
"00305693"	"04216"
"00305694"	"04216"
"00305695"	"04216"
"00305696"	"04216"
"00305697"	"04216"
"00305698"	"04216"
"00305699"	"04216"
"00305700"	"04216"
"00305701"	"04216"
"00305702"	"04216"
"00305703"	"04216"
"00305704"	"04216"
"00305705"	"04216"
"00305706"	"04216"
"00305707"	"04216"
"00305708"	"04216"
"00305709"	"04216"
"00305710"	"04216"
"00305711"	"04216"
"00305712"	"04216"
"00305713"	"04216"
"00305714"	"04216"
"00305715"	"04216"
"00305716"	"04216"
"00305717"	"04216"
"00305718"	"04216"
"00305719"	"04216"
"00305720"	"04216"
"00305721"	"04216"
"00305722"	"04216"
"00305723"	"04216"
"00305724"	"04216"
"00305725"	"04216"
"00305726"	"04216"
"00305727"	"04216"
"00305728"	"04216"
"00305729"	"04216"
"00305730"	"04216"
"00305731"	"04216"
"00305732"	"04216"
"00305733"	"04216"
"00305734"	"04216"
"00305735"	"04216"
"00306730"	"01822"
"00306731"	"01822"
"00306732"	"01822"
"00306733"	"01822"
"00307084"	"00000"
"00314310"	"05126"
"00314311"	"05126"
"00314312"	"05126"
"00314313"	"05126"
"00314314"	"05126"
"00314315"	"05126"
"00314316"	"05126"
"00314317"	"05126"
"00314318"	"05126"
"00314319"	"05126"
"00314320"	"05126"
"00314321"	"05126"
"00374320"	"00198"
"00380811"	"01822"
"00388003"	"02492"
"00388671"	"00244"
"00388672"	"00244"
"00388691"	"00244"
"00404984"	"01822"
"00404985"	"01822"
"00404986"	"01822"
"00404987"	"01822"
"00404988"	"01822"
"00413105"	"00244"
"00413135"	"00244"
"00413456"	"05324"
"00413457"	"05324"
"00414481"	"00198"
"00418602"	"00128"
"00418603"	"00128"
"00426977"	"00000"
"00426978"	"00000"
"00427052"	"00000"
"00427053"	"00000"
"00427054"	"00000"
"00427980"	"00198"
"00442664"	"05618"
"00453583"	"01473"
"00454543"	"05121"
"00454544"	"05121"
"00456257"	"00198"
"00457664"	"05126"
"00460252"	"01273"
"00460264"	"01273"
"00468229"	"00244"
"00468233"	"00244"
"00468242"	"00244"


## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00128, 00141, 00198, 00244, 01273, 01473, 01822, 02492, 04216, 04327, 05121, 05126, 05166, 05320, 05324, 05427, 05618
## Count = 1001
"{{id}}"	"{{diseaseid}}"	"{{individualid}}"	"{{owned_by}}"	"{{Phenotype/Inheritance}}"	"{{Phenotype/Age}}"	"{{Phenotype/Additional}}"	"{{Phenotype/Age/Onset}}"	"{{Phenotype/Age/Diagnosis}}"	"{{Phenotype/Onset}}"	"{{Phenotype/Protein}}"	"{{Phenotype/Tumor/MSI}}"	"{{Phenotype/Enzyme/CPK}}"	"{{Phenotype/Heart/Myocardium}}"	"{{Phenotype/Lung}}"	"{{Phenotype/Diagnosis/Definite}}"	"{{Phenotype/Diagnosis/Initial}}"	"{{Phenotype/Diagnosis/Criteria}}"
"0000015274"	"00187"	"00000004"	"00124"	"Familial, X-linked recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079188"	"01822"	"00100967"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079189"	"00000"	"00100968"	"01942"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079190"	"00000"	"00100969"	"01942"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079191"	"00000"	"00100970"	"01942"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079192"	"00000"	"00100971"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079193"	"00000"	"00100972"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079194"	"00000"	"00100973"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079195"	"00000"	"00100974"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079196"	"00000"	"00100975"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079197"	"00000"	"00100976"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079198"	"00000"	"00100977"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079199"	"01822"	"00100978"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079200"	"00000"	"00100979"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079201"	"00000"	"00100980"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079202"	"00000"	"00100981"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079203"	"00000"	"00100982"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079204"	"00000"	"00100983"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079205"	"00000"	"00100984"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079206"	"00000"	"00100985"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079207"	"00000"	"00100986"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079208"	"00000"	"00100987"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079209"	"00000"	"00100988"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079210"	"00000"	"00100989"	"00006"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079211"	"00000"	"00100990"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079212"	"00000"	"00100991"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079213"	"00000"	"00100992"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079214"	"00000"	"00100993"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079215"	"00000"	"00100994"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079216"	"01822"	"00100995"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079217"	"01822"	"00100996"	"01938"	"Familial, autosomal recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079218"	"00000"	"00100997"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079219"	"00000"	"00100998"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079220"	"00000"	"00100999"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079221"	"01822"	"00101000"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079222"	"01822"	"00101001"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079223"	"01822"	"00101002"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079224"	"01822"	"00101003"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079225"	"01822"	"00101004"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079226"	"01822"	"00101005"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079227"	"01822"	"00101006"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079228"	"01822"	"00101007"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079229"	"01822"	"00101008"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079230"	"00000"	"00101009"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079231"	"00000"	"00101010"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079232"	"00000"	"00101011"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079233"	"01822"	"00101012"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079234"	"01822"	"00101013"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079235"	"01822"	"00101014"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079236"	"01822"	"00101015"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079237"	"00000"	"00101016"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079238"	"00000"	"00101017"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079239"	"00000"	"00101018"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079240"	"00000"	"00101019"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079241"	"01822"	"00101020"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079242"	"01822"	"00101021"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079243"	"01822"	"00101022"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079244"	"01822"	"00101023"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079245"	"01822"	"00101024"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079246"	"01822"	"00101025"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079247"	"01822"	"00101026"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079248"	"01822"	"00101027"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079249"	"01822"	"00101028"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079250"	"01822"	"00101029"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079251"	"01822"	"00101030"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079252"	"01822"	"00101031"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079253"	"01822"	"00101032"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079254"	"01822"	"00101033"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079255"	"00000"	"00101034"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079256"	"00000"	"00101035"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079257"	"00000"	"00101036"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079258"	"00000"	"00101037"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079259"	"01822"	"00101038"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079262"	"01822"	"00101041"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079265"	"01822"	"00101044"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079266"	"00000"	"00101045"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079267"	"00000"	"00101046"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079268"	"01822"	"00101047"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079269"	"00000"	"00101048"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079270"	"01822"	"00101049"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079271"	"00000"	"00101050"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079272"	"00000"	"00101051"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079273"	"01822"	"00101052"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079274"	"00000"	"00101053"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079275"	"01822"	"00101054"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079276"	"01822"	"00101055"	"01938"	"Familial, autosomal recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079277"	"00000"	"00101056"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079278"	"01822"	"00101057"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079279"	"01822"	"00101058"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079280"	"01822"	"00101059"	"01938"	"Familial, autosomal recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079281"	"01822"	"00101060"	"01938"	"Familial, autosomal recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079282"	"01822"	"00101061"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079283"	"00000"	"00101062"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079284"	"01822"	"00101063"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079285"	"01822"	"00101064"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079286"	"01822"	"00101065"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079287"	"01822"	"00101066"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079288"	"01822"	"00101067"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079289"	"01822"	"00101068"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079290"	"01822"	"00101069"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079291"	"01822"	"00101070"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079292"	"01822"	"00101071"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079293"	"01822"	"00101072"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079294"	"01822"	"00101073"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079295"	"01822"	"00101074"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079296"	"01822"	"00101075"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079297"	"01822"	"00101076"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079298"	"01822"	"00101077"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079299"	"01822"	"00101078"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079300"	"01822"	"00101079"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079301"	"01822"	"00101080"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079302"	"01822"	"00101081"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079303"	"01822"	"00101082"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079304"	"01822"	"00101083"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079305"	"01822"	"00101084"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079306"	"01822"	"00101085"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079307"	"01822"	"00101086"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079308"	"01822"	"00101087"	"01941"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079309"	"00000"	"00101088"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079310"	"01822"	"00101089"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079311"	"01822"	"00101090"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079312"	"01822"	"00101091"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079313"	"01822"	"00101092"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079314"	"01822"	"00101093"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079315"	"01822"	"00101094"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079316"	"01822"	"00101095"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079317"	"01822"	"00101096"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079318"	"01822"	"00101097"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079319"	"01822"	"00101098"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079320"	"01822"	"00101099"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079321"	"01822"	"00101100"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079322"	"01822"	"00101101"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079323"	"01822"	"00101102"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079324"	"01822"	"00101103"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079325"	"01822"	"00101104"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079326"	"01822"	"00101105"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079327"	"01822"	"00101106"	"01938"	"Unknown"	""	"severe?"	""	""	""	""	""	""	""	""	""	""	""
"0000079328"	"01822"	"00101107"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079329"	"01822"	"00101108"	"01938"	"Unknown"	""	"intermediate?"	""	""	""	""	""	""	""	""	""	""	""
"0000079330"	"01822"	"00101109"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079331"	"01822"	"00101110"	"01938"	"Unknown"	""	"severe?"	""	""	""	""	""	""	""	""	""	""	""
"0000079332"	"01822"	"00101111"	"01938"	"Unknown"	""	"severe?"	""	""	""	""	""	""	""	""	""	""	""
"0000079333"	"01822"	"00101112"	"01938"	"Unknown"	""	"severe?"	""	""	""	""	""	""	""	""	""	""	""
"0000079334"	"01822"	"00101113"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079335"	"01822"	"00101114"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079336"	"01822"	"00101115"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079337"	"01822"	"00101116"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079338"	"01822"	"00101117"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079339"	"01822"	"00101118"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079340"	"01822"	"00101119"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079341"	"01822"	"00101120"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079342"	"01822"	"00101121"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079343"	"01822"	"00101122"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079344"	"01822"	"00101123"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079345"	"00198"	"00101124"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079346"	"01822"	"00101125"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079347"	"00000"	"00101126"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079348"	"01822"	"00101127"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079349"	"01822"	"00101128"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079350"	"01822"	"00101129"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079351"	"01822"	"00101130"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079352"	"01822"	"00101131"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079353"	"00000"	"00101132"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079354"	"00000"	"00101133"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079355"	"01822"	"00101134"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079356"	"01822"	"00101135"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079357"	"01822"	"00101136"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079358"	"01822"	"00101137"	"01938"	"Unknown"	""	"intermediate?"	""	""	""	""	""	""	""	""	""	""	""
"0000079359"	"01822"	"00101138"	"01938"	"Unknown"	""	"severe?"	""	""	""	""	""	""	""	""	""	""	""
"0000079360"	"01822"	"00101139"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079361"	"00000"	"00101140"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079362"	"01822"	"00101141"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079363"	"01822"	"00101142"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079364"	"01822"	"00101143"	"01938"	"Familial, autosomal recessive"	""	"infantile, severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079365"	"00000"	"00101144"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079366"	"01822"	"00101145"	"01938"	"Familial, autosomal recessive"	"68y"	"mild, see paper ...; no neurological symptoms, progressive painless, mild leg weakness, difficulty rising from chair and\r\nfrom lying to sitting;"	"65y"	""	"difficulty walking"	""	""	""	""	""	""	""	""
"0000079367"	"01822"	"00101146"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079368"	"01822"	"00101147"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079369"	"01822"	"00101148"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079370"	"01822"	"00101149"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079371"	"01822"	"00101150"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079372"	"01822"	"00101151"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079373"	"01822"	"00101152"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079374"	"01822"	"00101153"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079375"	"01822"	"00101154"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079376"	"01822"	"00101155"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079377"	"01822"	"00101156"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079378"	"01822"	"00101157"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079379"	"01822"	"00101158"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079380"	"01822"	"00101159"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079381"	"01822"	"00101160"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079382"	"01822"	"00101161"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079383"	"01822"	"00101162"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079384"	"01822"	"00101163"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079385"	"00000"	"00101164"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079386"	"01822"	"00101165"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079387"	"01822"	"00101166"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079388"	"01822"	"00101167"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079389"	"01822"	"00101168"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079390"	"00198"	"00101169"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079392"	"01822"	"00101171"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079393"	"01822"	"00101172"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079394"	"01822"	"00101173"	"01942"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079395"	"01822"	"00101174"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079396"	"00198"	"00101175"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079397"	"01822"	"00101176"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079398"	"01822"	"00101177"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079399"	"01822"	"00101178"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079400"	"01822"	"00101179"	"01938"	"Unknown"	""	"mild"	""	""	""	""	""	""	""	""	""	""	""
"0000079401"	"00198"	"00101180"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079402"	"01822"	"00101181"	"01938"	"Unknown"	""	"milder"	""	""	""	""	""	""	""	""	""	""	""
"0000079403"	"01822"	"00101182"	"01938"	"Unknown"	""	"intermediate"	""	""	""	""	""	""	""	""	""	""	""
"0000079404"	"01822"	"00101183"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079405"	"01822"	"00101184"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079406"	"01822"	"00101185"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079407"	"01822"	"00101186"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079408"	"01822"	"00101187"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079409"	"01822"	"00101188"	"01938"	"Unknown"	""	"less severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079410"	"01822"	"00101189"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079411"	"01822"	"00101190"	"01938"	"Unknown"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079412"	"00198"	"00101191"	"01938"	"Unknown"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000079413"	"00198"	"00101192"	"01938"	"Unknown"	""	"late-onset glycogen-storage disease type 2 (OMIM 232300)"	""	""	""	""	""	""	""	""	""	""	""
"0000079414"	"00244"	"00101193"	"01938"	"Unknown"	""	"myopathy"	""	""	""	""	""	""	""	""	""	""	""
"0000079415"	"01822"	"00101194"	"01938"	"Familial, autosomal recessive"	""	"late onset, progressive weakness, with recurrent respiratory failure and pneumonia, para spinal myotonic discharge, demyelinating polyneuropathy; respiratory failure due to diaphragmatic weakness and para spinal myotonia."	""	""	""	""	""	""	""	""	""	""	""
"0000079416"	"01822"	"00101195"	"01938"	"Familial, autosomal recessive"	""	"late onset, waddling gait, muscle atrophy and lipid infiltration as seen on MRI of bilateral leg hip adductors and gluteus. Nasal voice. No respiratory failure or dyspnea"	""	""	""	""	""	""	""	""	""	""	""
"0000079417"	"01822"	"00101196"	"01938"	"Familial, autosomal recessive"	""	"late onset, progressive symmetrical lower and upper limb weakness with muscle atrophy, dyspnea and waddling gait"	""	""	""	""	""	""	""	""	""	""	""
"0000079418"	"01822"	"00101197"	"01938"	"Familial, autosomal recessive"	""	"asymptomatic"	""	""	""	""	""	""	""	""	""	""	""
"0000079419"	"01822"	"00101198"	"00006"	"Familial, autosomal recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000079420"	"01822"	"00101199"	"00006"	"Familial, autosomal recessive"	""	"severe"	""	""	""	""	""	""	""	""	""	""	""
"0000143837"	"04216"	"00183081"	"01939"	"Familial, autosomal recessive"	""	""	""	"03y"	""	""	""	""	""	""	"GSD-2"	"glycogen storage disease"	""
"0000143838"	"04216"	"00183082"	"01939"	"Familial, autosomal recessive"	""	"10w-died with cardiorespiratory arrest"	""	"00y01m14d"	""	""	""	""	""	""	"GSD-2"	"glycogen storage disease"	""
"0000143839"	"04216"	"00183083"	"01939"	"Familial, autosomal recessive"	""	"CRIM positive"	""	"01y04m"	""	""	""	""	""	""	"GSD-2"	"glycogen storage disease"	""
"0000143840"	"04216"	"00183084"	"01939"	"Familial, autosomal recessive"	""	"biventricular cardiac hypertrophy"	""	"00y02m14d"	""	""	""	""	""	""	"GSD-2"	"glycogen storage disease"	""
"0000172606"	"05320"	"00228668"	"00006"	"Unknown"	""	"see paper; ..., mixed phenotype, delayed motor and mental milestones, elevated creatine kinase (2421 to 5257 U/L)"	""	""	""	""	""	""	""	""	"BMD"	"Becker muscular dystrophy"	""
"0000174886"	"01822"	"00234483"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174887"	"01822"	"00234484"	"01940"	"Familial, autosomal recessive"	"38y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"15y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174888"	"01822"	"00234485"	"01940"	"Familial, autosomal recessive"	""	"age onset <2y/<2y; age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174889"	"01822"	"00234486"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; mobility problem (HP:0100022)"	"29y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174890"	"01822"	"00234487"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174891"	"01822"	"00234488"	"01940"	"Familial, autosomal recessive"	"23y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000174892"	"01822"	"00234490"	"01940"	"Familial, autosomal recessive"	"8m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174893"	"01822"	"00234492"	"01940"	"Familial, autosomal recessive"	""	"age onset <2y/<2y; age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174894"	"01822"	"00234494"	"01940"	"Familial, autosomal recessive"	"19y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000174895"	"01822"	"00234495"	"01940"	"Familial, autosomal recessive"	""	"died at 7y; cardiomyopathy (HP:0001638); liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"8m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174896"	"01822"	"00234496"	"01940"	"Familial, autosomal recessive"	"49y"	"ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174897"	"01822"	"00234497"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174898"	"01822"	"00234499"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174899"	"01822"	"00234501"	"01940"	"Familial, autosomal recessive"	""	"age onset 31y/25y/15y; age analysis 41y/36y/48y; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)/no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (2)"	"glycogen storage disease"	""
"0000174900"	"01822"	"00234502"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174901"	"01822"	"00234503"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174902"	"01822"	"00234504"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174903"	"01822"	"00234505"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174904"	"01822"	"00234506"	"01940"	"Familial, autosomal recessive"	"30m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"5m14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174905"	"01822"	"00234508"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174906"	"01822"	"00234509"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"28y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174907"	"01822"	"00234510"	"01940"	"Familial, autosomal recessive"	""	"age onset <2y/<2y; age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174908"	"01822"	"00234511"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<12m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174909"	"01822"	"00234512"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174910"	"01822"	"00234513"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174911"	"01822"	"00234514"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174912"	"01822"	"00234515"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174913"	"01822"	"00234516"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174914"	"01822"	"00234518"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174915"	"01822"	"00234519"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174916"	"01822"	"00234520"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	">1y"	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000174917"	"01822"	"00234522"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174918"	"01822"	"00234523"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174919"	"01822"	"00234524"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174920"	"01822"	"00234526"	"01940"	"Familial, autosomal recessive"	"73y"	"no ventilatory support (-HP:0002093); VC% in a sitting position 40%; mobility problem (HP:0100022)"	"52y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174921"	"01822"	"00234529"	"01940"	"Familial, autosomal recessive"	"<10m"	"cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174922"	"01822"	"00234533"	"01940"	"Familial, autosomal recessive"	"<1y"	"age onset shortly after birth; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174923"	"01822"	"00234534"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174924"	"01822"	"00234535"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174925"	"01822"	"00234536"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174926"	"01822"	"00234544"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174927"	"01822"	"00234547"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174928"	"01822"	"00234550"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174929"	"01822"	"00234551"	"01940"	"Familial, autosomal recessive"	"15y"	"no ventilatory support (-HP:0002093)"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174930"	"01822"	"00234552"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174931"	"01822"	"00234553"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174932"	"01822"	"00234554"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174933"	"01822"	"00234555"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174934"	"01822"	"00234556"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174935"	"01822"	"00234557"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174936"	"01822"	"00234558"	"01940"	"Familial, autosomal recessive"	"65y"	"##"	"55y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174937"	"01822"	"00234559"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174938"	"01822"	"00234560"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174939"	"01822"	"00234561"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (3); age analysis 2m/42d/6m"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174940"	"01822"	"00234562"	"01940"	"Familial, autosomal recessive"	""	"age onset 10y/15y; age analysis 19y/20y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no liver/spleen involvement/no liver/spleen involvement; ventilatory support (HP:0002093) at night/ventilatory support (HP:0002093); respiratory problems (HP:0002795)/respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540)/wheelchair bound (HP:0002540) ; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174941"	"01822"	"00234563"	"01940"	"Familial, autosomal recessive"	"14y"	"no respiratory problems (-HP:0002795)"	"9y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174942"	"01822"	"00234564"	"01940"	"Familial, autosomal recessive"	""	"died at 36.8m; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174943"	"01822"	"00234565"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174944"	"01822"	"00234567"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174945"	"01822"	"00234569"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174946"	"01822"	"00234572"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174947"	"01822"	"00234574"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174948"	"01822"	"00234576"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174949"	"01822"	"00234581"	"01940"	"Familial, autosomal recessive"	"6y"	"cardiomyopathy (HP:0001638); mobility problem (HP:0100022)"	"<3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174950"	"01822"	"00234584"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174951"	"01822"	"00234585"	"01940"	"Familial, autosomal recessive"	"4m"	"biventricular hypertrophy/ small pericardial effusion; ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174952"	"01822"	"00234586"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174953"	"01822"	"00234587"	"01940"	"Familial, autosomal recessive"	""	"age onset late onset; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174954"	"01822"	"00234596"	"01940"	"Familial, autosomal recessive"	"8y"	"cardiomyopathy (HP:0001638) (provoked by Epstein Barr virus infection); ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"7y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174955"	"01822"	"00234597"	"01940"	"Familial, autosomal recessive"	"9y"	"##"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174956"	"01822"	"00234599"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174957"	"01822"	"00234600"	"01940"	"Familial, autosomal recessive"	"5m"	"age onset unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174958"	"01822"	"00234694"	"01940"	"Familial, autosomal recessive"	"49y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"47y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174959"	"01822"	"00234695"	"01940"	"Familial, autosomal recessive"	"47y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"38y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174960"	"01822"	"00234696"	"01940"	"Familial, autosomal recessive"	"68y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); kyphosis/scoliosis (HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000174961"	"01822"	"00234697"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638);  + 11h/night; respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022); scapular winging (HP:0003691)"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174962"	"01822"	"00234698"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638);  + 7h/night; respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); scapular winging (HP:0003691)"	"48y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174963"	"01822"	"00234699"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no scapular winging (-HP:0003691)"	"58y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174964"	"01822"	"00234700"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no scapular winging (-HP:0003691)"	"42y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174965"	"01822"	"00234701"	"01940"	"Familial, autosomal recessive"	""	"age onset 48y/6y; age analysis 49y/8y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674)/no kyphosis/scoliosis (-HP:0010674)"	""	""	""	""	""	""	""	""	"GSD-2: Adult (1)/ Childhood (1)"	"glycogen storage disease"	""
"0000174966"	"01822"	"00234702"	"01940"	"Familial, autosomal recessive"	"41y"	"no cardiomyopathy (-HP:0001638)"	"39y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174967"	"01822"	"00234703"	"01940"	"Familial, autosomal recessive"	"13y"	"FVC in sitting/ supine position 82/75%; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174968"	"01822"	"00234704"	"01940"	"Familial, autosomal recessive"	""	"age onset 49y/40y; age analysis 51y/42y; no cardiomyopathy (-HP:0001638)/slight left ventricular hypertrophy; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022); no scapular winging (-HP:0003691)/no scapular winging (-HP:0003691)"	""	""	""	""	""	""	""	""	"GSD-2: Adult (2)"	"glycogen storage disease"	""
"0000174969"	"01822"	"00234705"	"01940"	"Familial, autosomal recessive"	"25y"	"no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174970"	"01822"	"00234706"	"01940"	"Familial, autosomal recessive"	"48y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); mobility problem (HP:0100022)  (Walton score: III); no ptosis (-HP:0000508)"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174971"	"01822"	"00234707"	"01940"	"Familial, autosomal recessive"	""	"age onset presymptomatic; age analysis 34y/prenatally diagnosed; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no liver/spleen involvement/no liver/spleen involvement; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674)/no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508)/no ptosis (-HP:0000508); no scapular winging (-HP:0003691)/no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)/no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174972"	"01822"	"00234708"	"01940"	"Familial, autosomal recessive"	""	"age onset 35y/36y/34y; age analysis 43y/46y/46y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795)/no respiratory problems (-HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174973"	"01822"	"00234709"	"01940"	"Familial, autosomal recessive"	""	"age onset 32y/31y/43y; age analysis 46y/40y/44y; ventilatory support (HP:0002093)/no ventilatory support (-HP:0002093)/ventilatory support (HP:0002093); respiratory problems (HP:0002795)/respiratory problems (HP:0002795)/respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)/mobility problem (HP:0100022)/no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174974"	"01822"	"00234710"	"01940"	"Familial, autosomal recessive"	"48y"	"##"	"41y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174975"	"01822"	"00234711"	"01940"	"Familial, autosomal recessive"	"11y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"6y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174976"	"01822"	"00234712"	"01940"	"Familial, autosomal recessive"	"4m"	"cardiomyopathy (HP:0001638)"	"<4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174977"	"01822"	"00234713"	"01940"	"Familial, autosomal recessive"	"2y"	"cardiac failure; liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174978"	"01822"	"00234714"	"01940"	"Familial, autosomal recessive"	""	"died at 20y; liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"<2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174979"	"01822"	"00234715"	"01940"	"Familial, autosomal recessive"	"4y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); kyphosis/scoliosis (HP:0010674)"	">2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174980"	"01822"	"00234716"	"01940"	"Familial, autosomal recessive"	""	"age onset childhood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174981"	"01822"	"00234717"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); liver/spleen involvement"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174982"	"01822"	"00234718"	"01940"	"Familial, autosomal recessive"	""	"age onset 40y/38y; age analysis 58y/53y; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174983"	"01822"	"00234719"	"01940"	"Familial, autosomal recessive"	""	"died at 13m; cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174984"	"01822"	"00234720"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<10m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174985"	"01822"	"00234721"	"01940"	"Familial, autosomal recessive"	"44m"	"cardiomyopathy (HP:0001638); no respiratory problems (-HP:0002795)"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174986"	"01822"	"00234722"	"01940"	"Familial, autosomal recessive"	""	"died at 11m; cardiomyopathy (HP:0001638)"	"<5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174987"	"01822"	"00234723"	"01940"	"Familial, autosomal recessive"	""	"age onset infantile; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174988"	"01822"	"00234724"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174989"	"01822"	"00234725"	"01940"	"Familial, autosomal recessive"	"6m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174990"	"01822"	"00234726"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174991"	"01822"	"00234727"	"01940"	"Familial, autosomal recessive"	"30y"	"no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174992"	"01822"	"00234728"	"01940"	"Familial, autosomal recessive"	"3m"	"cardiomyopathy (HP:0001638)"	"<3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174993"	"01822"	"00234729"	"01940"	"Familial, autosomal recessive"	"10m14d"	"age onset 32 weeks gestation; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174994"	"01822"	"00234730"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"4y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000174995"	"01822"	"00234731"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174996"	"01822"	"00234732"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000174997"	"01822"	"00234733"	"01940"	"Familial, autosomal recessive"	"37y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000174998"	"01822"	"00234734"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; died"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000174999"	"01822"	"00234735"	"01940"	"Familial, autosomal recessive"	""	"age onset infantile; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175000"	"01822"	"00234736"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175001"	"01822"	"00234737"	"01940"	"Familial, autosomal recessive"	"33y"	"no cardiomyopathy (-HP:0001638); mobility problem (HP:0100022)"	"11y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175002"	"01822"	"00234738"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175003"	"01822"	"00234739"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2) ; age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175004"	"01822"	"00234740"	"01940"	"Familial, autosomal recessive"	"25y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175005"	"01822"	"00234741"	"01940"	"Familial, autosomal recessive"	""	"age onset fourth decade of life; died at 51y"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175006"	"01822"	"00234742"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175007"	"01822"	"00234743"	"01940"	"Familial, autosomal recessive"	"2y"	"age onset prenatal; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175008"	"01822"	"00234744"	"01940"	"Familial, autosomal recessive"	"21m"	"no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795); kyphosis/scoliosis (HP:0010674)"	"18m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175009"	"01822"	"00234745"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175010"	"01822"	"00234746"	"01940"	"Familial, autosomal recessive"	"<1y"	"age onset shortly after birth; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175011"	"01822"	"00234747"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175012"	"01822"	"00234748"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175013"	"01822"	"00234749"	"01940"	"Familial, autosomal recessive"	"5m"	"cardiomyopathy (HP:0001638); liver/spleen involvement; respiratory problems (HP:0002795)"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175014"	"01822"	"00234750"	"01940"	"Familial, autosomal recessive"	"5y"	"cardiomyopathy (HP:0001638)"	"1y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175015"	"01822"	"00234751"	"01940"	"Familial, autosomal recessive"	"3y"	"cardiomyopathy (HP:0001638)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175016"	"01822"	"00234752"	"01940"	"Familial, autosomal recessive"	"21y"	"no cardiomyopathy (-HP:0001638); liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175017"	"01822"	"00234753"	"01940"	"Familial, autosomal recessive"	"15y"	"ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); no kyphosis/scoliosis (-HP:0010674)"	"7y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175018"	"01822"	"00234754"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175019"	"01822"	"00234755"	"01940"	"Familial, autosomal recessive"	""	"age onset 1d/1d; age analysis 4m/8m; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175020"	"01822"	"00234756"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175021"	"01822"	"00234757"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175022"	"01822"	"00234758"	"01940"	"Familial, autosomal recessive"	"1d"	"cardiomyopathy (HP:0001638); liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175023"	"01822"	"00234759"	"01940"	"Familial, autosomal recessive"	"3m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175024"	"01822"	"00234760"	"01940"	"Familial, autosomal recessive"	""	"age onset infantile; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175025"	"01822"	"00234761"	"01940"	"Familial, autosomal recessive"	""	"died at 2y; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"1y3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175026"	"01822"	"00234762"	"01940"	"Familial, autosomal recessive"	"2d"	"cardiomyopathy (HP:0001638)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175027"	"01822"	"00234763"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); liver/spleen involvement"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175028"	"01822"	"00234764"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175029"	"01822"	"00234765"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175030"	"01822"	"00234766"	"01940"	"Familial, autosomal recessive"	""	"age onset 3-6m (17); age analysis unknown (17); cardiomyopathy (HP:0001638) (17); liver/spleen involvement (17)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175031"	"01822"	"00234767"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175032"	"01822"	"00234768"	"01940"	"Familial, autosomal recessive"	""	"age onset <7m (11); died at 5-34m (8)/unknown (3)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175033"	"01822"	"00234769"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175034"	"01822"	"00234770"	"01940"	"Familial, autosomal recessive"	""	"age onset infantile; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175035"	"01822"	"00234771"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175036"	"01822"	"00234772"	"01940"	"Familial, autosomal recessive"	""	"age onset shortly after birth/3m; died at 6m/died at 7m; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); liver/spleen involvement/liver/spleen involvement; respiratory problems (HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175037"	"01822"	"00234773"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175038"	"01822"	"00234774"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638)"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175039"	"01822"	"00234775"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175040"	"01822"	"00234776"	"01940"	"Familial, autosomal recessive"	""	"died at 12m; cardiomyopathy (HP:0001638); liver/spleen involvement"	"<9m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175041"	"01822"	"00234777"	"01940"	"Familial, autosomal recessive"	"10m"	"cardiomyopathy (HP:0001638); liver/spleen involvement"	"<10m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175042"	"01822"	"00234778"	"01940"	"Familial, autosomal recessive"	""	"died at 22m; cardiomyopathy (HP:0001638); liver/spleen involvement"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175043"	"01822"	"00234779"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); liver/spleen involvement"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175044"	"01822"	"00234780"	"01940"	"Familial, autosomal recessive"	"17y"	"no ventilatory support (-HP:0002093)"	"17y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175045"	"01822"	"00234781"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175046"	"01822"	"00234782"	"01940"	"Familial, autosomal recessive"	"<1y"	"age onset shortly after birth; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175047"	"01822"	"00234783"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175048"	"01822"	"00234784"	"01940"	"Familial, autosomal recessive"	""	"age onset prenatal; died; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175049"	"01822"	"00234785"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175050"	"01822"	"00234786"	"01940"	"Familial, autosomal recessive"	"2y5m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"<2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175051"	"01822"	"00234787"	"01940"	"Familial, autosomal recessive"	"6m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175052"	"01822"	"00234788"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2) ; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175053"	"01822"	"00234789"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"10m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175054"	"01822"	"00234790"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (5); age analysis unknown (5)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175055"	"01822"	"00234791"	"01940"	"Familial, autosomal recessive"	"35d"	"cardiomyopathy (HP:0001638)"	"<42d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175056"	"01822"	"00234792"	"01940"	"Familial, autosomal recessive"	"19m"	"cardiomyopathy (HP:0001638); no respiratory problems (-HP:0002795)"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175057"	"01822"	"00234793"	"01940"	"Familial, autosomal recessive"	"4m"	"cardiomyopathy (HP:0001638)"	"<4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175058"	"01822"	"00234794"	"01940"	"Familial, autosomal recessive"	"9m"	"cardiomyopathy (HP:0001638); liver/spleen involvement; respiratory problems (HP:0002795)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175059"	"01822"	"00234795"	"01940"	"Familial, autosomal recessive"	""	"age onset 1d/1d/2m; age analysis 7m/4m/5m; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); no liver/spleen involvement/no liver/spleen involvement/liver/spleen involvement; respiratory problems (HP:0002795)/no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175060"	"01822"	"00234796"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"3m"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175061"	"01822"	"00234797"	"01940"	"Familial, autosomal recessive"	"45d"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175062"	"01822"	"00234798"	"01940"	"Familial, autosomal recessive"	""	"age onset infantile; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175063"	"01822"	"00234799"	"01940"	"Familial, autosomal recessive"	"7m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175064"	"01822"	"00234800"	"01940"	"Familial, autosomal recessive"	"<1y"	"age onset shortly after birth; cardiomyopathy (HP:0001638) (3)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175065"	"01822"	"00234801"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175066"	"01822"	"00234802"	"01940"	"Familial, autosomal recessive"	"7y"	"age onset unknown; no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175067"	"01822"	"00234803"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175068"	"01822"	"00234804"	"01940"	"Familial, autosomal recessive"	"4m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"56d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175069"	"01822"	"00234805"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175070"	"01822"	"00234806"	"01940"	"Familial, autosomal recessive"	""	"died at 8m; cardiomyopathy (HP:0001638); liver/spleen involvement; no ventilatory support (-HP:0002093); respiratory problems (HP:0002795)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175071"	"01822"	"00234807"	"01940"	"Familial, autosomal recessive"	""	"died at 8m; cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175072"	"01822"	"00234808"	"01940"	"Familial, autosomal recessive"	"6m14d"	"cardiomyopathy (HP:0001638); ventilatory support (HP:0002093) at night"	"<5m14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175073"	"01822"	"00234809"	"01940"	"Familial, autosomal recessive"	"13m"	"cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); no kyphosis/scoliosis (-HP:0010674)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175074"	"01822"	"00234810"	"01940"	"Familial, autosomal recessive"	""	"age onset <5m/<2m; age analysis unknown (2); cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175075"	"01822"	"00234811"	"01940"	"Familial, autosomal recessive"	"<10m"	"cardiomyopathy (HP:0001638)"	"<2m14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175076"	"01822"	"00234812"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (5); age analysis unknown (5)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175077"	"01822"	"00234813"	"01940"	"Familial, autosomal recessive"	""	"age analysis 4.1m; cardiomyopathy (HP:0001638); ventilatory support (HP:0002093) at night"	"<2m14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175078"	"01822"	"00234814"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175079"	"01822"	"00234815"	"01940"	"Familial, autosomal recessive"	""	"age onset 41y/35y; age analysis 44y/62y; no ventilatory support (-HP:0002093)/ventilatory support (HP:0002093); no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795) ; not wheelchair bound (-HP:0002540)/wheelchair bound (HP:0002540) ; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175080"	"01822"	"00234816"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; died at 8m; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175081"	"01822"	"00234817"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175082"	"01822"	"00234818"	"01940"	"Familial, autosomal recessive"	""	"died"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175083"	"01822"	"00234819"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); NBS/NBS"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175084"	"01822"	"00234820"	"01940"	"Familial, autosomal recessive"	""	"died at 3y; cardiomyopathy (HP:0001638)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175085"	"01822"	"00234821"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175086"	"01822"	"00234822"	"01940"	"Familial, autosomal recessive"	"33m"	"cardiomyopathy (HP:0001638)"	"<42d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175087"	"01822"	"00234823"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175088"	"01822"	"00234824"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175089"	"01822"	"00234825"	"01940"	"Familial, autosomal recessive"	""	"age onset >30y/>30y; age analysis 59y/54y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night/no ventilatory support (-HP:0002093); VC standing 1.4L/VC standing 2.8L; no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175090"	"01822"	"00234826"	"01940"	"Familial, autosomal recessive"	"52y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); ischemic stroke (HP:0002140)"	"46y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175091"	"01822"	"00234827"	"01940"	"Familial, autosomal recessive"	"51y"	"##"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175092"	"01822"	"00234828"	"01940"	"Familial, autosomal recessive"	"68y"	"no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795); mobility problem (HP:0100022); no kyphosis/scoliosis (-HP:0010674)"	"63y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175093"	"01822"	"00234829"	"01940"	"Familial, autosomal recessive"	"15y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"15y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175094"	"01822"	"00234830"	"01940"	"Familial, autosomal recessive"	"55y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); mobility problem (HP:0100022)"	"49y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175095"	"01822"	"00234831"	"01940"	"Familial, autosomal recessive"	"36y"	"mobility problem (HP:0100022)"	"34y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175096"	"01822"	"00234832"	"01940"	"Familial, autosomal recessive"	""	"age onset 50y/67y; age analysis 60y/72y; no ventilatory support (-HP:0002093)/ventilatory support (HP:0002093); VC% in a sitting position 58 %/43%; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175097"	"01822"	"00234833"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175098"	"01822"	"00234834"	"01940"	"Familial, autosomal recessive"	""	"age onset childhood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175099"	"01822"	"00234835"	"01940"	"Familial, autosomal recessive"	""	"age onset 16y/50y; age analysis 32y/58y; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (1)"	"glycogen storage disease"	""
"0000175100"	"01822"	"00234836"	"01940"	"Familial, autosomal recessive"	""	"age onset 43y/63y; age analysis 48y/65y; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175101"	"01822"	"00234837"	"01940"	"Familial, autosomal recessive"	"69y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); ptosis (HP:0000508); abnormal cerebral vessels (HP:0100659)"	"40y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175102"	"01822"	"00234838"	"01940"	"Familial, autosomal recessive"	"64y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); mobility problem (HP:0100022); no ptosis (-HP:0000508)"	"49y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175103"	"01822"	"00234839"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"31y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175104"	"01822"	"00234840"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<4y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175105"	"01822"	"00234841"	"01940"	"Familial, autosomal recessive"	"31y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175106"	"01822"	"00234842"	"01940"	"Familial, autosomal recessive"	""	"age onset 23y/29y; age analysis 58y/71y; no cardiomyopathy (-HP:0001638); FVC in sitting and suppine 76/68% / 101/81%; mobility problem (HP:0100022)/no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175107"	"01822"	"00234843"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175108"	"01822"	"00234844"	"01940"	"Familial, autosomal recessive"	"28y"	"not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175109"	"01822"	"00234845"	"01940"	"Familial, autosomal recessive"	"31y"	"no ventilatory support (-HP:0002093); mobility problem (HP:0100022)"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175110"	"01822"	"00234846"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis 16-19y; no ventilatory support (-HP:0002093)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175111"	"01822"	"00234847"	"01940"	"Familial, autosomal recessive"	""	"age onset 18y/22y; age analysis 18y/22y; Wolf–Parkinson–White/-; ventilatory support (HP:0002093)/ventilatory support (HP:0002093); respiratory problems (HP:0002795)/respiratory problems (HP:0002795); wheelchair bound (HP:0002540)/wheelchair bound (HP:0002540) ; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175112"	"01822"	"00234848"	"01940"	"Familial, autosomal recessive"	"44y"	"##"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175113"	"01822"	"00234849"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175114"	"01822"	"00234850"	"01940"	"Familial, autosomal recessive"	"13y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540)"	"5y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175115"	"01822"	"00234851"	"01940"	"Familial, autosomal recessive"	"11y"	"no cardiomyopathy (-HP:0001638); small fiber neuropathy"	"7y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175116"	"01822"	"00234852"	"01940"	"Familial, autosomal recessive"	"44y"	"no cardiomyopathy (-HP:0001638); not wheelchair bound (-HP:0002540); no kyphosis/scoliosis (-HP:0010674)"	"40y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175117"	"01822"	"00234853"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"42y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175118"	"01822"	"00234854"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"6y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175119"	"01822"	"00234855"	"01940"	"Familial, autosomal recessive"	"32y"	"no cardiomyopathy (-HP:0001638)"	"21y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175120"	"01822"	"00234856"	"01940"	"Familial, autosomal recessive"	"73y"	"FVC in upright position 60%; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"53y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175121"	"01822"	"00234857"	"01940"	"Familial, autosomal recessive"	""	"age onset adulthood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175122"	"01822"	"00234858"	"01940"	"Familial, autosomal recessive"	"53y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"17y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175123"	"01822"	"00234859"	"01940"	"Familial, autosomal recessive"	"39y"	"no ventilatory support (-HP:0002093)"	"32y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175124"	"01822"	"00234860"	"01940"	"Familial, autosomal recessive"	"32y"	"age onset childhood; mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175125"	"01822"	"00234861"	"01940"	"Familial, autosomal recessive"	"28y"	"##"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175126"	"01822"	"00234862"	"01940"	"Familial, autosomal recessive"	"48y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540)"	"48y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175127"	"01822"	"00234863"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175128"	"01822"	"00234864"	"01940"	"Familial, autosomal recessive"	""	"age analysis 45-50y; respiratory problems (HP:0002795)"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175129"	"01822"	"00234865"	"01940"	"Familial, autosomal recessive"	"40y"	"age onset unknown; respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175130"	"01822"	"00234866"	"01940"	"Familial, autosomal recessive"	""	"age onset 16y/28y; age analysis 19y/35y; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (1)"	"glycogen storage disease"	""
"0000175131"	"01822"	"00234867"	"01940"	"Familial, autosomal recessive"	"61y"	"no ventilatory support (-HP:0002093); mobility problem (HP:0100022)"	"40y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175132"	"01822"	"00234868"	"01940"	"Familial, autosomal recessive"	"58y"	"age onset unknown; no cardiomyopathy (-HP:0001638); not wheelchair bound (-HP:0002540)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175133"	"01822"	"00234869"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175134"	"01822"	"00234870"	"01940"	"Familial, autosomal recessive"	"34y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"22y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175135"	"01822"	"00234871"	"01940"	"Familial, autosomal recessive"	"49y"	"no ventilatory support (-HP:0002093); vital capacity in sitting/supine position: 2.49L/1,47L; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"28y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175136"	"01822"	"00234872"	"01940"	"Familial, autosomal recessive"	"59y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175137"	"01822"	"00234873"	"01940"	"Familial, autosomal recessive"	"63y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"27y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175138"	"01822"	"00234874"	"01940"	"Familial, autosomal recessive"	"38y"	"wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175139"	"01822"	"00234875"	"01940"	"Familial, autosomal recessive"	"45y"	"##"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175140"	"01822"	"00234876"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"6y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175141"	"01822"	"00234877"	"01940"	"Familial, autosomal recessive"	"29y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175142"	"01822"	"00234878"	"01940"	"Familial, autosomal recessive"	"17y"	"Mild left ventricular hypertrophy; liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); scapular winging (HP:0003691)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175143"	"01822"	"00234879"	"01940"	"Familial, autosomal recessive"	"38y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"28y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175144"	"01822"	"00234880"	"01940"	"Familial, autosomal recessive"	"37y"	"not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175145"	"01822"	"00234881"	"01940"	"Familial, autosomal recessive"	"38y"	"age onset unknown; mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175146"	"01822"	"00234882"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175147"	"01822"	"00234883"	"01940"	"Familial, autosomal recessive"	"51y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); mobility problem (HP:0100022); no ptosis (-HP:0000508)"	"36y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175148"	"01822"	"00234884"	"01940"	"Familial, autosomal recessive"	"20y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175149"	"01822"	"00234885"	"01940"	"Familial, autosomal recessive"	"40y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175150"	"01822"	"00234886"	"01940"	"Familial, autosomal recessive"	""	"no ventilatory support (-HP:0002093)"	"33y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175151"	"01822"	"00234887"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638); FVC in sitting/ supine position 33/26%; not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"27y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175152"	"01822"	"00234888"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175153"	"01822"	"00234889"	"01940"	"Familial, autosomal recessive"	"54y"	"no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022); no ptosis (-HP:0000508)"	"43y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175154"	"01822"	"00234890"	"01940"	"Familial, autosomal recessive"	"45y"	"no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175155"	"01822"	"00234891"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	">20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175156"	"01822"	"00234892"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<17y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175157"	"01822"	"00234893"	"01940"	"Familial, autosomal recessive"	""	"age onset adulthood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175158"	"01822"	"00234894"	"01940"	"Familial, autosomal recessive"	"20y"	"mobility problem (HP:0100022)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175159"	"01822"	"00234895"	"01940"	"Familial, autosomal recessive"	"40y"	"no ventilatory support (-HP:0002093); vital capacity in sitting/supine position:  3.91L/ 3,74L; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"33y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175160"	"01822"	"00234896"	"01940"	"Familial, autosomal recessive"	"43y"	"##"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175161"	"01822"	"00234897"	"01940"	"Familial, autosomal recessive"	"50y"	"mobility problem (HP:0100022)"	"30y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175162"	"01822"	"00234898"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"5y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175163"	"01822"	"00234899"	"01940"	"Familial, autosomal recessive"	"36y"	"no cardiomyopathy (-HP:0001638)"	"15y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175164"	"01822"	"00234900"	"01940"	"Familial, autosomal recessive"	"29y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175165"	"01822"	"00234901"	"01940"	"Familial, autosomal recessive"	"38y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night; not wheelchair bound (-HP:0002540); ptosis (HP:0000508); abnormal cerebral vessels (HP:0100659)"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175166"	"01822"	"00234902"	"01940"	"Familial, autosomal recessive"	"52y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022); no ptosis (-HP:0000508)"	"34y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175167"	"01822"	"00234903"	"01940"	"Familial, autosomal recessive"	"68y"	"mobility problem (HP:0100022)"	"48y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175168"	"01822"	"00234904"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175169"	"01822"	"00234905"	"01940"	"Familial, autosomal recessive"	""	"age onset 8y/10y/10y; age analysis 23y/36y/33y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175170"	"01822"	"00234906"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"30y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175171"	"01822"	"00234907"	"01940"	"Familial, autosomal recessive"	"40y"	"##"	"36y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175172"	"01822"	"00234908"	"01940"	"Familial, autosomal recessive"	"73y"	"no cardiomyopathy (-HP:0001638); Vignos scale l.e. (2/3)"	"30y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175173"	"01822"	"00234909"	"01940"	"Familial, autosomal recessive"	"50y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"31y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175174"	"01822"	"00234910"	"01940"	"Familial, autosomal recessive"	"57y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175175"	"01822"	"00234911"	"01940"	"Familial, autosomal recessive"	"36y"	"age onset unknown; FVC in sitting position 4.92L; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175176"	"01822"	"00234912"	"01940"	"Familial, autosomal recessive"	"21y"	"no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175177"	"01822"	"00234913"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175178"	"01822"	"00234914"	"01940"	"Familial, autosomal recessive"	"48y"	"ventilatory support (HP:0002093) 24h/d; respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175179"	"01822"	"00234915"	"01940"	"Familial, autosomal recessive"	"22y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"22y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175180"	"01822"	"00234916"	"01940"	"Familial, autosomal recessive"	"36y"	"not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175181"	"01822"	"00234917"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<6y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175182"	"01822"	"00234918"	"01940"	"Familial, autosomal recessive"	"25y"	"##"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175183"	"01822"	"00234919"	"01940"	"Familial, autosomal recessive"	""	"age onset 42y/34y; age analysis 46y/36y; mobility problem (HP:0100022)/mobility problem (HP:0100022); no abnormal cerebral vessels (-HP:0100659)/no abnormal cerebral vessels (-HP:0100659)/neurological changes"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175184"	"01822"	"00234920"	"01940"	"Familial, autosomal recessive"	"63y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"32y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175185"	"01822"	"00234921"	"01940"	"Familial, autosomal recessive"	""	"age analysis 40-44y; ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"40y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175186"	"01822"	"00234922"	"01940"	"Familial, autosomal recessive"	"44y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175187"	"01822"	"00234923"	"01940"	"Familial, autosomal recessive"	""	"age onset 2y/38y; age analysis 2y/63y; no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795) ; no mobility problem (-HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (1)"	"glycogen storage disease"	""
"0000175188"	"01822"	"00234924"	"01940"	"Familial, autosomal recessive"	"6y"	"##"	"6y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175189"	"01822"	"00234925"	"01940"	"Familial, autosomal recessive"	""	"age onset 40y/30y; age analysis 60y/61y; ventilatory support (HP:0002093)/ventilatory support (HP:0002093); respiratory problems (HP:0002795)/respiratory problems (HP:0002795); mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175190"	"01822"	"00234926"	"01940"	"Familial, autosomal recessive"	""	"age onset 1-38y; age analysis 12-60y (6)/died at 40y (1); ventilatory support (HP:0002093) (2)/no ventilatory support (-HP:0002093) (5); wheelchair bound (HP:0002540) (3)/not wheelchair bound (-HP:0002540 (4); mobility problem (HP:0100022)  (7)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (2)/ Adult (5)"	"glycogen storage disease"	""
"0000175191"	"01822"	"00234927"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175192"	"01822"	"00234928"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175193"	"01822"	"00234929"	"01940"	"Familial, autosomal recessive"	""	"age onset adulthood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175194"	"01822"	"00234930"	"01940"	"Familial, autosomal recessive"	"16y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); kyphosis/scoliosis (HP:0010674)"	"13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175195"	"01822"	"00234931"	"01940"	"Familial, autosomal recessive"	"58y"	"##"	"42y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175196"	"01822"	"00234932"	"01940"	"Familial, autosomal recessive"	"55y"	"##"	"42y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175197"	"01822"	"00234933"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175198"	"01822"	"00234934"	"01940"	"Familial, autosomal recessive"	"74y"	"no cardiomyopathy (-HP:0001638)"	"50y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175199"	"01822"	"00234935"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis 31y/40y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); FVC 83/102%; not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175200"	"01822"	"00234936"	"01940"	"Familial, autosomal recessive"	""	"age onset 2y6m/5y; age analysis 13y/7.8y; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); FVC in sitting/ supine position 66/54% / 108/104%; not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); MRC 84%/MRC 100%"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175201"	"01822"	"00234937"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175202"	"01822"	"00234938"	"01940"	"Familial, autosomal recessive"	"35y"	"mobility problem (HP:0100022)"	"22y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175203"	"01822"	"00234939"	"01940"	"Familial, autosomal recessive"	""	"age onset 20y/adulthood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175204"	"01822"	"00234940"	"01940"	"Familial, autosomal recessive"	""	"age onset 32y/30y; age analysis 53y/60y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795); abnormal cerebral vessels (HP:0100659)/abnormal cerebral vessels (HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175205"	"01822"	"00234941"	"01940"	"Familial, autosomal recessive"	"42y"	"respiratory problems (HP:0002795)"	"39y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175206"	"01822"	"00234942"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175207"	"01822"	"00234943"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (5); age analysis unknown (5); no cardiomyopathy (-HP:0001638) (5)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175208"	"01822"	"00234944"	"01940"	"Familial, autosomal recessive"	""	"age onset childhood/42y/26y; age analysis 30y/57y/29/y; no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (2)"	"glycogen storage disease"	""
"0000175209"	"01822"	"00234945"	"01940"	"Familial, autosomal recessive"	""	"age onset <3y/unknown; age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Childhood or Adult (1)"	"glycogen storage disease"	""
"0000175210"	"01822"	"00234946"	"01940"	"Familial, autosomal recessive"	"59y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"50y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175211"	"01822"	"00234947"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (3); age analysis 34y/34y/unknown; FVC (%):86/82/unknown; not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540)/unknown; no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022)/unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175212"	"01822"	"00234948"	"01940"	"Familial, autosomal recessive"	"31y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"27y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175213"	"01822"	"00234949"	"01940"	"Familial, autosomal recessive"	""	"age onset 28y/35y; age analysis 41y/55y; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175214"	"01822"	"00234950"	"01940"	"Familial, autosomal recessive"	"50y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022); no ptosis (-HP:0000508)"	"41y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175215"	"01822"	"00234951"	"01940"	"Familial, autosomal recessive"	""	"age onset 10y-20y; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175216"	"01822"	"00234952"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175217"	"01822"	"00234953"	"01940"	"Familial, autosomal recessive"	"48y"	"no ventilatory support (-HP:0002093); respiratory problems (HP:0002795)"	"20y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175218"	"01822"	"00234954"	"01940"	"Familial, autosomal recessive"	""	"died at 57y; ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"15y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175219"	"01822"	"00234955"	"01940"	"Familial, autosomal recessive"	""	"age analysis 3-7m; no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) (BI-PAP); respiratory problems (HP:0002795); wheelchair bound (HP:0002540) (bed-ridden); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"3m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175220"	"01822"	"00234956"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175221"	"01822"	"00234957"	"01940"	"Familial, autosomal recessive"	"15y"	"kyphosis/scoliosis (HP:0010674); scapular winging (HP:0003691)"	"14y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175222"	"01822"	"00234958"	"01940"	"Familial, autosomal recessive"	"33y"	"no respiratory problems (-HP:0002795)"	"32y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175223"	"01822"	"00234959"	"01940"	"Familial, autosomal recessive"	"15y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); kyphosis/scoliosis (HP:0010674); scapular winging (HP:0003691)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175224"	"01822"	"00234960"	"01940"	"Familial, autosomal recessive"	"49y"	"not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"37y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175225"	"01822"	"00234961"	"01940"	"Familial, autosomal recessive"	"23y"	"FVC 25%"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175226"	"01822"	"00234962"	"01940"	"Familial, autosomal recessive"	"50y"	"no cardiomyopathy (-HP:0001638); Spirometry indicated moderate restriction; not wheelchair bound (-HP:0002540); mobility problem (HP:0100022); abnormal cerebral vessels (HP:0100659)"	"51y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175227"	"01822"	"00234963"	"01940"	"Familial, autosomal recessive"	"48y"	"ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"43y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175228"	"01822"	"00234964"	"01940"	"Familial, autosomal recessive"	""	"age onset 43y/20y/55y; age analysis 47y/43y/65y; respiratory problems (HP:0002795)/no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540)/wheelchair bound (HP:0002540)/not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)/mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175229"	"01822"	"00234965"	"01940"	"Familial, autosomal recessive"	"3y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175230"	"01822"	"00234966"	"01940"	"Familial, autosomal recessive"	"8y"	"no cardiomyopathy (-HP:0001638)"	"7y6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175231"	"01822"	"00234967"	"01940"	"Familial, autosomal recessive"	""	"age onset 46y/20y/15y; age analysis unknown (3); ventilatory support (HP:0002093)/ventilatory support (HP:0002093)/no ventilatory support (-HP:0002093); respiratory problems (HP:0002795)/respiratory problems (HP:0002795)/unknown; mobility problem (HP:0100022)/mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (2)"	"glycogen storage disease"	""
"0000175232"	"01822"	"00234968"	"01940"	"Familial, autosomal recessive"	"43y"	"arrhythmias; no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"42y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175233"	"01822"	"00234969"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175234"	"01822"	"00234970"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	">19y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175235"	"01822"	"00234971"	"01940"	"Familial, autosomal recessive"	"68y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); wheelchair bound (HP:0002540); mobility problem (HP:0100022); no ptosis (-HP:0000508)"	"34y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175236"	"01822"	"00234972"	"01940"	"Familial, autosomal recessive"	""	"age onset 17-45y; age analysis 21-58y; respiratory problems (HP:0002795) (2); mobility problem (HP:0100022)  (3)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175237"	"01822"	"00234973"	"01940"	"Familial, autosomal recessive"	"48y"	"respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"30y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175238"	"01822"	"00234974"	"01940"	"Familial, autosomal recessive"	""	"age onset 20-38y (4)/ asymptomatic (2); age analysis 32-72y; ventilatory support (HP:0002093) (3)/no ventilatory support (-HP:0002093) (3); respiratory problems (HP:0002795) (2)/ no respiratory problems (-HP:0002795) (2)/unknown (2); mobility problem (HP:0100022)  (2)/no mobility problem (-HP:0100022) (4)"	""	""	""	""	""	""	""	""	"GSD-2: Adult (4)/ unknown (2)"	"glycogen storage disease"	""
"0000175239"	"01822"	"00234975"	"01940"	"Familial, autosomal recessive"	"29y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175240"	"01822"	"00234976"	"01940"	"Familial, autosomal recessive"	"27y"	"no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795)"	"14y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175241"	"01822"	"00234977"	"01940"	"Familial, autosomal recessive"	""	"age onset 10y/adulthood; age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (1)"	"glycogen storage disease"	""
"0000175242"	"01822"	"00234978"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (11); age analysis unknown (11)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (10)"	"glycogen storage disease"	""
"0000175243"	"01822"	"00234979"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (3); age analysis unknown (3)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (2)"	"glycogen storage disease"	""
"0000175244"	"01822"	"00234980"	"01940"	"Familial, autosomal recessive"	""	"age onset 41y/42y; age analysis 42y/47y; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175245"	"01822"	"00234981"	"01940"	"Familial, autosomal recessive"	"65y"	"age onset unknown; ischemic cardiopathy; respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175246"	"01822"	"00234982"	"01940"	"Familial, autosomal recessive"	"34y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); mobility problem (HP:0100022); ptosis (HP:0000508)"	"29y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175247"	"01822"	"00234983"	"01940"	"Familial, autosomal recessive"	"15y"	"no cardiomyopathy (-HP:0001638)"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175248"	"01822"	"00234984"	"01940"	"Familial, autosomal recessive"	"62y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"34y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175249"	"01822"	"00234985"	"01940"	"Familial, autosomal recessive"	"2y"	"bilateral calf hypertrophy"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175250"	"01822"	"00234986"	"01940"	"Familial, autosomal recessive"	"26y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175251"	"01822"	"00234987"	"01940"	"Familial, autosomal recessive"	"70y"	"FVC in sitting/ supine position 53/30%; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"18y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175252"	"01822"	"00234988"	"01940"	"Familial, autosomal recessive"	"33y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no ptosis (-HP:0000508); no abnormal cerebral vessels (-HP:0100659)"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175253"	"01822"	"00234989"	"01940"	"Familial, autosomal recessive"	"9y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175254"	"01822"	"00234990"	"01940"	"Familial, autosomal recessive"	"53y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no ptosis (-HP:0000508); no abnormal cerebral vessels (-HP:0100659)"	"43y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175255"	"01822"	"00234991"	"01940"	"Familial, autosomal recessive"	"72y"	"no ventilatory support (-HP:0002093); mobility problem (HP:0100022)"	"30y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175256"	"01822"	"00234992"	"01940"	"Familial, autosomal recessive"	"37y"	"no respiratory problems (-HP:0002795); mobility problem (HP:0100022)"	"35y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175257"	"01822"	"00234993"	"01940"	"Familial, autosomal recessive"	"40y"	"ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); mobility problem (HP:0100022); scapular winging (HP:0003691)"	"26y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175258"	"01822"	"00234994"	"01940"	"Familial, autosomal recessive"	"64y"	"age onset 34-39y; ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022); scapular winging (HP:0003691)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175259"	"01822"	"00234995"	"01940"	"Familial, autosomal recessive"	"60y"	"age onset unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175260"	"01822"	"00234996"	"01940"	"Familial, autosomal recessive"	""	"age onset 20y/55y; age analysis 42y/53y; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175261"	"01822"	"00234997"	"01940"	"Familial, autosomal recessive"	"46y"	"##"	"48y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175262"	"01822"	"00234998"	"01940"	"Familial, autosomal recessive"	"51y"	"no cardiomyopathy (-HP:0001638); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175263"	"01822"	"00234999"	"01940"	"Familial, autosomal recessive"	""	"age onset 21y/unknown; age analysis 35y/37y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795)/no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175264"	"01822"	"00235000"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175265"	"01822"	"00235001"	"01940"	"Familial, autosomal recessive"	"34y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"17y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175266"	"01822"	"00235002"	"01940"	"Familial, autosomal recessive"	"48y"	"##"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175267"	"01822"	"00235003"	"01940"	"Familial, autosomal recessive"	"66y"	"mobility problem (HP:0100022)"	"52y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175268"	"01822"	"00235004"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175269"	"01822"	"00235005"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175270"	"01822"	"00235006"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"2y6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175271"	"01822"	"00235007"	"01940"	"Familial, autosomal recessive"	""	"age onset 20y/19y/17y; age analysis 33y/35y/36y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no liver/spleen involvement/no liver/spleen involvement/no liver/spleen involvement; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)/mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (2)"	"glycogen storage disease"	""
"0000175272"	"01822"	"00235008"	"01940"	"Familial, autosomal recessive"	"24y"	"no cardiomyopathy (-HP:0001638)"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175273"	"01822"	"00235009"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175274"	"01822"	"00235010"	"01940"	"Familial, autosomal recessive"	"15y"	"no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795)"	"7y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175275"	"01822"	"00235011"	"01940"	"Familial, autosomal recessive"	"23y"	"respiratory problems (HP:0002795)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175276"	"01822"	"00235012"	"01940"	"Familial, autosomal recessive"	"28y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"16y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175277"	"01822"	"00235013"	"01940"	"Familial, autosomal recessive"	"8y6m"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175278"	"01822"	"00235014"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<7y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175279"	"01822"	"00235015"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175280"	"01822"	"00235016"	"01940"	"Familial, autosomal recessive"	"5y"	"no cardiomyopathy (-HP:0001638); liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540)"	"1y1m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175281"	"01822"	"00235017"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175282"	"01822"	"00235018"	"01940"	"Familial, autosomal recessive"	""	"age onset 10-13y/11y; age analysis 13y/11y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night/ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795)/respiratory problems (HP:0002795); wheelchair bound (HP:0002540)/not wheelchair bound (-HP:0002540) ; mobility problem (HP:0100022)/mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)/no kyphosis/scoliosis (-HP:0010674); scapular winging (HP:0003691)/no scapular winging (-HP:0003691)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175283"	"01822"	"00235019"	"01940"	"Familial, autosomal recessive"	"5m"	"cardiomyopathy (HP:0001638)"	"<5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175284"	"01822"	"00235020"	"01940"	"Familial, autosomal recessive"	"34y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175285"	"01822"	"00235021"	"01940"	"Familial, autosomal recessive"	""	"age onset 3y/3y; age analysis unknown (2) ; liver/spleen involvement/no liver/spleen involvement; no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795)"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175286"	"01822"	"00235022"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175287"	"01822"	"00235023"	"01940"	"Familial, autosomal recessive"	"47y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) 24h/d; respiratory problems (HP:0002795); mobility problem (HP:0100022); no kyphosis/scoliosis (-HP:0010674)"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175288"	"01822"	"00235024"	"01940"	"Familial, autosomal recessive"	"17y"	"Wolf-Parkinson-White syndrome (at 17y); ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"14y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175289"	"01822"	"00235025"	"01940"	"Familial, autosomal recessive"	"12y"	"slightly enlarged right ventricle; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"20m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175290"	"01822"	"00235026"	"01940"	"Familial, autosomal recessive"	""	"age onset early Childhood/asymptomatic; age analysis 16y/13y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night/no ventilatory support (-HP:0002093); respiratory problems (HP:0002795)/no respiratory problems (-HP:0002795); mobility problem (HP:0100022)/no mobility problem (-HP:0100022) ; kyphosis/scoliosis (HP:0010674)/no kyphosis/scoliosis (-HP:0010674)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ unknown (1)"	"glycogen storage disease"	""
"0000175291"	"01822"	"00235027"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175292"	"01822"	"00235028"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175293"	"01822"	"00235029"	"01940"	"Familial, autosomal recessive"	""	"age analysis 4.9m; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175294"	"01822"	"00235030"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175295"	"01822"	"00235031"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175296"	"01822"	"00235032"	"01940"	"Familial, autosomal recessive"	"5y6m"	"no cardiomyopathy (-HP:0001638); FVC in sitting/ supine position 32/27%; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"1y6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175297"	"01822"	"00235033"	"01940"	"Familial, autosomal recessive"	"36m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"<12d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175298"	"01822"	"00235034"	"01940"	"Familial, autosomal recessive"	""	"died at 33.8m; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175299"	"01822"	"00235035"	"01940"	"Familial, autosomal recessive"	""	"age onset 4-10m; age analysis 4.9y; cardiomyopathy (HP:0001638); liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175300"	"01822"	"00235036"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175301"	"01822"	"00235037"	"01940"	"Familial, autosomal recessive"	""	"age onset 35-53y; age analysis unknown; respiratory problems (HP:0002795) (6); mobility problem (HP:0100022)  (7); scapular winging (HP:0003691) (7); abnormal cerebral vessels (HP:0100659) (6)/ND (1)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175302"	"01822"	"00235038"	"01940"	"Familial, autosomal recessive"	""	"died"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175303"	"01822"	"00235039"	"01940"	"Familial, autosomal recessive"	"49y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no mobility problem (-HP:0100022)"	"39y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175304"	"01822"	"00235040"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); liver/spleen involvement"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175305"	"01822"	"00235041"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175306"	"01822"	"00235042"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175307"	"01822"	"00235043"	"01940"	"Familial, autosomal recessive"	""	"age onset <14d/<16d; age analysis 55m/28m; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175308"	"01822"	"00235044"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175309"	"01822"	"00235045"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175310"	"01822"	"00235046"	"01940"	"Familial, autosomal recessive"	"2m"	"cardiomyopathy (HP:0001638)"	"5d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175311"	"01822"	"00235047"	"01940"	"Familial, autosomal recessive"	"6m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175312"	"01822"	"00235048"	"01940"	"Familial, autosomal recessive"	""	"age onset 2m/1d; died at < 2y/unknown; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); liver/spleen involvement/liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175313"	"01822"	"00235049"	"01940"	"Familial, autosomal recessive"	""	"age onset 15y/unknown; age analysis 15y/13y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no respiratory problems (-HP:0002795)/no respiratory problems (-HP:0002795); mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175314"	"01822"	"00235050"	"01940"	"Familial, autosomal recessive"	"1y3m"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175315"	"01822"	"00235051"	"01940"	"Familial, autosomal recessive"	"1y6m"	"cardiomyopathy (HP:0001638)"	"3m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175316"	"01822"	"00235052"	"01940"	"Familial, autosomal recessive"	"23y"	"incomplete right bundle branch block; ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); no mobility problem (-HP:0100022); no abnormal cerebral vessels (-HP:0100659)"	"18y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175317"	"01822"	"00235053"	"01940"	"Familial, autosomal recessive"	"2y9m"	"no cardiomyopathy (-HP:0001638); liver/spleen involvement"	"15m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175318"	"01822"	"00235054"	"01940"	"Familial, autosomal recessive"	"2y4m"	"age onset 1-2y4m; no cardiomyopathy (-HP:0001638); liver/spleen involvement; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175319"	"01822"	"00235055"	"01940"	"Familial, autosomal recessive"	""	"age onset <7y/<7y; age analysis 11y/10y; ventilatory support (HP:0002093) at night/ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795)/respiratory problems (HP:0002795); no mobility problem (-HP:0100022)/no mobility problem (-HP:0100022); kyphosis/scoliosis (HP:0010674)/kyphosis/scoliosis (HP:0010674); scapular winging (HP:0003691)/scapular winging (HP:0003691)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175320"	"01822"	"00235056"	"01940"	"Familial, autosomal recessive"	"9m"	"cardiomyopathy (HP:0001638)/Wolff-Parkinson-White syndrome"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175321"	"01822"	"00235057"	"01940"	"Familial, autosomal recessive"	""	"died at 29y; ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"4y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175322"	"01822"	"00235058"	"01940"	"Familial, autosomal recessive"	""	"age onset 1-6m; age analysis 3.8-5y6m; cardiomyopathy (HP:0001638); mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175323"	"01822"	"00235059"	"01940"	"Familial, autosomal recessive"	"25y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"15y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175324"	"01822"	"00235060"	"01940"	"Familial, autosomal recessive"	"8m"	"cardiomyopathy (HP:0001638); liver/spleen involvement"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175325"	"01822"	"00235061"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175326"	"01822"	"00235062"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175327"	"01822"	"00235063"	"01940"	"Familial, autosomal recessive"	"23m"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175328"	"01822"	"00235064"	"01940"	"Familial, autosomal recessive"	"16y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175329"	"01822"	"00235065"	"01940"	"Familial, autosomal recessive"	"23y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"21y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175330"	"01822"	"00235066"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"2m"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175331"	"01822"	"00235067"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175332"	"01822"	"00235068"	"01940"	"Familial, autosomal recessive"	""	"died at 10m; cardiomyopathy (HP:0001638); liver/spleen involvement"	"8m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175333"	"01822"	"00235069"	"01940"	"Familial, autosomal recessive"	"44m"	"cardiomyopathy (HP:0001638)"	"<5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175334"	"01822"	"00235070"	"01940"	"Familial, autosomal recessive"	""	"age onset 24y/23y; age analysis 30y/28y; no ventilatory support (-HP:0002093)/no ventilatory support (-HP:0002093)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175335"	"01822"	"00235071"	"01940"	"Familial, autosomal recessive"	"9m"	"cardiomyopathy (HP:0001638)"	"12d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175336"	"01822"	"00235072"	"01940"	"Familial, autosomal recessive"	"9y"	"no ventilatory support (-HP:0002093); kyphosis/scoliosis (HP:0010674)"	"7y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175337"	"01822"	"00235073"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175338"	"01822"	"00235074"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638); no ptosis (-HP:0000508)"	"<26d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175339"	"01822"	"00235075"	"01940"	"Familial, autosomal recessive"	""	"age onset 2m/2m; died at 4m/died at 7m; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); liver/spleen involvement/liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175340"	"01822"	"00235076"	"01940"	"Familial, autosomal recessive"	""	"age onset 3-6m/3-6m; age analysis unknown (2) ; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); liver/spleen involvement/liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175341"	"01822"	"00235077"	"01940"	"Familial, autosomal recessive"	""	"age onset 3m/unknown/unknown; died at 6m/NBS/NBS"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175342"	"01822"	"00235078"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175343"	"01822"	"00235079"	"01940"	"Familial, autosomal recessive"	"7y"	"cardiomyopathy (HP:0001638)"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175344"	"01822"	"00235080"	"01940"	"Familial, autosomal recessive"	"50d"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175345"	"01822"	"00235081"	"01940"	"Familial, autosomal recessive"	""	"died at 10m"	"8m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175346"	"01822"	"00235082"	"01940"	"Familial, autosomal recessive"	""	"died at <2y; cardiomyopathy (HP:0001638)"	"<5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175347"	"01822"	"00235083"	"01940"	"Familial, autosomal recessive"	""	"age onset adulthood; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175348"	"01822"	"00235084"	"01940"	"Familial, autosomal recessive"	""	"died at <18.7m; cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175349"	"01822"	"00235085"	"01940"	"Familial, autosomal recessive"	""	"died at 14.7m; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"42d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175350"	"01822"	"00235086"	"01940"	"Familial, autosomal recessive"	"34y"	"no ventilatory support (-HP:0002093)"	"27y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175351"	"01822"	"00235087"	"01940"	"Familial, autosomal recessive"	""	"died"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175352"	"01822"	"00235088"	"01940"	"Familial, autosomal recessive"	"53y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"32y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175353"	"01822"	"00235089"	"01940"	"Familial, autosomal recessive"	"40y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"14y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175354"	"01822"	"00235090"	"01940"	"Familial, autosomal recessive"	""	"died at 6m; cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175355"	"01822"	"00235091"	"01940"	"Familial, autosomal recessive"	""	"died at <18.7m; cardiomyopathy (HP:0001638)"	"7m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175356"	"01822"	"00235092"	"01940"	"Familial, autosomal recessive"	"23y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"23y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175357"	"01822"	"00235093"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"1d"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175358"	"01822"	"00235094"	"01940"	"Familial, autosomal recessive"	"24y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175359"	"01822"	"00235095"	"01940"	"Familial, autosomal recessive"	"01y-30y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"1y6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175360"	"01822"	"00235096"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no mobility problem (-HP:0100022)"	"5y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175361"	"01822"	"00235097"	"01940"	"Familial, autosomal recessive"	"22y"	"no ventilatory support (-HP:0002093)"	"5y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175362"	"01822"	"00235098"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<12m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175363"	"01822"	"00235099"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175364"	"01822"	"00235100"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175365"	"01822"	"00235101"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175366"	"01822"	"00235102"	"01940"	"Familial, autosomal recessive"	"20y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night; wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"15y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175367"	"01822"	"00235103"	"01940"	"Familial, autosomal recessive"	"20y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"19y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175368"	"01822"	"00235104"	"01940"	"Familial, autosomal recessive"	"32y"	"no ventilatory support (-HP:0002093)"	"28y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175369"	"01822"	"00235105"	"01940"	"Familial, autosomal recessive"	"25y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"22y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175370"	"01822"	"00235106"	"01940"	"Familial, autosomal recessive"	"1y11m"	"age onset 8m-18m; no cardiomyopathy (-HP:0001638); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175371"	"01822"	"00235107"	"01940"	"Familial, autosomal recessive"	"12m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175372"	"01822"	"00235108"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175373"	"01822"	"00235109"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175374"	"01822"	"00235110"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<8m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175375"	"01822"	"00235111"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"6m"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175376"	"01822"	"00235112"	"01940"	"Familial, autosomal recessive"	""	"age onset 3m/8m; age analysis 3y/7y; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); liver/spleen involvement/liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175377"	"01822"	"00235113"	"01940"	"Familial, autosomal recessive"	"38y"	"no cardiomyopathy (-HP:0001638); FVC in sitting/ supine position 50/46%; mobility problem (HP:0100022)"	"13y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175378"	"01822"	"00235114"	"01940"	"Familial, autosomal recessive"	"7m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175379"	"01822"	"00235115"	"01940"	"Familial, autosomal recessive"	"12y"	"mild cardiac hypertrophy; no liver/spleen involvement; respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175380"	"01822"	"00235116"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175381"	"01822"	"00235117"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175382"	"01822"	"00235118"	"01940"	"Familial, autosomal recessive"	""	"died at 1y5m; cardiomyopathy (HP:0001638)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175383"	"01822"	"00235119"	"01940"	"Familial, autosomal recessive"	""	"age onset 27y/31y; age analysis 33y/40y; no cardiomyopathy (-HP:0001638)/no cardiomyopathy (-HP:0001638); no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175384"	"01822"	"00235120"	"01940"	"Familial, autosomal recessive"	"16y"	"age onset unknown; no cardiomyopathy (-HP:0001638); no liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175385"	"01822"	"00235121"	"01940"	"Familial, autosomal recessive"	"9m14d"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175386"	"01822"	"00235122"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175387"	"01822"	"00235123"	"01940"	"Familial, autosomal recessive"	"<10m"	"cardiomyopathy (HP:0001638); no respiratory problems (-HP:0002795)"	"<3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175388"	"01822"	"00235124"	"01940"	"Familial, autosomal recessive"	""	"age onset infantile; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175389"	"01822"	"00235125"	"01940"	"Familial, autosomal recessive"	"9m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175390"	"01822"	"00235126"	"01940"	"Familial, autosomal recessive"	"17y"	"no cardiomyopathy (-HP:0001638); FVC: reduced to 41.0%; not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"6y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175391"	"01822"	"00235127"	"01940"	"Familial, autosomal recessive"	"7y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175392"	"01822"	"00235128"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175393"	"01822"	"00235129"	"01940"	"Familial, autosomal recessive"	"8m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175394"	"01822"	"00235130"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175395"	"01822"	"00235131"	"01940"	"Familial, autosomal recessive"	""	"died"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175396"	"01822"	"00235132"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175397"	"01822"	"00235133"	"01940"	"Familial, autosomal recessive"	""	"age analysis 4.6m; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"49d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175398"	"01822"	"00235134"	"01940"	"Familial, autosomal recessive"	"68y"	"no ventilatory support (-HP:0002093)"	"61y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175399"	"01822"	"00235135"	"01940"	"Familial, autosomal recessive"	"27y"	"age onset 05y-06y; mitral valve prolapse; ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175400"	"01822"	"00235136"	"01940"	"Familial, autosomal recessive"	"4m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175401"	"01822"	"00235137"	"01940"	"Familial, autosomal recessive"	"7m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175402"	"01822"	"00235138"	"01940"	"Familial, autosomal recessive"	""	"died at 1y10m; cardiomyopathy (HP:0001638); liver/spleen involvement; respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175403"	"01822"	"00235139"	"01940"	"Familial, autosomal recessive"	"17y"	"cardiomyopathy (HP:0001638); wheelchair bound (HP:0002540); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"11m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175404"	"01822"	"00235140"	"01940"	"Familial, autosomal recessive"	"13y"	"cardiomyopathy (HP:0001638); wheelchair bound (HP:0002540); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"1d"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175405"	"01822"	"00235141"	"01940"	"Familial, autosomal recessive"	"35y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"22y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175406"	"01822"	"00235142"	"01940"	"Familial, autosomal recessive"	"6m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175407"	"01822"	"00235143"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175408"	"01822"	"00235144"	"01940"	"Familial, autosomal recessive"	"3m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"<2m14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175409"	"01822"	"00235145"	"01940"	"Familial, autosomal recessive"	"6y"	"1y-cardiomyopathy (HP:0001638) mild LVH; no respiratory problems (-HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"8m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175410"	"01822"	"00235146"	"01940"	"Familial, autosomal recessive"	""	"died at 12m"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175411"	"01822"	"00235147"	"01940"	"Familial, autosomal recessive"	""	"died"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175412"	"01822"	"00235148"	"01940"	"Familial, autosomal recessive"	""	"age onset 3-6m/3-6m; age analysis unknown (2) ; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); liver/spleen involvement/liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175413"	"01822"	"00235149"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175414"	"01822"	"00235150"	"01940"	"Familial, autosomal recessive"	"48d"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); respiratory problems (HP:0002795); no ptosis (-HP:0000508)"	"21d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175415"	"01822"	"00235151"	"01940"	"Familial, autosomal recessive"	""	"died at 15m"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175416"	"01822"	"00235152"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175417"	"01822"	"00235153"	"01940"	"Familial, autosomal recessive"	""	"age onset 6y/23y; age analysis 14y/32y; no ventilatory support (-HP:0002093)/ventilatory support (HP:0002093); respiratory problems (HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (1)"	"glycogen storage disease"	""
"0000175418"	"01822"	"00235154"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175419"	"01822"	"00235155"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"13d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175420"	"01822"	"00235156"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"9d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175421"	"01822"	"00235157"	"01940"	"Familial, autosomal recessive"	""	"died at 31m"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175422"	"01822"	"00235158"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175423"	"01822"	"00235159"	"01940"	"Familial, autosomal recessive"	"30y"	"##"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175424"	"01822"	"00235160"	"01940"	"Familial, autosomal recessive"	""	"died at 12m"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175425"	"01822"	"00235161"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"29d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175426"	"01822"	"00235162"	"01940"	"Familial, autosomal recessive"	""	"died; cardiomyopathy (HP:0001638); liver/spleen involvement"	"<4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175427"	"01822"	"00235163"	"01940"	"Familial, autosomal recessive"	""	"died at 24.8m; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175428"	"01822"	"00235164"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175429"	"01822"	"00235165"	"01940"	"Familial, autosomal recessive"	""	"age analysis 3-6m; cardiomyopathy (HP:0001638)"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175430"	"01822"	"00235166"	"01940"	"Familial, autosomal recessive"	""	"age onset 1d/1d; age analysis 10m/ 3 weeks; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175431"	"01822"	"00235167"	"01940"	"Familial, autosomal recessive"	""	"died at 10y; no cardiomyopathy (-HP:0001638); no liver/spleen involvement; respiratory problems (HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175432"	"01822"	"00235168"	"01940"	"Familial, autosomal recessive"	"2y"	"cardiomyopathy (HP:0001638); no liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); rapidly progressive muscle weakness"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175433"	"01822"	"00235169"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1y3m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175434"	"01822"	"00235170"	"01940"	"Familial, autosomal recessive"	""	"died at 1y; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"15d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175435"	"01822"	"00235171"	"01940"	"Familial, autosomal recessive"	"17y"	"no ventilatory support (-HP:0002093)"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175436"	"01822"	"00235172"	"01940"	"Familial, autosomal recessive"	""	"age onset 13-30m; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175437"	"01822"	"00235173"	"01940"	"Familial, autosomal recessive"	""	"age onset 56y/54y; age analysis 66y/57y; FVC 12,8/11%; abnormal cerebral vessels (HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175438"	"01822"	"00235174"	"01940"	"Familial, autosomal recessive"	""	"died at 10m; cardiomyopathy (HP:0001638); liver/spleen involvement; no ventilatory support (-HP:0002093)"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175439"	"01822"	"00235175"	"01940"	"Familial, autosomal recessive"	""	"age onset 16y/12y/27y; age analysis 24y/31y/29y; ventilatory support (HP:0002093)/no ventilatory support (-HP:0002093)/ventilatory support (HP:0002093); respiratory problems (HP:0002795)/no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795); unknown/unknown/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (2)/ Adult (1)"	"glycogen storage disease"	""
"0000175440"	"01822"	"00235176"	"01940"	"Familial, autosomal recessive"	"5m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175441"	"01822"	"00235177"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175442"	"01822"	"00235178"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); liver/spleen involvement"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175443"	"01822"	"00235179"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; died"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175444"	"01822"	"00235180"	"01940"	"Familial, autosomal recessive"	""	"age onset 2m/2m; age analysis 6m/5m; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638); no respiratory problems (-HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175445"	"01822"	"00235181"	"01940"	"Familial, autosomal recessive"	"3m"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175446"	"01822"	"00235182"	"01940"	"Familial, autosomal recessive"	"60y"	"no cardiomyopathy (-HP:0001638); mobility problem (HP:0100022)"	"53y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175447"	"01822"	"00235183"	"01940"	"Familial, autosomal recessive"	"14y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	">2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175448"	"01822"	"00235184"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175449"	"01822"	"00235185"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175450"	"01822"	"00235186"	"01940"	"Familial, autosomal recessive"	"23y"	"no ventilatory support (-HP:0002093)"	"21y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175451"	"01822"	"00235187"	"01940"	"Familial, autosomal recessive"	"34y"	"age onset unknown; respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175452"	"01822"	"00235188"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175453"	"01822"	"00235189"	"01940"	"Familial, autosomal recessive"	""	"age onset 27y/6y; age analysis 29y/31y; not wheelchair bound (-HP:0002540)/not wheelchair bound (-HP:0002540); MRI:mild/MRI:moderate"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ Adult (1)"	"glycogen storage disease"	""
"0000175454"	"01822"	"00235190"	"01940"	"Familial, autosomal recessive"	""	"age onset 14y/5y; age analysis 20y/11y; valvular myopathy (2); respiratory problems (HP:0002795)/respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175455"	"01822"	"00235191"	"01940"	"Familial, autosomal recessive"	"10y"	"no cardiomyopathy (-HP:0001638); kyphosis/scoliosis (HP:0010674)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175456"	"01822"	"00235192"	"01940"	"Familial, autosomal recessive"	"9m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175457"	"01822"	"00235193"	"01940"	"Familial, autosomal recessive"	""	"died at <18.7m; cardiomyopathy (HP:0001638)"	"3m14d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175458"	"01822"	"00235194"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175459"	"01822"	"00235195"	"01940"	"Familial, autosomal recessive"	""	"died at 5y; cardiomyopathy (HP:0001638); liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"1y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175460"	"01822"	"00235196"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown"	"<2y"	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175461"	"01822"	"00235197"	"01940"	"Familial, autosomal recessive"	""	"died"	"7m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175462"	"01822"	"00235198"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175463"	"01822"	"00235199"	"01940"	"Familial, autosomal recessive"	""	"age onset 11-14m; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175464"	"01822"	"00235200"	"01940"	"Familial, autosomal recessive"	"28y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"23y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175465"	"01822"	"00235201"	"01940"	"Familial, autosomal recessive"	""	"died at 4y4m; ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175466"	"01822"	"00235202"	"01940"	"Familial, autosomal recessive"	""	"age onset 1.2y/10y; age analysis 3y/30y; ventilatory support (HP:0002093)/no ventilatory support (-HP:0002093); respiratory problems (HP:0002795)/unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175467"	"01822"	"00235203"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; kyphosis/scoliosis (HP:0010674); scapular winging (HP:0003691)"	"10y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175468"	"01822"	"00235204"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175469"	"01822"	"00235205"	"01940"	"Familial, autosomal recessive"	"3y6m"	"no ventilatory support (-HP:0002093)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175470"	"01822"	"00235206"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); liver/spleen involvement"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175471"	"01822"	"00235207"	"01940"	"Familial, autosomal recessive"	"<10m"	"cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"<7m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175472"	"01822"	"00235208"	"01940"	"Familial, autosomal recessive"	"3m"	"cardiomyopathy (HP:0001638); supplemental oxygen"	"<3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175473"	"01822"	"00235209"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<12m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175474"	"01822"	"00235210"	"01940"	"Familial, autosomal recessive"	"57y"	"no cardiomyopathy (-HP:0001638); ventilatory support (HP:0002093) 7h/d; respiratory problems (HP:0002795); mobility problem (HP:0100022); no kyphosis/scoliosis (-HP:0010674)"	"36y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175475"	"01822"	"00235211"	"01940"	"Familial, autosomal recessive"	"3m14d"	"cardiomyopathy (HP:0001638)"	"<3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175476"	"01822"	"00235212"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175477"	"01822"	"00235213"	"01940"	"Familial, autosomal recessive"	""	"age onset first decade of life; died at 18y; mobility problem (HP:0100022); scapular winging (HP:0003691)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175478"	"01822"	"00235214"	"01940"	"Familial, autosomal recessive"	""	"died at 14m; cardiomyopathy (HP:0001638); liver/spleen involvement"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175479"	"01822"	"00235215"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175480"	"01822"	"00235216"	"01940"	"Familial, autosomal recessive"	""	"died at 14y; 1y-cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175481"	"01822"	"00235217"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175482"	"01822"	"00235218"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175483"	"01822"	"00235219"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175484"	"01822"	"00235220"	"01940"	"Familial, autosomal recessive"	"1m"	"cardiomyopathy (HP:0001638); liver/spleen involvement; no respiratory problems (-HP:0002795)"	"27d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175485"	"01822"	"00235221"	"01940"	"Familial, autosomal recessive"	"<1y"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175486"	"01822"	"00235222"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175487"	"01822"	"00235223"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (4); age analysis unknown (4)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175488"	"01822"	"00235224"	"01940"	"Familial, autosomal recessive"	"12d"	"cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"<10d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175489"	"01822"	"00235225"	"01940"	"Familial, autosomal recessive"	"68y"	"##"	"65y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175490"	"01822"	"00235226"	"01940"	"Familial, autosomal recessive"	""	"died at 3y; moderate left ventricular non-obstructive hypertrophy/ cardiac arhythmia; respiratory problems (HP:0002795)"	"8m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175491"	"01822"	"00235227"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175492"	"01822"	"00235228"	"01940"	"Familial, autosomal recessive"	"46y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"26y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175493"	"01822"	"00235229"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (2); age analysis unknown (2)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175494"	"01822"	"00235230"	"01940"	"Familial, autosomal recessive"	""	"age analysis 4y6m/2y; cardiomyopathy (HP:0001638)/cardiomyopathy (HP:0001638)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175495"	"01822"	"00235231"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175496"	"01822"	"00235232"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175497"	"01822"	"00235233"	"01940"	"Familial, autosomal recessive"	"30y"	"liver/spleen involvement; respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175498"	"01822"	"00235234"	"01940"	"Familial, autosomal recessive"	"9y"	"no cardiomyopathy (-HP:0001638); no respiratory problems (-HP:0002795); mobility problem (HP:0100022)"	"3y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175499"	"01822"	"00235235"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); kyphosis/scoliosis (HP:0010674)"	"17y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175500"	"01822"	"00235236"	"01940"	"Familial, autosomal recessive"	"16y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); respiratory capacity is diminished; not wheelchair bound (-HP:0002540); mobility problem (HP:0100022); no abnormal cerebral vessels (-HP:0100659)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175501"	"01822"	"00235237"	"01940"	"Familial, autosomal recessive"	""	"age onset 15y/unknown; age analysis 25y/23y; FVC in sitting/ supine position 75/65% / 57/48%; not wheelchair bound (-HP:0002540)/wheelchair bound (HP:0002540) ; mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175502"	"01822"	"00235238"	"01940"	"Familial, autosomal recessive"	""	"died at 4m14d; age onset 02m14d-03m; cardiomyopathy (HP:0001638); liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175503"	"01822"	"00235239"	"01940"	"Familial, autosomal recessive"	"2m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175504"	"01822"	"00235240"	"01940"	"Familial, autosomal recessive"	"5m14d"	"cardiomyopathy (HP:0001638)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175505"	"01822"	"00235241"	"01940"	"Familial, autosomal recessive"	""	"age onset prenatal; died; cardiomyopathy (HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175506"	"01822"	"00235242"	"01940"	"Familial, autosomal recessive"	"4m"	"cardiomyopathy (HP:0001638); liver/spleen involvement"	"3m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175507"	"01822"	"00235243"	"01940"	"Familial, autosomal recessive"	""	"died at 10m; age onset 2m14d-4m; cardiomyopathy (HP:0001638); liver/spleen involvement"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175508"	"01822"	"00235244"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175509"	"01822"	"00235245"	"01940"	"Familial, autosomal recessive"	"6y"	"no cardiomyopathy (-HP:0001638); liver/spleen involvement; ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"05y-06y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175510"	"01822"	"00235246"	"01940"	"Familial, autosomal recessive"	"5y"	"no cardiomyopathy (-HP:0001638); liver/spleen involvement"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175511"	"01822"	"00235247"	"01940"	"Familial, autosomal recessive"	""	"died at 4y; moderate left ventricular non-obstructive hypertrophy Cardiac arhythmia; respiratory problems (HP:0002795)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175512"	"01822"	"00235248"	"01940"	"Familial, autosomal recessive"	""	"died at 2y; no cardiomyopathy (-HP:0001638); liver/spleen involvement; respiratory problems (HP:0002795)"	"6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175513"	"01822"	"00235249"	"01940"	"Familial, autosomal recessive"	"12y"	"no cardiomyopathy (-HP:0001638); no liver/spleen involvement; no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691); no abnormal cerebral vessels (-HP:0100659)"	""	""	""	""	""	""	""	""	"GSD-2: asymptomatic"	"glycogen storage disease"	""
"0000175514"	"01822"	"00235250"	"01940"	"Familial, autosomal recessive"	"50y"	"age onset late teens; ventilatory support (HP:0002093); respiratory problems (HP:0002795); wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175515"	"01822"	"00235251"	"01940"	"Familial, autosomal recessive"	"27y"	"no ventilatory support (-HP:0002093); not wheelchair bound (-HP:0002540); no mobility problem (-HP:0100022); 28y-stroke (HP:0001297)"	"26y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175516"	"01822"	"00235252"	"01940"	"Familial, autosomal recessive"	"30y"	"abnormal cerebral vessels (HP:0100659)"	"26y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175517"	"01822"	"00235253"	"01940"	"Familial, autosomal recessive"	"<1y6m"	"cardiomyopathy (HP:0001638)"	"<1y"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175518"	"01822"	"00235254"	"01940"	"Familial, autosomal recessive"	"41y"	"no cardiomyopathy (-HP:0001638); mobility problem (HP:0100022); no kyphosis/scoliosis (-HP:0010674)"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175519"	"01822"	"00235255"	"01940"	"Familial, autosomal recessive"	"<6m"	"cardiomyopathy (HP:0001638); no respiratory problems (-HP:0002795)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175520"	"01822"	"00235256"	"01940"	"Familial, autosomal recessive"	""	"died at  4y2m; cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"2m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175521"	"01822"	"00235257"	"01940"	"Familial, autosomal recessive"	"6m"	"cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795)"	"<6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175522"	"01822"	"00235258"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000175523"	"01822"	"00235259"	"01940"	"Familial, autosomal recessive"	""	"age onset 18-33y; died at 44y; respiratory problems (HP:0002795)"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175524"	"01822"	"00235260"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175525"	"01822"	"00235261"	"01940"	"Familial, autosomal recessive"	""	"died at <18.7m; cardiomyopathy (HP:0001638)"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175526"	"01822"	"00235262"	"01940"	"Familial, autosomal recessive"	""	"died at 4y; cardiomyopathy (HP:0001638); no ventilatory support (-HP:0002093)"	"2y6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175527"	"01822"	"00235263"	"01940"	"Familial, autosomal recessive"	"4m"	"cardiomyopathy (HP:0001638); respiratory problems (HP:0002795)"	"1d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175528"	"01822"	"00235264"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175529"	"01822"	"00235265"	"01940"	"Familial, autosomal recessive"	""	"NBS; cardiomyopathy (HP:0001638)"	"<1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175530"	"01822"	"00235266"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; respiratory problems (HP:0002795)"	"8y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175531"	"01822"	"00235267"	"01940"	"Familial, autosomal recessive"	"14y"	"no ventilatory support (-HP:0002093)"	"8y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175532"	"01822"	"00235268"	"01940"	"Familial, autosomal recessive"	"11y"	"no cardiomyopathy (-HP:0001638)"	"9y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175533"	"01822"	"00235269"	"01940"	"Familial, autosomal recessive"	"15y"	"ventilatory support (HP:0002093) at night; respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"9y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175534"	"01822"	"00235270"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638); not wheelchair bound (-HP:0002540); mobility problem (HP:0100022)"	"1y9m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175535"	"01822"	"00235271"	"01940"	"Familial, autosomal recessive"	""	"died at 1y2m; cardiomyopathy (HP:0001638); liver/spleen involvement; respiratory problems (HP:0002795)"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175536"	"01822"	"00235272"	"01940"	"Familial, autosomal recessive"	""	"died at 4m; cardiomyopathy (HP:0001638)"	"15d"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175537"	"01822"	"00235273"	"01940"	"Familial, autosomal recessive"	"61y"	"ventilatory support (HP:0002093) at night; wheelchair bound (HP:0002540); mobility problem (HP:0100022)"	"40y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175538"	"01822"	"00235274"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175539"	"01822"	"00235275"	"01940"	"Familial, autosomal recessive"	"<2y6m"	"cardiomyopathy (HP:0001638); ventilatory support (HP:0002093); respiratory problems (HP:0002795); mobility problem (HP:0100022)"	"1y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175540"	"01822"	"00235276"	"01940"	"Familial, autosomal recessive"	""	"died at <18.7m; cardiomyopathy (HP:0001638)"	"5m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175541"	"01822"	"00235277"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175542"	"01822"	"00235278"	"01940"	"Familial, autosomal recessive"	"12y"	"no ventilatory support (-HP:0002093)"	"12y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175543"	"01822"	"00235279"	"01940"	"Familial, autosomal recessive"	""	"died"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175544"	"01822"	"00235280"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175545"	"01822"	"00235281"	"01940"	"Familial, autosomal recessive"	""	"age analysis 3.8-5y6m; cardiomyopathy (HP:0001638); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"6m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175546"	"01822"	"00235282"	"01940"	"Familial, autosomal recessive"	"2y"	"respiratory problems (HP:0002795)"	"10m"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175547"	"01822"	"00235283"	"01940"	"Familial, autosomal recessive"	""	"age analysis unknown; cardiomyopathy (HP:0001638)"	"<4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175548"	"01822"	"00235284"	"01940"	"Familial, autosomal recessive"	"65y"	"age onset unknown"	""	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175549"	"01822"	"00235285"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175550"	"01822"	"00235286"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; age analysis unknown"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175551"	"01822"	"00235287"	"01940"	"Familial, autosomal recessive"	"44y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); mobility problem (HP:0100022); no kyphosis/scoliosis (-HP:0010674); no ptosis (-HP:0000508); no scapular winging (-HP:0003691)"	"39y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175552"	"01822"	"00235288"	"01940"	"Familial, autosomal recessive"	"4y4m"	"cardiomyopathy (HP:0001638)"	"4m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175553"	"01822"	"00235289"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown (3); age analysis unknown (3)"	""	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175554"	"01822"	"00235290"	"01940"	"Familial, autosomal recessive"	">10y"	"age onset unknown; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: childhood or adult onset"	"glycogen storage disease"	""
"0000175555"	"01822"	"00235291"	"01940"	"Familial, autosomal recessive"	"15y"	"no cardiomyopathy (-HP:0001638); mobility problem (HP:0100022); kyphosis/scoliosis (HP:0010674)"	"4y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175556"	"01822"	"00235292"	"01940"	"Familial, autosomal recessive"	"16y"	"no cardiomyopathy (-HP:0001638); no ventilatory support (-HP:0002093); no respiratory problems (-HP:0002795); mobility problem (HP:0100022); ptosis (HP:0000508)"	"2y"	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175557"	"01822"	"00235293"	"01940"	"Familial, autosomal recessive"	"6m"	"cardiomyopathy (HP:0001638); liver/spleen involvement"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175558"	"01822"	"00235294"	"01940"	"Familial, autosomal recessive"	""	"died at 3y (2); age onset 5m-6m; moderate left ventricular non-obstructive hypertophy (2); liver/spleen involvement/liver/spleen involvement; respiratory problems (HP:0002795)/respiratory problems (HP:0002795); mobility problem (HP:0100022)/mobility problem (HP:0100022)"	""	""	""	""	""	""	""	""	"GSD-2: childhood onset"	"glycogen storage disease"	""
"0000175559"	"01822"	"00235295"	"01940"	"Familial, autosomal recessive"	""	"died at 1y; cardiomyopathy (HP:0001638); liver/spleen involvement; respiratory problems (HP:0002795)"	"1m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175560"	"01822"	"00235296"	"01940"	"Familial, autosomal recessive"	""	"died at 17m; cardiomyopathy (HP:0001638); liver/spleen involvement"	"6m"	""	""	""	""	""	""	""	"GSD-2: classic infantile onset"	"glycogen storage disease"	""
"0000175561"	"01822"	"00235297"	"01940"	"Familial, autosomal recessive"	"35y"	"ventilatory support (HP:0002093); respiratory problems (HP:0002795)"	"25y"	""	""	""	""	""	""	""	"GSD-2: adult onset"	"glycogen storage disease"	""
"0000175562"	"01822"	"00235298"	"01940"	"Familial, autosomal recessive"	""	"age onset 14-34m/unknown/unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: Childhood (1)/ unknown (2)"	"glycogen storage disease"	""
"0000175563"	"01822"	"00235299"	"01940"	"Familial, autosomal recessive"	""	"age onset unknown; NBS; no cardiomyopathy (-HP:0001638)"	""	""	""	""	""	""	""	""	"GSD-2: unknown onset"	"glycogen storage disease"	""
"0000187151"	"00198"	"00248150"	"01164"	"Unknown"	""	"HP:0011021 (Abnormality of circulating enzyme level); HP:0003236 (Elevated serum creatine phosphokinase); HP:0040081 (Abnormal levels of creatine kinase in blood)"	""	""	""	""	""	""	""	""	""	""	""
"0000209256"	"05126"	"00274311"	"00006"	"Familial, autosomal recessive"	""	"elevated CK level (1,000-2000\'s); muscle histology dystrophic (no increased glycogen observed); atrial fibrillation; ambulatory"	"35y"	""	""	""	""	""	""	""	""	"LGMD"	""
"0000209349"	"05121"	"00274406"	"00006"	"Familial, autosomal recessive"	""	"proximal muscle weakness and respiratory failure; muscle dystrophic pattern with glycogen accumulation on PAS stain; elevated CK (242 IU/L); bradycardia; familial"	"30y"	"40y"	""	""	""	""	""	""	""	"muscular dystrophy"	""
"0000209350"	"05121"	"00274407"	"00006"	"Unknown"	""	"proximal muscle weakness, scoliosis, dysphagia, and respiratory failure; elevated CK (237 IU/L); ECG or echo normal; no family history"	"6y"	"30y"	""	""	""	""	""	""	""	"muscular dystrophy"	""
"0000209351"	"05121"	"00274408"	"00006"	"Unknown"	""	"proximal muscle weakness and heart failure; muscle dystrophic pattern; elevated CK (120 IU/L); heart failure; no family history"	"8y"	"31y"	""	""	""	""	""	""	""	"muscular dystrophy"	""
"0000228713"	"00141"	"00301608"	"03678"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	""	""
"0000231532"	"04216"	"00305685"	"00006"	"Familial, autosomal recessive"	"68y"	"68y-deceased; limb-girdle weakness; 54y-non-invasive ventilation; 68y-invasiveventilation;"	"42y"	"65y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231533"	"04216"	"00305686"	"00006"	"Familial, autosomal recessive"	"66y"	"ambulatory; respiratory weakness; 58y-non-invasive ventilation; CT brain normal"	"58y"	"60y"	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231534"	"04216"	"00305687"	"00006"	"Familial, autosomal recessive"	"23y"	"ambulatory; limb-girdle weakness; no ventilation;"	"14y"	"14y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231535"	"04216"	"00305688"	"00006"	"Familial, autosomal recessive"	"56y"	"ambulatory; limb-girdle weakness, fatigue; 39y-non-invasive ventilation;"	"15y"	"44y"	"limb-girdle weakness, fatigue"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231536"	"04216"	"00305689"	"00006"	"Familial, autosomal recessive"	"55y"	"ambulatory; limb-girdle weakness, fatigue; 53y-non-invasive ventilation;"	"26y"	"52y"	"limb-girdle weakness, fatigue"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231537"	"04216"	"00305690"	"00006"	"Familial, autosomal recessive"	"65y"	"ambulatory; limb-girdle weakness; no ventilation;"	"13y"	"58y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231538"	"04216"	"00305691"	"00006"	"Familial, autosomal recessive"	"44y"	"ambulatory; limb-girdle weakness, fatigue; 32y-non-invasive ventilation;"	"14y"	"32y"	"limb-girdle weakness, fatigue"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231539"	"04216"	"00305692"	"00006"	"Familial, autosomal recessive"	""	"deceased; respiratory weakness; 42y-invasive ventilation;"	"10y"	"41y"	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231540"	"04216"	"00305693"	"00006"	"Familial, autosomal recessive"	"75y"	"wheelchair-bound; limb-girdle weakness; no ventilation; MRI brain atrophy, mild microvascular white matter lesions"	"49y"	"61y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231541"	"04216"	"00305694"	"00006"	"Unknown"	""	"deceased; respiratory weakness; 75y-non-invasive ventilation;"	"68y"	""	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231542"	"04216"	"00305695"	"00006"	"Familial, autosomal recessive"	"45y"	"ambulatory; limb-girdle weakness; 37y-non-invasive ventilation; MRI brain normal"	"11y"	"33y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231543"	"04216"	"00305696"	"00006"	"Familial, autosomal recessive"	"27y"	"ambulatory; limb-girdle weakness; no ventilation;"	"7y"	"20y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231544"	"04216"	"00305697"	"00006"	"Familial, autosomal recessive"	"45y"	"ambulatory; limb-girdle weakness; no ventilation;"	"36y"	""	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231545"	"04216"	"00305698"	"00006"	"Unknown"	"62y"	"62y-deceased; respiratory weakness; 58y-non-invasive ventilation;"	""	"60y"	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231546"	"04216"	"00305699"	"00006"	"Familial, autosomal recessive"	"55y"	"ambulatory; respiratory weakness; 36y-non-invasive ventilation;"	"30y"	"40y"	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231547"	"04216"	"00305700"	"00006"	"Familial, autosomal recessive"	"59y"	"ambulatory; no ventilation; MRI brain normal"	"52y"	"44y"	""	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231548"	"04216"	"00305701"	"00006"	"Familial, autosomal recessive"	"64y"	"ambulatory; respiratory weakness, limb-girdle weakness; no ventilation; MRI brain normal"	"51y"	"53y"	"respiratory weakness, limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231549"	"04216"	"00305702"	"00006"	"Familial, autosomal recessive"	"27y"	"ambulatory; no ventilation; MRI brain normal"	"11y"	"14y"	""	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231550"	"04216"	"00305703"	"00006"	"Familial, autosomal recessive"	"48y"	"ambulatory; respiratory weakness, limb-girdle weakness, axial weakness; no ventilation; MRI brain normal"	"35y"	"37y"	"respiratory weakness, limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231551"	"04216"	"00305704"	"00006"	"Familial, autosomal recessive"	"50y"	"ambulatory; respiratory weakness, limb-girdle weakness, axial weakness; no ventilation; MRI brain moderate ventriculomegaly"	"31y"	"40y"	"respiratory weakness, limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231552"	"04216"	"00305705"	"00006"	"Familial, autosomal recessive"	"50y"	"ambulatory; respiratory weakness, limb-girdle weakness, axial weakness; no ventilation; MRI brain normal"	"20y"	"39y"	"respiratory weakness, limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231553"	"04216"	"00305706"	"00006"	"Familial, autosomal recessive"	"47y"	"ambulatory; respiratory weakness, limb-girdle weakness, axial weakness; no ventilation; MRI brain normal"	"37y"	"36y"	"respiratory weakness, limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231554"	"04216"	"00305707"	"00006"	"Familial, autosomal recessive"	"34y"	"ambulatory; no ventilation; MRI brain normal"	"15y"	"22y"	""	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231555"	"04216"	"00305708"	"00006"	"Familial, autosomal recessive"	"15y"	"ambulatory; no ventilation; MRI brain aspecific T2 hyperintensity in right thalamus"	"7m"	"3y"	""	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231556"	"04216"	"00305709"	"00006"	"Familial, autosomal recessive"	"41y"	"ambulatory; limb-girdle weakness, respiratory weakness; no ventilation; MRI brain normal"	"17y"	"29y"	"limb-girdle weakness, respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231557"	"04216"	"00305710"	"00006"	"Familial, autosomal recessive"	"10y"	"ambulatory; respiratory weakness, limb-girdle weakness; no ventilation; MRI brain normal"	"2y6m"	"4y"	"respiratory weakness, limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231558"	"04216"	"00305711"	"00006"	"Familial, autosomal recessive"	"59y"	"ambulatory; respiratory weakness, limb-girdle weakness, axial weakness; no ventilation; MRI brain normal"	"43y"	"53y"	"respiratory weakness, limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231559"	"04216"	"00305712"	"00006"	"Familial, autosomal recessive"	"35y"	"ambulatory; respiratory weakness, limb-girdle weakness, axial weakness; no ventilation; MRI brain normal"	"28y"	"31y"	"respiratory weakness, limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231560"	"04216"	"00305713"	"00006"	"Familial, autosomal recessive"	"23y"	"ambulatory; limb-girdle weakness; no ventilation; MRI brain normal"	"9m"	"4y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231561"	"04216"	"00305714"	"00006"	"Familial, autosomal recessive"	"63y"	"ambulatory; respiratory weakness; 40y-non-invasive ventilation; MRI brain vertebrobasilar dolichoextasia, hypointensities in basal ganglia (SWI)"	"39y"	"51y"	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231562"	"04216"	"00305715"	"00006"	"Familial, autosomal recessive"	"50y"	"ambulatory; limb-girdle weakness; no ventilation; MRI brain normal"	"35y"	"38y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231563"	"04216"	"00305716"	"00006"	"Familial, autosomal recessive"	"73y"	"ambulatory; limb-girdle weakness; no ventilation;"	"28y"	"61y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231564"	"04216"	"00305717"	"00006"	"Familial, autosomal recessive"	"63y"	"ambulatory; limb-girdle weakness; no ventilation; CT brain normal"	"44y"	"52y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231565"	"04216"	"00305718"	"00006"	"Familial, autosomal recessive"	"68y"	"ambulatory; limb-girdle weakness, ptosis left side; 60y-non-invasive ventilation; MRI brain aneurysm right vertebral artery"	"45y"	"66y"	"limb-girdle weakness, ptosis left side"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231566"	"04216"	"00305719"	"00006"	"Familial, autosomal recessive"	"78y"	"78y-deceased; limb-girdle weakness, axial weakness; 72y-non-invasive ventilation; CT brain vascular leukoencephalopathy"	"44y"	"72y"	"limb-girdle weakness, axial weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231567"	"04216"	"00305720"	"00006"	"Familial, autosomal recessive"	"47y"	"ambulatory; limb-girdle weakness; no ventilation; MRI brain multiple small aneurysms (right internal carotid artery, left anterior cerebral artery)"	"25y"	"36y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231568"	"04216"	"00305721"	"00006"	"Familial, autosomal recessive"	"45y"	"ambulatory; limb-girdle weakness; no ventilation; MRI brain normal"	"17y"	"35y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231569"	"04216"	"00305722"	"00006"	"Familial, autosomal recessive"	"41y"	"ambulatory; hyperCKemia, fatigue; no ventilation; MRI brain normal"	"27y"	"31y"	"hyperCKemia, fatigue"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231570"	"04216"	"00305723"	"00006"	"Familial, autosomal recessive"	"49y"	"ambulatory; limb-girdle weakness; no ventilation; MRI brain normal"	"42y"	"41y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231571"	"04216"	"00305724"	"00006"	"Familial, autosomal recessive"	"35y"	"ambulatory; limb-girdle weakness; no ventilation; MRI brain normal"	"18y"	"32y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231572"	"04216"	"00305725"	"00006"	"Familial, autosomal recessive"	"55y"	"ambulatory; limb-girdle weakness; 53y-non-invasive ventilation; MRI brain normal"	"42y"	"53y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231573"	"04216"	"00305726"	"00006"	"Familial, autosomal recessive"	"59y"	"ambulatory; limb-girdle weakness; no ventilation;"	"51y"	"53y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231574"	"04216"	"00305727"	"00006"	"Familial, autosomal recessive"	"63y"	"ambulatory; limb-girdle weakness; no ventilation;"	"25y"	"54y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231575"	"04216"	"00305728"	"00006"	"Familial, autosomal recessive"	"62y"	"ambulatory; limb-girdle weakness; no ventilation;"	"44y"	"51y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231576"	"04216"	"00305729"	"00006"	"Familial, autosomal recessive"	"65y"	"65y-deceased; limb-girdle weakness, respiratory weakness; 55y-non-invasive ventilation; CT brain normal"	"44y"	"57y"	"limb-girdle weakness, respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231577"	"04216"	"00305730"	"00006"	"Familial, autosomal recessive"	"58y"	"ambulatory; limb-girdle weakness; 54y-non-invasive ventilation;"	"27y"	"51y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231578"	"04216"	"00305731"	"00006"	"Familial, autosomal recessive"	"53y"	"ambulatory; limb-girdle weakness; 41y-non-invasive ventilation; CT brain normal"	"29y"	"42y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231579"	"04216"	"00305732"	"00006"	"Familial, autosomal recessive"	"46y"	"ambulatory; limb-girdle weakness; 38y-non-invasive ventilation; MRI brain normal"	"9y"	"34y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231580"	"04216"	"00305733"	"00006"	"Familial, autosomal recessive"	"45y"	"ambulatory; respiratory weakness; no ventilation; MRI brain vertebrobasilar dolichoextasia"	"20y"	"43y"	"respiratory weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231581"	"04216"	"00305734"	"00006"	"Familial, autosomal recessive"	"40y"	"ambulatory; limb-girdle weakness; 37y-non-invasive ventilation;"	"36y"	"38y"	"limb-girdle weakness"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000231582"	"04216"	"00305735"	"00006"	"Familial, autosomal recessive"	"21y"	"ambulatory; limb-girdle weakness, fatigue; no ventilation;"	"18y"	"21y"	"limb-girdle weakness, fatigue"	""	""	""	""	""	"GSD2"	"late-onset Pompe disease"	""
"0000269530"	"00198"	"00374320"	"00006"	"Familial, autosomal recessive"	""	"Floppiness, global developmental delay, brisk deep tendon reflex, head lag, plagiocephaly, bilateral subdural hydroma and hypoxic ischemic encephalopathy."	""	""	""	""	""	""	""	""	""	"developmental delay"	""
"0000274664"	"01822"	"00380811"	"00000"	"Familial"	""	"DD; ID; microcephaly; lactic acidosis (Multiple systems)"	""	""	""	""	""	""	""	""	"Pompe disease"	""	""
"0000281597"	"02492"	"00388003"	"04146"	"Familial, autosomal recessive"	"12y"	"HP:0003701 (proximal muscle weakness), HP:0030234 (highly elevated creatine kinase, 7646 U/L); difficulty getting up from ground and climbing stairs, calf hypertrophy; most-affected muscles hip and knee extensors, ankle dorsiflexors; no cardiac involvement; 12y-ambulant"	"11y"	""	""	"IHC no SGCB"	""	""	""	""	"LGMD2E"	"limb-girdle muscular dystrophy"	""
"0000282211"	"00244"	"00388671"	"00006"	"Familial, autosomal recessive"	"38y"	"distal muscle weakness, proximal muscle weakness; CK level 1197 IU/L; difficulty getting up from ground followed by breathing difficulty, Respiratory muscles weakness; Most-affected muscles: Hip extensors and respiratory muscles"	"35y"	""	""	""	""	""	""	""	""	""	""
"0000282212"	"00244"	"00388672"	"00006"	"Familial, autosomal recessive"	"38y"	"proximal muscle weakness; CK level 1141 IU/L; difficulty getting up from ground followed by breathing difficulty, Respiratory muscles weakness; Most-affected muscles: Hip extensors and respiratory muscles"	"26y"	""	""	""	""	""	""	""	""	""	""
"0000282231"	"00244"	"00388691"	"00006"	"Familial, autosomal recessive"	"24y"	"proximal muscle weakness; CK level 10500 IU/L; Difficulty running, change in gait, wasting of calves, biceps lump; Most-affected muscles: Gastrocnemius, Iliopsoas, hip adductors, hamstrings and quadriceps; no cardiac involvement; 24y-ambulant"	"19y"	""	""	"IHC no DYSF"	""	""	""	""	""	""	""
"0000297542"	"01822"	"00404984"	"00006"	"Familial, autosomal recessive"	"20y"	"see paper; ..."	"18y"	""	""	""	""	""	""	""	"GSD2"	"anterior horn cell disease with hyperactive tendon reflexes"	""
"0000297543"	"01822"	"00404985"	"00006"	"Familial, autosomal recessive"	"22y"	"see paper; ..."	"13y"	""	""	""	""	""	""	""	"GSD2"	"rigid spine syndrome with respiratory involvement"	""
"0000297544"	"01822"	"00404986"	"00006"	"Familial, autosomal recessive"	"50y"	"see paper; ..."	"20y"	""	""	""	""	""	""	""	"GSD2"	"limb-girdle muscle weakness with recurrent exacerbations and ocular findings"	""
"0000297545"	"01822"	"00404987"	"00006"	"Familial, autosomal recessive"	"25y"	"see paper; ..."	"8y"	""	""	""	""	""	""	""	"GSD2"	"large fibre symmetrical peripheral neuropathy"	""
"0000297546"	"01822"	"00404988"	"00006"	"Familial, autosomal recessive"	"35y"	"see paper; ..."	"25y"	""	""	""	""	""	""	""	"GSD2"	"limb girdle weakness with early respiratory muscle involvement"	""
"0000305086"	"00244"	"00413105"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"Pompe disease"	"LGMD, dyspnea"	""
"0000305116"	"00244"	"00413135"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	"Pompe disease"	"limb-girdle muscular weakness, dyspnea"	""
"0000305429"	"05324"	"00413456"	"00006"	"Familial, X-linked recessive"	"00y02m"	"see paper; ..., born 38w, weight 3800g; 2m-blood test jaundice accidentally detected extremely high serum CK level (5,480∼11,880 U/L), no respiratory distress, no muscle weakness, no feeding difficulties, no failure to thrive"	""	""	""	""	""	""	""	""	"DMD"	"Duchenne muscular dystrophy"	""
"0000305430"	"05324"	"00413456"	"00006"	"Familial, autosomal recessive"	"00y02m"	"see paper;  GAA activity extremely low level (2.72 nmol/1 h/mg)"	""	""	""	""	""	""	""	""	"GSD2"	"Pompe disease"	""
"0000305431"	"05324"	"00413457"	"00006"	"Familial, X-linked recessive"	"00y02m"	"see paper; ..., born 39w, weight 3200g; hospitalized neonatal pneumonia, significantly increased CK (3,400 to 3,995 U/L); 2m-CK raised (12,408∼24,828 U/L)"	""	""	""	""	""	""	""	""	"DMD"	"Duchenne muscular dystrophy"	""
"0000305432"	"05324"	"00413457"	"00006"	"Familial, autosomal recessive"	"00y02m"	"see paper;  low blood GAA activity (9.02 nmol/1 h/mg)"	""	""	""	""	""	""	""	""	"GSD2"	"Pompe disease"	""
"0000306316"	"00198"	"00414481"	"00000"	"Familial, autosomal recessive"	"27y"	""	""	""	""	""	""	""	""	""	"Glycogen storage disease II"	""	""
"0000309938"	"00128"	"00418602"	"00006"	"Familial, autosomal recessive"	""	"failure to thrive, low weight (weight <3rd percentile, height 25th percentile); no dysmorphism; normal motor development; normal mental development; no neurological abnormalities; recurrent lower respiratory tract infections; chronic cough, pleural effusion, hilar lymphadenopathy bronchiectasis; leukocytosis, lymphocytosis; chronic diarrhea (improved after 2y), hepatomegaly; no cardiovascular abnormalities; chronic suppurative otitis media, mediastinal lymphadenopathy"	"00y00m01d"	""	""	""	""	""	""	""	""	"primary ciliary dyskinesia, cystic fibrosis primary immunodeficiency"	""
"0000309939"	"00128"	"00418603"	"00006"	"Familial, autosomal recessive"	""	"failure to thrive,low weight (weight <3rd percentile, height 10th- 25th percentile); no dysmorphism; normal motor development; normal mental development; no neurological abnormalities; recurrent lower respiratory tract infections; chronic cough, hilar lymphadenopathy; no immunological abnormalities; chronic diarrhea; no cardiovascular abnormalities; recurrent otitis media"	"00y00m01d"	""	""	""	""	""	""	""	""	"cystic fibrosis, primary immunodeficiency, malabsorption"	""
"0000318926"	"00198"	"00427980"	"00006"	"Familial, autosomal recessive"	"29y"	""	""	""	""	""	""	""	""	""	"Glycogen storage disease II"	""	""
"0000332011"	"05618"	"00442664"	"00006"	"Familial, autosomal recessive"	""	""	""	""	""	""	""	""	""	""	""	"Myopathy"	""
"0000342240"	"01473"	"00453583"	"00454"	"Familial, autosomal dominant"	""	"HP:0001324, HP:0009073, HP:0008994, HP:0000508, HP:0002015"	"35y"	"71y"	"HP:0008994"	""	""	""	""	""	"OPMD"	"LOPD"	""
"0000343198"	"05121"	"00454543"	"00006"	"Unknown"	""	"Progressive muscle weakness; no Gowers\' sign; hypertrophy gastrocnemius; limb muscle force 4; 10m walk 6 sec; elevated serum CK level (1452 U/L); ECG normal; no family history"	"7y1m"	""	""	""	""	""	""	""	"GSD2"	"BMD/DMD"	""
"0000343199"	"05121"	"00454544"	"00006"	"Familial, autosomal recessive"	""	"Limbs fatigue; no Gowers\' sign; hypertrophy gastrocnemius; limb muscle force 5; 10m walk 4.59 sec; elevated serum CK level (2572 U/L); no family history"	"9y"	""	""	""	""	""	""	""	"GSD2"	"BMD/DMD"	""
"0000344776"	"00198"	"00456257"	"00006"	"Unknown"	""	"see paper; ..."	""	""	""	""	""	""	""	""	""	"lysosomal storage disorder"	""
"0000346123"	"05126"	"00457664"	"00006"	"Familial, autosomal recessive"	""	"abnormality calf musculature; muscular dystrophy; respiratory insufficiency; abnormality eye; progressive muscle weaknes; marked deficiency of GAA enzymatic activity"	""	""	""	""	""	""	""	""	"GDS2"	"limb-girdle muscular dystrophy"	""
"0000347981"	"01273"	"00460252"	"00006"	"Unknown"	"0y-9y"	"asymptomatic, hyperCKemia; elevated CK level 900-1500 UI/L; vacuoles, glycogen storage; MRI muscle focal fat replacement medial gastrocnemiu; dried blood spot Pompe positive"	""	""	""	"IHC normal sarcolemma immunostaining"	""	""	""	""	""	"asymptomatic, hyperCKemia"	""
"0000347993"	"01273"	"00460264"	"00006"	"Unknown"	"0y-9y"	"asymptomatic, hyperCKemia; elevated CK level 400-600 UI/L; vacuoles, glycogen storage; MRI muscle normal; dried blood spot Pompe positive"	""	""	""	"IHC normal sarcolemma immunostaining"	""	""	""	""	""	"asymptomatic, hyperCKemia"	""
"0000353381"	"00244"	"00468229"	"00006"	"Unknown"	"32y"	""	""	""	""	""	""	""	""	""	""	"myopathy"	""
"0000353385"	"00244"	"00468233"	"00006"	"Unknown"	"53y"	""	""	""	""	""	""	""	""	""	""	"myopathy"	""
"0000353394"	"00244"	"00468242"	"00006"	"Unknown"	"9y"	""	""	""	""	""	""	""	""	""	""	"myopathy"	""


## Screenings ## Do not remove or alter this header ##
## Count = 1476
"{{id}}"	"{{individualid}}"	"{{variants_found}}"	"{{owned_by}}"	"{{created_by}}"	"{{created_date}}"	"{{edited_by}}"	"{{edited_date}}"	"{{Screening/Technique}}"	"{{Screening/Template}}"	"{{Screening/Tissue}}"	"{{Screening/Remarks}}"
"0000000004"	"00000004"	"1"	"00004"	""	"2012-05-11 13:18:36"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000031"	"00000031"	"1"	"00004"	""	"2012-05-11 13:18:43"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000033"	"00000033"	"1"	"00004"	""	"2012-05-11 13:18:43"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000039"	"00000039"	"1"	"00004"	""	"2012-05-11 13:18:46"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000048"	"00000048"	"1"	"00004"	""	"2012-05-11 13:18:48"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000057"	"00000057"	"1"	"00004"	""	"2012-05-11 13:18:52"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000075"	"00000075"	"1"	"00004"	""	"2012-05-11 13:19:00"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000076"	"00000076"	"1"	"00004"	""	"2012-05-11 13:19:02"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000083"	"00000083"	"1"	"00004"	""	"2012-05-11 13:19:08"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000000084"	"00000084"	"1"	"00004"	""	"2012-05-11 13:19:09"	"00006"	"2019-02-14 10:06:48"	"SEQ-NG"	"DNA"	""	""
"0000101390"	"00100967"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101391"	"00100968"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101392"	"00100969"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101393"	"00100970"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101394"	"00100971"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101395"	"00100972"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101396"	"00100973"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101397"	"00100974"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101398"	"00100975"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101399"	"00100976"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101400"	"00100977"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101401"	"00100978"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101402"	"00100979"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101403"	"00100980"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101404"	"00100981"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101405"	"00100982"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101406"	"00100983"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101407"	"00100984"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101408"	"00100985"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101409"	"00100986"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101410"	"00100987"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101411"	"00100988"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101412"	"00100989"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101413"	"00100990"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101414"	"00100991"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101415"	"00100992"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101416"	"00100993"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101417"	"00100994"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101418"	"00100995"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101419"	"00100996"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2013-07-28 09:57:18"	"SEQ"	"DNA"	""	""
"0000101420"	"00100997"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101421"	"00100998"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101422"	"00100999"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101423"	"00101000"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101424"	"00101001"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101425"	"00101002"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101426"	"00101003"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101427"	"00101004"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101428"	"00101005"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101429"	"00101006"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101430"	"00101007"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101431"	"00101008"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101432"	"00101009"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101433"	"00101010"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101434"	"00101011"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101435"	"00101012"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101436"	"00101013"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101437"	"00101014"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101438"	"00101015"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101439"	"00101016"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101440"	"00101017"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101441"	"00101018"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101442"	"00101019"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101443"	"00101020"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101444"	"00101021"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101445"	"00101022"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101446"	"00101023"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101447"	"00101024"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101448"	"00101025"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101449"	"00101026"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101450"	"00101027"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101451"	"00101028"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101452"	"00101029"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101453"	"00101030"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101454"	"00101031"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101455"	"00101032"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101456"	"00101033"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101457"	"00101034"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101458"	"00101035"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101459"	"00101036"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101460"	"00101037"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101461"	"00101038"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101464"	"00101041"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101467"	"00101044"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101468"	"00101045"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101469"	"00101046"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101470"	"00101047"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101471"	"00101048"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101472"	"00101049"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101473"	"00101050"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101474"	"00101051"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101475"	"00101052"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101476"	"00101053"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101477"	"00101054"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101478"	"00101055"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2017-03-17 19:43:50"	"SEQ;SSCA"	"DNA"	""	""
"0000101479"	"00101056"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101480"	"00101057"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101481"	"00101058"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101482"	"00101059"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101483"	"00101060"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2017-03-17 19:50:06"	"SEQ;SSCA"	"DNA"	""	""
"0000101484"	"00101061"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101485"	"00101062"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101486"	"00101063"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101487"	"00101064"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101488"	"00101065"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101489"	"00101066"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101490"	"00101067"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101491"	"00101068"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101492"	"00101069"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101493"	"00101070"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101494"	"00101071"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101495"	"00101072"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101496"	"00101073"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101497"	"00101074"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101498"	"00101075"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101499"	"00101076"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101500"	"00101077"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101501"	"00101078"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101502"	"00101079"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101503"	"00101080"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101504"	"00101081"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101505"	"00101082"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101506"	"00101083"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101507"	"00101084"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101508"	"00101085"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101509"	"00101086"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101510"	"00101087"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101511"	"00101088"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101512"	"00101089"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101513"	"00101090"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101514"	"00101091"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101515"	"00101092"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101516"	"00101093"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101517"	"00101094"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101518"	"00101095"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101519"	"00101096"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101520"	"00101097"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101521"	"00101098"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101522"	"00101099"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101523"	"00101100"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101524"	"00101101"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101525"	"00101102"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101526"	"00101103"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101527"	"00101104"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101528"	"00101105"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101529"	"00101106"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101530"	"00101107"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101531"	"00101108"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101532"	"00101109"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101533"	"00101110"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101534"	"00101111"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101535"	"00101112"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101536"	"00101113"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101537"	"00101114"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101538"	"00101115"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101539"	"00101116"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101540"	"00101117"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101541"	"00101118"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101542"	"00101119"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101543"	"00101120"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101544"	"00101121"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101545"	"00101122"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101546"	"00101123"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101547"	"00101124"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101548"	"00101125"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101549"	"00101126"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101550"	"00101127"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101551"	"00101128"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101552"	"00101129"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101553"	"00101130"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101554"	"00101131"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101555"	"00101132"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101556"	"00101133"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101557"	"00101134"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101558"	"00101135"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101559"	"00101136"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101560"	"00101137"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101561"	"00101138"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101562"	"00101139"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101563"	"00101140"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101564"	"00101141"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101565"	"00101142"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101566"	"00101143"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101567"	"00101144"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101568"	"00101145"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2017-08-10 14:26:36"	"RT-PCR;SEQ"	"DNA;RNA"	""	""
"0000101569"	"00101146"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101570"	"00101147"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101571"	"00101148"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101572"	"00101149"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101573"	"00101150"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101574"	"00101151"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101575"	"00101152"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101576"	"00101153"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101577"	"00101154"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101578"	"00101155"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101579"	"00101156"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101580"	"00101157"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101581"	"00101158"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101582"	"00101159"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101583"	"00101160"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101584"	"00101161"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101585"	"00101162"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101586"	"00101163"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101587"	"00101164"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101588"	"00101165"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101589"	"00101166"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101590"	"00101167"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101591"	"00101168"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101592"	"00101169"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101594"	"00101171"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101595"	"00101172"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101596"	"00101173"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101597"	"00101174"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101598"	"00101175"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101599"	"00101176"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101600"	"00101177"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101601"	"00101178"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101602"	"00101179"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101603"	"00101180"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101604"	"00101181"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101605"	"00101182"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101606"	"00101183"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101607"	"00101184"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101608"	"00101185"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101609"	"00101186"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101610"	"00101187"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101611"	"00101188"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101612"	"00101189"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101613"	"00101190"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	"00006"	"2011-01-24 22:25:00"	"SEQ"	"DNA"	""	""
"0000101614"	"00101191"	"1"	"01938"	"00006"	"2008-01-30 21:07:14"	""	""	"SEQ"	"DNA"	""	""
"0000101615"	"00101192"	"1"	"01941"	"01941"	"2010-04-15 20:21:23"	"01937"	"2010-04-19 03:51:36"	"SEQ"	"DNA"	""	""
"0000101616"	"00101193"	"1"	"00006"	"00006"	"2013-07-28 09:54:19"	""	""	"SEQ"	"DNA"	""	""
"0000101617"	"00101194"	"1"	"01942"	"01942"	"2017-01-27 04:12:39"	""	""	"SEQ"	"DNA"	""	""
"0000101618"	"00101195"	"1"	"01942"	"01942"	"2017-01-27 04:18:00"	""	""	"SEQ"	"DNA"	""	""
"0000101619"	"00101196"	"1"	"01942"	"01942"	"2017-01-27 04:21:05"	""	""	"SEQ"	"DNA"	""	""
"0000101620"	"00101197"	"1"	"01942"	"01942"	"2017-01-27 04:23:24"	""	""	"SEQ"	"DNA"	""	""
"0000101621"	"00101198"	"1"	"00006"	"00006"	"2017-03-17 19:52:30"	""	""	"SEQ;SSCA"	"DNA"	""	""
"0000101622"	"00101199"	"1"	"00006"	"00006"	"2017-03-17 19:56:14"	""	""	"SEQ;SSCA"	"DNA"	""	""
"0000181842"	"00180906"	"1"	"01601"	"01601"	"2018-09-10 13:45:33"	"01601"	"2018-09-10 14:16:07"	"SEQ-NG-I"	"DNA"	""	"100 genes associated with cardiac diseases"
"0000184041"	"00183081"	"1"	"01939"	"00006"	"2018-10-12 22:38:20"	""	""	"SEQ"	"DNA"	"Blood/Fibroblast"	""
"0000184042"	"00183082"	"1"	"01939"	"00006"	"2018-10-12 22:44:45"	""	""	"SEQ"	"DNA"	"Blood/Fibroblast"	""
"0000184043"	"00183083"	"1"	"01939"	"00006"	"2018-10-12 22:49:32"	""	""	"SEQ"	"DNA"	"Blood/Fibroblast"	""
"0000184044"	"00183084"	"1"	"01939"	"00006"	"2018-10-12 22:53:22"	""	""	"SEQ"	"DNA"	"Blood/Fibroblast"	""
"0000220554"	"00219483"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220560"	"00219489"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220573"	"00219502"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220622"	"00219551"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220640"	"00219569"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220646"	"00219575"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220652"	"00219581"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220653"	"00219582"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220655"	"00219584"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220676"	"00219605"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220692"	"00219621"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220693"	"00219622"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220704"	"00219633"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220705"	"00219634"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220730"	"00219659"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220731"	"00219660"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220737"	"00219666"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220748"	"00219677"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220751"	"00219680"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220787"	"00219716"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220795"	"00219724"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220807"	"00219736"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220827"	"00219756"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220834"	"00219763"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220837"	"00219766"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220841"	"00219770"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220855"	"00219784"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220867"	"00219796"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220886"	"00219815"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220888"	"00219817"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220909"	"00219838"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220925"	"00219854"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220937"	"00219866"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220942"	"00219871"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220951"	"00219880"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220953"	"00219882"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220959"	"00219888"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220961"	"00219890"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220993"	"00219922"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000220994"	"00219923"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221000"	"00219929"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221001"	"00219930"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221002"	"00219931"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221021"	"00219950"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221024"	"00219953"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221028"	"00219957"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221115"	"00220044"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221122"	"00220051"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221136"	"00220065"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221143"	"00220072"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221165"	"00220094"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221239"	"00220168"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221247"	"00220176"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221299"	"00220228"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221352"	"00220281"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221388"	"00220317"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221401"	"00220330"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221457"	"00220386"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221461"	"00220390"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221468"	"00220397"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221517"	"00220446"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221534"	"00220463"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221552"	"00220481"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221553"	"00220482"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221558"	"00220487"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221574"	"00220503"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221577"	"00220506"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221582"	"00220511"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221591"	"00220520"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221610"	"00220539"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221625"	"00220554"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221642"	"00220571"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221644"	"00220573"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221648"	"00220577"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221656"	"00220585"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221664"	"00220593"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221665"	"00220594"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221675"	"00220604"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221676"	"00220605"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221681"	"00220610"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221724"	"00220653"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221736"	"00220665"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221739"	"00220668"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221748"	"00220677"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221758"	"00220687"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221771"	"00220700"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221778"	"00220707"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221779"	"00220708"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221804"	"00220733"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221809"	"00220738"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221817"	"00220746"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221830"	"00220759"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221858"	"00220787"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221861"	"00220790"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221863"	"00220792"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221867"	"00220796"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221874"	"00220803"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221890"	"00220819"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221894"	"00220823"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221918"	"00220847"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221929"	"00220858"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221974"	"00220903"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221982"	"00220911"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000221983"	"00220912"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222003"	"00220932"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222049"	"00220978"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222076"	"00221005"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222083"	"00221012"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222099"	"00221028"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222105"	"00221034"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222125"	"00221054"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222131"	"00221060"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222155"	"00221084"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222156"	"00221085"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222162"	"00221091"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222207"	"00221136"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222219"	"00221148"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222226"	"00221155"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222228"	"00221157"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222262"	"00221191"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222265"	"00221194"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222268"	"00221197"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222272"	"00221201"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222283"	"00221212"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222287"	"00221216"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222288"	"00221217"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222353"	"00221282"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222372"	"00221301"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222377"	"00221306"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222386"	"00221315"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222405"	"00221334"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222415"	"00221344"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222437"	"00221366"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222454"	"00221383"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222478"	"00221407"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222519"	"00221448"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222520"	"00221449"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222527"	"00221456"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222541"	"00221470"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222555"	"00221484"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222564"	"00221493"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222569"	"00221498"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222582"	"00221511"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222591"	"00221520"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222592"	"00221521"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222599"	"00221528"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222600"	"00221529"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222604"	"00221533"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222606"	"00221535"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222653"	"00221582"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222668"	"00221597"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222694"	"00221623"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222705"	"00221634"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222723"	"00221652"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222753"	"00221682"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222757"	"00221686"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222777"	"00221706"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222806"	"00221735"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222808"	"00221737"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222814"	"00221743"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222831"	"00221760"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222838"	"00221767"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222864"	"00221793"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222880"	"00221809"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222914"	"00221843"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222916"	"00221845"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222922"	"00221851"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222938"	"00221867"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222949"	"00221878"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222971"	"00221900"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000222993"	"00221922"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223005"	"00221934"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223017"	"00221946"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223022"	"00221951"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223061"	"00221990"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223090"	"00222019"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223094"	"00222023"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223101"	"00222030"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223132"	"00222061"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223145"	"00222074"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223146"	"00222075"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223149"	"00222078"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223157"	"00222086"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223180"	"00222109"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223182"	"00222111"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223203"	"00222132"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223208"	"00222137"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223209"	"00222138"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223229"	"00222158"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223253"	"00222182"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223279"	"00222208"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223281"	"00222210"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223300"	"00222229"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223304"	"00222233"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223309"	"00222238"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223310"	"00222239"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223314"	"00222243"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223337"	"00222266"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223342"	"00222271"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223350"	"00222279"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223401"	"00222330"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223424"	"00222353"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223427"	"00222356"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223434"	"00222363"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223441"	"00222370"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223444"	"00222373"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223451"	"00222380"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223455"	"00222384"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223461"	"00222390"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223465"	"00222394"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223474"	"00222403"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223484"	"00222413"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223517"	"00222446"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223527"	"00222456"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223529"	"00222458"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223535"	"00222464"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223546"	"00222475"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223569"	"00222498"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223586"	"00222515"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223589"	"00222518"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223610"	"00222539"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223624"	"00222553"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223649"	"00222578"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223676"	"00222605"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223697"	"00222626"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223708"	"00222637"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223713"	"00222642"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223742"	"00222671"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223752"	"00222681"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223758"	"00222687"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223766"	"00222695"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223780"	"00222709"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223787"	"00222716"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000223813"	"00222742"	"1"	"00430"	"00006"	"2019-02-06 14:15:12"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"targeted gene panel"
"0000229758"	"00228668"	"1"	"00006"	"00006"	"2019-03-23 20:10:49"	""	""	"SEQ"	"DNA"	""	""
"0000235579"	"00234476"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235580"	"00234477"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235581"	"00234478"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235582"	"00234479"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235583"	"00234480"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235584"	"00234481"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235585"	"00234482"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235586"	"00234483"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235587"	"00234484"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235588"	"00234485"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235589"	"00234486"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235590"	"00234487"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235591"	"00234488"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235592"	"00234489"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235593"	"00234490"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235594"	"00234491"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235595"	"00234492"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235596"	"00234493"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235597"	"00234494"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235598"	"00234495"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235599"	"00234496"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235600"	"00234497"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235601"	"00234498"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235602"	"00234499"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235603"	"00234500"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235604"	"00234501"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235605"	"00234502"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235606"	"00234503"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235607"	"00234504"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235608"	"00234505"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235609"	"00234506"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235610"	"00234507"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235611"	"00234508"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235612"	"00234509"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235613"	"00234510"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235614"	"00234511"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235615"	"00234512"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235616"	"00234513"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235617"	"00234514"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235618"	"00234515"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235619"	"00234516"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235620"	"00234517"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235621"	"00234518"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235622"	"00234519"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235623"	"00234520"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235624"	"00234521"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235625"	"00234522"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235626"	"00234523"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235627"	"00234524"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235628"	"00234525"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235629"	"00234526"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235630"	"00234527"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235631"	"00234528"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235632"	"00234529"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235633"	"00234530"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235634"	"00234531"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235635"	"00234532"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235636"	"00234533"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235637"	"00234534"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235638"	"00234535"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235639"	"00234536"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235640"	"00234537"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235641"	"00234538"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235642"	"00234539"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235643"	"00234540"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235644"	"00234541"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235645"	"00234542"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235646"	"00234543"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235647"	"00234544"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235648"	"00234545"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235649"	"00234546"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235650"	"00234547"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235651"	"00234548"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235652"	"00234549"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235653"	"00234550"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235654"	"00234551"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235655"	"00234552"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235656"	"00234553"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235657"	"00234554"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235658"	"00234555"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235659"	"00234556"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235660"	"00234557"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235661"	"00234558"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235662"	"00234559"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235663"	"00234560"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235664"	"00234561"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235665"	"00234562"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235666"	"00234563"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235667"	"00234564"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235668"	"00234565"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235669"	"00234566"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235670"	"00234567"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235671"	"00234568"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235672"	"00234569"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235673"	"00234570"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235674"	"00234571"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235675"	"00234572"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235676"	"00234573"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235677"	"00234574"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235678"	"00234575"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235679"	"00234576"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235680"	"00234577"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235681"	"00234578"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235682"	"00234579"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235683"	"00234580"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235684"	"00234581"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235685"	"00234582"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235686"	"00234583"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235687"	"00234584"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235688"	"00234585"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235689"	"00234586"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235690"	"00234587"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235691"	"00234588"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235692"	"00234589"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235693"	"00234590"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235694"	"00234591"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235695"	"00234592"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235696"	"00234593"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235697"	"00234594"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235698"	"00234595"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235699"	"00234596"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235700"	"00234597"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235701"	"00234598"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235702"	"00234599"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235703"	"00234600"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235704"	"00234601"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235705"	"00234602"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235706"	"00234603"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235707"	"00234604"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235708"	"00234605"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235709"	"00234606"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235710"	"00234607"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235711"	"00234608"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235712"	"00234609"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235713"	"00234610"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235714"	"00234611"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235715"	"00234612"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235716"	"00234613"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235717"	"00234614"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235718"	"00234615"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235719"	"00234616"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235720"	"00234617"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235721"	"00234618"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235722"	"00234619"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235723"	"00234620"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235724"	"00234621"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235725"	"00234622"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235726"	"00234623"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235727"	"00234624"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235728"	"00234625"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235729"	"00234626"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235730"	"00234627"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235731"	"00234628"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235732"	"00234629"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235733"	"00234630"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235734"	"00234631"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235735"	"00234632"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235736"	"00234633"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235737"	"00234634"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235738"	"00234635"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235739"	"00234636"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235740"	"00234637"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235741"	"00234638"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235742"	"00234639"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235743"	"00234640"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235744"	"00234641"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235745"	"00234642"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235746"	"00234643"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235747"	"00234644"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235748"	"00234645"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235749"	"00234646"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235750"	"00234647"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235751"	"00234648"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235752"	"00234649"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235753"	"00234650"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235754"	"00234651"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235755"	"00234652"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235756"	"00234653"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235757"	"00234654"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235758"	"00234655"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235759"	"00234656"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235760"	"00234657"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235761"	"00234658"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235762"	"00234659"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235763"	"00234660"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235764"	"00234661"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235765"	"00234662"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235766"	"00234663"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235767"	"00234664"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235768"	"00234665"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235769"	"00234666"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235770"	"00234667"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235771"	"00234668"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235772"	"00234669"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235773"	"00234670"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235774"	"00234671"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235775"	"00234672"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235776"	"00234673"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235777"	"00234674"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235778"	"00234675"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235779"	"00234676"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235780"	"00234677"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235781"	"00234678"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235782"	"00234679"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235783"	"00234680"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235784"	"00234681"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235785"	"00234682"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235786"	"00234683"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235787"	"00234684"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235788"	"00234685"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235789"	"00234686"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235790"	"00234687"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235791"	"00234688"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235792"	"00234689"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235793"	"00234690"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235794"	"00234691"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235795"	"00234692"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235796"	"00234693"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235797"	"00234694"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235798"	"00234695"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235799"	"00234696"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235800"	"00234697"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235801"	"00234698"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235802"	"00234699"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235803"	"00234700"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235804"	"00234701"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235805"	"00234702"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235806"	"00234703"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235807"	"00234704"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235808"	"00234705"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235809"	"00234706"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235810"	"00234707"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235811"	"00234708"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235812"	"00234709"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235813"	"00234710"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235814"	"00234711"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235815"	"00234712"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235816"	"00234713"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235817"	"00234714"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235818"	"00234715"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235819"	"00234716"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235820"	"00234717"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235821"	"00234718"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235822"	"00234719"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235823"	"00234720"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235824"	"00234721"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235825"	"00234722"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235826"	"00234723"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235827"	"00234724"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235828"	"00234725"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235829"	"00234726"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235830"	"00234727"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235831"	"00234728"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235832"	"00234729"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235833"	"00234730"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235834"	"00234731"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235835"	"00234732"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235836"	"00234733"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235837"	"00234734"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235838"	"00234735"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235839"	"00234736"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235840"	"00234737"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235841"	"00234738"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235842"	"00234739"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235843"	"00234740"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235844"	"00234741"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235845"	"00234742"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235846"	"00234743"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235847"	"00234744"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235848"	"00234745"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235849"	"00234746"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235850"	"00234747"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235851"	"00234748"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235852"	"00234749"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235853"	"00234750"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235854"	"00234751"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235855"	"00234752"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235856"	"00234753"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235857"	"00234754"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235858"	"00234755"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235859"	"00234756"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235860"	"00234757"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235861"	"00234758"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235862"	"00234759"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235863"	"00234760"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235864"	"00234761"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235865"	"00234762"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235866"	"00234763"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235867"	"00234764"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235868"	"00234765"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235869"	"00234766"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235870"	"00234767"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235871"	"00234768"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235872"	"00234769"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235873"	"00234770"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235874"	"00234771"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235875"	"00234772"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235876"	"00234773"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235877"	"00234774"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235878"	"00234775"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235879"	"00234776"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235880"	"00234777"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235881"	"00234778"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235882"	"00234779"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235883"	"00234780"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235884"	"00234781"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235885"	"00234782"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235886"	"00234783"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235887"	"00234784"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235888"	"00234785"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235889"	"00234786"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235890"	"00234787"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235891"	"00234788"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235892"	"00234789"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235893"	"00234790"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235894"	"00234791"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235895"	"00234792"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235896"	"00234793"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235897"	"00234794"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235898"	"00234795"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235899"	"00234796"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235900"	"00234797"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235901"	"00234798"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235902"	"00234799"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235903"	"00234800"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235904"	"00234801"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235905"	"00234802"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235906"	"00234803"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235907"	"00234804"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235908"	"00234805"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235909"	"00234806"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235910"	"00234807"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235911"	"00234808"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235912"	"00234809"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235913"	"00234810"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235914"	"00234811"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235915"	"00234812"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235916"	"00234813"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235917"	"00234814"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235918"	"00234815"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235919"	"00234816"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235920"	"00234817"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235921"	"00234818"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235922"	"00234819"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235923"	"00234820"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235924"	"00234821"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235925"	"00234822"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235926"	"00234823"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235927"	"00234824"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235928"	"00234825"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235929"	"00234826"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235930"	"00234827"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235931"	"00234828"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235932"	"00234829"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235933"	"00234830"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235934"	"00234831"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235935"	"00234832"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235936"	"00234833"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235937"	"00234834"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235938"	"00234835"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235939"	"00234836"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235940"	"00234837"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235941"	"00234838"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235942"	"00234839"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235943"	"00234840"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235944"	"00234841"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235945"	"00234842"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235946"	"00234843"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235947"	"00234844"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235948"	"00234845"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235949"	"00234846"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235950"	"00234847"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235951"	"00234848"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235952"	"00234849"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235953"	"00234850"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235954"	"00234851"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235955"	"00234852"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235956"	"00234853"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235957"	"00234854"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235958"	"00234855"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235959"	"00234856"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235960"	"00234857"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235961"	"00234858"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235962"	"00234859"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235963"	"00234860"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235964"	"00234861"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235965"	"00234862"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235966"	"00234863"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235967"	"00234864"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235968"	"00234865"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235969"	"00234866"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235970"	"00234867"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235971"	"00234868"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235972"	"00234869"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235973"	"00234870"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235974"	"00234871"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235975"	"00234872"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235976"	"00234873"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235977"	"00234874"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235978"	"00234875"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235979"	"00234876"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235980"	"00234877"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235981"	"00234878"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235982"	"00234879"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235983"	"00234880"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235984"	"00234881"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235985"	"00234882"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235986"	"00234883"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235987"	"00234884"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235988"	"00234885"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235989"	"00234886"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235990"	"00234887"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235991"	"00234888"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235992"	"00234889"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235993"	"00234890"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235994"	"00234891"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235995"	"00234892"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235996"	"00234893"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235997"	"00234894"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235998"	"00234895"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000235999"	"00234896"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236000"	"00234897"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236001"	"00234898"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236002"	"00234899"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236003"	"00234900"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236004"	"00234901"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236005"	"00234902"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236006"	"00234903"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236007"	"00234904"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236008"	"00234905"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236009"	"00234906"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236010"	"00234907"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236011"	"00234908"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236012"	"00234909"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236013"	"00234910"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236014"	"00234911"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236015"	"00234912"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236016"	"00234913"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236017"	"00234914"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236018"	"00234915"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236019"	"00234916"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236020"	"00234917"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236021"	"00234918"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236022"	"00234919"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236023"	"00234920"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236024"	"00234921"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236025"	"00234922"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236026"	"00234923"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236027"	"00234924"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236028"	"00234925"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236029"	"00234926"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236030"	"00234927"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236031"	"00234928"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236032"	"00234929"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236033"	"00234930"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236034"	"00234931"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236035"	"00234932"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236036"	"00234933"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236037"	"00234934"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236038"	"00234935"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236039"	"00234936"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236040"	"00234937"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236041"	"00234938"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236042"	"00234939"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236043"	"00234940"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236044"	"00234941"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236045"	"00234942"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236046"	"00234943"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236047"	"00234944"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236048"	"00234945"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236049"	"00234946"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236050"	"00234947"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236051"	"00234948"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236052"	"00234949"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236053"	"00234950"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236054"	"00234951"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236055"	"00234952"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236056"	"00234953"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236057"	"00234954"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236058"	"00234955"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236059"	"00234956"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236060"	"00234957"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236061"	"00234958"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236062"	"00234959"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236063"	"00234960"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236064"	"00234961"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236065"	"00234962"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236066"	"00234963"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236067"	"00234964"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236068"	"00234965"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236069"	"00234966"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236070"	"00234967"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236071"	"00234968"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236072"	"00234969"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236073"	"00234970"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236074"	"00234971"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236075"	"00234972"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236076"	"00234973"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236077"	"00234974"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236078"	"00234975"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236079"	"00234976"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236080"	"00234977"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236081"	"00234978"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236082"	"00234979"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236083"	"00234980"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236084"	"00234981"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236085"	"00234982"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236086"	"00234983"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236087"	"00234984"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236088"	"00234985"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236089"	"00234986"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236090"	"00234987"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236091"	"00234988"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236092"	"00234989"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236093"	"00234990"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236094"	"00234991"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236095"	"00234992"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236096"	"00234993"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236097"	"00234994"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236098"	"00234995"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236099"	"00234996"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236100"	"00234997"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236101"	"00234998"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236102"	"00234999"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236103"	"00235000"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236104"	"00235001"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236105"	"00235002"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236106"	"00235003"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236107"	"00235004"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236108"	"00235005"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236109"	"00235006"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236110"	"00235007"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236111"	"00235008"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236112"	"00235009"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236113"	"00235010"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236114"	"00235011"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236115"	"00235012"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236116"	"00235013"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236117"	"00235014"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236118"	"00235015"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236119"	"00235016"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236120"	"00235017"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236121"	"00235018"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236122"	"00235019"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236123"	"00235020"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236124"	"00235021"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236125"	"00235022"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236126"	"00235023"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236127"	"00235024"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236128"	"00235025"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236129"	"00235026"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236130"	"00235027"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236131"	"00235028"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236132"	"00235029"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236133"	"00235030"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236134"	"00235031"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236135"	"00235032"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236136"	"00235033"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236137"	"00235034"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236138"	"00235035"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236139"	"00235036"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236140"	"00235037"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236141"	"00235038"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236142"	"00235039"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236143"	"00235040"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236144"	"00235041"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236145"	"00235042"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236146"	"00235043"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236147"	"00235044"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236148"	"00235045"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236149"	"00235046"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236150"	"00235047"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236151"	"00235048"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236152"	"00235049"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236153"	"00235050"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236154"	"00235051"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236155"	"00235052"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236156"	"00235053"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236157"	"00235054"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236158"	"00235055"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236159"	"00235056"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236160"	"00235057"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236161"	"00235058"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236162"	"00235059"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236163"	"00235060"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236164"	"00235061"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236165"	"00235062"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236166"	"00235063"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236167"	"00235064"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236168"	"00235065"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236169"	"00235066"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236170"	"00235067"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236171"	"00235068"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236172"	"00235069"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236173"	"00235070"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236174"	"00235071"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236175"	"00235072"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236176"	"00235073"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236177"	"00235074"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236178"	"00235075"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236179"	"00235076"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236180"	"00235077"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236181"	"00235078"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236182"	"00235079"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236183"	"00235080"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236184"	"00235081"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236185"	"00235082"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236186"	"00235083"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236187"	"00235084"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236188"	"00235085"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236189"	"00235086"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236190"	"00235087"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236191"	"00235088"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236192"	"00235089"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236193"	"00235090"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236194"	"00235091"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236195"	"00235092"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236196"	"00235093"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236197"	"00235094"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236198"	"00235095"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236199"	"00235096"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236200"	"00235097"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236201"	"00235098"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236202"	"00235099"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236203"	"00235100"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236204"	"00235101"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236205"	"00235102"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236206"	"00235103"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236207"	"00235104"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236208"	"00235105"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236209"	"00235106"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236210"	"00235107"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236211"	"00235108"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236212"	"00235109"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236213"	"00235110"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236214"	"00235111"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236215"	"00235112"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236216"	"00235113"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236217"	"00235114"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236218"	"00235115"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236219"	"00235116"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236220"	"00235117"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236221"	"00235118"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236222"	"00235119"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236223"	"00235120"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236224"	"00235121"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236225"	"00235122"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236226"	"00235123"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236227"	"00235124"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236228"	"00235125"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236229"	"00235126"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236230"	"00235127"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236231"	"00235128"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236232"	"00235129"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236233"	"00235130"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236234"	"00235131"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236235"	"00235132"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236236"	"00235133"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236237"	"00235134"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236238"	"00235135"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236239"	"00235136"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236240"	"00235137"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236241"	"00235138"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236242"	"00235139"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236243"	"00235140"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236244"	"00235141"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236245"	"00235142"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236246"	"00235143"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236247"	"00235144"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236248"	"00235145"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236249"	"00235146"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236250"	"00235147"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236251"	"00235148"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236252"	"00235149"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236253"	"00235150"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236254"	"00235151"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236255"	"00235152"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236256"	"00235153"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236257"	"00235154"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236258"	"00235155"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236259"	"00235156"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236260"	"00235157"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236261"	"00235158"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236262"	"00235159"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236263"	"00235160"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236264"	"00235161"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236265"	"00235162"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236266"	"00235163"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236267"	"00235164"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236268"	"00235165"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236269"	"00235166"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236270"	"00235167"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236271"	"00235168"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236272"	"00235169"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236273"	"00235170"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236274"	"00235171"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236275"	"00235172"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236276"	"00235173"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236277"	"00235174"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236278"	"00235175"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236279"	"00235176"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236280"	"00235177"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236281"	"00235178"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236282"	"00235179"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236283"	"00235180"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236284"	"00235181"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236285"	"00235182"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236286"	"00235183"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236287"	"00235184"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236288"	"00235185"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236289"	"00235186"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236290"	"00235187"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236291"	"00235188"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236292"	"00235189"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236293"	"00235190"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236294"	"00235191"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236295"	"00235192"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236296"	"00235193"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236297"	"00235194"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236298"	"00235195"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236299"	"00235196"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236300"	"00235197"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236301"	"00235198"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236302"	"00235199"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236303"	"00235200"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236304"	"00235201"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236305"	"00235202"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236306"	"00235203"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236307"	"00235204"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236308"	"00235205"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236309"	"00235206"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236310"	"00235207"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236311"	"00235208"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236312"	"00235209"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236313"	"00235210"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236314"	"00235211"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236315"	"00235212"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236316"	"00235213"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236317"	"00235214"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236318"	"00235215"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236319"	"00235216"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236320"	"00235217"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236321"	"00235218"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236322"	"00235219"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236323"	"00235220"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236324"	"00235221"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236325"	"00235222"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236326"	"00235223"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236327"	"00235224"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236328"	"00235225"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236329"	"00235226"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236330"	"00235227"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236331"	"00235228"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236332"	"00235229"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236333"	"00235230"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236334"	"00235231"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236335"	"00235232"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236336"	"00235233"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236337"	"00235234"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236338"	"00235235"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236339"	"00235236"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236340"	"00235237"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236341"	"00235238"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236342"	"00235239"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236343"	"00235240"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236344"	"00235241"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236345"	"00235242"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236346"	"00235243"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236347"	"00235244"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236348"	"00235245"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236349"	"00235246"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236350"	"00235247"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236351"	"00235248"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236352"	"00235249"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236353"	"00235250"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236354"	"00235251"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236355"	"00235252"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236356"	"00235253"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236357"	"00235254"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236358"	"00235255"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236359"	"00235256"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236360"	"00235257"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236361"	"00235258"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236362"	"00235259"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236363"	"00235260"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236364"	"00235261"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236365"	"00235262"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236366"	"00235263"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236367"	"00235264"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236368"	"00235265"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236369"	"00235266"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236370"	"00235267"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236371"	"00235268"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236372"	"00235269"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236373"	"00235270"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236374"	"00235271"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236375"	"00235272"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236376"	"00235273"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236377"	"00235274"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236378"	"00235275"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236379"	"00235276"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236380"	"00235277"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236381"	"00235278"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236382"	"00235279"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236383"	"00235280"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236384"	"00235281"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236385"	"00235282"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236386"	"00235283"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236387"	"00235284"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236388"	"00235285"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236389"	"00235286"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236390"	"00235287"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236391"	"00235288"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236392"	"00235289"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236393"	"00235290"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236394"	"00235291"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236395"	"00235292"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236396"	"00235293"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236397"	"00235294"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236398"	"00235295"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236399"	"00235296"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236400"	"00235297"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236401"	"00235298"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000236402"	"00235299"	"1"	"01940"	"00006"	"2019-05-10 13:10:57"	""	""	"SEQ"	"DNA"	""	""
"0000247806"	"00246696"	"1"	"03362"	"03362"	"2019-07-16 16:38:29"	""	""	"?"	"DNA"	""	""
"0000247807"	"00246697"	"1"	"03362"	"03362"	"2019-07-16 16:58:58"	""	""	"?"	"DNA"	""	""
"0000247808"	"00246698"	"1"	"03362"	"03362"	"2019-07-16 17:44:06"	""	""	"?"	"DNA"	""	""
"0000247809"	"00246699"	"1"	"03362"	"03362"	"2019-07-16 17:48:46"	""	""	"?"	"DNA"	""	""
"0000247810"	"00246700"	"1"	"03362"	"03362"	"2019-07-16 17:52:54"	""	""	"?"	"DNA"	""	""
"0000247811"	"00246701"	"1"	"03362"	"03362"	"2019-07-16 17:56:49"	""	""	"?"	"DNA"	""	""
"0000247812"	"00246702"	"1"	"03362"	"03362"	"2019-07-16 18:01:02"	""	""	"?"	"DNA"	""	""
"0000247813"	"00246703"	"1"	"03362"	"03362"	"2019-07-16 18:14:53"	""	""	"?"	"DNA"	""	""
"0000247814"	"00246704"	"1"	"03362"	"03362"	"2019-07-16 18:19:05"	""	""	"?"	"DNA"	""	""
"0000247815"	"00246705"	"1"	"03362"	"03362"	"2019-07-16 18:22:47"	""	""	"?"	"DNA"	""	""
"0000247816"	"00246706"	"1"	"03362"	"03362"	"2019-07-16 18:28:05"	""	""	"?"	"DNA"	""	""
"0000247817"	"00246707"	"1"	"03362"	"03362"	"2019-07-16 18:32:43"	""	""	"?"	"DNA"	""	""
"0000247818"	"00246708"	"1"	"03362"	"03362"	"2019-07-16 18:36:20"	""	""	"?"	"DNA"	""	""
"0000247819"	"00246709"	"1"	"03362"	"03362"	"2019-07-16 18:39:40"	""	""	"?"	"DNA"	""	""
"0000247820"	"00246710"	"1"	"03362"	"03362"	"2019-07-16 18:44:23"	""	""	"?"	"DNA"	""	""
"0000247821"	"00246711"	"1"	"03362"	"03362"	"2019-07-16 18:47:16"	""	""	"?"	"DNA"	""	""
"0000247969"	"00246859"	"1"	"03362"	"03362"	"2019-07-16 18:51:13"	""	""	"?"	"DNA"	""	""
"0000247970"	"00246860"	"1"	"03362"	"03362"	"2019-07-16 18:54:24"	""	""	"?"	"DNA"	""	""
"0000247971"	"00246861"	"1"	"03362"	"03362"	"2019-07-16 19:00:02"	""	""	"?"	"DNA"	""	""
"0000247972"	"00246862"	"1"	"03362"	"03362"	"2019-07-16 19:04:38"	""	""	"?"	"DNA"	""	""
"0000247973"	"00246863"	"1"	"03362"	"03362"	"2019-07-16 19:09:10"	""	""	"?"	"DNA"	""	""
"0000247974"	"00246864"	"1"	"03362"	"03362"	"2019-07-16 19:15:46"	""	""	"?"	"DNA"	""	""
"0000247975"	"00246865"	"1"	"03362"	"03362"	"2019-07-16 19:18:10"	""	""	"?"	"DNA"	""	""
"0000247976"	"00246866"	"1"	"03362"	"03362"	"2019-07-16 19:21:45"	""	""	"?"	"DNA"	""	""
"0000247977"	"00246867"	"1"	"03362"	"03362"	"2019-07-16 19:24:09"	""	""	"?"	"DNA"	""	""
"0000247978"	"00246868"	"1"	"03362"	"03362"	"2019-07-16 19:28:53"	""	""	"?"	"DNA"	""	""
"0000247979"	"00246869"	"1"	"03362"	"03362"	"2019-07-16 19:31:53"	""	""	"?"	"DNA"	""	""
"0000247980"	"00246870"	"1"	"03362"	"03362"	"2019-07-16 19:34:27"	""	""	"?"	"DNA"	""	""
"0000247981"	"00246871"	"1"	"03362"	"03362"	"2019-07-16 19:46:22"	""	""	"?"	"DNA"	""	""
"0000247982"	"00246872"	"1"	"03362"	"03362"	"2019-07-16 19:49:06"	""	""	"?"	"DNA"	""	""
"0000247983"	"00246873"	"1"	"03362"	"03362"	"2019-07-16 19:59:39"	""	""	"?"	"DNA"	""	""
"0000247984"	"00246874"	"1"	"03362"	"03362"	"2019-07-16 20:02:24"	""	""	"?"	"DNA"	""	""
"0000247985"	"00246875"	"1"	"03362"	"03362"	"2019-07-16 20:05:37"	""	""	"?"	"DNA"	""	""
"0000247987"	"00246877"	"1"	"03362"	"03362"	"2019-07-16 20:14:13"	""	""	"?"	"DNA"	""	""
"0000247988"	"00246878"	"1"	"03362"	"03362"	"2019-07-16 20:16:34"	""	""	"?"	"DNA"	""	""
"0000247989"	"00246879"	"1"	"03362"	"03362"	"2019-07-16 20:19:42"	""	""	"?"	"DNA"	""	""
"0000247990"	"00246880"	"1"	"03362"	"03362"	"2019-07-16 20:24:11"	""	""	"?"	"DNA"	""	""
"0000247991"	"00246881"	"1"	"03362"	"03362"	"2019-07-16 20:27:20"	""	""	"?"	"DNA"	""	""
"0000247992"	"00246882"	"1"	"03362"	"03362"	"2019-07-16 20:29:22"	""	""	"?"	"DNA"	""	""
"0000247993"	"00246883"	"1"	"03362"	"03362"	"2019-07-16 20:31:47"	""	""	"?"	"DNA"	""	""
"0000247994"	"00246884"	"1"	"03362"	"03362"	"2019-07-16 20:34:40"	""	""	"?"	"DNA"	""	""
"0000247995"	"00246885"	"1"	"03362"	"03362"	"2019-07-16 20:37:38"	""	""	"?"	"DNA"	""	""
"0000247996"	"00246886"	"1"	"03362"	"03362"	"2019-07-16 20:41:11"	""	""	"?"	"DNA"	""	""
"0000247997"	"00246887"	"1"	"03362"	"03362"	"2019-07-16 20:43:58"	""	""	"?"	"DNA"	""	""
"0000247998"	"00246888"	"1"	"03362"	"03362"	"2019-07-16 20:46:22"	""	""	"?"	"DNA"	""	""
"0000247999"	"00246889"	"1"	"03362"	"03362"	"2019-07-16 20:48:39"	""	""	"?"	"DNA"	""	""
"0000248000"	"00246891"	"1"	"03362"	"03362"	"2019-07-16 20:51:59"	""	""	"?"	"DNA"	""	""
"0000248001"	"00246893"	"1"	"03362"	"03362"	"2019-07-16 20:54:07"	""	""	"?"	"DNA"	""	""
"0000248003"	"00246894"	"1"	"03362"	"03362"	"2019-07-16 20:56:28"	""	""	"?"	"DNA"	""	""
"0000248004"	"00246895"	"1"	"03362"	"03362"	"2019-07-16 20:59:06"	""	""	"?"	"DNA"	""	""
"0000248005"	"00246896"	"1"	"03362"	"03362"	"2019-07-16 21:01:56"	""	""	"?"	"DNA"	""	""
"0000248006"	"00246897"	"1"	"03362"	"03362"	"2019-07-16 21:04:32"	""	""	"?"	"DNA"	""	""
"0000248007"	"00246899"	"1"	"03362"	"03362"	"2019-07-16 21:07:28"	""	""	"?"	"DNA"	""	""
"0000249255"	"00248150"	"1"	"01164"	"01164"	"2019-07-19 11:43:22"	""	""	"SEQ-NG-S"	"DNA"	""	""
"0000275467"	"00274311"	"1"	"00006"	"00006"	"2019-12-28 16:38:54"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000275565"	"00274406"	"1"	"00006"	"00006"	"2019-12-30 09:59:36"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"69-gene panel muscular disorder"
"0000275566"	"00274407"	"1"	"00006"	"00006"	"2019-12-30 09:59:36"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"69-gene panel muscular disorder"
"0000275567"	"00274408"	"1"	"00006"	"00006"	"2019-12-30 09:59:36"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"69-gene panel muscular disorder"
"0000293042"	"00291874"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293043"	"00291875"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293044"	"00291876"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293045"	"00291877"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293046"	"00291878"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293047"	"00291879"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000293048"	"00291880"	"1"	"03575"	"00006"	"2020-03-11 19:30:02"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000296692"	"00295523"	"1"	"03625"	"03625"	"2020-03-16 03:51:21"	""	""	"SEQ"	"DNA"	""	""
"0000296696"	"00295526"	"1"	"03625"	"03625"	"2020-03-17 02:37:29"	""	""	"SEQ"	"DNA"	""	""
"0000296697"	"00295527"	"1"	"03625"	"03625"	"2020-03-17 02:41:44"	""	""	"SEQ"	"DNA"	""	""
"0000302733"	"00301608"	"1"	"03678"	"03678"	"2020-05-19 11:28:44"	""	""	"SEQ-NG"	"DNA"	""	""
"0000305736"	"00304607"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000305737"	"00304608"	"1"	"03575"	"00006"	"2020-06-24 11:55:42"	""	""	"arraySNP"	"DNA"	""	"Infinium Global Screening Array v1.0"
"0000306814"	"00305685"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306815"	"00305686"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306816"	"00305687"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306817"	"00305688"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306818"	"00305689"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306819"	"00305690"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306820"	"00305691"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306821"	"00305692"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306822"	"00305693"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306823"	"00305694"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306824"	"00305695"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306825"	"00305696"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306826"	"00305697"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306827"	"00305698"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306828"	"00305699"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306829"	"00305700"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306830"	"00305701"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306831"	"00305702"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306832"	"00305703"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306833"	"00305704"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306834"	"00305705"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306835"	"00305706"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306836"	"00305707"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306837"	"00305708"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306838"	"00305709"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306839"	"00305710"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306840"	"00305711"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306841"	"00305712"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306842"	"00305713"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306843"	"00305714"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306844"	"00305715"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306845"	"00305716"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306846"	"00305717"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306847"	"00305718"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306848"	"00305719"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306849"	"00305720"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306850"	"00305721"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306851"	"00305722"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306852"	"00305723"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306853"	"00305724"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306854"	"00305725"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306855"	"00305726"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306856"	"00305727"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306857"	"00305728"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306858"	"00305729"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306859"	"00305730"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306860"	"00305731"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306861"	"00305732"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306862"	"00305733"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306863"	"00305734"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000306864"	"00305735"	"1"	"00006"	"00006"	"2020-07-01 13:40:43"	""	""	"SEQ"	"DNA"	""	""
"0000307863"	"00306730"	"1"	"00766"	"00766"	"2020-07-17 06:59:35"	""	""	"expr"	"DNA;RNA;protein"	"Fibroblasts"	""
"0000307864"	"00306731"	"1"	"00766"	"00766"	"2020-07-17 07:14:24"	""	""	"expr"	"DNA;RNA;protein"	"Fibroblasts"	""
"0000307865"	"00306732"	"1"	"00766"	"00766"	"2020-07-17 07:18:58"	""	""	"expr"	"DNA;RNA;protein"	""	""
"0000307866"	"00306733"	"1"	"00766"	"00766"	"2020-07-17 07:23:09"	""	""	"expr"	"DNA;RNA;protein"	""	""
"0000308226"	"00307084"	"1"	"00766"	"00766"	"2020-07-30 16:34:53"	""	""	"RT-PCR;SEQ"	"RNA"	"Fibroblasts"	""
"0000315483"	"00314310"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315484"	"00314311"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315485"	"00314312"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315486"	"00314313"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315487"	"00314314"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315488"	"00314315"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315489"	"00314316"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315490"	"00314317"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315491"	"00314318"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315492"	"00314319"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315493"	"00314320"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000315494"	"00314321"	"1"	"00006"	"00006"	"2020-10-12 14:24:44"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000375514"	"00374320"	"1"	"00006"	"00006"	"2021-05-24 20:06:48"	""	""	"SEQ-NG"	"DNA"	""	"TruSight One panel"
"0000382025"	"00380811"	"1"	"00000"	"03840"	"2021-08-23 12:15:23"	""	""	"SEQ-NG-I"	"DNA"	""	"whole exome sequencing"
"0000389241"	"00388003"	"1"	"04146"	"04146"	"2021-11-01 18:06:32"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"WES"
"0000389913"	"00388671"	"1"	"00006"	"00006"	"2021-11-04 20:51:09"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000389914"	"00388672"	"1"	"00006"	"00006"	"2021-11-04 20:51:09"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000389933"	"00388691"	"1"	"00006"	"00006"	"2021-11-04 20:51:09"	""	""	"SEQ-NG"	"DNA"	""	"WES"
"0000406222"	"00404984"	"1"	"00006"	"00006"	"2022-03-11 16:44:58"	""	""	"SEQ"	"DNA"	""	""
"0000406223"	"00404985"	"1"	"00006"	"00006"	"2022-03-11 16:44:58"	""	""	"SEQ"	"DNA"	""	""
"0000406224"	"00404986"	"1"	"00006"	"00006"	"2022-03-11 16:44:58"	""	""	"SEQ"	"DNA"	""	""
"0000406225"	"00404987"	"1"	"00006"	"00006"	"2022-03-11 16:44:58"	""	""	"SEQ"	"DNA"	""	""
"0000406226"	"00404988"	"1"	"00006"	"00006"	"2022-03-11 16:44:58"	""	""	"SEQ"	"DNA"	""	""
"0000414375"	"00413105"	"1"	"00006"	"00006"	"2022-07-11 16:33:01"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000414405"	"00413135"	"1"	"00006"	"00006"	"2022-07-11 16:33:01"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000414735"	"00413456"	"1"	"00006"	"00006"	"2022-07-18 21:04:14"	""	""	"SEQ"	"DNA"	""	""
"0000414736"	"00413457"	"1"	"00006"	"00006"	"2022-07-18 21:04:14"	""	""	"SEQ"	"DNA"	""	""
"0000415761"	"00414481"	"1"	"00000"	"03840"	"2022-07-28 13:16:36"	""	""	"SEQ-NG-I"	"DNA"	"blood"	""
"0000419897"	"00418602"	"1"	"00006"	"00006"	"2022-10-01 10:38:21"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000419898"	"00418603"	"1"	"00006"	"00006"	"2022-10-01 10:38:21"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000428297"	"00426977"	"1"	"00006"	"00006"	"2022-12-04 11:25:02"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"custom gene panel"
"0000428298"	"00426978"	"1"	"00006"	"00006"	"2022-12-04 11:25:02"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"custom gene panel"
"0000428372"	"00427052"	"1"	"00006"	"00006"	"2022-12-04 12:45:35"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"custom gene panel"
"0000428373"	"00427053"	"1"	"00006"	"00006"	"2022-12-04 12:45:35"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"custom gene panel"
"0000428374"	"00427054"	"1"	"00006"	"00006"	"2022-12-04 12:45:35"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"custom gene panel"
"0000429393"	"00427980"	"1"	"00006"	"00006"	"2022-12-19 13:11:26"	""	""	"RT-PCR;SEQ;SEQ-NG-RNA"	"DNA;RNA"	"whole blood"	"singleton WES"
"0000444148"	"00442664"	"1"	"00006"	"00006"	"2023-11-23 18:48:51"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000455196"	"00453583"	"1"	"00454"	"00454"	"2024-09-10 21:07:08"	""	""	"SEQ-NG-I"	"DNA"	"blood"	"WES, insilico gen panel"
"0000456156"	"00454543"	"1"	"00006"	"00006"	"2024-09-13 17:19:08"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000456157"	"00454544"	"1"	"00006"	"00006"	"2024-09-13 17:19:08"	""	""	"MLPA;SEQ-NG"	"DNA"	""	""
"0000457874"	"00456257"	"1"	"00006"	"00006"	"2024-10-24 08:52:57"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000459284"	"00457664"	"1"	"00006"	"00006"	"2024-11-15 16:56:53"	"00006"	"2024-11-15 17:08:17"	"RT-PCR;SEQ;SEQ-NG"	"DNA;RNA"	""	""
"0000461883"	"00460252"	"1"	"00006"	"00006"	"2025-01-22 12:23:09"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000461895"	"00460264"	"1"	"00006"	"00006"	"2025-01-22 12:23:09"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"WES"
"0000469895"	"00468229"	"1"	"00006"	"00006"	"2025-11-07 14:41:52"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000469899"	"00468233"	"1"	"00006"	"00006"	"2025-11-07 14:41:52"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"
"0000469908"	"00468242"	"1"	"00006"	"00006"	"2025-11-07 14:41:52"	""	""	"SEQ;SEQ-NG"	"DNA"	""	"gene panel"


## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 1320
"{{screeningid}}"	"{{geneid}}"
"0000000004"	"ACADM"
"0000000004"	"AGL"
"0000000004"	"DPYD"
"0000000004"	"ETFB"
"0000000004"	"GAA"
"0000000004"	"HESX1"
"0000000004"	"NHLRC1"
"0000000004"	"NPHS1"
"0000000004"	"SBDS"
"0000000004"	"SLC26A2"
"0000000004"	"SMPD1"
"0000000031"	"ADA"
"0000000031"	"ATP7B"
"0000000031"	"CYP21A2"
"0000000031"	"DPYD"
"0000000031"	"ETFB"
"0000000031"	"FKTN"
"0000000031"	"GAA"
"0000000031"	"GLB1"
"0000000031"	"IGHMBP2"
"0000000031"	"NHLRC1"
"0000000031"	"NPHS1"
"0000000031"	"SERPINA1"
"0000000031"	"TMEM67"
"0000000031"	"WNT10A"
"0000000033"	"ATP7B"
"0000000033"	"CDH23"
"0000000033"	"CYP21A2"
"0000000033"	"DPYD"
"0000000033"	"ETFB"
"0000000033"	"GAA"
"0000000033"	"HADHA"
"0000000033"	"HESX1"
"0000000033"	"NHLRC1"
"0000000033"	"PHEX"
"0000000033"	"SERPINA1"
"0000000033"	"USH2A"
"0000000039"	"AHI1"
"0000000039"	"ATP7B"
"0000000039"	"DPYD"
"0000000039"	"ETFB"
"0000000039"	"GAA"
"0000000039"	"GLB1"
"0000000039"	"LAMA2"
"0000000039"	"MTHFR"
"0000000039"	"NPHP4"
"0000000039"	"NPHS1"
"0000000039"	"P3H1"
"0000000039"	"SBDS"
"0000000039"	"SLC26A2"
"0000000048"	"ATP7B"
"0000000048"	"CPT1A"
"0000000048"	"DPYD"
"0000000048"	"ETFB"
"0000000048"	"GAA"
"0000000048"	"GBA"
"0000000048"	"GLB1"
"0000000048"	"IGHMBP2"
"0000000048"	"LAMA2"
"0000000048"	"MEFV"
"0000000048"	"NHLRC1"
"0000000048"	"NPHS1"
"0000000048"	"SERPINA1"
"0000000057"	"ALDOB"
"0000000057"	"ATM"
"0000000057"	"ATP7B"
"0000000057"	"DPYD"
"0000000057"	"ERCC6"
"0000000057"	"ETFB"
"0000000057"	"GAA"
"0000000057"	"IGHMBP2"
"0000000057"	"LAMA2"
"0000000057"	"NHLRC1"
"0000000057"	"NPHS1"
"0000000057"	"SERPINA1"
"0000000075"	"ATP7B"
"0000000075"	"CDH23"
"0000000075"	"ETFB"
"0000000075"	"GAA"
"0000000075"	"HESX1"
"0000000075"	"IGHMBP2"
"0000000075"	"LAMA2"
"0000000075"	"MEFV"
"0000000075"	"NPHP4"
"0000000075"	"SERPINA1"
"0000000076"	"ATP7B"
"0000000076"	"BCKDHA"
"0000000076"	"FKRP"
"0000000076"	"GAA"
"0000000076"	"GLB1"
"0000000076"	"HSD17B4"
"0000000076"	"IGHMBP2"
"0000000076"	"MEFV"
"0000000076"	"NHLRC1"
"0000000076"	"NPHS1"
"0000000076"	"PMM2"
"0000000076"	"POMGNT1"
"0000000076"	"PPT1"
"0000000076"	"SERPINA1"
"0000000076"	"SLC26A2"
"0000000083"	"ASPA"
"0000000083"	"ATP7B"
"0000000083"	"CPT1A"
"0000000083"	"CYP27A1"
"0000000083"	"ETFB"
"0000000083"	"GAA"
"0000000083"	"NPHS1"
"0000000083"	"SERPINA1"
"0000000084"	"ADA"
"0000000084"	"CPT1A"
"0000000084"	"FKRP"
"0000000084"	"GAA"
"0000000084"	"GLB1"
"0000000084"	"MYO5A"
"0000000084"	"NHLRC1"
"0000000084"	"NPHS1"
"0000000084"	"RAG1"
"0000000084"	"SERPINA1"
"0000000084"	"SMPD1"
"0000101390"	"GAA"
"0000101391"	"GAA"
"0000101392"	"GAA"
"0000101393"	"GAA"
"0000101394"	"GAA"
"0000101395"	"GAA"
"0000101396"	"GAA"
"0000101397"	"GAA"
"0000101398"	"GAA"
"0000101399"	"GAA"
"0000101400"	"GAA"
"0000101401"	"GAA"
"0000101402"	"GAA"
"0000101403"	"GAA"
"0000101404"	"GAA"
"0000101405"	"GAA"
"0000101406"	"GAA"
"0000101407"	"GAA"
"0000101408"	"GAA"
"0000101409"	"GAA"
"0000101410"	"GAA"
"0000101411"	"GAA"
"0000101412"	"GAA"
"0000101413"	"GAA"
"0000101414"	"GAA"
"0000101415"	"GAA"
"0000101416"	"GAA"
"0000101417"	"GAA"
"0000101418"	"GAA"
"0000101419"	"GAA"
"0000101420"	"GAA"
"0000101421"	"GAA"
"0000101422"	"GAA"
"0000101423"	"GAA"
"0000101424"	"GAA"
"0000101425"	"GAA"
"0000101426"	"GAA"
"0000101427"	"GAA"
"0000101428"	"GAA"
"0000101429"	"GAA"
"0000101430"	"GAA"
"0000101431"	"GAA"
"0000101432"	"GAA"
"0000101433"	"GAA"
"0000101434"	"GAA"
"0000101435"	"GAA"
"0000101436"	"GAA"
"0000101437"	"GAA"
"0000101438"	"GAA"
"0000101439"	"GAA"
"0000101440"	"GAA"
"0000101441"	"GAA"
"0000101442"	"GAA"
"0000101443"	"GAA"
"0000101444"	"GAA"
"0000101445"	"GAA"
"0000101446"	"GAA"
"0000101447"	"GAA"
"0000101448"	"GAA"
"0000101449"	"GAA"
"0000101450"	"GAA"
"0000101451"	"GAA"
"0000101452"	"GAA"
"0000101453"	"GAA"
"0000101454"	"GAA"
"0000101455"	"GAA"
"0000101456"	"GAA"
"0000101457"	"GAA"
"0000101458"	"GAA"
"0000101459"	"GAA"
"0000101460"	"GAA"
"0000101461"	"GAA"
"0000101464"	"GAA"
"0000101467"	"GAA"
"0000101468"	"GAA"
"0000101469"	"GAA"
"0000101470"	"GAA"
"0000101471"	"GAA"
"0000101472"	"GAA"
"0000101473"	"GAA"
"0000101474"	"GAA"
"0000101475"	"GAA"
"0000101476"	"GAA"
"0000101477"	"GAA"
"0000101478"	"GAA"
"0000101479"	"GAA"
"0000101480"	"GAA"
"0000101481"	"GAA"
"0000101482"	"GAA"
"0000101483"	"GAA"
"0000101484"	"GAA"
"0000101485"	"GAA"
"0000101486"	"GAA"
"0000101487"	"GAA"
"0000101488"	"GAA"
"0000101489"	"GAA"
"0000101490"	"GAA"
"0000101491"	"GAA"
"0000101492"	"GAA"
"0000101493"	"GAA"
"0000101494"	"GAA"
"0000101495"	"GAA"
"0000101496"	"GAA"
"0000101497"	"GAA"
"0000101498"	"GAA"
"0000101499"	"GAA"
"0000101500"	"GAA"
"0000101501"	"GAA"
"0000101502"	"GAA"
"0000101503"	"GAA"
"0000101504"	"GAA"
"0000101505"	"GAA"
"0000101506"	"GAA"
"0000101507"	"GAA"
"0000101508"	"GAA"
"0000101509"	"GAA"
"0000101510"	"GAA"
"0000101511"	"GAA"
"0000101512"	"GAA"
"0000101513"	"GAA"
"0000101514"	"GAA"
"0000101515"	"GAA"
"0000101516"	"GAA"
"0000101517"	"GAA"
"0000101518"	"GAA"
"0000101519"	"GAA"
"0000101520"	"GAA"
"0000101521"	"GAA"
"0000101522"	"GAA"
"0000101523"	"GAA"
"0000101524"	"GAA"
"0000101525"	"GAA"
"0000101526"	"GAA"
"0000101527"	"GAA"
"0000101528"	"GAA"
"0000101529"	"GAA"
"0000101530"	"GAA"
"0000101531"	"GAA"
"0000101532"	"GAA"
"0000101533"	"GAA"
"0000101534"	"GAA"
"0000101535"	"GAA"
"0000101536"	"GAA"
"0000101537"	"GAA"
"0000101538"	"GAA"
"0000101539"	"GAA"
"0000101540"	"GAA"
"0000101541"	"GAA"
"0000101542"	"GAA"
"0000101543"	"GAA"
"0000101544"	"GAA"
"0000101545"	"GAA"
"0000101546"	"GAA"
"0000101547"	"GAA"
"0000101548"	"GAA"
"0000101549"	"GAA"
"0000101550"	"GAA"
"0000101551"	"GAA"
"0000101552"	"GAA"
"0000101553"	"GAA"
"0000101554"	"GAA"
"0000101555"	"GAA"
"0000101556"	"GAA"
"0000101557"	"GAA"
"0000101558"	"GAA"
"0000101559"	"GAA"
"0000101560"	"GAA"
"0000101561"	"GAA"
"0000101562"	"GAA"
"0000101563"	"GAA"
"0000101564"	"GAA"
"0000101565"	"GAA"
"0000101566"	"GAA"
"0000101567"	"GAA"
"0000101568"	"GAA"
"0000101569"	"GAA"
"0000101570"	"GAA"
"0000101571"	"GAA"
"0000101572"	"GAA"
"0000101573"	"GAA"
"0000101574"	"GAA"
"0000101575"	"GAA"
"0000101576"	"GAA"
"0000101577"	"GAA"
"0000101578"	"GAA"
"0000101579"	"GAA"
"0000101580"	"GAA"
"0000101581"	"GAA"
"0000101582"	"GAA"
"0000101583"	"GAA"
"0000101584"	"GAA"
"0000101585"	"GAA"
"0000101586"	"GAA"
"0000101587"	"GAA"
"0000101588"	"GAA"
"0000101589"	"GAA"
"0000101590"	"GAA"
"0000101591"	"GAA"
"0000101592"	"GAA"
"0000101594"	"GAA"
"0000101595"	"GAA"
"0000101596"	"GAA"
"0000101597"	"GAA"
"0000101598"	"GAA"
"0000101599"	"GAA"
"0000101600"	"GAA"
"0000101601"	"GAA"
"0000101602"	"GAA"
"0000101603"	"GAA"
"0000101604"	"GAA"
"0000101605"	"GAA"
"0000101606"	"GAA"
"0000101607"	"GAA"
"0000101608"	"GAA"
"0000101609"	"GAA"
"0000101610"	"GAA"
"0000101611"	"GAA"
"0000101612"	"GAA"
"0000101613"	"GAA"
"0000101614"	"GAA"
"0000101615"	"GAA"
"0000101616"	"GAA"
"0000101617"	"GAA"
"0000101618"	"GAA"
"0000101619"	"GAA"
"0000101620"	"GAA"
"0000101621"	"GAA"
"0000101622"	"GAA"
"0000184041"	"GAA"
"0000184042"	"GAA"
"0000184043"	"GAA"
"0000184044"	"GAA"
"0000229758"	"DMD"
"0000229758"	"GAA"
"0000235579"	"GAA"
"0000235580"	"GAA"
"0000235581"	"GAA"
"0000235582"	"GAA"
"0000235583"	"GAA"
"0000235584"	"GAA"
"0000235585"	"GAA"
"0000235586"	"GAA"
"0000235587"	"GAA"
"0000235588"	"GAA"
"0000235589"	"GAA"
"0000235590"	"GAA"
"0000235591"	"GAA"
"0000235592"	"GAA"
"0000235593"	"GAA"
"0000235594"	"GAA"
"0000235595"	"GAA"
"0000235596"	"GAA"
"0000235597"	"GAA"
"0000235598"	"GAA"
"0000235599"	"GAA"
"0000235600"	"GAA"
"0000235601"	"GAA"
"0000235602"	"GAA"
"0000235603"	"GAA"
"0000235604"	"GAA"
"0000235605"	"GAA"
"0000235606"	"GAA"
"0000235607"	"GAA"
"0000235608"	"GAA"
"0000235609"	"GAA"
"0000235610"	"GAA"
"0000235611"	"GAA"
"0000235612"	"GAA"
"0000235613"	"GAA"
"0000235614"	"GAA"
"0000235615"	"GAA"
"0000235616"	"GAA"
"0000235617"	"GAA"
"0000235618"	"GAA"
"0000235619"	"GAA"
"0000235620"	"GAA"
"0000235621"	"GAA"
"0000235622"	"GAA"
"0000235623"	"GAA"
"0000235624"	"GAA"
"0000235625"	"GAA"
"0000235626"	"GAA"
"0000235627"	"GAA"
"0000235628"	"GAA"
"0000235629"	"GAA"
"0000235630"	"GAA"
"0000235631"	"GAA"
"0000235632"	"GAA"
"0000235633"	"GAA"
"0000235634"	"GAA"
"0000235635"	"GAA"
"0000235636"	"GAA"
"0000235637"	"GAA"
"0000235638"	"GAA"
"0000235639"	"GAA"
"0000235640"	"GAA"
"0000235641"	"GAA"
"0000235642"	"GAA"
"0000235643"	"GAA"
"0000235644"	"GAA"
"0000235645"	"GAA"
"0000235646"	"GAA"
"0000235647"	"GAA"
"0000235648"	"GAA"
"0000235649"	"GAA"
"0000235650"	"GAA"
"0000235651"	"GAA"
"0000235652"	"GAA"
"0000235653"	"GAA"
"0000235654"	"GAA"
"0000235655"	"GAA"
"0000235656"	"GAA"
"0000235657"	"GAA"
"0000235658"	"GAA"
"0000235659"	"GAA"
"0000235660"	"GAA"
"0000235661"	"GAA"
"0000235662"	"GAA"
"0000235663"	"GAA"
"0000235664"	"GAA"
"0000235665"	"GAA"
"0000235666"	"GAA"
"0000235667"	"GAA"
"0000235668"	"GAA"
"0000235669"	"GAA"
"0000235670"	"GAA"
"0000235671"	"GAA"
"0000235672"	"GAA"
"0000235673"	"GAA"
"0000235674"	"GAA"
"0000235675"	"GAA"
"0000235676"	"GAA"
"0000235677"	"GAA"
"0000235678"	"GAA"
"0000235679"	"GAA"
"0000235680"	"GAA"
"0000235681"	"GAA"
"0000235682"	"GAA"
"0000235683"	"GAA"
"0000235684"	"GAA"
"0000235685"	"GAA"
"0000235686"	"GAA"
"0000235687"	"GAA"
"0000235688"	"GAA"
"0000235689"	"GAA"
"0000235690"	"GAA"
"0000235691"	"GAA"
"0000235692"	"GAA"
"0000235693"	"GAA"
"0000235694"	"GAA"
"0000235695"	"GAA"
"0000235696"	"GAA"
"0000235697"	"GAA"
"0000235698"	"GAA"
"0000235699"	"GAA"
"0000235700"	"GAA"
"0000235701"	"GAA"
"0000235702"	"GAA"
"0000235703"	"GAA"
"0000235704"	"GAA"
"0000235705"	"GAA"
"0000235706"	"GAA"
"0000235707"	"GAA"
"0000235708"	"GAA"
"0000235709"	"GAA"
"0000235710"	"GAA"
"0000235711"	"GAA"
"0000235712"	"GAA"
"0000235713"	"GAA"
"0000235714"	"GAA"
"0000235715"	"GAA"
"0000235716"	"GAA"
"0000235717"	"GAA"
"0000235718"	"GAA"
"0000235719"	"GAA"
"0000235720"	"GAA"
"0000235721"	"GAA"
"0000235722"	"GAA"
"0000235723"	"GAA"
"0000235724"	"GAA"
"0000235725"	"GAA"
"0000235726"	"GAA"
"0000235727"	"GAA"
"0000235728"	"GAA"
"0000235729"	"GAA"
"0000235730"	"GAA"
"0000235731"	"GAA"
"0000235732"	"GAA"
"0000235733"	"GAA"
"0000235734"	"GAA"
"0000235735"	"GAA"
"0000235736"	"GAA"
"0000235737"	"GAA"
"0000235738"	"GAA"
"0000235739"	"GAA"
"0000235740"	"GAA"
"0000235741"	"GAA"
"0000235742"	"GAA"
"0000235743"	"GAA"
"0000235744"	"GAA"
"0000235745"	"GAA"
"0000235746"	"GAA"
"0000235747"	"GAA"
"0000235748"	"GAA"
"0000235749"	"GAA"
"0000235750"	"GAA"
"0000235751"	"GAA"
"0000235752"	"GAA"
"0000235753"	"GAA"
"0000235754"	"GAA"
"0000235755"	"GAA"
"0000235756"	"GAA"
"0000235757"	"GAA"
"0000235758"	"GAA"
"0000235759"	"GAA"
"0000235760"	"GAA"
"0000235761"	"GAA"
"0000235762"	"GAA"
"0000235763"	"GAA"
"0000235764"	"GAA"
"0000235765"	"GAA"
"0000235766"	"GAA"
"0000235767"	"GAA"
"0000235768"	"GAA"
"0000235769"	"GAA"
"0000235770"	"GAA"
"0000235771"	"GAA"
"0000235772"	"GAA"
"0000235773"	"GAA"
"0000235774"	"GAA"
"0000235775"	"GAA"
"0000235776"	"GAA"
"0000235777"	"GAA"
"0000235778"	"GAA"
"0000235779"	"GAA"
"0000235780"	"GAA"
"0000235781"	"GAA"
"0000235782"	"GAA"
"0000235783"	"GAA"
"0000235784"	"GAA"
"0000235785"	"GAA"
"0000235786"	"GAA"
"0000235787"	"GAA"
"0000235788"	"GAA"
"0000235789"	"GAA"
"0000235790"	"GAA"
"0000235791"	"GAA"
"0000235792"	"GAA"
"0000235793"	"GAA"
"0000235794"	"GAA"
"0000235795"	"GAA"
"0000235796"	"GAA"
"0000235797"	"GAA"
"0000235798"	"GAA"
"0000235799"	"GAA"
"0000235800"	"GAA"
"0000235801"	"GAA"
"0000235802"	"GAA"
"0000235803"	"GAA"
"0000235804"	"GAA"
"0000235805"	"GAA"
"0000235806"	"GAA"
"0000235807"	"GAA"
"0000235808"	"GAA"
"0000235809"	"GAA"
"0000235810"	"GAA"
"0000235811"	"GAA"
"0000235812"	"GAA"
"0000235813"	"GAA"
"0000235814"	"GAA"
"0000235815"	"GAA"
"0000235816"	"GAA"
"0000235817"	"GAA"
"0000235818"	"GAA"
"0000235819"	"GAA"
"0000235820"	"GAA"
"0000235821"	"GAA"
"0000235822"	"GAA"
"0000235823"	"GAA"
"0000235824"	"GAA"
"0000235825"	"GAA"
"0000235826"	"GAA"
"0000235827"	"GAA"
"0000235828"	"GAA"
"0000235829"	"GAA"
"0000235830"	"GAA"
"0000235831"	"GAA"
"0000235832"	"GAA"
"0000235833"	"GAA"
"0000235834"	"GAA"
"0000235835"	"GAA"
"0000235836"	"GAA"
"0000235837"	"GAA"
"0000235838"	"GAA"
"0000235839"	"GAA"
"0000235840"	"GAA"
"0000235841"	"GAA"
"0000235842"	"GAA"
"0000235843"	"GAA"
"0000235844"	"GAA"
"0000235845"	"GAA"
"0000235846"	"GAA"
"0000235847"	"GAA"
"0000235848"	"GAA"
"0000235849"	"GAA"
"0000235850"	"GAA"
"0000235851"	"GAA"
"0000235852"	"GAA"
"0000235853"	"GAA"
"0000235854"	"GAA"
"0000235855"	"GAA"
"0000235856"	"GAA"
"0000235857"	"GAA"
"0000235858"	"GAA"
"0000235859"	"GAA"
"0000235860"	"GAA"
"0000235861"	"GAA"
"0000235862"	"GAA"
"0000235863"	"GAA"
"0000235864"	"GAA"
"0000235865"	"GAA"
"0000235866"	"GAA"
"0000235867"	"GAA"
"0000235868"	"GAA"
"0000235869"	"GAA"
"0000235870"	"GAA"
"0000235871"	"GAA"
"0000235872"	"GAA"
"0000235873"	"GAA"
"0000235874"	"GAA"
"0000235875"	"GAA"
"0000235876"	"GAA"
"0000235877"	"GAA"
"0000235878"	"GAA"
"0000235879"	"GAA"
"0000235880"	"GAA"
"0000235881"	"GAA"
"0000235882"	"GAA"
"0000235883"	"GAA"
"0000235884"	"GAA"
"0000235885"	"GAA"
"0000235886"	"GAA"
"0000235887"	"GAA"
"0000235888"	"GAA"
"0000235889"	"GAA"
"0000235890"	"GAA"
"0000235891"	"GAA"
"0000235892"	"GAA"
"0000235893"	"GAA"
"0000235894"	"GAA"
"0000235895"	"GAA"
"0000235896"	"GAA"
"0000235897"	"GAA"
"0000235898"	"GAA"
"0000235899"	"GAA"
"0000235900"	"GAA"
"0000235901"	"GAA"
"0000235902"	"GAA"
"0000235903"	"GAA"
"0000235904"	"GAA"
"0000235905"	"GAA"
"0000235906"	"GAA"
"0000235907"	"GAA"
"0000235908"	"GAA"
"0000235909"	"GAA"
"0000235910"	"GAA"
"0000235911"	"GAA"
"0000235912"	"GAA"
"0000235913"	"GAA"
"0000235914"	"GAA"
"0000235915"	"GAA"
"0000235916"	"GAA"
"0000235917"	"GAA"
"0000235918"	"GAA"
"0000235919"	"GAA"
"0000235920"	"GAA"
"0000235921"	"GAA"
"0000235922"	"GAA"
"0000235923"	"GAA"
"0000235924"	"GAA"
"0000235925"	"GAA"
"0000235926"	"GAA"
"0000235927"	"GAA"
"0000235928"	"GAA"
"0000235929"	"GAA"
"0000235930"	"GAA"
"0000235931"	"GAA"
"0000235932"	"GAA"
"0000235933"	"GAA"
"0000235934"	"GAA"
"0000235935"	"GAA"
"0000235936"	"GAA"
"0000235937"	"GAA"
"0000235938"	"GAA"
"0000235939"	"GAA"
"0000235940"	"GAA"
"0000235941"	"GAA"
"0000235942"	"GAA"
"0000235943"	"GAA"
"0000235944"	"GAA"
"0000235945"	"GAA"
"0000235946"	"GAA"
"0000235947"	"GAA"
"0000235948"	"GAA"
"0000235949"	"GAA"
"0000235950"	"GAA"
"0000235951"	"GAA"
"0000235952"	"GAA"
"0000235953"	"GAA"
"0000235954"	"GAA"
"0000235955"	"GAA"
"0000235956"	"GAA"
"0000235957"	"GAA"
"0000235958"	"GAA"
"0000235959"	"GAA"
"0000235960"	"GAA"
"0000235961"	"GAA"
"0000235962"	"GAA"
"0000235963"	"GAA"
"0000235964"	"GAA"
"0000235965"	"GAA"
"0000235966"	"GAA"
"0000235967"	"GAA"
"0000235968"	"GAA"
"0000235969"	"GAA"
"0000235970"	"GAA"
"0000235971"	"GAA"
"0000235972"	"GAA"
"0000235973"	"GAA"
"0000235974"	"GAA"
"0000235975"	"GAA"
"0000235976"	"GAA"
"0000235977"	"GAA"
"0000235978"	"GAA"
"0000235979"	"GAA"
"0000235980"	"GAA"
"0000235981"	"GAA"
"0000235982"	"GAA"
"0000235983"	"GAA"
"0000235984"	"GAA"
"0000235985"	"GAA"
"0000235986"	"GAA"
"0000235987"	"GAA"
"0000235988"	"GAA"
"0000235989"	"GAA"
"0000235990"	"GAA"
"0000235991"	"GAA"
"0000235992"	"GAA"
"0000235993"	"GAA"
"0000235994"	"GAA"
"0000235995"	"GAA"
"0000235996"	"GAA"
"0000235997"	"GAA"
"0000235998"	"GAA"
"0000235999"	"GAA"
"0000236000"	"GAA"
"0000236001"	"GAA"
"0000236002"	"GAA"
"0000236003"	"GAA"
"0000236004"	"GAA"
"0000236005"	"GAA"
"0000236006"	"GAA"
"0000236007"	"GAA"
"0000236008"	"GAA"
"0000236009"	"GAA"
"0000236010"	"GAA"
"0000236011"	"GAA"
"0000236012"	"GAA"
"0000236013"	"GAA"
"0000236014"	"GAA"
"0000236015"	"GAA"
"0000236016"	"GAA"
"0000236017"	"GAA"
"0000236018"	"GAA"
"0000236019"	"GAA"
"0000236020"	"GAA"
"0000236021"	"GAA"
"0000236022"	"GAA"
"0000236023"	"GAA"
"0000236024"	"GAA"
"0000236025"	"GAA"
"0000236026"	"GAA"
"0000236027"	"GAA"
"0000236028"	"GAA"
"0000236029"	"GAA"
"0000236030"	"GAA"
"0000236031"	"GAA"
"0000236032"	"GAA"
"0000236033"	"GAA"
"0000236034"	"GAA"
"0000236035"	"GAA"
"0000236036"	"GAA"
"0000236037"	"GAA"
"0000236038"	"GAA"
"0000236039"	"GAA"
"0000236040"	"GAA"
"0000236041"	"GAA"
"0000236042"	"GAA"
"0000236043"	"GAA"
"0000236044"	"GAA"
"0000236045"	"GAA"
"0000236046"	"GAA"
"0000236047"	"GAA"
"0000236048"	"GAA"
"0000236049"	"GAA"
"0000236050"	"GAA"
"0000236051"	"GAA"
"0000236052"	"GAA"
"0000236053"	"GAA"
"0000236054"	"GAA"
"0000236055"	"GAA"
"0000236056"	"GAA"
"0000236057"	"GAA"
"0000236058"	"GAA"
"0000236059"	"GAA"
"0000236060"	"GAA"
"0000236061"	"GAA"
"0000236062"	"GAA"
"0000236063"	"GAA"
"0000236064"	"GAA"
"0000236065"	"GAA"
"0000236066"	"GAA"
"0000236067"	"GAA"
"0000236068"	"GAA"
"0000236069"	"GAA"
"0000236070"	"GAA"
"0000236071"	"GAA"
"0000236072"	"GAA"
"0000236073"	"GAA"
"0000236074"	"GAA"
"0000236075"	"GAA"
"0000236076"	"GAA"
"0000236077"	"GAA"
"0000236078"	"GAA"
"0000236079"	"GAA"
"0000236080"	"GAA"
"0000236081"	"GAA"
"0000236082"	"GAA"
"0000236083"	"GAA"
"0000236084"	"GAA"
"0000236085"	"GAA"
"0000236086"	"GAA"
"0000236087"	"GAA"
"0000236088"	"GAA"
"0000236089"	"GAA"
"0000236090"	"GAA"
"0000236091"	"GAA"
"0000236092"	"GAA"
"0000236093"	"GAA"
"0000236094"	"GAA"
"0000236095"	"GAA"
"0000236096"	"GAA"
"0000236097"	"GAA"
"0000236098"	"GAA"
"0000236099"	"GAA"
"0000236100"	"GAA"
"0000236101"	"GAA"
"0000236102"	"GAA"
"0000236103"	"GAA"
"0000236104"	"GAA"
"0000236105"	"GAA"
"0000236106"	"GAA"
"0000236107"	"GAA"
"0000236108"	"GAA"
"0000236109"	"GAA"
"0000236110"	"GAA"
"0000236111"	"GAA"
"0000236112"	"GAA"
"0000236113"	"GAA"
"0000236114"	"GAA"
"0000236115"	"GAA"
"0000236116"	"GAA"
"0000236117"	"GAA"
"0000236118"	"GAA"
"0000236119"	"GAA"
"0000236120"	"GAA"
"0000236121"	"GAA"
"0000236122"	"GAA"
"0000236123"	"GAA"
"0000236124"	"GAA"
"0000236125"	"GAA"
"0000236126"	"GAA"
"0000236127"	"GAA"
"0000236128"	"GAA"
"0000236129"	"GAA"
"0000236130"	"GAA"
"0000236131"	"GAA"
"0000236132"	"GAA"
"0000236133"	"GAA"
"0000236134"	"GAA"
"0000236135"	"GAA"
"0000236136"	"GAA"
"0000236137"	"GAA"
"0000236138"	"GAA"
"0000236139"	"GAA"
"0000236140"	"GAA"
"0000236141"	"GAA"
"0000236142"	"GAA"
"0000236143"	"GAA"
"0000236144"	"GAA"
"0000236145"	"GAA"
"0000236146"	"GAA"
"0000236147"	"GAA"
"0000236148"	"GAA"
"0000236149"	"GAA"
"0000236150"	"GAA"
"0000236151"	"GAA"
"0000236152"	"GAA"
"0000236153"	"GAA"
"0000236154"	"GAA"
"0000236155"	"GAA"
"0000236156"	"GAA"
"0000236157"	"GAA"
"0000236158"	"GAA"
"0000236159"	"GAA"
"0000236160"	"GAA"
"0000236161"	"GAA"
"0000236162"	"GAA"
"0000236163"	"GAA"
"0000236164"	"GAA"
"0000236165"	"GAA"
"0000236166"	"GAA"
"0000236167"	"GAA"
"0000236168"	"GAA"
"0000236169"	"GAA"
"0000236170"	"GAA"
"0000236171"	"GAA"
"0000236172"	"GAA"
"0000236173"	"GAA"
"0000236174"	"GAA"
"0000236175"	"GAA"
"0000236176"	"GAA"
"0000236177"	"GAA"
"0000236178"	"GAA"
"0000236179"	"GAA"
"0000236180"	"GAA"
"0000236181"	"GAA"
"0000236182"	"GAA"
"0000236183"	"GAA"
"0000236184"	"GAA"
"0000236185"	"GAA"
"0000236186"	"GAA"
"0000236187"	"GAA"
"0000236188"	"GAA"
"0000236189"	"GAA"
"0000236190"	"GAA"
"0000236191"	"GAA"
"0000236192"	"GAA"
"0000236193"	"GAA"
"0000236194"	"GAA"
"0000236195"	"GAA"
"0000236196"	"GAA"
"0000236197"	"GAA"
"0000236198"	"GAA"
"0000236199"	"GAA"
"0000236200"	"GAA"
"0000236201"	"GAA"
"0000236202"	"GAA"
"0000236203"	"GAA"
"0000236204"	"GAA"
"0000236205"	"GAA"
"0000236206"	"GAA"
"0000236207"	"GAA"
"0000236208"	"GAA"
"0000236209"	"GAA"
"0000236210"	"GAA"
"0000236211"	"GAA"
"0000236212"	"GAA"
"0000236213"	"GAA"
"0000236214"	"GAA"
"0000236215"	"GAA"
"0000236216"	"GAA"
"0000236217"	"GAA"
"0000236218"	"GAA"
"0000236219"	"GAA"
"0000236220"	"GAA"
"0000236221"	"GAA"
"0000236222"	"GAA"
"0000236223"	"GAA"
"0000236224"	"GAA"
"0000236225"	"GAA"
"0000236226"	"GAA"
"0000236227"	"GAA"
"0000236228"	"GAA"
"0000236229"	"GAA"
"0000236230"	"GAA"
"0000236231"	"GAA"
"0000236232"	"GAA"
"0000236233"	"GAA"
"0000236234"	"GAA"
"0000236235"	"GAA"
"0000236236"	"GAA"
"0000236237"	"GAA"
"0000236238"	"GAA"
"0000236239"	"GAA"
"0000236240"	"GAA"
"0000236241"	"GAA"
"0000236242"	"GAA"
"0000236243"	"GAA"
"0000236244"	"GAA"
"0000236245"	"GAA"
"0000236246"	"GAA"
"0000236247"	"GAA"
"0000236248"	"GAA"
"0000236249"	"GAA"
"0000236250"	"GAA"
"0000236251"	"GAA"
"0000236252"	"GAA"
"0000236253"	"GAA"
"0000236254"	"GAA"
"0000236255"	"GAA"
"0000236256"	"GAA"
"0000236257"	"GAA"
"0000236258"	"GAA"
"0000236259"	"GAA"
"0000236260"	"GAA"
"0000236261"	"GAA"
"0000236262"	"GAA"
"0000236263"	"GAA"
"0000236264"	"GAA"
"0000236265"	"GAA"
"0000236266"	"GAA"
"0000236267"	"GAA"
"0000236268"	"GAA"
"0000236269"	"GAA"
"0000236270"	"GAA"
"0000236271"	"GAA"
"0000236272"	"GAA"
"0000236273"	"GAA"
"0000236274"	"GAA"
"0000236275"	"GAA"
"0000236276"	"GAA"
"0000236277"	"GAA"
"0000236278"	"GAA"
"0000236279"	"GAA"
"0000236280"	"GAA"
"0000236281"	"GAA"
"0000236282"	"GAA"
"0000236283"	"GAA"
"0000236284"	"GAA"
"0000236285"	"GAA"
"0000236286"	"GAA"
"0000236287"	"GAA"
"0000236288"	"GAA"
"0000236289"	"GAA"
"0000236290"	"GAA"
"0000236291"	"GAA"
"0000236292"	"GAA"
"0000236293"	"GAA"
"0000236294"	"GAA"
"0000236295"	"GAA"
"0000236296"	"GAA"
"0000236297"	"GAA"
"0000236298"	"GAA"
"0000236299"	"GAA"
"0000236300"	"GAA"
"0000236301"	"GAA"
"0000236302"	"GAA"
"0000236303"	"GAA"
"0000236304"	"GAA"
"0000236305"	"GAA"
"0000236306"	"GAA"
"0000236307"	"GAA"
"0000236308"	"GAA"
"0000236309"	"GAA"
"0000236310"	"GAA"
"0000236311"	"GAA"
"0000236312"	"GAA"
"0000236313"	"GAA"
"0000236314"	"GAA"
"0000236315"	"GAA"
"0000236316"	"GAA"
"0000236317"	"GAA"
"0000236318"	"GAA"
"0000236319"	"GAA"
"0000236320"	"GAA"
"0000236321"	"GAA"
"0000236322"	"GAA"
"0000236323"	"GAA"
"0000236324"	"GAA"
"0000236325"	"GAA"
"0000236326"	"GAA"
"0000236327"	"GAA"
"0000236328"	"GAA"
"0000236329"	"GAA"
"0000236330"	"GAA"
"0000236331"	"GAA"
"0000236332"	"GAA"
"0000236333"	"GAA"
"0000236334"	"GAA"
"0000236335"	"GAA"
"0000236336"	"GAA"
"0000236337"	"GAA"
"0000236338"	"GAA"
"0000236339"	"GAA"
"0000236340"	"GAA"
"0000236341"	"GAA"
"0000236342"	"GAA"
"0000236343"	"GAA"
"0000236344"	"GAA"
"0000236345"	"GAA"
"0000236346"	"GAA"
"0000236347"	"GAA"
"0000236348"	"GAA"
"0000236349"	"GAA"
"0000236350"	"GAA"
"0000236351"	"GAA"
"0000236352"	"GAA"
"0000236353"	"GAA"
"0000236354"	"GAA"
"0000236355"	"GAA"
"0000236356"	"GAA"
"0000236357"	"GAA"
"0000236358"	"GAA"
"0000236359"	"GAA"
"0000236360"	"GAA"
"0000236361"	"GAA"
"0000236362"	"GAA"
"0000236363"	"GAA"
"0000236364"	"GAA"
"0000236365"	"GAA"
"0000236366"	"GAA"
"0000236367"	"GAA"
"0000236368"	"GAA"
"0000236369"	"GAA"
"0000236370"	"GAA"
"0000236371"	"GAA"
"0000236372"	"GAA"
"0000236373"	"GAA"
"0000236374"	"GAA"
"0000236375"	"GAA"
"0000236376"	"GAA"
"0000236377"	"GAA"
"0000236378"	"GAA"
"0000236379"	"GAA"
"0000236380"	"GAA"
"0000236381"	"GAA"
"0000236382"	"GAA"
"0000236383"	"GAA"
"0000236384"	"GAA"
"0000236385"	"GAA"
"0000236386"	"GAA"
"0000236387"	"GAA"
"0000236388"	"GAA"
"0000236389"	"GAA"
"0000236390"	"GAA"
"0000236391"	"GAA"
"0000236392"	"GAA"
"0000236393"	"GAA"
"0000236394"	"GAA"
"0000236395"	"GAA"
"0000236396"	"GAA"
"0000236397"	"GAA"
"0000236398"	"GAA"
"0000236399"	"GAA"
"0000236400"	"GAA"
"0000236401"	"GAA"
"0000236402"	"GAA"
"0000247806"	"GAA"
"0000247807"	"GAA"
"0000247808"	"GAA"
"0000247809"	"GAA"
"0000247810"	"GAA"
"0000247811"	"GAA"
"0000247812"	"GAA"
"0000247813"	"GAA"
"0000247814"	"GAA"
"0000247815"	"GAA"
"0000247816"	"GAA"
"0000247817"	"GAA"
"0000247818"	"GAA"
"0000247819"	"GAA"
"0000247820"	"GAA"
"0000247821"	"GAA"
"0000247969"	"GAA"
"0000247970"	"GAA"
"0000247971"	"GAA"
"0000247972"	"GAA"
"0000247973"	"GAA"
"0000247974"	"GAA"
"0000247975"	"GAA"
"0000247976"	"GAA"
"0000247977"	"GAA"
"0000247978"	"GAA"
"0000247979"	"GAA"
"0000247980"	"GAA"
"0000247981"	"GAA"
"0000247982"	"GAA"
"0000247983"	"GAA"
"0000247984"	"GAA"
"0000247985"	"GAA"
"0000247987"	"GAA"
"0000247988"	"GAA"
"0000247989"	"GAA"
"0000247990"	"GAA"
"0000247991"	"GAA"
"0000247992"	"GAA"
"0000247993"	"GAA"
"0000247994"	"GAA"
"0000247995"	"GAA"
"0000247996"	"GAA"
"0000247997"	"GAA"
"0000247998"	"GAA"
"0000247999"	"GAA"
"0000248000"	"GAA"
"0000248001"	"GAA"
"0000248003"	"GAA"
"0000248004"	"GAA"
"0000248005"	"GAA"
"0000248006"	"GAA"
"0000248007"	"GAA"
"0000275467"	"GAA"
"0000275565"	"GAA"
"0000275566"	"GAA"
"0000275567"	"GAA"
"0000296692"	"GAA"
"0000296696"	"GAA"
"0000296697"	"GAA"
"0000302733"	"GAA"
"0000306814"	"GAA"
"0000306815"	"GAA"
"0000306816"	"GAA"
"0000306817"	"GAA"
"0000306818"	"GAA"
"0000306819"	"GAA"
"0000306820"	"GAA"
"0000306821"	"GAA"
"0000306822"	"GAA"
"0000306823"	"GAA"
"0000306824"	"GAA"
"0000306825"	"GAA"
"0000306826"	"GAA"
"0000306827"	"GAA"
"0000306828"	"GAA"
"0000306829"	"GAA"
"0000306830"	"GAA"
"0000306831"	"GAA"
"0000306832"	"GAA"
"0000306833"	"GAA"
"0000306834"	"GAA"
"0000306835"	"GAA"
"0000306836"	"GAA"
"0000306837"	"GAA"
"0000306838"	"GAA"
"0000306839"	"GAA"
"0000306840"	"GAA"
"0000306841"	"GAA"
"0000306842"	"GAA"
"0000306843"	"GAA"
"0000306844"	"GAA"
"0000306845"	"GAA"
"0000306846"	"GAA"
"0000306847"	"GAA"
"0000306848"	"GAA"
"0000306849"	"GAA"
"0000306850"	"GAA"
"0000306851"	"GAA"
"0000306852"	"GAA"
"0000306853"	"GAA"
"0000306854"	"GAA"
"0000306855"	"GAA"
"0000306856"	"GAA"
"0000306857"	"GAA"
"0000306858"	"GAA"
"0000306859"	"GAA"
"0000306860"	"GAA"
"0000306861"	"GAA"
"0000306862"	"GAA"
"0000306863"	"GAA"
"0000306864"	"GAA"
"0000307863"	"GAA"
"0000307864"	"GAA"
"0000307865"	"GAA"
"0000307866"	"GAA"
"0000308226"	"GAA"
"0000315483"	"GAA"
"0000315484"	"GAA"
"0000315485"	"GAA"
"0000315486"	"GAA"
"0000315487"	"GAA"
"0000315488"	"GAA"
"0000315489"	"GAA"
"0000315490"	"GAA"
"0000315491"	"GAA"
"0000315492"	"GAA"
"0000315493"	"GAA"
"0000315494"	"GAA"
"0000375514"	"GAA"
"0000389241"	"SGCB"
"0000406222"	"GAA"
"0000406223"	"GAA"
"0000406224"	"GAA"
"0000406225"	"GAA"
"0000406226"	"GAA"
"0000414735"	"DMD"
"0000414735"	"GAA"
"0000414736"	"DMD"
"0000414736"	"GAA"
"0000415761"	"GAA"
"0000455196"	"GAA"
"0000455196"	"PABPN1"


## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 3084
"{{id}}"	"{{allele}}"	"{{effectid}}"	"{{chromosome}}"	"{{position_g_start}}"	"{{position_g_end}}"	"{{type}}"	"{{average_frequency}}"	"{{owned_by}}"	"{{VariantOnGenome/DBID}}"	"{{VariantOnGenome/DNA}}"	"{{VariantOnGenome/Frequency}}"	"{{VariantOnGenome/Reference}}"	"{{VariantOnGenome/Restriction_site}}"	"{{VariantOnGenome/Published_as}}"	"{{VariantOnGenome/Remarks}}"	"{{VariantOnGenome/Genetic_origin}}"	"{{VariantOnGenome/Segregation}}"	"{{VariantOnGenome/dbSNP}}"	"{{VariantOnGenome/VIP}}"	"{{VariantOnGenome/Methylation}}"	"{{VariantOnGenome/ISCN}}"	"{{VariantOnGenome/DNA/hg38}}"	"{{VariantOnGenome/ClinVar}}"	"{{VariantOnGenome/ClinicalClassification}}"	"{{VariantOnGenome/ClinicalClassification/Method}}"
"0000000650"	"0"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00002"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80104857G>A"	""	"VUS"	""
"0000000651"	"0"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00002"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80104857G>A"	""	"VUS"	""
"0000000652"	"0"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00002"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80104857G>A"	""	"VUS"	""
"0000000653"	"0"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00002"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80104857G>A"	""	"VUS"	""
"0000000654"	"0"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00002"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80104857G>A"	""	"VUS"	""
"0000000655"	"0"	"50"	"17"	"78092054"	"78092054"	"del"	"0"	"00002"	"GAA_000182"	"g.78092054del"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80118255del"	""	"VUS"	""
"0000000656"	"0"	"50"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00002"	"GAA_000028"	"g.78078910del"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80105111del"	""	"VUS"	""
"0000000657"	"0"	"50"	"17"	"78081693"	"78081693"	"subst"	"4.29778E-5"	"00002"	"GAA_000016"	"g.78081693T>C"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80107894T>C"	""	"VUS"	""
"0000000658"	"0"	"50"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00002"	"GAA_000025"	"g.78092070C>T"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80118271C>T"	""	"VUS"	""
"0000000659"	"0"	"50"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00002"	"GAA_000025"	"g.78092070C>T"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80118271C>T"	""	"VUS"	""
"0000000660"	"0"	"50"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"00002"	"GAA_000020"	"g.78086721C>A"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80112922C>A"	""	"VUS"	""
"0000000661"	"0"	"50"	"17"	"78084529"	"78084529"	"subst"	"1.62624E-5"	"00002"	"GAA_000080"	"g.78084529T>C"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80110730T>C"	""	"VUS"	""
"0000000662"	"0"	"50"	"17"	"78082628"	"78082628"	"subst"	"0"	"00002"	"GAA_000078"	"g.78082628G>A"	""	""	""	"INTRON 7, IVS7+1G>A"	""	"Germline"	""	""	""	""	""	"g.80108829G>A"	""	"VUS"	""
"0000000663"	"0"	"50"	"17"	"78092054"	"78092054"	"del"	"0"	"00002"	"GAA_000182"	"g.78092054del"	""	""	""	""	"Authors description: g.75706649_75706650; mutant allele C; not known correct genotype; undefined second mutation in affected CHT"	"Germline"	""	""	""	""	""	"g.80118255del"	""	"VUS"	""
"0000000664"	"0"	"50"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00002"	"GAA_000029"	"g.78078341T>G"	""	""	""	""	""	"Germline"	""	""	""	""	""	"g.80104542T>G"	""	"VUS"	""
"0000163951"	"2"	"90"	"17"	"0"	"0"	"del"	"0"	"01938"	"GAA_000000"	"g.?"	""	"{PMID:Zhong 1991:1652892}"	""	""	"second allele expressing no GAA mRNA"	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000163952"	"0"	"10"	"17"	"78075640"	"78075640"	"subst"	"0"	"01938"	"GAA_000001"	"g.78075640G>C"	""	"{PMID:Martiniuk 1990:02111708}"	""	""	"in 5\'UTR"	"Germline"	""	""	"0"	""	""	"g.80101841G>C"	""	"benign"	""
"0000163953"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01942"	"GAA_000029"	"g.78078341T>G"	""	""	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000163954"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01942"	"GAA_000029"	"g.78078341T>G"	""	""	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000163955"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01942"	"GAA_000029"	"g.78078341T>G"	""	""	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000163956"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01938"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Boerkoel 1995:07717400}"	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000163957"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01938"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Huie 1994b:07881425}"	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000163958"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01938"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 1995:08558570}"	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000163959"	"21"	"70"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01941"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alcantara-Ortigoza 2010:20350966}"	""	""	"compound heterozygous genotype"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"likely pathogenic"	""
"0000163960"	"0"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01938"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000163961"	"0"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01938"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Kroos 1997:09266392}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000163962"	"0"	"90"	"17"	"78078557"	"78078557"	"subst"	"0"	"01938"	"GAA_000076"	"g.78078557C>T"	""	"{PMID:Huie 1999:10377006}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104758C>T"	""	"pathogenic (recessive)"	""
"0000163963"	"0"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"01938"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Beesley 1998:10206684}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000163964"	"0"	"90"	"17"	"78078656"	"78078656"	"del"	"0"	"01938"	"GAA_000061"	"g.78078656del"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857del"	""	"pathogenic (recessive)"	""
"0000163965"	"0"	"10"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"01938"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Martiniuk 1990:02203258}, {OMIM606800:0001}"	"TaqI-"	""	"variant basis of GAA*2 allozyme"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000163966"	"0"	"90"	"17"	"78078692"	"78078692"	"subst"	"0"	"01938"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"pathogenic (recessive)"	""
"0000163967"	"0"	"90"	"17"	"78078694"	"78078694"	"subst"	"0"	"01938"	"GAA_000120"	"g.78078694C>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104895C>A"	""	"pathogenic (recessive)"	""
"0000163968"	"0"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"01938"	"GAA_000002"	"g.78078709T>C"	""	"{PMID:Martiniuk 1990:02111708}"	""	"324C>T"	""	"Germline"	""	""	"0"	""	""	"g.80104910T>C"	""	"benign"	""
"0000163969"	"0"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"01938"	"GAA_000002"	"g.78078709T>C"	""	"{PMID:Hoefsloot 1990:02268276}"	""	"324C>T"	""	"Germline"	""	""	"0"	""	""	"g.80104910T>C"	""	"benign"	""
"0000163970"	"3"	"90"	"17"	"78078725"	"78078726"	"ins"	"0"	"01938"	"GAA_000121"	"g.78078725_78078726insT"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104926_80104927insT"	""	"pathogenic (recessive)"	""
"0000163971"	"0"	"90"	"17"	"78078764"	"78078765"	"del"	"0"	"01938"	"GAA_000062"	"g.78078764_78078765del"	""	"{PMID:Kroos 1998:09660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104965_80104966del"	""	"pathogenic (recessive)"	""
"0000163972"	"0"	"90"	"17"	"78078784"	"78078784"	"subst"	"0"	"01938"	"GAA_000124"	"g.78078784C>A"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104985C>A"	""	"pathogenic (recessive)"	""
"0000163973"	"0"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"01938"	"GAA_000055"	"g.78078867_78078868del"	""	"{PMID:Nicolino 1997:09196050}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic (recessive)"	""
"0000163974"	"0"	"10"	"17"	"78078895"	"78078895"	"subst"	"5.0514E-5"	"01938"	"GAA_000122"	"g.78078895C>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105096C>T"	""	"benign"	""
"0000163975"	"0"	"50"	"17"	"78078909"	"78078909"	"subst"	"0"	"00006"	"GAA_000171"	"g.78078909C>G"	""	""	""	"c-524C>G"	""	"Germline"	""	""	"0"	""	""	"g.80105110C>G"	""	"VUS"	""
"0000163976"	"0"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01938"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 1994:07881422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000163977"	"0"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01938"	"GAA_000028"	"g.78078910del"	""	"{PMID:Kroos 1995:08558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000163978"	"0"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01938"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hirschhorn 1999:09950376}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000163979"	"2"	"90"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"01938"	"GAA_000123"	"g.78078931G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	"leaky splice site, 0.063 copy number of 526g>a mRNA; residual activity in patient fibroblasts 0.03"	"Germline"	""	""	"0"	""	""	"g.80105132G>A"	""	"pathogenic (recessive)"	""
"0000163980"	"0"	"90"	"17"	"78079574"	"78079574"	"subst"	"4.0858E-6"	"01938"	"GAA_000098"	"g.78079574C>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105775C>A"	""	"pathogenic (recessive)"	""
"0000163981"	"0"	"10"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"01938"	"GAA_000004"	"g.78079597A>G"	""	"{PMID:Martiniuk 1990:02111708}"	""	"596G>A"	""	"Germline"	""	""	"0"	""	""	"g.80105798A>G"	""	"benign"	""
"0000163982"	"0"	"90"	"17"	"78079624"	"78079624"	"subst"	"0"	"01938"	"GAA_000087"	"g.78079624T>C"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105825T>C"	""	"pathogenic (recessive)"	""
"0000163983"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"01938"	"GAA_000005"	"g.78079643C>T"	""	"{PMID:Martiniuk 1990:02111708}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105844C>T"	""	"benign"	""
"0000163984"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"01938"	"GAA_000005"	"g.78079643C>T"	""	"{PMID:Hermans 1993:08401535}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105844C>T"	""	"benign"	""
"0000163985"	"0"	"90"	"17"	"78079656"	"78079656"	"subst"	"0"	"01938"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"pathogenic (recessive)"	""
"0000163986"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"01938"	"GAA_000038"	"g.78079669G>A"	""	"{PMID:Reuser  1995:07603530}"	""	"668A>G"	""	"Germline"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000163987"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"01938"	"GAA_000038"	"g.78079669G>A"	""	"{PMID:Hermans 1997:09425285}"	""	"668A>G"	""	"Germline"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000163988"	"0"	"90"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01938"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"pathogenic (recessive)"	""
"0000163989"	"0"	"90"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01938"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Pipo 2003:14643388}"	""	"719T>C"	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"pathogenic (recessive)"	""
"0000163991"	"0"	"90"	"17"	"78079694"	"78079694"	"subst"	"4.25268E-6"	"01938"	"GAA_000148"	"g.78079694G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105895G>C"	""	"pathogenic (recessive)"	""
"0000163992"	"0"	"90"	"17"	"78081379"	"78081379"	"del"	"0"	"01938"	"GAA_000125"	"g.78081379del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107580del"	""	"pathogenic (recessive)"	""
"0000163993"	"0"	"50"	"17"	"78081382"	"78081382"	"subst"	"0"	"01938"	"GAA_000146"	"g.78081382T>C"	""	"{PMID:Anneser 2005:15668445}"	""	"719C>T"	""	"Germline"	""	""	"0"	""	""	"g.80107583T>C"	""	"VUS"	""
"0000163994"	"0"	"90"	"17"	"78081385"	"78081386"	"del"	"0"	"01938"	"GAA_000094"	"g.78081385_78081386del"	""	"2001 ASHG"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107586_80107587del"	""	"pathogenic (recessive)"	""
"0000163995"	"0"	"90"	"17"	"78081429"	"78081448"	"delins"	"0"	"01938"	"GAA_000063"	"g.78081429_78081448delinsC"	""	"{PMID:Beesley 1998:10206684}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107630_80107649delinsC"	""	"pathogenic (recessive)"	""
"0000163996"	"0"	"90"	"17"	"78081429"	"78081448"	"delins"	"0"	"01938"	"GAA_000063"	"g.78081429_78081448delinsC"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107630_80107649delinsC"	""	"pathogenic (recessive)"	""
"0000163997"	"0"	"90"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01938"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"pathogenic (recessive)"	""
"0000163998"	"0"	"90"	"17"	"78081492"	"78081514"	"del"	"0"	"01938"	"GAA_000109"	"g.78081492_78081514del"	""	"2003"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107693_80107715del"	""	"pathogenic (recessive)"	""
"0000163999"	"0"	"90"	"17"	"78081517"	"78081517"	"subst"	"5.17218E-6"	"01938"	"GAA_000101"	"g.78081517C>G"	""	"{PMID:Bodamer 2002:12213618}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107718C>G"	""	"pathogenic (recessive)"	""
"0000164000"	"0"	"10"	"17"	"78081541"	"78081541"	"dup"	"0"	"01938"	"GAA_000110"	"g.78081541dup"	""	"{PMID:Pipo 2003:14643388}"	""	"858+20dupG"	""	"Germline"	""	""	"0"	""	""	"g.80107742dup"	""	"benign"	""
"0000164001"	"0"	"10"	"17"	"78081541"	"78081541"	"subst"	"0"	"01938"	"GAA_000111"	"g.78081541C>G"	""	"{PMID:Pipo 2003:14643388}"	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.80107742C>G"	""	"benign"	""
"0000164002"	"0"	"90"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01938"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Castro-Gago 1999:10528311}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"pathogenic (recessive)"	""
"0000164003"	"0"	"90"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01938"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Talsma 2002:11927738}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"pathogenic (recessive)"	""
"0000164004"	"0"	"90"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01938"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"pathogenic (recessive)"	""
"0000164005"	"0"	"90"	"17"	"78081636"	"78081636"	"subst"	"0"	"01938"	"GAA_000039"	"g.78081636T>G"	""	"{PMID:Raben 1995:07603531}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>G"	""	"pathogenic (recessive)"	""
"0000164006"	"0"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"01938"	"GAA_000018"	"g.78081661A>T"	""	"{PMID:Hermans 1993:08401535}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107862A>T"	""	"benign"	""
"0000164007"	"0"	"90"	"17"	"78081663"	"78081663"	"subst"	"0"	"01938"	"GAA_000127"	"g.78081663A>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>C"	""	"pathogenic (recessive)"	""
"0000164008"	"0"	"90"	"17"	"78081663"	"78081663"	"subst"	"0"	"01938"	"GAA_000088"	"g.78081663A>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>T"	""	"pathogenic (recessive)"	""
"0000164009"	"0"	"90"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01938"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Kroos 1998:09660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic (recessive)"	""
"0000164010"	"0"	"90"	"17"	"78081675"	"78081675"	"subst"	"0"	"01938"	"GAA_000128"	"g.78081675T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107876T>G"	""	"pathogenic (recessive)"	""
"0000164011"	"1"	"90"	"17"	"78081693"	"78081693"	"subst"	"4.29778E-5"	"01938"	"GAA_000016"	"g.78081693T>C"	""	"{PMID:Zhong 1991:1652892}, {OMIM606800:0002}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107894T>C"	""	"pathogenic (recessive)"	""
"0000164012"	"0"	"10"	"17"	"78081707"	"78081707"	"subst"	"0"	"01938"	"GAA_000040"	"g.78081707A>G"	""	"{PMID:Boerkoel 1995:07717400}"	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.80107908A>G"	""	"benign"	""
"0000164013"	"0"	"90"	"17"	"78082104"	"78082104"	"subst"	"8.12585E-6"	"01938"	"GAA_000089"	"g.78082104C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108305C>T"	""	"pathogenic (recessive)"	""
"0000164014"	"0"	"90"	"17"	"78082121"	"78082121"	"subst"	"0"	"01938"	"GAA_000149"	"g.78082121T>G"	""	"{PMID:Dou 2006:16782080}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108322T>G"	""	"pathogenic (recessive)"	""
"0000164015"	"0"	"90"	"17"	"78082122"	"78082122"	"subst"	"0"	"01938"	"GAA_000112"	"g.78082122G>A"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108323G>A"	""	"pathogenic (recessive)"	""
"0000164016"	"0"	"90"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01938"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"pathogenic (recessive)"	""
"0000164017"	"0"	"90"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01938"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"pathogenic (recessive)"	""
"0000164018"	"0"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01938"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000164019"	"0"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01938"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Adams 1997:09259196}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000164020"	"0"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01938"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000164021"	"0"	"90"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01938"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Lam 2003:12601120}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"pathogenic (recessive)"	""
"0000164022"	"0"	"90"	"17"	"78082332"	"78082332"	"subst"	"0"	"01938"	"GAA_000130"	"g.78082332T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108533T>C"	""	"pathogenic (recessive)"	""
"0000164023"	"0"	"90"	"17"	"78082341"	"78082341"	"subst"	"8.19008E-6"	"01938"	"GAA_000150"	"g.78082341G>C"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108542G>C"	""	"pathogenic (recessive)"	""
"0000164024"	"0"	"50"	"17"	"78082408"	"78082408"	"subst"	"0"	"01938"	"GAA_000152"	"g.78082408T>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108609T>A"	""	"VUS"	""
"0000164025"	"0"	"90"	"17"	"78082477"	"78090750"	"del"	"0"	"01938"	"GAA_000103"	"g.78082477_78090750del"	""	"{PMID:Huie 2002:11854868}"	""	"deletion exons 8 to 15"	""	"Germline"	""	""	"0"	""	""	"g.80108678_80116951del"	""	"pathogenic (recessive)"	""
"0000164026"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"01938"	"GAA_000006"	"g.78082504G>A"	""	"{PMID:Martiniuk 1990:02111708}"	""	"1203A>G"	""	"Germline"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000164027"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"01938"	"GAA_000006"	"g.78082504G>A"	""	"{PMID:Hermans 1994:07881422}"	""	"1203A>G"	""	"Germline"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000164028"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"01938"	"GAA_000006"	"g.78082504G>A"	""	"{PMID:Hermans 1993:08094613}"	""	"1203A>G"	""	"Germline"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000164029"	"0"	"90"	"17"	"78082505"	"78082505"	"subst"	"0"	"01938"	"GAA_000007"	"g.78082505T>C"	""	"{PMID:Hoefsloot 1990:02268276}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108706T>C"	""	"pathogenic (recessive)"	""
"0000164030"	"0"	"90"	"17"	"78082511"	"78082511"	"subst"	"2.86982E-5"	"01938"	"GAA_000153"	"g.78082511G>A"	""	"{PMID:Amartino 2006:16433701}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108712G>A"	""	"pathogenic (recessive)"	""
"0000164031"	"0"	"90"	"17"	"78082515"	"78082515"	"subst"	"0"	"01938"	"GAA_000131"	"g.78082515T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108716T>C"	""	"pathogenic (recessive)"	""
"0000164032"	"0"	"90"	"17"	"78082523"	"78082523"	"subst"	"8.20136E-6"	"01938"	"GAA_000102"	"g.78082523A>G"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108724A>G"	""	"pathogenic (recessive)"	""
"0000164033"	"0"	"90"	"17"	"78082610"	"78082610"	"subst"	"0"	"01938"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Lam 2003:12601120}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"pathogenic (recessive)"	""
"0000164034"	"0"	"90"	"17"	"78082628"	"78082628"	"subst"	"0"	"01938"	"GAA_000078"	"g.78082628G>A"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108829G>A"	""	"pathogenic (recessive)"	""
"0000164035"	"0"	"10"	"17"	"78083726"	"78083726"	"subst"	"0"	"01938"	"GAA_000042"	"g.78083726G>A"	""	"{PMID:Boerkoel 1995:07717400}"	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.80109927G>A"	""	"benign"	""
"0000164036"	"0"	"90"	"17"	"78083750"	"78083750"	"subst"	"0"	"01938"	"GAA_000154"	"g.78083750G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109951G>C"	""	"pathogenic (recessive)"	""
"0000164037"	"0"	"90"	"17"	"78083781"	"78083781"	"subst"	"0"	"01938"	"GAA_000132"	"g.78083781A>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109982A>T"	""	"pathogenic (recessive)"	""
"0000164038"	"0"	"90"	"17"	"78083794"	"78083796"	"del"	"0"	"01938"	"GAA_000133"	"g.78083794_78083796del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109995_80109997del"	""	"pathogenic (recessive)"	""
"0000164039"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"01938"	"GAA_000019"	"g.78083791C>T"	""	"{PMID:Hermans 1993:08094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109992C>T"	""	"benign"	""
"0000164040"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"01938"	"GAA_000019"	"g.78083791C>T"	""	"{PMID:Hermans 1993:08401535}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109992C>T"	""	"benign"	""
"0000164041"	"0"	"50"	"17"	"78083825"	"78083827"	"del"	"0"	"01938"	"GAA_000104"	"g.78083825_78083827del"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110026_80110028del"	""	"VUS"	""
"0000164042"	"0"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01938"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000164043"	"0"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01938"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Shieh 1996:08604985}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000164044"	"0"	"90"	"17"	"78083849"	"78083849"	"subst"	"4.08881E-6"	"01938"	"GAA_000041"	"g.78083849G>A"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110050G>A"	""	"pathogenic (recessive)"	""
"0000164045"	"0"	"90"	"17"	"78083856"	"78083856"	"subst"	"0"	"01938"	"GAA_000095"	"g.78083856T>C"	""	"{PMID:Stroppiano 2001:11343339}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110057T>C"	""	"pathogenic (recessive)"	""
"0000164046"	"0"	"10"	"17"	"78084507"	"78084507"	"subst"	"0"	"01938"	"GAA_000043"	"g.78084507C>G"	""	"{PMID:Boerkoel 1995:07717400}"	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.80110708C>G"	""	"benign"	""
"0000164047"	"0"	"90"	"17"	"78084525"	"78084525"	"subst"	"0"	"01938"	"GAA_000096"	"g.78084525G>C"	""	"2001 ASHG"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110726G>C"	""	"pathogenic (recessive)"	""
"0000164048"	"0"	"90"	"17"	"78084529"	"78084529"	"del"	"4.0658E-6"	"01938"	"GAA_000079"	"g.78084529del"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110730del"	""	"pathogenic (recessive)"	""
"0000164049"	"0"	"90"	"17"	"78084529"	"78084529"	"subst"	"1.62624E-5"	"01938"	"GAA_000080"	"g.78084529T>C"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110730T>C"	""	"pathogenic (recessive)"	""
"0000164050"	"0"	"90"	"17"	"78084544"	"78084556"	"del"	"0"	"01938"	"GAA_000031"	"g.78084544_78084556del"	""	"{PMID:Huie 1994c:07981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110745_80110757del"	""	"pathogenic (recessive)"	""
"0000164051"	"0"	"90"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01938"	"GAA_000155"	"g.78084553G>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>A"	""	"pathogenic (recessive)"	""
"0000164052"	"0"	"90"	"17"	"78084585"	"78084585"	"subst"	"0"	"01938"	"GAA_000090"	"g.78084585G>A"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110786G>A"	""	"pathogenic (recessive)"	""
"0000164053"	"0"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01938"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000164054"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01938"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Stroppiano 2001:11343339}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000164055"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01938"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Huie 1994b:07881425}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000164056"	"0"	"50"	"17"	"78084681"	"78084681"	"subst"	"0.0023074"	"01942"	"GAA_000172"	"g.78084681G>A"	"0.005"	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110882G>A"	""	"VUS"	""
"0000164057"	"0"	"90"	"17"	"78084737"	"78084737"	"subst"	"0.000138095"	"01938"	"GAA_000156"	"g.78084737C>G"	""	"2006"	""	""	"leaky splice site"	"Germline"	""	""	"0"	""	""	"g.80110938C>G"	""	"pathogenic (recessive)"	""
"0000164058"	"0"	"90"	"17"	"78084743"	"78084743"	"subst"	"0"	"01938"	"GAA_000032"	"g.78084743A>G"	""	"{PMID:Huie 1994:07866409}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110944A>G"	""	"pathogenic (recessive)"	""
"0000164059"	"0"	"90"	"17"	"78084743"	"78084743"	"subst"	"0"	"01938"	"GAA_000032"	"g.78084743A>G"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110944A>G"	""	"pathogenic (recessive)"	""
"0000164060"	"0"	"90"	"17"	"78084744"	"78084744"	"subst"	"8.12334E-6"	"01938"	"GAA_000044"	"g.78084744T>C"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110945T>C"	""	"pathogenic (recessive)"	""
"0000164061"	"0"	"90"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01938"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:Hermans 1991:01898413}, {OMIM606800:0003}"	""	"1561G>A"	"abnormal physical properties enzyme precursor, catalytically active enzyme not formed"	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"pathogenic (recessive)"	""
"0000164062"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01938"	"GAA_000008"	"g.78084769G>A"	""	"{PMID:Hermans 1991:01898413}"	""	"1581A>G"	""	"Germline"	""	""	"0"	""	""	"g.80110970G>A"	""	"benign"	""
"0000164063"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01938"	"GAA_000008"	"g.78084769G>A"	""	"{PMID:Martiniuk 1990:02111708}"	""	"1581A>G"	""	"Germline"	""	""	"0"	""	""	"g.80110970G>A"	""	"benign"	""
"0000164064"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01938"	"GAA_000008"	"g.78084769G>A"	""	"{PMID:Hoefsloot 1990:02268276}"	""	"1581A>G"	""	"Germline"	""	""	"0"	""	""	"g.80110970G>A"	""	"benign"	""
"0000164065"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01938"	"GAA_000008"	"g.78084769G>A"	""	"{PMID:Hermans 1993:08094613}"	""	"1581A>G"	""	"Germline"	""	""	"0"	""	""	"g.80110970G>A"	""	"benign"	""
"0000164066"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01938"	"GAA_000008"	"g.78084769G>A"	""	"{PMID:Hermans 1993:08401535}"	""	"1581A>G"	""	"Germline"	""	""	"0"	""	""	"g.80110970G>A"	""	"benign"	""
"0000164067"	"0"	"90"	"17"	"78084773"	"78084774"	"delins"	"0"	"01938"	"GAA_000054"	"g.78084773_78084774delinsGT"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110974_80110975delinsGT"	""	"pathogenic (recessive)"	""
"0000164068"	"0"	"90"	"17"	"78084773"	"78084774"	"delins"	"0"	"01938"	"GAA_000054"	"g.78084773_78084774delinsGT"	""	"{PMID:Tsunoda 1996:08834250}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110974_80110975delinsGT"	""	"pathogenic (recessive)"	""
"0000164069"	"0"	"50"	"17"	"78084814"	"78084814"	"subst"	"8.13246E-6"	"01938"	"GAA_000157"	"g.78084814C>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111015C>G"	""	"VUS"	""
"0000164070"	"0"	"90"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01938"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Hermans 1994:07881422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"pathogenic (recessive)"	""
"0000164071"	"0"	"90"	"17"	"78085790"	"78085790"	"subst"	"0"	"01938"	"GAA_000135"	"g.78085790G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111991G>A"	""	"pathogenic (recessive)"	""
"0000164072"	"0"	"90"	"17"	"78085790"	"78085790"	"subst"	"0"	"01938"	"GAA_000158"	"g.78085790G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111991G>C"	""	"pathogenic (recessive)"	""
"0000164073"	"0"	"90"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01938"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Bodamer 2002:12213618}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"pathogenic (recessive)"	""
"0000164074"	"11"	"70"	"17"	"78085818"	"78085818"	"subst"	"0"	"01941"	"GAA_000170"	"g.78085818G>C"	""	"{PMID:Alcantara-Ortigoza 2010:20350966}"	""	""	"not in 240 control chromosomes; compound heterozygous genotype"	"Germline"	""	""	"0"	""	""	"g.80112019G>C"	""	"likely pathogenic"	""
"0000164075"	"0"	"90"	"17"	"78085832"	"78085832"	"subst"	"0"	"01938"	"GAA_000097"	"g.78085832C>T"	""	"2001 ASHG"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112033C>T"	""	"pathogenic (recessive)"	""
"0000164076"	"0"	"90"	"17"	"78085841"	"78085841"	"subst"	"0"	"01938"	"GAA_000046"	"g.78085841T>C"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112042T>C"	""	"pathogenic (recessive)"	""
"0000164077"	"3"	"90"	"17"	"78085841"	"78085841"	"subst"	"0"	"01938"	"GAA_000046"	"g.78085841T>C"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112042T>C"	""	"pathogenic (recessive)"	""
"0000164078"	"0"	"90"	"17"	"78085869"	"78085869"	"subst"	"0"	"01938"	"GAA_000136"	"g.78085869A>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112070A>C"	""	"pathogenic (recessive)"	""
"0000164079"	"0"	"10"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"01938"	"GAA_000045"	"g.78085871G>A"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112072G>A"	""	"benign"	""
"0000164080"	"0"	"90"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"01938"	"GAA_000137"	"g.78085880G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112081G>A"	""	"pathogenic (recessive)"	""
"0000164081"	"0"	"90"	"17"	"78085899"	"78085899"	"subst"	"0"	"01938"	"GAA_000091"	"g.78085899G>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112100G>T"	""	"pathogenic (recessive)"	""
"0000164082"	"0"	"90"	"17"	"78086398"	"78086398"	"del"	"0"	"01938"	"GAA_000160"	"g.78086398del"	""	"{PMID:Montalvo 2006:16917947}"	""	"1776delG"	""	"Germline"	""	""	"0"	""	""	"g.80112599del"	""	"pathogenic (recessive)"	""
"0000164083"	"0"	"90"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01938"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"pathogenic (recessive)"	""
"0000164084"	"0"	"90"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01938"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"pathogenic (recessive)"	""
"0000164085"	"0"	"90"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"01938"	"GAA_000081"	"g.78086421G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112622G>A"	""	"pathogenic (recessive)"	""
"0000164086"	"0"	"90"	"17"	"78086441"	"78086458"	"del"	"0"	"01938"	"GAA_000093"	"g.78086441_78086458del"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112642_80112659del"	""	"pathogenic (recessive)"	""
"0000164087"	"0"	"90"	"17"	"78086442"	"78086442"	"subst"	"0"	"01938"	"GAA_000138"	"g.78086442G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112643G>A"	""	"pathogenic (recessive)"	""
"0000164088"	"0"	"90"	"17"	"78086448"	"78086448"	"dup"	"0"	"01938"	"GAA_000139"	"g.78086448dup"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112649dup"	""	"pathogenic (recessive)"	""
"0000164089"	"0"	"90"	"17"	"78086449"	"78086449"	"del"	"3.32928E-5"	"01938"	"GAA_000140"	"g.78086449del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112650del"	""	"pathogenic (recessive)"	""
"0000164090"	"0"	"10"	"17"	"78086452"	"78086452"	"subst"	"0.00134355"	"01938"	"GAA_000141"	"g.78086452C>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112653C>T"	""	"benign"	""
"0000164091"	"0"	"90"	"17"	"78086455"	"78086461"	""	"0"	"01938"	"GAA_000161"	"g.[78086455_78086461del;78086468G>T;78086469_78086470insT]"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000164092"	"0"	"90"	"17"	"78086458"	"78086458"	"subst"	"4.13846E-6"	"01938"	"GAA_000162"	"g.78086458C>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112659C>G"	""	"pathogenic (recessive)"	""
"0000164093"	"0"	"90"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01938"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"pathogenic (recessive)"	""
"0000164094"	"0"	"90"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"01938"	"GAA_000159"	"g.78086478G>A"	""	"2006"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112679G>A"	""	"pathogenic (recessive)"	""
"0000164095"	"0"	"90"	"17"	"78086479"	"78086479"	"subst"	"0"	"01938"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"pathogenic (recessive)"	""
"0000164096"	"0"	"90"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01938"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"pathogenic (recessive)"	""
"0000164097"	"0"	"10"	"17"	"78086703"	"78086703"	"subst"	"0"	"01938"	"GAA_000047"	"g.78086703G>A"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112904G>A"	""	"benign"	""
"0000164098"	"0"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01938"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000164099"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01938"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Hermans 1993:08401535}, {OMIM606800:0004}"	""	""	"impaired intracellular transport and maturation of enzyme, 1-2% remaining activity"	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000164100"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01938"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Hermans 1998:09521422}"	""	""	"2nd allele RNA not expressed, no variant identified"	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000164101"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01938"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000164102"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01938"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000164103"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"4.19893E-6"	"01938"	"GAA_000048"	"g.78086719G>C"	""	"{PMID:Lin 1995:07695647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>C"	""	"pathogenic (recessive)"	""
"0000164104"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01938"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000164105"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01938"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Shieh 1994:08051927}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000164106"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01938"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Hermans 1993:08094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000164107"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01938"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Hermans 1993:08486380}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000164108"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01938"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Adams 1997:09259196}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000164109"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01938"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Shieh 1998:09554747}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000164110"	"0"	"90"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01938"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Huie 1994c:07981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"pathogenic (recessive)"	""
"0000164111"	"0"	"90"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01938"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"pathogenic (recessive)"	""
"0000164112"	"0"	"90"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01938"	"GAA_000067"	"g.78086728G>A"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112929G>A"	""	"pathogenic (recessive)"	""
"0000164113"	"0"	"90"	"17"	"78086765"	"78086765"	"subst"	"0"	"01938"	"GAA_000116"	"g.78086765G>A"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112966G>A"	""	"pathogenic (recessive)"	""
"0000164114"	"0"	"90"	"17"	"78086798"	"78086798"	"subst"	"0"	"01938"	"GAA_000163"	"g.78086798T>G"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112999T>G"	""	"pathogenic (recessive)"	""
"0000164115"	"0"	"90"	"17"	"78086800"	"78086800"	"subst"	"0"	"01938"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"pathogenic (recessive)"	""
"0000164116"	"0"	"90"	"17"	"78086800"	"78086800"	"subst"	"0"	"01938"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"pathogenic (recessive)"	""
"0000164117"	"0"	"90"	"17"	"78086801"	"78086801"	"subst"	"0"	"01938"	"GAA_000069"	"g.78086801G>A"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"pathogenic (recessive)"	""
"0000164118"	"0"	"90"	"17"	"78086801"	"78086801"	"subst"	"0"	"01938"	"GAA_000069"	"g.78086801G>A"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"pathogenic (recessive)"	""
"0000164119"	"0"	"90"	"17"	"78086810"	"78086812"	"del"	"0"	"01938"	"GAA_000083"	"g.78086810_78086812del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113011_80113013del"	""	"pathogenic (recessive)"	""
"0000164120"	"0"	"10"	"17"	"78086953"	"78086953"	"subst"	"0"	"01938"	"GAA_000106"	"g.78086953A>G"	""	"{PMID:Huie 2002:11854868}"	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.80113154A>G"	""	"benign"	""
"0000164121"	"0"	"90"	"17"	"78087015"	"78087015"	"subst"	"0"	"01938"	"GAA_000142"	"g.78087015A>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113216A>C"	""	"pathogenic (recessive)"	""
"0000164122"	"0"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"01938"	"GAA_000035"	"g.78087041G>A"	""	"{PMID:Huie 1994c:07981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113242G>A"	""	"benign"	""
"0000164123"	"0"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"01938"	"GAA_000035"	"g.78087041G>A"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113242G>A"	""	"benign"	""
"0000164124"	"0"	"90"	"17"	"78087042"	"78087046"	"dup"	"0"	"01938"	"GAA_000164"	"g.78087042_78087046dup"	""	"2006"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113243_80113247dup"	""	"pathogenic (recessive)"	""
"0000164125"	"0"	"90"	"17"	"78087080"	"78087080"	"subst"	"0"	"01938"	"GAA_000143"	"g.78087080C>T"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113281C>T"	""	"pathogenic (recessive)"	""
"0000164126"	"0"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"01938"	"GAA_000022"	"g.78087109A>G"	""	"{PMID:Hermans 1993:08401535}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000164127"	"0"	"10"	"17"	"78087130"	"78087130"	"subst"	"0"	"01938"	"GAA_000071"	"g.78087130C>T"	""	"{PMID:Becker 1998:09529346}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113331C>T"	""	"benign"	""
"0000164128"	"2"	"90"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01938"	"GAA_000023"	"g.78087149C>T"	""	"{PMID:Hermans 1993:08401535}, {OMIM606800:0004}"	""	""	"impaired intracellular transport and maturation of enzyme, 1-2% remaining activity"	"Germline"	""	""	"0"	""	""	"g.80113350C>T"	""	"pathogenic (recessive)"	""
"0000164129"	"0"	"90"	"17"	"78087164"	"78087164"	"subst"	"0"	"01938"	"GAA_000117"	"g.78087164G>T"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113365G>T"	""	"pathogenic (recessive)"	""
"0000164130"	"0"	"90"	"17"	"78087624"	"78093679"	"del"	"0"	"01938"	"GAA_000084"	"g.78087624_78093679del"	""	"{PMID:Huie 1999:10071199}"	""	"deletion exon 15 to 3\' of gene"	""	"Germline"	""	""	"0"	""	""	"g.80113825_80119880del"	""	"pathogenic (recessive)"	""
"0000164131"	"0"	"90"	"17"	"78090796"	"78090797"	"del"	"0"	"01938"	"GAA_000166"	"g.78090796_78090797del"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80116997_80116998del"	""	"pathogenic (recessive)"	""
"0000164132"	"0"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01938"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Beesley 1998:10206684}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000164133"	"0"	"10"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01938"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Huie 1994c:07981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"benign"	""
"0000164134"	"0"	"10"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01938"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"benign"	""
"0000164135"	"0"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01938"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Beesley 1998:10206684}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic (recessive)"	""
"0000164136"	"0"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01938"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Huie 1998:09535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic (recessive)"	""
"0000164137"	"0"	"90"	"17"	"78090880"	"78090880"	"subst"	"0"	"01938"	"GAA_000049"	"g.78090880C>G"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117081C>G"	""	"pathogenic (recessive)"	""
"0000164138"	"3"	"90"	"17"	"78090880"	"78090880"	"subst"	"0"	"01938"	"GAA_000049"	"g.78090880C>G"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117081C>G"	""	"pathogenic (recessive)"	""
"0000164139"	"0"	"90"	"17"	"78090910"	"78090910"	"subst"	"0"	"01938"	"GAA_000058"	"g.78090910T>C"	""	"{PMID:Hermans 1997:09425285}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>C"	""	"pathogenic (recessive)"	""
"0000164140"	"0"	"90"	"17"	"78090912"	"78090912"	"subst"	"0"	"01938"	"GAA_000165"	"g.78090912A>G"	""	"2006"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117113A>G"	""	"pathogenic (recessive)"	""
"0000164141"	"0"	"10"	"17"	"78091405"	"78091405"	"subst"	"0.718163"	"01938"	"GAA_000009"	"g.78091405G>A"	""	"{PMID:Martiniuk 1990:02111708}"	""	"2338A>G"	""	"Germline"	""	""	"0"	""	""	"g.80117606G>A"	""	"benign"	""
"0000164142"	"0"	"90"	"17"	"78091447"	"78091447"	"del"	"0"	"01938"	"GAA_000085"	"g.78091447del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117648del"	""	"pathogenic (recessive)"	""
"0000164143"	"0"	"90"	"17"	"78091498"	"78091498"	"dup"	"0"	"01938"	"GAA_000059"	"g.78091498dup"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117699dup"	""	"pathogenic (recessive)"	""
"0000164144"	"0"	"90"	"17"	"78091499"	"78091499"	"del"	"4.11828E-6"	"01938"	"GAA_000167"	"g.78091499del"	""	"{PMID:Amartino 2006:16433701}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117700del"	""	"pathogenic (recessive)"	""
"0000164145"	"0"	"10"	"17"	"78091513"	"78091513"	"subst"	"0.0495638"	"01938"	"GAA_000024"	"g.78091513G>A"	""	"{PMID:Hermans 1993:08094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117714G>A"	""	"benign"	""
"0000164146"	"0"	"10"	"17"	"78091513"	"78091513"	"subst"	"0.0495638"	"01938"	"GAA_000024"	"g.78091513G>A"	""	"{PMID:Hermans 1993:08486380}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117714G>A"	""	"benign"	""
"0000164147"	"0"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01938"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Dagnino 2000:10899751}"	""	"deletion exon 18"	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000164150"	"0"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01938"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Van der Kraan 1994:07945303}"	""	"deletion exon 18"	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000164153"	"0"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01938"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Hirschhorn 1999:09950376}"	""	"deletion exon 18"	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000164154"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"01938"	"GAA_000010"	"g.78092063G>A"	""	"{PMID:Martiniuk 1990:02111708}"	""	"2553A>G"	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000164155"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"01938"	"GAA_000010"	"g.78092063G>A"	""	"{PMID:Hoefsloot 1990:02268276}"	""	"2553A>G"	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000164156"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"01938"	"GAA_000010"	"g.78092063G>A"	""	"{PMID:Hermans 1993:08094613}"	""	"2553A>G"	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000164157"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01938"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Castro-Gago 1999:10528311}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164158"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01938"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164159"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01938"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Hermans 1993:08094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164160"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01938"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Becker 1998:09529346}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164161"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01942"	"GAA_000025"	"g.78092070C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164162"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01942"	"GAA_000025"	"g.78092070C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164163"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01942"	"GAA_000025"	"g.78092070C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164164"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01942"	"GAA_000025"	"g.78092070C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000164165"	"0"	"90"	"17"	"78092149"	"78092149"	"subst"	"0"	"01938"	"GAA_000144"	"g.78092149C>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118350C>A"	""	"pathogenic (recessive)"	""
"0000164166"	"0"	"50"	"17"	"78092158"	"78092159"	"del"	"0"	"01938"	"GAA_000168"	"g.78092158_78092159del"	""	"{PMID:Montalvo 2006:16917947}"	""	"2646_2646+1delTG"	""	"Germline"	""	""	"0"	""	""	"g.80118359_80118360del"	""	"VUS"	""
"0000164167"	"0"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01938"	"GAA_000107"	"g.78092158T>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic (recessive)"	""
"0000164168"	"0"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01938"	"GAA_000107"	"g.78092158T>A"	""	"{PMID:Huie 2002:11854868}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic (recessive)"	""
"0000164169"	"0"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01938"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Kostera-Pruszczyk 2006:16531044}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000164170"	"0"	"90"	"17"	"78092507"	"78092507"	"subst"	"0"	"01938"	"GAA_000145"	"g.78092507T>A"	""	"{PMID:Kroos 2004:15145338}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118708T>A"	""	"pathogenic (recessive)"	""
"0000164171"	"0"	"90"	"17"	"78092512"	"78092514"	"del"	"0"	"01938"	"GAA_000051"	"g.78092512_78092514del"	""	"{PMID:Raben 1995:07603531}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118713_80118715del"	""	"pathogenic (recessive)"	""
"0000164172"	"3"	"90"	"17"	"78092546"	"78092546"	"delins"	"0"	"01938"	"GAA_000050"	"g.78092546delinsCAG"	""	"{PMID:Reuser  1995:07603530}, {PMID:Hermans 1998:09521422}"	""	"2741AG>CAGG"	""	"Germline"	""	""	"0"	""	""	"g.80118747delinsCAG"	""	"pathogenic (recessive)"	""
"0000164173"	"0"	"90"	"17"	"78092563"	"78092580"	"dup"	"0"	"01938"	"GAA_000074"	"g.78092563_78092580dup"	""	"{PMID:Beesley 1998:10206684}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118764_80118781dup"	""	"pathogenic (recessive)"	""
"0000164174"	"0"	"10"	"17"	"78092585"	"78092585"	"subst"	"0.0186771"	"01938"	"GAA_000026"	"g.78092585C>T"	""	"{PMID:Hermans 1993:08094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118786C>T"	""	"benign"	""
"0000164175"	"0"	"10"	"17"	"78092585"	"78092585"	"subst"	"0.0186771"	"01938"	"GAA_000026"	"g.78092585C>T"	""	"{PMID:Hermans 1993:08486380}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118786C>T"	""	"benign"	""
"0000164176"	"0"	"10"	"17"	"78093079"	"78093079"	"subst"	"0"	"01938"	"GAA_000052"	"g.78093079C>T"	""	"{PMID:Reuser  1995:07603530}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119280C>T"	""	"benign"	""
"0000164177"	"0"	"90"	"17"	"78093086"	"78093087"	"del"	"0"	"01938"	"GAA_000086"	"g.78093086_78093087del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119287_80119288del"	""	"pathogenic (recessive)"	""
"0000164178"	"0"	"90"	"17"	"78093117"	"78093117"	"subst"	"4.0624E-6"	"01938"	"GAA_000075"	"g.78093117T>A"	""	"{PMID:Becker 1998:09529346}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119318T>A"	""	"pathogenic (recessive)"	""
"0000164179"	"0"	"10"	"17"	"78093133"	"78093133"	"subst"	"0.0488615"	"01938"	"GAA_000027"	"g.78093133G>A"	""	"{PMID:Hermans 1993:08094613}"	""	"2862G>A"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119334G>A"	""	"benign"	""
"0000164180"	"0"	"10"	"17"	"78093133"	"78093133"	"subst"	"0.0488615"	"01938"	"GAA_000027"	"g.78093133G>A"	""	"{PMID:Hermans 1993:08486380}"	""	"2862G>A"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119334G>A"	""	"benign"	""
"0000164181"	"0"	"10"	"17"	"78093221"	"78093221"	"subst"	"0"	"01938"	"GAA_000118"	"g.78093221G>A"	""	"{PMID:Pipo 2003:14643388}"	""	"2950G>A"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119422G>A"	""	"benign"	""
"0000164182"	"0"	"10"	"17"	"78093270"	"78093270"	"del"	"0"	"01938"	"GAA_000015"	"g.78093270del"	""	"{PMID:Hoefsloot 1990:02268276}"	""	"2999del"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119471del"	""	"benign"	""
"0000164183"	"0"	"10"	"17"	"78093273"	"78093273"	"subst"	"0"	"01938"	"GAA_000011"	"g.78093273C>T"	""	"{PMID:Martiniuk 1990:02111708}"	""	"3002C>T"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119474C>T"	""	"benign"	""
"0000164184"	"0"	"10"	"17"	"78093353"	"78093353"	"subst"	"0"	"01938"	"GAA_000012"	"g.78093353C>T"	""	"{PMID:Martiniuk 1990:02111708}"	""	"3082C>T"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119554C>T"	""	"benign"	""
"0000164185"	"0"	"10"	"17"	"78093357"	"78093357"	"subst"	"0"	"01938"	"GAA_000013"	"g.78093357G>C"	""	"{PMID:Martiniuk 1990:02111708}"	""	"3086G>C"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119558G>C"	""	"benign"	""
"0000164186"	"0"	"10"	"17"	"78093357"	"78093357"	"subst"	"0"	"01938"	"GAA_000013"	"g.78093357G>C"	""	"{PMID:Hoefsloot 1990:02268276}"	""	"3086G>C"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119558G>C"	""	"benign"	""
"0000164187"	"0"	"10"	"17"	"78093548"	"78093548"	"subst"	"0"	"01938"	"GAA_000014"	"g.78093548T>C"	""	"{PMID:Martiniuk 1990:02111708}"	""	"3277T>C"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119749T>C"	""	"benign"	""
"0000164188"	"0"	"10"	"17"	"78093548"	"78093548"	"subst"	"0"	"01938"	"GAA_000014"	"g.78093548T>C"	""	"{PMID:Hoefsloot 1990:02268276}"	""	"3277T>C"	"in 3\'UTR"	"Germline"	""	""	"0"	""	""	"g.80119749T>C"	""	"benign"	""
"0000164189"	"3"	"90"	"17"	"78092546"	"78092546"	"delins"	"0"	"00006"	"GAA_000050"	"g.78092546delinsCAG"	""	"{PMID:Hermans 1998:09521422}"	""	"2741AG>CAGG"	""	"Germline"	""	""	"0"	""	""	"g.80118747delinsCAG"	""	"pathogenic (recessive)"	""
"0000164190"	"3"	"90"	"17"	"78092546"	"78092546"	"delins"	"0"	"00006"	"GAA_000050"	"g.78092546delinsCAG"	""	"{PMID:Hermans 1998:09521422}"	""	"2741AG>CAGG"	""	"Germline"	""	""	"0"	""	""	"g.80118747delinsCAG"	""	"pathogenic (recessive)"	""
"0000164191"	"3"	"10"	"17"	"78086757"	"78086757"	"subst"	"0"	"00006"	"GAA_000183"	"g.78086757G>A"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112958G>A"	""	"benign"	""
"0000164192"	"3"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"00006"	"GAA_000010"	"g.78092063G>A"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000164193"	"0"	"10"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00006"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"likely benign"	""
"0000164194"	"0"	"10"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"00006"	"GAA_000004"	"g.78079597A>G"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105798A>G"	""	"benign"	""
"0000164195"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"00006"	"GAA_000038"	"g.78079669G>A"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000164196"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"00006"	"GAA_000010"	"g.78092063G>A"	""	"{PMID:Hermans 1998:09521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000164197"	"0"	"90"	"17"	"78085841"	"78085841"	"subst"	"0"	"00006"	"GAA_000046"	"g.78085841T>C"	""	"{PMID:Hermans 1998:09521422}"	""	""	"COS cell cDNA expression cloning shows no lysosomal alpha-glucosidase activity, severely impaired GAA-protein maturation and reduced secretion"	"In vitro (cloned)"	"-"	""	"0"	""	""	"g.80112042T>C"	""	"NA"	""
"0000164198"	"0"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"00006"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Hermans 1998:09521422}"	""	"G643R"	"COS cell cDNA expression cloning shows no lysosomal alpha-glucosidase activity, severely impaired GAA-protein maturation and no secretion"	"In vitro (cloned)"	"-"	""	"0"	""	""	"g.80112914G>A"	""	"NA"	""
"0000164199"	"0"	"90"	"17"	"78090880"	"78090880"	"subst"	"0"	"00006"	"GAA_000049"	"g.78090880C>G"	""	"{PMID:Hermans 1998:09521422}"	""	"P768R"	"COS cell cDNA expression cloning shows no lysosomal alpha-glucosidase activity, severely impaired GAA-protein maturation and no secretion"	"In vitro (cloned)"	"-"	""	"0"	""	""	"g.80117081C>G"	""	"NA"	""
"0000168219"	"0"	"70"	"17"	"78086451"	"78086451"	"subst"	"0"	"01939"	"GAA_000201"	"g.78086451C>T"	"MAF not reported"	"{Pompe:911}"	""	""	"predicted less severe phenotype, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 99.13-GD: 64.43), SIFT deleterious (score: 0.02), Mutation Taster polymorphism (p-value: 0.873)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112652C>T"	""	"likely pathogenic"	"ACMG"
"0000168220"	"0"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01939"	"GAA_000108"	"g.78079671C>T"	"MAF <0.01"	"{Pompe:640}"	""	""	"predicted less severe phenotype, classic infantile/childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 54.02-GD: 101.29), SIFT deleterious (score: 0), Mutation Taster polymorphism (p-value: 0.886)"	"SUMMARY record"	""	"rs757700700"	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	"ACMG"
"0000168221"	"0"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01939"	"GAA_000114"	"g.78082610C>T"	"MAF <0.01"	"{Pompe:766}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 98.89-GD: 126.72), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.998)"	"SUMMARY record"	""	"rs770610356"	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	"ACMG"
"0000168222"	"0"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01939"	"GAA_000092"	"g.78086420C>T"	"MAF not reported"	"{Pompe:896}"	""	""	"predicted less severe phenotype, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 179.53), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	"ACMG"
"0000168223"	"0"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01939"	"GAA_000070"	"g.78086800C>T"	"MAF <0.01"	"{Pompe:953}"	""	""	"predicted less severe phenotype, childhood/adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 101.29), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs757111744"	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	"ACMG"
"0000168224"	"0"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01939"	"GAA_000023"	"g.78087149C>T"	"MAF <0.01"	"{Pompe:981}"	""	""	"predicted less severe phenotype, childhood/adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 127.11-GD: 65.28), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs121907938"	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	"ACMG"
"0000168225"	"0"	"50"	"17"	"78081516"	"78081516"	"subst"	"0"	"01939"	"GAA_000202"	"g.78081516C>T"	"MAF not reported"	"{Pompe:674}"	""	""	"predicted less severe phenotype, childhood/adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 93.73-GD: 34.34), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107717C>T"	""	"VUS"	"ACMG"
"0000168226"	"0"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01939"	"GAA_000033"	"g.78084822C>T"	"MAF <0.01"	"{Pompe:850}"	""	""	"predicted less severe phenotype, childhood/adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 208.63-GD: 94.04), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs121907942"	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	"ACMG"
"0000168227"	"0"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01939"	"GAA_000115"	"g.78086479C>G"	"MAF not reported"	"{Pompe:921}"	""	""	"predicted less severe phenotype, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 99.13-GD: 95.56), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.915)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	"ACMG"
"0000168228"	"0"	"70"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"01939"	"GAA_000159"	"g.78086478G>A"	"MAF <0.01"	"{Pompe:920}"	""	""	"predicted less severe phenotype, childhood/adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 99.13-GD: 45.82), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.99)"	"SUMMARY record"	""	"rs753269119"	"0"	""	""	"g.80112679G>A"	""	"likely pathogenic"	"ACMG"
"0000168229"	"0"	"70"	"17"	"78083854"	"78083854"	"subst"	"4.09185E-6"	"01939"	"GAA_000203"	"g.78083854G>A"	"MAF not reported"	"{Pompe:797}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing) ; Align GVGD class C25 (GV: 32.40-GD: 65.72), SIFT tolerated (score: 0.06), Mutation Taster disease causing (p-value: 0.998)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110055G>A"	""	"likely pathogenic"	"ACMG"
"0000168231"	"0"	"90"	"17"	"78079698"	"78079698"	"subst"	"4.26294E-6"	"01939"	"GAA_000205"	"g.78079698G>T"	"MAF <0.01"	"{Pompe:646}"	""	""	"predicted less severe phenotype, adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs763027848"	"0"	""	""	"g.80105899G>T"	""	"pathogenic"	"ACMG"
"0000168232"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"01939"	"GAA_000038"	"g.78079669G>A"	"MAF >0.05"	"{Pompe:639}"	""	"668A>G (His223Arg)"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 102.71-GD: 0.00), SIFT tolerated (score: 0.07), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs1042395"	"0"	""	""	"g.80105870G>A"	""	"benign"	"ACMG"
"0000168233"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01939"	"GAA_000008"	"g.78084769G>A"	"MAF >0.05"	"{Pompe:845}"	""	"1581A>G"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1042396"	"0"	""	""	"g.80110970G>A"	""	"benign"	"ACMG"
"0000168234"	"0"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"01939"	"GAA_000002"	"g.78078709T>C"	"MAF >0.05"	"{Pompe:594}"	""	"324C>T"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1800300"	"0"	""	""	"g.80104910T>C"	""	"benign"	"ACMG"
"0000168235"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"01939"	"GAA_000006"	"g.78082504G>A"	"MAF >0.05"	"{Pompe:751}"	""	"1203A>G"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1800304"	"0"	""	""	"g.80108705G>A"	""	"benign"	"ACMG"
"0000168236"	"0"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"01939"	"GAA_000035"	"g.78087041G>A"	"MAF >0.05"	"{Pompe:964}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 130.85-GD: 34.45), SIFT tolerated (score: 0.09), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs1800309"	"0"	""	""	"g.80113242G>A"	""	"benign"	"ACMG"
"0000168237"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"01939"	"GAA_000010"	"g.78092063G>A"	"MAF >0.05"	"{Pompe:1045}"	""	"2553A>G"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1042397"	"0"	""	""	"g.80118264G>A"	""	"benign"	"ACMG"
"0000168238"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"01939"	"GAA_000005"	"g.78079643C>T"	"MAF >0.05"	"{Pompe:636}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1800301"	"0"	""	""	"g.80105844C>T"	""	"benign"	"ACMG"
"0000168239"	"0"	"50"	"17"	"78081474"	"78081474"	"subst"	"0"	"01939"	"GAA_000208"	"g.78081474A>G"	"MAF not reported"	"{Pompe:668}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 137.69-GD: 0.00), SIFT tolerated (score: 1), Mutation Taster polymorphism (p-value: 0.983)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107675A>G"	""	"VUS"	"ACMG"
"0000168240"	"0"	"50"	"17"	"78087108"	"78087108"	"subst"	"0.000101169"	"01939"	"GAA_000209"	"g.78087108C>G"	"MAF <0.01"	"{Pompe:972}"	""	""	"predicted non-pathogenic, childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C15 (GV: 57.75-GD: 67.34), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs759292700"	"0"	""	""	"g.80113309C>G"	""	"VUS"	"ACMG"
"0000168241"	"0"	"10"	"17"	"78092585"	"78092585"	"subst"	"0.0186771"	"01939"	"GAA_000026"	"g.78092585C>T"	"MAF >0.05"	"{Pompe:1065}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 57.75-GD: 89.28), SIFT deleterious (score: 0.01), Mutation Taster polymorphism (p-value: 0.863)"	"SUMMARY record"	""	"rs1800315"	"0"	""	""	"g.80118786C>T"	""	"benign"	"ACMG"
"0000168242"	"0"	"10"	"17"	"78091513"	"78091513"	"subst"	"0.0495638"	"01939"	"GAA_000024"	"g.78091513G>A"	"MAF >0.05"	"{Pompe:1035}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 235.27-GD: 0.00), SIFT tolerated (score: 0.35), Mutation Taster polymorphism (p-value: 0.999)"	"SUMMARY record"	""	"rs1800314"	"0"	""	""	"g.80117714G>A"	""	"benign"	"ACMG"
"0000168243"	"0"	"70"	"17"	"78081415"	"78081415"	"subst"	"0.000349525"	"01939"	"GAA_000210"	"g.78081415C>T"	"MAF <0.01"	"{Pompe:659}"	""	""	"predicted presumably non-pathogenic, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 109.21-GD: 82.68), SIFT deleterious (score: 0.02), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs200856561"	"0"	""	""	"g.80107616C>T"	""	"likely pathogenic"	"ACMG"
"0000168244"	"0"	"70"	"17"	"78081424"	"78081424"	"subst"	"0.000195078"	"01939"	"GAA_000211"	"g.78081424C>T"	"MAF <0.01"	"{Pompe:660}"	""	""	"predicted presumably non-pathogenic, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 144.08), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs577915581"	"0"	""	""	"g.80107625C>T"	""	"likely pathogenic"	"ACMG"
"0000168245"	"0"	"50"	"17"	"78085899"	"78085899"	"subst"	"1.21935E-5"	"01939"	"GAA_000212"	"g.78085899G>A"	"MAF <0.01"	"{Pompe:884}"	""	""	"predicted less severe phenotype, childhood/adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 173.88-GD: 0.00), SIFT tolerated (score: 0.56), Mutation Taster disease causing (p-value: 0.997)"	"SUMMARY record"	""	"rs747373179"	"0"	""	""	"g.80112100G>A"	""	"VUS"	"ACMG"
"0000168246"	"0"	"70"	"17"	"78084544"	"78084544"	"subst"	"0"	"01939"	"GAA_000213"	"g.78084544G>C"	"MAF not reported"	"{Pompe:811}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 93.66-GD: 26.78), SIFT tolerated (score: 0.07), Mutation Taster disease causing (p-value: 0.977)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110745G>C"	""	"likely pathogenic"	"ACMG"
"0000168247"	"0"	"50"	"17"	"78079672"	"78079672"	"subst"	"4.19041E-6"	"01939"	"GAA_000214"	"g.78079672G>C"	"MAF not reported"	"{Pompe:641}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 54.02-GD: 67.63), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105873G>C"	""	"VUS"	"ACMG"
"0000168248"	"0"	"70"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"01939"	"GAA_000215"	"g.78086403G>A"	"MAF <0.01"	"{Pompe:893}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 28.82), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs775450536"	"0"	""	""	"g.80112604G>A"	""	"likely pathogenic"	"ACMG"
"0000168249"	"0"	"70"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"01939"	"GAA_000216"	"g.78086403G>C"	"MAF <0.01"	"{Pompe:892}"	""	""	"predicted potentially less severe, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 102.71), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs775450536"	"0"	""	""	"g.80112604G>C"	""	"likely pathogenic"	"ACMG"
"0000168250"	"0"	"70"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"01939"	"GAA_000081"	"g.78086421G>A"	"MAF <0.01"	"{Pompe:897}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 28.82), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs377544304"	"0"	""	""	"g.80112622G>A"	""	"likely pathogenic"	"ACMG"
"0000168251"	"0"	"70"	"17"	"78087080"	"78087080"	"subst"	"0"	"01939"	"GAA_000143"	"g.78087080C>T"	"MAF not reported"	"{Pompe:968}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 102.71-GD: 149.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113281C>T"	""	"likely pathogenic"	"ACMG"
"0000168252"	"0"	"70"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01939"	"GAA_000155"	"g.78084553G>A"	"MAF <0.01"	"{Pompe:814}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 0.00-GD: 23.01), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs398123169"	"0"	""	""	"g.80110754G>A"	""	"likely pathogenic"	"ACMG"
"0000168253"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01939"	"GAA_000068"	"g.78086719G>A"	"MAF <0.01"	"{Pompe:936}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C15 (GV: 0.00-GD: 23.01), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs368438393"	"0"	""	""	"g.80112920G>A"	""	"pathogenic"	"ACMG"
"0000168254"	"0"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01939"	"GAA_000020"	"g.78086721C>A"	"MAF <0.01"	"{Pompe:938}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C35 (GV: 0.00-GD: 44.60), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.923)"	"SUMMARY record"	""	"rs28940868"	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	"ACMG"
"0000168255"	"0"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01939"	"GAA_000119"	"g.78078692T>G"	"MAF not reported"	"{Pompe:590}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 138.77-GD: 66.46), SIFT tolerated (score: 0.45), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	"ACMG"
"0000168256"	"0"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01939"	"GAA_000034"	"g.78086727C>G"	"MAF <0.01"	"{Pompe:939}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 195.00-GD: 116.53), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs776948121"	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	"ACMG"
"0000168257"	"0"	"70"	"17"	"78090805"	"78090805"	"subst"	"0"	"01939"	"GAA_000217"	"g.78090805A>G"	"MAF not reported"	"{Pompe:994}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 223.30-GD: 39.51), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117006A>G"	""	"likely pathogenic"	"ACMG"
"0000168258"	"0"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01939"	"GAA_000100"	"g.78081447G>A"	"MAF <0.01"	"{Pompe:665}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 29.27-GD: 51.63), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.998)"	"SUMMARY record"	""	"rs201896815"	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	"ACMG"
"0000168259"	"0"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01939"	"GAA_000017"	"g.78084749G>A"	"MAF <0.01"	"{Pompe:838}"	""	""	"predicted potentially less severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C55 (GV: 0.00-GD: 56.87), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs121907937"	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	"ACMG"
"0000168260"	"0"	"70"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"01939"	"GAA_000137"	"g.78085880G>A"	"MAF not reported"	"{Pompe:881}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 121.34-GD: 34.45), SIFT tolerated (score: 0.16), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112081G>A"	""	"likely pathogenic"	"ACMG"
"0000168261"	"0"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01939"	"GAA_000099"	"g.78079656G>A"	"MAF <0.01"	"{Pompe:638}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C25 (GV: 60.00-GD: 97.30), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs370950728"	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	"ACMG"
"0000168262"	"0"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01939"	"GAA_000126"	"g.78081617G>A"	"MAF <0.01"	"{Pompe:685}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs121907945"	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	"ACMG"
"0000168263"	"0"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01939"	"GAA_000065"	"g.78081665G>A"	"MAF <0.01"	"{Pompe:694}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C25 (GV: 55.27-GD: 95.76), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs543300039"	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	"ACMG"
"0000168264"	"0"	"50"	"17"	"78082136"	"78082136"	"subst"	"4.06299E-6"	"01939"	"GAA_000218"	"g.78082136G>A"	"MAF <0.01"	"{Pompe:709}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs202095215"	"0"	""	""	"g.80108337G>A"	""	"VUS"	"ACMG"
"0000168265"	"0"	"70"	"17"	"78083849"	"78083849"	"subst"	"4.08881E-6"	"01939"	"GAA_000041"	"g.78083849G>A"	"MAF <0.01"	"{Pompe:795}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs778068209"	"0"	""	""	"g.80110050G>A"	""	"likely pathogenic"	"ACMG"
"0000168266"	"0"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01939"	"GAA_000082"	"g.78086465G>A"	"MAF <0.01"	"{Pompe:917}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs549029029"	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	"ACMG"
"0000168267"	"0"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01939"	"GAA_000066"	"g.78086698G>T"	"MAF <0.01"	"{Pompe:928}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C65 (GV: 0.00-GD: 183.79), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs757617999"	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	"ACMG"
"0000168268"	"0"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01939"	"GAA_000021"	"g.78086713G>A"	"MAF <0.01"	"{Pompe:932}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs28937909"	"0"	""	""	"g.80112914G>A"	""	"pathogenic"	"ACMG"
"0000168269"	"0"	"70"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01939"	"GAA_000067"	"g.78086728G>A"	"MAF <0.01"	"{Pompe:940}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C55 (GV: 0.00-GD: 55.27), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs536906561"	"0"	""	""	"g.80112929G>A"	""	"likely pathogenic"	"ACMG"
"0000168270"	"0"	"50"	"17"	"78081611"	"78081611"	"subst"	"3.31738E-5"	"01939"	"GAA_000219"	"g.78081611C>T"	"MAF <0.01"	"{Pompe:681}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 14.30-GD: 21.28), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.815)"	"SUMMARY record"	""	"rs773417785"	"0"	""	""	"g.80107812C>T"	""	"VUS"	"ACMG"
"0000168271"	"0"	"70"	"17"	"78081612"	"78081612"	"subst"	"0"	"01939"	"GAA_000220"	"g.78081612T>C"	"MAF not reported"	"{Pompe:683}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 14.30-GD: 86.59), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107813T>C"	""	"likely pathogenic"	"ACMG"
"0000168272"	"0"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01939"	"GAA_000221"	"g.78081636T>C"	"MAF not reported"	"{Pompe:689}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 21.82-GD: 95.38), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	"ACMG"
"0000168273"	"0"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01939"	"GAA_000129"	"g.78082197T>C"	"MAF <0.01"	"{Pompe:715}"	""	""	"predicted potentially less severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C0 (GV: 120.48-GD: 28.88), SIFT tolerated (score: 0.08), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs766074609"	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	"ACMG"
"0000168274"	"0"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01939"	"GAA_000105"	"g.78085800T>C"	"MAF <0.01"	"{Pompe:860}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 234.72-GD: 50.17), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs779556619"	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	"ACMG"
"0000168275"	"0"	"50"	"17"	"78081693"	"78081693"	"subst"	"0"	"01939"	"GAA_000222"	"g.78081693T>A"	"MAF not reported"	"{Pompe:699}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 89.28-GD: 44.44), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107894T>A"	""	"VUS"	"ACMG"
"0000168276"	"0"	"70"	"17"	"78082523"	"78082523"	"subst"	"8.20136E-6"	"01939"	"GAA_000102"	"g.78082523A>G"	"MAF <0.01"	"{Pompe:758}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 101.00-GD: 0.00), SIFT tolerated (score: 0.69), Mutation Taster polymorphism (p-value: 0.992)"	"SUMMARY record"	""	"rs560575383"	"0"	""	""	"g.80108724A>G"	""	"likely pathogenic"	"ACMG"
"0000168277"	"0"	"50"	"17"	"78082173"	"78082173"	"subst"	"0"	"01939"	"GAA_000223"	"g.78082173C>G"	"MAF not reported"	"{Pompe:711}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 95.38-GD: 46.14), SIFT tolerated (score: 0.13), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108374C>G"	""	"VUS"	"ACMG"
"0000168278"	"0"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01939"	"GAA_000113"	"g.78082294C>T"	"MAF <0.01"	"{Pompe:723}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs755253527"	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	"ACMG"
"0000168279"	"0"	"70"	"17"	"78086463"	"78086463"	"subst"	"1.66199E-5"	"01939"	"GAA_000224"	"g.78086463C>A"	"MAF <0.01"	"{Pompe:916}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 77.74), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs369531647"	"0"	""	""	"g.80112664C>A"	""	"likely pathogenic"	"ACMG"
"0000168280"	"0"	"70"	"17"	"78084529"	"78084529"	"subst"	"1.62624E-5"	"01939"	"GAA_000080"	"g.78084529T>C"	"MAF <0.01"	"{Pompe:805}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 101.29), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs772883420"	"0"	""	""	"g.80110730T>C"	""	"likely pathogenic"	"ACMG"
"0000168281"	"0"	"70"	"17"	"78090814"	"78090814"	"subst"	"6.10227E-5"	"01939"	"GAA_000225"	"g.78090814G>C"	"MAF not reported"	"{Pompe:997}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 268.54-GD: 61.50), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117015G>C"	""	"likely pathogenic"	"ACMG"
"0000168282"	"0"	"70"	"17"	"78083813"	"78083813"	"subst"	"0"	"01939"	"GAA_000226"	"g.78083813G>T"	"MAF not reported"	"{Pompe:791}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 0.00-GD: 48.95), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110014G>T"	""	"likely pathogenic"	"ACMG"
"0000168283"	"0"	"70"	"17"	"78087081"	"78087081"	"subst"	"5.51369E-5"	"01939"	"GAA_000227"	"g.78087081G>A"	"MAF <0.01"	"{Pompe:969}"	""	""	"predicted potentially mild, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 102.71-GD: 0.00), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs398123172"	"0"	""	""	"g.80113282G>A"	""	"likely pathogenic"	"ACMG"
"0000168284"	"0"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01939"	"GAA_000228"	"g.78082617T>A"	"MAF <0.01"	"{Pompe:769}"	""	""	"predicted potentially mild, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 28.68-GD: 90.65), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.978)"	"SUMMARY record"	""	"rs747610090"	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	"ACMG"
"0000168285"	"0"	"70"	"17"	"78084762"	"78084762"	"subst"	"0"	"01939"	"GAA_000229"	"g.78084762T>A"	"MAF not reported"	"{Pompe:844}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 0.00-GD: 21.61), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110963T>A"	""	"likely pathogenic"	"ACMG"
"0000168286"	"0"	"70"	"17"	"78081459"	"78081459"	"subst"	"0"	"01939"	"GAA_000230"	"g.78081459C>T"	"MAF not reported"	"{Pompe:667}"	""	""	"predicted potentially mild, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 99.44-GD: 0.00), SIFT tolerated (score: 0.85), Mutation Taster disease causing (p-value: 0.603)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107660C>T"	""	"likely pathogenic"	"ACMG"
"0000168287"	"0"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01939"	"GAA_000036"	"g.78090815G>C"	"MAF <0.01"	"{Pompe:999}"	""	""	"predicted potentially mild, childhood/adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 268.54-GD: 1.62), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs1800312"	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	"ACMG"
"0000168288"	"0"	"70"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01939"	"GAA_000077"	"g.78081615A>G"	"MAF not reported"	"{Pompe:684}"	""	""	"predicted potentially mild, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 193.72), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.997)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107816A>G"	""	"likely pathogenic"	"ACMG"
"0000168289"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01939"	"GAA_000029"	"g.78078341T>G"	"MAF <0.01"	"{Pompe:568}"	""	""	"predicted potentially mild, childhood/adult phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing)"	"SUMMARY record"	""	"rs386834236"	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	"ACMG"
"0000168290"	"0"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01939"	"GAA_000057"	"g.78082266T>G"	"MAF <0.01"	"{Pompe:719}"	""	""	"predicted potentially mild, childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs762260678"	"0"	""	""	"g.80108467T>G"	""	"pathogenic"	"ACMG"
"0000168291"	"0"	"10"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"01939"	"GAA_000045"	"g.78085871G>A"	"MAF >0.05"	"{Pompe:878}"	""	""	"predicted presumably non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C55 (GV: 0.00-GD: 55.27), SIFT deleterious (score: 0), Mutation Taster polymorphism (p-value: 0)"	"SUMMARY record"	""	"rs1800307"	"0"	""	""	"g.80112072G>A"	""	"benign"	"ACMG"
"0000168292"	"0"	"50"	"17"	"78086826"	"78086826"	"subst"	"0"	"01939"	"GAA_000231"	"g.78086826G>A"	"MAF not reported"	"{Pompe:956}"	""	""	"predicted less severe phenotype, childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113027G>A"	""	"VUS"	"ACMG"
"0000168293"	"0"	"70"	"17"	"78078888"	"78078888"	"subst"	"0.000121725"	"01939"	"GAA_000232"	"g.78078888G>A"	"MAF <0.01"	"{Pompe:613}"	""	""	"prediction unknown, childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 115.59-GD: 0.00), SIFT tolerated (score: 0.41), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs376685205"	"0"	""	""	"g.80105089G>A"	""	"likely pathogenic"	"ACMG"
"0000168294"	"0"	"90"	"17"	"78087016"	"78087016"	"subst"	"0"	"01939"	"GAA_000233"	"g.78087016G>A"	"MAF <0.01"	"{Pompe:961}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs760731229"	"0"	""	""	"g.80113217G>A"	""	"pathogenic"	"ACMG"
"0000168295"	"0"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01939"	"GAA_000056"	"g.78078503C>T"	"MAF <0.01"	"{Pompe:578}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs767409395"	"0"	""	""	"g.80104704C>T"	""	"pathogenic"	"ACMG"
"0000168296"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01939"	"GAA_000025"	"g.78092070C>T"	"MAF <0.01"	"{Pompe:1046}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs121907943"	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	"ACMG"
"0000168297"	"0"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"01939"	"GAA_000234"	"g.78092118C>T"	"MAF <0.01"	"{Pompe:1049}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs780321415"	"0"	""	""	"g.80118319C>T"	""	"pathogenic"	"ACMG"
"0000168298"	"0"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"01939"	"GAA_000060"	"g.78078643dup"	"MAF <0.01"	"{Pompe:585}"	""	"258dupC"	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs886042496"	"0"	""	""	"g.80104844dup"	""	"pathogenic"	"ACMG"
"0000168299"	"0"	"90"	"17"	"78078764"	"78078765"	"del"	"0"	"01939"	"GAA_000062"	"g.78078764_78078765del"	"MAF not reported"	"{Pompe:601}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104965_80104966del"	""	"pathogenic"	"ACMG"
"0000168300"	"0"	"90"	"17"	"78090846"	"78090846"	"subst"	"0"	"01939"	"GAA_000236"	"g.78090846C>T"	"MAF not reported"	"{Pompe:1004}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117047C>T"	""	"pathogenic"	"ACMG"
"0000168301"	"0"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01939"	"GAA_000028"	"g.78078910del"	"MAF <0.01"	"{Pompe:616}"	""	"525delT"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs386834235"	"0"	""	""	"g.80105111del"	""	"pathogenic"	"ACMG"
"0000168302"	"0"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01939"	"GAA_000053"	"g.78083828_78083831del"	"MAF <0.01"	"{Pompe:794}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs770276275"	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic"	"ACMG"
"0000168303"	"0"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01939"	"GAA_000073"	"g.78090819dup"	"MAF <0.01"	"{Pompe:1001}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs777275355"	"0"	""	""	"g.80117020dup"	""	"pathogenic"	"ACMG"
"0000168304"	"0"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01939"	"GAA_000169"	"g.78092467G>T"	"MAF <0.01"	"{Pompe:1056}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs765718882"	"0"	""	""	"g.80118668G>T"	""	"pathogenic"	"ACMG"
"0000168305"	"0"	"70"	"17"	"78085814"	"78085814"	"subst"	"0"	"01939"	"GAA_000238"	"g.78085814A>T"	"MAF not reported"	"{Pompe:862}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 234.77-GD: 21.28), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 0.909)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112015A>T"	""	"likely pathogenic"	"ACMG"
"0000168306"	"0"	"90"	"17"	"78085839"	"78085842"	"del"	"0"	"01939"	"GAA_000239"	"g.78085839_78085842del"	"MAF not reported"	"{Pompe:866}"	""	"1694_1697delTCTC"	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112040_80112043del"	""	"pathogenic"	"ACMG"
"0000168307"	"0"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"01939"	"GAA_000055"	"g.78078867_78078868del"	"MAF <0.01"	"{Pompe:611}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs764750389"	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic"	"ACMG"
"0000168308"	"0"	"90"	"17"	"78078621"	"78078631"	"del"	"0"	"01939"	"GAA_000240"	"g.78078621_78078631del"	"MAF not reported"	"{Pompe:583}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104822_80104832del"	""	"pathogenic"	"ACMG"
"0000168309"	"0"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"01939"	"GAA_000241"	"g.78092011_78092012del"	"MAF not reported"	"{Pompe:1041}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic"	"ACMG"
"0000168310"	"0"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01939"	"GAA_000242"	"g.78078762G>A"	"MAF not reported"	"{Pompe:599}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic"	"ACMG"
"0000168311"	"0"	"90"	"17"	"78082340"	"78082341"	"delins"	"0"	"01939"	"GAA_000243"	"g.78082340_78082341delinsC"	"MAF not reported"	"{Pompe:733}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108541_80108542delinsC"	""	"pathogenic"	"ACMG"
"0000168312"	"0"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01939"	"GAA_000134"	"g.78084636G>A"	"MAF <0.01"	"{Pompe:826}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs140826989"	"0"	""	""	"g.80110837G>A"	""	"pathogenic"	"ACMG"
"0000168313"	"0"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01939"	"GAA_000072"	"g.78090814G>A"	"MAF <0.01"	"{Pompe:998}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs752921215"	"0"	""	""	"g.80117015G>A"	""	"pathogenic"	"ACMG"
"0000168314"	"0"	"90"	"17"	"78082195"	"78082195"	"subst"	"0"	"01939"	"GAA_000244"	"g.78082195C>G"	"MAF not reported"	"{Pompe:714}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108396C>G"	""	"pathogenic"	"ACMG"
"0000168315"	"0"	"90"	"17"	"78082184"	"78082184"	"del"	"0"	"01939"	"GAA_000245"	"g.78082184del"	"MAF not reported"	"{Pompe:713}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108385del"	""	"pathogenic"	"ACMG"
"0000168316"	"0"	"90"	"17"	"78083813"	"78083813"	"del"	"0"	"01939"	"GAA_000246"	"g.78083813del"	"MAF not reported"	"{Pompe:790}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110014del"	""	"pathogenic"	"ACMG"
"0000168317"	"0"	"90"	"17"	"78083856"	"78083856"	"subst"	"0"	"01939"	"GAA_000095"	"g.78083856T>C"	"MAF not reported"	"{Pompe:799}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110057T>C"	""	"pathogenic"	"ACMG"
"0000168318"	"0"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01939"	"GAA_000037"	"g.78091658_78092195del"	"MAF not reported"	"{Pompe:1039}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic"	"ACMG"
"0000168319"	"0"	"90"	"17"	"78093112"	"78093112"	"dup"	"0"	"01940"	"GAA_000184"	"g.78093112dup"	"MAF <0.01"	"{Pompe:1071}"	""	"2842insT (L948SfsX70)"	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs763359208"	"0"	""	""	"g.80119313dup"	""	"pathogenic"	"ACMG"
"0000168320"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01939"	"GAA_000030"	"g.78084640G>C"	"MAF not reported"	"{Pompe:827}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic"	"ACMG"
"0000168321"	"0"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01939"	"GAA_000107"	"g.78092158T>A"	"MAF not reported"	"{Pompe:1052}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic"	"ACMG"
"0000168322"	"0"	"90"	"17"	"78083742"	"78083742"	"subst"	"0"	"01939"	"GAA_000247"	"g.78083742A>G"	"MAF not reported"	"{Pompe:775}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109943A>G"	""	"pathogenic"	"ACMG"
"0000168323"	"0"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01939"	"GAA_000151"	"g.78082287G>C"	"MAF not reported"	"{Pompe:721}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic"	"ACMG"
"0000188112"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00006"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	"0.01 copy number of 526g>a mRNA; residual activity in patient fibroblasts 0.03"	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000247854"	"0"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"02325"	"GAA_000022"	"g.78087109A>G"	""	""	""	"GAA(NM_000152.3):c.2133A>G (p.T711=), GAA(NM_000152.5):c.2133A>G (p.T711=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000247975"	"0"	"10"	"17"	"78073355"	"78073355"	"subst"	"0.302713"	"02325"	"CCDC40_000093"	"g.78073355A>G"	""	""	""	"CCDC40(NM_017950.3):c.3210A>G (p.T1070=), CCDC40(NM_017950.4):c.3210A>G (p.T1070=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099556A>G"	""	"benign"	""
"0000247976"	"0"	"10"	"17"	"78073562"	"78073562"	"subst"	"0.451219"	"02325"	"CCDC40_000099"	"g.78073562A>G"	""	""	""	"CCDC40(NM_017950.3):c.3417A>G (p.P1139=), CCDC40(NM_017950.4):c.3417A>G (p.P1139=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099763A>G"	""	"benign"	""
"0000248182"	"0"	"10"	"17"	"78083726"	"78083726"	"subst"	"0.721259"	"02325"	"GAA_000295"	"g.78083726A>G"	""	""	""	"GAA(NM_000152.3):c.1327-18A>G, GAA(NM_000152.5):c.1327-18A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109927A>G"	""	"benign"	""
"0000248214"	"0"	"10"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"02325"	"GAA_000004"	"g.78079597A>G"	""	""	""	"GAA(NM_000152.3):c.596A>G (p.H199R), GAA(NM_000152.5):c.596A>G (p.H199R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105798A>G"	""	"benign"	""
"0000248238"	"0"	"10"	"17"	"78086846"	"78086846"	"subst"	"0.719557"	"02325"	"GAA_000327"	"g.78086846A>G"	""	""	""	"GAA(NM_000152.3):c.2040+20A>G, GAA(NM_000152.5):c.2040+20A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113047A>G"	""	"benign"	""
"0000250636"	"0"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"02326"	"GAA_000022"	"g.78087109A>G"	""	""	""	"GAA(NM_000152.3):c.2133A>G (p.T711=), GAA(NM_000152.5):c.2133A>G (p.T711=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000250691"	"0"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"02326"	"GAA_000018"	"g.78081661A>T"	""	""	""	"GAA(NM_000152.3):c.921A>T (p.A307=), GAA(NM_000152.5):c.921A>T (p.A307=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107862A>T"	""	"benign"	""
"0000250831"	"0"	"90"	"17"	"78082327"	"78082327"	"subst"	"0"	"02326"	"GAA_000287"	"g.78082327A>T"	""	""	""	"GAA(NM_000152.3):c.1115A>T (p.H372L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108528A>T"	""	"pathogenic"	""
"0000250835"	"0"	"90"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"02326"	"GAA_000077"	"g.78081615A>G"	""	""	""	"GAA(NM_000152.3):c.875A>G (p.Y292C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107816A>G"	""	"pathogenic"	""
"0000250885"	"0"	"10"	"17"	"78083726"	"78083726"	"subst"	"0.721259"	"02326"	"GAA_000295"	"g.78083726A>G"	""	""	""	"GAA(NM_000152.3):c.1327-18A>G, GAA(NM_000152.5):c.1327-18A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109927A>G"	""	"benign"	""
"0000250917"	"0"	"10"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"02326"	"GAA_000004"	"g.78079597A>G"	""	""	""	"GAA(NM_000152.3):c.596A>G (p.H199R), GAA(NM_000152.5):c.596A>G (p.H199R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105798A>G"	""	"benign"	""
"0000250941"	"0"	"10"	"17"	"78086846"	"78086846"	"subst"	"0.719557"	"02326"	"GAA_000327"	"g.78086846A>G"	""	""	""	"GAA(NM_000152.3):c.2040+20A>G, GAA(NM_000152.5):c.2040+20A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113047A>G"	""	"benign"	""
"0000252988"	"0"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"01943"	"GAA_000022"	"g.78087109A>G"	""	""	""	"GAA(NM_000152.3):c.2133A>G (p.T711=), GAA(NM_000152.5):c.2133A>G (p.T711=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000253043"	"0"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"01943"	"GAA_000018"	"g.78081661A>T"	""	""	""	"GAA(NM_000152.3):c.921A>T (p.A307=), GAA(NM_000152.5):c.921A>T (p.A307=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107862A>T"	""	"benign"	""
"0000253236"	"0"	"10"	"17"	"78073355"	"78073355"	"subst"	"0.302713"	"01943"	"CCDC40_000093"	"g.78073355A>G"	""	""	""	"CCDC40(NM_017950.3):c.3210A>G (p.T1070=), CCDC40(NM_017950.4):c.3210A>G (p.T1070=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099556A>G"	""	"benign"	""
"0000253237"	"0"	"10"	"17"	"78073562"	"78073562"	"subst"	"0.451219"	"01943"	"CCDC40_000099"	"g.78073562A>G"	""	""	""	"CCDC40(NM_017950.3):c.3417A>G (p.P1139=), CCDC40(NM_017950.4):c.3417A>G (p.P1139=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099763A>G"	""	"benign"	""
"0000253622"	"0"	"10"	"17"	"78078749"	"78078749"	"subst"	"0"	"01943"	"GAA_000255"	"g.78078749A>G"	""	""	""	"GAA(NM_000152.3):c.364A>G (p.M122V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104950A>G"	""	"benign"	""
"0000253643"	"0"	"10"	"17"	"78081608"	"78081608"	"subst"	"8.29394E-6"	"01943"	"GAA_000277"	"g.78081608A>G"	""	""	""	"GAA(NM_000152.3):c.868A>G (p.N290D), GAA(NM_000152.5):c.868A>G (p.(Asn290Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107809A>G"	""	"benign"	""
"0000255386"	"0"	"90"	"17"	"78082327"	"78082327"	"subst"	"0"	"01943"	"GAA_000287"	"g.78082327A>T"	""	""	""	"GAA(NM_000152.3):c.1115A>T (p.H372L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108528A>T"	""	"pathogenic"	""
"0000255390"	"0"	"90"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01943"	"GAA_000077"	"g.78081615A>G"	""	""	""	"GAA(NM_000152.3):c.875A>G (p.Y292C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107816A>G"	""	"pathogenic"	""
"0000255589"	"0"	"90"	"17"	"78092546"	"78092546"	"delins"	"0"	"01943"	"GAA_000050"	"g.78092546delinsCAG"	""	""	""	"GAA(NM_000152.3):c.2741delAinsCAG (p.Q914Pfs*30)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118747delinsCAG"	""	"pathogenic"	""
"0000255656"	"0"	"90"	"17"	"78082194"	"78082194"	"del"	"0"	"01943"	"GAA_000285"	"g.78082194del"	""	""	""	"GAA(NM_000152.3):c.1061delA (p.Y354Sfs*38)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108395del"	""	"pathogenic"	""
"0000255666"	"0"	"90"	"17"	"78085869"	"78085869"	"subst"	"0"	"01943"	"GAA_000313"	"g.78085869A>G"	""	""	""	"GAA(NM_000152.3):c.1724A>G (p.Y575C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112070A>G"	""	"pathogenic"	""
"0000255763"	"0"	"90"	"17"	"78083742"	"78083742"	"subst"	"0"	"01943"	"GAA_000247"	"g.78083742A>G"	""	""	""	"GAA(NM_000152.3):c.1327-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109943A>G"	""	"pathogenic"	""
"0000255764"	"0"	"90"	"17"	"78085780"	"78085780"	"subst"	"0"	"01943"	"GAA_000352"	"g.78085780A>G"	""	""	""	"GAA(NM_000152.3):c.1637-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80111981A>G"	""	"pathogenic"	""
"0000266524"	"0"	"10"	"17"	"78073589"	"78073589"	"subst"	"0.302043"	"02325"	"CCDC40_000101"	"g.78073589T>C"	""	""	""	"CCDC40(NM_017950.3):c.*15T>C, CCDC40(NM_017950.4):c.*15T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099790T>C"	""	"benign"	""
"0000266529"	"0"	"10"	"17"	"78071052"	"78071052"	"subst"	"0.7231"	"02325"	"CCDC40_000091"	"g.78071052T>C"	""	""	""	"CCDC40(NM_017950.3):c.3030T>C (p.D1010=), CCDC40(NM_017950.4):c.3030T>C (p.D1010=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80097253T>C"	""	"benign"	""
"0000272775"	"0"	"10"	"17"	"78073589"	"78073589"	"subst"	"0.302043"	"01943"	"CCDC40_000101"	"g.78073589T>C"	""	""	""	"CCDC40(NM_017950.3):c.*15T>C, CCDC40(NM_017950.4):c.*15T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099790T>C"	""	"benign"	""
"0000272793"	"0"	"10"	"17"	"78071052"	"78071052"	"subst"	"0.7231"	"01943"	"CCDC40_000091"	"g.78071052T>C"	""	""	""	"CCDC40(NM_017950.3):c.3030T>C (p.D1010=), CCDC40(NM_017950.4):c.3030T>C (p.D1010=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80097253T>C"	""	"benign"	""
"0000280948"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"02325"	"GAA_000006"	"g.78082504G>A"	""	""	""	"GAA(NM_000152.3):c.1203G>A (p.Q401=), GAA(NM_000152.5):c.1203G>A (p.Q401=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000280949"	"0"	"10"	"17"	"78084507"	"78084507"	"subst"	"0.67069"	"02325"	"GAA_000300"	"g.78084507G>C"	""	""	""	"GAA(NM_000152.3):c.1438-19G>C, GAA(NM_000152.5):c.1438-19G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110708G>C"	""	"benign"	""
"0000280950"	"0"	"10"	"17"	"78090928"	"78090928"	"subst"	"0.741984"	"02325"	"GAA_000338"	"g.78090928G>A"	""	""	""	"GAA(NM_000152.3):c.2331+20G>A, GAA(NM_000152.5):c.2331+20G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117129G>A"	""	"benign"	""
"0000280951"	"0"	"10"	"17"	"78091405"	"78091405"	"subst"	"0.718163"	"02325"	"GAA_000009"	"g.78091405G>A"	""	""	""	"GAA(NM_000152.3):c.2338G>A (p.V780I), GAA(NM_000152.5):c.2338G>A (p.V780I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117606G>A"	""	"benign"	""
"0000280952"	"0"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"02325"	"GAA_000002"	"g.78078709T>C"	""	""	""	"GAA(NM_000152.3):c.324T>C (p.C108=), GAA(NM_000152.5):c.324T>C (p.C108=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104910T>C"	""	"benign"	""
"0000280953"	"0"	"10"	"17"	"78079544"	"78079544"	"subst"	"0.669863"	"02325"	"GAA_000258"	"g.78079544C>G"	""	""	""	"GAA(NM_000152.3):c.547-4C>G, GAA(NM_000152.5):c.547-4C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105745C>G"	""	"benign"	""
"0000280954"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"02325"	"GAA_000005"	"g.78079643C>T"	""	""	""	"GAA(NM_000152.3):c.642C>T (p.S214=), GAA(NM_000152.5):c.642C>T (p.S214=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105844C>T"	""	"benign"	""
"0000280955"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"02325"	"GAA_000038"	"g.78079669G>A"	""	""	""	"GAA(NM_000152.3):c.668G>A (p.R223H), GAA(NM_000152.5):c.668G>A (p.R223H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000280958"	"0"	"10"	"17"	"78081707"	"78081707"	"subst"	"0.695957"	"02325"	"GAA_000282"	"g.78081707G>A"	""	""	""	"GAA(NM_000152.3):c.955+12G>A, GAA(NM_000152.5):c.955+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107908G>A"	""	"benign"	""
"0000284457"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"02326"	"GAA_000029"	"g.78078341T>G"	""	""	""	"GAA(NM_000152.3):c.-32-13T>G (p.(=)), GAA(NM_000152.5):c.-32-13T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000284459"	"0"	"30"	"17"	"78082221"	"78082221"	"subst"	"0.0104313"	"02326"	"GAA_000286"	"g.78082221C>T"	""	""	""	"GAA(NM_000152.3):c.1075+13C>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108422C>T"	""	"likely benign"	""
"0000284460"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"02326"	"GAA_000006"	"g.78082504G>A"	""	""	""	"GAA(NM_000152.3):c.1203G>A (p.Q401=), GAA(NM_000152.5):c.1203G>A (p.Q401=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000284461"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"02326"	"GAA_000019"	"g.78083791C>T"	""	""	""	"GAA(NM_000152.3):c.1374C>T (p.Y458=), GAA(NM_000152.5):c.1374C>T (p.Y458=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109992C>T"	""	"benign"	""
"0000284462"	"0"	"90"	"17"	"78083813"	"78083813"	"subst"	"0"	"02326"	"GAA_000226"	"g.78083813G>T"	""	""	""	"GAA(NM_000152.3):c.1396G>T (p.V466F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110014G>T"	""	"pathogenic"	""
"0000284463"	"0"	"50"	"17"	"78083854"	"78083854"	"subst"	"4.09185E-6"	"02326"	"GAA_000203"	"g.78083854G>A"	""	""	""	"GAA(NM_000152.3):c.1437G>A (p.K479=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110055G>A"	""	"VUS"	""
"0000284464"	"0"	"10"	"17"	"78084507"	"78084507"	"subst"	"0.67069"	"02326"	"GAA_000300"	"g.78084507G>C"	""	""	""	"GAA(NM_000152.3):c.1438-19G>C, GAA(NM_000152.5):c.1438-19G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110708G>C"	""	"benign"	""
"0000284465"	"0"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"02326"	"GAA_000134"	"g.78084636G>A"	""	""	""	"GAA(NM_000152.3):c.1548G>A (p.W516*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic"	""
"0000284466"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"02326"	"GAA_000304"	"g.78084640G>A"	""	""	""	"GAA(NM_000152.3):c.1551+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110841G>A"	""	"pathogenic"	""
"0000284468"	"0"	"30"	"17"	"78084727"	"78084727"	"subst"	"0.00275386"	"02326"	"GAA_000307"	"g.78084727G>A"	""	""	""	"GAA(NM_000152.3):c.1552-13G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110928G>A"	""	"likely benign"	""
"0000284469"	"0"	"90"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"02326"	"GAA_000105"	"g.78085800T>C"	""	""	""	"GAA(NM_000152.3):c.1655T>C (p.L552P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112001T>C"	""	"pathogenic"	""
"0000284470"	"0"	"90"	"17"	"78085802"	"78085802"	"subst"	"0"	"02326"	"GAA_000309"	"g.78085802C>T"	""	""	""	"GAA(NM_000152.3):c.1657C>T (p.Q553*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112003C>T"	""	"pathogenic"	""
"0000284471"	"0"	"10"	"17"	"78085911"	"78085911"	"subst"	"0.0561804"	"02326"	"GAA_000315"	"g.78085911G>A"	""	""	""	"GAA(NM_000152.3):c.1754+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112112G>A"	""	"benign"	""
"0000284472"	"0"	"90"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"02326"	"GAA_000081"	"g.78086421G>A"	""	""	""	"GAA(NM_000152.3):c.1799G>A (p.R600H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112622G>A"	""	"pathogenic"	""
"0000284473"	"0"	"50"	"17"	"78086471"	"78086471"	"subst"	"1.67255E-5"	"02326"	"GAA_000319"	"g.78086471G>A"	""	""	""	"GAA(NM_000152.3):c.1849G>A (p.V617M)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112672G>A"	""	"VUS"	""
"0000284474"	"0"	"50"	"17"	"78086472"	"78086472"	"subst"	"4.18029E-6"	"02326"	"GAA_000320"	"g.78086472T>C"	""	""	""	"GAA(NM_000152.3):c.1850T>C (p.V617A)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112673T>C"	""	"VUS"	""
"0000284475"	"0"	"90"	"17"	"78087080"	"78087080"	"subst"	"0"	"02326"	"GAA_000143"	"g.78087080C>T"	""	""	""	"GAA(NM_000152.3):c.2104C>T (p.R702C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113281C>T"	""	"pathogenic"	""
"0000284476"	"0"	"50"	"17"	"78087081"	"78087081"	"subst"	"5.51369E-5"	"02326"	"GAA_000227"	"g.78087081G>A"	""	""	""	"GAA(NM_000152.3):c.2105G>A (p.R702H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113282G>A"	""	"VUS"	""
"0000284477"	"0"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"02326"	"GAA_000036"	"g.78090815G>C"	""	""	""	"GAA(NM_000152.3):c.2238G>C (p.W746C, p.(Trp746Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000284478"	"0"	"90"	"17"	"78090891"	"78090891"	"subst"	"0"	"02326"	"GAA_000335"	"g.78090891T>C"	""	""	""	"GAA(NM_000152.3):c.2314T>C (p.W772R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117092T>C"	""	"pathogenic"	""
"0000284479"	"0"	"10"	"17"	"78090928"	"78090928"	"subst"	"0.741984"	"02326"	"GAA_000338"	"g.78090928G>A"	""	""	""	"GAA(NM_000152.3):c.2331+20G>A, GAA(NM_000152.5):c.2331+20G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117129G>A"	""	"benign"	""
"0000284480"	"0"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"02326"	"GAA_000336"	"g.78090910T>A"	""	""	""	"GAA(NM_000152.3):c.2331+2T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic"	""
"0000284481"	"0"	"10"	"17"	"78091405"	"78091405"	"subst"	"0.718163"	"02326"	"GAA_000009"	"g.78091405G>A"	""	""	""	"GAA(NM_000152.3):c.2338G>A (p.V780I), GAA(NM_000152.5):c.2338G>A (p.V780I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117606G>A"	""	"benign"	""
"0000284482"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"02326"	"GAA_000025"	"g.78092070C>T"	""	""	""	"GAA(NM_000152.3):c.2560C>T (p.R854*), GAA(NM_000152.5):c.2560C>T (p.(Arg854Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	""
"0000284483"	"0"	"90"	"17"	"78078651"	"78078651"	"subst"	"0.000139397"	"02326"	"GAA_000251"	"g.78078651G>A"	""	""	""	"GAA(NM_000152.3):c.266G>A (p.R89H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104852G>A"	""	"pathogenic"	""
"0000284484"	"0"	"30"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"02326"	"GAA_000003"	"g.78078656G>A"	""	""	""	"GAA(NM_000152.3):c.271G>A (p.D91N, p.(Asp91Asn)), GAA(NM_000152.5):c.271G>A (p.D91N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104857G>A"	""	"likely benign"	""
"0000284485"	"0"	"10"	"17"	"78092585"	"78092585"	"subst"	"0.0186771"	"02326"	"GAA_000026"	"g.78092585C>T"	""	""	""	"GAA(NM_000152.3):c.2780C>T (p.(Thr927Ile), p.T927I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118786C>T"	""	"benign"	""
"0000284486"	"0"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"02326"	"GAA_000002"	"g.78078709T>C"	""	""	""	"GAA(NM_000152.3):c.324T>C (p.C108=), GAA(NM_000152.5):c.324T>C (p.C108=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104910T>C"	""	"benign"	""
"0000284487"	"0"	"10"	"17"	"78079544"	"78079544"	"subst"	"0.669863"	"02326"	"GAA_000258"	"g.78079544C>G"	""	""	""	"GAA(NM_000152.3):c.547-4C>G, GAA(NM_000152.5):c.547-4C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105745C>G"	""	"benign"	""
"0000284488"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"02326"	"GAA_000005"	"g.78079643C>T"	""	""	""	"GAA(NM_000152.3):c.642C>T (p.S214=), GAA(NM_000152.5):c.642C>T (p.S214=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105844C>T"	""	"benign"	""
"0000284489"	"0"	"50"	"17"	"78079666"	"78079666"	"subst"	"0"	"02326"	"GAA_000263"	"g.78079666T>G"	""	""	""	"GAA(NM_000152.3):c.665T>G (p.V222G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105867T>G"	""	"VUS"	""
"0000284490"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"02326"	"GAA_000038"	"g.78079669G>A"	""	""	""	"GAA(NM_000152.3):c.668G>A (p.R223H), GAA(NM_000152.5):c.668G>A (p.R223H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000284491"	"0"	"50"	"17"	"78081444"	"78081444"	"subst"	"2.03249E-5"	"02326"	"GAA_000267"	"g.78081444G>A"	""	""	""	"GAA(NM_000152.3):c.781G>A (p.A261T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107645G>A"	""	"VUS"	""
"0000284492"	"0"	"30"	"17"	"78081515"	"78081515"	"subst"	"0.00629527"	"02326"	"GAA_000269"	"g.78081515G>A"	""	""	""	"GAA(NM_000152.3):c.852G>A (p.A284=, p.(Ala284=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107716G>A"	""	"likely benign"	""
"0000284495"	"0"	"10"	"17"	"78081528"	"78081529"	"ins"	"0.665858"	"02326"	"GAA_000272"	"g.78081528_78081529insAGCGGGC"	""	""	""	"GAA(NM_000152.3):c.858+5_858+6insGCAGCGG, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC (p.(=)), GAA(NM_00015...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107729_80107730insAGCGGGC"	""	"benign"	""
"0000284496"	"0"	"10"	"17"	"78081529"	"78081529"	"subst"	"0.0059393"	"02326"	"GAA_000273"	"g.78081529G>A"	""	""	""	"GAA(NM_000152.3):c.858+8G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107730G>A"	""	"benign"	""
"0000284497"	"0"	"50"	"17"	"78081601"	"78081601"	"subst"	"9.16277E-5"	"02326"	"GAA_000276"	"g.78081601C>T"	""	""	""	"GAA(NM_000152.3):c.861C>T (p.P287=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107802C>T"	""	"VUS"	""
"0000284498"	"0"	"90"	"17"	"78081617"	"78081617"	"subst"	"0"	"02326"	"GAA_000278"	"g.78081617G>C"	""	""	""	"GAA(NM_000152.3):c.877G>C (p.G293R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107818G>C"	""	"pathogenic"	""
"0000284499"	"0"	"90"	"17"	"78081636"	"78081636"	"subst"	"0"	"02326"	"GAA_000279"	"g.78081636T>A"	""	""	""	"GAA(NM_000152.3):c.896T>A (p.L299Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107837T>A"	""	"pathogenic"	""
"0000284500"	"0"	"50"	"17"	"78081653"	"78081653"	"subst"	"0"	"02326"	"GAA_000280"	"g.78081653G>C"	""	""	""	"GAA(NM_000152.3):c.913G>C (p.G305R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107854G>C"	""	"VUS"	""
"0000284501"	"0"	"90"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"02326"	"GAA_000065"	"g.78081665G>A"	""	""	""	"GAA(NM_000152.3):c.925G>A (p.G309R), GAA(NM_000152.5):c.925G>A (p.G309R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic"	""
"0000284502"	"0"	"10"	"17"	"78081707"	"78081707"	"subst"	"0.695957"	"02326"	"GAA_000282"	"g.78081707G>A"	""	""	""	"GAA(NM_000152.3):c.955+12G>A, GAA(NM_000152.5):c.955+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107908G>A"	""	"benign"	""
"0000288023"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01943"	"GAA_000029"	"g.78078341T>G"	""	""	""	"GAA(NM_000152.3):c.-32-13T>G (p.(=)), GAA(NM_000152.5):c.-32-13T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000288024"	"0"	"10"	"17"	"78093133"	"78093133"	"subst"	"0.0488615"	"01943"	"GAA_000027"	"g.78093133G>A"	""	""	""	"GAA(NM_000152.3):c.*3G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80119334G>A"	""	"benign"	""
"0000288025"	"0"	"90"	"17"	"78082137"	"78082137"	"subst"	"0"	"01943"	"GAA_000283"	"g.78082137G>A"	""	""	""	"GAA(NM_000152.3):c.1004G>A (p.G335E), GAA(NM_000152.5):c.1004G>A (p.G335E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108338G>A"	""	"pathogenic"	""
"0000288026"	"0"	"90"	"17"	"78082184"	"78082184"	"del"	"0"	"01943"	"GAA_000245"	"g.78082184del"	""	""	""	"GAA(NM_000152.3):c.1051delG (p.V351Cfs*41)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108385del"	""	"pathogenic"	""
"0000288027"	"0"	"90"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01943"	"GAA_000129"	"g.78082197T>C"	""	""	""	"GAA(NM_000152.3):c.1064T>C (p.L355P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108398T>C"	""	"pathogenic"	""
"0000288028"	"0"	"10"	"17"	"78082221"	"78082221"	"subst"	"0.0104313"	"01943"	"GAA_000286"	"g.78082221C>T"	""	""	""	"GAA(NM_000152.3):c.1075+13C>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108422C>T"	""	"benign"	""
"0000288029"	"0"	"90"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01943"	"GAA_000113"	"g.78082294C>T"	""	""	""	"GAA(NM_000152.3):c.1082C>T (p.P361L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108495C>T"	""	"pathogenic"	""
"0000288030"	"0"	"90"	"17"	"78082340"	"78082341"	"delins"	"0"	"01943"	"GAA_000243"	"g.78082340_78082341delinsC"	""	""	""	"GAA(NM_000152.3):c.1128_1129delGGinsC (p.W376Cfs*16)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108541_80108542delinsC"	""	"pathogenic"	""
"0000288031"	"0"	"90"	"17"	"78082402"	"78082402"	"subst"	"2.45988E-5"	"01943"	"GAA_000288"	"g.78082402C>T"	""	""	""	"GAA(NM_000152.3):c.1190C>T (p.P397L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108603C>T"	""	"pathogenic"	""
"0000288032"	"0"	"10"	"17"	"78082423"	"78082423"	"subst"	"9.0335E-5"	"01943"	"GAA_000289"	"g.78082423G>T"	""	""	""	"GAA(NM_000152.3):c.1194+17G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108624G>T"	""	"benign"	""
"0000288033"	"0"	"90"	"17"	"78082510"	"78082510"	"subst"	"0"	"01943"	"GAA_000291"	"g.78082510C>G"	""	""	""	"GAA(NM_000152.3):c.1209C>G (p.N403K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108711C>G"	""	"pathogenic"	""
"0000288034"	"0"	"90"	"17"	"78082510"	"78082510"	"del"	"0"	"01943"	"GAA_000292"	"g.78082510del"	""	""	""	"GAA(NM_000152.3):c.1209delC (p.N403Kfs*37)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108711del"	""	"pathogenic"	""
"0000288035"	"0"	"90"	"17"	"78082522"	"78082522"	"del"	"0"	"01943"	"GAA_000293"	"g.78082522del"	""	""	""	"GAA(NM_000152.3):c.1221delC (p.Y407*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80108723del"	""	"pathogenic"	""
"0000288037"	"0"	"90"	"17"	"78083787"	"78083787"	"subst"	"0"	"01943"	"GAA_000297"	"g.78083787C>A"	""	""	""	"GAA(NM_000152.3):c.1370C>A (p.P457H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109988C>A"	""	"pathogenic"	""
"0000288038"	"0"	"90"	"17"	"78083787"	"78083787"	"subst"	"0"	"01943"	"GAA_000298"	"g.78083787C>T"	""	""	""	"GAA(NM_000152.3):c.1370C>T (p.P457L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109988C>T"	""	"pathogenic"	""
"0000288039"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"01943"	"GAA_000019"	"g.78083791C>T"	""	""	""	"GAA(NM_000152.3):c.1374C>T (p.Y458=), GAA(NM_000152.5):c.1374C>T (p.Y458=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109992C>T"	""	"benign"	""
"0000288040"	"0"	"50"	"17"	"78083792"	"78083792"	"subst"	"6.51121E-5"	"01943"	"GAA_000299"	"g.78083792G>A"	""	""	""	"GAA(NM_000152.3):c.1375G>A (p.D459N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109993G>A"	""	"VUS"	""
"0000288041"	"0"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01943"	"GAA_000053"	"g.78083828_78083831del"	""	""	""	"GAA(NM_000152.3):c.1411_1414delGAGA (p.E471Pfs*5)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic"	""
"0000288043"	"0"	"90"	"17"	"78084535"	"78084535"	"subst"	"8.13121E-6"	"01943"	"GAA_000301"	"g.78084535G>A"	""	""	""	"GAA(NM_000152.3):c.1447G>A (p.G483R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110736G>A"	""	"pathogenic"	""
"0000288044"	"0"	"90"	"17"	"78084552"	"78084552"	"dup"	"0"	"01943"	"GAA_000302"	"g.78084552dup"	""	""	""	"GAA(NM_000152.3):c.1464dupC (p.D489Rfs*17)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110753dup"	""	"pathogenic"	""
"0000288045"	"0"	"90"	"17"	"78084556"	"78084556"	"subst"	"0"	"01943"	"GAA_000303"	"g.78084556T>C"	""	""	""	"GAA(NM_000152.3):c.1468T>C (p.F490L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110757T>C"	""	"pathogenic"	""
"0000288046"	"0"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01943"	"GAA_000134"	"g.78084636G>A"	""	""	""	"GAA(NM_000152.3):c.1548G>A (p.W516*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic"	""
"0000288047"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"8.12572E-6"	"01943"	"GAA_000305"	"g.78084640G>T"	""	""	""	"GAA(NM_000152.3):c.1551+1G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110841G>T"	""	"pathogenic"	""
"0000288048"	"0"	"10"	"17"	"78084727"	"78084727"	"subst"	"0.00275386"	"01943"	"GAA_000307"	"g.78084727G>A"	""	""	""	"GAA(NM_000152.3):c.1552-13G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110928G>A"	""	"benign"	""
"0000288049"	"0"	"90"	"17"	"78084756"	"78084756"	"subst"	"0"	"01943"	"GAA_000308"	"g.78084756C>A"	""	""	""	"GAA(NM_000152.3):c.1568C>A (p.S523Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80110957C>A"	""	"pathogenic"	""
"0000288050"	"0"	"90"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01943"	"GAA_000105"	"g.78085800T>C"	""	""	""	"GAA(NM_000152.3):c.1655T>C (p.L552P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112001T>C"	""	"pathogenic"	""
"0000288051"	"0"	"90"	"17"	"78085802"	"78085802"	"subst"	"0"	"01943"	"GAA_000309"	"g.78085802C>T"	""	""	""	"GAA(NM_000152.3):c.1657C>T (p.Q553*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112003C>T"	""	"pathogenic"	""
"0000288052"	"0"	"90"	"17"	"78085817"	"78085817"	"subst"	"0"	"01943"	"GAA_000310"	"g.78085817T>A"	""	""	""	"GAA(NM_000152.3):c.1672T>A (p.C558S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112018T>A"	""	"pathogenic"	""
"0000288053"	"0"	"50"	"17"	"78085824"	"78085824"	"subst"	"0"	"01943"	"GAA_000311"	"g.78085824C>G"	""	""	""	"GAA(NM_000152.3):c.1679C>G (p.S560C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112025C>G"	""	"VUS"	""
"0000288055"	"0"	"90"	"17"	"78085871"	"78085871"	"subst"	"0"	"01943"	"GAA_000314"	"g.78085871G>C"	""	""	""	"GAA(NM_000152.3):c.1726G>C (p.G576R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112072G>C"	""	"pathogenic"	""
"0000288056"	"0"	"90"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"01943"	"GAA_000137"	"g.78085880G>A"	""	""	""	"GAA(NM_000152.3):c.1735G>A (p.E579K), GAA(NM_000152.5):c.1735G>A (p.E579K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112081G>A"	""	"pathogenic"	""
"0000288057"	"0"	"10"	"17"	"78085911"	"78085911"	"subst"	"0.0561804"	"01943"	"GAA_000315"	"g.78085911G>A"	""	""	""	"GAA(NM_000152.3):c.1754+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112112G>A"	""	"benign"	""
"0000288058"	"0"	"90"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"01943"	"GAA_000215"	"g.78086403G>A"	""	""	""	"GAA(NM_000152.3):c.1781G>A (p.R594H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112604G>A"	""	"pathogenic"	""
"0000288059"	"0"	"90"	"17"	"78086418"	"78086418"	"subst"	"0"	"01943"	"GAA_000316"	"g.78086418C>T"	""	""	""	"GAA(NM_000152.3):c.1796C>T (p.S599F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112619C>T"	""	"pathogenic"	""
"0000288060"	"0"	"90"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"01943"	"GAA_000081"	"g.78086421G>A"	""	""	""	"GAA(NM_000152.3):c.1799G>A (p.R600H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112622G>A"	""	"pathogenic"	""
"0000288061"	"0"	"90"	"17"	"78086424"	"78086424"	"subst"	"0"	"01943"	"GAA_000317"	"g.78086424C>T"	""	""	""	"GAA(NM_000152.3):c.1802C>T (p.S601L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112625C>T"	""	"pathogenic"	""
"0000288062"	"0"	"90"	"17"	"78086444"	"78086444"	"subst"	"1.24408E-5"	"01943"	"GAA_000318"	"g.78086444C>T"	""	""	""	"GAA(NM_000152.3):c.1822C>T (p.R608*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112645C>T"	""	"pathogenic"	""
"0000288063"	"0"	"10"	"17"	"78086452"	"78086452"	"subst"	"0.00134355"	"01943"	"GAA_000141"	"g.78086452C>T"	""	""	""	"GAA(NM_000152.3):c.1830C>T (p.A610=, p.(Ala610=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112653C>T"	""	"benign"	""
"0000288065"	"0"	"10"	"17"	"78086531"	"78086531"	"subst"	"0.0575615"	"01943"	"GAA_000321"	"g.78086531G>A"	""	""	""	"GAA(NM_000152.3):c.1888+21G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112732G>A"	""	"benign"	""
"0000288066"	"0"	"90"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01943"	"GAA_000066"	"g.78086698G>T"	""	""	""	"GAA(NM_000152.3):c.1912G>T (p.G638W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112899G>T"	""	"pathogenic"	""
"0000288067"	"0"	"90"	"17"	"78086699"	"78086699"	"subst"	"0"	"01943"	"GAA_000322"	"g.78086699G>T"	""	""	""	"GAA(NM_000152.3):c.1913G>T (p.G638V)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112900G>T"	""	"pathogenic"	""
"0000288068"	"0"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01943"	"GAA_000021"	"g.78086713G>A"	""	""	""	"GAA(NM_000152.3):c.1927G>A (p.G643R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic"	""
"0000288069"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"8.39786E-6"	"01943"	"GAA_000323"	"g.78086719G>T"	""	""	""	"GAA(NM_000152.3):c.1933G>T (p.D645Y)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112920G>T"	""	"pathogenic"	""
"0000288070"	"0"	"90"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01943"	"GAA_000020"	"g.78086721C>A"	""	""	""	"GAA(NM_000152.3):c.1935C>A (p.D645E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic"	""
"0000288071"	"0"	"90"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01943"	"GAA_000034"	"g.78086727C>G"	""	""	""	"GAA(NM_000152.3):c.1941C>G (p.C647W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112928C>G"	""	"pathogenic"	""
"0000288072"	"0"	"90"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01943"	"GAA_000067"	"g.78086728G>A"	""	""	""	"GAA(NM_000152.3):c.1942G>A (p.G648S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112929G>A"	""	"pathogenic"	""
"0000288073"	"0"	"90"	"17"	"78086729"	"78086729"	"subst"	"0"	"01943"	"GAA_000324"	"g.78086729G>A"	""	""	""	"GAA(NM_000152.3):c.1943G>A (p.G648D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112930G>A"	""	"pathogenic"	""
"0000288074"	"0"	"90"	"17"	"78086737"	"78086738"	"delins"	"0"	"01943"	"GAA_000325"	"g.78086737_78086738delinsT"	""	""	""	"GAA(NM_000152.3):c.1951_1952delGGinsT (p.G651Sfs*45)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112938_80112939delinsT"	""	"pathogenic"	""
"0000288075"	"0"	"90"	"17"	"78086764"	"78086764"	"subst"	"0"	"01943"	"GAA_000326"	"g.78086764C>T"	""	""	""	"GAA(NM_000152.3):c.1978C>T (p.R660C)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112965C>T"	""	"pathogenic"	""
"0000288077"	"0"	"90"	"17"	"78087078"	"78087078"	"subst"	"0"	"01943"	"GAA_000329"	"g.78087078T>C"	""	""	""	"GAA(NM_000152.3):c.2102T>C (p.L701P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113279T>C"	""	"pathogenic"	""
"0000288078"	"0"	"90"	"17"	"78087111"	"78087111"	"subst"	"0"	"01943"	"GAA_000330"	"g.78087111T>C"	""	""	""	"GAA(NM_000152.3):c.2135T>C (p.L712P), GAA(NM_000152.5):c.2135T>C (p.(Leu712Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113312T>C"	""	"pathogenic"	""
"0000288079"	"0"	"10"	"17"	"78087128"	"78087128"	"subst"	"0.000275181"	"01943"	"GAA_000331"	"g.78087128G>A"	""	""	""	"GAA(NM_000152.3):c.2152G>A (p.V718I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113329G>A"	""	"benign"	""
"0000288080"	"0"	"50"	"17"	"78087131"	"78087131"	"subst"	"0.000247779"	"01943"	"GAA_000332"	"g.78087131G>T"	""	""	""	"GAA(NM_000152.3):c.2155G>T (p.A719S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113332G>T"	""	"VUS"	""
"0000288081"	"0"	"90"	"17"	"78087166"	"78087166"	"subst"	"0"	"01943"	"GAA_000333"	"g.78087166G>A"	""	""	""	"GAA(NM_000152.3):c.2189+1G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80113367G>A"	""	"pathogenic"	""
"0000288082"	"0"	"10"	"17"	"78078606"	"78078606"	"subst"	"5.78321E-5"	"01943"	"GAA_000250"	"g.78078606G>A"	""	""	""	"GAA(NM_000152.3):c.221G>A (p.R74H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104807G>A"	""	"benign"	""
"0000288083"	"0"	"90"	"17"	"78090804"	"78090804"	"subst"	"0"	"01943"	"GAA_000334"	"g.78090804C>A"	""	""	""	"GAA(NM_000152.3):c.2227C>A (p.Q743K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117005C>A"	""	"pathogenic"	""
"0000288084"	"0"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01943"	"GAA_000036"	"g.78090815G>C"	""	""	""	"GAA(NM_000152.3):c.2238G>C (p.W746C, p.(Trp746Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000288085"	"0"	"90"	"17"	"78090846"	"78090846"	"subst"	"0"	"01943"	"GAA_000236"	"g.78090846C>T"	""	""	""	"GAA(NM_000152.3):c.2269C>T (p.Q757*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117047C>T"	""	"pathogenic"	""
"0000288086"	"0"	"10"	"17"	"78090932"	"78090932"	"subst"	"0.14918"	"01943"	"GAA_000339"	"g.78090932T>C"	""	""	""	"GAA(NM_000152.3):c.2331+24T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117133T>C"	""	"benign"	""
"0000288087"	"0"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"01943"	"GAA_000336"	"g.78090910T>A"	""	""	""	"GAA(NM_000152.3):c.2331+2T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic"	""
"0000288088"	"0"	"90"	"17"	"78091447"	"78091447"	"del"	"0"	"01943"	"GAA_000085"	"g.78091447del"	""	""	""	"GAA(NM_000152.3):c.2380delC (p.R794Vfs*12)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117648del"	""	"pathogenic"	""
"0000288089"	"0"	"10"	"17"	"78091513"	"78091513"	"subst"	"0.0495638"	"01943"	"GAA_000024"	"g.78091513G>A"	""	""	""	"GAA(NM_000152.3):c.2446G>A (p.V816I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117714G>A"	""	"benign"	""
"0000288090"	"0"	"90"	"17"	"78091523"	"78091523"	"subst"	"0"	"01943"	"GAA_000341"	"g.78091523G>C"	""	""	""	"GAA(NM_000152.3):c.2456G>C (p.R819P)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117724G>C"	""	"pathogenic"	""
"0000288091"	"0"	"10"	"17"	"78091573"	"78091573"	"subst"	"4.79916E-6"	"01943"	"GAA_000342"	"g.78091573G>A"	""	""	""	"GAA(NM_000152.3):c.2481+25G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80117774G>A"	""	"benign"	""
"0000288092"	"0"	"30"	"17"	"78091979"	"78091979"	"subst"	"4.07933E-6"	"01943"	"GAA_000343"	"g.78091979C>T"	""	""	""	"GAA(NM_000152.3):c.2482-13C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118180C>T"	""	"likely benign"	""
"0000288093"	"0"	"90"	"17"	"78092005"	"78092006"	"del"	"0"	"01943"	"GAA_000344"	"g.78092005_78092006del"	""	""	""	"GAA(NM_000152.3):c.2495_2496delCA (p.T832Nfs*51)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118206_80118207del"	""	"pathogenic"	""
"0000288094"	"0"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"01943"	"GAA_000241"	"g.78092011_78092012del"	""	""	""	"GAA(NM_000152.3):c.2501_2502delCA (p.T834Rfs*49)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic"	""
"0000288095"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01943"	"GAA_000025"	"g.78092070C>T"	""	""	""	"GAA(NM_000152.3):c.2560C>T (p.R854*), GAA(NM_000152.5):c.2560C>T (p.(Arg854Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	""
"0000288096"	"0"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"01943"	"GAA_000060"	"g.78078643dup"	""	""	""	"GAA(NM_000152.3):c.258dupC (p.N87Qfs*9), GAA(NM_000152.5):c.258dupC (p.N87Qfs*9)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic"	""
"0000288097"	"0"	"90"	"17"	"78092149"	"78092149"	"subst"	"0"	"01943"	"GAA_000144"	"g.78092149C>A"	""	""	""	"GAA(NM_000152.3):c.2639C>A (p.A880D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118350C>A"	""	"pathogenic"	""
"0000288098"	"0"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01943"	"GAA_000107"	"g.78092158T>A"	""	""	""	"GAA(NM_000152.3):c.2646+2T>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic"	""
"0000288099"	"0"	"90"	"17"	"78092451"	"78092453"	"del"	"0"	"01943"	"GAA_000346"	"g.78092451_78092453del"	""	""	""	"GAA(NM_000152.3):c.2647-1_2648delGAA"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118652_80118654del"	""	"pathogenic"	""
"0000288100"	"0"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01943"	"GAA_000169"	"g.78092467G>T"	""	""	""	"GAA(NM_000152.3):c.2662G>T (p.E888*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic"	""
"0000288101"	"0"	"10"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"01943"	"GAA_000003"	"g.78078656G>A"	""	""	""	"GAA(NM_000152.3):c.271G>A (p.D91N, p.(Asp91Asn)), GAA(NM_000152.5):c.271G>A (p.D91N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000288104"	"0"	"90"	"17"	"78092551"	"78092551"	"subst"	"0"	"01943"	"GAA_000351"	"g.78092551G>T"	""	""	""	"GAA(NM_000152.3):c.2746G>T (p.V916F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118752G>T"	""	"pathogenic"	""
"0000288105"	"0"	"90"	"17"	"78078692"	"78078692"	"subst"	"0"	"01943"	"GAA_000119"	"g.78078692T>G"	""	""	""	"GAA(NM_000152.3):c.307T>G (p.C103G)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104893T>G"	""	"pathogenic"	""
"0000288107"	"0"	"90"	"17"	"78078725"	"78078726"	"ins"	"0"	"01943"	"GAA_000121"	"g.78078725_78078726insT"	""	""	""	"GAA(NM_000152.3):c.340_341insT (p.K114Ifs*32)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104926_80104927insT"	""	"pathogenic"	""
"0000288108"	"0"	"90"	"17"	"78078728"	"78078728"	"subst"	"0"	"01943"	"GAA_000254"	"g.78078728C>T"	""	""	""	"GAA(NM_000152.3):c.343C>T (p.Q115*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104929C>T"	""	"pathogenic"	""
"0000288109"	"0"	"90"	"17"	"78078764"	"78078765"	"del"	"0"	"01943"	"GAA_000062"	"g.78078764_78078765del"	""	""	""	"GAA(NM_000152.3):c.379_380delTG (p.C127Lfs*18), GAA(NM_000152.5):c.379_380delTG (p.C127Lfs*18)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104965_80104966del"	""	"pathogenic"	""
"0000288110"	"0"	"90"	"17"	"78078765"	"78078765"	"subst"	"0"	"01943"	"GAA_000256"	"g.78078765G>T"	""	""	""	"GAA(NM_000152.3):c.380G>T (p.C127F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104966G>T"	""	"pathogenic"	""
"0000288111"	"0"	"30"	"17"	"78078895"	"78078895"	"subst"	"5.0514E-5"	"01943"	"GAA_000122"	"g.78078895C>T"	""	""	""	"GAA(NM_000152.3):c.510C>T (p.D170=), GAA(NM_000152.5):c.510C>T (p.D170=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105096C>T"	""	"likely benign"	""
"0000288112"	"0"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01943"	"GAA_000028"	"g.78078910del"	""	""	""	"GAA(NM_000152.3):c.525delT (p.(Glu176ArgfsTer45)), GAA(NM_000152.3):c.525delT (p.E176Rfs*45), GAA(NM_000152.5):c.525delT (p.E176Rfs*45)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic"	""
"0000288113"	"0"	"90"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"01943"	"GAA_000123"	"g.78078931G>A"	""	""	""	"GAA(NM_000152.3):c.546G>A (p.T182=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105132G>A"	""	"pathogenic"	""
"0000288114"	"0"	"90"	"17"	"78079574"	"78079574"	"subst"	"4.0858E-6"	"01943"	"GAA_000098"	"g.78079574C>A"	""	""	""	"GAA(NM_000152.3):c.573C>A (p.Y191*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105775C>A"	""	"pathogenic"	""
"0000288115"	"0"	"50"	"17"	"78079577"	"78079577"	"subst"	"2.86095E-5"	"01943"	"GAA_000259"	"g.78079577G>C"	""	""	""	"GAA(NM_000152.3):c.576G>C (p.E192D)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105778G>C"	""	"VUS"	""
"0000288117"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"01943"	"GAA_000005"	"g.78079643C>T"	""	""	""	"GAA(NM_000152.3):c.642C>T (p.S214=), GAA(NM_000152.5):c.642C>T (p.S214=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105844C>T"	""	"benign"	""
"0000288118"	"0"	"10"	"17"	"78079665"	"78079665"	"subst"	"0.000793266"	"01943"	"GAA_000262"	"g.78079665G>A"	""	""	""	"GAA(NM_000152.3):c.664G>A (p.V222M, p.(Val222Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105866G>A"	""	"benign"	""
"0000288119"	"0"	"90"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01943"	"GAA_000108"	"g.78079671C>T"	""	""	""	"GAA(NM_000152.3):c.670C>T (p.R224W)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105872C>T"	""	"pathogenic"	""
"0000288120"	"0"	"30"	"17"	"78079710"	"78079710"	"subst"	"0.00121717"	"01943"	"GAA_000266"	"g.78079710G>C"	""	""	""	"GAA(NM_000152.3):c.692+17G>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105911G>C"	""	"likely benign"	""
"0000288122"	"0"	"90"	"17"	"78081429"	"78081448"	"delins"	"0"	"01943"	"GAA_000063"	"g.78081429_78081448delinsC"	""	""	""	"GAA(NM_000152.3):c.766_785delTATATCACAGGCCTCGCCGAinsC (p.Y256Rfs*6)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107630_80107649delinsC"	""	"pathogenic"	""
"0000288123"	"0"	"90"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01943"	"GAA_000100"	"g.78081447G>A"	""	""	""	"GAA(NM_000152.3):c.784G>A (p.E262K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107648G>A"	""	"pathogenic"	""
"0000288124"	"0"	"90"	"17"	"78081499"	"78081499"	"subst"	"0"	"01943"	"GAA_000268"	"g.78081499G>A"	""	""	""	"GAA(NM_000152.3):c.836G>A (p.W279*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107700G>A"	""	"pathogenic"	""
"0000288125"	"0"	"10"	"17"	"78081515"	"78081515"	"subst"	"0.00629527"	"01943"	"GAA_000269"	"g.78081515G>A"	""	""	""	"GAA(NM_000152.3):c.852G>A (p.A284=, p.(Ala284=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107716G>A"	""	"benign"	""
"0000288126"	"0"	"10"	"17"	"78081532"	"78081532"	"subst"	"0"	"01943"	"GAA_000274"	"g.78081532G>A"	""	""	""	"GAA(NM_000152.3):c.858+11G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107733G>A"	""	"benign"	""
"0000288127"	"0"	"10"	"17"	"78081551"	"78081551"	"subst"	"0.662574"	"01943"	"GAA_000275"	"g.78081551T>C"	""	""	""	"GAA(NM_000152.3):c.858+30T>C, GAA(NM_000152.5):c.858+30T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107752T>C"	""	"benign"	""
"0000288129"	"0"	"90"	"17"	"78081611"	"78081611"	"subst"	"3.31738E-5"	"01943"	"GAA_000219"	"g.78081611C>T"	""	""	""	"GAA(NM_000152.3):c.871C>T (p.L291F)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107812C>T"	""	"pathogenic"	""
"0000288130"	"0"	"30"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"01943"	"GAA_000281"	"g.78081655G>A"	""	""	""	"GAA(NM_000152.3):c.915G>A (p.G305=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107856G>A"	""	"likely benign"	""
"0000288131"	"0"	"90"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01943"	"GAA_000065"	"g.78081665G>A"	""	""	""	"GAA(NM_000152.3):c.925G>A (p.G309R), GAA(NM_000152.5):c.925G>A (p.G309R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic"	""
"0000288132"	"0"	"10"	"17"	"78081707"	"78081707"	"subst"	"0.695957"	"01943"	"GAA_000282"	"g.78081707G>A"	""	""	""	"GAA(NM_000152.3):c.955+12G>A, GAA(NM_000152.5):c.955+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107908G>A"	""	"benign"	""
"0000325731"	"0"	"50"	"17"	"78071068"	"78071068"	"subst"	"0.000865199"	"01804"	"CCDC40_000092"	"g.78071068G>A"	""	""	""	"CCDC40(NM_017950.3):c.3046G>A (p.V1016I, p.(Val1016Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80097269G>A"	""	"VUS"	""
"0000325732"	"0"	"30"	"17"	"78073485"	"78073485"	"subst"	"0.0147683"	"01804"	"CCDC40_000094"	"g.78073485G>A"	""	""	""	"CCDC40(NM_017950.3):c.3340G>A (p.V1114M, p.(Val1114Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099686G>A"	""	"likely benign"	""
"0000325734"	"0"	"30"	"17"	"78073494"	"78073494"	"subst"	"0.000939582"	"01804"	"CCDC40_000096"	"g.78073494G>A"	""	""	""	"CCDC40(NM_017950.3):c.3349G>A (p.(Glu1117Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099695G>A"	""	"likely benign"	""
"0000325735"	"0"	"50"	"17"	"78073500"	"78073500"	"subst"	"1.62676E-5"	"01804"	"CCDC40_000097"	"g.78073500C>T"	""	""	""	"CCDC40(NM_017950.3):c.3355C>T (p.(Pro1119Ser))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099701C>T"	""	"VUS"	""
"0000325737"	"0"	"30"	"17"	"78073569"	"78073569"	"subst"	"0.000925448"	"01804"	"CCDC40_000100"	"g.78073569T>C"	""	""	""	"CCDC40(NM_017950.3):c.3424T>C (p.(Ser1142Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80099770T>C"	""	"likely benign"	""
"0000325739"	"0"	"30"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"01804"	"GAA_000003"	"g.78078656G>A"	""	""	""	"GAA(NM_000152.3):c.271G>A (p.D91N, p.(Asp91Asn)), GAA(NM_000152.5):c.271G>A (p.D91N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104857G>A"	""	"likely benign"	""
"0000325740"	"0"	"50"	"17"	"78078769"	"78078769"	"subst"	"0"	"01804"	"GAA_000257"	"g.78078769C>G"	""	""	""	"GAA(NM_000152.3):c.384C>G (p.(Phe128Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104970C>G"	""	"VUS"	""
"0000325741"	"0"	"50"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01804"	"GAA_000028"	"g.78078910del"	""	""	""	"GAA(NM_000152.3):c.525delT (p.(Glu176ArgfsTer45)), GAA(NM_000152.3):c.525delT (p.E176Rfs*45), GAA(NM_000152.5):c.525delT (p.E176Rfs*45)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105111del"	""	"VUS"	""
"0000325746"	"0"	"50"	"17"	"78079665"	"78079665"	"subst"	"0.000793266"	"01804"	"GAA_000262"	"g.78079665G>A"	""	""	""	"GAA(NM_000152.3):c.664G>A (p.V222M, p.(Val222Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80105866G>A"	""	"VUS"	""
"0000325748"	"0"	"30"	"17"	"78083769"	"78083769"	"subst"	"0.000390685"	"01804"	"GAA_000296"	"g.78083769C>G"	""	""	""	"GAA(NM_000152.3):c.1352C>G (p.(Pro451Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80109970C>G"	""	"likely benign"	""
"0000325750"	"0"	"30"	"17"	"78092461"	"78092461"	"subst"	"0"	"01804"	"GAA_000347"	"g.78092461G>A"	""	""	""	"GAA(NM_000152.3):c.2656G>A (p.(Val886Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118662G>A"	""	"likely benign"	""
"0000325751"	"0"	"30"	"17"	"78092473"	"78092473"	"subst"	"0.00344726"	"01804"	"GAA_000348"	"g.78092473G>C"	""	""	""	"GAA(NM_000152.3):c.2668G>C (p.(Val890Leu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118674G>C"	""	"likely benign"	""
"0000343224"	"0"	"70"	"17"	"78086765"	"78086765"	"subst"	"0"	"02327"	"GAA_000116"	"g.78086765G>A"	""	""	""	"GAA(NM_000152.3):c.1979G>A (p.R660H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112966G>A"	""	"likely pathogenic"	""
"0000343441"	"0"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"02327"	"GAA_000234"	"g.78092118C>T"	""	""	""	"GAA(NM_000152.3):c.2608C>T (p.R870*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic"	""
"0000344161"	"0"	"50"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"02327"	"GAA_000020"	"g.78086721C>A"	""	""	""	"GAA(NM_000152.3):c.1935C>A (p.D645E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80112922C>A"	""	"VUS"	""
"0000348866"	"0"	"50"	"17"	"78081415"	"78081415"	"subst"	"0.000349525"	"02327"	"GAA_000210"	"g.78081415C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107616C>T"	""	"VUS"	""
"0000348870"	"0"	"50"	"17"	"78081424"	"78081424"	"subst"	"0.000195078"	"02327"	"GAA_000211"	"g.78081424C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80107625C>T"	""	"VUS"	""
"0000351375"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"02327"	"GAA_000029"	"g.78078341T>G"	""	""	""	"GAA(NM_000152.3):c.-32-13T>G (p.(=)), GAA(NM_000152.5):c.-32-13T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000405538"	"0"	"70"	"17"	"78086764"	"78086764"	"subst"	"0"	"01601"	"GAA_000326"	"g.78086764C>T"	""	""	""	""	""	"Germline"	"?"	""	"0"	""	""	"g.80112965C>T"	""	"likely pathogenic"	""
"0000408005"	"21"	"97"	"17"	"78086475"	"78086475"	"subst"	"4.21358E-6"	"01939"	"GAA_000353"	"g.78086475G>A"	""	"Labrijn-Marks et al, submitted"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112676G>A"	""	"pathogenic (recessive)"	""
"0000408006"	"10"	"97"	"17"	"78086475"	"78086475"	"subst"	"4.21358E-6"	"01939"	"GAA_000353"	"g.78086475G>A"	""	"Labrijn-Marks et al, submitted"	""	""	"maternal segmental isodisomy chromosome 17"	"Uniparental disomy, maternal allele"	""	""	"0"	""	""	"g.80112676G>A"	""	"pathogenic (recessive)"	""
"0000408007"	"21"	"97"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01939"	"GAA_000065"	"g.78081665G>A"	""	"Labrijn-Marks et al, submitted"	""	""	"pathogenic potential less severe"	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic (!)"	""
"0000408008"	"10"	"97"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01939"	"GAA_000065"	"g.78081665G>A"	""	"Labrijn-Marks et al, submitted"	""	""	"pathogenic potential less severe; maternal segmental isodisomy chromosome 17"	"Uniparental disomy, maternal allele"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic (!)"	""
"0000408009"	"21"	"97"	"17"	"78081611"	"78081611"	"subst"	"3.31738E-5"	"01939"	"GAA_000219"	"g.78081611C>T"	""	"Labrijn-Marks et al, submitted"	""	""	"pathogenic potential less severe"	"Germline"	""	""	"0"	""	""	"g.80107812C>T"	""	"pathogenic (!)"	""
"0000408010"	"10"	"97"	"17"	"78081611"	"78081611"	"subst"	"3.31738E-5"	"01939"	"GAA_000219"	"g.78081611C>T"	""	"pathogenic potential less severe"	""	""	"maternal whole chromosome 17 isodisomy; pathogenic potential less severe"	"Germline"	""	""	"0"	""	""	"g.80107812C>T"	""	"pathogenic (!)"	""
"0000408011"	"11"	"97"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01939"	"GAA_000065"	"g.78081665G>A"	""	"Labrijn-Marks et al, submitted"	""	""	"pathogenic potential less severe"	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic (!)"	""
"0000408012"	"20"	"97"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01939"	"GAA_000065"	"g.78081665G>A"	""	"Labrijn-Marks et al, submitted"	""	""	"paternal mosaic segmental isodisomy chromosome 17; pathogenic potential less severe"	"Somatic"	""	""	"0"	""	""	"g.80107866G>A"	""	"pathogenic (!)"	""
"0000439109"	"0"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	"MAF not reported"	"{Pompe:570}"	""	"IVS1-3C>A"	"predicted less severe phenotype, childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic"	"ACMG"
"0000463985"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000463986"	"1"	"50"	"17"	"78078651"	"78078651"	"subst"	"0.000139397"	"00430"	"GAA_000251"	"g.78078651G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104852G>A"	""	"VUS"	""
"0000463987"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"2 Variants detected in GAA"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000463988"	"1"	"90"	"17"	"78082336"	"78082336"	"subst"	"8.19061E-6"	"00430"	"GAA_000393"	"g.78082336G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant in GAA"	"Germline"	""	""	"0"	""	""	"g.80108537G>T"	""	"pathogenic"	""
"0000463989"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000463990"	"1"	"50"	"17"	"78087128"	"78087128"	"subst"	"0.000275181"	"00430"	"GAA_000331"	"g.78087128G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80113329G>A"	""	"VUS"	""
"0000463991"	"1"	"50"	"17"	"78078665"	"78078665"	"subst"	"2.04738E-5"	"00430"	"GAA_000372"	"g.78078665C>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104866C>A"	""	"VUS"	""
"0000463992"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000463993"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000463994"	"1"	"50"	"17"	"78086716"	"78086716"	"subst"	"0"	"00430"	"GAA_000419"	"g.78086716G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112917G>C"	""	"VUS"	""
"0000463995"	"1"	"50"	"17"	"78091490"	"78091490"	"subst"	"4.11326E-6"	"00430"	"GAA_000435"	"g.78091490C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117691C>T"	""	"VUS"	""
"0000463996"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000463997"	"1"	"50"	"17"	"78086450"	"78086450"	"subst"	"2.90993E-5"	"00430"	"GAA_000414"	"g.78086450G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112651G>A"	""	"VUS"	""
"0000463998"	"1"	"50"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"VUS"	""
"0000463999"	"1"	"50"	"17"	"78078805"	"78078805"	"subst"	"1.23258E-5"	"00430"	"GAA_000376"	"g.78078805C>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105006C>A"	""	"VUS"	""
"0000464000"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"variant found in individuals with adult-onset Pompe disease"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464001"	"1"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00430"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	""
"0000464002"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464003"	"1"	"90"	"17"	"78079656"	"78079656"	"subst"	"0"	"00430"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"pathogenic"	""
"0000464004"	"1"	"50"	"17"	"78082541"	"78082541"	"subst"	"0"	"00430"	"GAA_000398"	"g.78082541T>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108742T>C"	""	"VUS"	""
"0000464005"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464006"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"consistent with diagnosis Pompe disease"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464007"	"1"	"90"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"00430"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"consistent with diagnosis Pompe disease"	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"pathogenic"	""
"0000464008"	"1"	"50"	"17"	"78091541"	"78091541"	"subst"	"0"	"00430"	"GAA_000436"	"g.78091541C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117742C>G"	""	"VUS"	""
"0000464009"	"1"	"90"	"17"	"78086800"	"78086800"	"subst"	"0"	"00430"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"pathogenic"	""
"0000464010"	"1"	"50"	"17"	"78090852"	"78090852"	"subst"	"0.00011393"	"00430"	"GAA_000426"	"g.78090852G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117053G>A"	""	"VUS"	""
"0000464011"	"1"	"50"	"17"	"78090900"	"78090900"	"subst"	"7.36938E-5"	"00430"	"GAA_000428"	"g.78090900C>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117101C>A"	""	"VUS"	""
"0000464012"	"1"	"50"	"17"	"78078417"	"78078417"	"subst"	"0.000130749"	"00430"	"GAA_000365"	"g.78078417G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104618G>A"	""	"VUS"	""
"0000464013"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant; commonly found in individuals with adult-onset Pompe disease"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464014"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000464015"	"1"	"50"	"17"	"78082409"	"78082409"	"subst"	"0.000159961"	"00430"	"GAA_000397"	"g.78082409G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108610G>C"	""	"VUS"	""
"0000464016"	"1"	"50"	"17"	"78081606"	"78081606"	"subst"	"1.24803E-5"	"00430"	"GAA_000387"	"g.78081606C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107807C>T"	""	"VUS"	""
"0000464017"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464018"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464019"	"1"	"50"	"17"	"78083819"	"78083819"	"subst"	"0"	"00430"	"GAA_000407"	"g.78083819A>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110020A>T"	""	"VUS"	""
"0000464020"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464021"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000464022"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464023"	"1"	"50"	"17"	"78087027"	"78087027"	"subst"	"7.27729E-5"	"00430"	"GAA_000420"	"g.78087027C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113228C>T"	""	"VUS"	""
"0000464024"	"1"	"50"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"00430"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"VUS"	""
"0000464025"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464026"	"1"	"90"	"17"	"78082184"	"78082184"	"del"	"0"	"00430"	"GAA_000245"	"g.78082184del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"1051delG"	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108385del"	""	"pathogenic"	""
"0000464027"	"1"	"50"	"17"	"78092608"	"78092608"	"subst"	"4.0784E-6"	"00430"	"GAA_000444"	"g.78092608A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118809A>G"	""	"VUS"	""
"0000464028"	"1"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"00430"	"GAA_000241"	"g.78092011_78092012del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"2501_2502delCA"	""	"Germline"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic"	""
"0000464029"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464030"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00430"	"GAA_000028"	"g.78078910del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic"	""
"0000464031"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464032"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464033"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464034"	"1"	"50"	"17"	"78087131"	"78087131"	"subst"	"0.000247779"	"00430"	"GAA_000332"	"g.78087131G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113332G>T"	""	"VUS"	""
"0000464035"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464036"	"1"	"50"	"17"	"78092071"	"78092071"	"subst"	"0.000331931"	"00430"	"GAA_000440"	"g.78092071G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118272G>A"	""	"VUS"	""
"0000464037"	"1"	"50"	"17"	"78082566"	"78082566"	"subst"	"0.000241221"	"00430"	"GAA_000294"	"g.78082566G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108767G>A"	""	"VUS"	""
"0000464038"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464039"	"1"	"50"	"17"	"78091471"	"78091471"	"subst"	"6.1418E-5"	"00430"	"GAA_000431"	"g.78091471G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117672G>A"	""	"VUS"	""
"0000464040"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464041"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464042"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464043"	"1"	"90"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"00430"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"pathogenic"	""
"0000464044"	"1"	"50"	"17"	"78081528"	"78081529"	"ins"	"0"	"00430"	"GAA_000386"	"g.78081528_78081529insAGTG"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107729_80107730insAGTG"	""	"VUS"	""
"0000464045"	"1"	"50"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"00430"	"GAA_000281"	"g.78081655G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107856G>A"	""	"VUS"	""
"0000464046"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464047"	"1"	"50"	"17"	"78092457"	"78092457"	"subst"	"0.000429083"	"00430"	"GAA_000442"	"g.78092457G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118658G>A"	""	"VUS"	""
"0000464048"	"1"	"50"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"00430"	"GAA_000216"	"g.78086403G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112604G>C"	""	"VUS"	""
"0000464049"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00430"	"GAA_000028"	"g.78078910del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic"	""
"0000464050"	"1"	"50"	"17"	"78082152"	"78082152"	"subst"	"5.28236E-5"	"00430"	"GAA_000390"	"g.78082152A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108353A>G"	""	"VUS"	""
"0000464051"	"1"	"50"	"17"	"78083773"	"78083773"	"subst"	"7.73213E-5"	"00430"	"GAA_000403"	"g.78083773C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80109974C>T"	""	"VUS"	""
"0000464052"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant in GAA"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464053"	"1"	"50"	"17"	"78087132"	"78087132"	"subst"	"0.000127319"	"00430"	"GAA_000422"	"g.78087132C>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant in GAA"	"Germline"	""	""	"0"	""	""	"g.80113333C>A"	""	"VUS"	""
"0000464054"	"1"	"50"	"17"	"78082621"	"78082621"	"subst"	"0"	"00430"	"GAA_000401"	"g.78082621G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108822G>T"	""	"VUS"	""
"0000464055"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464056"	"1"	"90"	"17"	"78087116"	"78087116"	"del"	"0"	"00430"	"GAA_000421"	"g.78087116del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"2140delC"	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80113317del"	""	"pathogenic"	""
"0000464057"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000464058"	"1"	"50"	"17"	"78078468"	"78078468"	"subst"	"0"	"00430"	"GAA_000368"	"g.78078468G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104669G>T"	""	"VUS"	""
"0000464059"	"1"	"50"	"17"	"78082566"	"78082566"	"subst"	"0.000241221"	"00430"	"GAA_000294"	"g.78082566G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108767G>A"	""	"VUS"	""
"0000464060"	"1"	"50"	"17"	"78078895"	"78078895"	"subst"	"5.0514E-5"	"00430"	"GAA_000122"	"g.78078895C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105096C>T"	""	"VUS"	""
"0000464061"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"commonly found in individualswith adult-onset Pompe disease"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464062"	"1"	"90"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"00430"	"GAA_000123"	"g.78078931G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105132G>A"	""	"pathogenic"	""
"0000464063"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464064"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464065"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464066"	"1"	"50"	"17"	"78090814"	"78090814"	"subst"	"6.91591E-5"	"00430"	"GAA_000424"	"g.78090814G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117015G>T"	""	"VUS"	""
"0000464067"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464068"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464069"	"1"	"50"	"17"	"78090874"	"78090874"	"subst"	"2.44543E-5"	"00430"	"GAA_000427"	"g.78090874A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117075A>G"	""	"VUS"	""
"0000464070"	"1"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00430"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	""
"0000464071"	"1"	"50"	"17"	"78086470"	"78086470"	"subst"	"4.5954E-5"	"00430"	"GAA_000416"	"g.78086470C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112671C>T"	""	"VUS"	""
"0000464072"	"1"	"50"	"17"	"78092446"	"78092446"	"subst"	"0"	"00430"	"GAA_000441"	"g.78092446G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118647G>A"	""	"VUS"	""
"0000464073"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464074"	"1"	"90"	"17"	"78087116"	"78087116"	"del"	"0"	"00430"	"GAA_000421"	"g.78087116del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"2140delC"	""	"Germline"	""	""	"0"	""	""	"g.80113317del"	""	"pathogenic"	""
"0000464075"	"1"	"50"	"17"	"78081504"	"78081504"	"subst"	"0.000197663"	"00430"	"GAA_000385"	"g.78081504C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107705C>T"	""	"VUS"	""
"0000464076"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464077"	"1"	"50"	"17"	"78084535"	"78084535"	"subst"	"8.13121E-6"	"00430"	"GAA_000301"	"g.78084535G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110736G>A"	""	"VUS"	""
"0000464078"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464079"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464080"	"1"	"50"	"17"	"78092461"	"78092461"	"subst"	"0"	"00430"	"GAA_000347"	"g.78092461G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118662G>A"	""	"VUS"	""
"0000464081"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464082"	"1"	"50"	"17"	"78091484"	"78091484"	"subst"	"0.000455759"	"00430"	"GAA_000434"	"g.78091484C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117685C>T"	""	"VUS"	""
"0000464083"	"1"	"50"	"17"	"78078934"	"78078934"	"subst"	"4.32485E-5"	"00430"	"GAA_000379"	"g.78078934G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105135G>A"	""	"VUS"	""
"0000464084"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464085"	"1"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"VUS"	""
"0000464086"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464087"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464088"	"1"	"50"	"17"	"78092071"	"78092071"	"subst"	"0.000331931"	"00430"	"GAA_000440"	"g.78092071G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118272G>A"	""	"VUS"	""
"0000464089"	"1"	"50"	"17"	"78079686"	"78079686"	"subst"	"1.26907E-5"	"00430"	"GAA_000381"	"g.78079686C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105887C>T"	""	"VUS"	""
"0000464090"	"1"	"90"	"17"	"78079656"	"78079656"	"subst"	"0"	"00430"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"pathogenic"	""
"0000464091"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464092"	"1"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"VUS"	""
"0000464093"	"1"	"50"	"17"	"78078656"	"78078657"	"delins"	"0"	"00430"	"GAA_000371"	"g.78078656_78078657delinsAG"	""	"{PMID:Nallamilli 2018:30564623}"	""	"271_272delGAinsAG"	""	"Germline"	""	""	"0"	""	""	"g.80104857_80104858delinsAG"	""	"VUS"	""
"0000464094"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464095"	"1"	"50"	"17"	"78086463"	"78086463"	"subst"	"8.30993E-6"	"00430"	"GAA_000415"	"g.78086463C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112664C>T"	""	"VUS"	""
"0000464096"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464097"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464098"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464099"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464100"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464101"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464102"	"1"	"50"	"17"	"78081653"	"78081653"	"subst"	"0.000181784"	"00430"	"GAA_000388"	"g.78081653G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107854G>A"	""	"VUS"	""
"0000464103"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464104"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464105"	"1"	"50"	"17"	"78091490"	"78091490"	"subst"	"4.11326E-6"	"00430"	"GAA_000435"	"g.78091490C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117691C>T"	""	"VUS"	""
"0000464106"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464107"	"0"	"90"	"17"	"78081399"	"78081399"	"del"	"0"	"00430"	"GAA_000383"	"g.78081399del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"736delC"	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107600del"	""	"pathogenic"	""
"0000464108"	"1"	"50"	"17"	"78081365"	"78081365"	"subst"	"3.65999E-5"	"00430"	"GAA_000382"	"g.78081365G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107566G>A"	""	"VUS"	""
"0000464109"	"1"	"50"	"17"	"78078417"	"78078417"	"subst"	"0.000130749"	"00430"	"GAA_000365"	"g.78078417G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104618G>A"	""	"VUS"	""
"0000464110"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464111"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00430"	"GAA_000028"	"g.78078910del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic"	""
"0000464112"	"1"	"50"	"17"	"78091490"	"78091490"	"subst"	"4.11326E-6"	"00430"	"GAA_000435"	"g.78091490C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117691C>T"	""	"VUS"	""
"0000464113"	"1"	"50"	"17"	"78084744"	"78084744"	"subst"	"8.12334E-6"	"00430"	"GAA_000044"	"g.78084744T>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80110945T>C"	""	"VUS"	""
"0000464114"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464115"	"1"	"50"	"17"	"78082400"	"78082400"	"subst"	"4.10055E-5"	"00430"	"GAA_000396"	"g.78082400C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108601C>G"	""	"VUS"	""
"0000464116"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464117"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464118"	"1"	"90"	"17"	"78086449"	"78086449"	"del"	"3.32928E-5"	"00430"	"GAA_000140"	"g.78086449del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"1827delC"	""	"Germline"	""	""	"0"	""	""	"g.80112650del"	""	"pathogenic"	""
"0000464119"	"1"	"50"	"17"	"78081692"	"78081692"	"subst"	"4.26047E-6"	"00430"	"GAA_000389"	"g.78081692A>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107893A>T"	""	"VUS"	""
"0000464120"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464121"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464122"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464123"	"1"	"50"	"17"	"78091482"	"78091482"	"subst"	"0.000898756"	"00430"	"GAA_000433"	"g.78091482G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117683G>A"	""	"VUS"	""
"0000464124"	"1"	"50"	"17"	"78086445"	"78086445"	"subst"	"0.000112072"	"00430"	"GAA_000413"	"g.78086445G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112646G>A"	""	"VUS"	""
"0000464125"	"1"	"50"	"17"	"78086445"	"78086445"	"subst"	"0.000112072"	"00430"	"GAA_000413"	"g.78086445G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112646G>A"	""	"VUS"	""
"0000464126"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000464127"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000464128"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464129"	"1"	"50"	"17"	"78086508"	"78086508"	"subst"	"8.84823E-6"	"00430"	"GAA_000417"	"g.78086508C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112709C>T"	""	"VUS"	""
"0000464130"	"1"	"50"	"17"	"78078797"	"78078797"	"subst"	"1.64258E-5"	"00430"	"GAA_000375"	"g.78078797C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104998C>G"	""	"VUS"	""
"0000464131"	"1"	"50"	"17"	"78078797"	"78078797"	"subst"	"1.64258E-5"	"00430"	"GAA_000375"	"g.78078797C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104998C>G"	""	"VUS"	""
"0000464132"	"1"	"50"	"17"	"78078651"	"78078651"	"subst"	"0.000139397"	"00430"	"GAA_000251"	"g.78078651G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104852G>A"	""	"VUS"	""
"0000464133"	"1"	"50"	"17"	"78078632"	"78078632"	"subst"	"4.11662E-5"	"00430"	"GAA_000370"	"g.78078632G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104833G>A"	""	"VUS"	""
"0000464134"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464135"	"1"	"50"	"17"	"78078632"	"78078632"	"subst"	"4.11662E-5"	"00430"	"GAA_000370"	"g.78078632G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104833G>A"	""	"VUS"	""
"0000464136"	"1"	"50"	"17"	"78091432"	"78091432"	"subst"	"4.10506E-6"	"00430"	"GAA_000429"	"g.78091432C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117633C>G"	""	"VUS"	""
"0000464137"	"1"	"90"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"00430"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"pathogenic"	""
"0000464138"	"1"	"70"	"17"	"78084737"	"78084737"	"subst"	"0.000138095"	"00430"	"GAA_000156"	"g.78084737C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80110938C>G"	""	"likely pathogenic"	""
"0000464139"	"1"	"50"	"17"	"78078459"	"78078459"	"subst"	"8.1483E-6"	"00430"	"GAA_000367"	"g.78078459C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104660C>T"	""	"VUS"	""
"0000464140"	"1"	"50"	"17"	"78087027"	"78087027"	"subst"	"7.27729E-5"	"00430"	"GAA_000420"	"g.78087027C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80113228C>T"	""	"VUS"	""
"0000464141"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464142"	"1"	"50"	"17"	"78082625"	"78082625"	"subst"	"0"	"00430"	"GAA_000402"	"g.78082625G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108826G>A"	""	"VUS"	""
"0000464143"	"1"	"50"	"17"	"78091484"	"78091484"	"subst"	"0.000455759"	"00430"	"GAA_000434"	"g.78091484C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117685C>T"	""	"VUS"	""
"0000464144"	"1"	"50"	"17"	"78081653"	"78081653"	"subst"	"0.000181784"	"00430"	"GAA_000388"	"g.78081653G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107854G>A"	""	"VUS"	""
"0000464145"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464146"	"1"	"90"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"00430"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"pathogenic"	""
"0000464147"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464148"	"1"	"90"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"00430"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"pathogenic"	""
"0000464149"	"1"	"50"	"17"	"78078396"	"78078396"	"subst"	"2.46326E-5"	"00430"	"GAA_000363"	"g.78078396G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104597G>A"	""	"VUS"	""
"0000464150"	"1"	"50"	"17"	"78078402"	"78078402"	"subst"	"1.22973E-5"	"00430"	"GAA_000364"	"g.78078402C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104603C>T"	""	"VUS"	""
"0000464151"	"1"	"50"	"17"	"78078695"	"78078695"	"subst"	"4.10651E-6"	"00430"	"GAA_000373"	"g.78078695G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104896G>A"	""	"VUS"	""
"0000464152"	"1"	"50"	"17"	"78082574"	"78082574"	"subst"	"0"	"00430"	"GAA_000399"	"g.78082574C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108775C>T"	""	"VUS"	""
"0000464153"	"1"	"50"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"00430"	"GAA_000281"	"g.78081655G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107856G>A"	""	"VUS"	""
"0000464154"	"1"	"90"	"17"	"78090813"	"78090813"	"subst"	"0"	"00430"	"GAA_000423"	"g.78090813T>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117014T>C"	""	"pathogenic"	""
"0000464155"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464156"	"1"	"50"	"17"	"78079686"	"78079686"	"subst"	"1.26907E-5"	"00430"	"GAA_000381"	"g.78079686C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105887C>T"	""	"VUS"	""
"0000464157"	"1"	"90"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"00430"	"GAA_000123"	"g.78078931G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>A"	""	"pathogenic"	""
"0000464158"	"1"	"90"	"17"	"78081399"	"78081399"	"del"	"0"	"00430"	"GAA_000383"	"g.78081399del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"736delC"	""	"Germline"	""	""	"0"	""	""	"g.80107600del"	""	"pathogenic"	""
"0000464159"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464160"	"1"	"70"	"17"	"78086463"	"78086463"	"subst"	"1.66199E-5"	"00430"	"GAA_000224"	"g.78086463C>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112664C>A"	""	"likely pathogenic"	""
"0000464161"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464162"	"1"	"50"	"17"	"78086471"	"78086471"	"subst"	"1.67255E-5"	"00430"	"GAA_000319"	"g.78086471G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112672G>A"	""	"VUS"	""
"0000464163"	"1"	"50"	"17"	"78090852"	"78090852"	"subst"	"0.00011393"	"00430"	"GAA_000426"	"g.78090852G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117053G>A"	""	"VUS"	""
"0000464164"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464165"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464166"	"1"	"50"	"17"	"78078747"	"78078747"	"subst"	"2.46221E-5"	"00430"	"GAA_000374"	"g.78078747A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104948A>G"	""	"VUS"	""
"0000464167"	"1"	"50"	"17"	"78091450"	"78091450"	"subst"	"0"	"00430"	"GAA_000430"	"g.78091450G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117651G>A"	""	"VUS"	""
"0000464168"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464169"	"1"	"50"	"17"	"78083835"	"78083835"	"subst"	"0"	"00430"	"GAA_000408"	"g.78083835G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80110036G>C"	""	"VUS"	""
"0000464170"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"00430"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic"	""
"0000464171"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464172"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464173"	"1"	"50"	"17"	"78079668"	"78079668"	"subst"	"0"	"00430"	"GAA_000380"	"g.78079668C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105869C>T"	""	"VUS"	""
"0000464174"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464175"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464176"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00430"	"GAA_000028"	"g.78078910del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic"	""
"0000464177"	"1"	"50"	"17"	"78081606"	"78081606"	"subst"	"1.24803E-5"	"00430"	"GAA_000387"	"g.78081606C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107807C>T"	""	"VUS"	""
"0000464178"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464179"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464180"	"1"	"50"	"17"	"78091482"	"78091482"	"subst"	"0.000898756"	"00430"	"GAA_000433"	"g.78091482G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117683G>A"	""	"VUS"	""
"0000464181"	"1"	"50"	"17"	"78092544"	"78092544"	"subst"	"2.44166E-5"	"00430"	"GAA_000443"	"g.78092544C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118745C>G"	""	"VUS"	""
"0000464182"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464183"	"1"	"50"	"17"	"78082294"	"78082294"	"subst"	"0"	"00430"	"GAA_000391"	"g.78082294C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>G"	""	"VUS"	""
"0000464184"	"1"	"50"	"17"	"78083804"	"78083804"	"subst"	"2.85033E-5"	"00430"	"GAA_000406"	"g.78083804C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110005C>T"	""	"VUS"	""
"0000464185"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464186"	"1"	"50"	"17"	"78087131"	"78087131"	"subst"	"0.000247779"	"00430"	"GAA_000332"	"g.78087131G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80113332G>T"	""	"VUS"	""
"0000464187"	"1"	"50"	"17"	"78092457"	"78092457"	"subst"	"0.000429083"	"00430"	"GAA_000442"	"g.78092457G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118658G>A"	""	"VUS"	""
"0000464188"	"1"	"50"	"17"	"78078455"	"78078455"	"subst"	"3.25998E-5"	"00430"	"GAA_000366"	"g.78078455G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104656G>A"	""	"VUS"	""
"0000464189"	"1"	"50"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"00430"	"GAA_000281"	"g.78081655G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107856G>A"	""	"VUS"	""
"0000464190"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"00430"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic"	""
"0000464191"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464192"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464193"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464194"	"1"	"90"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"00430"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"pathogenic"	""
"0000464195"	"1"	"50"	"17"	"78082400"	"78082400"	"subst"	"4.10055E-5"	"00430"	"GAA_000396"	"g.78082400C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108601C>G"	""	"VUS"	""
"0000464196"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464197"	"1"	"50"	"17"	"78087027"	"78087027"	"subst"	"7.27729E-5"	"00430"	"GAA_000420"	"g.78087027C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80113228C>T"	""	"VUS"	""
"0000464198"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464199"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464200"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464201"	"1"	"90"	"17"	"78092022"	"78092022"	"subst"	"4.07422E-6"	"00430"	"GAA_000438"	"g.78092022C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118223C>T"	""	"pathogenic"	""
"0000464202"	"1"	"50"	"17"	"78092033"	"78092033"	"subst"	"0"	"00430"	"GAA_000439"	"g.78092033G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118234G>C"	""	"VUS"	""
"0000464203"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464204"	"1"	"50"	"17"	"78083792"	"78083792"	"subst"	"8.13901E-6"	"00430"	"GAA_000404"	"g.78083792G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80109993G>C"	""	"VUS"	""
"0000464205"	"1"	"50"	"17"	"78091484"	"78091484"	"subst"	"0.000455759"	"00430"	"GAA_000434"	"g.78091484C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117685C>T"	""	"VUS"	""
"0000464206"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464207"	"1"	"50"	"17"	"78078845"	"78078845"	"subst"	"2.07574E-5"	"00430"	"GAA_000377"	"g.78078845C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105046C>T"	""	"VUS"	""
"0000464208"	"1"	"90"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"00430"	"GAA_000123"	"g.78078931G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105132G>A"	""	"pathogenic"	""
"0000464209"	"1"	"50"	"17"	"78091484"	"78091484"	"subst"	"0.000455759"	"00430"	"GAA_000434"	"g.78091484C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117685C>T"	""	"VUS"	""
"0000464210"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464211"	"1"	"50"	"17"	"78092020"	"78092020"	"subst"	"2.44539E-5"	"00430"	"GAA_000437"	"g.78092020G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118221G>A"	""	"VUS"	""
"0000464212"	"1"	"50"	"17"	"78081504"	"78081504"	"subst"	"0.000197663"	"00430"	"GAA_000385"	"g.78081504C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107705C>T"	""	"VUS"	""
"0000464213"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"00430"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic"	""
"0000464214"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464215"	"1"	"50"	"17"	"78084592"	"78084592"	"subst"	"4.87496E-5"	"00430"	"GAA_000409"	"g.78084592A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110793A>G"	""	"VUS"	""
"0000464216"	"1"	"50"	"17"	"78085806"	"78085806"	"subst"	"2.03259E-5"	"00430"	"GAA_000410"	"g.78085806C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112007C>T"	""	"VUS"	""
"0000464217"	"1"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00430"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Nallamilli 2018:30564623}"	""	"258dupC"	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic"	""
"0000464218"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464219"	"1"	"50"	"17"	"78078930"	"78078930"	"subst"	"4.7309E-5"	"00430"	"GAA_000378"	"g.78078930C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80105131C>G"	""	"VUS"	""
"0000464220"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464221"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"8.13431E-6"	"00430"	"GAA_000425"	"g.78090815G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>A"	""	"pathogenic"	""
"0000464222"	"1"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00430"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	""
"0000464223"	"1"	"50"	"17"	"78091475"	"78091475"	"subst"	"4.09464E-5"	"00430"	"GAA_000432"	"g.78091475A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117676A>G"	""	"VUS"	""
"0000464224"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464225"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464226"	"1"	"50"	"17"	"78082335"	"78082335"	"subst"	"4.09272E-5"	"00430"	"GAA_000392"	"g.78082335C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108536C>T"	""	"VUS"	""
"0000464227"	"1"	"50"	"17"	"78081457"	"78081457"	"subst"	"2.43938E-5"	"00430"	"GAA_000384"	"g.78081457G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107658G>A"	""	"VUS"	""
"0000464228"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464229"	"1"	"90"	"17"	"78082355"	"78082355"	"del"	"0"	"00430"	"GAA_000394"	"g.78082355del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"1143delC"	""	"Germline"	""	""	"0"	""	""	"g.80108556del"	""	"pathogenic"	""
"0000464230"	"0"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464231"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464232"	"1"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"00430"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Nallamilli 2018:30564623}"	""	"2242dupG"	""	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic"	""
"0000464233"	"1"	"50"	"17"	"78086515"	"78086515"	"subst"	"2.25874E-5"	"00430"	"GAA_000418"	"g.78086515G>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112716G>T"	""	"VUS"	""
"0000464234"	"1"	"50"	"17"	"78078597"	"78078597"	"subst"	"4.14546E-6"	"00430"	"GAA_000369"	"g.78078597A>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104798A>G"	""	"VUS"	""
"0000464235"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464236"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464237"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464238"	"1"	"90"	"17"	"78086449"	"78086449"	"del"	"3.32928E-5"	"00430"	"GAA_000140"	"g.78086449del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"1827delC"	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112650del"	""	"pathogenic"	""
"0000464239"	"1"	"70"	"17"	"78084737"	"78084737"	"subst"	"0.000138095"	"00430"	"GAA_000156"	"g.78084737C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80110938C>G"	""	"likely pathogenic"	""
"0000464240"	"1"	"90"	"17"	"78082340"	"78082341"	"delins"	"0"	"00430"	"GAA_000243"	"g.78082340_78082341delinsC"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108541_80108542delinsC"	""	"pathogenic"	""
"0000464241"	"1"	"50"	"17"	"78078390"	"78078390"	"subst"	"4.11235E-6"	"00430"	"GAA_000362"	"g.78078390G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104591G>C"	""	"VUS"	""
"0000464242"	"3"	"50"	"17"	"78079686"	"78079686"	"subst"	"1.26907E-5"	"00430"	"GAA_000381"	"g.78079686C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"variant apparently homozygous"	"Germline"	""	""	"0"	""	""	"g.80105887C>T"	""	"VUS"	""
"0000464243"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464244"	"1"	"90"	"17"	"78082365"	"78082365"	"del"	"0"	"00430"	"GAA_000395"	"g.78082365del"	""	"{PMID:Nallamilli 2018:30564623}"	""	"1153delC"	""	"Germline"	""	""	"0"	""	""	"g.80108566del"	""	"pathogenic"	""
"0000464245"	"1"	"90"	"17"	"78084525"	"78084525"	"subst"	"0"	"00430"	"GAA_000096"	"g.78084525G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80110726G>C"	""	"pathogenic"	""
"0000464246"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464247"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00430"	"GAA_000028"	"g.78078910del"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic"	""
"0000464248"	"1"	"50"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"00430"	"GAA_000281"	"g.78081655G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80107856G>A"	""	"VUS"	""
"0000464249"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464250"	"1"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00430"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"pathogenic"	""
"0000464251"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464252"	"1"	"50"	"17"	"78086445"	"78086445"	"subst"	"0.000112072"	"00430"	"GAA_000413"	"g.78086445G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112646G>A"	""	"VUS"	""
"0000464253"	"1"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"00430"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Nallamilli 2018:30564623}"	""	"2242dupG"	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic"	""
"0000464254"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464255"	"1"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00430"	"GAA_000003"	"g.78078656G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000464256"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464257"	"1"	"90"	"17"	"78092022"	"78092022"	"subst"	"4.07422E-6"	"00430"	"GAA_000438"	"g.78092022C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80118223C>T"	""	"pathogenic"	""
"0000464258"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464259"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464260"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464261"	"1"	"50"	"17"	"78083795"	"78083795"	"subst"	"1.22108E-5"	"00430"	"GAA_000405"	"g.78083795G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80109996G>A"	""	"VUS"	""
"0000464262"	"1"	"50"	"17"	"78082589"	"78082589"	"subst"	"3.04984E-5"	"00430"	"GAA_000400"	"g.78082589G>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108790G>A"	""	"VUS"	""
"0000464263"	"1"	"50"	"17"	"78082335"	"78082335"	"subst"	"4.09272E-5"	"00430"	"GAA_000392"	"g.78082335C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80108536C>T"	""	"VUS"	""
"0000464264"	"1"	"70"	"17"	"78086424"	"78086424"	"subst"	"0"	"00430"	"GAA_000412"	"g.78086424C>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112625C>G"	""	"likely pathogenic"	""
"0000464265"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464266"	"1"	"50"	"17"	"78087132"	"78087132"	"subst"	"0.000127319"	"00430"	"GAA_000422"	"g.78087132C>A"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80113333C>A"	""	"VUS"	""
"0000464267"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00430"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000464268"	"1"	"50"	"17"	"78086379"	"78086379"	"subst"	"2.46025E-5"	"00430"	"GAA_000411"	"g.78086379C>T"	""	"{PMID:Nallamilli 2018:30564623}"	""	""	"no second variant"	"Germline"	""	""	"0"	""	""	"g.80112580C>T"	""	"VUS"	""
"0000470964"	"1"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"00006"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Oitan 2018:29778277}"	""	""	"GAA activity allele  in parent fibroblasts 0.30 (combined 0.08)"	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000470965"	"2"	"70"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"00006"	"GAA_000045"	"g.78085871G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	"GAA activity allele  in parent fibroblasts 0.20 (combined 0.08)"	"Germline"	""	""	"0"	""	""	"g.80112072G>A"	""	"benign (!)"	""
"0000470966"	"2"	"30"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"00006"	"GAA_000035"	"g.78087041G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113242G>A"	""	"benign"	""
"0000470967"	"2"	"10"	"17"	"78086531"	"78086531"	"subst"	"0.0575615"	"00006"	"GAA_000321"	"g.78086531G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112732G>A"	""	"benign"	""
"0000470968"	"2"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"00006"	"GAA_000022"	"g.78087109A>G"	""	"{PMID:Oitan 2018:29778277}"	""	"2113A>G"	""	"Germline"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000470969"	"1"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"00006"	"GAA_000010"	"g.78092063G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000470970"	"1"	"10"	"17"	"78079544"	"78079544"	"subst"	"0.669863"	"00006"	"GAA_000258"	"g.78079544C>G"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105745C>G"	""	"benign"	""
"0000470971"	"2"	"10"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"00006"	"GAA_000004"	"g.78079597A>G"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105798A>G"	""	"benign"	""
"0000470972"	"1"	"10"	"17"	"78081529"	"78081529"	"subst"	"0.0059393"	"00006"	"GAA_000273"	"g.78081529G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107730G>A"	""	"benign"	""
"0000470973"	"1"	"10"	"17"	"78081551"	"78081551"	"subst"	"0.662574"	"00006"	"GAA_000275"	"g.78081551T>C"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107752T>C"	""	"benign"	""
"0000470974"	"2"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"00006"	"GAA_000006"	"g.78082504G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000470975"	"2"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"00006"	"GAA_000038"	"g.78079669G>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000470976"	"1"	"10"	"17"	"78084688"	"78084688"	"subst"	"0.669866"	"00006"	"GAA_000445"	"g.78084688C>A"	""	"{PMID:Oitan 2018:29778277}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110889C>A"	""	"benign"	""
"0000478257"	"0"	"90"	"17"	"78056048"	"78094853"	"del"	"0"	"01940"	"GAA_000489"	"g.78056048_78094853delinsTGTGGTGGCTCATG"	"MAF not reported"	"{Pompe:566}"	""	"del GAA and part of CCDC40"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80082249_80121054delinsTGTGGTGGCTCATG"	""	"pathogenic"	"ACMG"
"0000478258"	"0"	"90"	"17"	"78078386"	"78078386"	"subst"	"0"	"01940"	"GAA_000284"	"g.78078386A>T"	"MAF not reported"	"{Pompe:572}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104587A>T"	""	"pathogenic"	"ACMG"
"0000478259"	"0"	"90"	"17"	"78078386"	"78078386"	"subst"	"0"	"01940"	"GAA_000355"	"g.78078386A>G"	"MAF not reported"	"{Pompe:573}"	""	""	"predicted very severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104587A>G"	""	"pathogenic"	"ACMG"
"0000478260"	"0"	"70"	"17"	"78078387"	"78078387"	"subst"	"0"	"01940"	"GAA_000356"	"g.78078387T>C"	"MAF not reported"	"{Pompe:574}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104588T>C"	""	"likely pathogenic"	"ACMG"
"0000478261"	"0"	"90"	"17"	"78078388"	"78078388"	"subst"	"4.11556E-6"	"01940"	"GAA_000357"	"g.78078388G>A"	"MAF not reported"	"{Pompe:575}"	""	""	"predicted very severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104589G>A"	""	"pathogenic"	"ACMG"
"0000478262"	"0"	"70"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000491"	"g.78078351C>G"	"MAF not reported"	"{Pompe:569}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104552C>G"	""	"likely pathogenic"	"ACMG"
"0000478263"	"0"	"50"	"17"	"78078936"	"78078936"	"subst"	"3.89176E-5"	"01940"	"GAA_000471"	"g.78078936G>T"	"MAF <0.01"	"{Pompe:625}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs756024023"	"0"	""	""	"g.80105137G>T"	""	"VUS"	"ACMG"
"0000478264"	"0"	"10"	"17"	"78079544"	"78079544"	"subst"	"0.669863"	"01940"	"GAA_000258"	"g.78079544C>G"	"MAF >0.05"	"{Pompe:629}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs3816256"	"0"	""	""	"g.80105745C>G"	""	"benign"	"ACMG"
"0000478265"	"0"	"50"	"17"	"78082632"	"78082632"	"subst"	"0"	"01940"	"GAA_000564"	"g.78082632G>A"	"MAF not reported"	"{Pompe:773}"	""	""	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108833G>A"	""	"VUS"	"ACMG"
"0000478266"	"0"	"50"	"17"	"78084642"	"78084645"	"del"	"0"	"01940"	"GAA_000594"	"g.78084642_78084645del"	"MAF not reported"	"{Pompe:831}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110843_80110846del"	""	"VUS"	"ACMG"
"0000478267"	"0"	"70"	"17"	"78084737"	"78084737"	"subst"	"0.000138095"	"01940"	"GAA_000156"	"g.78084737C>G"	"MAF <0.01"	"{Pompe:834}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing)"	"SUMMARY record"	""	"rs375470378"	"0"	""	""	"g.80110938C>G"	""	"likely pathogenic"	"ACMG"
"0000478268"	"0"	"70"	"17"	"78084829"	"78084829"	"subst"	"0"	"01940"	"GAA_000604"	"g.78084829G>T"	"MAF not reported"	"{Pompe:852}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111030G>T"	""	"likely pathogenic"	"ACMG"
"0000478269"	"0"	"90"	"17"	"78084829"	"78084829"	"subst"	"0"	"01940"	"GAA_000605"	"g.78084829G>C"	"MAF not reported"	"{Pompe:853}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111030G>C"	""	"pathogenic"	"ACMG"
"0000478270"	"0"	"50"	"17"	"78087168"	"78087168"	"subst"	"0"	"01940"	"GAA_000676"	"g.78087168G>C"	"MAF not reported"	"{Pompe:987}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113369G>C"	""	"VUS"	"ACMG"
"0000478271"	"0"	"50"	"17"	"78090912"	"78090912"	"subst"	"0"	"01940"	"GAA_000165"	"g.78090912A>G"	"MAF not reported"	"{Pompe:1020}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117113A>G"	""	"VUS"	"ACMG"
"0000478272"	"0"	"50"	"17"	"78092608"	"78092608"	"subst"	"4.0784E-6"	"01940"	"GAA_000444"	"g.78092608A>G"	"MAF <0.01"	"{Pompe:1067}"	""	""	"prediction unknown, adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs778032599"	"0"	""	""	"g.80118809A>G"	""	"VUS"	"ACMG"
"0000478273"	"0"	"50"	"17"	"78093067"	"78093067"	"subst"	"0"	"01940"	"GAA_000718"	"g.78093067C>G"	"MAF not reported"	"{Pompe:1068}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119268C>G"	""	"VUS"	"ACMG"
"0000478274"	"0"	"50"	"17"	"78082411"	"78082411"	"subst"	"0"	"01940"	"GAA_000544"	"g.78082411G>A"	"MAF not reported"	"{Pompe:1093}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108612G>A"	""	"VUS"	"ACMG"
"0000478275"	"0"	"50"	"17"	"78083858"	"78083858"	"subst"	"0"	"01940"	"GAA_000577"	"g.78083858G>C"	"MAF not reported"	"{Pompe:1097}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110059G>C"	""	"VUS"	"ACMG"
"0000478276"	"0"	"90"	"17"	"78078352"	"78078352"	"subst"	"0"	"01940"	"GAA_000354"	"g.78078352A>G"	"MAF not reported"	"{Pompe:571}"	""	""	"predicted very severe, childhood/adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104553A>G"	""	"pathogenic"	"ACMG"
"0000478277"	"0"	"90"	"17"	"78078932"	"78078932"	"subst"	"0"	"01940"	"GAA_000468"	"g.78078932G>T"	"MAF not reported"	"{Pompe:622}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105133G>T"	""	"pathogenic"	"ACMG"
"0000478278"	"0"	"90"	"17"	"78078933"	"78078933"	"subst"	"0"	"01940"	"GAA_000469"	"g.78078933T>C"	"MAF not reported"	"{Pompe:623}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105134T>C"	""	"pathogenic"	"ACMG"
"0000478279"	"0"	"90"	"17"	"78079694"	"78079694"	"subst"	"4.25268E-6"	"01940"	"GAA_000148"	"g.78079694G>C"	"MAF <0.01"	"{Pompe:644}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs773281453"	"0"	""	""	"g.80105895G>C"	""	"pathogenic"	"ACMG"
"0000478280"	"0"	"90"	"17"	"78079694"	"78079694"	"subst"	"4.25268E-6"	"01940"	"GAA_000498"	"g.78079694G>A"	"MAF not reported"	"{Pompe:645}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105895G>A"	""	"pathogenic"	"ACMG"
"0000478281"	"0"	"90"	"17"	"78081523"	"78081523"	"subst"	"0"	"01940"	"GAA_000509"	"g.78081523T>A"	"MAF not reported"	"{Pompe:676}"	""	""	"predicted very severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107724T>A"	""	"pathogenic"	"ACMG"
"0000478282"	"0"	"90"	"17"	"78081597"	"78081597"	"subst"	"0"	"01940"	"GAA_000515"	"g.78081597A>T"	"MAF not reported"	"{Pompe:679}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107798A>T"	""	"pathogenic"	"ACMG"
"0000478283"	"0"	"50"	"17"	"78081697"	"78081697"	"subst"	"0"	"01940"	"GAA_000522"	"g.78081697T>G"	"MAF not reported"	"{Pompe:701}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107898T>G"	""	"VUS"	"ACMG"
"0000478284"	"0"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000529"	"g.78082287G>A"	"MAF not reported"	"{Pompe:720}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108488G>A"	""	"pathogenic"	"ACMG"
"0000478285"	"0"	"90"	"17"	"78082408"	"78082408"	"subst"	"0"	"01940"	"GAA_000152"	"g.78082408T>A"	"MAF not reported"	"{Pompe:743}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108609T>A"	""	"pathogenic"	"ACMG"
"0000478286"	"0"	"90"	"17"	"78082408"	"78082408"	"subst"	"0"	"01940"	"GAA_000543"	"g.78082408T>C"	"MAF not reported"	"{Pompe:744}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108609T>C"	""	"pathogenic"	"ACMG"
"0000478287"	"0"	"90"	"17"	"78082494"	"78082494"	"subst"	"0"	"01940"	"GAA_000549"	"g.78082494A>G"	"MAF <0.01"	"{Pompe:748}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs765360653"	"0"	""	""	"g.80108695A>G"	""	"pathogenic"	"ACMG"
"0000478288"	"0"	"90"	"17"	"78082628"	"78082628"	"subst"	"0"	"01940"	"GAA_000078"	"g.78082628G>A"	"MAF not reported"	"{Pompe:772}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108829G>A"	""	"pathogenic"	"ACMG"
"0000478289"	"0"	"90"	"17"	"78083855"	"78083855"	"subst"	"0"	"01940"	"GAA_000576"	"g.78083855G>A"	"MAF not reported"	"{Pompe:798}"	""	""	"predicted very severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110056G>A"	""	"pathogenic"	"ACMG"
"0000478290"	"0"	"90"	"17"	"78084524"	"78084524"	"subst"	"0"	"01940"	"GAA_000578"	"g.78084524A>G"	"MAF not reported"	"{Pompe:801}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110725A>G"	""	"pathogenic"	"ACMG"
"0000478291"	"0"	"90"	"17"	"78084525"	"78084525"	"subst"	"0"	"01940"	"GAA_000096"	"g.78084525G>C"	"MAF not reported"	"{Pompe:802}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110726G>C"	""	"pathogenic"	"ACMG"
"0000478292"	"0"	"50"	"17"	"78084525"	"78084525"	"subst"	"8.13312E-6"	"01940"	"GAA_000579"	"g.78084525G>T"	"MAF <0.01"	"{Pompe:803}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs147804176"	"0"	""	""	"g.80110726G>T"	""	"VUS"	"ACMG"
"0000478293"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"8.12572E-6"	"01940"	"GAA_000305"	"g.78084640G>T"	"MAF <0.01"	"{Pompe:828}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing)"	"SUMMARY record"	""	"rs770780848"	"0"	""	""	"g.80110841G>T"	""	"pathogenic"	"ACMG"
"0000478294"	"0"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000304"	"g.78084640G>A"	"MAF not reported"	"{Pompe:829}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110841G>A"	""	"pathogenic"	"ACMG"
"0000478295"	"0"	"90"	"17"	"78084641"	"78084641"	"subst"	"0"	"01940"	"GAA_000593"	"g.78084641T>G"	"MAF not reported"	"{Pompe:830}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110842T>G"	""	"pathogenic"	"ACMG"
"0000478296"	"0"	"90"	"17"	"78084825"	"78084825"	"subst"	"0"	"01940"	"GAA_000603"	"g.78084825G>C"	"MAF not reported"	"{Pompe:851}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111026G>C"	""	"pathogenic"	"ACMG"
"0000478297"	"0"	"90"	"17"	"78085780"	"78085780"	"subst"	"0"	"01940"	"GAA_000352"	"g.78085780A>G"	"MAF not reported"	"{Pompe:854}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111981A>G"	""	"pathogenic"	"ACMG"
"0000478298"	"0"	"90"	"17"	"78085900"	"78085900"	"subst"	"0"	"01940"	"GAA_000620"	"g.78085900G>A"	"MAF not reported"	"{Pompe:885}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112101G>A"	""	"pathogenic"	"ACMG"
"0000478299"	"0"	"90"	"17"	"78085901"	"78085901"	"subst"	"0"	"01940"	"GAA_000621"	"g.78085901T>A"	"MAF not reported"	"{Pompe:886}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112102T>A"	""	"pathogenic"	"ACMG"
"0000478300"	"0"	"90"	"17"	"78086376"	"78086376"	"subst"	"0"	"01940"	"GAA_000623"	"g.78086376G>A"	"MAF not reported"	"{Pompe:888}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112577G>A"	""	"pathogenic"	"ACMG"
"0000478301"	"0"	"90"	"17"	"78086511"	"78086511"	"subst"	"0"	"01940"	"GAA_000640"	"g.78086511G>A"	"MAF <0.01"	"{Pompe:924}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs776325453"	"0"	""	""	"g.80112712G>A"	""	"pathogenic"	"ACMG"
"0000478302"	"0"	"90"	"17"	"78086827"	"78086827"	"subst"	"0"	"01940"	"GAA_000655"	"g.78086827G>T"	"MAF not reported"	"{Pompe:957}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113028G>T"	""	"pathogenic"	"ACMG"
"0000478303"	"0"	"90"	"17"	"78087015"	"78087015"	"subst"	"0"	"01940"	"GAA_000142"	"g.78087015A>C"	"MAF not reported"	"{Pompe:960}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113216A>C"	""	"pathogenic"	"ACMG"
"0000478304"	"0"	"50"	"17"	"78087166"	"78087166"	"subst"	"0"	"01940"	"GAA_000333"	"g.78087166G>A"	"MAF not reported"	"{Pompe:986}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113367G>A"	""	"VUS"	"ACMG"
"0000478305"	"0"	"90"	"17"	"78090909"	"78090909"	"subst"	"0"	"01940"	"GAA_000693"	"g.78090909G>A"	"MAF not reported"	"{Pompe:1017}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117110G>A"	""	"pathogenic"	"ACMG"
"0000478306"	"0"	"90"	"17"	"78090910"	"78090910"	"subst"	"0"	"01940"	"GAA_000058"	"g.78090910T>C"	"MAF not reported"	"{Pompe:1018}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117111T>C"	""	"pathogenic"	"ACMG"
"0000478307"	"0"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"01940"	"GAA_000336"	"g.78090910T>A"	"MAF not reported"	"{Pompe:1019}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic"	"ACMG"
"0000478308"	"0"	"50"	"17"	"78091549"	"78091549"	"subst"	"0"	"01940"	"GAA_000702"	"g.78091549G>A"	"MAF not reported"	"{Pompe:1037}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117750G>A"	""	"VUS"	"ACMG"
"0000478309"	"0"	"90"	"17"	"78091550"	"78091550"	"subst"	"0"	"01940"	"GAA_000703"	"g.78091550T>C"	"MAF not reported"	"{Pompe:1038}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117751T>C"	""	"pathogenic"	"ACMG"
"0000478310"	"0"	"90"	"17"	"78078933"	"78078936"	"del"	"0"	"01940"	"GAA_000470"	"g.78078933_78078936del"	"MAF not reported"	"{Pompe:624}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105134_80105137del"	""	"pathogenic"	"ACMG"
"0000478311"	"0"	"70"	"17"	"78084773"	"78084774"	"del"	"0"	"01940"	"GAA_000054"	"g.78084773_78084774delinsGT"	"MAF not reported"	"{Pompe:847}"	""	"1585_1586TC>GT"	"predicted potentially mild, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110974_80110975delinsGT"	""	"likely pathogenic"	"ACMG"
"0000478312"	"0"	"50"	"17"	"78082137"	"78082137"	"subst"	"0"	"01940"	"GAA_000283"	"g.78082137G>A"	"MAF not reported"	"{Pompe:710}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.85), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108338G>A"	""	"VUS"	"ACMG"
"0000478313"	"0"	"70"	"17"	"78086455"	"78086469"	"del"	"0"	"01940"	"GAA_000490"	"g.78086455_78086469delinsACGGGGTAT"	"MAF not reported"	"{Pompe:913}"	""	"1833_1839del;1846G>T;1847_1848insT"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112656_80112670delinsACGGGGTAT"	""	"likely pathogenic"	"ACMG"
"0000478314"	"0"	"90"	"17"	"78078725"	"78078726"	"ins"	"0"	"01940"	"GAA_000121"	"g.78078725_78078726insT"	"MAF not reported"	"{Pompe:1124}"	""	"340insT"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104926_80104927insT"	""	"pathogenic"	"ACMG"
"0000478315"	"0"	"90"	"17"	"78079686"	"78079687"	"ins"	"0"	"01940"	"GAA_000497"	"g.78079686_78079687insCGGC"	"MAF not reported"	"{Pompe:643}"	""	"685insCGGC"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105887_80105888insCGGC"	""	"pathogenic"	"ACMG"
"0000478316"	"0"	"70"	"17"	"78081694"	"78081695"	"ins"	"0"	"01940"	"GAA_000488"	"g.78081694_78081695insN[21]"	"MAF not reported"	"{Pompe:700}"	""	"955ins21"	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000478317"	"0"	"90"	"17"	"78090899"	"78090900"	"ins"	"0"	"01940"	"GAA_000486"	"g.78090899_78090900insGGTGAGTCTGCAAACGGGGAGT"	"MAF not reported"	"{Pompe:452}"	""	"2322insggtgagtctgcaaacggggagt"	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117100_80117101insGGTGAGTCTGCAAACGGGGAGT"	""	"pathogenic"	"ACMG"
"0000478318"	"0"	"50"	"17"	"78093283"	"78093284"	"ins"	"0"	"01940"	"GAA_000721"	"g.78093283_78093284insG"	"MAF not reported"	"{Pompe:1124}"	""	"*154insG"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119484_80119485insG"	""	"VUS"	"ACMG"
"0000478319"	"0"	"50"	"17"	"78081526"	"78081527"	"ins"	"0"	"01940"	"GAA_000487"	"g.78081526_78081527insN[7]"	"MAF not reported"	"{Pompe:677}"	""	"858+5ins7"	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000478320"	"0"	"50"	"17"	"78081541"	"78081541"	"dup"	"0"	"01940"	"GAA_000110"	"g.78081541dup"	"MAF not reported"	"{Pompe:1087}"	""	"858+18insG"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107742dup"	""	"VUS"	"ACMG"
"0000478321"	"0"	"50"	"17"	"78081538"	"78081544"	"dup"	"0"	"01940"	"GAA_000511"	"g.78081538_78081544dup"	"MAF not reported"	"{Pompe:1089}"	""	"858+24insCGGGCGG"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107739_80107745dup"	""	"VUS"	"ACMG"
"0000478322"	"0"	"50"	"17"	"78081558"	"78081558"	"subst"	"0"	"01940"	"GAA_000514"	"g.78081558C>T"	"MAF not reported"	"{Pompe:1090}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)\r\nVariant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"SUMMARY record"	""	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000478323"	"0"	"70"	"17"	"78083794"	"78083796"	"del"	"0"	"01940"	"GAA_000571"	"g.78083794_78083796del"	"MAF not reported"	"{Pompe:785}"	""	"1373_1375del"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109995_80109997del"	""	"likely pathogenic"	"ACMG"
"0000478324"	"0"	"70"	"17"	"78082621"	"78082623"	"del"	"0"	"01940"	"GAA_000562"	"g.78082621_78082623del"	"MAF not reported"	"{Pompe:768}"	""	"1315_1317del"	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108822_80108824del"	""	"likely pathogenic"	"ACMG"
"0000478326"	"0"	"90"	"17"	"78083788"	"78083788"	"del"	"0"	"01940"	"GAA_000569"	"g.78083788del"	"MAF not reported"	"{Pompe:782}"	""	"1369del"	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109989del"	""	"pathogenic"	"ACMG"
"0000478327"	"0"	"90"	"17"	"78081492"	"78081514"	"del"	"0"	"01940"	"GAA_000507"	"g.78081492_78081514del"	"MAF not reported"	"{Pompe:670}"	""	"828_850del"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107693_80107715del"	""	"pathogenic"	"ACMG"
"0000478328"	"0"	"70"	"17"	"78082500"	"78082511"	"del"	"0"	"01940"	"GAA_000550"	"g.78082500_78082511del"	"MAF not reported"	"{Pompe:749}"	""	"1197_1208del"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108701_80108712del"	""	"likely pathogenic"	"ACMG"
"0000478329"	"0"	"50"	"17"	"78086956"	"78086956"	"del"	"0"	"01940"	"GAA_000660"	"g.78086956del"	"MAF not reported"	"{Pompe:1111}"	""	"2041-64del"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113157del"	""	"VUS"	"ACMG"
"0000478330"	"0"	"90"	"17"	"78092115"	"78092115"	"del"	"0"	"01940"	"GAA_000707"	"g.78092115del"	"MAF not reported"	"{Pompe:1048}"	""	"2604del"	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118316del"	""	"pathogenic"	"ACMG"
"0000478331"	"0"	"50"	"17"	"78081538"	"78081544"	"del"	"0"	"01940"	"GAA_000512"	"g.78081538_78081544del"	"MAF not reported"	"{Pompe:1086}"	""	"858+9_858+15del"	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107739_80107745del"	""	"VUS"	"ACMG"
"0000478333"	"0"	"90"	"17"	"78093086"	"78093087"	"del"	"0"	"01940"	"GAA_000086"	"g.78093086_78093087del"	"MAF not reported"	"{Pompe:1070}"	""	"2812_2813del"	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119287_80119288del"	""	"pathogenic"	"ACMG"
"0000478334"	"0"	"90"	"17"	"78082477"	"78090747"	"del"	"0"	"01940"	"GAA_000546"	"g.78082477_78090747del"	"MAF not reported"	"{Pompe:745}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108678_80116948del"	""	"pathogenic"	"ACMG"
"0000478335"	"0"	"90"	"17"	"78082623"	"78082636"	"del"	"0"	"01940"	"GAA_000563"	"g.78082623_78082636del"	"MAF not reported"	"{Pompe:770}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108824_80108837del"	""	"pathogenic"	"ACMG"
"0000478336"	"0"	"50"	"17"	"78086648"	"78086849"	"del"	"0"	"01940"	"GAA_000641"	"g.78086648_78086849del"	"MAF not reported"	"{Pompe:926}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112849_80113050del"	""	"VUS"	"ACMG"
"0000478337"	"0"	"70"	"17"	"78087624"	"78093676"	"del"	"0"	"01940"	"GAA_000677"	"g.78087624_78093676del"	"MAF not reported"	"{Pompe:988}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)\r\nVariant Error [EMISMATCH/ERANGE]: This transcript variant has an error. Please fix this entry and then remove this message."	"SUMMARY record"	""	""	"0"	""	""	""	""	"likely pathogenic"	"ACMG"
"0000478338"	"0"	"90"	"17"	"78078533"	"78081588"	"del"	"0"	"01940"	"GAA_000446"	"g.78078533_78081588del"	"MAF not reported"	"{Pompe:580}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104734_80107789del"	""	"pathogenic"	"ACMG"
"0000478339"	"0"	"90"	"17"	"78092158"	"78092159"	"del"	"0"	"01940"	"GAA_000168"	"g.78092158_78092159del"	"MAF not reported"	"{Pompe:1051}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118359_80118360del"	""	"pathogenic"	"ACMG"
"0000478340"	"0"	"50"	"17"	"78075640"	"78075640"	"subst"	"0"	"01940"	"GAA_000001"	"g.78075640G>C"	"MAF not reported"	"{Pompe:567}"	""	""	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80101841G>C"	""	"VUS"	"ACMG"
"0000478341"	"0"	"90"	"17"	"78078403"	"78078410"	"del"	"0"	"01940"	"GAA_000358"	"g.78078403_78078410del"	"MAF not reported"	"{Pompe:576}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104604_80104611del"	""	"pathogenic"	"ACMG"
"0000478342"	"0"	"90"	"17"	"78078410"	"78078410"	"del"	"0"	"01940"	"GAA_000359"	"g.78078410del"	"MAF not reported"	"{Pompe:577}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104611del"	""	"pathogenic"	"ACMG"
"0000478343"	"0"	"50"	"17"	"78078521"	"78078521"	"subst"	"0"	"01940"	"GAA_000056"	"g.78078521T>C"	"MAF <0.01"	"{Pompe:579}"	""	""	"predicted non-pathogenic, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 353.86-GD: 0.00), SIFT tolerated (score: 0.26), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs777215354"	"0"	""	""	"g.80104722T>C"	""	"VUS"	"ACMG"
"0000478344"	"0"	"90"	"17"	"78078557"	"78078557"	"subst"	"0"	"01940"	"GAA_000076"	"g.78078557C>T"	"MAF <0.01"	"{Pompe:581}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs201185475"	"0"	""	""	"g.80104758C>T"	""	"pathogenic"	"ACMG"
"0000478345"	"0"	"50"	"17"	"78078571"	"78078581"	"dup"	"0"	"01940"	"GAA_000447"	"g.78078571_78078581dup"	"MAF not reported"	"{Pompe:582}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104772_80104782dup"	""	"VUS"	"ACMG"
"0000478346"	"0"	"90"	"17"	"78078626"	"78078626"	"subst"	"0"	"01940"	"GAA_000448"	"g.78078626C>T"	"MAF not reported"	"{Pompe:584}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104827C>T"	""	"pathogenic"	"ACMG"
"0000478347"	"0"	"50"	"17"	"78078651"	"78078651"	"subst"	"0.000139397"	"01940"	"GAA_000251"	"g.78078651G>A"	"MAF <0.01"	"{Pompe:586}"	""	""	"predicted presumably non-pathogenic, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 109.21-GD: 4.81), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs200586324"	"0"	""	""	"g.80104852G>A"	""	"VUS"	"ACMG"
"0000478348"	"0"	"30"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"01940"	"GAA_000003"	"g.78078656G>A"	"MAF >0.01"	"{Pompe:587}"	""	""	"predicted presumably non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 65.47-GD: 3.99), SIFT tolerated (score: 0.08), Mutation Taster polymorphism (p-value: 0)"	"SUMMARY record"	""	"rs1800299"	"0"	""	""	"g.80104857G>A"	""	"likely benign"	"ACMG"
"0000478349"	"0"	"90"	"17"	"78078656"	"78078656"	"del"	"0"	"01940"	"GAA_000061"	"g.78078656del"	"MAF not reported"	"{Pompe:588}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104857del"	""	"pathogenic"	"ACMG"
"0000478350"	"0"	"50"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000449"	"g.78078692T>C"	"MAF not reported"	"{Pompe:589}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 138.77-GD: 66.46), SIFT tolerated (score: 0.45), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104893T>C"	""	"VUS"	"ACMG"
"0000478351"	"0"	"90"	"17"	"78078694"	"78078694"	"subst"	"0"	"01940"	"GAA_000120"	"g.78078694C>A"	"MAF not reported"	"{Pompe:591}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104895C>A"	""	"pathogenic"	"ACMG"
"0000478352"	"0"	"50"	"17"	"78078707"	"78078707"	"subst"	"0"	"01940"	"GAA_000450"	"g.78078707T>G"	"MAF not reported"	"{Pompe:592}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 195.55-GD: 75.02), SIFT tolerated (score: 0.07), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104908T>G"	""	"VUS"	"ACMG"
"0000478353"	"0"	"50"	"17"	"78078708"	"78078708"	"subst"	"0"	"01940"	"GAA_000451"	"g.78078708G>A"	"MAF not reported"	"{Pompe:593}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 195.55-GD: 32.43), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104909G>A"	""	"VUS"	"ACMG"
"0000478354"	"0"	"90"	"17"	"78078728"	"78078728"	"subst"	"0"	"01940"	"GAA_000254"	"g.78078728C>T"	"MAF not reported"	"{Pompe:596}"	""	""	"predicted very severe, childhood/adult phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104929C>T"	""	"pathogenic"	"ACMG"
"0000478355"	"0"	"90"	"17"	"78078737"	"78078737"	"subst"	"0"	"01940"	"GAA_000452"	"g.78078737C>T"	"MAF not reported"	"{Pompe:597}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104938C>T"	""	"pathogenic"	"ACMG"
"0000478356"	"0"	"50"	"17"	"78078749"	"78078749"	"subst"	"0"	"01940"	"GAA_000255"	"g.78078749A>G"	"MAF not reported"	"{Pompe:598}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 139.69-GD: 0.00), SIFT tolerated (score: 0.75), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104950A>G"	""	"VUS"	"ACMG"
"0000478357"	"0"	"90"	"17"	"78078763"	"78078763"	"subst"	"0"	"01940"	"GAA_000453"	"g.78078763G>A"	"MAF not reported"	"{Pompe:600}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104964G>A"	""	"pathogenic"	"ACMG"
"0000478358"	"0"	"50"	"17"	"78078765"	"78078765"	"subst"	"0"	"01940"	"GAA_000256"	"g.78078765G>T"	"MAF not reported"	"{Pompe:602}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 201.58-GD: 26.66), SIFT tolerated (score: 0.09), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104966G>T"	""	"VUS"	"ACMG"
"0000478359"	"0"	"90"	"17"	"78078784"	"78078784"	"subst"	"0"	"01940"	"GAA_000124"	"g.78078784C>A"	"MAF not reported"	"{Pompe:603}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104985C>A"	""	"pathogenic"	"ACMG"
"0000478360"	"0"	"50"	"17"	"78078806"	"78078806"	"subst"	"0"	"01940"	"GAA_000454"	"g.78078806C>A"	"MAF not reported"	"{Pompe:604}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 102.84-GD: 0.00), SIFT tolerated (score: 0.19), Mutation Taster polymorphism (p-value: 0.89)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105007C>A"	""	"VUS"	"ACMG"
"0000478361"	"0"	"90"	"17"	"78078809"	"78078825"	"del"	"0"	"01940"	"GAA_000455"	"g.78078809_78078825del"	"MAF not reported"	"{Pompe:605}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105010_80105026del"	""	"pathogenic"	"ACMG"
"0000478362"	"0"	"90"	"17"	"78078829"	"78078829"	"subst"	"0"	"01940"	"GAA_000456"	"g.78078829C>G"	"MAF not reported"	"{Pompe:606}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105030C>G"	""	"pathogenic"	"ACMG"
"0000478363"	"0"	"30"	"17"	"78078832"	"78078832"	"subst"	"0.00500256"	"01940"	"GAA_000457"	"g.78078832G>A"	"MAF >0.01"	"{Pompe:607}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2289536"	"0"	""	""	"g.80105033G>A"	""	"likely benign"	"ACMG"
"0000478364"	"0"	"70"	"17"	"78078845"	"78078850"	"del"	"0"	"01940"	"GAA_000458"	"g.78078845_78078850del"	"MAF not reported"	"{Pompe:608}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105046_80105051del"	""	"likely pathogenic"	"ACMG"
"0000478365"	"0"	"50"	"17"	"78078846"	"78078846"	"subst"	"0"	"01940"	"GAA_000459"	"g.78078846G>C"	"MAF not reported"	"{Pompe:609}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 42.81-GD: 69.18), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.986)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105047G>C"	""	"VUS"	"ACMG"
"0000478366"	"0"	"70"	"17"	"78078846"	"78078854"	"del"	"0"	"01940"	"GAA_000460"	"g.78078846_78078854del"	"MAF not reported"	"{Pompe:610}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105047_80105055del"	""	"likely pathogenic"	"ACMG"
"0000478367"	"0"	"50"	"17"	"78078868"	"78078868"	"dup"	"0"	"01940"	"GAA_000461"	"g.78078868dup"	"MAF not reported"	"{Pompe:612}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105069dup"	""	"VUS"	"ACMG"
"0000478368"	"0"	"70"	"17"	"78078888"	"78078888"	"subst"	"0"	"01940"	"GAA_000462"	"g.78078888G>C"	"MAF not reported"	"{Pompe:614}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 115.59-GD: 53.19), SIFT tolerated (score: 0.14), Mutation Taster polymorphism (p-value: 0.997)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105089G>C"	""	"likely pathogenic"	"ACMG"
"0000478369"	"0"	"50"	"17"	"78078891"	"78078891"	"subst"	"0"	"01940"	"GAA_000463"	"g.78078891T>C"	"MAF not reported"	"{Pompe:615}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105092T>C"	""	"VUS"	"ACMG"
"0000478370"	"0"	"90"	"17"	"78078910"	"78078911"	"del"	"4.24932E-6"	"01940"	"GAA_000464"	"g.78078910_78078911del"	"MAF <0.01"	"{Pompe:617}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs767882689"	"0"	""	""	"g.80105111_80105112del"	""	"pathogenic"	"ACMG"
"0000478371"	"0"	"50"	"17"	"78078918"	"78078918"	"subst"	"1.70691E-5"	"01940"	"GAA_000465"	"g.78078918G>A"	"MAF <0.01"	"{Pompe:618}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 179.53-GD: 4.81), SIFT tolerated (score: 0.12), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs762267535"	"0"	""	""	"g.80105119G>A"	""	"VUS"	"ACMG"
"0000478372"	"0"	"70"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"01940"	"GAA_000123"	"g.78078931G>A"	"MAF <0.01"	"{Pompe:619}"	""	""	"predicted potentially mild, adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs143523371"	"0"	""	""	"g.80105132G>A"	""	"likely pathogenic"	"ACMG"
"0000478373"	"0"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"01940"	"GAA_000466"	"g.78078931G>T"	"MAF not reported"	"{Pompe:620}"	""	""	"predicted potentially mild, childhood phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105132G>T"	""	"pathogenic"	"ACMG"
"0000478374"	"0"	"70"	"17"	"78078931"	"78078931"	"subst"	"8.61193E-6"	"01940"	"GAA_000467"	"g.78078931G>C"	"MAF not reported"	"{Pompe:621}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105132G>C"	""	"likely pathogenic"	"ACMG"
"0000478375"	"0"	"50"	"17"	"78078976"	"78078976"	"subst"	"0"	"01940"	"GAA_000472"	"g.78078976G>C"	"MAF not reported"	"{Pompe:626}"	""	""	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105177G>C"	""	"VUS"	"ACMG"
"0000478376"	"0"	"50"	"17"	"78079481"	"78079481"	"subst"	"0"	"01940"	"GAA_000473"	"g.78079481C>G"	"MAF >0.01"	"{Pompe:627}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs8069491"	"0"	""	""	"g.80105682C>G"	""	"VUS"	"ACMG"
"0000478377"	"0"	"50"	"17"	"78079509"	"78079509"	"subst"	"0.669225"	"01940"	"GAA_000474"	"g.78079509T>G"	"MAF >0.01"	"{Pompe:628}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs12452721"	"0"	""	""	"g.80105710T>G"	""	"VUS"	"ACMG"
"0000478378"	"0"	"50"	"17"	"78079570"	"78079570"	"subst"	"1.63475E-5"	"01940"	"GAA_000475"	"g.78079570G>A"	"MAF <0.01"	"{Pompe:630}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 97.59-GD: 15.20), SIFT tolerated (score: 0.12), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs528367092"	"0"	""	""	"g.80105771G>A"	""	"VUS"	"ACMG"
"0000478379"	"0"	"50"	"17"	"78079573"	"78079573"	"subst"	"0"	"01940"	"GAA_000476"	"g.78079573A>G"	"MAF not reported"	"{Pompe:631}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C55 (GV: 21.61-GD: 191.71), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.998)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105774A>G"	""	"VUS"	"ACMG"
"0000478380"	"0"	"90"	"17"	"78079574"	"78079574"	"subst"	"4.0858E-6"	"01940"	"GAA_000098"	"g.78079574C>A"	"MAF not reported"	"{Pompe:632}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105775C>A"	""	"pathogenic"	"ACMG"
"0000478381"	"0"	"50"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"01940"	"GAA_000004"	"g.78079597A>G"	"MAF <0.01"	"{Pompe:633}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 113.73-GD: 0.00), SIFT tolerated (score: 0.84), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs528367092"	"0"	""	""	"g.80105798A>G"	""	"VUS"	"ACMG"
"0000478382"	"0"	"50"	"17"	"78079624"	"78079624"	"subst"	"0"	"01940"	"GAA_000087"	"g.78079624T>C"	"MAF not reported"	"{Pompe:634}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 21.82-GD: 95.38), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105825T>C"	""	"VUS"	"ACMG"
"0000478383"	"0"	"90"	"17"	"78079635"	"78079635"	"subst"	"0"	"01940"	"GAA_000477"	"g.78079635G>T"	"MAF not reported"	"{Pompe:635}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105836G>T"	""	"pathogenic"	"ACMG"
"0000478384"	"0"	"50"	"17"	"78079651"	"78079651"	"subst"	"0"	"01940"	"GAA_000478"	"g.78079651C>T"	"MAF not reported"	"{Pompe:637}"	""	""	"predicted less severe phenotype, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 90.16-GD: 79.62), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105852C>T"	""	"VUS"	"ACMG"
"0000478385"	"0"	"50"	"17"	"78079672"	"78079672"	"subst"	"2.51425E-5"	"01940"	"GAA_000479"	"g.78079672G>A"	"MAF <0.01"	"{Pompe:642}"	""	""	"predicted potentially less severe, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 54.02-GD: 0.00), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs200210219"	"0"	""	""	"g.80105873G>A"	""	"VUS"	"ACMG"
"0000478386"	"0"	"10"	"17"	"78081307"	"78081307"	"subst"	"0.0667469"	"01940"	"GAA_000480"	"g.78081307C>T"	"MAF >0.05"	"{Pompe:647}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs78855075"	"0"	""	""	"g.80107508C>T"	""	"benign"	"ACMG"
"0000478387"	"0"	"50"	"17"	"78081364"	"78081364"	"subst"	"0"	"01940"	"GAA_000481"	"g.78081364C>G"	"MAF not reported"	"{Pompe:648}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 114.06-GD: 5.07), SIFT tolerated (score: 0.07), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107565C>G"	""	"VUS"	"ACMG"
"0000478388"	"0"	"50"	"17"	"78081364"	"78081364"	"subst"	"0"	"01940"	"GAA_000482"	"g.78081364C>A"	"MAF not reported"	"{Pompe:649}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 114.06-GD: 0.00), SIFT tolerated (score: 0.36), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107565C>A"	""	"VUS"	"ACMG"
"0000478389"	"0"	"50"	"17"	"78081373"	"78081373"	"subst"	"2.03318E-5"	"01940"	"GAA_000483"	"g.78081373C>T"	"MAF <0.01"	"{Pompe:650}"	""	""	"prediction unknown, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 170.54-GD: 35.60), SIFT tolerated (score: 0.19), Mutation Taster disease causing (p-value: 0.982)"	"SUMMARY record"	""	"rs121907944"	"0"	""	""	"g.80107574C>T"	""	"VUS"	"ACMG"
"0000478390"	"0"	"90"	"17"	"78081379"	"78081379"	"del"	"0"	"01940"	"GAA_000125"	"g.78081379del"	"MAF not reported"	"{Pompe:651}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107580del"	""	"pathogenic"	"ACMG"
"0000478391"	"0"	"50"	"17"	"78081382"	"78081382"	"subst"	"0"	"01940"	"GAA_000146"	"g.78081382T>C"	"MAF not reported"	"{Pompe:652}"	""	""	"prediction unknown, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 115.75-GD: 73.35), SIFT deleterious (score: 0.05), Mutation Taster disease causing (p-value: 0.956)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107583T>C"	""	"VUS"	"ACMG"
"0000478392"	"0"	"90"	"17"	"78081385"	"78081386"	"del"	"0"	"01940"	"GAA_000094"	"g.78081385_78081386del"	"MAF not reported"	"{Pompe:653}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107586_80107587del"	""	"pathogenic"	"ACMG"
"0000478393"	"0"	"50"	"17"	"78081388"	"78081388"	"subst"	"9.34876E-5"	"01940"	"GAA_000484"	"g.78081388C>T"	"MAF <0.01"	"{Pompe:654}"	""	""	"predicted potentially mild, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 138.12-GD: 35.60), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs745861849"	"0"	""	""	"g.80107589C>T"	""	"VUS"	"ACMG"
"0000478394"	"0"	"50"	"17"	"78081400"	"78081400"	"subst"	"0"	"01940"	"GAA_000485"	"g.78081400T>G"	"MAF not reported"	"{Pompe:655}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 30.92-GD: 87.80), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107601T>G"	""	"VUS"	"ACMG"
"0000478395"	"0"	"90"	"17"	"78081405"	"78081405"	"del"	"0"	"01940"	"GAA_000499"	"g.78081405del"	"MAF not reported"	"{Pompe:656}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107606del"	""	"pathogenic"	"ACMG"
"0000478396"	"0"	"50"	"17"	"78081406"	"78081406"	"subst"	"0"	"01940"	"GAA_000500"	"g.78081406T>G"	"MAF not reported"	"{Pompe:657}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 97.59), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.995)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107607T>G"	""	"VUS"	"ACMG"
"0000478397"	"0"	"50"	"17"	"78081406"	"78081406"	"subst"	"4.06382E-6"	"01940"	"GAA_000501"	"g.78081406T>C"	"MAF not reported"	"{Pompe:658}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 95.38), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107607T>C"	""	"VUS"	"ACMG"
"0000478398"	"0"	"90"	"17"	"78081426"	"78081426"	"subst"	"0"	"01940"	"GAA_000502"	"g.78081426C>T"	"MAF not reported"	"{Pompe:661}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107627C>T"	""	"pathogenic"	"ACMG"
"0000478399"	"0"	"90"	"17"	"78081429"	"78081448"	"del"	"0"	"01940"	"GAA_000063"	"g.78081429_78081448delinsC"	"MAF not reported"	"{Pompe:662}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107630_80107649delinsC"	""	"pathogenic"	"ACMG"
"0000478400"	"0"	"50"	"17"	"78081431"	"78081431"	"dup"	"0"	"01940"	"GAA_000503"	"g.78081431dup"	"MAF not reported"	"{Pompe:663}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107632dup"	""	"VUS"	"ACMG"
"0000478401"	"0"	"50"	"17"	"78081439"	"78081439"	"subst"	"0"	"01940"	"GAA_000504"	"g.78081439G>T"	"MAF not reported"	"{Pompe:664}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 109.55), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107640G>T"	""	"VUS"	"ACMG"
"0000478402"	"0"	"90"	"17"	"78081457"	"78081457"	"del"	"0"	"01940"	"GAA_000505"	"g.78081457del"	"MAF not reported"	"{Pompe:666}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107658del"	""	"pathogenic"	"ACMG"
"0000478403"	"0"	"90"	"17"	"78081490"	"78081508"	"del"	"0"	"01940"	"GAA_000506"	"g.78081490_78081508del"	"MAF not reported"	"{Pompe:669}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107691_80107709del"	""	"pathogenic"	"ACMG"
"0000478404"	"0"	"90"	"17"	"78081499"	"78081499"	"subst"	"0"	"01940"	"GAA_000268"	"g.78081499G>A"	"MAF not reported"	"{Pompe:671}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107700G>A"	""	"pathogenic"	"ACMG"
"0000478405"	"0"	"50"	"17"	"78081507"	"78081507"	"subst"	"0"	"01940"	"GAA_000508"	"g.78081507G>C"	"MAF not reported"	"{Pompe:672}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 81.24), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107708G>C"	""	"VUS"	"ACMG"
"0000478406"	"0"	"30"	"17"	"78081515"	"78081515"	"subst"	"0.00629527"	"01940"	"GAA_000269"	"g.78081515G>A"	"MAF >0.01"	"{Pompe:673}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs142626724"	"0"	""	""	"g.80107716G>A"	""	"likely benign"	"ACMG"
"0000478407"	"0"	"70"	"17"	"78081517"	"78081517"	"subst"	"5.17218E-6"	"01940"	"GAA_000101"	"g.78081517C>G"	"MAF not reported"	"{Pompe:675}"	""	""	"predicted potentially mild, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 93.73-GD: 41.54), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107718C>G"	""	"likely pathogenic"	"ACMG"
"0000478408"	"0"	"10"	"17"	"78081551"	"78081551"	"subst"	"0.662574"	"01940"	"GAA_000275"	"g.78081551T>C"	"MAF >0.05"	"{Pompe:678}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304845"	"0"	""	""	"g.80107752T>C"	""	"benign"	"ACMG"
"0000478409"	"0"	"50"	"17"	"78081601"	"78081601"	"subst"	"9.16277E-5"	"01940"	"GAA_000276"	"g.78081601C>T"	"MAF <0.01"	"{Pompe:680}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs778580823"	"0"	""	""	"g.80107802C>T"	""	"VUS"	"ACMG"
"0000478410"	"0"	"50"	"17"	"78081612"	"78081612"	"subst"	"0"	"01940"	"GAA_000516"	"g.78081612T>A"	"MAF not reported"	"{Pompe:682}"	""	""	"predicted less severe phenotype, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 14.30-GD: 86.34), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.908)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107813T>A"	""	"VUS"	"ACMG"
"0000478411"	"0"	"50"	"17"	"78081625"	"78081625"	"subst"	"0"	"01940"	"GAA_000517"	"g.78081625C>G"	"MAF not reported"	"{Pompe:686}"	""	""	"predicted potentially mild, adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 94.34-GD: 24.08), SIFT tolerated (score: 0.19), Mutation Taster disease causing (p-value: 0.869)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107826C>G"	""	"VUS"	"ACMG"
"0000478412"	"0"	"50"	"17"	"78081633"	"78081633"	"subst"	"0"	"01940"	"GAA_000518"	"g.78081633A>C"	"MAF not reported"	"{Pompe:687}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 37.91-GD: 121.85), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.944)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107834A>C"	""	"VUS"	"ACMG"
"0000478413"	"0"	"50"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000039"	"g.78081636T>G"	"MAF not reported"	"{Pompe:688}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 21.82-GD: 96.69), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.999)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107837T>G"	""	"VUS"	"ACMG"
"0000478414"	"0"	"50"	"17"	"78081657"	"78081657"	"subst"	"0.000616977"	"01940"	"GAA_000519"	"g.78081657C>T"	"MAF <0.01"	"{Pompe:690}"	""	""	"predicted presumably non-pathogenic, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 167.35-GD: 0.00), SIFT tolerated (score: 0.42), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs138097673"	"0"	""	""	"g.80107858C>T"	""	"VUS"	"ACMG"
"0000478415"	"0"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"01940"	"GAA_000018"	"g.78081661A>T"	"MAF >0.05"	"{Pompe:691}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1800303"	"0"	""	""	"g.80107862A>T"	""	"benign"	"ACMG"
"0000478416"	"0"	"70"	"17"	"78081663"	"78081663"	"subst"	"0"	"01940"	"GAA_000127"	"g.78081663A>C"	"MAF not reported"	"{Pompe:692}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 46.75-GD: 33.14), SIFT tolerated (score: 0.13), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107864A>C"	""	"likely pathogenic"	"ACMG"
"0000478417"	"0"	"70"	"17"	"78081663"	"78081663"	"subst"	"0"	"01940"	"GAA_000088"	"g.78081663A>T"	"MAF not reported"	"{Pompe:693}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 46.75-GD: 73.51), SIFT tolerated (score: 0.13), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107864A>T"	""	"likely pathogenic"	"ACMG"
"0000478418"	"0"	"50"	"17"	"78081669"	"78081669"	"subst"	"0"	"01940"	"GAA_000520"	"g.78081669T>G"	"MAF <0.01"	"{Pompe:695}"	""	""	"predicted less severe phenotype, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 28.68-GD: 109.55), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs763091901"	"0"	""	""	"g.80107870T>G"	""	"VUS"	"ACMG"
"0000478419"	"0"	"50"	"17"	"78081675"	"78081675"	"subst"	"0"	"01940"	"GAA_000128"	"g.78081675T>G"	"MAF not reported"	"{Pompe:696}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 60.98-GD: 89.93), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.987)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107876T>G"	""	"VUS"	"ACMG"
"0000478420"	"0"	"50"	"17"	"78081687"	"78081687"	"subst"	"0"	"01940"	"GAA_000521"	"g.78081687A>T"	"MAF not reported"	"{Pompe:697}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 165.22-GD: 16.18), SIFT tolerated (score: 0.08), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107888A>T"	""	"VUS"	"ACMG"
"0000478421"	"0"	"50"	"17"	"78081693"	"78081693"	"subst"	"4.29778E-5"	"01940"	"GAA_000016"	"g.78081693T>C"	"MAF <0.01"	"{Pompe:698}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 89.28-GD: 0.00), SIFT tolerated (score: 0.42), Mutation Taster disease causing (p-value: 0.998)"	"SUMMARY record"	""	"rs121907936"	"0"	""	""	"g.80107894T>C"	""	"VUS"	"ACMG"
"0000478422"	"0"	"10"	"17"	"78081707"	"78081707"	"subst"	"0.695957"	"01940"	"GAA_000282"	"g.78081707G>A"	"MAF >0.05"	"{Pompe:702}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2252455"	"0"	""	""	"g.80107908G>A"	""	"benign"	"ACMG"
"0000478423"	"0"	"10"	"17"	"78082005"	"78082005"	"subst"	"0"	"01940"	"GAA_000523"	"g.78082005C>T"	"MAF >0.05"	"{Pompe:703}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2241887"	"0"	""	""	"g.80108206C>T"	""	"benign"	"ACMG"
"0000478424"	"0"	"50"	"17"	"78082104"	"78082104"	"subst"	"8.12585E-6"	"01940"	"GAA_000089"	"g.78082104C>T"	"MAF <0.01"	"{Pompe:704}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 107.83-GD: 63.55), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs750030887"	"0"	""	""	"g.80108305C>T"	""	"VUS"	"ACMG"
"0000478425"	"0"	"50"	"17"	"78082121"	"78082121"	"subst"	"0"	"01940"	"GAA_000149"	"g.78082121T>G"	"MAF not reported"	"{Pompe:705}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 37.11-GD: 146.93), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108322T>G"	""	"VUS"	"ACMG"
"0000478426"	"0"	"90"	"17"	"78082122"	"78082122"	"subst"	"0"	"01940"	"GAA_000112"	"g.78082122G>A"	"MAF not reported"	"{Pompe:706}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108323G>A"	""	"pathogenic"	"ACMG"
"0000478427"	"0"	"50"	"17"	"78082131"	"78082131"	"subst"	"0"	"01940"	"GAA_000524"	"g.78082131C>A"	"MAF not reported"	"{Pompe:707}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 144.57-GD: 8.11), SIFT tolerated (score: 0.13), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108332C>A"	""	"VUS"	"ACMG"
"0000478428"	"0"	"50"	"17"	"78082133"	"78082133"	"subst"	"0"	"01940"	"GAA_000525"	"g.78082133G>A"	"MAF not reported"	"{Pompe:708}"	""	""	"prediction unknown, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 79.35-GD: 6.18), SIFT tolerated (score: 0.05), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108334G>A"	""	"VUS"	"ACMG"
"0000478429"	"0"	"50"	"17"	"78082181"	"78082181"	"subst"	"0.000105675"	"01940"	"GAA_000526"	"g.78082181G>A"	"MAF <0.01"	"{Pompe:712}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 28.68-GD: 0.00), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs200412003"	"0"	""	""	"g.80108382G>A"	""	"VUS"	"ACMG"
"0000478430"	"0"	"70"	"17"	"78082208"	"78082208"	"subst"	"0"	"01940"	"GAA_000527"	"g.78082208G>A"	"MAF not reported"	"{Pompe:716}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing) ; Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108409G>A"	""	"likely pathogenic"	"ACMG"
"0000478431"	"0"	"90"	"17"	"78082208"	"78082208"	"subst"	"0"	"01940"	"GAA_000528"	"g.78082208G>T"	"MAF not reported"	"{Pompe:717}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108409G>T"	""	"pathogenic"	"ACMG"
"0000478432"	"0"	"50"	"17"	"78082221"	"78082221"	"subst"	"0.0104313"	"01940"	"GAA_000286"	"g.78082221C>T"	"MAF >0.01"	"{Pompe:718}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs41292402"	"0"	""	""	"g.80108422C>T"	""	"VUS"	"ACMG"
"0000478433"	"0"	"90"	"17"	"78082292"	"78082292"	"subst"	"0"	"01940"	"GAA_000530"	"g.78082292C>G"	"MAF not reported"	"{Pompe:722}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108493C>G"	""	"pathogenic"	"ACMG"
"0000478434"	"0"	"50"	"17"	"78082311"	"78082311"	"subst"	"0"	"01940"	"GAA_000531"	"g.78082311T>C"	"MAF not reported"	"{Pompe:724}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 176.58-GD: 21.04), SIFT tolerated (score: 0.13), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108512T>C"	""	"VUS"	"ACMG"
"0000478435"	"0"	"90"	"17"	"78082312"	"78082312"	"subst"	"4.08327E-6"	"01940"	"GAA_000532"	"g.78082312G>A"	"MAF not reported"	"{Pompe:725}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108513G>A"	""	"pathogenic"	"ACMG"
"0000478436"	"0"	"90"	"17"	"78082313"	"78082313"	"subst"	"0"	"01940"	"GAA_000533"	"g.78082313G>A"	"MAF not reported"	"{Pompe:726}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108514G>A"	""	"pathogenic"	"ACMG"
"0000478437"	"0"	"70"	"17"	"78082318"	"78082318"	"subst"	"0"	"01940"	"GAA_000534"	"g.78082318T>C"	"MAF not reported"	"{Pompe:727}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 95.38), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108519T>C"	""	"likely pathogenic"	"ACMG"
"0000478438"	"0"	"50"	"17"	"78082327"	"78082327"	"subst"	"0"	"01940"	"GAA_000287"	"g.78082327A>T"	"MAF not reported"	"{Pompe:728}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 98.69), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108528A>T"	""	"VUS"	"ACMG"
"0000478439"	"0"	"50"	"17"	"78082330"	"78082330"	"subst"	"0"	"01940"	"GAA_000535"	"g.78082330T>G"	"MAF not reported"	"{Pompe:729}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 112.44-GD: 13.17), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108531T>G"	""	"VUS"	"ACMG"
"0000478440"	"0"	"50"	"17"	"78082332"	"78082332"	"subst"	"0"	"01940"	"GAA_000130"	"g.78082332T>C"	"MAF not reported"	"{Pompe:730}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 179.53), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108533T>C"	""	"VUS"	"ACMG"
"0000478441"	"0"	"70"	"17"	"78082336"	"78082336"	"subst"	"8.19061E-6"	"01940"	"GAA_000393"	"g.78082336G>T"	"MAF <0.01"	"{Pompe:731}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 101.88), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs142752477"	"0"	""	""	"g.80108537G>T"	""	"likely pathogenic"	"ACMG"
"0000478442"	"0"	"50"	"17"	"78082336"	"78082336"	"subst"	"3.27624E-5"	"01940"	"GAA_000536"	"g.78082336G>A"	"MAF <0.01"	"{Pompe:732}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 28.82), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs142752477"	"0"	""	""	"g.80108537G>A"	""	"VUS"	"ACMG"
"0000478443"	"0"	"70"	"17"	"78082341"	"78082341"	"subst"	"8.19008E-6"	"01940"	"GAA_000150"	"g.78082341G>C"	"MAF <0.01"	"{Pompe:734}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 79.35-GD: 69.17), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs752002666"	"0"	""	""	"g.80108542G>C"	""	"likely pathogenic"	"ACMG"
"0000478444"	"0"	"50"	"17"	"78082346"	"78082346"	"subst"	"0"	"01940"	"GAA_000537"	"g.78082346C>G"	"MAF not reported"	"{Pompe:735}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108547C>G"	""	"VUS"	"ACMG"
"0000478445"	"0"	"90"	"17"	"78082355"	"78082355"	"del"	"0"	"01940"	"GAA_000394"	"g.78082355del"	"MAF <0.01"	"{Pompe:736}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs757458607"	"0"	""	""	"g.80108556del"	""	"pathogenic"	"ACMG"
"0000478446"	"0"	"90"	"17"	"78082368"	"78082368"	"subst"	"0"	"01940"	"GAA_000538"	"g.78082368C>T"	"MAF not reported"	"{Pompe:737}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108569C>T"	""	"pathogenic"	"ACMG"
"0000478447"	"0"	"90"	"17"	"78082369"	"78082369"	"dup"	"0"	"01940"	"GAA_000539"	"g.78082369dup"	"MAF not reported"	"{Pompe:738}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108570dup"	""	"pathogenic"	"ACMG"
"0000478448"	"0"	"90"	"17"	"78082377"	"78082377"	"del"	"0"	"01940"	"GAA_000540"	"g.78082377del"	"MAF not reported"	"{Pompe:739}"	""	""	"predicted very severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108578del"	""	"pathogenic"	"ACMG"
"0000478449"	"0"	"50"	"17"	"78082383"	"78082383"	"subst"	"4.09611E-6"	"01940"	"GAA_000541"	"g.78082383A>G"	"MAF <0.01"	"{Pompe:740}"	""	""	"predicted presumably non-pathogenic, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C15 (GV: 0.00-GD: 20.52), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.995)"	"SUMMARY record"	""	"rs778634337"	"0"	""	""	"g.80108584A>G"	""	"VUS"	"ACMG"
"0000478450"	"0"	"50"	"17"	"78082402"	"78082402"	"subst"	"2.45988E-5"	"01940"	"GAA_000288"	"g.78082402C>T"	"MAF <0.01"	"{Pompe:741}"	""	""	"predicted less severe phenotype, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs776008078"	"0"	""	""	"g.80108603C>T"	""	"VUS"	"ACMG"
"0000478451"	"0"	"90"	"17"	"78082404"	"78082404"	"dup"	"0"	"01940"	"GAA_000542"	"g.78082404dup"	"MAF not reported"	"{Pompe:742}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108605dup"	""	"pathogenic"	"ACMG"
"0000478452"	"0"	"50"	"17"	"78082481"	"78082481"	"subst"	"0.000204713"	"01940"	"GAA_000547"	"g.78082481G>A"	"MAF <0.01"	"{Pompe:746}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs373840229"	"0"	""	""	"g.80108682G>A"	""	"VUS"	"ACMG"
"0000478453"	"0"	"50"	"17"	"78082488"	"78082488"	"subst"	"0"	"01940"	"GAA_000548"	"g.78082488G>A"	"MAF not reported"	"{Pompe:747}"	""	""	"prediction unknown, childhood/adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108689G>A"	""	"VUS"	"ACMG"
"0000478454"	"0"	"70"	"17"	"78082503"	"78082503"	"subst"	"0"	"01940"	"GAA_000551"	"g.78082503A>G"	"MAF not reported"	"{Pompe:750}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 148.91-GD: 13.17), SIFT tolerated (score: 0.76), Mutation Taster disease causing (p-value: 0.995)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108704A>G"	""	"likely pathogenic"	"ACMG"
"0000478455"	"0"	"50"	"17"	"78082505"	"78082505"	"subst"	"0"	"01940"	"GAA_000007"	"g.78082505T>C"	"MAF not reported"	"{Pompe:752}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 176.58-GD: 21.04), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108706T>C"	""	"VUS"	"ACMG"
"0000478456"	"0"	"50"	"17"	"78082510"	"78082510"	"subst"	"0"	"01940"	"GAA_000291"	"g.78082510C>G"	"MAF not reported"	"{Pompe:753}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 152.33-GD: 8.11), SIFT tolerated (score: 0.22), Mutation Taster disease causing (p-value: 0.893)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108711C>G"	""	"VUS"	"ACMG"
"0000478457"	"0"	"90"	"17"	"78082510"	"78082510"	"del"	"0"	"01940"	"GAA_000292"	"g.78082510del"	"MAF not reported"	"{Pompe:754}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108711del"	""	"pathogenic"	"ACMG"
"0000478458"	"0"	"50"	"17"	"78082511"	"78082511"	"subst"	"2.86982E-5"	"01940"	"GAA_000153"	"g.78082511G>A"	"MAF <0.01"	"{Pompe:755}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 23.01-GD: 0.00), SIFT tolerated (score: 0.16), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs141533320"	"0"	""	""	"g.80108712G>A"	""	"VUS"	"ACMG"
"0000478459"	"0"	"50"	"17"	"78082512"	"78082512"	"subst"	"0"	"01940"	"GAA_000552"	"g.78082512A>G"	"MAF not reported"	"{Pompe:756}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 23.01-GD: 77.99), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108713A>G"	""	"VUS"	"ACMG"
"0000478460"	"0"	"50"	"17"	"78082515"	"78082515"	"subst"	"0"	"01940"	"GAA_000131"	"g.78082515T>C"	"MAF not reported"	"{Pompe:757}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 95.38), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108716T>C"	""	"VUS"	"ACMG"
"0000478461"	"0"	"70"	"17"	"78082540"	"78082540"	"subst"	"0"	"01940"	"GAA_000554"	"g.78082540C>G"	"MAF not reported"	"{Pompe:759}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 170.55-GD: 0.00), SIFT tolerated (score: 0.8), Mutation Taster polymorphism (p-value: 0.992)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108741C>G"	""	"likely pathogenic"	"ACMG"
"0000478462"	"0"	"70"	"17"	"78082557"	"78082557"	"subst"	"0"	"01940"	"GAA_000555"	"g.78082557A>T"	"MAF not reported"	"{Pompe:760}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (leaky normal splicing) ; Align GVGD class C15 (GV: 99.09-GD: 83.01), SIFT tolerated (score: 0.11), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108758A>T"	""	"likely pathogenic"	"ACMG"
"0000478463"	"0"	"50"	"17"	"78082581"	"78082581"	"subst"	"0"	"01940"	"GAA_000556"	"g.78082581T>C"	"MAF not reported"	"{Pompe:761}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 14.30-GD: 81.04), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.551)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108782T>C"	""	"VUS"	"ACMG"
"0000478464"	"0"	"30"	"17"	"78082587"	"78082587"	"subst"	"0.000765717"	"01940"	"GAA_000557"	"g.78082587A>G"	"MAF >0.01"	"{Pompe:762}"	""	""	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 129.65-GD: 0.00), SIFT tolerated (score: 0.72), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs200294882"	"0"	""	""	"g.80108788A>G"	""	"likely benign"	"ACMG"
"0000478465"	"0"	"70"	"17"	"78082592"	"78082600"	"del"	"0"	"01940"	"GAA_000558"	"g.78082592_78082600del"	"MAF not reported"	"{Pompe:763}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108793_80108801del"	""	"likely pathogenic"	"ACMG"
"0000478466"	"0"	"90"	"17"	"78082594"	"78082613"	"del"	"0"	"01940"	"GAA_000559"	"g.78082594_78082613del"	"MAF not reported"	"{Pompe:764}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108795_80108814del"	""	"pathogenic"	"ACMG"
"0000478467"	"0"	"50"	"17"	"78082598"	"78082598"	"subst"	"0"	"01940"	"GAA_000560"	"g.78082598C>A"	"MAF not reported"	"{Pompe:765}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 57.03-GD: 0.00), SIFT tolerated (score: 0.87), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108799C>A"	""	"VUS"	"ACMG"
"0000478468"	"0"	"50"	"17"	"78082611"	"78082611"	"subst"	"7.591E-5"	"01940"	"GAA_000561"	"g.78082611G>A"	"MAF <0.01"	"{Pompe:767}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 98.89-GD: 1.62), SIFT deleterious (score: 0.05), Mutation Taster polymorphism (p-value: 0.957)"	"SUMMARY record"	""	"rs150868652"	"0"	""	""	"g.80108812G>A"	""	"VUS"	"ACMG"
"0000478469"	"0"	"50"	"17"	"78082625"	"78082625"	"subst"	"0"	"01940"	"GAA_000402"	"g.78082625G>A"	"MAF <0.01"	"{Pompe:771}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 30.92-GD: 0.00), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.721)"	"SUMMARY record"	""	"rs377559348"	"0"	""	""	"g.80108826G>A"	""	"VUS"	"ACMG"
"0000478470"	"0"	"10"	"17"	"78083726"	"78083726"	"subst"	"0.721259"	"01940"	"GAA_000295"	"g.78083726A>G"	"MAF >0.05"	"{Pompe:774}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2278619"	"0"	""	""	"g.80109927A>G"	""	"benign"	"ACMG"
"0000478471"	"0"	"70"	"17"	"78083748"	"78083748"	"subst"	"0"	"01940"	"GAA_000565"	"g.78083748C>G"	"MAF not reported"	"{Pompe:776}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 102.71), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109949C>G"	""	"likely pathogenic"	"ACMG"
"0000478472"	"0"	"50"	"17"	"78083750"	"78083750"	"subst"	"0"	"01940"	"GAA_000154"	"g.78083750G>C"	"MAF not reported"	"{Pompe:777}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 113.34-GD: 1.62), SIFT tolerated (score: 0.21), Mutation Taster disease causing (p-value: 0.863)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109951G>C"	""	"VUS"	"ACMG"
"0000478473"	"0"	"90"	"17"	"78083771"	"78083789"	"del"	"0"	"01940"	"GAA_000566"	"g.78083771_78083789del"	"MAF not reported"	"{Pompe:778}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109972_80109990del"	""	"pathogenic"	"ACMG"
"0000478474"	"0"	"90"	"17"	"78083773"	"78083773"	"del"	"0"	"01940"	"GAA_000567"	"g.78083773del"	"MAF not reported"	"{Pompe:779}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109974del"	""	"pathogenic"	"ACMG"
"0000478475"	"0"	"70"	"17"	"78083781"	"78083781"	"subst"	"0"	"01940"	"GAA_000568"	"g.78083781A>C"	"MAF not reported"	"{Pompe:780}"	""	""	"prediction unknown, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 143.11), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.98)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109982A>C"	""	"likely pathogenic"	"ACMG"
"0000478476"	"0"	"70"	"17"	"78083781"	"78083781"	"subst"	"0"	"01940"	"GAA_000132"	"g.78083781A>T"	"MAF not reported"	"{Pompe:781}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 0.00-GD: 21.61), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.794)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109982A>T"	""	"likely pathogenic"	"ACMG"
"0000478477"	"0"	"70"	"17"	"78083787"	"78083787"	"subst"	"0"	"01940"	"GAA_000298"	"g.78083787C>T"	"MAF not reported"	"{Pompe:783}"	""	""	"predicted potentially mild, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 95.38-GD: 4.86), SIFT tolerated (score: 0.83), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109988C>T"	""	"likely pathogenic"	"ACMG"
"0000478478"	"0"	"50"	"17"	"78083787"	"78083787"	"subst"	"0"	"01940"	"GAA_000297"	"g.78083787C>A"	"MAF not reported"	"{Pompe:784}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 95.38-GD: 40.97), SIFT deleterious (score: 0.05), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109988C>A"	""	"VUS"	"ACMG"
"0000478480"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"01940"	"GAA_000019"	"g.78083791C>T"	"MAF >0.05"	"{Pompe:786}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1800305"	"0"	""	""	"g.80109992C>T"	""	"benign"	"ACMG"
"0000478481"	"0"	"70"	"17"	"78083792"	"78083792"	"subst"	"6.51121E-5"	"01940"	"GAA_000299"	"g.78083792G>A"	"MAF <0.01"	"{Pompe:787}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 44.60-GD: 11.33), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.992)"	"SUMMARY record"	""	"rs535644999"	"0"	""	""	"g.80109993G>A"	""	"likely pathogenic"	"ACMG"
"0000478482"	"0"	"50"	"17"	"78083798"	"78083798"	"subst"	"0"	"01940"	"GAA_000572"	"g.78083798G>A"	"MAF not reported"	"{Pompe:788}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 109.55-GD: 46.81), SIFT tolerated (score: 0.52), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109999G>A"	""	"VUS"	"ACMG"
"0000478483"	"0"	"70"	"17"	"78083802"	"78083802"	"subst"	"0"	"01940"	"GAA_000573"	"g.78083802T>C"	"MAF not reported"	"{Pompe:789}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 95.38), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110003T>C"	""	"likely pathogenic"	"ACMG"
"0000478484"	"0"	"70"	"17"	"78083814"	"78083814"	"subst"	"0"	"01940"	"GAA_000574"	"g.78083814T>G"	"MAF not reported"	"{Pompe:792}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 109.55), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110015T>G"	""	"likely pathogenic"	"ACMG"
"0000478485"	"0"	"70"	"17"	"78083825"	"78083827"	"del"	"0"	"01940"	"GAA_000104"	"g.78083825_78083827del"	"MAF <0.01"	"{Pompe:793}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs748893499"	"0"	""	""	"g.80110026_80110028del"	""	"likely pathogenic"	"ACMG"
"0000478486"	"0"	"70"	"17"	"78083854"	"78083854"	"subst"	"0"	"01940"	"GAA_000575"	"g.78083854G>C"	"MAF not reported"	"{Pompe:796}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C25 (GV: 32.40-GD: 65.72), SIFT tolerated (score: 0.06), Mutation Taster disease causing (p-value: 0.998)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110055G>C"	""	"likely pathogenic"	"ACMG"
"0000478487"	"0"	"10"	"17"	"78084507"	"78084507"	"subst"	"0.67069"	"01940"	"GAA_000300"	"g.78084507G>C"	"MAF >0.05"	"{Pompe:800}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304844"	"0"	""	""	"g.80110708G>C"	""	"benign"	"ACMG"
"0000478488"	"0"	"90"	"17"	"78084529"	"78084529"	"del"	"4.0658E-6"	"01940"	"GAA_000079"	"g.78084529del"	"MAF not reported"	"{Pompe:804}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110730del"	""	"pathogenic"	"ACMG"
"0000478489"	"0"	"90"	"17"	"78084530"	"78084530"	"subst"	"0"	"01940"	"GAA_000580"	"g.78084530G>A"	"MAF not reported"	"{Pompe:806}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110731G>A"	""	"pathogenic"	"ACMG"
"0000478490"	"0"	"70"	"17"	"78084533"	"78084533"	"subst"	"0"	"01940"	"GAA_000581"	"g.78084533C>T"	"MAF not reported"	"{Pompe:807}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110734C>T"	""	"likely pathogenic"	"ACMG"
"0000478491"	"0"	"50"	"17"	"78084533"	"78084533"	"subst"	"0"	"01940"	"GAA_000582"	"g.78084533C>G"	"MAF not reported"	"{Pompe:808}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 102.71), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110734C>G"	""	"VUS"	"ACMG"
"0000478492"	"0"	"70"	"17"	"78084535"	"78084535"	"subst"	"8.13121E-6"	"01940"	"GAA_000301"	"g.78084535G>A"	"MAF <0.01"	"{Pompe:809}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.999)"	"SUMMARY record"	""	"rs770590394"	"0"	""	""	"g.80110736G>A"	""	"likely pathogenic"	"ACMG"
"0000478493"	"0"	"50"	"17"	"78084536"	"78084536"	"subst"	"0"	"01940"	"GAA_000583"	"g.78084536G>T"	"MAF not reported"	"{Pompe:810}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 109.55), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110737G>T"	""	"VUS"	"ACMG"
"0000478494"	"0"	"90"	"17"	"78084544"	"78084556"	"del"	"0"	"01940"	"GAA_000031"	"g.78084544_78084556del"	"MAF not reported"	"{Pompe:812}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110745_80110757del"	""	"pathogenic"	"ACMG"
"0000478495"	"0"	"70"	"17"	"78084548"	"78084548"	"subst"	"0"	"01940"	"GAA_000584"	"g.78084548T>C"	"MAF not reported"	"{Pompe:813}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (endogenous protein on Western blot) ; Align GVGD class C35 (GV: 39.66-GD: 147.97), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.997)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110749T>C"	""	"likely pathogenic"	"ACMG"
"0000478496"	"0"	"70"	"17"	"78084553"	"78084553"	"subst"	"0"	"01940"	"GAA_000585"	"g.78084553G>T"	"MAF not reported"	"{Pompe:815}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 159.94), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110754G>T"	""	"likely pathogenic"	"ACMG"
"0000478497"	"0"	"70"	"17"	"78084554"	"78084554"	"subst"	"0"	"01940"	"GAA_000586"	"g.78084554A>G"	"MAF not reported"	"{Pompe:816}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 93.77), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110755A>G"	""	"likely pathogenic"	"ACMG"
"0000478498"	"0"	"50"	"17"	"78084556"	"78084556"	"subst"	"0"	"01940"	"GAA_000303"	"g.78084556T>C"	"MAF not reported"	"{Pompe:817}"	""	""	"predicted less severe phenotype, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 102.86-GD: 4.86), SIFT tolerated (score: 0.15), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110757T>C"	""	"VUS"	"ACMG"
"0000478499"	"0"	"50"	"17"	"78084566"	"78084566"	"subst"	"1.2188E-5"	"01940"	"GAA_000587"	"g.78084566C>T"	"MAF <0.01"	"{Pompe:818}"	""	""	"prediction unknown, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 102.71-GD: 55.05), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs148842275"	"0"	""	""	"g.80110767C>T"	""	"VUS"	"ACMG"
"0000478500"	"0"	"50"	"17"	"78084583"	"78084583"	"subst"	"0"	"01940"	"GAA_000588"	"g.78084583T>A"	"MAF not reported"	"{Pompe:819}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 101.29), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110784T>A"	""	"VUS"	"ACMG"
"0000478501"	"0"	"90"	"17"	"78084584"	"78084584"	"subst"	"4.0627E-6"	"01940"	"GAA_000589"	"g.78084584G>A"	"MAF <0.01"	"{Pompe:820}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs766680292"	"0"	""	""	"g.80110785G>A"	""	"pathogenic"	"ACMG"
"0000478502"	"0"	"90"	"17"	"78084585"	"78084585"	"subst"	"0"	"01940"	"GAA_000090"	"g.78084585G>A"	"MAF not reported"	"{Pompe:821}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110786G>A"	""	"pathogenic"	"ACMG"
"0000478503"	"0"	"50"	"17"	"78084592"	"78084592"	"subst"	"4.87496E-5"	"01940"	"GAA_000409"	"g.78084592A>G"	"MAF <0.01"	"{Pompe:822}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 222.05-GD: 3.24), SIFT tolerated (score: 0.26), Mutation Taster polymorphism (p-value: 0.804)"	"SUMMARY record"	""	"rs376067362"	"0"	""	""	"g.80110793A>G"	""	"VUS"	"ACMG"
"0000478504"	"0"	"70"	"17"	"78084597"	"78084599"	"del"	"0"	"01940"	"GAA_000590"	"g.78084597_78084599del"	"MAF not reported"	"{Pompe:823}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110798_80110800del"	""	"likely pathogenic"	"ACMG"
"0000478505"	"0"	"50"	"17"	"78084628"	"78084628"	"subst"	"0"	"01940"	"GAA_000591"	"g.78084628G>C"	"MAF not reported"	"{Pompe:824}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 137.69-GD: 27.62), SIFT tolerated (score: 0.17), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110829G>C"	""	"VUS"	"ACMG"
"0000478506"	"0"	"50"	"17"	"78084632"	"78084632"	"subst"	"0"	"01940"	"GAA_000592"	"g.78084632T>A"	"MAF not reported"	"{Pompe:825}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 92.35-GD: 44.44), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.997)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110833T>A"	""	"VUS"	"ACMG"
"0000478507"	"0"	"50"	"17"	"78084681"	"78084681"	"subst"	"0.0023074"	"01940"	"GAA_000172"	"g.78084681G>A"	"MAF >0.01"	"{Pompe:832}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs115427918"	"0"	""	""	"g.80110882G>A"	""	"VUS"	"ACMG"
"0000478508"	"0"	"10"	"17"	"78084688"	"78084688"	"subst"	"0.669866"	"01940"	"GAA_000445"	"g.78084688C>A"	"MAF >0.05"	"{Pompe:833}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304843"	"0"	""	""	"g.80110889C>A"	""	"benign"	"ACMG"
"0000478509"	"0"	"70"	"17"	"78084743"	"78084743"	"subst"	"0"	"01940"	"GAA_000032"	"g.78084743A>G"	"MAF not reported"	"{Pompe:835}"	""	""	"predicted less severe phenotype, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 0.00-GD: 20.52), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110944A>G"	""	"likely pathogenic"	"ACMG"
"0000478510"	"0"	"70"	"17"	"78084744"	"78084744"	"subst"	"8.12334E-6"	"01940"	"GAA_000044"	"g.78084744T>C"	"MAF not reported"	"{Pompe:836}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 81.04), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110945T>C"	""	"likely pathogenic"	"ACMG"
"0000478511"	"0"	"70"	"17"	"78084749"	"78084749"	"subst"	"0"	"01940"	"GAA_000596"	"g.78084749G>C"	"MAF not reported"	"{Pompe:837}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 29.27), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110950G>C"	""	"likely pathogenic"	"ACMG"
"0000478512"	"0"	"70"	"17"	"78084750"	"78084750"	"subst"	"4.06161E-6"	"01940"	"GAA_000597"	"g.78084750A>T"	"MAF not reported"	"{Pompe:839}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C65 (GV: 0.00-GD: 121.34), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110951A>T"	""	"likely pathogenic"	"ACMG"
"0000478513"	"0"	"70"	"17"	"78084752"	"78084752"	"subst"	"0"	"01940"	"GAA_000598"	"g.78084752C>G"	"MAF not reported"	"{Pompe:840}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 26.87), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110953C>G"	""	"likely pathogenic"	"ACMG"
"0000478514"	"0"	"70"	"17"	"78084752"	"78084752"	"subst"	"0"	"01940"	"GAA_000599"	"g.78084752C>A"	"MAF not reported"	"{Pompe:841}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 0.00-GD: 37.56), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110953C>A"	""	"likely pathogenic"	"ACMG"
"0000478515"	"0"	"50"	"17"	"78084752"	"78084752"	"subst"	"8.12341E-6"	"01940"	"GAA_000600"	"g.78084752C>T"	"MAF not reported"	"{Pompe:842}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 73.35), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110953C>T"	""	"VUS"	"ACMG"
"0000478516"	"0"	"50"	"17"	"78084756"	"78084756"	"subst"	"0"	"01940"	"GAA_000308"	"g.78084756C>A"	"MAF not reported"	"{Pompe:843}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 99.13-GD: 109.77), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.988)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110957C>A"	""	"VUS"	"ACMG"
"0000478517"	"0"	"90"	"17"	"78084770"	"78084771"	"del"	"0"	"01940"	"GAA_000601"	"g.78084770_78084771del"	"MAF not reported"	"{Pompe:846}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110971_80110972del"	""	"pathogenic"	"ACMG"
"0000478518"	"0"	"90"	"17"	"78084779"	"78084779"	"dup"	"0"	"01940"	"GAA_000602"	"g.78084779dup"	"MAF not reported"	"{Pompe:848}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110980dup"	""	"pathogenic"	"ACMG"
"0000478519"	"0"	"50"	"17"	"78084814"	"78084814"	"subst"	"8.13246E-6"	"01940"	"GAA_000157"	"g.78084814C>G"	"MAF not reported"	"{Pompe:849}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111015C>G"	""	"VUS"	"ACMG"
"0000478520"	"0"	"70"	"17"	"78085787"	"78085787"	"subst"	"0"	"01940"	"GAA_000606"	"g.78085787G>T"	"MAF not reported"	"{Pompe:855}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 234.99-GD: 21.28), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.57)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111988G>T"	""	"likely pathogenic"	"ACMG"
"0000478521"	"0"	"70"	"17"	"78085790"	"78085790"	"subst"	"0"	"01940"	"GAA_000135"	"g.78085790G>A"	"MAF not reported"	"{Pompe:856}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C15 (GV: 206.04-GD: 124.98), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111991G>A"	""	"likely pathogenic"	"ACMG"
"0000478522"	"0"	"70"	"17"	"78085790"	"78085790"	"subst"	"0"	"01940"	"GAA_000158"	"g.78085790G>C"	"MAF not reported"	"{Pompe:857}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 206.04-GD: 124.98), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80111991G>C"	""	"likely pathogenic"	"ACMG"
"0000478523"	"0"	"90"	"17"	"78085795"	"78085795"	"dup"	"0"	"01940"	"GAA_000607"	"g.78085795dup"	"MAF <0.01"	"{Pompe:858}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs766398206"	"0"	""	""	"g.80111996dup"	""	"pathogenic"	"ACMG"
"0000478524"	"0"	"90"	"17"	"78085799"	"78085799"	"del"	"0"	"01940"	"GAA_000608"	"g.78085799del"	"MAF not reported"	"{Pompe:859}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112000del"	""	"pathogenic"	"ACMG"
"0000478525"	"0"	"70"	"17"	"78085811"	"78085811"	"subst"	"0"	"01940"	"GAA_000609"	"g.78085811A>G"	"MAF not reported"	"{Pompe:861}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 215.09-GD: 8.09), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.999)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112012A>G"	""	"likely pathogenic"	"ACMG"
"0000478526"	"0"	"50"	"17"	"78085817"	"78085817"	"subst"	"0"	"01940"	"GAA_000310"	"g.78085817T>A"	"MAF not reported"	"{Pompe:863}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 213.42-GD: 59.88), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112018T>A"	""	"VUS"	"ACMG"
"0000478527"	"0"	"70"	"17"	"78085818"	"78085818"	"subst"	"0"	"01940"	"GAA_000170"	"g.78085818G>C"	"MAF not reported"	"{Pompe:864}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 213.42-GD: 59.88), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112019G>C"	""	"likely pathogenic"	"ACMG"
"0000478528"	"0"	"90"	"17"	"78085832"	"78085832"	"subst"	"0"	"01940"	"GAA_000097"	"g.78085832C>T"	"MAF not reported"	"{Pompe:865}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112033C>T"	""	"pathogenic"	"ACMG"
"0000478529"	"0"	"70"	"17"	"78085841"	"78085841"	"subst"	"0"	"01940"	"GAA_000046"	"g.78085841T>C"	"MAF not reported"	"{Pompe:867}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 79.79-GD: 41.25), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112042T>C"	""	"likely pathogenic"	"ACMG"
"0000478530"	"0"	"70"	"17"	"78085848"	"78085848"	"subst"	"0"	"01940"	"GAA_000610"	"g.78085848A>T"	"MAF not reported"	"{Pompe:868}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 28.82-GD: 97.52), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112049A>T"	""	"likely pathogenic"	"ACMG"
"0000478531"	"0"	"70"	"17"	"78085849"	"78085849"	"subst"	"4.06147E-6"	"01940"	"GAA_000611"	"g.78085849C>G"	"MAF not reported"	"{Pompe:869}"	""	""	"prediction unknown, adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 28.82-GD: 19.90), SIFT tolerated (score: 0.07), Mutation Taster disease causing (p-value: 0.927)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112050C>G"	""	"likely pathogenic"	"ACMG"
"0000478532"	"0"	"90"	"17"	"78085850"	"78085850"	"dup"	"0"	"01940"	"GAA_000612"	"g.78085850dup"	"MAF not reported"	"{Pompe:870}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112051dup"	""	"pathogenic"	"ACMG"
"0000478533"	"0"	"70"	"17"	"78085855"	"78085855"	"subst"	"0"	"01940"	"GAA_000613"	"g.78085855C>G"	"MAF not reported"	"{Pompe:871}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 46.24-GD: 93.76), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.964)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112056C>G"	""	"likely pathogenic"	"ACMG"
"0000478534"	"0"	"70"	"17"	"78085861"	"78085861"	"subst"	"0"	"01940"	"GAA_000614"	"g.78085861C>G"	"MAF not reported"	"{Pompe:872}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C15 (GV: 0.00-GD: 24.08), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.978)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112062C>G"	""	"likely pathogenic"	"ACMG"
"0000478535"	"0"	"50"	"17"	"78085862"	"78085862"	"subst"	"0"	"01940"	"GAA_000615"	"g.78085862A>C"	"MAF not reported"	"{Pompe:873}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 68.35), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.992)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112063A>C"	""	"VUS"	"ACMG"
"0000478536"	"0"	"50"	"17"	"78085864"	"78085864"	"subst"	"4.06177E-6"	"01940"	"GAA_000616"	"g.78085864C>A"	"MAF not reported"	"{Pompe:874}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 93.88), SIFT deleterious (score: 0), Mutation Taster polymorphism (p-value: 0.637)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112065C>A"	""	"VUS"	"ACMG"
"0000478537"	"0"	"50"	"17"	"78085869"	"78085869"	"subst"	"0"	"01940"	"GAA_000136"	"g.78085869A>C"	"MAF not reported"	"{Pompe:875}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 143.11), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112070A>C"	""	"VUS"	"ACMG"
"0000478538"	"0"	"50"	"17"	"78085869"	"78085869"	"subst"	"0"	"01940"	"GAA_000313"	"g.78085869A>G"	"MAF not reported"	"{Pompe:876}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 193.72), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112070A>G"	""	"VUS"	"ACMG"
"0000478539"	"0"	"90"	"17"	"78085870"	"78085870"	"subst"	"1.62488E-5"	"01940"	"GAA_000617"	"g.78085870C>A"	"MAF <0.01"	"{Pompe:877}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs112517802"	"0"	""	""	"g.80112071C>A"	""	"pathogenic"	"ACMG"
"0000478540"	"0"	"70"	"17"	"78085871"	"78085871"	"subst"	"0"	"01940"	"GAA_000314"	"g.78085871G>C"	"MAF not reported"	"{Pompe:879}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112072G>C"	""	"likely pathogenic"	"ACMG"
"0000478541"	"0"	"50"	"17"	"78085872"	"78085872"	"subst"	"0"	"01940"	"GAA_000618"	"g.78085872G>A"	"MAF not reported"	"{Pompe:880}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 93.77), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112073G>A"	""	"VUS"	"ACMG"
"0000478542"	"0"	"70"	"17"	"78085893"	"78085893"	"subst"	"0"	"01940"	"GAA_000619"	"g.78085893C>T"	"MAF not reported"	"{Pompe:882}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 57.75-GD: 102.86), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.997)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112094C>T"	""	"likely pathogenic"	"ACMG"
"0000478543"	"0"	"50"	"17"	"78085899"	"78085899"	"subst"	"0"	"01940"	"GAA_000091"	"g.78085899G>T"	"MAF not reported"	"{Pompe:883}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 173.88-GD: 15.94), SIFT tolerated (score: 0.1), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112100G>T"	""	"VUS"	"ACMG"
"0000478544"	"0"	"10"	"17"	"78085911"	"78085911"	"subst"	"0.0561804"	"01940"	"GAA_000315"	"g.78085911G>A"	"MAF >0.05"	"{Pompe:887}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304840"	"0"	""	""	"g.80112112G>A"	""	"benign"	"ACMG"
"0000478545"	"0"	"50"	"17"	"78086382"	"78086382"	"subst"	"0"	"01940"	"GAA_000624"	"g.78086382T>C"	"MAF not reported"	"{Pompe:889}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 95.38), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112583T>C"	""	"VUS"	"ACMG"
"0000478546"	"0"	"50"	"17"	"78086393"	"78086393"	"subst"	"8.1884E-6"	"01940"	"GAA_000625"	"g.78086393C>T"	"MAF <0.01"	"{Pompe:890}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 170.08-GD: 46.61), SIFT deleterious (score: 0.01), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs770983413"	"0"	""	""	"g.80112594C>T"	""	"VUS"	"ACMG"
"0000478547"	"0"	"90"	"17"	"78086398"	"78086398"	"del"	"0"	"01940"	"GAA_000160"	"g.78086398del"	"MAF not reported"	"{Pompe:891}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112599del"	""	"pathogenic"	"ACMG"
"0000478548"	"0"	"70"	"17"	"78086418"	"78086418"	"subst"	"1.22822E-5"	"01940"	"GAA_000626"	"g.78086418C>A"	"MAF <0.01"	"{Pompe:894}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 57.75-GD: 92.25), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs753505203"	"0"	""	""	"g.80112619C>A"	""	"likely pathogenic"	"ACMG"
"0000478549"	"0"	"50"	"17"	"78086418"	"78086418"	"subst"	"0"	"01940"	"GAA_000316"	"g.78086418C>T"	"MAF not reported"	"{Pompe:895}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 57.75-GD: 102.86), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112619C>T"	""	"VUS"	"ACMG"
"0000478550"	"0"	"50"	"17"	"78086421"	"78086421"	"subst"	"0"	"01940"	"GAA_000627"	"g.78086421G>T"	"MAF not reported"	"{Pompe:898}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 101.88), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112622G>T"	""	"VUS"	"ACMG"
"0000478551"	"0"	"90"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000628"	"g.78086424C>A"	"MAF not reported"	"{Pompe:899}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112625C>A"	""	"pathogenic"	"ACMG"
"0000478552"	"0"	"50"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000412"	"g.78086424C>G"	"MAF not reported"	"{Pompe:900}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 99.13-GD: 146.49), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112625C>G"	""	"VUS"	"ACMG"
"0000478553"	"0"	"70"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000317"	"g.78086424C>T"	"MAF not reported"	"{Pompe:901}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 99.13-GD: 95.33), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112625C>T"	""	"likely pathogenic"	"ACMG"
"0000478554"	"0"	"50"	"17"	"78086426"	"78086426"	"subst"	"4.10516E-6"	"01940"	"GAA_000629"	"g.78086426A>G"	"MAF <0.01"	"{Pompe:902}"	""	""	"predicted less severe phenotype, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 154.81-GD: 1.01), SIFT tolerated (score: 0.24), Mutation Taster polymorphism (p-value: 0.551)"	"SUMMARY record"	""	"rs781484283"	"0"	""	""	"g.80112627A>G"	""	"VUS"	"ACMG"
"0000478555"	"0"	"50"	"17"	"78086436"	"78086436"	"subst"	"0"	"01940"	"GAA_000630"	"g.78086436G>A"	"MAF not reported"	"{Pompe:903}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 55.27-GD: 65.41), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112637G>A"	""	"VUS"	"ACMG"
"0000478556"	"0"	"70"	"17"	"78086441"	"78086458"	"del"	"0"	"01940"	"GAA_000093"	"g.78086441_78086458del"	"MAF not reported"	"{Pompe:904}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112642_80112659del"	""	"likely pathogenic"	"ACMG"
"0000478557"	"0"	"50"	"17"	"78086442"	"78086442"	"subst"	"0"	"01940"	"GAA_000138"	"g.78086442G>A"	"MAF not reported"	"{Pompe:905}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 87.17-GD: 52.62), SIFT tolerated (score: 0.12), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112643G>A"	""	"VUS"	"ACMG"
"0000478558"	"0"	"90"	"17"	"78086444"	"78086444"	"subst"	"1.24408E-5"	"01940"	"GAA_000318"	"g.78086444C>T"	"MAF not reported"	"{Pompe:906}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112645C>T"	""	"pathogenic"	"ACMG"
"0000478559"	"0"	"90"	"17"	"78086446"	"78086450"	"dup"	"0"	"01940"	"GAA_000631"	"g.78086446_78086450dup"	"MAF <0.01"	"{Pompe:907}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112647_80112651dup"	""	"pathogenic"	"ACMG"
"0000478560"	"0"	"90"	"17"	"78086448"	"78086448"	"dup"	"0"	"01940"	"GAA_000139"	"g.78086448dup"	"MAF <0.01"	"{Pompe:908}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs754952153"	"0"	""	""	"g.80112649dup"	""	"pathogenic"	"ACMG"
"0000478561"	"0"	"90"	"17"	"78086449"	"78086449"	"del"	"3.32928E-5"	"01940"	"GAA_000140"	"g.78086449del"	"MAF <0.01"	"{Pompe:909}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs781088002"	"0"	""	""	"g.80112650del"	""	"pathogenic"	"ACMG"
"0000478562"	"0"	"90"	"17"	"78086449"	"78086449"	"subst"	"0"	"01940"	"GAA_000632"	"g.78086449C>G"	"MAF <0.01"	"{Pompe:910}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112650C>G"	""	"pathogenic"	"ACMG"
"0000478563"	"0"	"50"	"17"	"78086454"	"78086454"	"subst"	"0"	"01940"	"GAA_000633"	"g.78086454G>A"	"MAF not reported"	"{Pompe:912}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 60.00-GD: 81.64), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.968)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112655G>A"	""	"VUS"	"ACMG"
"0000478564"	"0"	"70"	"17"	"78086456"	"78086456"	"subst"	"0"	"01940"	"GAA_000634"	"g.78086456C>T"	"MAF not reported"	"{Pompe:914}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 94.54-GD: 40.53), SIFT tolerated (score: 0.31), Mutation Taster disease causing (p-value: 0.973)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112657C>T"	""	"likely pathogenic"	"ACMG"
"0000478565"	"0"	"50"	"17"	"78086458"	"78086458"	"subst"	"4.13846E-6"	"01940"	"GAA_000162"	"g.78086458C>G"	"MAF not reported"	"{Pompe:915}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 94.54-GD: 12.47), SIFT tolerated (score: 0.22), Mutation Taster disease causing (p-value: 0.982)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112659C>G"	""	"VUS"	"ACMG"
"0000478566"	"0"	"50"	"17"	"78086468"	"78086468"	"subst"	"0"	"01940"	"GAA_000635"	"g.78086468G>A"	"MAF not reported"	"{Pompe:918}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 0.00-GD: 23.01), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112669G>A"	""	"VUS"	"ACMG"
"0000478567"	"0"	"90"	"17"	"78086470"	"78086470"	"dup"	"0"	"01940"	"GAA_000636"	"g.78086470dup"	"MAF not reported"	"{Pompe:919}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112671dup"	""	"pathogenic"	"ACMG"
"0000478568"	"0"	"50"	"17"	"78086501"	"78086501"	"subst"	"0"	"01940"	"GAA_000638"	"g.78086501T>C"	"MAF not reported"	"{Pompe:922}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 73.35), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.915)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112702T>C"	""	"VUS"	"ACMG"
"0000478569"	"0"	"50"	"17"	"78086502"	"78086502"	"subst"	"0"	"01940"	"GAA_000639"	"g.78086502C>T"	"MAF not reported"	"{Pompe:923}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 154.81), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.994)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112703C>T"	""	"VUS"	"ACMG"
"0000478570"	"0"	"10"	"17"	"78086531"	"78086531"	"subst"	"0.0575615"	"01940"	"GAA_000321"	"g.78086531G>A"	"MAF >0.05"	"{Pompe:925}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304837"	"0"	""	""	"g.80112732G>A"	""	"benign"	"ACMG"
"0000478571"	"0"	"70"	"17"	"78086691"	"78086691"	"subst"	"0"	"01940"	"GAA_000360"	"g.78086691C>A"	"MAF not reported"	"{Pompe:927}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 79.35-GD: 69.77), SIFT tolerated (score: 0.06), Mutation Taster polymorphism (p-value: 0.811)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112892C>A"	""	"likely pathogenic"	"ACMG"
"0000478572"	"0"	"70"	"17"	"78086699"	"78086699"	"subst"	"0"	"01940"	"GAA_000322"	"g.78086699G>T"	"MAF not reported"	"{Pompe:929}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 109.55), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112900G>T"	""	"likely pathogenic"	"ACMG"
"0000478573"	"0"	"50"	"17"	"78086707"	"78086707"	"subst"	"0"	"01940"	"GAA_000643"	"g.78086707C>G"	"MAF not reported"	"{Pompe:930}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 30.27-GD: 20.52), SIFT tolerated (score: 0.05), Mutation Taster polymorphism (p-value: 0.596)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112908C>G"	""	"VUS"	"ACMG"
"0000478574"	"0"	"50"	"17"	"78086710"	"78086710"	"subst"	"0"	"01940"	"GAA_000645"	"g.78086710G>T"	"MAF not reported"	"{Pompe:931}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 28.68-GD: 21.28), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112911G>T"	""	"VUS"	"ACMG"
"0000478575"	"0"	"90"	"17"	"78086716"	"78086722"	"dup"	"0"	"01940"	"GAA_000646"	"g.78086716_78086722dup"	"MAF <0.01"	"{Pompe:933}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs748829376"	"0"	""	""	"g.80112917_80112923dup"	""	"pathogenic"	"ACMG"
"0000478576"	"0"	"50"	"17"	"78086716"	"78086716"	"subst"	"0"	"01940"	"GAA_000419"	"g.78086716G>C"	"MAF not reported"	"{Pompe:934}"	""	""	"prediction unknown, adult phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 26.87), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112917G>C"	""	"VUS"	"ACMG"
"0000478577"	"0"	"50"	"17"	"78086719"	"78086719"	"subst"	"4.19893E-6"	"01940"	"GAA_000048"	"g.78086719G>C"	"MAF <0.01"	"{Pompe:935}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 81.24), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs368438393"	"0"	""	""	"g.80112920G>C"	""	"VUS"	"ACMG"
"0000478578"	"0"	"70"	"17"	"78086719"	"78086719"	"subst"	"8.39786E-6"	"01940"	"GAA_000323"	"g.78086719G>T"	"MAF not reported"	"{Pompe:937}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 159.94), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112920G>T"	""	"likely pathogenic"	"ACMG"
"0000478579"	"0"	"70"	"17"	"78086729"	"78086729"	"subst"	"0"	"01940"	"GAA_000324"	"g.78086729G>A"	"MAF not reported"	"{Pompe:941}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 93.77), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112930G>A"	""	"likely pathogenic"	"ACMG"
"0000478580"	"0"	"50"	"17"	"78086737"	"78086738"	"del"	"0"	"01940"	"GAA_000325"	"g.78086737_78086738delinsT"	"MAF not reported"	"{Pompe:942}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112938_80112939delinsT"	""	"VUS"	"ACMG"
"0000478581"	"0"	"50"	"17"	"78086744"	"78086744"	"subst"	"1.26072E-5"	"01940"	"GAA_000647"	"g.78086744C>A"	"MAF <0.01"	"{Pompe:943}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 58.27-GD: 64.58), SIFT tolerated (score: 0.11), Mutation Taster disease causing (p-value: 0.997)"	"SUMMARY record"	""	"rs763456921"	"0"	""	""	"g.80112945C>A"	""	"VUS"	"ACMG"
"0000478582"	"0"	"50"	"17"	"78086746"	"78086746"	"subst"	"0"	"01940"	"GAA_000648"	"g.78086746T>C"	"MAF not reported"	"{Pompe:944}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 74.82-GD: 24.03), SIFT deleterious (score: 0.03), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112947T>C"	""	"VUS"	"ACMG"
"0000478583"	"0"	"50"	"17"	"78086748"	"78086750"	"del"	"0"	"01940"	"GAA_000649"	"g.78086748_78086750del"	"MAF not reported"	"{Pompe:945}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112949_80112951del"	""	"VUS"	"ACMG"
"0000478584"	"0"	"50"	"17"	"78086764"	"78086764"	"subst"	"0"	"01940"	"GAA_000326"	"g.78086764C>T"	"MAF <0.01"	"{Pompe:946}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 179.53), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs759518659"	"0"	""	""	"g.80112965C>T"	""	"VUS"	"ACMG"
"0000478585"	"0"	"70"	"17"	"78086765"	"78086765"	"subst"	"0"	"01940"	"GAA_000116"	"g.78086765G>A"	"MAF <0.01"	"{Pompe:947}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 0.00-GD: 28.82), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs374143224"	"0"	""	""	"g.80112966G>A"	""	"likely pathogenic"	"ACMG"
"0000478586"	"0"	"50"	"17"	"78086767"	"78086767"	"subst"	"0"	"01940"	"GAA_000650"	"g.78086767T>G"	"MAF not reported"	"{Pompe:948}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 183.79), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112968T>G"	""	"VUS"	"ACMG"
"0000478587"	"0"	"90"	"17"	"78086773"	"78086773"	"del"	"0"	"01940"	"GAA_000651"	"g.78086773del"	"MAF not reported"	"{Pompe:949}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112974del"	""	"pathogenic"	"ACMG"
"0000478588"	"0"	"50"	"17"	"78086779"	"78086779"	"subst"	"0"	"01940"	"GAA_000652"	"g.78086779G>A"	"MAF not reported"	"{Pompe:950}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 125.13), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112980G>A"	""	"VUS"	"ACMG"
"0000478589"	"0"	"50"	"17"	"78086798"	"78086798"	"subst"	"0"	"01940"	"GAA_000653"	"g.78086798T>A"	"MAF not reported"	"{Pompe:951}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C35 (GV: 28.53-GD: 93.42), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.999)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112999T>A"	""	"VUS"	"ACMG"
"0000478590"	"0"	"50"	"17"	"78086798"	"78086798"	"subst"	"0"	"01940"	"GAA_000163"	"g.78086798T>G"	"MAF not reported"	"{Pompe:952}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C35 (GV: 28.53-GD: 89.59), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 0.999)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112999T>G"	""	"VUS"	"ACMG"
"0000478591"	"0"	"70"	"17"	"78086801"	"78086801"	"subst"	"0"	"01940"	"GAA_000069"	"g.78086801G>A"	"MAF <0.01"	"{Pompe:954}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C35 (GV: 0.00-GD: 42.81), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs778418246"	"0"	""	""	"g.80113002G>A"	""	"likely pathogenic"	"ACMG"
"0000478592"	"0"	"70"	"17"	"78086810"	"78086812"	"del"	"0"	"01940"	"GAA_000654"	"g.78086810_78086812del"	"MAF <0.01"	"{Pompe:955}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs773958269"	"0"	""	""	"g.80113011_80113013del"	""	"likely pathogenic"	"ACMG"
"0000478593"	"0"	"10"	"17"	"78086846"	"78086846"	"subst"	"0.719557"	"01940"	"GAA_000327"	"g.78086846A>G"	"MAF >0.05"	"{Pompe:958}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304836"	"0"	""	""	"g.80113047A>G"	""	"benign"	"ACMG"
"0000478594"	"0"	"10"	"17"	"78086953"	"78086953"	"subst"	"0"	"01940"	"GAA_000659"	"g.78086953G>A"	"MAF >0.05"	"{Pompe:959}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304833"	"0"	""	""	"g.80113154G>A"	""	"benign"	"ACMG"
"0000478595"	"0"	"50"	"17"	"78087021"	"78087021"	"subst"	"0"	"01940"	"GAA_000661"	"g.78087021A>G"	"MAF not reported"	"{Pompe:962}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 106.82-GD: 0.00), SIFT tolerated (score: 0.59), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113222A>G"	""	"VUS"	"ACMG"
"0000478596"	"0"	"90"	"17"	"78087031"	"78087031"	"subst"	"0"	"01940"	"GAA_000662"	"g.78087031C>A"	"MAF not reported"	"{Pompe:963}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113232C>A"	""	"pathogenic"	"ACMG"
"0000478597"	"0"	"90"	"17"	"78087042"	"78087046"	"dup"	"0"	"01940"	"GAA_000164"	"g.78087042_78087046dup"	"MAF not reported"	"{Pompe:965}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113243_80113247dup"	""	"pathogenic"	"ACMG"
"0000478598"	"0"	"90"	"17"	"78087054"	"78087054"	"dup"	"0"	"01940"	"GAA_000664"	"g.78087054dup"	"MAF not reported"	"{Pompe:966}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113255dup"	""	"pathogenic"	"ACMG"
"0000478599"	"0"	"50"	"17"	"78087073"	"78087078"	"del"	"0"	"01940"	"GAA_000665"	"g.78087073_78087078del"	"MAF not reported"	"{Pompe:967}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113274_80113279del"	""	"VUS"	"ACMG"
"0000478600"	"0"	"70"	"17"	"78087081"	"78087081"	"subst"	"0"	"01940"	"GAA_000666"	"g.78087081G>T"	"MAF not reported"	"{Pompe:970}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 102.71-GD: 56.87), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113282G>T"	""	"likely pathogenic"	"ACMG"
"0000478601"	"0"	"50"	"17"	"78087090"	"78087090"	"subst"	"0"	"01940"	"GAA_000667"	"g.78087090T>C"	"MAF not reported"	"{Pompe:971}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 30.92-GD: 68.57), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113291T>C"	""	"VUS"	"ACMG"
"0000478602"	"0"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"01940"	"GAA_000022"	"g.78087109A>G"	"MAF >0.05"	"{Pompe:973}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs1800310"	"0"	""	""	"g.80113310A>G"	""	"benign"	"ACMG"
"0000478603"	"0"	"70"	"17"	"78087111"	"78087111"	"subst"	"0"	"01940"	"GAA_000330"	"g.78087111T>C"	"MAF not reported"	"{Pompe:974}"	""	""	"predicted less severe phenotype, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 14.30-GD: 86.59), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113312T>C"	""	"likely pathogenic"	"ACMG"
"0000478604"	"0"	"90"	"17"	"78087112"	"78087113"	"del"	"0"	"01940"	"GAA_000668"	"g.78087112_78087113del"	"MAF not reported"	"{Pompe:975}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113313_80113314del"	""	"pathogenic"	"ACMG"
"0000478605"	"0"	"90"	"17"	"78087116"	"78087116"	"del"	"0"	"01940"	"GAA_000421"	"g.78087116del"	"MAF not reported"	"{Pompe:976}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113317del"	""	"pathogenic"	"ACMG"
"0000478606"	"0"	"50"	"17"	"78087137"	"78087137"	"dup"	"0"	"01940"	"GAA_000669"	"g.78087137dup"	"MAF not reported"	"{Pompe:977}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113338dup"	""	"VUS"	"ACMG"
"0000478607"	"0"	"90"	"17"	"78087137"	"78087137"	"subst"	"0"	"01940"	"GAA_000670"	"g.78087137G>T"	"MAF not reported"	"{Pompe:978}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113338G>T"	""	"pathogenic"	"ACMG"
"0000478608"	"0"	"50"	"17"	"78087143"	"78087143"	"subst"	"0"	"01940"	"GAA_000671"	"g.78087143G>A"	"MAF <0.01"	"{Pompe:979}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 234.99-GD: 0.00), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs767247397"	"0"	""	""	"g.80113344G>A"	""	"VUS"	"ACMG"
"0000478609"	"0"	"50"	"17"	"78087147"	"78087147"	"subst"	"0"	"01940"	"GAA_000672"	"g.78087147C>A"	"MAF not reported"	"{Pompe:980}"	""	""	"prediction unknown, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 235.10-GD: 79.30), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113348C>A"	""	"VUS"	"ACMG"
"0000478610"	"0"	"50"	"17"	"78087150"	"78087150"	"subst"	"0"	"01940"	"GAA_000673"	"g.78087150G>C"	"MAF not reported"	"{Pompe:982}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 127.11-GD: 0.00), SIFT tolerated (score: 0.16), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113351G>C"	""	"VUS"	"ACMG"
"0000478611"	"0"	"50"	"17"	"78087153"	"78087153"	"subst"	"0"	"01940"	"GAA_000674"	"g.78087153C>G"	"MAF not reported"	"{Pompe:983}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C35 (GV: 26.87-GD: 102.09), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113354C>G"	""	"VUS"	"ACMG"
"0000478612"	"0"	"90"	"17"	"78087161"	"78087161"	"del"	"0"	"01940"	"GAA_000675"	"g.78087161del"	"MAF not reported"	"{Pompe:984}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113362del"	""	"pathogenic"	"ACMG"
"0000478613"	"0"	"90"	"17"	"78087164"	"78087164"	"subst"	"0"	"01940"	"GAA_000117"	"g.78087164G>T"	"MAF not reported"	"{Pompe:985}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113365G>T"	""	"pathogenic"	"ACMG"
"0000478614"	"0"	"70"	"17"	"78090787"	"78090787"	"subst"	"4.06702E-6"	"01940"	"GAA_000679"	"g.78090787C>A"	"MAF not reported"	"{Pompe:989}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 244.82-GD: 38.84), SIFT tolerated (score: 0.18), Mutation Taster disease causing (p-value: 0.937)"	"SUMMARY record"	""	""	"0"	""	""	"g.80116988C>A"	""	"likely pathogenic"	"ACMG"
"0000478615"	"0"	"90"	"17"	"78090791"	"78090791"	"subst"	"4.06686E-6"	"01940"	"GAA_000680"	"g.78090791G>A"	"MAF not reported"	"{Pompe:990}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80116992G>A"	""	"pathogenic"	"ACMG"
"0000478616"	"0"	"90"	"17"	"78090796"	"78090797"	"del"	"0"	"01940"	"GAA_000166"	"g.78090796_78090797del"	"MAF not reported"	"{Pompe:991}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80116997_80116998del"	""	"pathogenic"	"ACMG"
"0000478617"	"0"	"50"	"17"	"78090804"	"78090804"	"subst"	"0"	"01940"	"GAA_000334"	"g.78090804C>A"	"MAF not reported"	"{Pompe:992}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 223.30-GD: 36.80), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117005C>A"	""	"VUS"	"ACMG"
"0000478618"	"0"	"90"	"17"	"78090804"	"78090804"	"subst"	"0"	"01940"	"GAA_000681"	"g.78090804C>T"	"MAF not reported"	"{Pompe:993}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117005C>T"	""	"pathogenic"	"ACMG"
"0000478619"	"0"	"70"	"17"	"78090813"	"78090813"	"subst"	"0"	"01940"	"GAA_000423"	"g.78090813T>C"	"MAF not reported"	"{Pompe:995}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 268.54-GD: 82.54), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117014T>C"	""	"likely pathogenic"	"ACMG"
"0000478620"	"0"	"50"	"17"	"78090813"	"78090813"	"subst"	"0"	"01940"	"GAA_000682"	"g.78090813T>G"	"MAF not reported"	"{Pompe:996}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 268.54-GD: 58.26), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117014T>G"	""	"VUS"	"ACMG"
"0000478621"	"0"	"90"	"17"	"78090815"	"78090815"	"subst"	"8.13431E-6"	"01940"	"GAA_000425"	"g.78090815G>A"	"MAF <0.01"	"{Pompe:1000}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs1800312"	"0"	""	""	"g.80117016G>A"	""	"pathogenic"	"ACMG"
"0000478622"	"0"	"50"	"17"	"78090819"	"78090819"	"subst"	"0"	"01940"	"GAA_000683"	"g.78090819G>T"	"MAF not reported"	"{Pompe:1002}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117020G>T"	""	"VUS"	"ACMG"
"0000478623"	"0"	"70"	"17"	"78090832"	"78090834"	"del"	"0"	"01940"	"GAA_000684"	"g.78090832_78090834del"	"MAF not reported"	"{Pompe:1003}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117033_80117035del"	""	"likely pathogenic"	"ACMG"
"0000478624"	"0"	"90"	"17"	"78090851"	"78090851"	"dup"	"0"	"01940"	"GAA_000685"	"g.78090851dup"	"MAF not reported"	"{Pompe:1005}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117052dup"	""	"pathogenic"	"ACMG"
"0000478625"	"0"	"50"	"17"	"78090853"	"78090853"	"subst"	"0"	"01940"	"GAA_000686"	"g.78090853G>C"	"MAF not reported"	"{Pompe:1006}"	""	""	"predicted potentially mild, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 125.13-GD: 46.95), SIFT tolerated (score: 0.09), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117054G>C"	""	"VUS"	"ACMG"
"0000478626"	"0"	"90"	"17"	"78090858"	"78090858"	"del"	"0"	"01940"	"GAA_000687"	"g.78090858delinsAT"	"MAF not reported"	"{Pompe:1007}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117059delinsAT"	""	"pathogenic"	"ACMG"
"0000478627"	"0"	"50"	"17"	"78090861"	"78090861"	"subst"	"1.62801E-5"	"01940"	"GAA_000688"	"g.78090861G>A"	"MAF <0.01"	"{Pompe:1008}"	""	""	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 117.42-GD: 36.71), SIFT tolerated (score: 0.08), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs760063214"	"0"	""	""	"g.80117062G>A"	""	"VUS"	"ACMG"
"0000478628"	"0"	"50"	"17"	"78090874"	"78090874"	"subst"	"2.44543E-5"	"01940"	"GAA_000427"	"g.78090874A>G"	"MAF <0.01"	"{Pompe:1009}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C25 (GV: 100.30-GD: 140.37), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs144016984"	"0"	""	""	"g.80117075A>G"	""	"VUS"	"ACMG"
"0000478629"	"0"	"90"	"17"	"78090875"	"78090878"	"del"	"0"	"01940"	"GAA_000689"	"g.78090875_78090878delinsAAAGTA"	"MAF not reported"	"{Pompe:1010}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117076_80117079delinsAAAGTA"	""	"pathogenic"	"ACMG"
"0000478630"	"0"	"90"	"17"	"78090877"	"78090877"	"del"	"0"	"01940"	"GAA_000690"	"g.78090877del"	"MAF not reported"	"{Pompe:1011}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117078del"	""	"pathogenic"	"ACMG"
"0000478631"	"0"	"50"	"17"	"78090880"	"78090880"	"subst"	"0"	"01940"	"GAA_000049"	"g.78090880C>G"	"MAF not reported"	"{Pompe:1012}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 102.71), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117081C>G"	""	"VUS"	"ACMG"
"0000478632"	"0"	"50"	"17"	"78090880"	"78090880"	"subst"	"0"	"01940"	"GAA_000691"	"g.78090880C>T"	"MAF not reported"	"{Pompe:1013}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117081C>T"	""	"VUS"	"ACMG"
"0000478633"	"0"	"70"	"17"	"78090891"	"78090891"	"subst"	"0"	"01940"	"GAA_000335"	"g.78090891T>C"	"MAF not reported"	"{Pompe:1014}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 268.56-GD: 82.54), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117092T>C"	""	"likely pathogenic"	"ACMG"
"0000478634"	"0"	"90"	"17"	"78090903"	"78090903"	"subst"	"0"	"01940"	"GAA_000692"	"g.78090903C>T"	"MAF not reported"	"{Pompe:1016}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117104C>T"	""	"pathogenic"	"ACMG"
"0000478635"	"0"	"10"	"17"	"78090928"	"78090928"	"subst"	"0.741984"	"01940"	"GAA_000338"	"g.78090928G>A"	"MAF >0.05"	"{Pompe:1021}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304832"	"0"	""	""	"g.80117129G>A"	""	"benign"	"ACMG"
"0000478636"	"0"	"10"	"17"	"78090932"	"78090932"	"subst"	"0.14918"	"01940"	"GAA_000339"	"g.78090932T>C"	"MAF >0.05"	"{Pompe:1022}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2304831"	"0"	""	""	"g.80117133T>C"	""	"benign"	"ACMG"
"0000478637"	"0"	"10"	"17"	"78091405"	"78091405"	"subst"	"0.718163"	"01940"	"GAA_000009"	"g.78091405G>A"	"MAF >0.05"	"{Pompe:1023}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 353.86-GD: 0.00), SIFT tolerated (score: 0.97), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	"rs1126690"	"0"	""	""	"g.80117606G>A"	""	"benign"	"ACMG"
"0000478638"	"0"	"50"	"17"	"78091424"	"78091424"	"dup"	"0"	"01940"	"GAA_000694"	"g.78091424dup"	"MAF not reported"	"{Pompe:1024}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117625dup"	""	"VUS"	"ACMG"
"0000478639"	"0"	"90"	"17"	"78091440"	"78091443"	"del"	"0"	"01940"	"GAA_000695"	"g.78091440_78091443delinsTGCTCA"	"MAF not reported"	"{Pompe:1025}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117641_80117644delinsTGCTCA"	""	"pathogenic"	"ACMG"
"0000478640"	"0"	"90"	"17"	"78091447"	"78091447"	"del"	"0"	"01940"	"GAA_000085"	"g.78091447del"	"MAF not reported"	"{Pompe:1026}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117648del"	""	"pathogenic"	"ACMG"
"0000478641"	"0"	"90"	"17"	"78091452"	"78091452"	"del"	"0"	"01940"	"GAA_000696"	"g.78091452del"	"MAF not reported"	"{Pompe:1027}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117653del"	""	"pathogenic"	"ACMG"
"0000478642"	"0"	"50"	"17"	"78091462"	"78091462"	"subst"	"0"	"01940"	"GAA_000697"	"g.78091462C>G"	"MAF not reported"	"{Pompe:1028}"	""	""	"prediction unknown, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 249.90-GD: 40.46), SIFT tolerated (score: 0.3), Mutation Taster polymorphism (p-value: 0.88)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117663C>G"	""	"VUS"	"ACMG"
"0000478643"	"0"	"70"	"17"	"78091474"	"78091479"	"del"	"0"	"01940"	"GAA_000698"	"g.78091474_78091479del"	"MAF not reported"	"{Pompe:1029}"	""	""	"prediction unknown, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117675_80117680del"	""	"likely pathogenic"	"ACMG"
"0000478644"	"0"	"90"	"17"	"78091475"	"78091493"	"del"	"0"	"01940"	"GAA_000699"	"g.78091475_78091493del"	"MAF <0.01"	"{Pompe:1030}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs763048948"	"0"	""	""	"g.80117676_80117694del"	""	"pathogenic"	"ACMG"
"0000478645"	"0"	"90"	"17"	"78091498"	"78091498"	"dup"	"0"	"01940"	"GAA_000059"	"g.78091498dup"	"MAF not reported"	"{Pompe:1031}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117699dup"	""	"pathogenic"	"ACMG"
"0000478646"	"0"	"90"	"17"	"78091498"	"78091498"	"del"	"0"	"01940"	"GAA_000700"	"g.78091498del"	"MAF not reported"	"{Pompe:1032}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117699del"	""	"pathogenic"	"ACMG"
"0000478647"	"0"	"90"	"17"	"78091499"	"78091499"	"del"	"4.11828E-6"	"01940"	"GAA_000167"	"g.78091499del"	"MAF <0.01"	"{Pompe:1033}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	"rs766560578"	"0"	""	""	"g.80117700del"	""	"pathogenic"	"ACMG"
"0000478648"	"0"	"90"	"17"	"78091506"	"78091506"	"dup"	"0"	"01940"	"GAA_000701"	"g.78091506dup"	"MAF not reported"	"{Pompe:1034}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117707dup"	""	"pathogenic"	"ACMG"
"0000478649"	"0"	"70"	"17"	"78091523"	"78091523"	"subst"	"0"	"01940"	"GAA_000341"	"g.78091523G>C"	"MAF not reported"	"{Pompe:1036}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 243.06-GD: 40.46), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80117724G>C"	""	"likely pathogenic"	"ACMG"
"0000478650"	"0"	"50"	"17"	"78092005"	"78092006"	"del"	"0"	"01940"	"GAA_000344"	"g.78092005_78092006del"	"MAF not reported"	"{Pompe:1040}"	""	""	"predicted very severe, unknown phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118206_80118207del"	""	"VUS"	"ACMG"
"0000478651"	"0"	"90"	"17"	"78092022"	"78092022"	"subst"	"4.07422E-6"	"01940"	"GAA_000438"	"g.78092022C>T"	"MAF <0.01"	"{Pompe:1042}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	"rs369532274"	"0"	""	""	"g.80118223C>T"	""	"pathogenic"	"ACMG"
"0000478652"	"0"	"50"	"17"	"78092038"	"78092038"	"subst"	"4.0861E-6"	"01940"	"GAA_000704"	"g.78092038T>C"	"MAF <0.01"	"{Pompe:1043}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 4.86-GD: 95.38), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	"rs775524898"	"0"	""	""	"g.80118239T>C"	""	"VUS"	"ACMG"
"0000478653"	"0"	"70"	"17"	"78092040"	"78092051"	"del"	"0"	"01940"	"GAA_000705"	"g.78092040_78092051del"	"MAF not reported"	"{Pompe:1044}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118241_80118252del"	""	"likely pathogenic"	"ACMG"
"0000478654"	"0"	"90"	"17"	"78092110"	"78092114"	"del"	"0"	"01940"	"GAA_000706"	"g.78092110_78092114delinsA"	"MAF not reported"	"{Pompe:1047}"	""	""	"predicted very severe, classic infantile/childhood phenotype when combined with null allele; predicted CRIM- (protein not expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118311_80118315delinsA"	""	"pathogenic"	"ACMG"
"0000478655"	"0"	"50"	"17"	"78092149"	"78092149"	"subst"	"0"	"01940"	"GAA_000144"	"g.78092149C>A"	"MAF not reported"	"{Pompe:1050}"	""	""	"predicted potentially less severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 112.58-GD: 123.57), SIFT tolerated (score: 0.08), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118350C>A"	""	"VUS"	"ACMG"
"0000478656"	"0"	"50"	"17"	"78092195"	"78092195"	"subst"	"0.00303531"	"01940"	"GAA_000708"	"g.78092195G>A"	"MAF <0.01"	"{Pompe:1053}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs41292410"	"0"	""	""	"g.80118396G>A"	""	"VUS"	"ACMG"
"0000478657"	"0"	"50"	"17"	"78092432"	"78092432"	"subst"	"0"	"01940"	"GAA_000709"	"g.78092432T>G"	"MAF not reported"	"{Pompe:1054}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118633T>G"	""	"VUS"	"ACMG"
"0000478658"	"0"	"50"	"17"	"78092445"	"78092445"	"subst"	"1.63751E-5"	"01940"	"GAA_000361"	"g.78092445G>A"	"MAF <0.01"	"{Pompe:1055}"	""	""	"predicted potentially mild, adult phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	"rs192679574"	"0"	""	""	"g.80118646G>A"	""	"VUS"	"ACMG"
"0000478659"	"0"	"70"	"17"	"78092507"	"78092507"	"subst"	"0"	"01940"	"GAA_000145"	"g.78092507T>A"	"MAF not reported"	"{Pompe:1057}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 98.69-GD: 24.08), SIFT deleterious (score: 0.04), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118708T>A"	""	"likely pathogenic"	"ACMG"
"0000478660"	"0"	"90"	"17"	"78092511"	"78092511"	"del"	"0"	"01940"	"GAA_000710"	"g.78092511del"	"MAF not reported"	"{Pompe:1058}"	""	""	"predicted very severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118712del"	""	"pathogenic"	"ACMG"
"0000478661"	"0"	"70"	"17"	"78092512"	"78092514"	"del"	"0"	"01940"	"GAA_000051"	"g.78092512_78092514del"	"MAF not reported"	"{Pompe:1059}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118713_80118715del"	""	"likely pathogenic"	"ACMG"
"0000478662"	"0"	"50"	"17"	"78092543"	"78092543"	"subst"	"0"	"01940"	"GAA_000712"	"g.78092543C>G"	"MAF not reported"	"{Pompe:1060}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 73.35-GD: 95.06), SIFT deleterious (score: 0.01), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118744C>G"	""	"VUS"	"ACMG"
"0000478663"	"0"	"90"	"17"	"78092546"	"78092546"	"del"	"0"	"01940"	"GAA_000713"	"g.78092546delinsGAC"	"MAF not reported"	"{Pompe:1061}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM- (no endogenous protein on Western blot)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118747delinsGAC"	""	"pathogenic"	"ACMG"
"0000478664"	"0"	"50"	"17"	"78092549"	"78092549"	"subst"	"0"	"01940"	"GAA_000714"	"g.78092549A>C"	"MAF not reported"	"{Pompe:1062}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM? (protein expression unknown); Align GVGD class C0 (GV: 166.33-GD: 0.00), SIFT tolerated (score: 0.22), Mutation Taster disease causing (p-value: 0.825)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118750A>C"	""	"VUS"	"ACMG"
"0000478665"	"0"	"70"	"17"	"78092551"	"78092551"	"subst"	"0"	"01940"	"GAA_000351"	"g.78092551G>T"	"MAF not reported"	"{Pompe:1063}"	""	""	"predicted potentially less severe, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C45 (GV: 0.00-GD: 48.95), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118752G>T"	""	"likely pathogenic"	"ACMG"
"0000478666"	"0"	"70"	"17"	"78092563"	"78092580"	"dup"	"0"	"01940"	"GAA_000074"	"g.78092563_78092580dup"	"MAF not reported"	"{Pompe:1064}"	""	""	"predicted very severe, classic infantile phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118764_80118781dup"	""	"likely pathogenic"	"ACMG"
"0000478667"	"0"	"50"	"17"	"78092588"	"78092588"	"subst"	"0"	"01940"	"GAA_000716"	"g.78092588A>G"	"MAF not reported"	"{Pompe:1066}"	""	""	"prediction unknown, unknown (disease-associated) phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 193.72), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.953)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118789A>G"	""	"VUS"	"ACMG"
"0000478668"	"0"	"50"	"17"	"78093075"	"78093075"	"subst"	"0"	"01940"	"GAA_000719"	"g.78093075T>C"	"MAF not reported"	"{Pompe:1069}"	""	""	"predicted potentially less severe, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 242.23-GD: 0.00), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119276T>C"	""	"VUS"	"ACMG"
"0000478670"	"0"	"50"	"17"	"78093117"	"78093117"	"subst"	"4.0624E-6"	"01940"	"GAA_000075"	"g.78093117T>A"	"MAF not reported"	"{Pompe:1072}"	""	""	"predicted potentially less severe, childhood phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C15 (GV: 234.99-GD: 114.90), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 0.588)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119318T>A"	""	"VUS"	"ACMG"
"0000478671"	"0"	"10"	"17"	"78093221"	"78093221"	"subst"	"0"	"01940"	"GAA_000118"	"g.78093221G>A"	"MAF >0.05"	"{Pompe:1073}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs2229221"	"0"	""	""	"g.80119422G>A"	""	"benign"	"ACMG"
"0000478672"	"0"	"10"	"17"	"78093353"	"78093353"	"subst"	"0"	"01940"	"GAA_000012"	"g.78093353C>T"	"MAF >0.05"	"{Pompe:1074}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	"rs8132"	"0"	""	""	"g.80119554C>T"	""	"benign"	"ACMG"
"0000478673"	"0"	"30"	"17"	"78078417"	"78078417"	"subst"	"0.000130749"	"01940"	"GAA_000365"	"g.78078417G>A"	"MAF <0.01"	"{Pompe:1075}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 353.86-GD: 0.00), SIFT tolerated (score: 0.65), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104618G>A"	""	"likely benign"	"ACMG"
"0000478674"	"0"	"50"	"17"	"78078439"	"78078439"	"subst"	"4.07701E-6"	"01940"	"GAA_000492"	"g.78078439C>T"	"MAF not reported"	"{Pompe:1076}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104640C>T"	""	"VUS"	"ACMG"
"0000478675"	"0"	"50"	"17"	"78078584"	"78078584"	"subst"	"0"	"01940"	"GAA_000493"	"g.78078584G>A"	"MAF not reported"	"{Pompe:1077}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 353.86-GD: 0.00), SIFT tolerated (score: 0.51), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104785G>A"	""	"VUS"	"ACMG"
"0000478676"	"0"	"30"	"17"	"78078606"	"78078606"	"subst"	"5.78321E-5"	"01940"	"GAA_000250"	"g.78078606G>A"	"MAF not reported"	"{Pompe:1078}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 353.86-GD: 0.00), SIFT tolerated (score: 0.58), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104807G>A"	""	"likely benign"	"ACMG"
"0000478677"	"0"	"50"	"17"	"78078748"	"78078748"	"subst"	"0"	"01940"	"GAA_000494"	"g.78078748G>A"	"MAF not reported"	"{Pompe:1079}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80104949G>A"	""	"VUS"	"ACMG"
"0000478678"	"0"	"50"	"17"	"78078895"	"78078895"	"subst"	"5.0514E-5"	"01940"	"GAA_000122"	"g.78078895C>T"	"MAF <0.01"	"{Pompe:1080}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105096C>T"	""	"VUS"	"ACMG"
"0000478679"	"0"	"30"	"17"	"78078917"	"78078917"	"subst"	"3.40942E-5"	"01940"	"GAA_000495"	"g.78078917C>T"	"MAF <0.01"	"{Pompe:1081}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 179.53-GD: 0.00), SIFT tolerated (score: 0.15), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105118C>T"	""	"likely benign"	"ACMG"
"0000478680"	"0"	"50"	"17"	"78078955"	"78078955"	"subst"	"3.18866E-5"	"01940"	"GAA_000496"	"g.78078955G>A"	"MAF <0.01"	"{Pompe:1082}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105156G>A"	""	"VUS"	"ACMG"
"0000478681"	"0"	"30"	"17"	"78079659"	"78079659"	"subst"	"7.91752E-5"	"01940"	"GAA_000261"	"g.78079659G>T"	"MAF <0.01"	"{Pompe:1083}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 108.52-GD: 0.00), SIFT tolerated (score: 1), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105860G>T"	""	"likely benign"	"ACMG"
"0000478682"	"0"	"50"	"17"	"78079665"	"78079665"	"subst"	"0.000793266"	"01940"	"GAA_000262"	"g.78079665G>A"	"MAF <0.01"	"{Pompe:1084}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 30.92-GD: 0.00), SIFT deleterious (score: 0.02), Mutation Taster disease causing (p-value: 0.832)"	"SUMMARY record"	""	""	"0"	""	""	"g.80105866G>A"	""	"VUS"	"ACMG"
"0000478683"	"0"	"50"	"17"	"78081527"	"78081527"	"subst"	"0"	"01940"	"GAA_000510"	"g.78081527G>A"	"MAF not reported"	"{Pompe:1085}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107728G>A"	""	"VUS"	"ACMG"
"0000478684"	"0"	"50"	"17"	"78081542"	"78081542"	"subst"	"0"	"01940"	"GAA_000513"	"g.78081542C>G"	"MAF not reported"	"{Pompe:1088}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107743C>G"	""	"VUS"	"ACMG"
"0000478685"	"0"	"50"	"17"	"78081608"	"78081608"	"subst"	"8.29394E-6"	"01940"	"GAA_000277"	"g.78081608A>G"	"MAF <0.01"	"{Pompe:1091}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 90.16-GD: 22.92), SIFT tolerated (score: 0.31), Mutation Taster disease causing (p-value: 0.957)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107809A>G"	""	"VUS"	"ACMG"
"0000478686"	"0"	"50"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"01940"	"GAA_000281"	"g.78081655G>A"	"MAF <0.01"	"{Pompe:1092}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80107856G>A"	""	"VUS"	"ACMG"
"0000478687"	"0"	"50"	"17"	"78082452"	"78082452"	"subst"	"1.64822E-5"	"01940"	"GAA_000545"	"g.78082452C>T"	"MAF <0.01"	"{Pompe:1094}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108653C>T"	""	"VUS"	"ACMG"
"0000478688"	"0"	"30"	"17"	"78082530"	"78082530"	"subst"	"8.21328E-6"	"01940"	"GAA_000553"	"g.78082530C>T"	"MAF <0.01"	"{Pompe:1095}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 154.10-GD: 48.75), SIFT deleterious (score: 0.05), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80108731C>T"	""	"likely benign"	"ACMG"
"0000478689"	"0"	"50"	"17"	"78083790"	"78083790"	"subst"	"4.06971E-6"	"01940"	"GAA_000570"	"g.78083790A>G"	"MAF not reported"	"{Pompe:1096}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 157.49-GD: 91.34), SIFT deleterious (score: 0.03), Mutation Taster disease causing (p-value: 0.854)"	"SUMMARY record"	""	""	"0"	""	""	"g.80109991A>G"	""	"VUS"	"ACMG"
"0000478690"	"0"	"50"	"17"	"78084688"	"78084688"	"subst"	"0"	"01940"	"GAA_000595"	"g.78084688C>T"	"MAF not reported"	"{Pompe:1098}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80110889C>T"	""	"VUS"	"ACMG"
"0000478691"	"0"	"50"	"17"	"78085915"	"78085915"	"subst"	"6.51201E-5"	"01940"	"GAA_000622"	"g.78085915C>T"	"MAF <0.01"	"{Pompe:1099}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112116C>T"	""	"VUS"	"ACMG"
"0000478692"	"0"	"50"	"17"	"78086452"	"78086452"	"subst"	"0.00134355"	"01940"	"GAA_000141"	"g.78086452C>T"	"MAF <0.01"	"{Pompe:1100}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112653C>T"	""	"VUS"	"ACMG"
"0000478693"	"0"	"50"	"17"	"78086472"	"78086472"	"subst"	"4.18029E-6"	"01940"	"GAA_000320"	"g.78086472T>C"	"MAF not reported"	"{Pompe:1101}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 133.10-GD: 25.33), SIFT tolerated (score: 0.32), Mutation Taster disease causing (p-value: 0.999)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112673T>C"	""	"VUS"	"ACMG"
"0000478694"	"0"	"50"	"17"	"78086494"	"78086494"	"subst"	"3.46057E-5"	"01940"	"GAA_000637"	"g.78086494C>T"	"MAF <0.01"	"{Pompe:1102}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112695C>T"	""	"VUS"	"ACMG"
"0000478695"	"0"	"50"	"17"	"78086508"	"78086508"	"subst"	"8.84823E-6"	"01940"	"GAA_000417"	"g.78086508C>T"	"MAF <0.01"	"{Pompe:1103}"	""	""	"predicted presumably non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C65 (GV: 0.00-GD: 97.78), SIFT deleterious (score: 0), Mutation Taster disease causing (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112709C>T"	""	"VUS"	"ACMG"
"0000478696"	"0"	"50"	"17"	"78086703"	"78086703"	"subst"	"0"	"01940"	"GAA_000047"	"g.78086703G>A"	"MAF not reported"	"{Pompe:1104}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112904G>A"	""	"VUS"	"ACMG"
"0000478697"	"0"	"50"	"17"	"78086706"	"78086706"	"subst"	"0.000188648"	"01940"	"GAA_000642"	"g.78086706T>G"	"MAF <0.01"	"{Pompe:1105}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112907T>G"	""	"VUS"	"ACMG"
"0000478698"	"0"	"50"	"17"	"78086709"	"78086709"	"subst"	"0"	"01940"	"GAA_000644"	"g.78086709G>A"	"MAF not reported"	"{Pompe:1106}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM? (protein expression unknown)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112910G>A"	""	"VUS"	"ACMG"
"0000478699"	"0"	"50"	"17"	"78086757"	"78086757"	"subst"	"0"	"01940"	"GAA_000183"	"g.78086757G>A"	"MAF not reported"	"{Pompe:1107}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80112958G>A"	""	"VUS"	"ACMG"
"0000478700"	"0"	"50"	"17"	"78086838"	"78086838"	"subst"	"0"	"01940"	"GAA_000656"	"g.78086838G>A"	"MAF not reported"	"{Pompe:1108}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113039G>A"	""	"VUS"	"ACMG"
"0000478701"	"0"	"50"	"17"	"78086846"	"78086846"	"subst"	"0"	"01940"	"GAA_000657"	"g.78086846A>T"	"MAF not reported"	"{Pompe:1109}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113047A>T"	""	"VUS"	"ACMG"
"0000478702"	"0"	"50"	"17"	"78086848"	"78086848"	"subst"	"0"	"01940"	"GAA_000658"	"g.78086848G>T"	"MAF not reported"	"{Pompe:1110}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113049G>T"	""	"VUS"	"ACMG"
"0000478703"	"0"	"50"	"17"	"78087037"	"78087037"	"subst"	"0"	"01940"	"GAA_000663"	"g.78087037C>T"	"MAF not reported"	"{Pompe:1112}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113238C>T"	""	"VUS"	"ACMG"
"0000478704"	"0"	"30"	"17"	"78087128"	"78087128"	"subst"	"0.000275181"	"01940"	"GAA_000331"	"g.78087128G>A"	"MAF <0.01"	"{Pompe:1113}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 123.92-GD: 28.68), SIFT tolerated (score: 0.16), Mutation Taster polymorphism (p-value: 1)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113329G>A"	""	"likely benign"	"ACMG"
"0000478705"	"0"	"50"	"17"	"78087130"	"78087130"	"subst"	"0"	"01940"	"GAA_000071"	"g.78087130C>T"	"MAF <0.01"	"{Pompe:1114}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80113331C>T"	""	"VUS"	"ACMG"
"0000478706"	"0"	"50"	"17"	"78090714"	"78090714"	"subst"	"0"	"01940"	"GAA_000678"	"g.78090714C>G"	"MAF <0.01"	"{Pompe:1115}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80116915C>G"	""	"VUS"	"ACMG"
"0000478707"	"0"	"50"	"17"	"78092529"	"78092529"	"subst"	"0"	"01940"	"GAA_000711"	"g.78092529C>G"	"MAF not reported"	"{Pompe:1116}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118730C>G"	""	"VUS"	"ACMG"
"0000478708"	"0"	"30"	"17"	"78092575"	"78092575"	"subst"	"0"	"01940"	"GAA_000715"	"g.78092575T>C"	"MAF not reported"	"{Pompe:1117}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed); Align GVGD class C0 (GV: 130.87-GD: 0.00), SIFT tolerated (score: 0.24), Mutation Taster polymorphism (p-value: 0.997)"	"SUMMARY record"	""	""	"0"	""	""	"g.80118776T>C"	""	"likely benign"	"ACMG"
"0000478709"	"0"	"50"	"17"	"78093011"	"78093011"	"subst"	"0"	"01940"	"GAA_000717"	"g.78093011G>A"	"MAF <0.01"	"{Pompe:1118}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119212G>A"	""	"VUS"	"ACMG"
"0000478710"	"0"	"50"	"17"	"78093079"	"78093079"	"subst"	"0"	"01940"	"GAA_000052"	"g.78093079C>T"	"MAF not reported"	"{Pompe:1119}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119280C>T"	""	"VUS"	"ACMG"
"0000478711"	"0"	"50"	"17"	"78093133"	"78093133"	"subst"	"0.0488615"	"01940"	"GAA_000027"	"g.78093133G>A"	"MAF not reported"	"{Pompe:1120}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119334G>A"	""	"VUS"	"ACMG"
"0000478712"	"0"	"50"	"17"	"78093146"	"78093146"	"subst"	"0"	"01940"	"GAA_000720"	"g.78093146T>A"	"MAF not reported"	"{Pompe:1121}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119347T>A"	""	"VUS"	"ACMG"
"0000478713"	"0"	"50"	"17"	"78093270"	"78093270"	"del"	"0"	"01940"	"GAA_000015"	"g.78093270del"	"MAF not reported"	"{Pompe:1122}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119471del"	""	"VUS"	"ACMG"
"0000478714"	"0"	"50"	"17"	"78093273"	"78093273"	"subst"	"0"	"01940"	"GAA_000011"	"g.78093273C>T"	"MAF not reported"	"{Pompe:1123}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119474C>T"	""	"VUS"	"ACMG"
"0000478715"	"0"	"50"	"17"	"78093357"	"78093357"	"subst"	"0"	"01940"	"GAA_000013"	"g.78093357G>C"	"MAF not reported"	"{Pompe:1125}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119558G>C"	""	"VUS"	"ACMG"
"0000478716"	"0"	"50"	"17"	"78093548"	"78093548"	"subst"	"0"	"01940"	"GAA_000014"	"g.78093548T>C"	"MAF not reported"	"{Pompe:1126}"	""	""	"predicted non-pathogenic, unknown phenotype when combined with null allele; predicted CRIM+ (protein expressed)"	"SUMMARY record"	""	""	"0"	""	""	"g.80119749T>C"	""	"VUS"	"ACMG"
"0000478806"	"1"	"50"	"17"	"78093270"	"78093270"	"del"	"0"	"01940"	"GAA_000015"	"g.78093270del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119471del"	""	"VUS"	""
"0000478807"	"1"	"50"	"17"	"78093273"	"78093273"	"subst"	"0"	"01940"	"GAA_000011"	"g.78093273C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119474C>T"	""	"VUS"	""
"0000478808"	"1"	"50"	"17"	"78093283"	"78093284"	"ins"	"0"	"01940"	"GAA_000721"	"g.78093283_78093284insG"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119484_80119485insG"	""	"VUS"	""
"0000478809"	"1"	"50"	"17"	"78093146"	"78093146"	"subst"	"0"	"01940"	"GAA_000720"	"g.78093146T>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119347T>A"	""	"VUS"	""
"0000478810"	"1"	"50"	"17"	"78093357"	"78093357"	"subst"	"0"	"01940"	"GAA_000013"	"g.78093357G>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119558G>C"	""	"VUS"	""
"0000478811"	"1"	"50"	"17"	"78093133"	"78093133"	"subst"	"0.0488615"	"01940"	"GAA_000027"	"g.78093133G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119334G>A"	""	"VUS"	""
"0000478812"	"1"	"50"	"17"	"78093548"	"78093548"	"subst"	"0"	"01940"	"GAA_000014"	"g.78093548T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119749T>C"	""	"VUS"	""
"0000478813"	"1"	"50"	"17"	"78082137"	"78082137"	"subst"	"0"	"01940"	"GAA_000283"	"g.78082137G>A"	""	"{PMID:Liao 2014:24513544}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108338G>A"	""	"VUS"	""
"0000478814"	"1"	"50"	"17"	"78082173"	"78082173"	"subst"	"0"	"01940"	"GAA_000223"	"g.78082173C>G"	""	"{PMID:Stepien 2016:26873529}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108374C>G"	""	"VUS"	""
"0000478815"	"1"	"90"	"17"	"78082208"	"78082208"	"subst"	"0"	"01940"	"GAA_000528"	"g.78082208G>T"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108409G>T"	""	"pathogenic (recessive)"	""
"0000478816"	"1"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01940"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Liu 2013:24169249}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	""
"0000478817"	"1"	"50"	"17"	"78082330"	"78082330"	"subst"	"0"	"01940"	"GAA_000535"	"g.78082330T>G"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108531T>G"	""	"VUS"	""
"0000478818"	"1"	"50"	"17"	"78082383"	"78082383"	"subst"	"4.09611E-6"	"01940"	"GAA_000541"	"g.78082383A>G"	""	"{PMID:Turaca 2015:25681614}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108584A>G"	""	"VUS"	""
"0000478819"	"1"	"50"	"17"	"78082411"	"78082411"	"subst"	"0"	"01940"	"GAA_000544"	"g.78082411G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108612G>A"	""	"VUS"	""
"0000478820"	"1"	"90"	"17"	"78082494"	"78082494"	"subst"	"0"	"01940"	"GAA_000549"	"g.78082494A>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108695A>G"	""	"pathogenic (recessive)"	""
"0000478821"	"1"	"50"	"17"	"78082452"	"78082452"	"subst"	"1.64822E-5"	"01940"	"GAA_000545"	"g.78082452C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108653C>T"	""	"VUS"	""
"0000478822"	"1"	"90"	"17"	"78082510"	"78082510"	"del"	"0"	"01940"	"GAA_000292"	"g.78082510del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108711del"	""	"pathogenic (recessive)"	""
"0000478823"	"1"	"30"	"17"	"78082530"	"78082530"	"subst"	"8.21328E-6"	"01940"	"GAA_000553"	"g.78082530C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108731C>T"	""	"likely benign"	""
"0000478824"	"1"	"50"	"17"	"78082611"	"78082611"	"subst"	"7.591E-5"	"01940"	"GAA_000561"	"g.78082611G>A"	""	"{PMID:Turaca 2015:25681614}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108812G>A"	""	"VUS"	""
"0000478825"	"1"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000478826"	"1"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Park 2013:23884227}, {PMID:Park 2006:17092519}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000478827"	"1"	"90"	"17"	"78083773"	"78083773"	"del"	"0"	"01940"	"GAA_000567"	"g.78083773del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80109974del"	""	"pathogenic (recessive)"	""
"0000478828"	"1"	"50"	"17"	"78083790"	"78083790"	"subst"	"4.06971E-6"	"01940"	"GAA_000570"	"g.78083790A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109991A>G"	""	"VUS"	""
"0000478829"	"1"	"70"	"17"	"78083849"	"78083849"	"subst"	"4.08881E-6"	"01940"	"GAA_000041"	"g.78083849G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110050G>A"	""	"likely pathogenic"	""
"0000478830"	"1"	"50"	"17"	"78083858"	"78083858"	"subst"	"0"	"01940"	"GAA_000577"	"g.78083858G>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110059G>C"	""	"VUS"	""
"0000478831"	"1"	"70"	"17"	"78083854"	"78083854"	"subst"	"4.09185E-6"	"01940"	"GAA_000203"	"g.78083854G>A"	""	"{PMID:Stepien 2016:26873529}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110055G>A"	""	"likely pathogenic"	""
"0000478832"	"1"	"90"	"17"	"78084529"	"78084529"	"del"	"4.0658E-6"	"01940"	"GAA_000079"	"g.78084529del"	""	"{PMID:Raben 1999:10189220}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110730del"	""	"pathogenic (recessive)"	""
"0000478833"	"1"	"90"	"17"	"78084530"	"78084530"	"subst"	"0"	"01940"	"GAA_000580"	"g.78084530G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110731G>A"	""	"pathogenic (recessive)"	""
"0000478834"	"1"	"70"	"17"	"78084554"	"78084554"	"subst"	"0"	"01940"	"GAA_000586"	"g.78084554A>G"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110755A>G"	""	"likely pathogenic"	""
"0000478835"	"1"	"90"	"17"	"78084584"	"78084584"	"subst"	"4.0627E-6"	"01940"	"GAA_000589"	"g.78084584G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110785G>A"	""	"pathogenic (recessive)"	""
"0000478836"	"1"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01940"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Elder 2013:23601496}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000478837"	"1"	"50"	"17"	"78084688"	"78084688"	"subst"	"0"	"01940"	"GAA_000595"	"g.78084688C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110889C>T"	""	"VUS"	""
"0000478838"	"1"	"70"	"17"	"78084744"	"78084744"	"subst"	"8.12334E-6"	"01940"	"GAA_000044"	"g.78084744T>C"	""	"{PMID:Reuser 1995:7603530}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110945T>C"	""	"likely pathogenic"	""
"0000478839"	"1"	"70"	"17"	"78084773"	"78084774"	"del"	"0"	"01940"	"GAA_000054"	"g.78084773_78084774delinsGT"	""	"{PMID:Tsunoda 1996:8834250}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110974_80110975delinsGT"	""	"likely pathogenic"	""
"0000478840"	"1"	"90"	"17"	"78084779"	"78084779"	"dup"	"0"	"01940"	"GAA_000602"	"g.78084779dup"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80110980dup"	""	"pathogenic (recessive)"	""
"0000478841"	"1"	"90"	"17"	"78084829"	"78084829"	"subst"	"0"	"01940"	"GAA_000605"	"g.78084829G>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80111030G>C"	""	"pathogenic (recessive)"	""
"0000478842"	"1"	"70"	"17"	"78085790"	"78085790"	"subst"	"0"	"01940"	"GAA_000135"	"g.78085790G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80111991G>A"	""	"likely pathogenic"	""
"0000478843"	"1"	"90"	"17"	"78085799"	"78085799"	"del"	"0"	"01940"	"GAA_000608"	"g.78085799del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112000del"	""	"pathogenic (recessive)"	""
"0000478844"	"1"	"90"	"17"	"78085832"	"78085832"	"subst"	"0"	"01940"	"GAA_000097"	"g.78085832C>T"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112033C>T"	""	"pathogenic (recessive)"	""
"0000478845"	"1"	"50"	"17"	"78085864"	"78085864"	"subst"	"4.06177E-6"	"01940"	"GAA_000616"	"g.78085864C>A"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112065C>A"	""	"VUS"	""
"0000478846"	"1"	"70"	"17"	"78085871"	"78085871"	"subst"	"0"	"01940"	"GAA_000314"	"g.78085871G>C"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112072G>C"	""	"likely pathogenic"	""
"0000478847"	"1"	"50"	"17"	"78085915"	"78085915"	"subst"	"6.51201E-5"	"01940"	"GAA_000622"	"g.78085915C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112116C>T"	""	"VUS"	""
"0000478848"	"1"	"90"	"17"	"78085900"	"78085900"	"subst"	"0"	"01940"	"GAA_000620"	"g.78085900G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112101G>A"	""	"pathogenic (recessive)"	""
"0000478849"	"1"	"90"	"17"	"78085901"	"78085901"	"subst"	"0"	"01940"	"GAA_000621"	"g.78085901T>A"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112102T>A"	""	"pathogenic (recessive)"	""
"0000478850"	"1"	"50"	"17"	"78086393"	"78086393"	"subst"	"8.1884E-6"	"01940"	"GAA_000625"	"g.78086393C>T"	""	"{PMID:Montagnese 2015:25673129}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112594C>T"	""	"VUS"	""
"0000478851"	"1"	"50"	"17"	"78086452"	"78086452"	"subst"	"0.00134355"	"01940"	"GAA_000141"	"g.78086452C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112653C>T"	""	"VUS"	""
"0000478852"	"1"	"50"	"17"	"78086454"	"78086454"	"subst"	"0"	"01940"	"GAA_000633"	"g.78086454G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112655G>A"	""	"VUS"	""
"0000478853"	"1"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000478854"	"1"	"90"	"17"	"78086470"	"78086470"	"dup"	"0"	"01940"	"GAA_000636"	"g.78086470dup"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112671dup"	""	"pathogenic (recessive)"	""
"0000478855"	"1"	"50"	"17"	"78086472"	"78086472"	"subst"	"4.18029E-6"	"01940"	"GAA_000320"	"g.78086472T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112673T>C"	""	"VUS"	""
"0000478856"	"1"	"70"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"01940"	"GAA_000159"	"g.78086478G>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112679G>A"	""	"likely pathogenic"	""
"0000478857"	"1"	"50"	"17"	"78086494"	"78086494"	"subst"	"3.46057E-5"	"01940"	"GAA_000637"	"g.78086494C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112695C>T"	""	"VUS"	""
"0000478858"	"1"	"50"	"17"	"78086508"	"78086508"	"subst"	"8.84823E-6"	"01940"	"GAA_000417"	"g.78086508C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112709C>T"	""	"VUS"	""
"0000478859"	"1"	"70"	"17"	"78086699"	"78086699"	"subst"	"0"	"01940"	"GAA_000322"	"g.78086699G>T"	""	"{PMID:Van den Hout 2004:15121988}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112900G>T"	""	"likely pathogenic"	""
"0000478860"	"1"	"50"	"17"	"78086703"	"78086703"	"subst"	"0"	"01940"	"GAA_000047"	"g.78086703G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112904G>A"	""	"VUS"	""
"0000478861"	"1"	"50"	"17"	"78086706"	"78086706"	"subst"	"0.000188648"	"01940"	"GAA_000642"	"g.78086706T>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112907T>G"	""	"VUS"	""
"0000478862"	"1"	"50"	"17"	"78086709"	"78086709"	"subst"	"0"	"01940"	"GAA_000644"	"g.78086709G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112910G>A"	""	"VUS"	""
"0000478863"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Hermans 1998:9521422}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000478864"	"1"	"90"	"17"	"78086716"	"78086722"	"dup"	"0"	"01940"	"GAA_000646"	"g.78086716_78086722dup"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112917_80112923dup"	""	"pathogenic (recessive)"	""
"0000478865"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Ko 1999:10338092}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000478866"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Amarinthnukrowh 2010:21039225}"	""	""	"no 2nd variant reported; Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000478867"	"1"	"50"	"17"	"78086757"	"78086757"	"subst"	"0"	"01940"	"GAA_000183"	"g.78086757G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112958G>A"	""	"VUS"	""
"0000478868"	"1"	"50"	"17"	"78078584"	"78078584"	"subst"	"0"	"01940"	"GAA_000493"	"g.78078584G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104785G>A"	""	"VUS"	""
"0000478869"	"1"	"50"	"17"	"78086838"	"78086838"	"subst"	"0"	"01940"	"GAA_000656"	"g.78086838G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113039G>A"	""	"VUS"	""
"0000478870"	"1"	"50"	"17"	"78086846"	"78086846"	"subst"	"0"	"01940"	"GAA_000657"	"g.78086846A>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113047A>T"	""	"VUS"	""
"0000478871"	"1"	"50"	"17"	"78086848"	"78086848"	"subst"	"0"	"01940"	"GAA_000658"	"g.78086848G>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113049G>T"	""	"VUS"	""
"0000478872"	"1"	"50"	"17"	"78086956"	"78086956"	"del"	"0"	"01940"	"GAA_000660"	"g.78086956del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113157del"	""	"VUS"	""
"0000478873"	"1"	"50"	"17"	"78087037"	"78087037"	"subst"	"0"	"01940"	"GAA_000663"	"g.78087037C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113238C>T"	""	"VUS"	""
"0000478874"	"1"	"70"	"17"	"78087081"	"78087081"	"subst"	"0"	"01940"	"GAA_000666"	"g.78087081G>T"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80113282G>T"	""	"likely pathogenic"	""
"0000478875"	"1"	"30"	"17"	"78087128"	"78087128"	"subst"	"0.000275181"	"01940"	"GAA_000331"	"g.78087128G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113329G>A"	""	"likely benign"	""
"0000478876"	"1"	"50"	"17"	"78087130"	"78087130"	"subst"	"0"	"01940"	"GAA_000071"	"g.78087130C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113331C>T"	""	"VUS"	""
"0000478877"	"1"	"50"	"17"	"78087168"	"78087168"	"subst"	"0"	"01940"	"GAA_000676"	"g.78087168G>C"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80113369G>C"	""	"VUS"	""
"0000478878"	"1"	"50"	"17"	"78090714"	"78090714"	"subst"	"0"	"01940"	"GAA_000678"	"g.78090714C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80116915C>G"	""	"VUS"	""
"0000478879"	"1"	"30"	"17"	"78078606"	"78078606"	"subst"	"5.78321E-5"	"01940"	"GAA_000250"	"g.78078606G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104807G>A"	""	"likely benign"	""
"0000478880"	"1"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Beesley 1998:10206684}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000478881"	"1"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000478882"	"1"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01940"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Beesley 1998:10206684}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic (recessive)"	""
"0000478883"	"1"	"90"	"17"	"78090877"	"78090877"	"del"	"0"	"01940"	"GAA_000690"	"g.78090877del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117078del"	""	"pathogenic (recessive)"	""
"0000478884"	"1"	"90"	"17"	"78091440"	"78091443"	"del"	"0"	"01940"	"GAA_000695"	"g.78091440_78091443delinsTGCTCA"	""	"{PMID:Labrousse 2010:20080426}"	""	""	"no 2nd variant reported; Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80117641_80117644delinsTGCTCA"	""	"pathogenic (recessive)"	""
"0000478885"	"1"	"90"	"17"	"78091475"	"78091493"	"del"	"0"	"01940"	"GAA_000699"	"g.78091475_78091493del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117676_80117694del"	""	"pathogenic (recessive)"	""
"0000478886"	"1"	"90"	"17"	"78091506"	"78091506"	"dup"	"0"	"01940"	"GAA_000701"	"g.78091506dup"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117707dup"	""	"pathogenic (recessive)"	""
"0000478887"	"1"	"70"	"17"	"78091523"	"78091523"	"subst"	"0"	"01940"	"GAA_000341"	"g.78091523G>C"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117724G>C"	""	"likely pathogenic"	""
"0000478888"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Laforet 2000:11071489}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000478889"	"1"	"90"	"17"	"78091550"	"78091550"	"subst"	"0"	"01940"	"GAA_000703"	"g.78091550T>C"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80117751T>C"	""	"pathogenic (recessive)"	""
"0000478890"	"1"	"50"	"17"	"78092038"	"78092038"	"subst"	"4.0861E-6"	"01940"	"GAA_000704"	"g.78092038T>C"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118239T>C"	""	"VUS"	""
"0000478891"	"1"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Becker 1998:9529346}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000478892"	"1"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Nino 2013:23430493}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000478893"	"1"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Liu 2014:25526786}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000478894"	"1"	"50"	"17"	"78078651"	"78078651"	"subst"	"0.000139397"	"01940"	"GAA_000251"	"g.78078651G>A"	""	"{PMID:Hahn 2015:25626711}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80104852G>A"	""	"VUS"	""
"0000478895"	"1"	"90"	"17"	"78092511"	"78092511"	"del"	"0"	"01940"	"GAA_000710"	"g.78092511del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118712del"	""	"pathogenic (recessive)"	""
"0000478896"	"1"	"50"	"17"	"78092529"	"78092529"	"subst"	"0"	"01940"	"GAA_000711"	"g.78092529C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118730C>G"	""	"VUS"	""
"0000478897"	"1"	"70"	"17"	"78092563"	"78092580"	"dup"	"0"	"01940"	"GAA_000074"	"g.78092563_78092580dup"	""	"{PMID:Beesley 1998:10206684}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118764_80118781dup"	""	"likely pathogenic"	""
"0000478898"	"1"	"30"	"17"	"78092575"	"78092575"	"subst"	"0"	"01940"	"GAA_000715"	"g.78092575T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118776T>C"	""	"likely benign"	""
"0000478899"	"1"	"50"	"17"	"78092588"	"78092588"	"subst"	"0"	"01940"	"GAA_000716"	"g.78092588A>G"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80118789A>G"	""	"VUS"	""
"0000478900"	"1"	"50"	"17"	"78093011"	"78093011"	"subst"	"0"	"01940"	"GAA_000717"	"g.78093011G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119212G>A"	""	"VUS"	""
"0000478901"	"1"	"50"	"17"	"78093079"	"78093079"	"subst"	"0"	"01940"	"GAA_000052"	"g.78093079C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119280C>T"	""	"VUS"	""
"0000478902"	"1"	"90"	"17"	"78093086"	"78093087"	"del"	"0"	"01940"	"GAA_000086"	"g.78093086_78093087del"	""	"{PMID:Ko 1999:10338092}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80119287_80119288del"	""	"pathogenic (recessive)"	""
"0000478903"	"1"	"30"	"17"	"78078417"	"78078417"	"subst"	"0.000130749"	"01940"	"GAA_000365"	"g.78078417G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104618G>A"	""	"likely benign"	""
"0000478904"	"1"	"90"	"17"	"78078737"	"78078737"	"subst"	"0"	"01940"	"GAA_000452"	"g.78078737C>T"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80104938C>T"	""	"pathogenic (recessive)"	""
"0000478905"	"1"	"50"	"17"	"78078748"	"78078748"	"subst"	"0"	"01940"	"GAA_000494"	"g.78078748G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104949G>A"	""	"VUS"	""
"0000478906"	"1"	"70"	"17"	"78078845"	"78078850"	"del"	"0"	"01940"	"GAA_000458"	"g.78078845_78078850del"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80105046_80105051del"	""	"likely pathogenic"	""
"0000478907"	"1"	"50"	"17"	"78078895"	"78078895"	"subst"	"5.0514E-5"	"01940"	"GAA_000122"	"g.78078895C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105096C>T"	""	"VUS"	""
"0000478908"	"1"	"30"	"17"	"78078917"	"78078917"	"subst"	"3.40942E-5"	"01940"	"GAA_000495"	"g.78078917C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105118C>T"	""	"likely benign"	""
"0000478909"	"1"	"50"	"17"	"78078955"	"78078955"	"subst"	"3.18866E-5"	"01940"	"GAA_000496"	"g.78078955G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105156G>A"	""	"VUS"	""
"0000478910"	"1"	"50"	"17"	"78078439"	"78078439"	"subst"	"4.07701E-6"	"01940"	"GAA_000492"	"g.78078439C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104640C>T"	""	"VUS"	""
"0000478911"	"1"	"50"	"17"	"78079573"	"78079573"	"subst"	"0"	"01940"	"GAA_000476"	"g.78079573A>G"	""	"{PMID:Pittis 2008:18429042}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80105774A>G"	""	"VUS"	""
"0000478912"	"1"	"30"	"17"	"78079659"	"78079659"	"subst"	"7.91752E-5"	"01940"	"GAA_000261"	"g.78079659G>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105860G>T"	""	"likely benign"	""
"0000478913"	"1"	"50"	"17"	"78079665"	"78079665"	"subst"	"0.000793266"	"01940"	"GAA_000262"	"g.78079665G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105866G>A"	""	"VUS"	""
"0000478914"	"1"	"50"	"17"	"78079672"	"78079672"	"subst"	"4.19041E-6"	"01940"	"GAA_000214"	"g.78079672G>C"	""	"{PMID:Labrousse 2010:20080426}"	""	""	"no 2nd variant reported; Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80105873G>C"	""	"VUS"	""
"0000478915"	"1"	"90"	"17"	"78079694"	"78079694"	"subst"	"4.25268E-6"	"01940"	"GAA_000498"	"g.78079694G>A"	""	"{PMID:Ng 2013:24027232}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80105895G>A"	""	"pathogenic (recessive)"	""
"0000478916"	"1"	"90"	"17"	"78081405"	"78081405"	"del"	"0"	"01940"	"GAA_000499"	"g.78081405del"	""	"{PMID:Pittis 2008:18429042}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80107606del"	""	"pathogenic (recessive)"	""
"0000478917"	"1"	"90"	"17"	"78081429"	"78081448"	"del"	"0"	"01940"	"GAA_000063"	"g.78081429_78081448delinsC"	""	"{PMID:Beesley 1998:10206684}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80107630_80107649delinsC"	""	"pathogenic (recessive)"	""
"0000478918"	"1"	"50"	"17"	"78081538"	"78081544"	"del"	"0"	"01940"	"GAA_000512"	"g.78081538_78081544del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107739_80107745del"	""	"VUS"	""
"0000478919"	"1"	"50"	"17"	"78081538"	"78081544"	"del"	"0"	"01940"	"GAA_000512"	"g.78081538_78081544del"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107739_80107745del"	""	"VUS"	""
"0000478920"	"1"	"50"	"17"	"78081538"	"78081544"	"dup"	"0"	"01940"	"GAA_000511"	"g.78081538_78081544dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107739_80107745dup"	""	"VUS"	""
"0000478921"	"1"	"50"	"17"	"78081541"	"78081541"	"dup"	"0"	"01940"	"GAA_000110"	"g.78081541dup"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107742dup"	""	"VUS"	""
"0000478922"	"1"	"50"	"17"	"78081542"	"78081542"	"subst"	"0"	"01940"	"GAA_000513"	"g.78081542C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107743C>G"	""	"VUS"	""
"0000478923"	"1"	"50"	"17"	"78081558"	"78081558"	"subst"	"0"	"01940"	"GAA_000514"	"g.78081558C>T"	""	""	""	""	"Variant Error [EREF/EREF]: This genomic variant does not match the reference sequence; the transcript variant does not match the reference sequence either. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000478924"	"1"	"50"	"17"	"78081527"	"78081527"	"subst"	"0"	"01940"	"GAA_000510"	"g.78081527G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107728G>A"	""	"VUS"	""
"0000478925"	"1"	"50"	"17"	"78081608"	"78081608"	"subst"	"8.29394E-6"	"01940"	"GAA_000277"	"g.78081608A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107809A>G"	""	"VUS"	""
"0000478926"	"1"	"70"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01940"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Talsma 2002:11927738}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"likely pathogenic"	""
"0000478927"	"1"	"70"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01940"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"likely pathogenic"	""
"0000478928"	"1"	"50"	"17"	"78081655"	"78081655"	"subst"	"0.00110413"	"01940"	"GAA_000281"	"g.78081655G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107856G>A"	""	"VUS"	""
"0000478929"	"1"	"50"	"17"	"78081657"	"78081657"	"subst"	"0.000616977"	"01940"	"GAA_000519"	"g.78081657C>T"	""	"{PMID:Bali 2012:22252923}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80107858C>T"	""	"VUS"	""
"0000478930"	"1"	"50"	"17"	"78081693"	"78081693"	"subst"	"4.29778E-5"	"01940"	"GAA_000016"	"g.78081693T>C"	""	"{PMID:Zhong 1991:1652892}"	""	""	"no 2nd variant reported"	"Germline"	""	""	"0"	""	""	"g.80107894T>C"	""	"VUS"	""
"0000478931"	"1"	"10"	"17"	"78081707"	"78081707"	"subst"	"0.695957"	"01940"	"GAA_000282"	"g.78081707G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107908G>A"	""	"benign"	""
"0000478932"	"1"	"10"	"17"	"78082005"	"78082005"	"subst"	"0"	"01940"	"GAA_000523"	"g.78082005C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108206C>T"	""	"benign"	""
"0000478933"	"1"	"50"	"17"	"78075640"	"78075640"	"subst"	"0"	"01940"	"GAA_000001"	"g.78075640G>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80101841G>C"	""	"VUS"	""
"0000478934"	"1"	"10"	"17"	"78093353"	"78093353"	"subst"	"0"	"01940"	"GAA_000012"	"g.78093353C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119554C>T"	""	"benign"	""
"0000478935"	"1"	"10"	"17"	"78093221"	"78093221"	"subst"	"0"	"01940"	"GAA_000118"	"g.78093221G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119422G>A"	""	"benign"	""
"0000478936"	"1"	"50"	"17"	"78082221"	"78082221"	"subst"	"0.0104313"	"01940"	"GAA_000286"	"g.78082221C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108422C>T"	""	"VUS"	""
"0000478937"	"1"	"50"	"17"	"78082346"	"78082346"	"subst"	"0"	"01940"	"GAA_000537"	"g.78082346C>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80108547C>G"	""	"VUS"	""
"0000478938"	"1"	"50"	"17"	"78082402"	"78082402"	"subst"	"2.45988E-5"	"01940"	"GAA_000288"	"g.78082402C>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80108603C>T"	""	"VUS"	""
"0000478939"	"1"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"01940"	"GAA_000006"	"g.78082504G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108705G>A"	""	"benign"	""
"0000478940"	"1"	"50"	"17"	"78082505"	"78082505"	"subst"	"0"	"01940"	"GAA_000007"	"g.78082505T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80108706T>C"	""	"VUS"	""
"0000478941"	"1"	"30"	"17"	"78082587"	"78082587"	"subst"	"0.000765717"	"01940"	"GAA_000557"	"g.78082587A>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80108788A>G"	""	"likely benign"	""
"0000478942"	"1"	"50"	"17"	"78082632"	"78082632"	"subst"	"0"	"01940"	"GAA_000564"	"g.78082632G>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80108833G>A"	""	"VUS"	""
"0000478943"	"1"	"10"	"17"	"78083726"	"78083726"	"subst"	"0.721259"	"01940"	"GAA_000295"	"g.78083726A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109927A>G"	""	"benign"	""
"0000478944"	"1"	"50"	"17"	"78083787"	"78083787"	"subst"	"0"	"01940"	"GAA_000297"	"g.78083787C>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80109988C>A"	""	"VUS"	""
"0000478945"	"1"	"90"	"17"	"78083788"	"78083788"	"del"	"0"	"01940"	"GAA_000569"	"g.78083788del"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80109989del"	""	"pathogenic (recessive)"	""
"0000478946"	"1"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"01940"	"GAA_000019"	"g.78083791C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109992C>T"	""	"benign"	""
"0000478947"	"1"	"50"	"17"	"78083798"	"78083798"	"subst"	"0"	"01940"	"GAA_000572"	"g.78083798G>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80109999G>A"	""	"VUS"	""
"0000478948"	"1"	"10"	"17"	"78084507"	"78084507"	"subst"	"0.67069"	"01940"	"GAA_000300"	"g.78084507G>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110708G>C"	""	"benign"	""
"0000478949"	"1"	"50"	"17"	"78084525"	"78084525"	"subst"	"8.13312E-6"	"01940"	"GAA_000579"	"g.78084525G>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80110726G>T"	""	"VUS"	""
"0000478950"	"1"	"50"	"17"	"78084533"	"78084533"	"subst"	"0"	"01940"	"GAA_000582"	"g.78084533C>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80110734C>G"	""	"VUS"	""
"0000478951"	"1"	"50"	"17"	"78084536"	"78084536"	"subst"	"0"	"01940"	"GAA_000583"	"g.78084536G>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80110737G>T"	""	"VUS"	""
"0000478952"	"1"	"50"	"17"	"78084556"	"78084556"	"subst"	"0"	"01940"	"GAA_000303"	"g.78084556T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80110757T>C"	""	"VUS"	""
"0000478953"	"1"	"50"	"17"	"78084681"	"78084681"	"subst"	"0.0023074"	"01940"	"GAA_000172"	"g.78084681G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110882G>A"	""	"VUS"	""
"0000478954"	"1"	"10"	"17"	"78084688"	"78084688"	"subst"	"0.669866"	"01940"	"GAA_000445"	"g.78084688C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110889C>A"	""	"benign"	""
"0000478955"	"1"	"50"	"17"	"78084752"	"78084752"	"subst"	"8.12341E-6"	"01940"	"GAA_000600"	"g.78084752C>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80110953C>T"	""	"VUS"	""
"0000478956"	"1"	"50"	"17"	"78084756"	"78084756"	"subst"	"0"	"01940"	"GAA_000308"	"g.78084756C>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80110957C>A"	""	"VUS"	""
"0000478957"	"1"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01940"	"GAA_000008"	"g.78084769G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110970G>A"	""	"benign"	""
"0000478958"	"1"	"50"	"17"	"78085817"	"78085817"	"subst"	"0"	"01940"	"GAA_000310"	"g.78085817T>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112018T>A"	""	"VUS"	""
"0000478959"	"1"	"50"	"17"	"78085862"	"78085862"	"subst"	"0"	"01940"	"GAA_000615"	"g.78085862A>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112063A>C"	""	"VUS"	""
"0000478960"	"1"	"50"	"17"	"78085869"	"78085869"	"subst"	"0"	"01940"	"GAA_000313"	"g.78085869A>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112070A>G"	""	"VUS"	""
"0000478961"	"1"	"10"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"01940"	"GAA_000045"	"g.78085871G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112072G>A"	""	"benign"	""
"0000478962"	"1"	"50"	"17"	"78085872"	"78085872"	"subst"	"0"	"01940"	"GAA_000618"	"g.78085872G>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112073G>A"	""	"VUS"	""
"0000478963"	"1"	"10"	"17"	"78085911"	"78085911"	"subst"	"0.0561804"	"01940"	"GAA_000315"	"g.78085911G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112112G>A"	""	"benign"	""
"0000478964"	"1"	"50"	"17"	"78086426"	"78086426"	"subst"	"4.10516E-6"	"01940"	"GAA_000629"	"g.78086426A>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112627A>G"	""	"VUS"	""
"0000478965"	"1"	"50"	"17"	"78078571"	"78078581"	"dup"	"0"	"01940"	"GAA_000447"	"g.78078571_78078581dup"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80104772_80104782dup"	""	"VUS"	""
"0000478966"	"1"	"50"	"17"	"78086501"	"78086501"	"subst"	"0"	"01940"	"GAA_000638"	"g.78086501T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112702T>C"	""	"VUS"	""
"0000478967"	"1"	"10"	"17"	"78086531"	"78086531"	"subst"	"0.0575615"	"01940"	"GAA_000321"	"g.78086531G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112732G>A"	""	"benign"	""
"0000478968"	"1"	"50"	"17"	"78086648"	"78086849"	"del"	"0"	"01940"	"GAA_000641"	"g.78086648_78086849del"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112849_80113050del"	""	"VUS"	""
"0000478969"	"1"	"50"	"17"	"78086737"	"78086738"	"del"	"0"	"01940"	"GAA_000325"	"g.78086737_78086738delinsT"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112938_80112939delinsT"	""	"VUS"	""
"0000478970"	"1"	"50"	"17"	"78086748"	"78086750"	"del"	"0"	"01940"	"GAA_000649"	"g.78086748_78086750del"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112949_80112951del"	""	"VUS"	""
"0000478971"	"1"	"50"	"17"	"78086767"	"78086767"	"subst"	"0"	"01940"	"GAA_000650"	"g.78086767T>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80112968T>G"	""	"VUS"	""
"0000478972"	"1"	"90"	"17"	"78078386"	"78078386"	"subst"	"0"	"01940"	"GAA_000284"	"g.78078386A>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80104587A>T"	""	"pathogenic (recessive)"	""
"0000478973"	"1"	"10"	"17"	"78086846"	"78086846"	"subst"	"0.719557"	"01940"	"GAA_000327"	"g.78086846A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113047A>G"	""	"benign"	""
"0000478974"	"1"	"10"	"17"	"78086953"	"78086953"	"subst"	"0"	"01940"	"GAA_000659"	"g.78086953G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113154G>A"	""	"benign"	""
"0000478975"	"1"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"01940"	"GAA_000035"	"g.78087041G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113242G>A"	""	"benign"	""
"0000478976"	"1"	"50"	"17"	"78087073"	"78087078"	"del"	"0"	"01940"	"GAA_000665"	"g.78087073_78087078del"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80113274_80113279del"	""	"VUS"	""
"0000478977"	"1"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"01940"	"GAA_000022"	"g.78087109A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000478978"	"1"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"01940"	"GAA_000022"	"g.78087109A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113310A>G"	""	"benign"	""
"0000478979"	"1"	"50"	"17"	"78087137"	"78087137"	"dup"	"0"	"01940"	"GAA_000669"	"g.78087137dup"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80113338dup"	""	"VUS"	""
"0000478980"	"1"	"90"	"17"	"78087137"	"78087137"	"subst"	"0"	"01940"	"GAA_000670"	"g.78087137G>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80113338G>T"	""	"pathogenic (recessive)"	""
"0000478981"	"1"	"50"	"17"	"78087166"	"78087166"	"subst"	"0"	"01940"	"GAA_000333"	"g.78087166G>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80113367G>A"	""	"VUS"	""
"0000478982"	"1"	"50"	"17"	"78090804"	"78090804"	"subst"	"0"	"01940"	"GAA_000334"	"g.78090804C>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117005C>A"	""	"VUS"	""
"0000478983"	"1"	"50"	"17"	"78090813"	"78090813"	"subst"	"0"	"01940"	"GAA_000682"	"g.78090813T>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117014T>G"	""	"VUS"	""
"0000478984"	"1"	"50"	"17"	"78090819"	"78090819"	"subst"	"0"	"01940"	"GAA_000683"	"g.78090819G>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117020G>T"	""	"VUS"	""
"0000478985"	"1"	"50"	"17"	"78090861"	"78090861"	"subst"	"1.62801E-5"	"01940"	"GAA_000688"	"g.78090861G>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117062G>A"	""	"VUS"	""
"0000478986"	"1"	"10"	"17"	"78090928"	"78090928"	"subst"	"0.741984"	"01940"	"GAA_000338"	"g.78090928G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117129G>A"	""	"benign"	""
"0000478987"	"1"	"10"	"17"	"78090932"	"78090932"	"subst"	"0.14918"	"01940"	"GAA_000339"	"g.78090932T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117133T>C"	""	"benign"	""
"0000478988"	"1"	"10"	"17"	"78091405"	"78091405"	"subst"	"0.718163"	"01940"	"GAA_000009"	"g.78091405G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117606G>A"	""	"benign"	""
"0000478989"	"1"	"50"	"17"	"78091424"	"78091424"	"dup"	"0"	"01940"	"GAA_000694"	"g.78091424dup"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117625dup"	""	"VUS"	""
"0000478990"	"1"	"50"	"17"	"78091462"	"78091462"	"subst"	"0"	"01940"	"GAA_000697"	"g.78091462C>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117663C>G"	""	"VUS"	""
"0000478991"	"1"	"10"	"17"	"78091513"	"78091513"	"subst"	"0.0495638"	"01940"	"GAA_000024"	"g.78091513G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117714G>A"	""	"benign"	""
"0000478992"	"1"	"50"	"17"	"78091549"	"78091549"	"subst"	"0"	"01940"	"GAA_000702"	"g.78091549G>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117750G>A"	""	"VUS"	""
"0000478993"	"1"	"90"	"17"	"78091550"	"78091550"	"subst"	"0"	"01940"	"GAA_000703"	"g.78091550T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80117751T>C"	""	"pathogenic (recessive)"	""
"0000478994"	"1"	"50"	"17"	"78092005"	"78092006"	"del"	"0"	"01940"	"GAA_000344"	"g.78092005_78092006del"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80118206_80118207del"	""	"VUS"	""
"0000478995"	"1"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"01940"	"GAA_000010"	"g.78092063G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118264G>A"	""	"benign"	""
"0000478996"	"1"	"50"	"17"	"78092195"	"78092195"	"subst"	"0.00303531"	"01940"	"GAA_000708"	"g.78092195G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118396G>A"	""	"VUS"	""
"0000478997"	"1"	"30"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"01940"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	""	"likely benign"	""
"0000478998"	"1"	"10"	"17"	"78092585"	"78092585"	"subst"	"0.0186771"	"01940"	"GAA_000026"	"g.78092585C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118786C>T"	""	"benign"	""
"0000478999"	"1"	"50"	"17"	"78093075"	"78093075"	"subst"	"0"	"01940"	"GAA_000719"	"g.78093075T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80119276T>C"	""	"VUS"	""
"0000479000"	"1"	"50"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000449"	"g.78078692T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80104893T>C"	""	"VUS"	""
"0000479001"	"1"	"50"	"17"	"78078707"	"78078707"	"subst"	"0"	"01940"	"GAA_000450"	"g.78078707T>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80104908T>G"	""	"VUS"	""
"0000479002"	"1"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"01940"	"GAA_000002"	"g.78078709T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104910T>C"	""	"benign"	""
"0000479003"	"1"	"30"	"17"	"78078832"	"78078832"	"subst"	"0.00500256"	"01940"	"GAA_000457"	"g.78078832G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105033G>A"	""	"likely benign"	""
"0000479004"	"1"	"50"	"17"	"78078868"	"78078868"	"dup"	"0"	"01940"	"GAA_000461"	"g.78078868dup"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80105069dup"	""	"VUS"	""
"0000479005"	"1"	"50"	"17"	"78078976"	"78078976"	"subst"	"0"	"01940"	"GAA_000472"	"g.78078976G>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80105177G>C"	""	"VUS"	""
"0000479006"	"1"	"10"	"17"	"78079544"	"78079544"	"subst"	"0.669863"	"01940"	"GAA_000258"	"g.78079544C>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105745C>G"	""	"benign"	""
"0000479007"	"1"	"50"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"01940"	"GAA_000004"	"g.78079597A>G"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105798A>G"	""	"VUS"	""
"0000479008"	"1"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"01940"	"GAA_000005"	"g.78079643C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105844C>T"	""	"benign"	""
"0000479009"	"1"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"01940"	"GAA_000038"	"g.78079669G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105870G>A"	""	"benign"	""
"0000479010"	"1"	"10"	"17"	"78081307"	"78081307"	"subst"	"0.0667469"	"01940"	"GAA_000480"	"g.78081307C>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107508C>T"	""	"benign"	""
"0000479011"	"1"	"50"	"17"	"78081364"	"78081364"	"subst"	"0"	"01940"	"GAA_000481"	"g.78081364C>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107565C>G"	""	"VUS"	""
"0000479012"	"1"	"50"	"17"	"78081388"	"78081388"	"subst"	"9.34876E-5"	"01940"	"GAA_000484"	"g.78081388C>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107589C>T"	""	"VUS"	""
"0000479013"	"1"	"50"	"17"	"78081406"	"78081406"	"subst"	"4.06382E-6"	"01940"	"GAA_000501"	"g.78081406T>C"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107607T>C"	""	"VUS"	""
"0000479014"	"1"	"50"	"17"	"78081431"	"78081431"	"dup"	"0"	"01940"	"GAA_000503"	"g.78081431dup"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107632dup"	""	"VUS"	""
"0000479015"	"1"	"50"	"17"	"78081439"	"78081439"	"subst"	"0"	"01940"	"GAA_000504"	"g.78081439G>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107640G>T"	""	"VUS"	""
"0000479016"	"1"	"30"	"17"	"78081515"	"78081515"	"subst"	"0.00629527"	"01940"	"GAA_000269"	"g.78081515G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107716G>A"	""	"likely benign"	""
"0000479017"	"1"	"10"	"17"	"78081551"	"78081551"	"subst"	"0.662574"	"01940"	"GAA_000275"	"g.78081551T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107752T>C"	""	"benign"	""
"0000479018"	"1"	"50"	"17"	"78081526"	"78081527"	"ins"	"0"	"01940"	"GAA_000487"	"g.78081526_78081527insN[7]"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000479019"	"1"	"50"	"17"	"78081612"	"78081612"	"subst"	"0"	"01940"	"GAA_000516"	"g.78081612T>A"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107813T>A"	""	"VUS"	""
"0000479020"	"1"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"01940"	"GAA_000018"	"g.78081661A>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107862A>T"	""	"benign"	""
"0000479021"	"1"	"50"	"17"	"78081669"	"78081669"	"subst"	"0"	"01940"	"GAA_000520"	"g.78081669T>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107870T>G"	""	"VUS"	""
"0000479022"	"1"	"50"	"17"	"78081687"	"78081687"	"subst"	"0"	"01940"	"GAA_000521"	"g.78081687A>T"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107888A>T"	""	"VUS"	""
"0000479023"	"1"	"50"	"17"	"78081697"	"78081697"	"subst"	"0"	"01940"	"GAA_000522"	"g.78081697T>G"	""	""	""	""	"no 2nd variant reported, no patient data reported"	"Germline"	""	""	"0"	""	""	"g.80107898T>G"	""	"VUS"	""
"0000479024"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479025"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479026"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479027"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2015:26231297}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479028"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2015:26231297}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479029"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2015:26231297}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479030"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2015:26231297}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479031"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479032"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Sharma 2005:15986226}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479033"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479034"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2015:26231297}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479035"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479036"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479037"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Golden-Grant 2015:25677830}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479038"	"3"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479039"	"3"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Grzesiuk 2010:20464284}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479040"	"3"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479041"	"3"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479042"	"3"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479043"	"3"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479044"	"3"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479045"	"3"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Loureiro Neves 2013:24016645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479046"	"3"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479047"	"3"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000479048"	"3"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01940"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000479049"	"3"	"50"	"17"	"78082311"	"78082311"	"subst"	"0"	"01940"	"GAA_000531"	"g.78082311T>C"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108512T>C"	""	"VUS"	""
"0000479050"	"3"	"70"	"17"	"78082336"	"78082336"	"subst"	"8.19061E-6"	"01940"	"GAA_000393"	"g.78082336G>T"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108537G>T"	""	"likely pathogenic"	""
"0000479051"	"3"	"90"	"17"	"78082369"	"78082369"	"dup"	"0"	"01940"	"GAA_000539"	"g.78082369dup"	""	"{PMID:Rohrbach 2010:20882352}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108570dup"	""	"pathogenic (recessive)"	""
"0000479052"	"3"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01940"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Kroos 1997:9266392}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000479053"	"3"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01940"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000479054"	"3"	"90"	"17"	"78082494"	"78082494"	"subst"	"0"	"01940"	"GAA_000549"	"g.78082494A>G"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108695A>G"	""	"pathogenic (recessive)"	""
"0000479055"	"3"	"90"	"17"	"78082510"	"78082510"	"del"	"0"	"01940"	"GAA_000292"	"g.78082510del"	""	"{PMID:Kishnani 2010:19775921}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108711del"	""	"pathogenic (recessive)"	""
"0000479056"	"3"	"50"	"17"	"78082515"	"78082515"	"subst"	"0"	"01940"	"GAA_000131"	"g.78082515T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108716T>C"	""	"VUS"	""
"0000479057"	"3"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Isayama 2014:24872213}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000479058"	"3"	"90"	"17"	"78083742"	"78083742"	"subst"	"0"	"01940"	"GAA_000247"	"g.78083742A>G"	""	"{PMID:Alansari 2013:24273659}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109943A>G"	""	"pathogenic (recessive)"	""
"0000479059"	"3"	"90"	"17"	"78083742"	"78083742"	"subst"	"0"	"01940"	"GAA_000247"	"g.78083742A>G"	""	"{PMID:Hamdan 2008:19067231}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109943A>G"	""	"pathogenic (recessive)"	""
"0000479060"	"3"	"70"	"17"	"78083781"	"78083781"	"subst"	"0"	"01940"	"GAA_000132"	"g.78083781A>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109982A>T"	""	"likely pathogenic"	""
"0000479061"	"3"	"70"	"17"	"78083794"	"78083796"	"del"	"0"	"01940"	"GAA_000571"	"g.78083794_78083796del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109995_80109997del"	""	"likely pathogenic"	""
"0000479062"	"3"	"90"	"17"	"78083855"	"78083855"	"subst"	"0"	"01940"	"GAA_000576"	"g.78083855G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110056G>A"	""	"pathogenic (recessive)"	""
"0000479063"	"3"	"70"	"17"	"78083854"	"78083854"	"subst"	"4.09185E-6"	"01940"	"GAA_000203"	"g.78083854G>A"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110055G>A"	""	"likely pathogenic"	""
"0000479064"	"3"	"70"	"17"	"78083854"	"78083854"	"subst"	"4.09185E-6"	"01940"	"GAA_000203"	"g.78083854G>A"	""	"{PMID:Morales 2015:26160551}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110055G>A"	""	"likely pathogenic"	""
"0000479065"	"3"	"90"	"17"	"78078533"	"78081588"	"del"	"0"	"01940"	"GAA_000446"	"g.78078533_78081588del"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104734_80107789del"	""	"pathogenic (recessive)"	""
"0000479066"	"3"	"50"	"17"	"78084628"	"78084628"	"subst"	"0"	"01940"	"GAA_000591"	"g.78084628G>C"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110829G>C"	""	"VUS"	""
"0000479067"	"3"	"70"	"17"	"78084737"	"78084737"	"subst"	"0.000138095"	"01940"	"GAA_000156"	"g.78084737C>G"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110938C>G"	""	"likely pathogenic"	""
"0000479068"	"3"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01940"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:Hermans 1991:1898413}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	""
"0000479069"	"3"	"70"	"17"	"78084773"	"78084774"	"del"	"0"	"01940"	"GAA_000054"	"g.78084773_78084774delinsGT"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110974_80110975delinsGT"	""	"likely pathogenic"	""
"0000479070"	"3"	"50"	"17"	"78084814"	"78084814"	"subst"	"8.13246E-6"	"01940"	"GAA_000157"	"g.78084814C>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111015C>G"	""	"VUS"	""
"0000479071"	"3"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Hermans 1994:7881422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000479072"	"3"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000479073"	"3"	"90"	"17"	"78085780"	"78085780"	"subst"	"0"	"01940"	"GAA_000352"	"g.78085780A>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111981A>G"	""	"pathogenic (recessive)"	""
"0000479074"	"3"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479075"	"3"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479076"	"3"	"70"	"17"	"78085841"	"78085841"	"subst"	"0"	"01940"	"GAA_000046"	"g.78085841T>C"	""	"{PMID:Hermans 1998:9521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112042T>C"	""	"likely pathogenic"	""
"0000479077"	"3"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000479078"	"3"	"50"	"17"	"78086442"	"78086442"	"subst"	"0"	"01940"	"GAA_000138"	"g.78086442G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112643G>A"	""	"VUS"	""
"0000479079"	"3"	"90"	"17"	"78086446"	"78086450"	"dup"	"0"	"01940"	"GAA_000631"	"g.78086446_78086450dup"	""	"{PMID:Aryani 2014:24976573}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112647_80112651dup"	""	"pathogenic (recessive)"	""
"0000479080"	"3"	"50"	"17"	"78086454"	"78086454"	"subst"	"0"	"01940"	"GAA_000633"	"g.78086454G>A"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112655G>A"	""	"VUS"	""
"0000479081"	"3"	"70"	"17"	"78086455"	"78086469"	"del"	"0"	"01940"	"GAA_000490"	"g.78086455_78086469delinsACGGGGTAT"	""	"{PMID:Deodato 2014:23620524}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112656_80112670delinsACGGGGTAT"	""	"likely pathogenic"	""
"0000479082"	"3"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01940"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	""
"0000479083"	"3"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01940"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Nabatame 2009:18495398}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	""
"0000479084"	"3"	"90"	"17"	"78086511"	"78086511"	"subst"	"0"	"01940"	"GAA_000640"	"g.78086511G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112712G>A"	""	"pathogenic (recessive)"	""
"0000479085"	"3"	"70"	"17"	"78086691"	"78086691"	"subst"	"0"	"01940"	"GAA_000360"	"g.78086691C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112892C>A"	""	"likely pathogenic"	""
"0000479086"	"3"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479087"	"3"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479088"	"3"	"90"	"17"	"78086716"	"78086722"	"dup"	"0"	"01940"	"GAA_000646"	"g.78086716_78086722dup"	""	"{PMID:But 2009:19966354}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112917_80112923dup"	""	"pathogenic (recessive)"	""
"0000479089"	"3"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479090"	"3"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479091"	"3"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479092"	"3"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Del Rizzo 2010:20830524}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479093"	"3"	"50"	"17"	"78086719"	"78086719"	"subst"	"4.19893E-6"	"01940"	"GAA_000048"	"g.78086719G>C"	""	"{PMID:Lin 1995:7695647}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>C"	""	"VUS"	""
"0000479094"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479095"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479096"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Shieh 1998:9554747}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479097"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479098"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479099"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Amarinthnukrowh 2010:21039225}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479100"	"3"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479101"	"3"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479102"	"3"	"90"	"17"	"78086773"	"78086773"	"del"	"0"	"01940"	"GAA_000651"	"g.78086773del"	""	"{PMID:Esmer 2013:24399866}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112974del"	""	"pathogenic (recessive)"	""
"0000479103"	"3"	"90"	"17"	"78078386"	"78078386"	"subst"	"0"	"01940"	"GAA_000355"	"g.78078386A>G"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104587A>G"	""	"pathogenic (recessive)"	""
"0000479104"	"3"	"70"	"17"	"78086801"	"78086801"	"subst"	"0"	"01940"	"GAA_000069"	"g.78086801G>A"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"likely pathogenic"	""
"0000479105"	"3"	"70"	"17"	"78086801"	"78086801"	"subst"	"0"	"01940"	"GAA_000069"	"g.78086801G>A"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"likely pathogenic"	""
"0000479106"	"3"	"50"	"17"	"78087021"	"78087021"	"subst"	"0"	"01940"	"GAA_000661"	"g.78087021A>G"	""	"{PMID:Aykut 2014:25026126}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113222A>G"	""	"VUS"	""
"0000479107"	"3"	"90"	"17"	"78087054"	"78087054"	"dup"	"0"	"01940"	"GAA_000664"	"g.78087054dup"	""	"{PMID:Galehdari 2013:23360637}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113255dup"	""	"pathogenic (recessive)"	""
"0000479108"	"3"	"90"	"17"	"78087161"	"78087161"	"del"	"0"	"01940"	"GAA_000675"	"g.78087161del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113362del"	""	"pathogenic (recessive)"	""
"0000479109"	"3"	"70"	"17"	"78087624"	"78093676"	"del"	"0"	"01940"	"GAA_000677"	"g.78087624_78093676del"	""	"{PMID:Huie 1999:10071199}"	""	""	"Variant Error [EMISMATCH/ERANGE]: This transcript variant has an error. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000479110"	"3"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479111"	"3"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479112"	"3"	"50"	"17"	"78090880"	"78090880"	"subst"	"0"	"01940"	"GAA_000049"	"g.78090880C>G"	""	"{PMID:Hermans 1998:9521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117081C>G"	""	"VUS"	""
"0000479113"	"3"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"01940"	"GAA_000336"	"g.78090910T>A"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic (recessive)"	""
"0000479114"	"3"	"90"	"17"	"78090910"	"78090910"	"subst"	"0"	"01940"	"GAA_000058"	"g.78090910T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>C"	""	"pathogenic (recessive)"	""
"0000479115"	"3"	"90"	"17"	"78090910"	"78090910"	"subst"	"0"	"01940"	"GAA_000058"	"g.78090910T>C"	""	"{PMID:Hermans 1997:9425285}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>C"	""	"pathogenic (recessive)"	""
"0000479116"	"3"	"90"	"17"	"78078621"	"78078631"	"del"	"0"	"01940"	"GAA_000240"	"g.78078621_78078631del"	""	"{PMID:Banugaria 2013:23825616}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104822_80104832del"	""	"pathogenic (recessive)"	""
"0000479117"	"3"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479118"	"3"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479119"	"3"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479120"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Becker 1998:9529346}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479121"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Messinger 2012:22237443}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479122"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479123"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Alansari 2013:24273659}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479124"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Pereira 2008:18535739}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479125"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479126"	"3"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479127"	"3"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"01940"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000479128"	"3"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479129"	"3"	"90"	"17"	"78092546"	"78092546"	"del"	"0"	"01940"	"GAA_000713"	"g.78092546delinsGAC"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118747delinsGAC"	""	"pathogenic (recessive)"	""
"0000479130"	"3"	"90"	"17"	"78092546"	"78092546"	"del"	"0"	"01940"	"GAA_000713"	"g.78092546delinsGAC"	""	"{PMID:Hermans 1998:9521422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118747delinsGAC"	""	"pathogenic (recessive)"	""
"0000479131"	"3"	"90"	"17"	"78092546"	"78092546"	"del"	"0"	"01940"	"GAA_000713"	"g.78092546delinsGAC"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118747delinsGAC"	""	"pathogenic (recessive)"	""
"0000479132"	"3"	"50"	"17"	"78092549"	"78092549"	"subst"	"0"	"01940"	"GAA_000714"	"g.78092549A>C"	""	"{PMID:Broomfield 2016:26497565}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118750A>C"	""	"VUS"	""
"0000479133"	"3"	"90"	"17"	"78078694"	"78078694"	"subst"	"0"	"01940"	"GAA_000120"	"g.78078694C>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104895C>A"	""	"pathogenic (recessive)"	""
"0000479134"	"3"	"90"	"17"	"78078725"	"78078726"	"ins"	"0"	"01940"	"GAA_000121"	"g.78078725_78078726insT"	""	"{PMID:Messinger 2012:22237443}"	""	"341insT"	""	"Germline"	""	""	"0"	""	""	"g.80104926_80104927insT"	""	"pathogenic (recessive)"	""
"0000479135"	"3"	"90"	"17"	"78078725"	"78078726"	"ins"	"0"	"01940"	"GAA_000121"	"g.78078725_78078726insT"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104926_80104927insT"	""	"pathogenic (recessive)"	""
"0000479136"	"3"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01940"	"GAA_000242"	"g.78078762G>A"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic (recessive)"	""
"0000479137"	"3"	"90"	"17"	"78078784"	"78078784"	"subst"	"0"	"01940"	"GAA_000124"	"g.78078784C>A"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104985C>A"	""	"pathogenic (recessive)"	""
"0000479138"	"3"	"90"	"17"	"78078910"	"78078911"	"del"	"4.24932E-6"	"01940"	"GAA_000464"	"g.78078910_78078911del"	""	"{PMID:Banugaria 2013:23825616}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111_80105112del"	""	"pathogenic (recessive)"	""
"0000479139"	"3"	"90"	"17"	"78078910"	"78078911"	"del"	"4.24932E-6"	"01940"	"GAA_000464"	"g.78078910_78078911del"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111_80105112del"	""	"pathogenic (recessive)"	""
"0000479140"	"3"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479141"	"3"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Van den Hout 2004:15121988}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479142"	"3"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479143"	"3"	"90"	"17"	"78078933"	"78078933"	"subst"	"0"	"01940"	"GAA_000469"	"g.78078933T>C"	""	"{PMID:Banugaria 2013:23825616}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105134T>C"	""	"pathogenic (recessive)"	""
"0000479144"	"3"	"50"	"17"	"78078936"	"78078936"	"subst"	"3.89176E-5"	"01940"	"GAA_000471"	"g.78078936G>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105137G>T"	""	"VUS"	""
"0000479145"	"3"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"01940"	"GAA_000466"	"g.78078931G>T"	""	"{PMID:Tsuburaya 2012:22196155}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>T"	""	"pathogenic (recessive)"	""
"0000479146"	"3"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479147"	"3"	"90"	"17"	"78081523"	"78081523"	"subst"	"0"	"01940"	"GAA_000509"	"g.78081523T>A"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107724T>A"	""	"pathogenic (recessive)"	""
"0000479148"	"3"	"70"	"17"	"78081612"	"78081612"	"subst"	"0"	"01940"	"GAA_000220"	"g.78081612T>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107813T>C"	""	"likely pathogenic"	""
"0000479149"	"3"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000221"	"g.78081636T>C"	""	"{PMID:Mechtler 2012:22133539}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	""
"0000479150"	"3"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000221"	"g.78081636T>C"	""	"{PMID:Hahn 2015:25626711}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	""
"0000479151"	"3"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000221"	"g.78081636T>C"	""	"{PMID:Shin 2006:17027861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	""
"0000479152"	"3"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479153"	"3"	"50"	"17"	"78081675"	"78081675"	"subst"	"0"	"01940"	"GAA_000128"	"g.78081675T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107876T>G"	""	"VUS"	""
"0000479154"	"3"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479155"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Andreassen 2014:24685124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479156"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Quenardelle 2015:25451853}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479157"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479158"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479159"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479160"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479161"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479162"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479163"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479164"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479165"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479166"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Horvath 2015:25155446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479167"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479168"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479169"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479170"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479171"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Amartino 2006:16433701}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479172"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479173"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479174"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Ravaglia 2012:22704482}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479175"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479176"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479177"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479178"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479179"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479180"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Horvath 2015:25155446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479181"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Hobson-Webb 2015:25835646}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479182"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479183"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2016:25783438}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479184"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479185"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479186"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Musumeci 2012:22958975}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479187"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479188"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479189"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479190"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479191"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479192"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Horvath 2015:25155446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479193"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479194"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479195"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Huie 1994:7881425}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479196"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gesquiere-Dando 2015:25703594}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479197"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479198"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Crescimanno 2015:25908581}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479199"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479200"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479201"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Carlier 2011:21803581}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479202"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479203"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Case 2008:18930676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479204"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479205"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479206"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479207"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479208"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alcantara-Ortigoza 2010:20350966}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479209"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479210"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Ravaglia 2012:22704482}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479211"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479212"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479213"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479214"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479215"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479216"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479217"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479218"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Shin 2006:17027861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479219"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479220"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Bandyopadhyay 2015:25846667}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479221"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Hofstra 2004:14695533}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479222"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479223"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479224"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479225"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Carlier 2011:21803581}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479226"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479227"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479228"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479229"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479230"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479231"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479232"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479233"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479234"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479235"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479236"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479237"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479238"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479239"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479240"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479241"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Terzis 2012:23146291}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479242"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Papadimas 2012:23843830}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479243"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479244"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479245"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479246"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479247"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479248"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479249"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479250"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Stepien 2016:26873529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479251"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479252"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479253"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479254"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479255"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479256"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479257"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479258"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479259"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479260"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479261"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479262"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Ravaglia 2012:22704482}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479263"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479264"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:El-Gharbawy 2011:21605996}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479265"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479266"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:van Capelle 2016:27189384}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479267"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479268"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479269"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479270"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479271"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Boerkoel 1995:7717400}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479272"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Huie 1994:7881425}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479273"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479274"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479275"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479276"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479277"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479278"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479279"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479280"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479281"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479282"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479283"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479284"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Angelini 2007:17470141}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479285"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479286"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479287"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Wagner 2013:23062590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479288"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479289"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kostera-Pruszczyk 2006:16531044}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479290"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479291"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479292"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Peric 2014:24338761}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479293"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479294"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479295"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479296"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479297"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479298"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479299"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479300"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nicolino 1997:9196050}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479301"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479302"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Wokke 1995:7668832}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479303"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479304"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479305"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479306"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479307"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479308"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479309"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479310"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479311"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479312"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479313"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479314"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479315"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479316"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479317"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479318"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479319"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Spada 2013:23566438}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479320"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479321"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479322"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479323"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Dubrovsky 2013:23463700}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479324"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Pardo 2015:25911022}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479325"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479326"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479327"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Spada 2013:23566438}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479328"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479329"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Tecellioglu 2015:26622091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479330"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479331"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Stepien 2016:26873529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479332"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479333"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479334"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479335"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479336"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01940"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000479337"	"1"	"90"	"17"	"78078352"	"78078352"	"subst"	"0"	"01940"	"GAA_000354"	"g.78078352A>G"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104553A>G"	""	"pathogenic (recessive)"	""
"0000479338"	"1"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479339"	"1"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479340"	"1"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479341"	"1"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479342"	"1"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000204"	"g.78078351C>A"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>A"	""	"pathogenic (recessive)"	""
"0000479343"	"1"	"70"	"17"	"78078351"	"78078351"	"subst"	"0"	"01940"	"GAA_000491"	"g.78078351C>G"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104552C>G"	""	"likely pathogenic"	""
"0000479344"	"1"	"50"	"17"	"78082133"	"78082133"	"subst"	"0"	"01940"	"GAA_000525"	"g.78082133G>A"	""	"{PMID:Manwaring 2012:21687968}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108334G>A"	""	"VUS"	""
"0000479345"	"1"	"90"	"17"	"78082195"	"78082195"	"subst"	"0"	"01940"	"GAA_000244"	"g.78082195C>G"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80108396C>G"	""	"pathogenic (recessive)"	""
"0000479346"	"1"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479347"	"1"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479348"	"1"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Loureiro Neves 2013:24016645}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479349"	"1"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479350"	"1"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000479351"	"1"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000479352"	"1"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01940"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000479353"	"1"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01940"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000479354"	"1"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01940"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000479355"	"1"	"90"	"17"	"78082266"	"78082266"	"subst"	"1.62881E-5"	"01940"	"GAA_000057"	"g.78082266T>G"	""	"{PMID:Adams 1997:9259196}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108467T>G"	""	"pathogenic (recessive)"	""
"0000479356"	"1"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01940"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Lam 2003:12601120}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	""
"0000479357"	"1"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01940"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	""
"0000479358"	"1"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01940"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	""
"0000479359"	"1"	"50"	"17"	"78082311"	"78082311"	"subst"	"0"	"01940"	"GAA_000531"	"g.78082311T>C"	""	"{PMID:Prater 2012:22538254}, {PMID:Prater 2013:23787031}, {PMID:Kishnani 2007:17151339}, {PMID:Palermo 2012:22658377}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80108512T>C"	""	"VUS"	""
"0000479360"	"1"	"90"	"17"	"78082313"	"78082313"	"subst"	"0"	"01940"	"GAA_000533"	"g.78082313G>A"	""	"{PMID:Cardone 2008:19046416}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108514G>A"	""	"pathogenic (recessive)"	""
"0000479361"	"1"	"50"	"17"	"78082336"	"78082336"	"subst"	"3.27624E-5"	"01940"	"GAA_000536"	"g.78082336G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80108537G>A"	""	"VUS"	""
"0000479362"	"1"	"90"	"17"	"78082340"	"78082341"	"delins"	"0"	"01940"	"GAA_000243"	"g.78082340_78082341delinsC"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108541_80108542delinsC"	""	"pathogenic (recessive)"	""
"0000479363"	"1"	"90"	"17"	"78082340"	"78082341"	"delins"	"0"	"01940"	"GAA_000243"	"g.78082340_78082341delinsC"	""	"{PMID:Messinger 2012:22237443}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108541_80108542delinsC"	""	"pathogenic (recessive)"	""
"0000479364"	"1"	"70"	"17"	"78082341"	"78082341"	"subst"	"8.19008E-6"	"01940"	"GAA_000150"	"g.78082341G>C"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108542G>C"	""	"likely pathogenic"	""
"0000479365"	"1"	"90"	"17"	"78082368"	"78082368"	"subst"	"0"	"01940"	"GAA_000538"	"g.78082368C>T"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108569C>T"	""	"pathogenic (recessive)"	""
"0000479366"	"1"	"90"	"17"	"78082377"	"78082377"	"del"	"0"	"01940"	"GAA_000540"	"g.78082377del"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108578del"	""	"pathogenic (recessive)"	""
"0000479367"	"1"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01940"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Sampaolo 2013:24107549}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000479368"	"1"	"90"	"17"	"78082408"	"78082408"	"subst"	"0"	"01940"	"GAA_000543"	"g.78082408T>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108609T>C"	""	"pathogenic (recessive)"	""
"0000479369"	"1"	"50"	"17"	"78082481"	"78082481"	"subst"	"0.000204713"	"01940"	"GAA_000547"	"g.78082481G>A"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108682G>A"	""	"VUS"	""
"0000479370"	"1"	"90"	"17"	"78082477"	"78090747"	"del"	"0"	"01940"	"GAA_000546"	"g.78082477_78090747del"	""	"{PMID:Huie 2002:11854868}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108678_80116948del"	""	"pathogenic (recessive)"	""
"0000479371"	"1"	"50"	"17"	"78082488"	"78082488"	"subst"	"0"	"01940"	"GAA_000548"	"g.78082488G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108689G>A"	""	"VUS"	""
"0000479372"	"1"	"50"	"17"	"78082488"	"78082488"	"subst"	"0"	"01940"	"GAA_000548"	"g.78082488G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108689G>A"	""	"VUS"	""
"0000479373"	"1"	"70"	"17"	"78082500"	"78082511"	"del"	"0"	"01940"	"GAA_000550"	"g.78082500_78082511del"	""	"{PMID:Chien 2015:25466677}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108701_80108712del"	""	"likely pathogenic"	""
"0000479374"	"1"	"70"	"17"	"78082500"	"78082511"	"del"	"0"	"01940"	"GAA_000550"	"g.78082500_78082511del"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80108701_80108712del"	""	"likely pathogenic"	""
"0000479375"	"1"	"70"	"17"	"78082503"	"78082503"	"subst"	"0"	"01940"	"GAA_000551"	"g.78082503A>G"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108704A>G"	""	"likely pathogenic"	""
"0000479376"	"1"	"50"	"17"	"78082511"	"78082511"	"subst"	"2.86982E-5"	"01940"	"GAA_000153"	"g.78082511G>A"	""	"{PMID:Amartino 2006:16433701}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108712G>A"	""	"VUS"	""
"0000479377"	"1"	"50"	"17"	"78082512"	"78082512"	"subst"	"0"	"01940"	"GAA_000552"	"g.78082512A>G"	""	"{PMID:Nilsson 2014:24384324}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108713A>G"	""	"VUS"	""
"0000479378"	"1"	"70"	"17"	"78082523"	"78082523"	"subst"	"8.20136E-6"	"01940"	"GAA_000102"	"g.78082523A>G"	""	"{PMID:Fernandez-Hojas 2002:11738358}, {PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108724A>G"	""	"likely pathogenic"	""
"0000479379"	"1"	"70"	"17"	"78082540"	"78082540"	"subst"	"0"	"01940"	"GAA_000554"	"g.78082540C>G"	""	"{PMID:Dlamini 2008:18434155}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108741C>G"	""	"likely pathogenic"	""
"0000479380"	"1"	"70"	"17"	"78082557"	"78082557"	"subst"	"0"	"01940"	"GAA_000555"	"g.78082557A>T"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108758A>T"	""	"likely pathogenic"	""
"0000479381"	"1"	"50"	"17"	"78082581"	"78082581"	"subst"	"0"	"01940"	"GAA_000556"	"g.78082581T>C"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108782T>C"	""	"VUS"	""
"0000479382"	"1"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Fujimoto 2013:24190153}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000479383"	"1"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000479384"	"1"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Ishigaki 2012:21704464}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000479385"	"1"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Nabatame 2009:18495398}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000479386"	"1"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000479387"	"1"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Kobayashi 2010:20202878}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000479388"	"1"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000479389"	"1"	"70"	"17"	"78082621"	"78082623"	"del"	"0"	"01940"	"GAA_000562"	"g.78082621_78082623del"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108822_80108824del"	""	"likely pathogenic"	""
"0000479390"	"1"	"90"	"17"	"78082623"	"78082636"	"del"	"0"	"01940"	"GAA_000563"	"g.78082623_78082636del"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108824_80108837del"	""	"pathogenic (recessive)"	""
"0000479391"	"1"	"50"	"17"	"78082625"	"78082625"	"subst"	"0"	"01940"	"GAA_000402"	"g.78082625G>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80108826G>A"	""	"VUS"	""
"0000479392"	"1"	"90"	"17"	"78082628"	"78082628"	"subst"	"0"	"01940"	"GAA_000078"	"g.78082628G>A"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108829G>A"	""	"pathogenic (recessive)"	""
"0000479393"	"1"	"90"	"17"	"78082628"	"78082628"	"subst"	"0"	"01940"	"GAA_000078"	"g.78082628G>A"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108829G>A"	""	"pathogenic (recessive)"	""
"0000479394"	"1"	"50"	"17"	"78083750"	"78083750"	"subst"	"0"	"01940"	"GAA_000154"	"g.78083750G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109951G>C"	""	"VUS"	""
"0000479395"	"1"	"90"	"17"	"78083773"	"78083773"	"del"	"0"	"01940"	"GAA_000567"	"g.78083773del"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109974del"	""	"pathogenic (recessive)"	""
"0000479396"	"1"	"70"	"17"	"78083781"	"78083781"	"subst"	"0"	"01940"	"GAA_000568"	"g.78083781A>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109982A>C"	""	"likely pathogenic"	""
"0000479397"	"1"	"70"	"17"	"78083781"	"78083781"	"subst"	"0"	"01940"	"GAA_000132"	"g.78083781A>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109982A>T"	""	"likely pathogenic"	""
"0000479398"	"1"	"70"	"17"	"78083802"	"78083802"	"subst"	"0"	"01940"	"GAA_000573"	"g.78083802T>C"	""	"{PMID:Hu 2015:25612604}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110003T>C"	""	"likely pathogenic"	""
"0000479399"	"1"	"90"	"17"	"78083813"	"78083813"	"del"	"0"	"01940"	"GAA_000246"	"g.78083813del"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110014del"	""	"pathogenic (recessive)"	""
"0000479400"	"1"	"90"	"17"	"78083813"	"78083813"	"del"	"0"	"01940"	"GAA_000246"	"g.78083813del"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110014del"	""	"pathogenic (recessive)"	""
"0000479401"	"1"	"70"	"17"	"78083813"	"78083813"	"subst"	"0"	"01940"	"GAA_000226"	"g.78083813G>T"	""	"{PMID:Yang 2014:24243590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110014G>T"	""	"likely pathogenic"	""
"0000479402"	"1"	"70"	"17"	"78083814"	"78083814"	"subst"	"0"	"01940"	"GAA_000574"	"g.78083814T>G"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110015T>G"	""	"likely pathogenic"	""
"0000479403"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479404"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Chien 2015:25466677}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479405"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Shieh 1996:8604985}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479406"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Shieh 1998:9554747}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479407"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479408"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479409"	"1"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Chien 2014:24706590}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000479410"	"1"	"90"	"17"	"78083856"	"78083856"	"subst"	"0"	"01940"	"GAA_000095"	"g.78083856T>C"	""	"{PMID:Stroppiano 2001:11343339}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110057T>C"	""	"pathogenic (recessive)"	""
"0000479411"	"1"	"70"	"17"	"78083854"	"78083854"	"subst"	"0"	"01940"	"GAA_000575"	"g.78083854G>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110055G>C"	""	"likely pathogenic"	""
"0000479412"	"1"	"90"	"17"	"78084544"	"78084556"	"del"	"0"	"01940"	"GAA_000031"	"g.78084544_78084556del"	""	"{PMID:Huie 1994:7981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110745_80110757del"	""	"pathogenic (recessive)"	""
"0000479413"	"1"	"70"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01940"	"GAA_000155"	"g.78084553G>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>A"	""	"likely pathogenic"	""
"0000479414"	"1"	"70"	"17"	"78084553"	"78084553"	"subst"	"0"	"01940"	"GAA_000585"	"g.78084553G>T"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>T"	""	"likely pathogenic"	""
"0000479415"	"1"	"90"	"17"	"78078533"	"78081588"	"del"	"0"	"01940"	"GAA_000446"	"g.78078533_78081588del"	""	"{PMID:Kishnani 2006:16860134}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80104734_80107789del"	""	"pathogenic (recessive)"	""
"0000479416"	"1"	"50"	"17"	"78084566"	"78084566"	"subst"	"1.2188E-5"	"01940"	"GAA_000587"	"g.78084566C>T"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110767C>T"	""	"VUS"	""
"0000479417"	"1"	"70"	"17"	"78084597"	"78084599"	"del"	"0"	"01940"	"GAA_000590"	"g.78084597_78084599del"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110798_80110800del"	""	"likely pathogenic"	""
"0000479418"	"1"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01940"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Stepien 2016:26873529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000479419"	"3"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000304"	"g.78084640G>A"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>A"	""	"pathogenic (recessive)"	""
"0000479420"	"1"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000479421"	"1"	"90"	"17"	"78084641"	"78084641"	"subst"	"0"	"01940"	"GAA_000593"	"g.78084641T>G"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110842T>G"	""	"pathogenic (recessive)"	""
"0000479422"	"1"	"50"	"17"	"78084642"	"78084645"	"del"	"0"	"01940"	"GAA_000594"	"g.78084642_78084645del"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110843_80110846del"	""	"VUS"	""
"0000479423"	"1"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01940"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	""
"0000479424"	"1"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01940"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	""
"0000479425"	"1"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01940"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	""
"0000479426"	"1"	"70"	"17"	"78084750"	"78084750"	"subst"	"4.06161E-6"	"01940"	"GAA_000597"	"g.78084750A>T"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110951A>T"	""	"likely pathogenic"	""
"0000479427"	"1"	"70"	"17"	"78084750"	"78084750"	"subst"	"4.06161E-6"	"01940"	"GAA_000597"	"g.78084750A>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110951A>T"	""	"likely pathogenic"	""
"0000479428"	"1"	"70"	"17"	"78084752"	"78084752"	"subst"	"0"	"01940"	"GAA_000598"	"g.78084752C>G"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110953C>G"	""	"likely pathogenic"	""
"0000479429"	"1"	"70"	"17"	"78084762"	"78084762"	"subst"	"0"	"01940"	"GAA_000229"	"g.78084762T>A"	""	"{PMID:Labrousse 2010:20080426}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110963T>A"	""	"likely pathogenic"	""
"0000479430"	"1"	"70"	"17"	"78084762"	"78084762"	"subst"	"0"	"01940"	"GAA_000229"	"g.78084762T>A"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110963T>A"	""	"likely pathogenic"	""
"0000479431"	"1"	"70"	"17"	"78084773"	"78084774"	"del"	"0"	"01940"	"GAA_000054"	"g.78084773_78084774delinsGT"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110974_80110975delinsGT"	""	"likely pathogenic"	""
"0000479432"	"1"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Korpela 2009:19472353}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000479433"	"1"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000479434"	"1"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000479435"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479436"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479437"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479438"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479439"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479440"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479441"	"1"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479442"	"1"	"70"	"17"	"78085814"	"78085814"	"subst"	"0"	"01940"	"GAA_000238"	"g.78085814A>T"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112015A>T"	""	"likely pathogenic"	""
"0000479443"	"1"	"70"	"17"	"78085848"	"78085848"	"subst"	"0"	"01940"	"GAA_000610"	"g.78085848A>T"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112049A>T"	""	"likely pathogenic"	""
"0000479444"	"1"	"70"	"17"	"78085855"	"78085855"	"subst"	"0"	"01940"	"GAA_000613"	"g.78085855C>G"	""	"{PMID:Palermo 2012:22658377}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112056C>G"	""	"likely pathogenic"	""
"0000479445"	"1"	"70"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"01940"	"GAA_000137"	"g.78085880G>A"	""	"{PMID:Ishigaki 2012:21676566}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112081G>A"	""	"likely pathogenic"	""
"0000479446"	"1"	"70"	"17"	"78085893"	"78085893"	"subst"	"0"	"01940"	"GAA_000619"	"g.78085893C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112094C>T"	""	"likely pathogenic"	""
"0000479447"	"1"	"50"	"17"	"78085899"	"78085899"	"subst"	"1.21935E-5"	"01940"	"GAA_000212"	"g.78085899G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112100G>A"	""	"VUS"	""
"0000479448"	"1"	"50"	"17"	"78086382"	"78086382"	"subst"	"0"	"01940"	"GAA_000624"	"g.78086382T>C"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112583T>C"	""	"VUS"	""
"0000479449"	"1"	"70"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"01940"	"GAA_000216"	"g.78086403G>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112604G>C"	""	"likely pathogenic"	""
"0000479450"	"1"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000479451"	"1"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Broomfield 2016:26497565}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000479452"	"1"	"70"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"01940"	"GAA_000081"	"g.78086421G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112622G>A"	""	"likely pathogenic"	""
"0000479453"	"1"	"70"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"01940"	"GAA_000081"	"g.78086421G>A"	""	"{PMID:Van den Hout 2004:15121988}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112622G>A"	""	"likely pathogenic"	""
"0000479454"	"1"	"50"	"17"	"78086421"	"78086421"	"subst"	"0"	"01940"	"GAA_000627"	"g.78086421G>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112622G>T"	""	"VUS"	""
"0000479455"	"1"	"90"	"17"	"78078403"	"78078410"	"del"	"0"	"01940"	"GAA_000358"	"g.78078403_78078410del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104604_80104611del"	""	"pathogenic (recessive)"	""
"0000479456"	"1"	"50"	"17"	"78086436"	"78086436"	"subst"	"0"	"01940"	"GAA_000630"	"g.78086436G>A"	""	"{PMID:Muraoka 2011:22185990}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112637G>A"	""	"VUS"	""
"0000479457"	"1"	"70"	"17"	"78086451"	"78086451"	"subst"	"0"	"01940"	"GAA_000201"	"g.78086451C>T"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112652C>T"	""	"likely pathogenic"	""
"0000479458"	"1"	"70"	"17"	"78086451"	"78086451"	"subst"	"0"	"01940"	"GAA_000201"	"g.78086451C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112652C>T"	""	"likely pathogenic"	""
"0000479459"	"1"	"70"	"17"	"78086456"	"78086456"	"subst"	"0"	"01940"	"GAA_000634"	"g.78086456C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112657C>T"	""	"likely pathogenic"	""
"0000479460"	"1"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479461"	"1"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479462"	"1"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479463"	"1"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479464"	"1"	"70"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"01940"	"GAA_000159"	"g.78086478G>A"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112679G>A"	""	"likely pathogenic"	""
"0000479465"	"1"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01940"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Park 2006:17092519}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	""
"0000479466"	"1"	"70"	"17"	"78086691"	"78086691"	"subst"	"0"	"01940"	"GAA_000360"	"g.78086691C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112892C>A"	""	"likely pathogenic"	""
"0000479467"	"1"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479468"	"1"	"50"	"17"	"78086710"	"78086710"	"subst"	"0"	"01940"	"GAA_000645"	"g.78086710G>T"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112911G>T"	""	"VUS"	""
"0000479469"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Khan 2013:23430500}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479470"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479471"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Hermans 1993:8401535}, {PMID:Trend 1985:3865697}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479472"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479473"	"1"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479474"	"1"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479475"	"1"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Kroos 2004:15145338}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479476"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479477"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479478"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Shieh 1998:9554747}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479479"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479480"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2015:25466677}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479481"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479482"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479483"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479484"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479485"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Yang 2016:26685070}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479486"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Yang 2014:24243590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479487"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479488"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479489"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Hermans 1993:8094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479490"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479491"	"1"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2015:25466677}, {PMID:Chien 2009:19948615}, {PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479492"	"1"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Huie 1994:7981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479493"	"1"	"50"	"17"	"78086798"	"78086798"	"subst"	"0"	"01940"	"GAA_000163"	"g.78086798T>G"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112999T>G"	""	"VUS"	""
"0000479494"	"1"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000479495"	"1"	"70"	"17"	"78087080"	"78087080"	"subst"	"0"	"01940"	"GAA_000143"	"g.78087080C>T"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113281C>T"	""	"likely pathogenic"	""
"0000479496"	"1"	"70"	"17"	"78087081"	"78087081"	"subst"	"0"	"01940"	"GAA_000666"	"g.78087081G>T"	""	"{PMID:Stenger 2015:26167453}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113282G>T"	""	"likely pathogenic"	""
"0000479497"	"1"	"50"	"17"	"78087108"	"78087108"	"subst"	"0.000101169"	"01940"	"GAA_000209"	"g.78087108C>G"	""	"{PMID:Qiu 2007:18211760}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113309C>G"	""	"VUS"	""
"0000479498"	"1"	"70"	"17"	"78090813"	"78090813"	"subst"	"0"	"01940"	"GAA_000423"	"g.78090813T>C"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117014T>C"	""	"likely pathogenic"	""
"0000479499"	"1"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479500"	"1"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479501"	"1"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479502"	"1"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479503"	"1"	"50"	"17"	"78090853"	"78090853"	"subst"	"0"	"01940"	"GAA_000686"	"g.78090853G>C"	""	"{PMID:Sampaolo 2013:24107549}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117054G>C"	""	"VUS"	""
"0000479504"	"1"	"90"	"17"	"78078621"	"78078631"	"del"	"0"	"01940"	"GAA_000240"	"g.78078621_78078631del"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104822_80104832del"	""	"pathogenic (recessive)"	""
"0000479505"	"1"	"90"	"17"	"78078626"	"78078626"	"subst"	"0"	"01940"	"GAA_000448"	"g.78078626C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104827C>T"	""	"pathogenic (recessive)"	""
"0000479506"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479507"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479508"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479509"	"1"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Boerkoel 1995:7717400}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479510"	"1"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"01940"	"GAA_000241"	"g.78092011_78092012del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic (recessive)"	""
"0000479511"	"1"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Becker 1998:9529346}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479512"	"1"	"90"	"17"	"78078656"	"78078656"	"del"	"0"	"01940"	"GAA_000061"	"g.78078656del"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857del"	""	"pathogenic (recessive)"	""
"0000479513"	"1"	"70"	"17"	"78078387"	"78078387"	"subst"	"0"	"01940"	"GAA_000356"	"g.78078387T>C"	""	"{PMID:Yang 2011:21757382}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80104588T>C"	""	"likely pathogenic"	""
"0000479514"	"1"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	""
"0000479515"	"1"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	""
"0000479516"	"1"	"50"	"17"	"78078708"	"78078708"	"subst"	"0"	"01940"	"GAA_000451"	"g.78078708G>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104909G>A"	""	"VUS"	""
"0000479517"	"1"	"90"	"17"	"78078728"	"78078728"	"subst"	"0"	"01940"	"GAA_000254"	"g.78078728C>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104929C>T"	""	"pathogenic (recessive)"	""
"0000479518"	"1"	"90"	"17"	"78078728"	"78078728"	"subst"	"0"	"01940"	"GAA_000254"	"g.78078728C>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104929C>T"	""	"pathogenic (recessive)"	""
"0000479519"	"1"	"50"	"17"	"78078749"	"78078749"	"subst"	"0"	"01940"	"GAA_000255"	"g.78078749A>G"	""	"{PMID:Rozdzynska-Swiatkowska 2016:26253708}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104950A>G"	""	"VUS"	""
"0000479520"	"1"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01940"	"GAA_000242"	"g.78078762G>A"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic (recessive)"	""
"0000479521"	"1"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01940"	"GAA_000242"	"g.78078762G>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic (recessive)"	""
"0000479522"	"1"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01940"	"GAA_000242"	"g.78078762G>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic (recessive)"	""
"0000479523"	"1"	"90"	"17"	"78078763"	"78078763"	"subst"	"0"	"01940"	"GAA_000453"	"g.78078763G>A"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104964G>A"	""	"pathogenic (recessive)"	""
"0000479524"	"1"	"90"	"17"	"78078764"	"78078765"	"del"	"0"	"01940"	"GAA_000062"	"g.78078764_78078765del"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104965_80104966del"	""	"pathogenic (recessive)"	""
"0000479525"	"1"	"50"	"17"	"78078765"	"78078765"	"subst"	"0"	"01940"	"GAA_000256"	"g.78078765G>T"	""	"{PMID:Loureiro Neves 2013:24016645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104966G>T"	""	"VUS"	""
"0000479526"	"1"	"90"	"17"	"78078388"	"78078388"	"subst"	"4.11556E-6"	"01940"	"GAA_000357"	"g.78078388G>A"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104589G>A"	""	"pathogenic (recessive)"	""
"0000479527"	"1"	"50"	"17"	"78078806"	"78078806"	"subst"	"0"	"01940"	"GAA_000454"	"g.78078806C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105007C>A"	""	"VUS"	""
"0000479528"	"1"	"90"	"17"	"78078809"	"78078825"	"del"	"0"	"01940"	"GAA_000455"	"g.78078809_78078825del"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80105010_80105026del"	""	"pathogenic (recessive)"	""
"0000479529"	"1"	"90"	"17"	"78078809"	"78078825"	"del"	"0"	"01940"	"GAA_000455"	"g.78078809_78078825del"	""	"{PMID:Labrousse 2010:20080426}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80105010_80105026del"	""	"pathogenic (recessive)"	""
"0000479530"	"1"	"90"	"17"	"78078829"	"78078829"	"subst"	"0"	"01940"	"GAA_000456"	"g.78078829C>G"	""	"{PMID:Fu Liong 2014:25093132}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105030C>G"	""	"pathogenic (recessive)"	""
"0000479531"	"1"	"50"	"17"	"78078846"	"78078846"	"subst"	"0"	"01940"	"GAA_000459"	"g.78078846G>C"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105047G>C"	""	"VUS"	""
"0000479532"	"1"	"70"	"17"	"78078888"	"78078888"	"subst"	"0.000121725"	"01940"	"GAA_000232"	"g.78078888G>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105089G>A"	""	"likely pathogenic"	""
"0000479533"	"1"	"70"	"17"	"78078888"	"78078888"	"subst"	"0.000121725"	"01940"	"GAA_000232"	"g.78078888G>A"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105089G>A"	""	"likely pathogenic"	""
"0000479534"	"1"	"70"	"17"	"78078888"	"78078888"	"subst"	"0"	"01940"	"GAA_000462"	"g.78078888G>C"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105089G>C"	""	"likely pathogenic"	""
"0000479535"	"1"	"70"	"17"	"78078888"	"78078888"	"subst"	"0"	"01940"	"GAA_000462"	"g.78078888G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105089G>C"	""	"likely pathogenic"	""
"0000479536"	"1"	"50"	"17"	"78078891"	"78078891"	"subst"	"0"	"01940"	"GAA_000463"	"g.78078891T>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105092T>C"	""	"VUS"	""
"0000479537"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Van den Hout 2004:15121988}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479538"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"<a href=\'http://raredisorders.imedpub.com/muscle-mri-in-classic-infantilepompe-disease.php?aid=6697\'>Wens 2015</a>"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479539"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479540"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479541"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Messinger 2012:22237443}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479542"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479543"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 1994:7881422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479544"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Huie 1999:10377006}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479545"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479546"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479547"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Manwaring 2012:21687968}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479548"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479549"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479550"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Swarr 2012:23430912}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479551"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Kindel 2012:22555271}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479552"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479553"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479554"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Banugaria 2013:23825616}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479555"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479556"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479557"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479558"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479559"	"1"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479560"	"1"	"90"	"17"	"78078933"	"78078936"	"del"	"0"	"01940"	"GAA_000470"	"g.78078933_78078936del"	""	"{PMID:Khallaf 2013:23430560}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105134_80105137del"	""	"pathogenic (recessive)"	""
"0000479561"	"1"	"50"	"17"	"78078936"	"78078936"	"subst"	"3.89176E-5"	"01940"	"GAA_000471"	"g.78078936G>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105137G>T"	""	"VUS"	""
"0000479562"	"1"	"70"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"01940"	"GAA_000123"	"g.78078931G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>A"	""	"likely pathogenic"	""
"0000479563"	"1"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"01940"	"GAA_000466"	"g.78078931G>T"	""	"{PMID:Kobayashi 2010:20202878}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>T"	""	"pathogenic (recessive)"	""
"0000479564"	"1"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"01940"	"GAA_000466"	"g.78078931G>T"	""	"{PMID:Maimaiti 2009:19609281}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>T"	""	"pathogenic (recessive)"	""
"0000479565"	"1"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"01940"	"GAA_000466"	"g.78078931G>T"	""	"{PMID:Park 2015:25388776}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>T"	""	"pathogenic (recessive)"	""
"0000479566"	"1"	"50"	"17"	"78079509"	"78079509"	"subst"	"0.669225"	"01940"	"GAA_000474"	"g.78079509T>G"	""	"{PMID:Guevara-Campos 2013:24008937}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105710T>G"	""	"VUS"	""
"0000479567"	"1"	"50"	"17"	"78079570"	"78079570"	"subst"	"1.63475E-5"	"01940"	"GAA_000475"	"g.78079570G>A"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105771G>A"	""	"VUS"	""
"0000479568"	"1"	"90"	"17"	"78079574"	"78079574"	"subst"	"4.0858E-6"	"01940"	"GAA_000098"	"g.78079574C>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105775C>A"	""	"pathogenic (recessive)"	""
"0000479569"	"1"	"50"	"17"	"78079651"	"78079651"	"subst"	"0"	"01940"	"GAA_000478"	"g.78079651C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105852C>T"	""	"VUS"	""
"0000479570"	"1"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479571"	"1"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479572"	"1"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Bonnefoy 2008:18995995}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479573"	"1"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479574"	"1"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479575"	"1"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01940"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Zouheir Habbal 2013:23632174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	""
"0000479576"	"1"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01940"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	""
"0000479577"	"1"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01940"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	""
"0000479578"	"1"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01940"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Aykut 2014:25026126}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	""
"0000479579"	"1"	"90"	"17"	"78079694"	"78079694"	"subst"	"4.25268E-6"	"01940"	"GAA_000148"	"g.78079694G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105895G>C"	""	"pathogenic (recessive)"	""
"0000479580"	"1"	"90"	"17"	"78079698"	"78079698"	"subst"	"4.26294E-6"	"01940"	"GAA_000205"	"g.78079698G>T"	""	"{PMID:Nilsson 2014:24384324}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105899G>T"	""	"pathogenic (recessive)"	""
"0000479581"	"1"	"50"	"17"	"78081373"	"78081373"	"subst"	"2.03318E-5"	"01940"	"GAA_000483"	"g.78081373C>T"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107574C>T"	""	"VUS"	""
"0000479582"	"1"	"50"	"17"	"78081373"	"78081373"	"subst"	"2.03318E-5"	"01940"	"GAA_000483"	"g.78081373C>T"	""	"{PMID:Anneser 2005:15668445}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107574C>T"	""	"VUS"	""
"0000479583"	"1"	"90"	"17"	"78081379"	"78081379"	"del"	"0"	"01940"	"GAA_000125"	"g.78081379del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107580del"	""	"pathogenic (recessive)"	""
"0000479584"	"1"	"50"	"17"	"78081382"	"78081382"	"subst"	"0"	"01940"	"GAA_000146"	"g.78081382T>C"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107583T>C"	""	"VUS"	""
"0000479585"	"1"	"90"	"17"	"78081385"	"78081386"	"del"	"0"	"01940"	"GAA_000094"	"g.78081385_78081386del"	""	"{PMID:Kishnani 2010:19775921}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107586_80107587del"	""	"pathogenic (recessive)"	""
"0000479586"	"1"	"90"	"17"	"78081385"	"78081386"	"del"	"0"	"01940"	"GAA_000094"	"g.78081385_78081386del"	""	"{PMID:Banugaria 2012:22365055}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107586_80107587del"	""	"pathogenic (recessive)"	""
"0000479587"	"1"	"90"	"17"	"78081385"	"78081386"	"del"	"0"	"01940"	"GAA_000094"	"g.78081385_78081386del"	""	"{PMID:Kishnani 2010:19775921}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107586_80107587del"	""	"pathogenic (recessive)"	""
"0000479588"	"1"	"70"	"17"	"78081415"	"78081415"	"subst"	"0.000349525"	"01940"	"GAA_000210"	"g.78081415C>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107616C>T"	""	"likely pathogenic"	""
"0000479589"	"1"	"90"	"17"	"78081429"	"78081448"	"del"	"0"	"01940"	"GAA_000063"	"g.78081429_78081448delinsC"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107630_80107649delinsC"	""	"pathogenic (recessive)"	""
"0000479590"	"1"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479591"	"1"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479592"	"1"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479593"	"1"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479594"	"1"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479595"	"1"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479596"	"1"	"70"	"17"	"78081459"	"78081459"	"subst"	"0"	"01940"	"GAA_000230"	"g.78081459C>T"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107660C>T"	""	"likely pathogenic"	""
"0000479597"	"1"	"70"	"17"	"78081459"	"78081459"	"subst"	"0"	"01940"	"GAA_000230"	"g.78081459C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107660C>T"	""	"likely pathogenic"	""
"0000479598"	"1"	"70"	"17"	"78081459"	"78081459"	"subst"	"0"	"01940"	"GAA_000230"	"g.78081459C>T"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107660C>T"	""	"likely pathogenic"	""
"0000479599"	"1"	"70"	"17"	"78081459"	"78081459"	"subst"	"0"	"01940"	"GAA_000230"	"g.78081459C>T"	""	"{PMID:Park 2006:17092519}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107660C>T"	""	"likely pathogenic"	""
"0000479600"	"1"	"70"	"17"	"78081459"	"78081459"	"subst"	"0"	"01940"	"GAA_000230"	"g.78081459C>T"	""	"{PMID:Qiu 2007:18211760}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107660C>T"	""	"likely pathogenic"	""
"0000479601"	"1"	"90"	"17"	"78081490"	"78081508"	"del"	"0"	"01940"	"GAA_000506"	"g.78081490_78081508del"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107691_80107709del"	""	"pathogenic (recessive)"	""
"0000479602"	"1"	"90"	"17"	"78081492"	"78081514"	"del"	"0"	"01940"	"GAA_000507"	"g.78081492_78081514del"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107693_80107715del"	""	"pathogenic (recessive)"	""
"0000479603"	"1"	"50"	"17"	"78081516"	"78081516"	"subst"	"0"	"01940"	"GAA_000202"	"g.78081516C>T"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107717C>T"	""	"VUS"	""
"0000479604"	"1"	"50"	"17"	"78081516"	"78081516"	"subst"	"0"	"01940"	"GAA_000202"	"g.78081516C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107717C>T"	""	"VUS"	""
"0000479605"	"1"	"70"	"17"	"78081517"	"78081517"	"subst"	"5.17218E-6"	"01940"	"GAA_000101"	"g.78081517C>G"	""	"{PMID:Bodamer 2002:1221361815}, {PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107718C>G"	""	"likely pathogenic"	""
"0000479606"	"1"	"90"	"17"	"78081597"	"78081597"	"subst"	"0"	"01940"	"GAA_000515"	"g.78081597A>T"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107798A>T"	""	"pathogenic (recessive)"	""
"0000479607"	"1"	"50"	"17"	"78081601"	"78081601"	"subst"	"9.16277E-5"	"01940"	"GAA_000276"	"g.78081601C>T"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107802C>T"	""	"VUS"	""
"0000479608"	"1"	"50"	"17"	"78081611"	"78081611"	"subst"	"3.31738E-5"	"01940"	"GAA_000219"	"g.78081611C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107812C>T"	""	"VUS"	""
"0000479609"	"1"	"70"	"17"	"78081612"	"78081612"	"subst"	"0"	"01940"	"GAA_000220"	"g.78081612T>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107813T>C"	""	"likely pathogenic"	""
"0000479610"	"1"	"70"	"17"	"78081612"	"78081612"	"subst"	"0"	"01940"	"GAA_000220"	"g.78081612T>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107813T>C"	""	"likely pathogenic"	""
"0000479611"	"1"	"70"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01940"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"likely pathogenic"	""
"0000479612"	"1"	"70"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01940"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Castro-Gago 1999:10528311}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"likely pathogenic"	""
"0000479613"	"1"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000479614"	"1"	"50"	"17"	"78081625"	"78081625"	"subst"	"0"	"01940"	"GAA_000517"	"g.78081625C>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107826C>G"	""	"VUS"	""
"0000479615"	"1"	"50"	"17"	"78081633"	"78081633"	"subst"	"0"	"01940"	"GAA_000518"	"g.78081633A>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107834A>C"	""	"VUS"	""
"0000479616"	"1"	"50"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000039"	"g.78081636T>G"	""	"{PMID:Raben 1995:7603531}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>G"	""	"VUS"	""
"0000479617"	"1"	"70"	"17"	"78081663"	"78081663"	"subst"	"0"	"01940"	"GAA_000088"	"g.78081663A>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>T"	""	"likely pathogenic"	""
"0000479618"	"1"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Markic 2014:24337590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479619"	"1"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479620"	"1"	"50"	"17"	"78081693"	"78081693"	"subst"	"0"	"01940"	"GAA_000222"	"g.78081693T>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107894T>A"	""	"VUS"	""
"0000479621"	"1"	"70"	"17"	"78081694"	"78081695"	"ins"	"0"	"01940"	"GAA_000488"	"g.78081694_78081695insN[21]"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000479622"	"1"	"50"	"17"	"78082104"	"78082104"	"subst"	"8.12585E-6"	"01940"	"GAA_000089"	"g.78082104C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108305C>T"	""	"VUS"	""
"0000479623"	"1"	"50"	"17"	"78082121"	"78082121"	"subst"	"0"	"01940"	"GAA_000149"	"g.78082121T>G"	""	"{PMID:Dou 2006:16782080}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108322T>G"	""	"VUS"	""
"0000479624"	"1"	"90"	"17"	"78082122"	"78082122"	"subst"	"0"	"01940"	"GAA_000112"	"g.78082122G>A"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108323G>A"	""	"pathogenic (recessive)"	""
"0000479625"	"1"	"50"	"17"	"78082131"	"78082131"	"subst"	"0"	"01940"	"GAA_000524"	"g.78082131C>A"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108332C>A"	""	"VUS"	""
"0000479626"	"1"	"90"	"17"	"78056048"	"78094853"	"del"	"0"	"01940"	"GAA_000489"	"g.78056048_78094853delinsTGTGGTGGCTCATG"	""	"{PMID:Aminoso 2013:23402890}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80082249_80121054delinsTGTGGTGGCTCATG"	""	"pathogenic (recessive)"	""
"0000479627"	"1"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479628"	"1"	"70"	"17"	"78081415"	"78081415"	"subst"	"0.000349525"	"01940"	"GAA_000210"	"g.78081415C>T"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80107616C>T"	""	"likely pathogenic"	""
"0000479629"	"1"	"70"	"17"	"78081415"	"78081415"	"subst"	"0.000349525"	"01940"	"GAA_000210"	"g.78081415C>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107616C>T"	""	"likely pathogenic"	""
"0000479630"	"2"	"50"	"17"	"78082136"	"78082136"	"subst"	"4.06299E-6"	"01940"	"GAA_000218"	"g.78082136G>A"	""	"{PMID:Andreassen 2014:24685124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108337G>A"	""	"VUS"	""
"0000479631"	"2"	"50"	"17"	"78082181"	"78082181"	"subst"	"0.000105675"	"01940"	"GAA_000526"	"g.78082181G>A"	""	"{PMID:Quenardelle 2015:25451853}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108382G>A"	""	"VUS"	""
"0000479632"	"2"	"50"	"17"	"78082181"	"78082181"	"subst"	"0.000105675"	"01940"	"GAA_000526"	"g.78082181G>A"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108382G>A"	""	"VUS"	""
"0000479633"	"2"	"90"	"17"	"78082184"	"78082184"	"del"	"0"	"01940"	"GAA_000245"	"g.78082184del"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108385del"	""	"pathogenic (recessive)"	""
"0000479634"	"2"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000479635"	"2"	"70"	"17"	"78082208"	"78082208"	"subst"	"0"	"01940"	"GAA_000527"	"g.78082208G>A"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108409G>A"	""	"likely pathogenic"	""
"0000479636"	"2"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000529"	"g.78082287G>A"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>A"	""	"pathogenic (recessive)"	""
"0000479637"	"2"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000479638"	"2"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000479639"	"2"	"90"	"17"	"78082312"	"78082312"	"subst"	"4.08327E-6"	"01940"	"GAA_000532"	"g.78082312G>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108513G>A"	""	"pathogenic (recessive)"	""
"0000479640"	"2"	"50"	"17"	"78082327"	"78082327"	"subst"	"0"	"01940"	"GAA_000287"	"g.78082327A>T"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108528A>T"	""	"VUS"	""
"0000479641"	"2"	"90"	"17"	"78082355"	"78082355"	"del"	"0"	"01940"	"GAA_000394"	"g.78082355del"	""	"{PMID:Horvath 2015:25155446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108556del"	""	"pathogenic (recessive)"	""
"0000479642"	"2"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01940"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000479643"	"2"	"90"	"17"	"78078503"	"78078503"	"subst"	"1.22774E-5"	"01940"	"GAA_000056"	"g.78078503C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104704C>T"	""	"pathogenic (recessive)"	""
"0000479644"	"2"	"90"	"17"	"78082404"	"78082404"	"dup"	"0"	"01940"	"GAA_000542"	"g.78082404dup"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108605dup"	""	"pathogenic (recessive)"	""
"0000479645"	"2"	"90"	"17"	"78082408"	"78082408"	"subst"	"0"	"01940"	"GAA_000152"	"g.78082408T>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108609T>A"	""	"pathogenic (recessive)"	""
"0000479646"	"2"	"50"	"17"	"78082511"	"78082511"	"subst"	"2.86982E-5"	"01940"	"GAA_000153"	"g.78082511G>A"	""	"{PMID:Amartino 2006:16433701}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108712G>A"	""	"VUS"	""
"0000479647"	"2"	"70"	"17"	"78082592"	"78082600"	"del"	"0"	"01940"	"GAA_000558"	"g.78082592_78082600del"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108793_80108801del"	""	"likely pathogenic"	""
"0000479648"	"2"	"90"	"17"	"78082594"	"78082613"	"del"	"0"	"01940"	"GAA_000559"	"g.78082594_78082613del"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108795_80108814del"	""	"pathogenic (recessive)"	""
"0000479649"	"2"	"50"	"17"	"78082598"	"78082598"	"subst"	"0"	"01940"	"GAA_000560"	"g.78082598C>A"	""	"{PMID:Ravaglia 2012:22704482}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108799C>A"	""	"VUS"	""
"0000479650"	"2"	"50"	"17"	"78082598"	"78082598"	"subst"	"0"	"01940"	"GAA_000560"	"g.78082598C>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108799C>A"	""	"VUS"	""
"0000479651"	"2"	"70"	"17"	"78083748"	"78083748"	"subst"	"0"	"01940"	"GAA_000565"	"g.78083748C>G"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109949C>G"	""	"likely pathogenic"	""
"0000479652"	"2"	"90"	"17"	"78083788"	"78083788"	"del"	"0"	"01940"	"GAA_000569"	"g.78083788del"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109989del"	""	"pathogenic (recessive)"	""
"0000479653"	"2"	"90"	"17"	"78083813"	"78083813"	"del"	"0"	"01940"	"GAA_000246"	"g.78083813del"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110014del"	""	"pathogenic (recessive)"	""
"0000479654"	"2"	"70"	"17"	"78083849"	"78083849"	"subst"	"4.08881E-6"	"01940"	"GAA_000041"	"g.78083849G>A"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110050G>A"	""	"likely pathogenic"	""
"0000479655"	"2"	"90"	"17"	"78083856"	"78083856"	"subst"	"0"	"01940"	"GAA_000095"	"g.78083856T>C"	""	"{PMID:Horvath 2015:25155446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110057T>C"	""	"pathogenic (recessive)"	""
"0000479656"	"2"	"90"	"17"	"78083856"	"78083856"	"subst"	"0"	"01940"	"GAA_000095"	"g.78083856T>C"	""	"{PMID:Hobson-Webb 2015:25835646}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110057T>C"	""	"pathogenic (recessive)"	""
"0000479657"	"2"	"90"	"17"	"78084525"	"78084525"	"subst"	"0"	"01940"	"GAA_000096"	"g.78084525G>C"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110726G>C"	""	"pathogenic (recessive)"	""
"0000479658"	"2"	"90"	"17"	"78084524"	"78084524"	"subst"	"0"	"01940"	"GAA_000578"	"g.78084524A>G"	""	"{PMID:Musumeci 2016:25783438}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110725A>G"	""	"pathogenic (recessive)"	""
"0000479659"	"2"	"70"	"17"	"78084529"	"78084529"	"subst"	"1.62624E-5"	"01940"	"GAA_000080"	"g.78084529T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110730T>C"	""	"likely pathogenic"	""
"0000479660"	"2"	"70"	"17"	"78084544"	"78084544"	"subst"	"0"	"01940"	"GAA_000213"	"g.78084544G>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110745G>C"	""	"likely pathogenic"	""
"0000479661"	"2"	"70"	"17"	"78084548"	"78084548"	"subst"	"0"	"01940"	"GAA_000584"	"g.78084548T>C"	""	"{PMID:Musumeci 2012:22958975}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110749T>C"	""	"likely pathogenic"	""
"0000479662"	"2"	"70"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01940"	"GAA_000155"	"g.78084553G>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>A"	""	"likely pathogenic"	""
"0000479663"	"2"	"70"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01940"	"GAA_000155"	"g.78084553G>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>A"	""	"likely pathogenic"	""
"0000479664"	"2"	"50"	"17"	"78084583"	"78084583"	"subst"	"0"	"01940"	"GAA_000588"	"g.78084583T>A"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110784T>A"	""	"VUS"	""
"0000479665"	"2"	"50"	"17"	"78084583"	"78084583"	"subst"	"0"	"01940"	"GAA_000588"	"g.78084583T>A"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110784T>A"	""	"VUS"	""
"0000479666"	"2"	"50"	"17"	"78084592"	"78084592"	"subst"	"4.87496E-5"	"01940"	"GAA_000409"	"g.78084592A>G"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110793A>G"	""	"VUS"	""
"0000479667"	"2"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01940"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Horvath 2015:25155446}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000479668"	"2"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01940"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000479669"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000479670"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Huie 1994:7881425}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000479671"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"8.12572E-6"	"01940"	"GAA_000305"	"g.78084640G>T"	""	"{PMID:Gesquiere-Dando 2015:25703594}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>T"	""	"pathogenic (recessive)"	""
"0000479672"	"2"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01940"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	""
"0000479673"	"2"	"70"	"17"	"78084749"	"78084749"	"subst"	"4.06184E-6"	"01940"	"GAA_000017"	"g.78084749G>A"	""	"{PMID:Crescimanno 2015:25908581}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>A"	""	"likely pathogenic"	""
"0000479674"	"2"	"70"	"17"	"78084752"	"78084752"	"subst"	"0"	"01940"	"GAA_000599"	"g.78084752C>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110953C>A"	""	"likely pathogenic"	""
"0000479675"	"2"	"70"	"17"	"78084752"	"78084752"	"subst"	"0"	"01940"	"GAA_000598"	"g.78084752C>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110953C>G"	""	"likely pathogenic"	""
"0000479676"	"2"	"90"	"17"	"78084825"	"78084825"	"subst"	"0"	"01940"	"GAA_000603"	"g.78084825G>C"	""	"{PMID:Carlier 2011:21803581}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111026G>C"	""	"pathogenic (recessive)"	""
"0000479677"	"2"	"70"	"17"	"78084829"	"78084829"	"subst"	"0"	"01940"	"GAA_000604"	"g.78084829G>T"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111030G>T"	""	"likely pathogenic"	""
"0000479678"	"0"	"70"	"17"	"78085787"	"78085787"	"subst"	"0"	"01940"	"GAA_000606"	"g.78085787G>T"	""	"{PMID:Case 2008:18930676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111988G>T"	""	"likely pathogenic"	""
"0000479679"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479680"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479681"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479682"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479683"	"2"	"70"	"17"	"78085818"	"78085818"	"subst"	"0"	"01940"	"GAA_000170"	"g.78085818G>C"	""	"{PMID:Alcantara-Ortigoza 2010:20350966}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112019G>C"	""	"likely pathogenic"	""
"0000479684"	"2"	"90"	"17"	"78085839"	"78085842"	"del"	"0"	"01940"	"GAA_000239"	"g.78085839_78085842del"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112040_80112043del"	""	"pathogenic (recessive)"	""
"0000479685"	"2"	"90"	"17"	"78085839"	"78085842"	"del"	"0"	"01940"	"GAA_000239"	"g.78085839_78085842del"	""	"{PMID:Ravaglia 2012:22704482}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112040_80112043del"	""	"pathogenic (recessive)"	""
"0000479686"	"2"	"90"	"17"	"78085839"	"78085842"	"del"	"0"	"01940"	"GAA_000239"	"g.78085839_78085842del"	""	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112040_80112043del"	""	"pathogenic (recessive)"	""
"0000479687"	"2"	"50"	"17"	"78085869"	"78085869"	"subst"	"0"	"01940"	"GAA_000136"	"g.78085869A>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112070A>C"	""	"VUS"	""
"0000479688"	"2"	"50"	"17"	"78085899"	"78085899"	"subst"	"0"	"01940"	"GAA_000091"	"g.78085899G>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112100G>T"	""	"VUS"	""
"0000479689"	"2"	"90"	"17"	"78086376"	"78086376"	"subst"	"0"	"01940"	"GAA_000623"	"g.78086376G>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112577G>A"	""	"pathogenic (recessive)"	""
"0000479690"	"2"	"90"	"17"	"78086398"	"78086398"	"del"	"0"	"01940"	"GAA_000160"	"g.78086398del"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112599del"	""	"pathogenic (recessive)"	""
"0000479691"	"2"	"50"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000412"	"g.78086424C>G"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112625C>G"	""	"VUS"	""
"0000479692"	"2"	"70"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000317"	"g.78086424C>T"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112625C>T"	""	"likely pathogenic"	""
"0000479693"	"2"	"70"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000317"	"g.78086424C>T"	""	"{PMID:Shin 2006:17027861}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112625C>T"	""	"likely pathogenic"	""
"0000479694"	"2"	"70"	"17"	"78086441"	"78086458"	"del"	"0"	"01940"	"GAA_000093"	"g.78086441_78086458del"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112642_80112659del"	""	"likely pathogenic"	""
"0000479695"	"2"	"90"	"17"	"78086448"	"78086448"	"dup"	"0"	"01940"	"GAA_000139"	"g.78086448dup"	""	"{PMID:Bandyopadhyay 2015:25846667}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112649dup"	""	"pathogenic (recessive)"	""
"0000479696"	"2"	"90"	"17"	"78086449"	"78086449"	"del"	"3.32928E-5"	"01940"	"GAA_000140"	"g.78086449del"	""	"{PMID:Hofstra 2004:14695533}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112650del"	""	"pathogenic (recessive)"	""
"0000479697"	"2"	"70"	"17"	"78086455"	"78086469"	"del"	"0"	"01940"	"GAA_000490"	"g.78086455_78086469delinsACGGGGTAT"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112656_80112670delinsACGGGGTAT"	""	"likely pathogenic"	""
"0000479698"	"2"	"50"	"17"	"78086458"	"78086458"	"subst"	"4.13846E-6"	"01940"	"GAA_000162"	"g.78086458C>G"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112659C>G"	""	"VUS"	""
"0000479699"	"2"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479700"	"2"	"90"	"17"	"78086511"	"78086511"	"subst"	"0"	"01940"	"GAA_000640"	"g.78086511G>A"	""	"{PMID:Carlier 2011:21803581}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112712G>A"	""	"pathogenic (recessive)"	""
"0000479701"	"2"	"90"	"17"	"78086511"	"78086511"	"subst"	"0"	"01940"	"GAA_000640"	"g.78086511G>A"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112712G>A"	""	"pathogenic (recessive)"	""
"0000479702"	"2"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479703"	"2"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479704"	"2"	"70"	"17"	"78086699"	"78086699"	"subst"	"0"	"01940"	"GAA_000322"	"g.78086699G>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112900G>T"	""	"likely pathogenic"	""
"0000479705"	"2"	"50"	"17"	"78086707"	"78086707"	"subst"	"0"	"01940"	"GAA_000643"	"g.78086707C>G"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112908C>G"	""	"VUS"	""
"0000479706"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479707"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479708"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479709"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479710"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479711"	"2"	"70"	"17"	"78086719"	"78086719"	"subst"	"8.39786E-6"	"01940"	"GAA_000323"	"g.78086719G>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>T"	""	"likely pathogenic"	""
"0000479712"	"2"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479713"	"2"	"70"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01940"	"GAA_000067"	"g.78086728G>A"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112929G>A"	""	"likely pathogenic"	""
"0000479714"	"2"	"70"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01940"	"GAA_000067"	"g.78086728G>A"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112929G>A"	""	"likely pathogenic"	""
"0000479715"	"2"	"70"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01940"	"GAA_000067"	"g.78086728G>A"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112929G>A"	""	"likely pathogenic"	""
"0000479716"	"2"	"70"	"17"	"78086729"	"78086729"	"subst"	"0"	"01940"	"GAA_000324"	"g.78086729G>A"	""	"{PMID:Terzis 2012:23146291}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112930G>A"	""	"likely pathogenic"	""
"0000479717"	"2"	"70"	"17"	"78086729"	"78086729"	"subst"	"0"	"01940"	"GAA_000324"	"g.78086729G>A"	""	"{PMID:Papadimas 2012:23843830}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112930G>A"	""	"likely pathogenic"	""
"0000479718"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000479719"	"2"	"90"	"17"	"78087016"	"78087016"	"subst"	"0"	"01940"	"GAA_000233"	"g.78087016G>A"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113217G>A"	""	"pathogenic (recessive)"	""
"0000479720"	"2"	"90"	"17"	"78087031"	"78087031"	"subst"	"0"	"01940"	"GAA_000662"	"g.78087031C>A"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113232C>A"	""	"pathogenic (recessive)"	""
"0000479721"	"2"	"90"	"17"	"78087042"	"78087046"	"dup"	"0"	"01940"	"GAA_000164"	"g.78087042_78087046dup"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113243_80113247dup"	""	"pathogenic (recessive)"	""
"0000479722"	"2"	"70"	"17"	"78087080"	"78087080"	"subst"	"0"	"01940"	"GAA_000143"	"g.78087080C>T"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113281C>T"	""	"likely pathogenic"	""
"0000479723"	"2"	"70"	"17"	"78087080"	"78087080"	"subst"	"0"	"01940"	"GAA_000143"	"g.78087080C>T"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113281C>T"	""	"likely pathogenic"	""
"0000479724"	"2"	"50"	"17"	"78087090"	"78087090"	"subst"	"0"	"01940"	"GAA_000667"	"g.78087090T>C"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113291T>C"	""	"VUS"	""
"0000479725"	"2"	"70"	"17"	"78087111"	"78087111"	"subst"	"0"	"01940"	"GAA_000330"	"g.78087111T>C"	""	"{PMID:Stepien 2016:26873529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113312T>C"	""	"likely pathogenic"	""
"0000479726"	"2"	"90"	"17"	"78087112"	"78087113"	"del"	"0"	"01940"	"GAA_000668"	"g.78087112_78087113del"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113313_80113314del"	""	"pathogenic (recessive)"	""
"0000479727"	"2"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01940"	"GAA_000023"	"g.78087149C>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	""
"0000479728"	"2"	"90"	"17"	"78090791"	"78090791"	"subst"	"4.06686E-6"	"01940"	"GAA_000680"	"g.78090791G>A"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80116992G>A"	""	"pathogenic (recessive)"	""
"0000479729"	"2"	"90"	"17"	"78090796"	"78090797"	"del"	"0"	"01940"	"GAA_000166"	"g.78090796_78090797del"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80116997_80116998del"	""	"pathogenic (recessive)"	""
"0000479730"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479731"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479732"	"2"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01940"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic (recessive)"	""
"0000479733"	"2"	"70"	"17"	"78090832"	"78090834"	"del"	"0"	"01940"	"GAA_000684"	"g.78090832_78090834del"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117033_80117035del"	""	"likely pathogenic"	""
"0000479734"	"2"	"90"	"17"	"78090846"	"78090846"	"subst"	"0"	"01940"	"GAA_000236"	"g.78090846C>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117047C>T"	""	"pathogenic (recessive)"	""
"0000479735"	"2"	"90"	"17"	"78090858"	"78090858"	"del"	"0"	"01940"	"GAA_000687"	"g.78090858delinsAT"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117059delinsAT"	""	"pathogenic (recessive)"	""
"0000479736"	"2"	"90"	"17"	"78090875"	"78090878"	"del"	"0"	"01940"	"GAA_000689"	"g.78090875_78090878delinsAAAGTA"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117076_80117079delinsAAAGTA"	""	"pathogenic (recessive)"	""
"0000479737"	"2"	"90"	"17"	"78090875"	"78090878"	"del"	"0"	"01940"	"GAA_000689"	"g.78090875_78090878delinsAAAGTA"	""	"{PMID:Ravaglia 2012:22704482}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117076_80117079delinsAAAGTA"	""	"pathogenic (recessive)"	""
"0000479738"	"2"	"70"	"17"	"78090891"	"78090891"	"subst"	"0"	"01940"	"GAA_000335"	"g.78090891T>C"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117092T>C"	""	"likely pathogenic"	""
"0000479739"	"2"	"90"	"17"	"78090899"	"78090900"	"ins"	"0"	"01940"	"GAA_000486"	"g.78090899_78090900insGGTGAGTCTGCAAACGGGGAGT"	""	"{PMID:El-Gharbawy 2011:21605996}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117100_80117101insGGTGAGTCTGCAAACGGGGAGT"	""	"pathogenic (recessive)"	""
"0000479740"	"2"	"90"	"17"	"78090909"	"78090909"	"subst"	"0"	"01940"	"GAA_000693"	"g.78090909G>A"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117110G>A"	""	"pathogenic (recessive)"	""
"0000479741"	"2"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"01940"	"GAA_000336"	"g.78090910T>A"	""	"{PMID:van Capelle 2016:27189384}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic (recessive)"	""
"0000479742"	"2"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"01940"	"GAA_000336"	"g.78090910T>A"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic (recessive)"	""
"0000479743"	"2"	"90"	"17"	"78091498"	"78091498"	"dup"	"0"	"01940"	"GAA_000059"	"g.78091498dup"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117699dup"	""	"pathogenic (recessive)"	""
"0000479744"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479745"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479746"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Boerkoel 1995:7717400}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479747"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Huie 1994:7881425}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479748"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479749"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479750"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479751"	"2"	"70"	"17"	"78092040"	"78092051"	"del"	"0"	"01940"	"GAA_000705"	"g.78092040_78092051del"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118241_80118252del"	""	"likely pathogenic"	""
"0000479752"	"2"	"70"	"17"	"78092040"	"78092051"	"del"	"0"	"01940"	"GAA_000705"	"g.78092040_78092051del"	""	"{PMID:Montagnese 2015:25673129}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118241_80118252del"	""	"likely pathogenic"	""
"0000479753"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479754"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479755"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479756"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479757"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"01940"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000479758"	"2"	"90"	"17"	"78078410"	"78078410"	"del"	"0"	"01940"	"GAA_000359"	"g.78078410del"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104611del"	""	"pathogenic (recessive)"	""
"0000479759"	"2"	"90"	"17"	"78092115"	"78092115"	"del"	"0"	"01940"	"GAA_000707"	"g.78092115del"	""	"{PMID:Angelini 2007:17470141}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118316del"	""	"pathogenic (recessive)"	""
"0000479760"	"2"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"01940"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000479761"	"2"	"90"	"17"	"78092158"	"78092159"	"del"	"0"	"01940"	"GAA_000168"	"g.78092158_78092159del"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118359_80118360del"	""	"pathogenic (recessive)"	""
"0000479762"	"2"	"50"	"17"	"78092432"	"78092432"	"subst"	"0"	"01940"	"GAA_000709"	"g.78092432T>G"	""	"{PMID:Wagner 2013:23062590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118633T>G"	""	"VUS"	""
"0000479763"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479764"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Kostera-Pruszczyk 2006:16531044}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479765"	"2"	"90"	"17"	"78078656"	"78078656"	"del"	"0"	"01940"	"GAA_000061"	"g.78078656del"	""	"{PMID:Vorgerd 1998:10737124}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857del"	""	"pathogenic (recessive)"	""
"0000479766"	"2"	"50"	"17"	"78092543"	"78092543"	"subst"	"0"	"01940"	"GAA_000712"	"g.78092543C>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118744C>G"	""	"VUS"	""
"0000479767"	"2"	"70"	"17"	"78092551"	"78092551"	"subst"	"0"	"01940"	"GAA_000351"	"g.78092551G>T"	""	"{PMID:Peric 2014:24338761}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118752G>T"	""	"likely pathogenic"	""
"0000479768"	"2"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	""
"0000479769"	"2"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	""
"0000479770"	"2"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	""
"0000479771"	"2"	"70"	"17"	"78078692"	"78078692"	"subst"	"0"	"01940"	"GAA_000119"	"g.78078692T>G"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104893T>G"	""	"likely pathogenic"	""
"0000479772"	"2"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01940"	"GAA_000242"	"g.78078762G>A"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic (recessive)"	""
"0000479773"	"2"	"90"	"17"	"78078764"	"78078765"	"del"	"0"	"01940"	"GAA_000062"	"g.78078764_78078765del"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104965_80104966del"	""	"pathogenic (recessive)"	""
"0000479774"	"2"	"70"	"17"	"78078846"	"78078854"	"del"	"0"	"01940"	"GAA_000460"	"g.78078846_78078854del"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105047_80105055del"	""	"likely pathogenic"	""
"0000479775"	"2"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"01940"	"GAA_000055"	"g.78078867_78078868del"	""	"{PMID:Nicolino 1997:9196050}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic (recessive)"	""
"0000479776"	"2"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"01940"	"GAA_000055"	"g.78078867_78078868del"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic (recessive)"	""
"0000479777"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Wokke 1995:7668832}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479778"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479779"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479780"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479781"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479782"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479783"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479784"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479785"	"2"	"90"	"17"	"78078932"	"78078932"	"subst"	"0"	"01940"	"GAA_000468"	"g.78078932G>T"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105133G>T"	""	"pathogenic (recessive)"	""
"0000479786"	"2"	"70"	"17"	"78078931"	"78078931"	"subst"	"8.61193E-6"	"01940"	"GAA_000467"	"g.78078931G>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>C"	""	"likely pathogenic"	""
"0000479787"	"2"	"50"	"17"	"78079624"	"78079624"	"subst"	"0"	"01940"	"GAA_000087"	"g.78079624T>C"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105825T>C"	""	"VUS"	""
"0000479788"	"2"	"90"	"17"	"78079635"	"78079635"	"subst"	"0"	"01940"	"GAA_000477"	"g.78079635G>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105836G>T"	""	"pathogenic (recessive)"	""
"0000479789"	"2"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479790"	"2"	"70"	"17"	"78079656"	"78079656"	"subst"	"0"	"01940"	"GAA_000099"	"g.78079656G>A"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105857G>A"	""	"likely pathogenic"	""
"0000479791"	"2"	"90"	"17"	"78079694"	"78079694"	"subst"	"4.25268E-6"	"01940"	"GAA_000148"	"g.78079694G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105895G>C"	""	"pathogenic (recessive)"	""
"0000479792"	"2"	"50"	"17"	"78081364"	"78081364"	"subst"	"0"	"01940"	"GAA_000482"	"g.78081364C>A"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107565C>A"	""	"VUS"	""
"0000479793"	"2"	"50"	"17"	"78081382"	"78081382"	"subst"	"0"	"01940"	"GAA_000146"	"g.78081382T>C"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107583T>C"	""	"VUS"	""
"0000479794"	"2"	"50"	"17"	"78081400"	"78081400"	"subst"	"0"	"01940"	"GAA_000485"	"g.78081400T>G"	""	"{PMID:Spada 2013:23566438}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107601T>G"	""	"VUS"	""
"0000479795"	"2"	"50"	"17"	"78081406"	"78081406"	"subst"	"0"	"01940"	"GAA_000500"	"g.78081406T>G"	""	"{PMID:Sacconi 2010:20559845}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107607T>G"	""	"VUS"	""
"0000479796"	"2"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000479797"	"2"	"90"	"17"	"78081457"	"78081457"	"del"	"0"	"01940"	"GAA_000505"	"g.78081457del"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107658del"	""	"pathogenic (recessive)"	""
"0000479798"	"2"	"90"	"17"	"78081499"	"78081499"	"subst"	"0"	"01940"	"GAA_000268"	"g.78081499G>A"	""	"{PMID:Dubrovsky 2013:23463700}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107700G>A"	""	"pathogenic (recessive)"	""
"0000479799"	"2"	"50"	"17"	"78081507"	"78081507"	"subst"	"0"	"01940"	"GAA_000508"	"g.78081507G>C"	""	"{PMID:Pardo 2015:25911022}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107708G>C"	""	"VUS"	""
"0000479800"	"2"	"70"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"01940"	"GAA_000077"	"g.78081615A>G"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107816A>G"	""	"likely pathogenic"	""
"0000479801"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000479802"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Spada 2013:23566438}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000479803"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000479804"	"2"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000221"	"g.78081636T>C"	""	"{PMID:Tecellioglu 2015:26622091}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	""
"0000479805"	"2"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000221"	"g.78081636T>C"	""	"{PMID:van der Beek 2008:18757064}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	""
"0000479806"	"2"	"70"	"17"	"78081636"	"78081636"	"subst"	"0"	"01940"	"GAA_000221"	"g.78081636T>C"	""	"{PMID:Stepien 2016:26873529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107837T>C"	""	"likely pathogenic"	""
"0000479807"	"2"	"70"	"17"	"78081663"	"78081663"	"subst"	"0"	"01940"	"GAA_000127"	"g.78081663A>C"	""	"{PMID:Echaniz-Laguna 2015:25786784}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>C"	""	"likely pathogenic"	""
"0000479808"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479809"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479810"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479811"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000479812"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479813"	"2"	"70"	"17"	"78084535"	"78084535"	"subst"	"8.13121E-6"	"01940"	"GAA_000301"	"g.78084535G>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110736G>A"	""	"likely pathogenic"	""
"0000479814"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479815"	"2"	"70"	"17"	"78086691"	"78086691"	"subst"	"0"	"01940"	"GAA_000360"	"g.78086691C>A"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112892C>A"	""	"likely pathogenic"	""
"0000479816"	"2"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01940"	"GAA_000023"	"g.78087149C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	""
"0000479817"	"2"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"01940"	"GAA_000055"	"g.78078867_78078868del"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic (recessive)"	""
"0000479818"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000304"	"g.78084640G>A"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>A"	""	"pathogenic (recessive)"	""
"0000479819"	"2"	"70"	"17"	"78082523"	"78082523"	"subst"	"8.20136E-6"	"01940"	"GAA_000102"	"g.78082523A>G"	""	"{PMID:Manwaring 2012:21687968}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108724A>G"	""	"likely pathogenic"	""
"0000479820"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479821"	"2"	"70"	"17"	"78082318"	"78082318"	"subst"	"0"	"01940"	"GAA_000534"	"g.78082318T>C"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108519T>C"	""	"likely pathogenic"	""
"0000479822"	"2"	"50"	"17"	"78082332"	"78082332"	"subst"	"0"	"01940"	"GAA_000130"	"g.78082332T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108533T>C"	""	"VUS"	""
"0000479823"	"2"	"70"	"17"	"78085811"	"78085811"	"subst"	"0"	"01940"	"GAA_000609"	"g.78085811A>G"	""	"{PMID:Loureiro Neves 2013:24016645}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112012A>G"	""	"likely pathogenic"	""
"0000479824"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479825"	"2"	"50"	"17"	"78086716"	"78086716"	"subst"	"0"	"01940"	"GAA_000419"	"g.78086716G>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112917G>C"	""	"VUS"	""
"0000479826"	"2"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01940"	"GAA_000023"	"g.78087149C>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	""
"0000479827"	"2"	"70"	"17"	"78086463"	"78086463"	"subst"	"1.66199E-5"	"01940"	"GAA_000224"	"g.78086463C>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112664C>A"	""	"likely pathogenic"	""
"0000479828"	"2"	"70"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01940"	"GAA_000067"	"g.78086728G>A"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112929G>A"	""	"likely pathogenic"	""
"0000479829"	"2"	"70"	"17"	"78086728"	"78086728"	"subst"	"5.46223E-5"	"01940"	"GAA_000067"	"g.78086728G>A"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112929G>A"	""	"likely pathogenic"	""
"0000479830"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Adams 1997:9259196}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479831"	"2"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Lam 2003:12601120}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000479832"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000479833"	"2"	"70"	"17"	"78086765"	"78086765"	"subst"	"0"	"01940"	"GAA_000116"	"g.78086765G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112966G>A"	""	"likely pathogenic"	""
"0000479834"	"2"	"70"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000317"	"g.78086424C>T"	""	"{PMID:Prater 2012:22538254}, {PMID:Prater 2013:23787031}, {PMID:Kishnani 2007:17151339}, {PMID:Palermo 2012:22658377}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112625C>T"	""	"likely pathogenic"	""
"0000479835"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Cardone 2008:19046416}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479836"	"2"	"70"	"17"	"78083792"	"78083792"	"subst"	"6.51121E-5"	"01940"	"GAA_000299"	"g.78083792G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80109993G>A"	""	"likely pathogenic"	""
"0000479837"	"2"	"70"	"17"	"78083787"	"78083787"	"subst"	"0"	"01940"	"GAA_000298"	"g.78083787C>T"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109988C>T"	""	"likely pathogenic"	""
"0000479838"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Messinger 2012:22237443}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479839"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479840"	"2"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01940"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	""
"0000479841"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479842"	"2"	"50"	"17"	"78092445"	"78092445"	"subst"	"1.63751E-5"	"01940"	"GAA_000361"	"g.78092445G>A"	""	"{PMID:Sampaolo 2013:24107549}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118646G>A"	""	"VUS"	""
"0000479843"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479844"	"2"	"50"	"17"	"78093067"	"78093067"	"subst"	"0"	"01940"	"GAA_000718"	"g.78093067C>G"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119268C>G"	""	"VUS"	""
"0000479845"	"2"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01940"	"GAA_000107"	"g.78092158T>A"	""	"{PMID:Huie 2002:11854868}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic (recessive)"	""
"0000479846"	"2"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01940"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic (recessive)"	""
"0000479847"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"01940"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000479848"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2015:25466677}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479849"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479850"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479851"	"2"	"90"	"17"	"78091499"	"78091499"	"del"	"4.11828E-6"	"01940"	"GAA_000167"	"g.78091499del"	""	"{PMID:Amartino 2006:16433701}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117700del"	""	"pathogenic (recessive)"	""
"0000479852"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Nilsson 2014:24384324}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000479853"	"2"	"70"	"17"	"78083825"	"78083827"	"del"	"0"	"01940"	"GAA_000104"	"g.78083825_78083827del"	""	"{PMID:Fernandez-Hojas 2002:11738358}, {PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110026_80110028del"	""	"likely pathogenic"	""
"0000479854"	"2"	"70"	"17"	"78090805"	"78090805"	"subst"	"0"	"01940"	"GAA_000217"	"g.78090805A>G"	""	"{PMID:Dlamini 2008:18434155}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117006A>G"	""	"likely pathogenic"	""
"0000479855"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"8.12572E-6"	"01940"	"GAA_000305"	"g.78084640G>T"	""	"{PMID:Bergsma 2015:25243733}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>T"	""	"pathogenic (recessive)"	""
"0000479856"	"2"	"50"	"17"	"78086798"	"78086798"	"subst"	"0"	"01940"	"GAA_000653"	"g.78086798T>A"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112999T>A"	""	"VUS"	""
"0000479857"	"2"	"50"	"17"	"78084632"	"78084632"	"subst"	"0"	"01940"	"GAA_000592"	"g.78084632T>A"	""	"{PMID:Fujimoto 2013:24190153}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110833T>A"	""	"VUS"	""
"0000479858"	"2"	"90"	"17"	"78086444"	"78086444"	"subst"	"1.24408E-5"	"01940"	"GAA_000318"	"g.78086444C>T"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112645C>T"	""	"pathogenic (recessive)"	""
"0000479859"	"2"	"50"	"17"	"78087153"	"78087153"	"subst"	"0"	"01940"	"GAA_000674"	"g.78087153C>G"	""	"{PMID:Ishigaki 2012:21704464}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113354C>G"	""	"VUS"	""
"0000479860"	"2"	"90"	"17"	"78090903"	"78090903"	"subst"	"0"	"01940"	"GAA_000692"	"g.78090903C>T"	""	"{PMID:Nabatame 2009:18495398}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117104C>T"	""	"pathogenic (recessive)"	""
"0000479861"	"2"	"90"	"17"	"78084770"	"78084771"	"del"	"0"	"01940"	"GAA_000601"	"g.78084770_78084771del"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110971_80110972del"	""	"pathogenic (recessive)"	""
"0000479862"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Kobayashi 2010:20202878}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000479863"	"2"	"70"	"17"	"78091474"	"78091479"	"del"	"0"	"01940"	"GAA_000698"	"g.78091474_78091479del"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117675_80117680del"	""	"likely pathogenic"	""
"0000479864"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479865"	"2"	"50"	"17"	"78087147"	"78087147"	"subst"	"0"	"01940"	"GAA_000672"	"g.78087147C>A"	""	"{PMID:Park 2013:23884227}, {PMID:Cho 2012:21940687}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113348C>A"	""	"VUS"	""
"0000479866"	"2"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479867"	"2"	"70"	"17"	"78084529"	"78084529"	"subst"	"1.62624E-5"	"01940"	"GAA_000080"	"g.78084529T>C"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110730T>C"	""	"likely pathogenic"	""
"0000479868"	"2"	"70"	"17"	"78084743"	"78084743"	"subst"	"0"	"01940"	"GAA_000032"	"g.78084743A>G"	""	"{PMID:Raben 1999:10189220}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110944A>G"	""	"likely pathogenic"	""
"0000479869"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479870"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479871"	"2"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479872"	"2"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000479873"	"2"	"70"	"17"	"78085814"	"78085814"	"subst"	"0"	"01940"	"GAA_000238"	"g.78085814A>T"	""	"{PMID:Hu 2015:25612604}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112015A>T"	""	"likely pathogenic"	""
"0000479874"	"2"	"90"	"17"	"78085850"	"78085850"	"dup"	"0"	"01940"	"GAA_000612"	"g.78085850dup"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112051dup"	""	"pathogenic (recessive)"	""
"0000479875"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479876"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Yang 2014:24243590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479877"	"2"	"50"	"17"	"78086764"	"78086764"	"subst"	"0"	"01940"	"GAA_000326"	"g.78086764C>T"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112965C>T"	""	"VUS"	""
"0000479878"	"2"	"70"	"17"	"78086465"	"78086465"	"subst"	"1.66671E-5"	"01940"	"GAA_000082"	"g.78086465G>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112666G>A"	""	"likely pathogenic"	""
"0000479879"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2015:25466677}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479880"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Shieh 1996:8604985}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479881"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Shieh 1998:9554747}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479882"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479883"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479884"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2014:24706590}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479885"	"2"	"90"	"17"	"78084640"	"78084640"	"subst"	"0"	"01940"	"GAA_000030"	"g.78084640G>C"	""	"{PMID:Stroppiano 2001:11343339}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110841G>C"	""	"pathogenic (recessive)"	""
"0000479886"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479887"	"2"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Huie 1994:7981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479888"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000479889"	"2"	"90"	"17"	"78086449"	"78086449"	"subst"	"0"	"01940"	"GAA_000632"	"g.78086449C>G"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112650C>G"	""	"pathogenic (recessive)"	""
"0000479890"	"2"	"90"	"17"	"78079686"	"78079687"	"ins"	"0"	"01940"	"GAA_000497"	"g.78079686_78079687insCGGC"	""	"{PMID:Kishnani 2006:16860134}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80105887_80105888insCGGC"	""	"pathogenic (recessive)"	""
"0000479891"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Schneider 2013:23160972}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479892"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479893"	"2"	"50"	"17"	"78092608"	"78092608"	"subst"	"4.0784E-6"	"01940"	"GAA_000444"	"g.78092608A>G"	""	"{PMID:Stepien 2016:26873529}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118809A>G"	""	"VUS"	""
"0000479894"	"2"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01940"	"GAA_000023"	"g.78087149C>T"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	""
"0000479895"	"2"	"90"	"17"	"78086376"	"78086376"	"subst"	"0"	"01940"	"GAA_000623"	"g.78086376G>A"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112577G>A"	""	"pathogenic (recessive)"	""
"0000479896"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479897"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479898"	"2"	"90"	"17"	"78087116"	"78087116"	"del"	"0"	"01940"	"GAA_000421"	"g.78087116del"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113317del"	""	"pathogenic (recessive)"	""
"0000479899"	"2"	"90"	"17"	"78087137"	"78087137"	"subst"	"0"	"01940"	"GAA_000670"	"g.78087137G>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113338G>T"	""	"pathogenic (recessive)"	""
"0000479900"	"2"	"50"	"17"	"78090874"	"78090874"	"subst"	"2.44543E-5"	"01940"	"GAA_000427"	"g.78090874A>G"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117075A>G"	""	"VUS"	""
"0000479901"	"2"	"70"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"01940"	"GAA_000215"	"g.78086403G>A"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112604G>A"	""	"likely pathogenic"	""
"0000479902"	"2"	"70"	"17"	"78086403"	"78086403"	"subst"	"8.18465E-6"	"01940"	"GAA_000215"	"g.78086403G>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112604G>A"	""	"likely pathogenic"	""
"0000479903"	"2"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479904"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Labrousse 2010:20080426}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479905"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479906"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Tsujino 2000:11053688}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479907"	"2"	"90"	"17"	"78085870"	"78085870"	"subst"	"1.62488E-5"	"01940"	"GAA_000617"	"g.78085870C>A"	""	"{PMID:Korpela 2009:19472353}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112071C>A"	""	"pathogenic (recessive)"	""
"0000479908"	"2"	"50"	"17"	"78086779"	"78086779"	"subst"	"0"	"01940"	"GAA_000652"	"g.78086779G>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112980G>A"	""	"VUS"	""
"0000479909"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479910"	"2"	"70"	"17"	"78085849"	"78085849"	"subst"	"4.06147E-6"	"01940"	"GAA_000611"	"g.78085849C>G"	""	"{PMID:Alejaldre 2012:22980766}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112050C>G"	""	"likely pathogenic"	""
"0000479911"	"2"	"70"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"01940"	"GAA_000159"	"g.78086478G>A"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112679G>A"	""	"likely pathogenic"	""
"0000479912"	"2"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479913"	"2"	"90"	"17"	"78087015"	"78087015"	"subst"	"0"	"01940"	"GAA_000142"	"g.78087015A>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113216A>C"	""	"pathogenic (recessive)"	""
"0000479914"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479915"	"2"	"90"	"17"	"78091499"	"78091499"	"del"	"4.11828E-6"	"01940"	"GAA_000167"	"g.78091499del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117700del"	""	"pathogenic (recessive)"	""
"0000479916"	"2"	"90"	"17"	"78092110"	"78092114"	"del"	"0"	"01940"	"GAA_000706"	"g.78092110_78092114delinsA"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118311_80118315delinsA"	""	"pathogenic (recessive)"	""
"0000479917"	"2"	"50"	"17"	"78087108"	"78087108"	"subst"	"0.000101169"	"01940"	"GAA_000209"	"g.78087108C>G"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113309C>G"	""	"VUS"	""
"0000479918"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Herzog 2012:22676651}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000479919"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Palermo 2012:22658377}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479920"	"2"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01940"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Ishigaki 2012:21676566}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	""
"0000479921"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000479922"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479923"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479924"	"2"	"70"	"17"	"78086727"	"78086727"	"subst"	"1.26036E-5"	"01940"	"GAA_000034"	"g.78086727C>G"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112928C>G"	""	"likely pathogenic"	""
"0000479925"	"2"	"70"	"17"	"78086765"	"78086765"	"subst"	"0"	"01940"	"GAA_000116"	"g.78086765G>A"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112966G>A"	""	"likely pathogenic"	""
"0000479926"	"2"	"70"	"17"	"78087081"	"78087081"	"subst"	"0"	"01940"	"GAA_000666"	"g.78087081G>T"	""	"{PMID:Broomfield 2016:26497565}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113282G>T"	""	"likely pathogenic"	""
"0000479927"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479928"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Van den Hout 2004:15121988}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479929"	"2"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01940"	"GAA_000068"	"g.78086719G>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112920G>A"	""	"pathogenic (recessive)"	""
"0000479930"	"2"	"50"	"17"	"78078521"	"78078521"	"subst"	"0"	"01940"	"GAA_000056"	"g.78078521T>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104722T>C"	""	"VUS"	""
"0000479931"	"2"	"50"	"17"	"78086468"	"78086468"	"subst"	"0"	"01940"	"GAA_000635"	"g.78086468G>A"	""	"{PMID:Muraoka 2011:22185990}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112669G>A"	""	"VUS"	""
"0000479932"	"2"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479933"	"2"	"70"	"17"	"78086698"	"78086698"	"subst"	"1.25829E-5"	"01940"	"GAA_000066"	"g.78086698G>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112899G>T"	""	"likely pathogenic"	""
"0000479934"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479935"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479936"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479937"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479938"	"2"	"90"	"17"	"78090815"	"78090815"	"subst"	"8.13431E-6"	"01940"	"GAA_000425"	"g.78090815G>A"	""	"{PMID:Kishnani 2006:16860134}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>A"	""	"pathogenic (recessive)"	""
"0000479939"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Remiche 2014:24158270}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000479940"	"2"	"70"	"17"	"78086801"	"78086801"	"subst"	"0"	"01940"	"GAA_000069"	"g.78086801G>A"	""	"{PMID:Park 2006:17092519}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"likely pathogenic"	""
"0000479941"	"2"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"01940"	"GAA_000241"	"g.78092011_78092012del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic (recessive)"	""
"0000479942"	"2"	"70"	"17"	"78086699"	"78086699"	"subst"	"0"	"01940"	"GAA_000322"	"g.78086699G>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112900G>T"	""	"likely pathogenic"	""
"0000479943"	"2"	"70"	"17"	"78087081"	"78087081"	"subst"	"5.51369E-5"	"01940"	"GAA_000227"	"g.78087081G>A"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113282G>A"	""	"likely pathogenic"	""
"0000479944"	"2"	"50"	"17"	"78086826"	"78086826"	"subst"	"0"	"01940"	"GAA_000231"	"g.78086826G>A"	""	"{PMID:Khan 2013:23430500}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113027G>A"	""	"VUS"	""
"0000479945"	"2"	"50"	"17"	"78086826"	"78086826"	"subst"	"0"	"01940"	"GAA_000231"	"g.78086826G>A"	""	"{PMID:McCready 2007:17723315}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113027G>A"	""	"VUS"	""
"0000479946"	"2"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"01940"	"GAA_000023"	"g.78087149C>T"	""	"{PMID:Hermans 1993:8401535}, {PMID:Trend 1985:3865697}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	""
"0000479947"	"2"	"90"	"17"	"78078621"	"78078631"	"del"	"0"	"01940"	"GAA_000240"	"g.78078621_78078631del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104822_80104832del"	""	"pathogenic (recessive)"	""
"0000479948"	"2"	"90"	"17"	"78090819"	"78090819"	"dup"	"0"	"01940"	"GAA_000073"	"g.78090819dup"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117020dup"	""	"pathogenic (recessive)"	""
"0000479949"	"2"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"01940"	"GAA_000241"	"g.78092011_78092012del"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic (recessive)"	""
"0000479950"	"2"	"70"	"17"	"78092507"	"78092507"	"subst"	"0"	"01940"	"GAA_000145"	"g.78092507T>A"	""	"{PMID:Kroos 2004:15145338}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118708T>A"	""	"likely pathogenic"	""
"0000479951"	"2"	"50"	"17"	"78086746"	"78086746"	"subst"	"0"	"01940"	"GAA_000648"	"g.78086746T>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112947T>C"	""	"VUS"	""
"0000479952"	"2"	"70"	"17"	"78086810"	"78086812"	"del"	"0"	"01940"	"GAA_000654"	"g.78086810_78086812del"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113011_80113013del"	""	"likely pathogenic"	""
"0000479953"	"2"	"70"	"17"	"78086810"	"78086812"	"del"	"0"	"01940"	"GAA_000654"	"g.78086810_78086812del"	""	"{PMID:Shieh 1998:9554747}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113011_80113013del"	""	"likely pathogenic"	""
"0000479954"	"2"	"70"	"17"	"78086810"	"78086812"	"del"	"0"	"01940"	"GAA_000654"	"g.78086810_78086812del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113011_80113013del"	""	"likely pathogenic"	""
"0000479955"	"2"	"90"	"17"	"78086827"	"78086827"	"subst"	"0"	"01940"	"GAA_000655"	"g.78086827G>T"	""	"{PMID:Chien 2015:25466677}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113028G>T"	""	"pathogenic (recessive)"	""
"0000479956"	"2"	"50"	"17"	"78087150"	"78087150"	"subst"	"0"	"01940"	"GAA_000673"	"g.78087150G>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113351G>C"	""	"VUS"	""
"0000479957"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479958"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479959"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479960"	"2"	"90"	"17"	"78090851"	"78090851"	"dup"	"0"	"01940"	"GAA_000685"	"g.78090851dup"	""	"{PMID:Yang 2016:26685070}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80117052dup"	""	"pathogenic (recessive)"	""
"0000479961"	"2"	"50"	"17"	"78090880"	"78090880"	"subst"	"0"	"01940"	"GAA_000691"	"g.78090880C>T"	""	"{PMID:Yang 2014:24243590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117081C>T"	""	"VUS"	""
"0000479962"	"2"	"90"	"17"	"78091447"	"78091447"	"del"	"0"	"01940"	"GAA_000085"	"g.78091447del"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117648del"	""	"pathogenic (recessive)"	""
"0000479963"	"2"	"90"	"17"	"78091447"	"78091447"	"del"	"0"	"01940"	"GAA_000085"	"g.78091447del"	""	"{PMID:Ko 1999:10338092}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117648del"	""	"pathogenic (recessive)"	""
"0000479964"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Hermans 1993:8094613}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479965"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479966"	"2"	"90"	"17"	"78093112"	"78093112"	"dup"	"0"	"01940"	"GAA_000184"	"g.78093112dup"	""	"{PMID:Chien 2015:25466677}, {PMID:Chien 2009:19948615}, {PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80119313dup"	""	"pathogenic (recessive)"	""
"0000479967"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Huie 1994:7981676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479968"	"2"	"70"	"17"	"78087624"	"78093676"	"del"	"0"	"01940"	"GAA_000677"	"g.78087624_78093676del"	""	"{PMID:Kishnani 2006:16860134}"	""	""	"Variant Error [EMISMATCH/ERANGE]: This transcript variant has an error. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic"	""
"0000479969"	"2"	"90"	"17"	"78091452"	"78091452"	"del"	"0"	"01940"	"GAA_000696"	"g.78091452del"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117653del"	""	"pathogenic (recessive)"	""
"0000479970"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Montalvo 2004:14972326}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479971"	"2"	"90"	"17"	"78092022"	"78092022"	"subst"	"4.07422E-6"	"01940"	"GAA_000438"	"g.78092022C>T"	""	"{PMID:Stenger 2015:26167453}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118223C>T"	""	"pathogenic (recessive)"	""
"0000479972"	"2"	"50"	"17"	"78087143"	"78087143"	"subst"	"0"	"01940"	"GAA_000671"	"g.78087143G>A"	""	"{PMID:Qiu 2007:18211760}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113344G>A"	""	"VUS"	""
"0000479973"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Nino 2013:23430493}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479974"	"2"	"70"	"17"	"78090814"	"78090814"	"subst"	"6.10227E-5"	"01940"	"GAA_000225"	"g.78090814G>C"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>C"	""	"likely pathogenic"	""
"0000479975"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000479976"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479977"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000479978"	"2"	"50"	"17"	"78092445"	"78092445"	"subst"	"1.63751E-5"	"01940"	"GAA_000361"	"g.78092445G>A"	""	"{PMID:Sampaolo 2013:24107549}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118646G>A"	""	"VUS"	""
"0000479979"	"2"	"90"	"17"	"78078762"	"78078762"	"subst"	"0"	"01940"	"GAA_000242"	"g.78078762G>A"	""	"{PMID:Palmer 2007:17056254}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104963G>A"	""	"pathogenic (recessive)"	""
"0000479980"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000479981"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479982"	"2"	"50"	"17"	"78092149"	"78092149"	"subst"	"0"	"01940"	"GAA_000144"	"g.78092149C>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118350C>A"	""	"VUS"	""
"0000479983"	"2"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01940"	"GAA_000107"	"g.78092158T>A"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic (recessive)"	""
"0000479984"	"2"	"70"	"17"	"78092512"	"78092514"	"del"	"0"	"01940"	"GAA_000051"	"g.78092512_78092514del"	""	"{PMID:Boerkoel 1995:7717400}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118713_80118715del"	""	"likely pathogenic"	""
"0000479985"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000479986"	"2"	"50"	"17"	"78093117"	"78093117"	"subst"	"4.0624E-6"	"01940"	"GAA_000075"	"g.78093117T>A"	""	"{PMID:Becker 1998:9529346}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119318T>A"	""	"VUS"	""
"0000479987"	"2"	"50"	"17"	"78090912"	"78090912"	"subst"	"0"	"01940"	"GAA_000165"	"g.78090912A>G"	""	"{PMID:Kroos 2006:16838077}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117113A>G"	""	"VUS"	""
"0000479988"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Yang 2011:21757382}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000479989"	"2"	"70"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01940"	"GAA_000155"	"g.78084553G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>A"	""	"likely pathogenic"	""
"0000479990"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"01940"	"GAA_000028"	"g.78078910del"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000479991"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000479992"	"2"	"90"	"17"	"78082287"	"78082287"	"subst"	"0"	"01940"	"GAA_000151"	"g.78082287G>C"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108488G>C"	""	"pathogenic (recessive)"	""
"0000479993"	"2"	"70"	"17"	"78084533"	"78084533"	"subst"	"0"	"01940"	"GAA_000581"	"g.78084533C>T"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110734C>T"	""	"likely pathogenic"	""
"0000479994"	"2"	"50"	"17"	"78086418"	"78086418"	"subst"	"0"	"01940"	"GAA_000316"	"g.78086418C>T"	""	"{PMID:Rozdzynska-Swiatkowska 2016:26253708}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112619C>T"	""	"VUS"	""
"0000479995"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Turaca 2015:25681614}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479996"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000479997"	"2"	"90"	"17"	"78092011"	"78092012"	"del"	"0"	"01940"	"GAA_000241"	"g.78092011_78092012del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118212_80118213del"	""	"pathogenic (recessive)"	""
"0000479998"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000479999"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000480000"	"2"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Loureiro Neves 2013:24016645}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000480001"	"2"	"70"	"17"	"78081663"	"78081663"	"subst"	"0"	"01940"	"GAA_000127"	"g.78081663A>C"	""	"{PMID:Bali 2012:22252923}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>C"	""	"likely pathogenic"	""
"0000480002"	"2"	"90"	"17"	"78083828"	"78083831"	"del"	"1.63193E-5"	"01940"	"GAA_000053"	"g.78083828_78083831del"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110029_80110032del"	""	"pathogenic (recessive)"	""
"0000480003"	"2"	"50"	"17"	"78078918"	"78078918"	"subst"	"1.70691E-5"	"01940"	"GAA_000465"	"g.78078918G>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80105119G>A"	""	"VUS"	""
"0000480004"	"2"	"50"	"17"	"78081474"	"78081474"	"subst"	"0"	"01940"	"GAA_000208"	"g.78081474A>G"	""	"{PMID:Labrousse 2010:20080426}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80107675A>G"	""	"VUS"	""
"0000480005"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Fu Liong 2014:25093132}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000480006"	"2"	"90"	"17"	"78090804"	"78090804"	"subst"	"0"	"01940"	"GAA_000681"	"g.78090804C>T"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117005C>T"	""	"pathogenic (recessive)"	""
"0000480007"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000480008"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000480009"	"2"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01940"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	""
"0000480010"	"2"	"70"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"01940"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"likely pathogenic"	""
"0000480011"	"2"	"70"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"01940"	"GAA_000155"	"g.78084553G>A"	""	"{PMID:Gort 2007:17616415}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110754G>A"	""	"likely pathogenic"	""
"0000480012"	"2"	"50"	"17"	"78082327"	"78082327"	"subst"	"0"	"01940"	"GAA_000287"	"g.78082327A>T"	""	"{PMID:Van den Hout 2004:15121988}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108528A>T"	""	"VUS"	""
"0000480013"	"2"	"50"	"17"	"78082510"	"78082510"	"subst"	"0"	"01940"	"GAA_000291"	"g.78082510C>G"	""	"<a href=\'http://raredisorders.imedpub.com/muscle-mri-in-classic-infantilepompe-disease.php?aid=6697\'>Wens 2015</a>"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108711C>G"	""	"VUS"	""
"0000480014"	"2"	"90"	"17"	"78083856"	"78083856"	"subst"	"0"	"01940"	"GAA_000095"	"g.78083856T>C"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110057T>C"	""	"pathogenic (recessive)"	""
"0000480015"	"2"	"50"	"17"	"78084566"	"78084566"	"subst"	"1.2188E-5"	"01940"	"GAA_000587"	"g.78084566C>T"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110767C>T"	""	"VUS"	""
"0000480016"	"2"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"01940"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Messinger 2012:22237443}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000480017"	"2"	"70"	"17"	"78084744"	"78084744"	"subst"	"8.12334E-6"	"01940"	"GAA_000044"	"g.78084744T>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110945T>C"	""	"likely pathogenic"	""
"0000480018"	"2"	"70"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01940"	"GAA_000033"	"g.78084822C>T"	""	"{PMID:Hermans 1994:7881422}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111023C>T"	""	"likely pathogenic"	""
"0000480019"	"2"	"90"	"17"	"78078557"	"78078557"	"subst"	"0"	"01940"	"GAA_000076"	"g.78078557C>T"	""	"{PMID:Huie 1999:10377006}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104758C>T"	""	"pathogenic (recessive)"	""
"0000480020"	"2"	"70"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"01940"	"GAA_000137"	"g.78085880G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112081G>A"	""	"likely pathogenic"	""
"0000480021"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000480022"	"2"	"90"	"17"	"78086424"	"78086424"	"subst"	"0"	"01940"	"GAA_000628"	"g.78086424C>A"	""	"{PMID:Manwaring 2012:21687968}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112625C>A"	""	"pathogenic (recessive)"	""
"0000480023"	"2"	"90"	"17"	"78086448"	"78086448"	"dup"	"0"	"01940"	"GAA_000139"	"g.78086448dup"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112649dup"	""	"pathogenic (recessive)"	""
"0000480024"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000480025"	"2"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"01940"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Swarr 2012:23430912}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	""
"0000480026"	"2"	"70"	"17"	"78090787"	"78090787"	"subst"	"4.06702E-6"	"01940"	"GAA_000679"	"g.78090787C>A"	""	"{PMID:Kindel 2012:22555271}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80116988C>A"	""	"likely pathogenic"	""
"0000480027"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000480028"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Kroos 1995:8558570}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000480029"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Banugaria 2013:23825616}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000480030"	"2"	"70"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"01940"	"GAA_000123"	"g.78078931G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>A"	""	"likely pathogenic"	""
"0000480031"	"2"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01940"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	""
"0000480032"	"2"	"70"	"17"	"78079671"	"78079671"	"subst"	"1.67565E-5"	"01940"	"GAA_000108"	"g.78079671C>T"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105872C>T"	""	"likely pathogenic"	""
"0000480033"	"2"	"50"	"17"	"78079672"	"78079672"	"subst"	"4.19041E-6"	"01940"	"GAA_000214"	"g.78079672G>C"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105873G>C"	""	"VUS"	""
"0000480034"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000480035"	"2"	"90"	"17"	"78085795"	"78085795"	"dup"	"0"	"01940"	"GAA_000607"	"g.78085795dup"	""	"{PMID:Khallaf 2013:23430560}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111996dup"	""	"pathogenic (recessive)"	""
"0000480036"	"2"	"90"	"17"	"78082292"	"78082292"	"subst"	"0"	"01940"	"GAA_000530"	"g.78082292C>G"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108493C>G"	""	"pathogenic (recessive)"	""
"0000480037"	"2"	"90"	"17"	"78087016"	"78087016"	"subst"	"0"	"01940"	"GAA_000233"	"g.78087016G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113217G>A"	""	"pathogenic (recessive)"	""
"0000480038"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Kobayashi 2010:20202878}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000480039"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Maimaiti 2009:19609281}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000480040"	"2"	"50"	"17"	"78087147"	"78087147"	"subst"	"0"	"01940"	"GAA_000672"	"g.78087147C>A"	""	"{PMID:Park 2015:25388776}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113348C>A"	""	"VUS"	""
"0000480041"	"2"	"50"	"17"	"78079481"	"78079481"	"subst"	"0"	"01940"	"GAA_000473"	"g.78079481C>G"	""	"{PMID:Guevara-Campos 2013:24008937}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105682C>G"	""	"VUS"	""
"0000480042"	"2"	"70"	"17"	"78084535"	"78084535"	"subst"	"8.13121E-6"	"01940"	"GAA_000301"	"g.78084535G>A"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110736G>A"	""	"likely pathogenic"	""
"0000480043"	"2"	"90"	"17"	"78092158"	"78092158"	"subst"	"0"	"01940"	"GAA_000107"	"g.78092158T>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118359T>A"	""	"pathogenic (recessive)"	""
"0000480044"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000480045"	"2"	"70"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"01940"	"GAA_000137"	"g.78085880G>A"	""	"{PMID:Elder 2013:23601496}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112081G>A"	""	"likely pathogenic"	""
"0000480046"	"2"	"70"	"17"	"78086418"	"78086418"	"subst"	"1.22822E-5"	"01940"	"GAA_000626"	"g.78086418C>A"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112619C>A"	""	"likely pathogenic"	""
"0000480047"	"2"	"70"	"17"	"78086421"	"78086421"	"subst"	"1.22904E-5"	"01940"	"GAA_000081"	"g.78086421G>A"	""	"{PMID:Bonnefoy 2008:18995995}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112622G>A"	""	"likely pathogenic"	""
"0000480048"	"2"	"70"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"01940"	"GAA_000100"	"g.78081447G>A"	""	"{PMID:Fernandez-Hojas 2002:11738358}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107648G>A"	""	"likely pathogenic"	""
"0000480049"	"2"	"70"	"17"	"78081663"	"78081663"	"subst"	"0"	"01940"	"GAA_000127"	"g.78081663A>C"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>C"	""	"likely pathogenic"	""
"0000480050"	"2"	"70"	"17"	"78082197"	"78082197"	"subst"	"8.13121E-6"	"01940"	"GAA_000129"	"g.78082197T>C"	""	"{PMID:Zouheir Habbal 2013:23632174}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108398T>C"	""	"likely pathogenic"	""
"0000480051"	"2"	"70"	"17"	"78086765"	"78086765"	"subst"	"0"	"01940"	"GAA_000116"	"g.78086765G>A"	""	"{PMID:Pipo 2003:14643388}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112966G>A"	""	"likely pathogenic"	""
"0000480052"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000480053"	"2"	"90"	"17"	"78081426"	"78081426"	"subst"	"0"	"01940"	"GAA_000502"	"g.78081426C>T"	""	"{PMID:Aykut 2014:25026126}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107627C>T"	""	"pathogenic (recessive)"	""
"0000480054"	"2"	"70"	"17"	"78085790"	"78085790"	"subst"	"0"	"01940"	"GAA_000158"	"g.78085790G>C"	""	"{PMID:Montalvo 2006:16917947}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80111991G>C"	""	"likely pathogenic"	""
"0000480055"	"2"	"50"	"17"	"78082512"	"78082512"	"subst"	"0"	"01940"	"GAA_000552"	"g.78082512A>G"	""	"{PMID:Nilsson 2014:24384324}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108713A>G"	""	"VUS"	""
"0000480056"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Muller-Felber 2007:17643989}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000480057"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Anneser 2005:15668445}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000480058"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000480059"	"2"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01940"	"GAA_000126"	"g.78081617G>A"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	""
"0000480060"	"2"	"90"	"17"	"78085832"	"78085832"	"subst"	"0"	"01940"	"GAA_000097"	"g.78085832C>T"	""	"{PMID:Kishnani 2010:19775921}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112033C>T"	""	"pathogenic (recessive)"	""
"0000480061"	"2"	"90"	"17"	"78085832"	"78085832"	"subst"	"0"	"01940"	"GAA_000097"	"g.78085832C>T"	""	"{PMID:Banugaria 2012:22365055}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112033C>T"	""	"pathogenic (recessive)"	""
"0000480062"	"2"	"90"	"17"	"78085900"	"78085900"	"subst"	"0"	"01940"	"GAA_000620"	"g.78085900G>A"	""	"{PMID:Kishnani 2010:19775921}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112101G>A"	""	"pathogenic (recessive)"	""
"0000480063"	"2"	"70"	"17"	"78081424"	"78081424"	"subst"	"0.000195078"	"01940"	"GAA_000211"	"g.78081424C>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107625C>T"	""	"likely pathogenic"	""
"0000480064"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Huie 1998:9535769}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000480065"	"2"	"70"	"17"	"78082336"	"78082336"	"subst"	"8.19061E-6"	"01940"	"GAA_000393"	"g.78082336G>T"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108537G>T"	""	"likely pathogenic"	""
"0000480066"	"2"	"90"	"17"	"78083773"	"78083773"	"del"	"0"	"01940"	"GAA_000567"	"g.78083773del"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109974del"	""	"pathogenic (recessive)"	""
"0000480067"	"2"	"90"	"17"	"78083813"	"78083813"	"del"	"0"	"01940"	"GAA_000246"	"g.78083813del"	""	"{PMID:Nascimbeni 2008:18285536}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110014del"	""	"pathogenic (recessive)"	""
"0000480068"	"2"	"70"	"17"	"78084749"	"78084749"	"subst"	"0"	"01940"	"GAA_000596"	"g.78084749G>C"	""	"{PMID:Oba-Shinjo 2009:19588081}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110950G>C"	""	"likely pathogenic"	""
"0000480069"	"2"	"70"	"17"	"78084752"	"78084752"	"subst"	"0"	"01940"	"GAA_000598"	"g.78084752C>G"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110953C>G"	""	"likely pathogenic"	""
"0000480070"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000480071"	"2"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000480072"	"2"	"70"	"17"	"78082610"	"78082610"	"subst"	"0"	"01940"	"GAA_000114"	"g.78082610C>T"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108811C>T"	""	"likely pathogenic"	""
"0000480073"	"2"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000480074"	"2"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"01940"	"GAA_000228"	"g.78082617T>A"	""	"{PMID:Park 2006:17092519}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic"	""
"0000480075"	"2"	"70"	"17"	"78087081"	"78087081"	"subst"	"5.51369E-5"	"01940"	"GAA_000227"	"g.78087081G>A"	""	"{PMID:Qiu 2007:18211760}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113282G>A"	""	"likely pathogenic"	""
"0000480076"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Liu 2013:24169249}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000480077"	"2"	"90"	"17"	"78087164"	"78087164"	"subst"	"0"	"01940"	"GAA_000117"	"g.78087164G>T"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113365G>T"	""	"pathogenic (recessive)"	""
"0000480078"	"2"	"90"	"17"	"78083771"	"78083789"	"del"	"0"	"01940"	"GAA_000566"	"g.78083771_78083789del"	""	"{PMID:Orlikowski 2011:21550241}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109972_80109990del"	""	"pathogenic (recessive)"	""
"0000480079"	"2"	"90"	"17"	"78090814"	"78090814"	"subst"	"8.13637E-6"	"01940"	"GAA_000072"	"g.78090814G>A"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117015G>A"	""	"pathogenic (recessive)"	""
"0000480080"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Bodamer 2002:1221361815}, {PMID:Hermans 2004:14695532}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000480081"	"2"	"90"	"17"	"78092467"	"78092467"	"subst"	"2.04037E-5"	"01940"	"GAA_000169"	"g.78092467G>T"	""	"{PMID:Fu 2014:24269976}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118668G>T"	""	"pathogenic (recessive)"	""
"0000480082"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Wens 2012:23000108}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000480083"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01940"	"GAA_000036"	"g.78090815G>C"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic"	""
"0000480084"	"2"	"70"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"01940"	"GAA_000092"	"g.78086420C>T"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112621C>T"	""	"likely pathogenic"	""
"0000480085"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000480086"	"2"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"01940"	"GAA_000115"	"g.78086479C>G"	""	"{PMID:Park 2013:23884227}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic"	""
"0000480087"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01940"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Castro-Gago 1999:10528311}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000480088"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Pittis 2008:18429042}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000480089"	"2"	"90"	"17"	"78082340"	"78082341"	"delins"	"0"	"01940"	"GAA_000243"	"g.78082340_78082341delinsC"	""	"{PMID:Joshi 2008:18607768}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108541_80108542delinsC"	""	"pathogenic (recessive)"	""
"0000480090"	"2"	"70"	"17"	"78083792"	"78083792"	"subst"	"6.51121E-5"	"01940"	"GAA_000299"	"g.78083792G>A"	""	"{PMID:Wan 2008:18458862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109993G>A"	""	"likely pathogenic"	""
"0000480091"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Raben 1995:7603531}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000480092"	"2"	"70"	"17"	"78086800"	"78086800"	"subst"	"0"	"01940"	"GAA_000070"	"g.78086800C>T"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113001C>T"	""	"likely pathogenic"	""
"0000480093"	"2"	"90"	"17"	"78090846"	"78090846"	"subst"	"0"	"01940"	"GAA_000236"	"g.78090846C>T"	""	"{PMID:Markic 2014:24337590}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117047C>T"	""	"pathogenic (recessive)"	""
"0000480094"	"2"	"90"	"17"	"78091658"	"78092195"	"del"	"0"	"01940"	"GAA_000037"	"g.78091658_78092195del"	""	"{PMID:Kroos 1998:9660056}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117859_80118396del"	""	"pathogenic (recessive)"	""
"0000480095"	"2"	"90"	"17"	"78086444"	"78086444"	"subst"	"1.24408E-5"	"01940"	"GAA_000318"	"g.78086444C>T"	""	"{PMID:Bali 2011:21484825}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112645C>T"	""	"pathogenic (recessive)"	""
"0000480096"	"2"	"70"	"17"	"78085861"	"78085861"	"subst"	"0"	"01940"	"GAA_000614"	"g.78085861C>G"	""	"{PMID:Vill 2015:25455803}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112062C>G"	""	"likely pathogenic"	""
"0000480097"	"2"	"90"	"17"	"78084585"	"78084585"	"subst"	"0"	"01940"	"GAA_000090"	"g.78084585G>A"	""	"{PMID:Laforet 2000:11071489}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110786G>A"	""	"pathogenic (recessive)"	""
"0000480098"	"2"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Dou 2006:16782080}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000480099"	"2"	"70"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"01940"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Pittis 2003:12923862}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"likely pathogenic"	""
"0000480100"	"2"	"90"	"17"	"78093086"	"78093087"	"del"	"0"	"01940"	"GAA_000086"	"g.78093086_78093087del"	""	"{PMID:Ding 2015:26310554}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80119287_80119288del"	""	"pathogenic (recessive)"	""
"0000480101"	"2"	"70"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"01940"	"GAA_000065"	"g.78081665G>A"	""	"{PMID:Aminoso 2013:23402890}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107866G>A"	""	"likely pathogenic"	""
"0000480102"	"2"	"90"	"17"	"78091498"	"78091498"	"del"	"0"	"01940"	"GAA_000700"	"g.78091498del"	""	"{PMID:Liu 2014:25526786}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117699del"	""	"pathogenic (recessive)"	""
"0000480103"	"0"	"70"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"01940"	"GAA_000020"	"g.78086721C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"likely pathogenic"	""
"0000480104"	"0"	"70"	"17"	"78081424"	"78081424"	"subst"	"0.000195078"	"01940"	"GAA_000211"	"g.78081424C>T"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107625C>T"	""	"likely pathogenic"	""
"0000480105"	"0"	"50"	"17"	"78086502"	"78086502"	"subst"	"0"	"01940"	"GAA_000639"	"g.78086502C>T"	""	"{PMID:Case 2008:18930676}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112703C>T"	""	"VUS"	""
"0000480106"	"0"	"70"	"17"	"78081424"	"78081424"	"subst"	"0.000195078"	"01940"	"GAA_000211"	"g.78081424C>T"	""	"{PMID:Chien 2011:21232767}"	""	""	"Asian pseudodeficiency allele"	"Germline"	""	""	"0"	""	""	"g.80107625C>T"	""	"likely pathogenic"	""
"0000480107"	"0"	"50"	"17"	"78086744"	"78086744"	"subst"	"1.26072E-5"	"01940"	"GAA_000647"	"g.78086744C>A"	""	"{PMID:Chien 2011:21232767}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112945C>A"	""	"VUS"	""
"0000487412"	"0"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"03294"	"GAA_000204"	"g.78078351C>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104552C>A"	""	"NA"	""
"0000487413"	"0"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"03294"	"GAA_000491"	"g.78078351C>G"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104552C>G"	""	"NA"	""
"0000487414"	"0"	"90"	"17"	"78078352"	"78078352"	"subst"	"0"	"03294"	"GAA_000354"	"g.78078352A>G"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104553A>G"	""	"NA"	""
"0000487415"	"0"	"90"	"17"	"78078386"	"78078386"	"subst"	"0"	"03294"	"GAA_000284"	"g.78078386A>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104587A>T"	""	"NA"	""
"0000487416"	"0"	"90"	"17"	"78078387"	"78078387"	"subst"	"0"	"03294"	"GAA_000356"	"g.78078387T>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104588T>C"	""	"NA"	""
"0000487417"	"0"	"90"	"17"	"78078417"	"78078417"	"subst"	"0.000130749"	"03294"	"GAA_000365"	"g.78078417G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104618G>A"	""	"NA"	""
"0000487418"	"0"	"90"	"17"	"78078439"	"78078439"	"subst"	"4.07701E-6"	"03294"	"GAA_000492"	"g.78078439C>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	"0"	""	""	"g.80104640C>T"	""	"NA"	""
"0000487419"	"0"	"50"	"17"	"78078584"	"78078584"	"subst"	"0"	"03294"	"GAA_000493"	"g.78078584G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104785G>A"	""	"NA"	""
"0000487420"	"0"	"90"	"17"	"78078626"	"78078626"	"subst"	"0"	"03294"	"GAA_000448"	"g.78078626C>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104827C>T"	""	"NA"	""
"0000487421"	"0"	"90"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"03294"	"GAA_000003"	"g.78078656G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104857G>A"	""	"NA"	""
"0000487422"	"0"	"90"	"17"	"78078692"	"78078692"	"subst"	"0"	"03294"	"GAA_000449"	"g.78078692T>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104893T>C"	""	"NA"	""
"0000487423"	"0"	"50"	"17"	"78078692"	"78078692"	"subst"	"0"	"03294"	"GAA_000119"	"g.78078692T>G"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104893T>G"	""	"NA"	""
"0000487424"	"0"	"50"	"17"	"78078708"	"78078708"	"subst"	"0"	"03294"	"GAA_000451"	"g.78078708G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104909G>A"	""	"NA"	""
"0000487425"	"0"	"90"	"17"	"78078728"	"78078728"	"subst"	"0"	"03294"	"GAA_000254"	"g.78078728C>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104929C>T"	""	"NA"	""
"0000487426"	"0"	"10"	"17"	"78078748"	"78078748"	"subst"	"0"	"03294"	"GAA_000494"	"g.78078748G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80104949G>A"	""	"NA"	""
"0000487427"	"0"	"50"	"17"	"78078888"	"78078888"	"subst"	"0.000121725"	"03294"	"GAA_000232"	"g.78078888G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80105089G>A"	""	"NA"	""
"0000487428"	"0"	"90"	"17"	"78078888"	"78078888"	"subst"	"0"	"03294"	"GAA_000462"	"g.78078888G>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80105089G>C"	""	"NA"	""
"0000487429"	"0"	"50"	"17"	"78078891"	"78078891"	"subst"	"0"	"03294"	"GAA_000463"	"g.78078891T>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80105092T>C"	""	"NA"	""
"0000487430"	"0"	"50"	"17"	"78078918"	"78078918"	"subst"	"1.70691E-5"	"03294"	"GAA_000465"	"g.78078918G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80105119G>A"	""	"NA"	""
"0000487431"	"0"	"90"	"17"	"78078931"	"78078931"	"subst"	"2.58358E-5"	"03294"	"GAA_000123"	"g.78078931G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105132G>A"	""	"NA"	""
"0000487432"	"0"	"90"	"17"	"78078931"	"78078931"	"subst"	"8.61193E-6"	"03294"	"GAA_000467"	"g.78078931G>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105132G>C"	""	"NA"	""
"0000487433"	"0"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"03294"	"GAA_000466"	"g.78078931G>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105132G>T"	""	"NA"	""
"0000487434"	"0"	"90"	"17"	"78078932"	"78078932"	"subst"	"0"	"03294"	"GAA_000468"	"g.78078932G>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105133G>T"	""	"NA"	""
"0000487435"	"0"	"90"	"17"	"78078933"	"78078933"	"subst"	"0"	"03294"	"GAA_000469"	"g.78078933T>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105134T>C"	""	"NA"	""
"0000487436"	"0"	"90"	"17"	"78078933"	"78078936"	"del"	"0"	"03294"	"GAA_000470"	"g.78078933_78078936del"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105134_80105137del"	""	"NA"	""
"0000487437"	"0"	"90"	"17"	"78078936"	"78078936"	"subst"	"3.89176E-5"	"03294"	"GAA_000471"	"g.78078936G>T"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay; complete skipping of exon 2"	"In vitro (cloned)"	""	""	""	""	""	"g.80105137G>T"	""	"NA"	""
"0000487438"	"0"	"10"	"17"	"78078955"	"78078955"	"subst"	"3.18866E-5"	"03294"	"GAA_000496"	"g.78078955G>A"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80105156G>A"	""	"NA"	""
"0000487439"	"0"	"10"	"17"	"78078976"	"78078976"	"subst"	"0"	"03294"	"GAA_000472"	"g.78078976G>C"	""	"Dardis 2019, submitted"	""	""	"functional analysis using expression cloning in minigene splicing assay"	"In vitro (cloned)"	""	""	""	""	""	"g.80105177G>C"	""	"NA"	""
"0000500691"	"0"	"50"	"17"	"78079666"	"78079666"	"subst"	"0"	"03362"	"GAA_000263"	"g.78079666T>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Germline/De novo (untested)"	""	"ss2137543935"	"0"	""	""	"g.80107891C>T"	""	"VUS"	""
"0000500692"	"0"	"50"	"17"	"78079693"	"78079693"	"subst"	"0"	"03362"	"GAA_000722"	"g.78079693T>C"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Germline/De novo (untested)"	""	"ss3654261701"	"0"	""	""	"g.80110027A>G"	""	"VUS"	""
"0000500693"	"0"	"90"	"17"	"78079694"	"78079694"	"subst"	"0"	"03362"	"GAA_000725"	"g.78079694G>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261702"	"0"	""	""	"g.80108522G>A"	""	"pathogenic (recessive)"	""
"0000500694"	"0"	"90"	"17"	"78081354"	"78081354"	"subst"	"0"	"03362"	"GAA_000726"	"g.78081354A>C"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261703"	"0"	""	""	"g.80108527C>G"	""	"pathogenic (recessive)"	""
"0000500695"	"0"	"90"	"17"	"78081429"	"78081447"	"del"	"0"	"03362"	"GAA_000729"	"g.78081429_78081447del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261704"	"0"	""	""	"g.80112948C>G"	""	"pathogenic (recessive)"	""
"0000500696"	"0"	"70"	"17"	"78081618"	"78081618"	"subst"	"0"	"03362"	"GAA_000732"	"g.78081618G>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261705"	"0"	""	""	"g.80105895G>T"	""	"likely pathogenic"	""
"0000500697"	"0"	"50"	"17"	"78081670"	"78081672"	"del"	"0"	"03362"	"GAA_000734"	"g.78081670_78081672del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261706"	"0"	""	""	"g.80110766C>T"	""	"VUS"	""
"0000500698"	"0"	"50"	"17"	"78081690"	"78081690"	"subst"	"0"	"03362"	"GAA_000735"	"g.78081690C>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261707"	"0"	""	""	"g.80110815A>T"	""	"VUS"	""
"0000500699"	"0"	"90"	"17"	"78082127"	"78082128"	"ins"	"0"	"03362"	"GAA_000737"	"g.78082127_78082128insTT"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261708"	"0"	""	""	"g.80113216A>G"	""	"pathogenic (recessive)"	""
"0000500700"	"0"	"70"	"17"	"78082321"	"78082321"	"subst"	"0"	"03362"	"GAA_000738"	"g.78082321G>A"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261709"	"0"	""	""	"g.80107555A>C"	""	"likely pathogenic"	""
"0000500701"	"0"	"70"	"17"	"78082326"	"78082326"	"subst"	"0"	"03362"	"GAA_000739"	"g.78082326C>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261710"	"0"	""	""	"g.80107630_80107648del"	""	"likely pathogenic"	""
"0000500702"	"0"	"70"	"17"	"78082326"	"78082326"	"subst"	"0"	"03362"	"GAA_000740"	"g.78082326C>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261711"	"0"	""	""	"g.80108328_80108329insTT"	""	"likely pathogenic"	""
"0000500703"	"0"	"70"	"17"	"78082333"	"78082333"	"subst"	"0"	"03362"	"GAA_000741"	"g.78082333G>A"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261712"	"0"	""	""	"g.80110006_80110024del"	""	"likely pathogenic"	""
"0000500704"	"0"	"70"	"17"	"78082512"	"78082512"	"subst"	"0"	"03362"	"GAA_000742"	"g.78082512A>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261713"	"0"	""	""	"g.80112027_80112045dup"	""	"likely pathogenic"	""
"0000500705"	"0"	"90"	"17"	"78083805"	"78083823"	"del"	"0"	"03362"	"GAA_000743"	"g.78083805_78083823del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261714"	"0"	""	""	"g.80113261dup"	""	"pathogenic (recessive)"	""
"0000500853"	"0"	"50"	"17"	"78083826"	"78083826"	"subst"	"0"	"03362"	"GAA_000744"	"g.78083826A>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261715"	"0"	""	""	"g.80110948A>G"	""	"VUS"	""
"0000500854"	"0"	"50"	"17"	"78084565"	"78084565"	"subst"	"0"	"03362"	"GAA_000745"	"g.78084565C>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261717"	"0"	""	""	"g.80110843A>T"	""	"VUS"	""
"0000500855"	"0"	"50"	"17"	"78084614"	"78084614"	"subst"	"0"	"03362"	"GAA_000746"	"g.78084614A>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261718"	"0"	""	""	"g.80112662G>C"	""	"VUS"	""
"0000500856"	"0"	"50"	"17"	"78084747"	"78084747"	"subst"	"0"	"03362"	"GAA_000749"	"g.78084747A>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261719"	"0"	""	""	"g.80112699_80112701del"	""	"VUS"	""
"0000500857"	"0"	"50"	"17"	"78084642"	"78084642"	"subst"	"0"	"03362"	"GAA_000747"	"g.78084642A>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261720"	"0"	""	""	"g.80112016T>G"	""	"VUS"	""
"0000500858"	"0"	"70"	"17"	"78085815"	"78085815"	"subst"	"0"	"03362"	"GAA_000750"	"g.78085815T>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261721"	"0"	""	""	"g.80112101dup"	""	"likely pathogenic"	""
"0000500859"	"0"	"90"	"17"	"78085826"	"78085844"	"dup"	"0"	"03362"	"GAA_000751"	"g.78085826_78085844dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261722"	"0"	""	""	"g.80113286del"	""	"pathogenic (recessive)"	""
"0000500860"	"0"	"90"	"17"	"78085900"	"78085900"	"dup"	"0"	"03362"	"GAA_000752"	"g.78085900dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261723"	"0"	""	""	"g.80108527C>T"	""	"pathogenic (recessive)"	""
"0000500861"	"0"	"70"	"17"	"78086447"	"78086447"	"subst"	"0"	"03362"	"GAA_000753"	"g.78086447T>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261724"	"0"	""	""	"g.80112670dup"	""	"likely pathogenic"	""
"0000500862"	"0"	"90"	"17"	"78086469"	"78086469"	"dup"	"0"	"03362"	"GAA_000755"	"g.78086469dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261726"	"0"	""	""	"g.80113330_80113333delinsACGCCG"	""	"pathogenic (recessive)"	""
"0000500863"	"0"	"50"	"17"	"78086461"	"78086461"	"subst"	"0"	"03362"	"GAA_000754"	"g.78086461G>C"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261725"	"0"	""	""	"g.80113007C>T"	""	"VUS"	""
"0000500864"	"0"	"50"	"17"	"78086498"	"78086500"	"del"	"0"	"03362"	"GAA_000756"	"g.78086498_78086500del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261727"	"0"	""	""	"g.80117015G>T"	""	"VUS"	""
"0000500865"	"0"	"90"	"17"	"78086730"	"78086736"	"del"	"0"	"03362"	"GAA_000757"	"g.78086730_78086736del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261728"	"0"	""	""	"g.80117036_80117037insC"	""	"pathogenic (recessive)"	""
"0000500866"	"0"	"90"	"17"	"78086747"	"78086747"	"subst"	"0"	"03362"	"GAA_000758"	"g.78086747C>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261729"	"0"	""	""	"g.80117039dup"	""	"pathogenic (recessive)"	""
"0000500867"	"0"	"50"	"17"	"78086806"	"78086806"	"subst"	"0"	"03362"	"GAA_000759"	"g.78086806C>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261730"	"0"	""	""	"g.80113273T>C"	""	"VUS"	""
"0000500868"	"0"	"90"	"17"	"78087015"	"78087015"	"subst"	"0"	"03362"	"GAA_000760"	"g.78087015A>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261731"	"0"	""	""	"g.80108534G>A"	""	"pathogenic (recessive)"	""
"0000500869"	"0"	"90"	"17"	"78087060"	"78087060"	"dup"	"0"	"03362"	"GAA_000761"	"g.78087060dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261732"	"0"	""	""	"g.80117675C>T"	""	"pathogenic (recessive)"	""
"0000500870"	"0"	"50"	"17"	"78087072"	"78087072"	"subst"	"0"	"03362"	"GAA_000762"	"g.78087072T>C"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261733"	"0"	""	""	"g.80113323G>C"	""	"VUS"	""
"0000500872"	"0"	"90"	"17"	"78087085"	"78087085"	"del"	"0"	"03362"	"GAA_000763"	"g.78087085del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261734"	"0"	""	""	"g.80117728dup"	""	"pathogenic (recessive)"	""
"0000500873"	"0"	"50"	"17"	"78087122"	"78087122"	"subst"	"0"	"03362"	"GAA_000764"	"g.78087122G>C"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261735"	"0"	""	""	"g.80117018G>A"	""	"VUS"	""
"0000500874"	"0"	"90"	"17"	"78087129"	"78087132"	"del"	"0"	"03362"	"GAA_000765"	"g.78087129_78087132delinsACGCCG"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261736"	"0"	""	""	"g.80118226C>T"	""	"pathogenic (recessive)"	""
"0000500875"	"0"	"70"	"17"	"78090814"	"78090814"	"subst"	"6.91591E-5"	"03362"	"GAA_000424"	"g.78090814G>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261738"	"0"	""	""	"g.80112931_80112937del"	""	"likely pathogenic"	""
"0000500876"	"0"	"50"	"17"	"78090817"	"78090817"	"subst"	"0"	"03362"	"GAA_000766"	"g.78090817G>A"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261738"	"0"	""	""	"g.80117210del"	""	"VUS"	""
"0000500877"	"0"	"90"	"17"	"78090838"	"78090838"	"dup"	"0"	"03362"	"GAA_000724"	"g.78090838dup"	""	"manuscript submitted, 2019"	""	"2258_2259insC"	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261739"	"0"	""	""	"g.78090838dup"	""	"pathogenic (recessive)"	""
"0000500878"	"0"	"90"	"17"	"78090838"	"78090838"	"dup"	"0"	"03362"	"GAA_000724"	"g.78090838dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261740"	"0"	""	""	"g.80118330C>G"	""	"pathogenic (recessive)"	""
"0000500879"	"0"	"50"	"17"	"78091009"	"78091009"	"del"	"0"	"03362"	"GAA_000768"	"g.78091009del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261741"	"0"	""	""	"g.80112648T>G"	""	"VUS"	""
"0000500880"	"0"	"90"	"17"	"78091474"	"78091474"	"subst"	"0"	"03362"	"GAA_000770"	"g.78091474C>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261742"	"0"	""	""	"g.80118661_80118662del"	""	"pathogenic (recessive)"	""
"0000500881"	"0"	"50"	"17"	"78091526"	"78091528"	"del"	"0"	"03362"	"GAA_000771"	"g.78091526_78091528del"	""	"manuscript submitted, 2019"	""	""	""	"Unknown"	""	"ss3654261743"	"0"	""	""	"g.80117727_80117729del"	""	"VUS"	""
"0000500882"	"0"	"90"	"17"	"78091527"	"78091527"	"dup"	"0"	"03362"	"GAA_000772"	"g.78091527dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261744"	"0"	""	""	"g.80118746dup"	""	"pathogenic (recessive)"	""
"0000500883"	"0"	"50"	"17"	"78091547"	"78091547"	"subst"	"0"	"03362"	"GAA_000773"	"g.78091547A>G"	""	"manuscript submitted, 2019"	""	""	""	"Unknown"	""	"ss3654261745"	"0"	""	""	"g.80117748A>G"	""	"VUS"	""
"0000500884"	"0"	"90"	"17"	"78092025"	"78092025"	"subst"	"0"	"03362"	"GAA_000776"	"g.78092025C>T"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261746"	"0"	""	""	"g.80118748dup"	""	"pathogenic (recessive)"	""
"0000500885"	"0"	"90"	"17"	"78092129"	"78092129"	"subst"	"0"	"03362"	"GAA_000777"	"g.78092129C>G"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261747"	"0"	""	""	"g.80118763del"	""	"pathogenic (recessive)"	""
"0000500886"	"0"	"90"	"17"	"78092460"	"78092461"	"del"	"0"	"03362"	"GAA_000778"	"g.78092460_78092461del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261748"	"0"	""	""	"g.80118763del"	""	"pathogenic (recessive)"	""
"0000500887"	"0"	"50"	"17"	"78092525"	"78092525"	"subst"	"0"	"03362"	"GAA_000779"	"g.78092525T>C"	""	"manuscript submitted, 2019"	""	""	""	"Unknown"	""	"ss3654261749"	"0"	""	""	"g.80118726T>C"	""	"VUS"	""
"0000500888"	"0"	"90"	"17"	"78092545"	"78092545"	"dup"	"0"	"03362"	"GAA_000780"	"g.78092545dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261750"	"0"	""	""	"g.80119271G>C"	""	"pathogenic (recessive)"	""
"0000500890"	"0"	"90"	"17"	"78092547"	"78092547"	"dup"	"0"	"03362"	"GAA_000781"	"g.78092547dup"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261751"	"0"	""	""	"g.80105867T>G"	""	"pathogenic (recessive)"	""
"0000500891"	"0"	"90"	"17"	"78092562"	"78092562"	"del"	"0"	"03362"	"GAA_000782"	"g.78092562del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261752"	"0"	""	""	"g.80105894T>C"	""	"pathogenic (recessive)"	""
"0000500892"	"0"	"90"	"17"	"78092562"	"78092562"	"del"	"0"	"03362"	"GAA_000782"	"g.78092562del"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261752"	"0"	""	""	"g.80107871_80107873del"	""	"pathogenic (recessive)"	""
"0000500893"	"0"	"90"	"17"	"78093070"	"78093070"	"subst"	"0"	"03362"	"GAA_000783"	"g.78093070G>C"	""	"manuscript submitted, 2019"	""	""	"Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message."	"Unknown"	""	"ss3654261753"	"0"	""	""	"g.80108713A>T"	""	"pathogenic (recessive)"	""
"0000563485"	"0"	"90"	"17"	"78071151"	"78071151"	"del"	"0"	"02327"	"CCDC40_000166"	"g.78071151del"	""	""	""	"CCDC40(NM_017950.4):c.3129delC (p.F1044Sfs*35)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80097352del"	""	"pathogenic"	""
"0000563488"	"0"	"50"	"17"	"78073485"	"78073485"	"subst"	"0.0147683"	"01943"	"CCDC40_000094"	"g.78073485G>A"	""	""	""	"CCDC40(NM_017950.3):c.3340G>A (p.V1114M, p.(Val1114Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80099686G>A"	""	"VUS"	""
"0000563491"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01804"	"GAA_000029"	"g.78078341T>G"	""	""	""	"GAA(NM_000152.3):c.-32-13T>G (p.(=)), GAA(NM_000152.5):c.-32-13T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000563492"	"0"	"90"	"17"	"78078571"	"78078581"	"dup"	"0"	"01943"	"GAA_000447"	"g.78078571_78078581dup"	""	""	""	"GAA(NM_000152.3):c.186_196dupACCAGGGCCCC (p.R66Hfs*80)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80104772_80104782dup"	""	"pathogenic"	""
"0000563495"	"0"	"50"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"02327"	"GAA_000003"	"g.78078656G>A"	""	""	""	"GAA(NM_000152.3):c.271G>A (p.D91N, p.(Asp91Asn)), GAA(NM_000152.5):c.271G>A (p.D91N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80104857G>A"	""	"VUS"	""
"0000563496"	"0"	"10"	"17"	"78078709"	"78078709"	"subst"	"0.723765"	"02327"	"GAA_000002"	"g.78078709T>C"	""	""	""	"GAA(NM_000152.3):c.324T>C (p.C108=), GAA(NM_000152.5):c.324T>C (p.C108=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80104910T>C"	""	"benign"	""
"0000563497"	"0"	"10"	"17"	"78078832"	"78078832"	"subst"	"0.00500256"	"01943"	"GAA_000457"	"g.78078832G>A"	""	""	""	"GAA(NM_000152.3):c.447G>A (p.T149=, p.(Thr149=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105033G>A"	""	"benign"	""
"0000563498"	"0"	"30"	"17"	"78078832"	"78078832"	"subst"	"0.00500256"	"01804"	"GAA_000457"	"g.78078832G>A"	""	""	""	"GAA(NM_000152.3):c.447G>A (p.T149=, p.(Thr149=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105033G>A"	""	"likely benign"	""
"0000563499"	"0"	"30"	"17"	"78078832"	"78078832"	"subst"	"0.00500256"	"02326"	"GAA_000457"	"g.78078832G>A"	""	""	""	"GAA(NM_000152.3):c.447G>A (p.T149=, p.(Thr149=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105033G>A"	""	"likely benign"	""
"0000563500"	"0"	"90"	"17"	"78078850"	"78078850"	"dup"	"0"	"01943"	"CCDC40_000170"	"g.78078850dup"	""	""	""	"GAA(NM_000152.3):c.465dupC (p.T156Hfs*21)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105051dup"	""	"pathogenic"	""
"0000563501"	"0"	"30"	"17"	"78078918"	"78078918"	"subst"	"1.70691E-5"	"01804"	"GAA_000465"	"g.78078918G>A"	""	""	""	"GAA(NM_000152.3):c.533G>A (p.(Arg178His))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105119G>A"	""	"likely benign"	""
"0000563502"	"0"	"10"	"17"	"78079509"	"78079509"	"subst"	"0.669225"	"02327"	"GAA_000474"	"g.78079509T>G"	""	""	""	"GAA(NM_000152.3):c.547-39T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105710T>G"	""	"benign"	""
"0000563503"	"0"	"10"	"17"	"78079509"	"78079509"	"subst"	"0.669225"	"02326"	"GAA_000474"	"g.78079509T>G"	""	""	""	"GAA(NM_000152.3):c.547-39T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105710T>G"	""	"benign"	""
"0000563504"	"0"	"10"	"17"	"78079544"	"78079544"	"subst"	"0.669863"	"02327"	"GAA_000258"	"g.78079544C>G"	""	""	""	"GAA(NM_000152.3):c.547-4C>G, GAA(NM_000152.5):c.547-4C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105745C>G"	""	"benign"	""
"0000563505"	"0"	"10"	"17"	"78079597"	"78079597"	"subst"	"0.668641"	"02327"	"GAA_000004"	"g.78079597A>G"	""	""	""	"GAA(NM_000152.3):c.596A>G (p.H199R), GAA(NM_000152.5):c.596A>G (p.H199R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105798A>G"	""	"benign"	""
"0000563506"	"0"	"10"	"17"	"78079659"	"78079659"	"subst"	"7.91752E-5"	"01943"	"GAA_000261"	"g.78079659G>T"	""	""	""	"GAA(NM_000152.3):c.658G>T (p.V220L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105860G>T"	""	"benign"	""
"0000563507"	"0"	"50"	"17"	"78079659"	"78079659"	"subst"	"7.91752E-5"	"02326"	"GAA_000261"	"g.78079659G>T"	""	""	""	"GAA(NM_000152.3):c.658G>T (p.V220L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105860G>T"	""	"VUS"	""
"0000563508"	"0"	"10"	"17"	"78079669"	"78079669"	"subst"	"0.667522"	"02327"	"GAA_000038"	"g.78079669G>A"	""	""	""	"GAA(NM_000152.3):c.668G>A (p.R223H), GAA(NM_000152.5):c.668G>A (p.R223H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105870G>A"	""	"benign"	""
"0000563510"	"0"	"30"	"17"	"78081389"	"78081389"	"subst"	"0.000243861"	"01804"	"GAA_000728"	"g.78081389G>A"	""	""	""	"GAA(NM_000152.3):c.726G>A (p.(Ala242=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107590G>A"	""	"likely benign"	""
"0000563511"	"0"	"50"	"17"	"78081514"	"78081514"	"subst"	"3.0168E-5"	"01804"	"GAA_000730"	"g.78081514C>T"	""	""	""	"GAA(NM_000152.3):c.851C>T (p.(Ala284Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107715C>T"	""	"VUS"	""
"0000563513"	"0"	"10"	"17"	"78081528"	"78081529"	"ins"	"0.665858"	"02327"	"GAA_000272"	"g.78081528_78081529insAGCGGGC"	""	""	""	"GAA(NM_000152.3):c.858+5_858+6insGCAGCGG, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC (p.(=)), GAA(NM_00015...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107729_80107730insAGCGGGC"	""	"benign"	""
"0000563514"	"0"	"10"	"17"	"78081528"	"78081529"	"ins"	"0.665858"	"02325"	"GAA_000272"	"g.78081528_78081529insAGCGGGC"	""	""	""	"GAA(NM_000152.3):c.858+5_858+6insGCAGCGG, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC (p.(=)), GAA(NM_00015...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107729_80107730insAGCGGGC"	""	"benign"	""
"0000563515"	"0"	"30"	"17"	"78081528"	"78081529"	"ins"	"0.665858"	"01943"	"GAA_000272"	"g.78081528_78081529insAGCGGGC"	""	""	""	"GAA(NM_000152.3):c.858+5_858+6insGCAGCGG, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC (p.(=)), GAA(NM_00015...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107729_80107730insAGCGGGC"	""	"likely benign"	""
"0000563516"	"0"	"10"	"17"	"78081551"	"78081551"	"subst"	"0.662574"	"02327"	"GAA_000275"	"g.78081551T>C"	""	""	""	"GAA(NM_000152.3):c.858+30T>C, GAA(NM_000152.5):c.858+30T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107752T>C"	""	"benign"	""
"0000563517"	"0"	"50"	"17"	"78081652"	"78081652"	"subst"	"3.71892E-5"	"01943"	"GAA_000733"	"g.78081652C>T"	""	""	""	"GAA(NM_000152.3):c.912C>T (p.G304=, p.(Gly304=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107853C>T"	""	"VUS"	""
"0000563518"	"0"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"02327"	"GAA_000018"	"g.78081661A>T"	""	""	""	"GAA(NM_000152.3):c.921A>T (p.A307=), GAA(NM_000152.5):c.921A>T (p.A307=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107862A>T"	""	"benign"	""
"0000563519"	"0"	"10"	"17"	"78081707"	"78081707"	"subst"	"0.695957"	"02327"	"GAA_000282"	"g.78081707G>A"	""	""	""	"GAA(NM_000152.3):c.955+12G>A, GAA(NM_000152.5):c.955+12G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107908G>A"	""	"benign"	""
"0000563520"	"0"	"90"	"17"	"78082087"	"78082087"	"subst"	"0"	"02326"	"GAA_000736"	"g.78082087A>G"	""	""	""	"GAA(NM_000152.3):c.956-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80108288A>G"	""	"pathogenic"	""
"0000563521"	"0"	"30"	"17"	"78082221"	"78082221"	"subst"	"0.0104313"	"01804"	"GAA_000286"	"g.78082221C>T"	""	""	""	"GAA(NM_000152.3):c.1075+13C>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80108422C>T"	""	"likely benign"	""
"0000563522"	"0"	"50"	"17"	"78082409"	"78082409"	"subst"	"0.000159961"	"02326"	"GAA_000397"	"g.78082409G>C"	""	""	""	"GAA(NM_000152.3):c.1194+3G>C (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80108610G>C"	""	"VUS"	""
"0000563523"	"0"	"10"	"17"	"78082504"	"78082504"	"subst"	"0.670503"	"02327"	"GAA_000006"	"g.78082504G>A"	""	""	""	"GAA(NM_000152.3):c.1203G>A (p.Q401=), GAA(NM_000152.5):c.1203G>A (p.Q401=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80108705G>A"	""	"benign"	""
"0000563524"	"0"	"10"	"17"	"78083726"	"78083726"	"subst"	"0.721259"	"02327"	"GAA_000295"	"g.78083726A>G"	""	""	""	"GAA(NM_000152.3):c.1327-18A>G, GAA(NM_000152.5):c.1327-18A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80109927A>G"	""	"benign"	""
"0000563525"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"02327"	"GAA_000019"	"g.78083791C>T"	""	""	""	"GAA(NM_000152.3):c.1374C>T (p.Y458=), GAA(NM_000152.5):c.1374C>T (p.Y458=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80109992C>T"	""	"benign"	""
"0000563526"	"0"	"10"	"17"	"78084507"	"78084507"	"subst"	"0.67069"	"02327"	"GAA_000300"	"g.78084507G>C"	""	""	""	"GAA(NM_000152.3):c.1438-19G>C, GAA(NM_000152.5):c.1438-19G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110708G>C"	""	"benign"	""
"0000563527"	"0"	"90"	"17"	"78084642"	"78084643"	"ins"	"0"	"02326"	"GAA_000748"	"g.78084642_78084643insT"	""	""	""	"GAA(NM_000152.3):c.1551+3_1551+4insT"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110843_80110844insT"	""	"pathogenic"	""
"0000563528"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"01943"	"GAA_000008"	"g.78084769G>A"	""	""	""	"GAA(NM_000152.3):c.1581G>A (p.R527=), GAA(NM_000152.5):c.1581G>A (p.R527=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110970G>A"	""	"benign"	""
"0000563529"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"02325"	"GAA_000008"	"g.78084769G>A"	""	""	""	"GAA(NM_000152.3):c.1581G>A (p.R527=), GAA(NM_000152.5):c.1581G>A (p.R527=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110970G>A"	""	"benign"	""
"0000563530"	"0"	"10"	"17"	"78084769"	"78084769"	"subst"	"0.232674"	"02326"	"GAA_000008"	"g.78084769G>A"	""	""	""	"GAA(NM_000152.3):c.1581G>A (p.R527=), GAA(NM_000152.5):c.1581G>A (p.R527=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110970G>A"	""	"benign"	""
"0000563531"	"0"	"90"	"17"	"78084822"	"78084822"	"subst"	"1.62796E-5"	"01943"	"GAA_000033"	"g.78084822C>T"	""	""	""	"GAA(NM_000152.3):c.1634C>T (p.P545L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80111023C>T"	""	"pathogenic"	""
"0000563532"	"0"	"90"	"17"	"78085826"	"78085844"	"dup"	"0"	"01943"	"GAA_000751"	"g.78085826_78085844dup"	""	""	""	"GAA(NM_000152.3):c.1681_1699dupAGCCACCAGTTTCTCTCCA (p.T567Kfs*75)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112027_80112045dup"	""	"pathogenic"	""
"0000563533"	"0"	"90"	"17"	"78086424"	"78086424"	"subst"	"0"	"01943"	"GAA_000628"	"g.78086424C>A"	""	""	""	"GAA(NM_000152.3):c.1802C>A (p.S601*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112625C>A"	""	"pathogenic"	""
"0000563534"	"0"	"30"	"17"	"78086452"	"78086452"	"subst"	"0.00134355"	"01804"	"GAA_000141"	"g.78086452C>T"	""	""	""	"GAA(NM_000152.3):c.1830C>T (p.A610=, p.(Ala610=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112653C>T"	""	"likely benign"	""
"0000563535"	"0"	"90"	"17"	"78086475"	"78086475"	"subst"	"4.21358E-6"	"01943"	"GAA_000353"	"g.78086475G>A"	""	""	""	"GAA(NM_000152.3):c.1853G>A (p.W618*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112676G>A"	""	"pathogenic"	""
"0000563536"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01943"	"GAA_000068"	"g.78086719G>A"	""	""	""	"GAA(NM_000152.3):c.1933G>A (p.D645N, p.(Asp645Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112920G>A"	""	"pathogenic"	""
"0000563537"	"0"	"50"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"02326"	"GAA_000068"	"g.78086719G>A"	""	""	""	"GAA(NM_000152.3):c.1933G>A (p.D645N, p.(Asp645Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112920G>A"	""	"VUS"	""
"0000563538"	"0"	"90"	"17"	"78086765"	"78086765"	"subst"	"0"	"01943"	"GAA_000116"	"g.78086765G>A"	""	""	""	"GAA(NM_000152.3):c.1979G>A (p.R660H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80112966G>A"	""	"pathogenic"	""
"0000563539"	"0"	"10"	"17"	"78086846"	"78086846"	"subst"	"0.719557"	"02327"	"GAA_000327"	"g.78086846A>G"	""	""	""	"GAA(NM_000152.3):c.2040+20A>G, GAA(NM_000152.5):c.2040+20A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113047A>G"	""	"benign"	""
"0000563540"	"0"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"01943"	"GAA_000035"	"g.78087041G>A"	""	""	""	"GAA(NM_000152.3):c.2065G>A (p.E689K), GAA(NM_000152.5):c.2065G>A (p.(Glu689Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113242G>A"	""	"benign"	""
"0000563541"	"0"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"02326"	"GAA_000035"	"g.78087041G>A"	""	""	""	"GAA(NM_000152.3):c.2065G>A (p.E689K), GAA(NM_000152.5):c.2065G>A (p.(Glu689Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113242G>A"	""	"benign"	""
"0000563542"	"0"	"90"	"17"	"78087054"	"78087054"	"dup"	"0"	"01943"	"GAA_000664"	"g.78087054dup"	""	""	""	"GAA(NM_000152.3):c.2078dupA (p.A694Gfs*43)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113255dup"	""	"pathogenic"	""
"0000563543"	"0"	"50"	"17"	"78087081"	"78087081"	"subst"	"5.51369E-5"	"02327"	"GAA_000227"	"g.78087081G>A"	""	""	""	"GAA(NM_000152.3):c.2105G>A (p.R702H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113282G>A"	""	"VUS"	""
"0000563544"	"0"	"50"	"17"	"78090889"	"78090889"	"subst"	"0"	"01804"	"GAA_000767"	"g.78090889C>T"	""	""	""	"GAA(NM_000152.3):c.2312C>T (p.(Thr771Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117090C>T"	""	"VUS"	""
"0000563545"	"0"	"10"	"17"	"78090928"	"78090928"	"subst"	"0.741984"	"02327"	"GAA_000338"	"g.78090928G>A"	""	""	""	"GAA(NM_000152.3):c.2331+20G>A, GAA(NM_000152.5):c.2331+20G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117129G>A"	""	"benign"	""
"0000563546"	"0"	"10"	"17"	"78091405"	"78091405"	"subst"	"0.718163"	"02327"	"GAA_000009"	"g.78091405G>A"	""	""	""	"GAA(NM_000152.3):c.2338G>A (p.V780I), GAA(NM_000152.5):c.2338G>A (p.V780I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117606G>A"	""	"benign"	""
"0000563547"	"0"	"30"	"17"	"78091459"	"78091459"	"subst"	"2.04787E-5"	"01804"	"GAA_000769"	"g.78091459A>G"	""	""	""	"GAA(NM_000152.3):c.2392A>G (p.(Ile798Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117660A>G"	""	"likely benign"	""
"0000563548"	"0"	"30"	"17"	"78091564"	"78091564"	"subst"	"0.00227383"	"01943"	"GAA_000774"	"g.78091564G>A"	""	""	""	"GAA(NM_000152.3):c.2481+16G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117765G>A"	""	"likely benign"	""
"0000563549"	"0"	"30"	"17"	"78091564"	"78091564"	"subst"	"0.00227383"	"01804"	"GAA_000774"	"g.78091564G>A"	""	""	""	"GAA(NM_000152.3):c.2481+16G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117765G>A"	""	"likely benign"	""
"0000563550"	"0"	"10"	"17"	"78091902"	"78091902"	"dup"	"0"	"01943"	"GAA_000775"	"g.78091902dup"	""	""	""	"GAA(NM_000152.3):c.2482-90dupG"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118103dup"	""	"benign"	""
"0000563551"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"02325"	"GAA_000010"	"g.78092063G>A"	""	""	""	"GAA(NM_000152.3):c.2553G>A (p.G851=), GAA(NM_000152.5):c.2553G>A (p.G851=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118264G>A"	""	"benign"	""
"0000563552"	"0"	"10"	"17"	"78092063"	"78092063"	"subst"	"0.572461"	"02326"	"GAA_000010"	"g.78092063G>A"	""	""	""	"GAA(NM_000152.3):c.2553G>A (p.G851=), GAA(NM_000152.5):c.2553G>A (p.G851=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118264G>A"	""	"benign"	""
"0000563553"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"02327"	"GAA_000025"	"g.78092070C>T"	""	""	""	"GAA(NM_000152.3):c.2560C>T (p.R854*), GAA(NM_000152.5):c.2560C>T (p.(Arg854Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118271C>T"	""	"pathogenic"	""
"0000563554"	"0"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"01943"	"GAA_000234"	"g.78092118C>T"	""	""	""	"GAA(NM_000152.3):c.2608C>T (p.R870*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118319C>T"	""	"pathogenic"	""
"0000563555"	"0"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"02326"	"GAA_000234"	"g.78092118C>T"	""	""	""	"GAA(NM_000152.3):c.2608C>T (p.R870*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118319C>T"	""	"pathogenic"	""
"0000563556"	"0"	"30"	"17"	"78092544"	"78092544"	"subst"	"2.44166E-5"	"02326"	"GAA_000443"	"g.78092544C>G"	""	""	""	"GAA(NM_000152.3):c.2739C>G (p.P913=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118745C>G"	""	"likely benign"	""
"0000563557"	"0"	"90"	"17"	"78092545"	"78092545"	"dup"	"0"	"01943"	"GAA_000780"	"g.78092545dup"	""	""	""	"GAA(NM_000152.3):c.2740dupC (p.Q914Pfs*104)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118746dup"	""	"pathogenic"	""
"0000563558"	"0"	"90"	"17"	"78092547"	"78092547"	"dup"	"0"	"01943"	"GAA_000781"	"g.78092547dup"	""	""	""	"GAA(NM_000152.3):c.2742dupG (p.Q915Afs*103)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118748dup"	""	"pathogenic"	""
"0000577984"	"0"	"70"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"01164"	"GAA_000029"	"g.78078341T>G"	""	""	""	""	"reported in Huie  1994. Hum Mol Genet 3: 2231; Dardis  2014. Nucleic Acids Res 42: 1291; Sacconi  2014. Neuromuscul Disord 24: 648"	"Germline"	""	"rs386834236"	"0"	""	""	"g.80104542T>G"	""	"likely pathogenic"	"ACMG"
"0000577985"	"0"	"70"	"17"	"78081617"	"78081617"	"subst"	"1.65721E-5"	"01164"	"GAA_000126"	"g.78081617G>A"	""	""	""	""	"ACMG grading: PM2,PP5,PS3; reported in Hermans  2004. Hum Mutat 23: 47; Beltran Papsdorf  2014. Neurology 82: 73"	"Germline"	""	"rs121907945"	"0"	""	""	"g.80107818G>A"	""	"likely pathogenic"	"ACMG"
"0000616880"	"0"	"50"	"17"	"78078519"	"78078519"	"subst"	"4.1375E-6"	"02327"	"CCDC40_000176"	"g.78078519C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80104720C>T"	""	"VUS"	""
"0000616881"	"0"	"30"	"17"	"78078650"	"78078650"	"subst"	"0.000258264"	"02327"	"CCDC40_000177"	"g.78078650C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80104851C>T"	""	"likely benign"	""
"0000616882"	"0"	"50"	"17"	"78078805"	"78078805"	"subst"	"1.23258E-5"	"01804"	"GAA_000376"	"g.78078805C>A"	""	""	""	"GAA(NM_000152.3):c.420C>A (p.(Asn140Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105006C>A"	""	"VUS"	""
"0000616883"	"0"	"30"	"17"	"78079632"	"78079632"	"subst"	"6.18638E-5"	"02327"	"GAA_000784"	"g.78079632G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105833G>A"	""	"likely benign"	""
"0000616884"	"0"	"50"	"17"	"78081636"	"78081636"	"subst"	"0"	"02327"	"GAA_000221"	"g.78081636T>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80107837T>C"	""	"VUS"	""
"0000616886"	"0"	"30"	"17"	"78082566"	"78082566"	"subst"	"0.000241221"	"02327"	"GAA_000294"	"g.78082566G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80108767G>A"	""	"likely benign"	""
"0000616887"	"0"	"30"	"17"	"78083862"	"78083862"	"subst"	"0.000118862"	"01804"	"GAA_000785"	"g.78083862G>A"	""	""	""	"GAA(NM_000152.3):c.1437+8G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110063G>A"	""	"likely benign"	""
"0000616888"	"0"	"70"	"17"	"78084552"	"78084552"	"dup"	"0"	"02327"	"GAA_000302"	"g.78084552dup"	""	""	""	"GAA(NM_000152.3):c.1464dupC (p.D489Rfs*17)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110753dup"	""	"likely pathogenic"	""
"0000616889"	"0"	"30"	"17"	"78084624"	"78084624"	"subst"	"4.06309E-6"	"02327"	"GAA_000786"	"g.78084624C>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80110825C>A"	""	"likely benign"	""
"0000616890"	"0"	"30"	"17"	"78084832"	"78084832"	"subst"	"4.899E-5"	"02327"	"GAA_000787"	"g.78084832C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80111033C>T"	""	"likely benign"	""
"0000616891"	"0"	"90"	"17"	"78086810"	"78086812"	"del"	"0"	"02327"	"GAA_000654"	"g.78086810_78086812del"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113011_80113013del"	""	"pathogenic"	""
"0000616892"	"0"	"30"	"17"	"78090763"	"78090763"	"subst"	"7.33759E-5"	"02326"	"GAA_000788"	"g.78090763G>A"	""	""	""	"GAA(NM_000152.3):c.2190-4G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80116964G>A"	""	"likely benign"	""
"0000616893"	"0"	"30"	"17"	"78090779"	"78090779"	"subst"	"0"	"02327"	"GAA_000789"	"g.78090779C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80116980C>T"	""	"likely benign"	""
"0000616894"	"0"	"70"	"17"	"78090814"	"78090814"	"subst"	"6.10227E-5"	"02327"	"GAA_000225"	"g.78090814G>C"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80117015G>C"	""	"likely pathogenic"	""
"0000616895"	"0"	"30"	"17"	"78092054"	"78092054"	"subst"	"8.20116E-6"	"02327"	"GAA_000790"	"g.78092054C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118255C>T"	""	"likely benign"	""
"0000616896"	"0"	"30"	"17"	"78092457"	"78092457"	"subst"	"0.000429083"	"02327"	"GAA_000442"	"g.78092457G>A"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118658G>A"	""	"likely benign"	""
"0000616897"	"0"	"30"	"17"	"78092585"	"78092585"	"subst"	"0.0186771"	"01804"	"GAA_000026"	"g.78092585C>T"	""	""	""	"GAA(NM_000152.3):c.2780C>T (p.(Thr927Ile), p.T927I)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80118786C>T"	""	"likely benign"	""
"0000616898"	"0"	"50"	"17"	"78093090"	"78093090"	"subst"	"4.06134E-6"	"02327"	"GAA_000791"	"g.78093090C>T"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80119291C>T"	""	"VUS"	""
"0000629481"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Reddy 2017:27708273}"	""	""	""	"Germline"	""	"rs386834236"	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000629482"	"1"	"90"	"17"	"78086463"	"78086463"	"subst"	"1.66199E-5"	"00006"	"GAA_000224"	"g.78086463C>A"	""	"{PMID:Reddy 2017:27708273}"	""	""	""	"Germline"	""	"rs369531647"	"0"	""	""	"g.80112664C>A"	""	"pathogenic (recessive)"	""
"0000629612"	"1"	"70"	"17"	"78086444"	"78086444"	"subst"	"1.24408E-5"	"00006"	"GAA_000318"	"g.78086444C>T"	"1/209 cases"	"{PMID:Park 2017:27363342}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.80112645C>T"	""	"likely pathogenic (recessive)"	""
"0000629613"	"2"	"70"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"00006"	"GAA_000036"	"g.78090815G>C"	"1/209 cases"	"{PMID:Park 2017:27363342}"	""	""	""	"Germline"	"yes"	""	"0"	""	""	"g.80117016G>C"	""	"likely pathogenic (recessive)"	""
"0000629614"	"1"	"70"	"17"	"78086479"	"78086479"	"subst"	"0"	"00006"	"GAA_000115"	"g.78086479C>G"	"1/209 cases"	"{PMID:Park 2017:27363342}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112680C>G"	""	"likely pathogenic (recessive)"	""
"0000629615"	"2"	"70"	"17"	"78086801"	"78086801"	"subst"	"0"	"00006"	"GAA_000069"	"g.78086801G>A"	"1/209 cases"	"{PMID:Park 2017:27363342}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"likely pathogenic (recessive)"	""
"0000629616"	"1"	"70"	"17"	"78082617"	"78082617"	"subst"	"2.91005E-5"	"00006"	"GAA_000228"	"g.78082617T>A"	"1/209 cases"	"{PMID:Park 2017:27363342}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108818T>A"	""	"likely pathogenic (recessive)"	""
"0000629617"	"2"	"70"	"17"	"78086801"	"78086801"	"subst"	"0"	"00006"	"GAA_000069"	"g.78086801G>A"	"1/209 cases"	"{PMID:Park 2017:27363342}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113002G>A"	""	"likely pathogenic (recessive)"	""
"0000649731"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"03575"	"GAA_000029"	"g.78078341T>G"	"8/2793 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"8 heterozygous, no homozygous; {DB:CLININrs386834236}"	"Germline"	""	"rs386834236"	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	""
"0000649732"	"1"	"10"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"03575"	"GAA_000003"	"g.78078656G>A"	"34/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"34 heterozygous, no homozygous; {DB:CLININrs1800299}"	"Germline"	""	"rs1800299"	"0"	""	""	"g.80104857G>A"	""	"benign"	""
"0000649733"	"1"	"50"	"17"	"78081373"	"78081373"	"subst"	"2.03318E-5"	"03575"	"GAA_000483"	"g.78081373C>T"	"3/2794 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"3 heterozygous, no homozygous; {DB:CLININrs121907944}"	"Germline"	""	"rs121907944"	"0"	""	""	"g.80107574C>T"	""	"VUS"	""
"0000649734"	"1"	"30"	"17"	"78083760"	"78083760"	"subst"	"0.00113529"	"03575"	"GAA_000792"	"g.78083760G>C"	"55/2792 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"55 heterozygous; {DB:CLININrs145712232}"	"Germline"	""	"rs145712232"	"0"	""	""	"g.80109961G>C"	""	"likely benign"	""
"0000649735"	"1"	"70"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"03575"	"GAA_000134"	"g.78084636G>A"	"1/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 heterozygous, no homozygous; {DB:CLININrs140826989}"	"Germline"	""	"rs140826989"	"0"	""	""	"g.80110837G>A"	""	"likely pathogenic"	""
"0000649736"	"1"	"30"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"03575"	"GAA_000045"	"g.78085871G>A"	"199/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"199 heterozygous; {DB:CLININrs1800307}"	"Germline"	""	"rs1800307"	"0"	""	""	"g.80112072G>A"	""	"likely benign"	""
"0000649737"	"1"	"70"	"17"	"78087149"	"78087149"	"subst"	"4.48158E-5"	"03575"	"GAA_000023"	"g.78087149C>T"	"3/2762 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"3 heterozygous, no homozygous; {DB:CLININrs121907938}"	"Germline"	""	"rs121907938"	"0"	""	""	"g.80113350C>T"	""	"likely pathogenic"	""
"0000653385"	"0"	"50"	"17"	"78087078"	"78087078"	"subst"	"0"	"03625"	"GAA_000329"	"g.78087078T>C"	""	""	""	"g.16724T>C"	""	"Germline"	""	""	"0"	""	""	"g.80113279T>C"	""	"VUS"	"ACMG"
"0000653388"	"0"	"50"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"03625"	"GAA_000020"	"g.78086721C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"VUS"	"ACMG"
"0000653389"	"11"	"50"	"17"	"78078923"	"78078923"	"subst"	"0"	"03625"	"GAA_000793"	"g.78078923C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105124C>A"	""	"VUS"	"ACMG"
"0000653390"	"21"	"50"	"17"	"78087072"	"78087072"	"subst"	"0"	"03625"	"GAA_000762"	"g.78087072T>C"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80113273T>C"	""	"VUS"	"ACMG"
"0000653501"	"21"	"50"	"17"	"78086721"	"78086721"	"subst"	"0.000113169"	"03625"	"GAA_000020"	"g.78086721C>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112922C>A"	""	"pathogenic (recessive)"	""
"0000653502"	"0"	"50"	"17"	"78085848"	"78085848"	"subst"	"0"	"03625"	"GAA_000610"	"g.78085848A>T"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112049A>T"	""	"VUS"	""
"0000658286"	"0"	"10"	"17"	"78079643"	"78079643"	"subst"	"0.17903"	"02327"	"GAA_000005"	"g.78079643C>T"	""	""	""	"GAA(NM_000152.3):c.642C>T (p.S214=), GAA(NM_000152.5):c.642C>T (p.S214=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80105844C>T"	""	"benign"	""
"0000658287"	"0"	"10"	"17"	"78087109"	"78087109"	"subst"	"0.271027"	"02327"	"GAA_000022"	"g.78087109A>G"	""	""	""	"GAA(NM_000152.3):c.2133A>G (p.T711=), GAA(NM_000152.5):c.2133A>G (p.T711=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	"g.80113310A>G"	""	"benign"	""
"0000666079"	"21"	"90"	"17"	"78081615"	"78081615"	"subst"	"8.28178E-6"	"03678"	"GAA_000077"	"g.78081615A>G"	""	""	""	""	""	"Germline"	""	"rs1057516600"	"0"	""	""	"g.80107816A>G"	""	"pathogenic (recessive)"	""
"0000666080"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"03678"	"GAA_000029"	"g.78078341T>G"	""	""	""	""	""	"Germline"	""	"rs386834236"	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000669424"	"3"	"30"	"17"	"78083760"	"78083760"	"subst"	"0.00113529"	"03575"	"GAA_000792"	"g.78083760G>C"	"1/2792 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"1 homozygous; {DB:CLININrs145712232}"	"Germline"	""	"rs145712232"	"0"	""	""	"g.80109961G>C"	""	"likely benign"	""
"0000669425"	"3"	"30"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"03575"	"GAA_000045"	"g.78085871G>A"	"10/2795 individuals"	"{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}"	""	""	"10 homozygous; {DB:CLININrs1800307}"	"Germline"	""	"rs1800307"	"0"	""	""	"g.80112072G>A"	""	"likely benign"	""
"0000670583"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670584"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670585"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670586"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670587"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670588"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670589"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670590"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670591"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670592"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	"no variant found on 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670593"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670594"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670595"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	"no variant found on 2nd chromosome"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670596"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670597"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670598"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670599"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670600"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670601"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670602"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670603"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670604"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670605"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670606"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670607"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670608"	"1"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"00006"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000670609"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670610"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670611"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670612"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670613"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670614"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670615"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670616"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670617"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670618"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670619"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670620"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670621"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670622"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670623"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670624"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670625"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670626"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670627"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670628"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670629"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670630"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	"Variant Error [EMISMATCH/EINVALIDBOUNDARY]: This transcript variant has an error. Please fix this entry and then remove this message."	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670631"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670632"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670633"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000670634"	"2"	"90"	"17"	"78090796"	"78090797"	"del"	"0"	"00006"	"GAA_000166"	"g.78090796_78090797del"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80116997_80116998del"	""	"pathogenic (recessive)"	""
"0000670635"	"2"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"00006"	"GAA_000336"	"g.78090910T>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic (recessive)"	""
"0000670636"	"2"	"90"	"17"	"78084752"	"78084752"	"subst"	"0"	"00006"	"GAA_000598"	"g.78084752C>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110953C>G"	""	"pathogenic (recessive)"	""
"0000670637"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"258dupC"	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670638"	"2"	"90"	"17"	"78090838"	"78090838"	"dup"	"0"	"00006"	"GAA_000724"	"g.78090838dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"2261dupC"	""	"Germline"	""	""	"0"	""	""	"g.80117039dup"	""	"pathogenic (recessive)"	""
"0000670639"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"258dupC"	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670640"	"2"	"90"	"17"	"78091991"	"78092157"	""	"0"	"00006"	"MYH2_000008"	"g.(78091549_78091991)_(78092157_78092451)del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"del ex18"	""	"Germline"	""	""	"0"	""	""	"g.(80117750_80118192)_(80118358_80118652)del"	""	"pathogenic (recessive)"	""
"0000670641"	"2"	"90"	"17"	"78082089"	"78082095"	"del"	"0"	"00006"	"GAA_000794"	"g.78082089_78082095del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"956del7"	""	"Germline"	""	""	"0"	""	""	"g.80108290_80108296del"	""	"pathogenic (recessive)"	""
"0000670642"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00006"	"GAA_000028"	"g.78078910del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000670643"	"2"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"00006"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000670644"	"2"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"00006"	"GAA_000336"	"g.78090910T>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic (recessive)"	""
"0000670645"	"2"	"90"	"17"	"78082327"	"78082327"	"subst"	"0"	"00006"	"GAA_000287"	"g.78082327A>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108528A>T"	""	"pathogenic (recessive)"	""
"0000670646"	"2"	"90"	"17"	"78091991"	"78092157"	""	"0"	"00006"	"MYH2_000008"	"g.(78091549_78091991)_(78092157_78092451)del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"del ex18"	""	"Germline"	""	""	"0"	""	""	"g.(80117750_80118192)_(80118358_80118652)del"	""	"pathogenic (recessive)"	""
"0000670647"	"2"	"90"	"17"	"78091991"	"78092157"	""	"0"	"00006"	"MYH2_000008"	"g.(78091549_78091991)_(78092157_78092451)del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"del ex18"	""	"Germline"	""	""	"0"	""	""	"g.(80117750_80118192)_(80118358_80118652)del"	""	"pathogenic (recessive)"	""
"0000670648"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"258dupC"	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670649"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"258dupC"	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670650"	"2"	"90"	"17"	"78091991"	"78092157"	""	"0"	"00006"	"MYH2_000008"	"g.(78091549_78091991)_(78092157_78092451)del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"del ex18"	""	"Germline"	""	""	"0"	""	""	"g.(80117750_80118192)_(80118358_80118652)del"	""	"pathogenic (recessive)"	""
"0000670651"	"2"	"90"	"17"	"78079694"	"78079694"	"subst"	"0"	"00006"	"GAA_000725"	"g.78079694G>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105895G>T"	""	"pathogenic (recessive)"	""
"0000670652"	"2"	"90"	"17"	"78084798"	"78084798"	"del"	"8.12585E-6"	"00006"	"GAA_000795"	"g.78084798del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"1610_1611delA"	""	"Germline"	""	""	"0"	""	""	"g.80110999del"	""	"pathogenic (recessive)"	""
"0000670653"	"2"	"90"	"17"	"78084798"	"78084798"	"del"	"8.12585E-6"	"00006"	"GAA_000795"	"g.78084798del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"1610_1611delA"	""	"Germline"	""	""	"0"	""	""	"g.80110999del"	""	"pathogenic (recessive)"	""
"0000670654"	"2"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"00006"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000670655"	"2"	"90"	"17"	"78091991"	"78092157"	""	"0"	"00006"	"MYH2_000008"	"g.(78091549_78091991)_(78092157_78092451)del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"del ex18"	""	"Germline"	""	""	"0"	""	""	"g.(80117750_80118192)_(80118358_80118652)del"	""	"pathogenic (recessive)"	""
"0000670656"	"2"	"90"	"17"	"78085800"	"78085800"	"subst"	"2.84581E-5"	"00006"	"GAA_000105"	"g.78085800T>C"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112001T>C"	""	"pathogenic (recessive)"	""
"0000670657"	"2"	"90"	"17"	"78086461"	"78086461"	"subst"	"0"	"00006"	"GAA_000754"	"g.78086461G>C"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112662G>C"	""	"pathogenic (recessive)"	""
"0000670658"	"2"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"00006"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000670659"	"2"	"90"	"17"	"78082333"	"78082333"	"subst"	"0"	"00006"	"GAA_000741"	"g.78082333G>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108534G>A"	""	"pathogenic (recessive)"	""
"0000670660"	"2"	"90"	"17"	"78081663"	"78081663"	"subst"	"0"	"00006"	"GAA_000127"	"g.78081663A>C"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107864A>C"	""	"pathogenic (recessive)"	""
"0000670661"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"258dupC"	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670662"	"2"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"00006"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000670663"	"2"	"70"	"17"	"78085855"	"78085855"	"subst"	"0"	"00006"	"GAA_000613"	"g.78085855C>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	"[1710C>G;1923G>A]"	""	"Germline"	""	""	"0"	""	""	"g.80112056C>G"	""	"VUS"	""
"0000670664"	"2"	"90"	"17"	"78091991"	"78092157"	""	"0"	"00006"	"MYH2_000008"	"g.(78091549_78091991)_(78092157_78092451)del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"del ex18"	""	"Germline"	""	""	"0"	""	""	"g.(80117750_80118192)_(80118358_80118652)del"	""	"pathogenic (recessive)"	""
"0000670665"	"2"	"90"	"17"	"78085826"	"78085844"	"dup"	"0"	"00006"	"GAA_000751"	"g.78085826_78085844dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"1681_1699dup19"	""	"Germline"	""	""	"0"	""	""	"g.80112027_80112045dup"	""	"pathogenic (recessive)"	""
"0000670666"	"2"	"90"	"17"	"78085826"	"78085844"	"dup"	"0"	"00006"	"GAA_000751"	"g.78085826_78085844dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"1681_1699dup19"	""	"Germline"	""	""	"0"	""	""	"g.80112027_80112045dup"	""	"pathogenic (recessive)"	""
"0000670667"	"2"	"90"	"17"	"78082208"	"78082208"	"subst"	"0"	"00006"	"GAA_000527"	"g.78082208G>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108409G>A"	""	"pathogenic (recessive)"	""
"0000670668"	"2"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"00006"	"GAA_000055"	"g.78078867_78078868del"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic (recessive)"	""
"0000670669"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00006"	"GAA_000028"	"g.78078910del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000670670"	"2"	"90"	"17"	"78078867"	"78078868"	"del"	"0"	"00006"	"GAA_000055"	"g.78078867_78078868del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"482_483delCC"	""	"Germline"	""	""	"0"	""	""	"g.80105068_80105069del"	""	"pathogenic (recessive)"	""
"0000670671"	"2"	"90"	"17"	"78090838"	"78090838"	"dup"	"0"	"00006"	"GAA_000724"	"g.78090838dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"2261dupC"	""	"Germline"	""	""	"0"	""	""	"g.80117039dup"	""	"pathogenic (recessive)"	""
"0000670672"	"2"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"00006"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000670673"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670674"	"2"	"90"	"17"	"78078571"	"78078581"	"dup"	"0"	"00006"	"GAA_000447"	"g.78078571_78078581dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	"186dup11"	""	"Germline"	""	""	"0"	""	""	"g.80104772_80104782dup"	""	"pathogenic (recessive)"	""
"0000670675"	"2"	"90"	"17"	"78082327"	"78082327"	"subst"	"0"	"00006"	"GAA_000287"	"g.78082327A>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108528A>T"	""	"pathogenic (recessive)"	""
"0000670676"	"2"	"90"	"17"	"78081364"	"78081364"	"subst"	"0"	"00006"	"GAA_000481"	"g.78081364C>G"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107565C>G"	""	"pathogenic (recessive)"	""
"0000670677"	"2"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"00006"	"GAA_000060"	"g.78078643dup"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104844dup"	""	"pathogenic (recessive)"	""
"0000670678"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00006"	"GAA_000028"	"g.78078910del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000670679"	"2"	"90"	"17"	"78092118"	"78092118"	"subst"	"2.7222E-5"	"00006"	"GAA_000234"	"g.78092118C>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118319C>T"	""	"pathogenic (recessive)"	""
"0000670680"	"2"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00006"	"GAA_000028"	"g.78078910del"	""	"{PMID:Vanherpe 2020:32248831}"	""	"525delT"	""	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"pathogenic (recessive)"	""
"0000670681"	"2"	"90"	"17"	"78082327"	"78082327"	"subst"	"0"	"00006"	"GAA_000287"	"g.78082327A>T"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108528A>T"	""	"pathogenic (recessive)"	""
"0000670682"	"2"	"90"	"17"	"78084636"	"78084636"	"subst"	"4.06306E-6"	"00006"	"GAA_000134"	"g.78084636G>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110837G>A"	""	"pathogenic (recessive)"	""
"0000670683"	"2"	"50"	"17"	"78086709"	"78086709"	"subst"	"0"	"00006"	"GAA_000644"	"g.78086709G>A"	""	"{PMID:Vanherpe 2020:32248831}"	""	"[1710C>G;1923G>A]"	""	"Germline"	""	""	"0"	""	""	"g.80112910G>A"	""	"VUS"	""
"0000674675"	"0"	"90"	"17"	"78084552"	"78084552"	"dup"	"0"	"00766"	"GAA_000302"	"g.78084552dup"	""	"{PMID:Bergsma 2021:33168984}"	""	""	"variant detected after cycloheximide treatment cultured cells"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80110753dup"	""	"pathogenic (recessive)"	"ACMG"
"0000674676"	"0"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"00766"	"GAA_000021"	"g.78086713G>A"	""	"{PMID:Bergsma 2021:33168984}"	""	""	"detected after cycloheximide treatment cultured cells"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic (recessive)"	"ACMG"
"0000674677"	"0"	"90"	"17"	"78078931"	"78078931"	"subst"	"0"	"00766"	"GAA_000466"	"g.78078931G>T"	""	"Takahashi 2016, {PMID:Bergsma 2021:33168984}"	""	""	"detected after cycloheximide treatment cultured cells"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80105132G>T"	""	"pathogenic (recessive)"	"ACMG"
"0000674678"	"0"	"90"	"17"	"78086420"	"78086420"	"subst"	"8.18981E-6"	"00766"	"GAA_000092"	"g.78086420C>T"	""	"Takahashi 2016, {PMID:Bergsma 2021:33168984}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80112621C>T"	""	"pathogenic (recessive)"	"ACMG"
"0000674679"	"0"	"70"	"17"	"78085871"	"78085871"	"subst"	"0"	"00766"	"GAA_000314"	"g.78085871G>C"	""	"{PMID:Bergsma 2021:33168984}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80112072G>C"	""	"likely pathogenic (recessive)"	"ACMG"
"0000674680"	"0"	"90"	"17"	"78091550"	"78091550"	"subst"	"0"	"00766"	"GAA_000703"	"g.78091550T>C"	""	"{PMID:Bergsma 2021:33168984}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80117751T>C"	""	"pathogenic (recessive)"	"ACMG"
"0000674681"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00766"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Bergsma 2021:33168984}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	"ACMG"
"0000674683"	"0"	"90"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"00766"	"GAA_000336"	"g.78090910T>A"	""	"{PMID:Bergsma 2021:33168984}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80117111T>A"	""	"pathogenic (recessive)"	"ACMG"
"0000675110"	"0"	"50"	"17"	"0"	"0"	""	"0"	"00766"	"GAA_000796"	"g.="	""	"{PMID:Bergsma 2021:33168984}"	""	""	"splice variants detected after cycloheximide treatment cultured cells"	"Germline"	""	""	"0"	""	""	""	""	"VUS"	"ACMG"
"0000681061"	"0"	"90"	"17"	"78081354"	"78081354"	"subst"	"0"	"02325"	"GAA_000797"	"g.78081354A>G"	""	""	""	"GAA(NM_000152.5):c.693-2A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000681062"	"0"	"30"	"17"	"78091564"	"78091564"	"subst"	"0.00227383"	"02326"	"GAA_000774"	"g.78091564G>A"	""	""	""	"GAA(NM_000152.3):c.2481+16G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000692503"	"0"	"30"	"17"	"78090896"	"78090896"	"subst"	"6.13894E-5"	"01943"	"GAA_000798"	"g.78090896C>T"	""	""	""	"GAA(NM_000152.3):c.2319C>T (p.Y773=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000697572"	"0"	"70"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	"8/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"likely pathogenic"	""
"0000697573"	"0"	"70"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"00006"	"GAA_000028"	"g.78078910del"	"2/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80105111del"	""	"likely pathogenic"	""
"0000697574"	"0"	"70"	"17"	"78078728"	"78078728"	"subst"	"0"	"00006"	"GAA_000254"	"g.78078728C>T"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80104929C>T"	""	"likely pathogenic"	""
"0000697575"	"0"	"70"	"17"	"78079570"	"78079570"	"subst"	"1.63475E-5"	"00006"	"GAA_000475"	"g.78079570G>A"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80105771G>A"	""	"likely pathogenic"	""
"0000697576"	"0"	"70"	"17"	"78081738"	"78081738"	"subst"	"0.00036341"	"00006"	"GAA_000799"	"g.78081738G>C"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80107939G>C"	""	"likely pathogenic"	""
"0000697577"	"0"	"70"	"17"	"78082404"	"78082404"	"del"	"0"	"00006"	"GAA_000800"	"g.78082404del"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80108605del"	""	"likely pathogenic"	""
"0000697578"	"0"	"70"	"17"	"78086806"	"78086806"	"subst"	"0"	"00006"	"GAA_000801"	"g.78086806C>G"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80113007C>G"	""	"likely pathogenic"	""
"0000697579"	"0"	"70"	"17"	"78087027"	"78087027"	"subst"	"0"	"00006"	"GAA_000802"	"g.78087027C>G"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80113228C>G"	""	"likely pathogenic"	""
"0000697580"	"0"	"70"	"17"	"78087042"	"78087046"	"dup"	"0"	"00006"	"GAA_000164"	"g.78087042_78087046dup"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80113243_80113247dup"	""	"likely pathogenic"	""
"0000697581"	"0"	"70"	"17"	"78090846"	"78090846"	"subst"	"0"	"00006"	"GAA_000236"	"g.78090846C>T"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80117047C>T"	""	"likely pathogenic"	""
"0000697582"	"0"	"70"	"17"	"78090910"	"78090910"	"subst"	"4.10907E-6"	"00006"	"GAA_000336"	"g.78090910T>A"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80117111T>A"	""	"likely pathogenic"	""
"0000697583"	"0"	"70"	"17"	"78092521"	"78092521"	"subst"	"0"	"00006"	"GAA_000803"	"g.78092521G>A"	"1/1001 cases"	"{PMID:Topf 2020:32528171}"	""	""	"combination of variants not reported"	"Germline"	""	""	"0"	""	""	"g.80118722G>A"	""	"likely pathogenic"	""
"0000726739"	"0"	"30"	"17"	"78071068"	"78071068"	"subst"	"0.000865199"	"01943"	"CCDC40_000092"	"g.78071068G>A"	""	""	""	"CCDC40(NM_017950.3):c.3046G>A (p.V1016I, p.(Val1016Ile))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000726740"	"0"	"30"	"17"	"78073553"	"78073553"	"subst"	"1.63227E-5"	"01943"	"CCDC40_000187"	"g.78073553C>G"	""	""	""	"CCDC40(NM_017950.3):c.3408C>G (p.L1136=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000726741"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"02329"	"GAA_000029"	"g.78078341T>G"	""	""	""	"GAA(NM_000152.3):c.-32-13T>G (p.(=)), GAA(NM_000152.5):c.-32-13T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000726742"	"0"	"30"	"17"	"78078643"	"78078643"	"subst"	"0.00039819"	"01943"	"CCDC40_000188"	"g.78078643C>A"	""	""	""	"GAA(NM_000152.3):c.258C>A (p.P86=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000726743"	"0"	"90"	"17"	"78078643"	"78078643"	"dup"	"0"	"02329"	"GAA_000060"	"g.78078643dup"	""	""	""	"GAA(NM_000152.3):c.258dupC (p.N87Qfs*9), GAA(NM_000152.5):c.258dupC (p.N87Qfs*9)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000726744"	"0"	"90"	"17"	"78078910"	"78078910"	"del"	"9.77343E-5"	"02325"	"GAA_000028"	"g.78078910del"	""	""	""	"GAA(NM_000152.3):c.525delT (p.(Glu176ArgfsTer45)), GAA(NM_000152.3):c.525delT (p.E176Rfs*45), GAA(NM_000152.5):c.525delT (p.E176Rfs*45)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000726745"	"0"	"30"	"17"	"78087008"	"78087008"	"subst"	"0"	"01943"	"GAA_000804"	"g.78087008G>A"	""	""	""	"GAA(NM_000152.3):c.2041-9G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000786865"	"0"	"50"	"17"	"78081520"	"78081520"	"subst"	"7.33842E-5"	"00006"	"GAA_000805"	"g.78081520C>T"	""	"{PMID:Ganapathy 2019:31069529}"	""	""	""	"Germline"	""	"rs375310352"	"0"	""	""	"g.80107721C>T"	""	"VUS"	""
"0000787476"	"1"	"90"	"17"	"78086713"	"78086713"	"subst"	"2.52122E-5"	"00000"	"GAA_000021"	"g.78086713G>A"	""	"0"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112914G>A"	""	"pathogenic"	""
"0000795659"	"0"	"70"	"17"	"78078651"	"78078651"	"subst"	"0.000139397"	"00000"	"GAA_000251"	"g.78078651G>A"	""	"{PMID:Nair 2018:30293248}"	""	"NM_000152.3:c.266G>A; p.R89H"	""	"Unknown"	"?"	"rs200586324"	"0"	""	""	"g.80104852G>A"	""	"likely pathogenic"	""
"0000808308"	"0"	"30"	"17"	"78079665"	"78079665"	"subst"	"0.000793266"	"02326"	"GAA_000262"	"g.78079665G>A"	""	""	""	"GAA(NM_000152.3):c.664G>A (p.V222M, p.(Val222Met))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000808309"	"0"	"30"	"17"	"78081352"	"78081352"	"subst"	"0.000394739"	"02325"	"GAA_000806"	"g.78081352G>T"	""	""	""	"GAA(NM_000152.5):c.693-4G>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000808310"	"0"	"30"	"17"	"78081528"	"78081529"	"ins"	"0.665858"	"01804"	"GAA_000272"	"g.78081528_78081529insAGCGGGC"	""	""	""	"GAA(NM_000152.3):c.858+5_858+6insGCAGCGG, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC, GAA(NM_000152.3):c.858+7_858+8insAGCGGGC (p.(=)), GAA(NM_00015...)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000808311"	"0"	"70"	"17"	"78082137"	"78082137"	"subst"	"0"	"02329"	"GAA_000283"	"g.78082137G>A"	""	""	""	"GAA(NM_000152.3):c.1004G>A (p.G335E), GAA(NM_000152.5):c.1004G>A (p.G335E)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0000808312"	"0"	"50"	"17"	"78082356"	"78082356"	"subst"	"0"	"02325"	"GAA_000807"	"g.78082356G>A"	""	""	""	"GAA(NM_000152.5):c.1144G>A (p.A382T)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000808313"	"0"	"30"	"17"	"78087127"	"78087127"	"subst"	"0"	"01943"	"GAA_000808"	"g.78087127C>T"	""	""	""	"GAA(NM_000152.3):c.2151C>T (p.H717=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000819037"	"0"	"70"	"17"	"78081457"	"78081457"	"subst"	"2.43938E-5"	"00006"	"GAA_000384"	"g.78081457G>A"	""	"{PMID:Chakravorty 2020:33250842}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"likely pathogenic (recessive)"	""
"0000819184"	"1"	"90"	"17"	"78078386"	"78078386"	"subst"	"0"	"00006"	"GAA_000355"	"g.78078386A>G"	""	"{PMID:Chakravorty 2020:33250842}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104587A>G"	""	"pathogenic (recessive)"	"ACMG"
"0000819185"	"3"	"70"	"17"	"78086463"	"78086463"	"subst"	"8.30993E-6"	"00006"	"GAA_000415"	"g.78086463C>T"	""	"{PMID:Chakravorty 2020:33250842}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112664C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0000819253"	"2"	"70"	"17"	"78086453"	"78086453"	"subst"	"4.13404E-6"	"00006"	"GAA_000810"	"g.78086453G>A"	""	"{PMID:Chakravorty 2020:33250842}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112654G>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0000819271"	"0"	"50"	"17"	"78092530"	"78092530"	"subst"	"4.07196E-5"	"00006"	"GAA_000809"	"g.78092530G>A"	""	"{PMID:Chakravorty 2020:33250842}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"VUS"	""
"0000842492"	"3"	"70"	"17"	"78084549"	"78084549"	"subst"	"0"	"00006"	"GAA_000812"	"g.78084549C>A"	""	"{PMID:Chawla 2022:34864681}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80110750C>A"	""	"likely pathogenic (recessive)"	"ACMG"
"0000842493"	"3"	"90"	"17"	"78082294"	"78082294"	"subst"	"1.22441E-5"	"00006"	"GAA_000113"	"g.78082294C>T"	""	"{PMID:Chawla 2022:34864681}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108495C>T"	""	"pathogenic (recessive)"	"ACMG"
"0000842494"	"1"	"70"	"17"	"78086723"	"78086728"	"del"	"0"	"00006"	"GAA_000813"	"g.78086723_78086728del"	""	"{PMID:Chawla 2022:34864681}"	""	"1935_1940del"	""	"Germline"	""	""	"0"	""	""	"g.80112924_80112929del"	""	"likely pathogenic (recessive)"	"ACMG"
"0000842495"	"1"	"70"	"17"	"78082104"	"78082104"	"subst"	"8.12585E-6"	"00006"	"GAA_000089"	"g.78082104C>T"	""	"{PMID:Chawla 2022:34864681}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80108305C>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0000842496"	"1"	"90"	"17"	"78083813"	"78083813"	"dup"	"0"	"00006"	"GAA_000811"	"g.78083813dup"	""	"{PMID:Chawla 2022:34864681}"	""	"1396dupG"	""	"Germline"	""	""	"0"	""	""	"g.80110014dup"	""	"pathogenic (recessive)"	"ACMG"
"0000842497"	"2"	"70"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Chawla 2022:34864681}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"likely pathogenic (recessive)"	"ACMG"
"0000842498"	"2"	"50"	"17"	"78081457"	"78081457"	"subst"	"2.43938E-5"	"00006"	"GAA_000384"	"g.78081457G>A"	""	"{PMID:Chawla 2022:34864681}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80107658G>A"	""	"VUS"	"ACMG"
"0000842499"	"2"	"70"	"17"	"78078931"	"78078931"	"subst"	"0"	"00006"	"GAA_000466"	"g.78078931G>T"	""	"{PMID:Chawla 2022:34864681}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80105132G>T"	""	"likely pathogenic (recessive)"	"ACMG"
"0000855143"	"0"	"30"	"17"	"78073394"	"78073394"	"subst"	"0.000211601"	"01943"	"CCDC40_000198"	"g.78073394C>T"	""	""	""	"CCDC40(NM_017950.3):c.3249C>T (p.Y1083=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000855144"	"0"	"30"	"17"	"78092444"	"78092444"	"subst"	"0.000548654"	"02326"	"GAA_000815"	"g.78092444C>T"	""	""	""	"GAA(NM_000152.3):c.2647-8C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000865535"	"0"	"30"	"17"	"78081652"	"78081652"	"subst"	"3.71892E-5"	"02327"	"GAA_000733"	"g.78081652C>T"	""	""	""	"GAA(NM_000152.3):c.912C>T (p.G304=, p.(Gly304=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000865536"	"0"	"50"	"17"	"78082409"	"78082409"	"subst"	"0.000159961"	"01804"	"GAA_000397"	"g.78082409G>C"	""	""	""	"GAA(NM_000152.3):c.1194+3G>C (p.?)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000865537"	"0"	"30"	"17"	"78084624"	"78084624"	"subst"	"2.43786E-5"	"01804"	"GAA_000814"	"g.78084624C>T"	""	""	""	"GAA(NM_000152.3):c.1536C>T (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000865538"	"0"	"30"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"01804"	"GAA_000045"	"g.78085871G>A"	""	""	""	"GAA(NM_000152.3):c.1726G>A (p.(Gly576Ser), p.G576S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000865539"	"0"	"50"	"17"	"78087132"	"78087132"	"subst"	"0.000127319"	"01804"	"GAA_000422"	"g.78087132C>A"	""	""	""	"GAA(NM_000152.3):c.2156C>A (p.(Ala719Glu))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000865540"	"0"	"30"	"17"	"78091482"	"78091482"	"subst"	"0.000898756"	"01804"	"GAA_000433"	"g.78091482G>A"	""	""	""	"GAA(NM_000152.3):c.2415G>A (p.(Val805=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000872026"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Cerino 2022:35741838}"	""	""	"ACMG PVS1_strong, PM3_strong, PP4_mod, BS1"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic"	"ACMG"
"0000872056"	"1"	"90"	"17"	"78086376"	"78086376"	"subst"	"0"	"00006"	"GAA_000623"	"g.78086376G>A"	""	"{PMID:Cerino 2022:35741838}"	""	""	"ACMG PVS1, PM2, PM3, PP4"	"Germline"	""	""	"0"	""	""	"g.80112577G>A"	""	"pathogenic"	"ACMG"
"0000872065"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00006"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Cerino 2022:35741838}"	""	""	"ACMG PVS1, PM2, PM3"	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic"	"ACMG"
"0000872073"	"2"	"70"	"17"	"78084747"	"78084747"	"subst"	"0"	"00006"	"GAA_000749"	"g.78084747A>G"	""	"{PMID:Cerino 2022:35741838}"	""	""	"ACMG PM1, PM2, PP3, PP4_mod"	"Germline"	""	""	"0"	""	""	"g.80110948A>G"	""	"likely pathogenic"	"ACMG"
"0000872443"	"3"	"50"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"00006"	"GAA_000045"	"g.78085871G>A"	""	"{PMID:He 2022:35722482}"	""	""	"pseudo deficiency allele"	"Germline"	""	""	"0"	""	""	""	""	"VUS (!)"	""
"0000872444"	"3"	"50"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"00006"	"GAA_000035"	"g.78087041G>A"	""	"{PMID:He 2022:35722482}"	""	""	"pseudo deficiency allele"	"Germline"	""	""	"0"	""	""	""	""	"VUS (!)"	""
"0000872446"	"3"	"50"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"00006"	"GAA_000045"	"g.78085871G>A"	""	"{PMID:He 2022:35722482}"	""	""	"pseudo deficiency allele"	"Germline"	""	""	"0"	""	""	""	""	"VUS (!)"	""
"0000872447"	"3"	"50"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"00006"	"GAA_000035"	"g.78087041G>A"	""	"{PMID:He 2022:35722482}"	""	""	"pseudo deficiency allele"	"Germline"	""	""	"0"	""	""	""	""	"VUS (!)"	""
"0000873651"	"0"	"70"	"17"	"78081693"	"78081693"	"subst"	"0"	"00000"	"GAA_000222"	"g.78081693T>A"	"248"	"{PMID:Sun 2018:30076350}"	""	"GAA(NM_000152.3):c.953T>A(p.M318K)/c.2184delC(p.L729Wfs*35)"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.80107894T>A"	""	"likely pathogenic"	""
"0000873652"	"0"	"70"	"17"	"78087161"	"78087161"	"del"	"0"	"00000"	"GAA_000675"	"g.78087161del"	"248"	"{PMID:Sun 2018:30076350}"	""	"GAA(NM_000152.3):c.953T>A(p.M318K)/c.2184delC(p.L729Wfs*35)"	""	"Germline/De novo (untested)"	"?"	""	"0"	""	""	"g.80113362del"	""	"likely pathogenic"	""
"0000880080"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Bertoli-Avella 2022:34952832}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000880081"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Bertoli-Avella 2022:34952832}"	""	""	""	"Germline"	""	""	"0"	""	""	""	""	"pathogenic (recessive)"	""
"0000894329"	"0"	"30"	"17"	"78078883"	"78078883"	"subst"	"0"	"01804"	"CCDC40_000199"	"g.78078883C>G"	""	""	""	"GAA(NM_000152.3):c.498C>G (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000894330"	"0"	"30"	"17"	"78079710"	"78079710"	"subst"	"0.00121717"	"01804"	"GAA_000266"	"g.78079710G>C"	""	""	""	"GAA(NM_000152.3):c.692+17G>C (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000894332"	"0"	"50"	"17"	"78092040"	"78092040"	"subst"	"0"	"02325"	"GAA_000817"	"g.78092040G>T"	""	""	""	"GAA(NM_000152.5):c.2530G>T (p.A844S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000906020"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	"2/73,755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000906021"	"3"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	"2/73,755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000906097"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	"1/73755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	"combination alleles not determined"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000906098"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	"1/73755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	"combination alleles not determined"	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000906099"	"1"	"90"	"17"	"78086765"	"78086765"	"subst"	"0"	"00006"	"GAA_000116"	"g.78086765G>A"	"1/73755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	"combination alleles not determined"	"Germline"	""	""	"0"	""	""	"g.80112966G>A"	""	"pathogenic (recessive)"	""
"0000906155"	"0"	"90"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"00006"	"GAA_000159"	"g.78086478G>A"	"1/73755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	"combination alleles not determined"	"Germline"	""	""	"0"	""	""	"g.80112679G>A"	""	"pathogenic (recessive)"	""
"0000906156"	"0"	"90"	"17"	"78086478"	"78086478"	"subst"	"1.68431E-5"	"00006"	"GAA_000159"	"g.78086478G>A"	"1/73755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	"combination alleles not determined"	"Germline"	""	""	"0"	""	""	"g.80112679G>A"	""	"pathogenic (recessive)"	""
"0000906157"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00006"	"GAA_000025"	"g.78092070C>T"	"1/73755 controls"	"{PMID:Reiner 2022:36459106}"	""	""	"combination alleles not determined"	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0000908866"	"1"	"50"	"17"	"78081601"	"78081601"	"subst"	"9.16277E-5"	"00006"	"GAA_000276"	"g.78081601C>T"	""	"{PMID:Bournazos 2022:34906502}"	""	""	"transcripts degraded"	"Germline"	""	""	"0"	""	""	"g.80107802C>T"	""	"VUS"	""
"0000908930"	"2"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Bournazos 2022:34906502}"	""	""	"exon skipping, cryptic splice acceptor"	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0000914989"	"0"	"30"	"17"	"78084727"	"78084727"	"subst"	"0.00275386"	"01804"	"GAA_000307"	"g.78084727G>A"	""	""	""	"GAA(NM_000152.3):c.1552-13G>A (p.(=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000914990"	"0"	"30"	"17"	"78087066"	"78087066"	"subst"	"0"	"01804"	"GAA_000818"	"g.78087066A>C"	""	""	""	"GAA(NM_000152.3):c.2090A>C (p.(Lys697Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000914991"	"0"	"30"	"17"	"78092556"	"78092556"	"subst"	"4.47496E-5"	"01804"	"GAA_000819"	"g.78092556C>T"	""	""	""	"GAA(NM_000152.3):c.2751C>T (p.(Leu917=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000926656"	"0"	"30"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"02325"	"GAA_000003"	"g.78078656G>A"	""	""	""	"GAA(NM_000152.3):c.271G>A (p.D91N, p.(Asp91Asn)), GAA(NM_000152.5):c.271G>A (p.D91N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000926657"	"0"	"10"	"17"	"78081307"	"78081307"	"subst"	"0.0667469"	"02325"	"GAA_000480"	"g.78081307C>T"	""	""	""	"GAA(NM_000152.5):c.693-49C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000926658"	"0"	"10"	"17"	"78081551"	"78081551"	"subst"	"0.662574"	"02325"	"GAA_000275"	"g.78081551T>C"	""	""	""	"GAA(NM_000152.3):c.858+30T>C, GAA(NM_000152.5):c.858+30T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000926659"	"0"	"50"	"17"	"78081652"	"78081652"	"subst"	"3.71892E-5"	"01804"	"GAA_000733"	"g.78081652C>T"	""	""	""	"GAA(NM_000152.3):c.912C>T (p.G304=, p.(Gly304=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000926660"	"0"	"10"	"17"	"78081661"	"78081661"	"subst"	"0.0717446"	"02325"	"GAA_000018"	"g.78081661A>T"	""	""	""	"GAA(NM_000152.3):c.921A>T (p.A307=), GAA(NM_000152.5):c.921A>T (p.A307=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000926661"	"0"	"90"	"17"	"78081665"	"78081665"	"subst"	"2.48909E-5"	"02325"	"GAA_000065"	"g.78081665G>A"	""	""	""	"GAA(NM_000152.3):c.925G>A (p.G309R), GAA(NM_000152.5):c.925G>A (p.G309R)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000926662"	"0"	"10"	"17"	"78083791"	"78083791"	"subst"	"0.0692037"	"02325"	"GAA_000019"	"g.78083791C>T"	""	""	""	"GAA(NM_000152.3):c.1374C>T (p.Y458=), GAA(NM_000152.5):c.1374C>T (p.Y458=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000926663"	"0"	"90"	"17"	"78084553"	"78084553"	"subst"	"1.21897E-5"	"02329"	"GAA_000155"	"g.78084553G>A"	""	""	""	"GAA(NM_000152.5):c.1465G>A (p.D489N)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000926664"	"0"	"10"	"17"	"78084688"	"78084688"	"subst"	"0.669866"	"02325"	"GAA_000445"	"g.78084688C>A"	""	""	""	"GAA(NM_000152.3):c.1551+49C>A, GAA(NM_000152.5):c.1551+49C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000946005"	"3"	"90"	"17"	"78086765"	"78086765"	"subst"	"0"	"00006"	"GAA_000116"	"g.78086765G>A"	""	"{PMID:Westra 2019:31127727}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80112966G>A"	""	"pathogenic (recessive)"	""
"0000969266"	"0"	"90"	"17"	"78078764"	"78078765"	"del"	"0"	"02329"	"GAA_000062"	"g.78078764_78078765del"	""	""	""	"GAA(NM_000152.3):c.379_380delTG (p.C127Lfs*18), GAA(NM_000152.5):c.379_380delTG (p.C127Lfs*18)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0000982857"	"0"	"10"	"17"	"78081515"	"78081515"	"subst"	"0.00629527"	"01804"	"GAA_000269"	"g.78081515G>A"	""	""	""	"GAA(NM_000152.3):c.852G>A (p.A284=, p.(Ala284=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0000982858"	"0"	"30"	"17"	"78081528"	"78081529"	"ins"	"2.50156E-5"	"01804"	"GAA_000821"	"g.78081528_78081529insAGCAGGC"	""	""	""	"GAA(NM_000152.5):c.858+7_858+8insAGCAGGC"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0000982859"	"0"	"50"	"17"	"78081608"	"78081608"	"subst"	"8.29394E-6"	"01804"	"GAA_000277"	"g.78081608A>G"	""	""	""	"GAA(NM_000152.3):c.868A>G (p.N290D), GAA(NM_000152.5):c.868A>G (p.(Asn290Asp))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982860"	"0"	"50"	"17"	"78083828"	"78083828"	"subst"	"9.38262E-5"	"01804"	"GAA_000822"	"g.78083828G>A"	""	""	""	"GAA(NM_000152.5):c.1411G>A (p.(Glu471Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982861"	"0"	"50"	"17"	"78086450"	"78086450"	"subst"	"2.90993E-5"	"01804"	"GAA_000414"	"g.78086450G>A"	""	""	""	"GAA(NM_000152.3):c.1828G>A (p.(Ala610Thr))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0000982862"	"0"	"50"	"17"	"78091475"	"78091475"	"subst"	"4.09464E-5"	"01804"	"GAA_000432"	"g.78091475A>G"	""	""	""	"GAA(NM_000152.5):c.2408A>G (p.(Gln803Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001003771"	"0"	"90"	"17"	"78078351"	"78078351"	"subst"	"0"	"02327"	"GAA_000491"	"g.78078351C>G"	""	""	""	""	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001003772"	"0"	"90"	"17"	"78086719"	"78086719"	"subst"	"1.25968E-5"	"01804"	"GAA_000068"	"g.78086719G>A"	""	""	""	"GAA(NM_000152.3):c.1933G>A (p.D645N, p.(Asp645Asn))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001003773"	"0"	"50"	"17"	"78092476"	"78092476"	"subst"	"8.56765E-5"	"01804"	"GAA_000823"	"g.78092476C>T"	""	""	""	"GAA(NM_000152.3):c.2671C>T (p.(Arg891Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001007223"	"3"	"10"	"17"	"78078656"	"78078656"	"subst"	"0.0203628"	"00454"	"GAA_000003"	"g.78078656G>A"	""	""	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104857G>A"	"4020"	"benign"	"ACMG"
"0001008325"	"0"	"90"	"17"	"78086441"	"78086441"	"subst"	"0"	"00006"	"GAA_000824"	"g.78086441G>A"	""	"{PMID:Xie 2024:39198981}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80112642G>A"	""	"pathogenic"	""
"0001008326"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Xie 2024:39198981}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0001008344"	"2"	"90"	"17"	"78083854"	"78083854"	"subst"	"0"	"00006"	"GAA_000575"	"g.78083854G>C"	""	"{PMID:Xie 2024:39198981}"	""	""	""	"Germline/De novo (untested)"	""	""	"0"	""	""	"g.80110055G>C"	""	"pathogenic"	""
"0001012449"	"1"	"50"	"17"	"78083784"	"78083784"	"subst"	"0"	"00006"	"GAA_000825"	"g.78083784G>T"	""	"{PMID:Fernandez-Marmiesse 2014:24767253}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80109985G>T"	""	"VUS"	""
"0001015631"	"0"	"90"	"17"	"78071151"	"78071151"	"del"	"0"	"02329"	"CCDC40_000004"	"g.78071151del"	""	""	""	"CCDC40(NM_017950.4):c.3129delC (p.F1044Sfs*35)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001015632"	"0"	"10"	"17"	"78075908"	"78075908"	"subst"	"0"	"02326"	"CCDC40_000211"	"g.78075908G>C"	""	""	""	"GAA(NM_000152.3):c.-33+219G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015633"	"0"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"02325"	"GAA_000029"	"g.78078341T>G"	""	""	""	"GAA(NM_000152.3):c.-32-13T>G (p.(=)), GAA(NM_000152.5):c.-32-13T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001015634"	"0"	"10"	"17"	"78079305"	"78079305"	"subst"	"0"	"02326"	"CCDC40_000212"	"g.78079305C>G"	""	""	""	"GAA(NM_000152.3):c.547-243C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015635"	"0"	"70"	"17"	"78079672"	"78079672"	"subst"	"2.51425E-5"	"02325"	"GAA_000479"	"g.78079672G>A"	""	""	""	"GAA(NM_000152.5):c.671G>A (p.R224Q)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001015636"	"0"	"10"	"17"	"78079837"	"78079837"	"subst"	"0"	"02326"	"GAA_000826"	"g.78079837A>G"	""	""	""	"GAA(NM_000152.3):c.692+144A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015637"	"0"	"10"	"17"	"78082005"	"78082005"	"subst"	"0"	"02326"	"GAA_000523"	"g.78082005C>T"	""	""	""	"GAA(NM_000152.3):c.956-84C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015638"	"0"	"10"	"17"	"78084688"	"78084688"	"subst"	"0.669866"	"02326"	"GAA_000445"	"g.78084688C>A"	""	""	""	"GAA(NM_000152.3):c.1551+49C>A, GAA(NM_000152.5):c.1551+49C>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015639"	"0"	"10"	"17"	"78091201"	"78091201"	"subst"	"0"	"02326"	"GAA_000827"	"g.78091201A>T"	""	""	""	"GAA(NM_000152.3):c.2332-198A>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001015640"	"0"	"10"	"17"	"78093353"	"78093353"	"subst"	"0"	"02326"	"GAA_000012"	"g.78093353C>T"	""	""	""	"GAA(NM_000152.3):c.*223C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001017262"	"1"	"90"	"17"	"78092087"	"78092087"	"subst"	"0"	"00006"	"GAA_000828"	"g.78092087G>A"	""	"{PMID:Lord 2024:39243181}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118288G>A"	""	"pathogenic (recessive)"	""
"0001017263"	"2"	"30"	"17"	"78075198"	"78075198"	"subst"	"0"	"00006"	"GAA_000829"	"g.78075198C>G"	""	"{PMID:Lord 2024:39243181}"	""	""	"RNA analysis shows no effect on expression"	"Germline"	""	""	"0"	""	""	"g.80101399C>G"	""	"likely benign"	""
"0001017264"	"2"	"90"	"17"	"80104542"	"80104542"	"subst"	"0"	"00006"	"GAA_000029"	"g.80104542T>G"	""	"{PMID:Lord 2024:39243181}"	""	""	"reduced expression of this allele"	"Germline"	""	""	"0"	""	""	"g.78078341T>G"	""	"pathogenic (recessive)"	""
"0001021251"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Marti 2025:39666917}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0001021259"	"1"	"90"	"17"	"78078341"	"78078341"	"subst"	"0.00347161"	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Marti 2025:39666917}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80104542T>G"	""	"pathogenic (recessive)"	""
"0001021284"	"2"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"00006"	"GAA_000025"	"g.78092070C>T"	""	"{PMID:Marti 2025:39666917}"	""	""	""	"Germline"	""	""	"0"	""	""	"g.80118271C>T"	""	"pathogenic (recessive)"	""
"0001021288"	"2"	"90"	"17"	"78083825"	"78083827"	"del"	"0"	"00006"	"GAA_000104"	"g.78083825_78083827del"	""	"{PMID:Marti 2025:39666917}"	""	"c.1408_1410delAAC"	""	"Germline"	""	""	"0"	""	""	"g.80110026_80110028del"	""	"pathogenic (recessive)"	""
"0001027070"	"0"	"90"	"17"	"78071083"	"78071083"	"subst"	"0"	"02325"	"CCDC40_000216"	"g.78071083G>T"	""	""	""	"CCDC40(NM_017950.4):c.3061G>T (p.E1021*)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001027071"	"0"	"70"	"17"	"78071131"	"78071131"	"del"	"0"	"02329"	"CCDC40_000217"	"g.78071131del"	""	""	""	"CCDC40(NM_017950.4):c.3109delC (p.L1037Cfs*3)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely pathogenic"	""
"0001027072"	"0"	"50"	"17"	"78078895"	"78078895"	"subst"	"5.0514E-5"	"02325"	"GAA_000122"	"g.78078895C>T"	""	""	""	"GAA(NM_000152.3):c.510C>T (p.D170=), GAA(NM_000152.5):c.510C>T (p.D170=)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001027073"	"0"	"10"	"17"	"78085871"	"78085871"	"subst"	"0.0174313"	"02326"	"GAA_000045"	"g.78085871G>A"	""	""	""	"GAA(NM_000152.3):c.1726G>A (p.(Gly576Ser), p.G576S)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001027074"	"0"	"90"	"17"	"78085880"	"78085880"	"subst"	"4.06303E-6"	"02325"	"GAA_000137"	"g.78085880G>A"	""	""	""	"GAA(NM_000152.3):c.1735G>A (p.E579K), GAA(NM_000152.5):c.1735G>A (p.E579K)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001042229"	"0"	"50"	"17"	"78078930"	"78078930"	"subst"	"4.7309E-5"	"01804"	"GAA_000378"	"g.78078930C>G"	""	""	""	"GAA(NM_000152.5):c.545C>G (p.(Thr182Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001042230"	"0"	"90"	"17"	"78081636"	"78081636"	"subst"	"0"	"01804"	"GAA_000039"	"g.78081636T>G"	""	""	""	"GAA(NM_000152.5):c.896T>G (p.(Leu299Arg))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001042231"	"0"	"50"	"17"	"78082611"	"78082611"	"subst"	"7.591E-5"	"02325"	"GAA_000561"	"g.78082611G>A"	""	""	""	"GAA(NM_000152.5):c.1310G>A (p.R437H)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001042232"	"0"	"50"	"17"	"78083763"	"78083763"	"subst"	"0.000150676"	"02325"	"GAA_000830"	"g.78083763C>T"	""	""	""	"GAA(NM_000152.5):c.1346C>T (p.S449L)"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001042233"	"0"	"30"	"17"	"78087089"	"78087089"	"subst"	"0"	"01804"	"GAA_000831"	"g.78087089C>G"	""	""	""	"GAA(NM_000152.5):c.2113C>G (p.(Leu705Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"likely benign"	""
"0001042234"	"0"	"50"	"17"	"78087111"	"78087111"	"subst"	"0"	"01804"	"GAA_000330"	"g.78087111T>C"	""	""	""	"GAA(NM_000152.3):c.2135T>C (p.L712P), GAA(NM_000152.5):c.2135T>C (p.(Leu712Pro))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001042235"	"0"	"90"	"17"	"78090815"	"78090815"	"subst"	"0.000305037"	"01804"	"GAA_000036"	"g.78090815G>C"	""	""	""	"GAA(NM_000152.3):c.2238G>C (p.W746C, p.(Trp746Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001042237"	"0"	"90"	"17"	"78092070"	"78092070"	"subst"	"0.000169882"	"01804"	"GAA_000025"	"g.78092070C>T"	""	""	""	"GAA(NM_000152.3):c.2560C>T (p.R854*), GAA(NM_000152.5):c.2560C>T (p.(Arg854Ter))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"pathogenic"	""
"0001046675"	"0"	"10"	"17"	"78075462"	"78075462"	"subst"	"0"	"02326"	"CCDC40_000231"	"g.78075462G>C"	""	""	""	"GAA(NM_000152.3):c.-260G>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046676"	"0"	"10"	"17"	"78079224"	"78079224"	"subst"	"0"	"02326"	"CCDC40_000232"	"g.78079224G>A"	""	""	""	"GAA(NM_000152.3):c.546+293G>A"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046677"	"0"	"10"	"17"	"78079310"	"78079310"	"subst"	"0"	"02326"	"CCDC40_000233"	"g.78079310T>C"	""	""	""	"GAA(NM_000152.3):c.547-238T>C"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046678"	"0"	"10"	"17"	"78079481"	"78079481"	"subst"	"0"	"02326"	"GAA_000473"	"g.78079481C>G"	""	""	""	"GAA(NM_000152.3):c.547-67C>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046679"	"0"	"10"	"17"	"78080202"	"78080202"	"subst"	"0"	"02326"	"GAA_000832"	"g.78080202T>G"	""	""	""	"GAA(NM_000152.3):c.692+509T>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046680"	"0"	"10"	"17"	"78086892"	"78086892"	"subst"	"0"	"02326"	"GAA_000833"	"g.78086892C>T"	""	""	""	"GAA(NM_000152.3):c.2040+66C>T"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046681"	"0"	"10"	"17"	"78086895"	"78086895"	"subst"	"0"	"02326"	"GAA_000834"	"g.78086895A>G"	""	""	""	"GAA(NM_000152.3):c.2040+69A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046682"	"0"	"10"	"17"	"78090323"	"78090323"	"subst"	"0"	"02326"	"GAA_000835"	"g.78090323A>G"	""	""	""	"GAA(NM_000152.3):c.2190-444A>G"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001046922"	"0"	"90"	"17"	"78081447"	"78081447"	"subst"	"8.13041E-6"	"03779"	"GAA_000100"	"g.78081447G>A"	""	""	""	""	""	"Unknown"	""	"rs201896815"	"0"	""	""	""	""	"pathogenic"	""
"0001056214"	"0"	"50"	"17"	"78081664"	"78081664"	"subst"	"2.90447E-5"	"01804"	"GAA_000836"	"g.78081664C>T"	""	""	""	"GAA(NM_000152.3):c.924C>T (p.(His308=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001056215"	"0"	"50"	"17"	"78082335"	"78082335"	"subst"	"4.09272E-5"	"01804"	"GAA_000392"	"g.78082335C>T"	""	""	""	"GAA(NM_000152.5):c.1123C>T (p.(Arg375Cys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001056216"	"0"	"50"	"17"	"78082585"	"78082585"	"subst"	"0"	"01804"	"GAA_000837"	"g.78082585G>A"	""	""	""	"GAA(NM_000152.5):c.1284G>A (p.(Val428=))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001056217"	"0"	"50"	"17"	"78086397"	"78086397"	"subst"	"0"	"01804"	"GAA_000838"	"g.78086397G>T"	""	""	""	"GAA(NM_000152.5):c.1775G>T (p.(Gly592Val))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"VUS"	""
"0001056218"	"0"	"10"	"17"	"78087041"	"78087041"	"subst"	"0.0551314"	"01804"	"GAA_000035"	"g.78087041G>A"	""	""	""	"GAA(NM_000152.3):c.2065G>A (p.E689K), GAA(NM_000152.5):c.2065G>A (p.(Glu689Lys))"	"VKGL data sharing initiative Nederland"	"CLASSIFICATION record"	""	""	""	""	""	""	""	"benign"	""
"0001057914"	"0"	"70"	"17"	"78078341"	"78078341"	"subst"	""	"00006"	"GAA_000029"	"g.78078341T>G"	""	"{PMID:Ayala-Ramirez 2025:41066171}"	""	""	""	"Germline"	""	"rs386834236"	"0"	""	""	"g.80104542T>G"	"{CV:4027}"	"likely pathogenic"	""
"0001057923"	"0"	"50"	"17"	"78078837"	"78078837"	"subst"	""	"00006"	"chr17_010889"	"g.78078837C>T"	""	"{PMID:Ayala-Ramirez 2025:41066171}"	""	""	""	"Germline"	""	"rs772518246"	"0"	""	""	"g.80105038C>T"	"{CV:196125}"	"VUS"	""
"0001057950"	"0"	"70"	"17"	"78083774"	"78083774"	"subst"	""	"00006"	"chr17_010890"	"g.78083774G>A"	""	"{PMID:Ayala-Ramirez 2025:41066171}"	""	""	""	"Germline"	""	"rs550065979"	"0"	""	""	"g.80109975G>A"	"{CV:526541}"	"likely pathogenic"	""


## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes GAA
## Count = 3084
"{{id}}"	"{{transcriptid}}"	"{{effectid}}"	"{{position_c_start}}"	"{{position_c_start_intron}}"	"{{position_c_end}}"	"{{position_c_end_intron}}"	"{{VariantOnTranscript/DNA}}"	"{{VariantOnTranscript/RNA}}"	"{{VariantOnTranscript/Protein}}"	"{{VariantOnTranscript/Exon}}"	"{{VariantOnTranscript/Enzyme/Kinase_activity}}"
"0000000650"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000000651"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000000652"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000000653"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000000654"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000000655"	"00024242"	"50"	"2544"	"0"	"2544"	"0"	"c.2544del"	"r.(?)"	"p.(Lys849Argfs*38)"	"18"	""
"0000000656"	"00024242"	"50"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000000657"	"00024242"	"50"	"953"	"0"	"953"	"0"	"c.953T>C"	"r.(?)"	"p.(Met318Thr)"	"5"	""
"0000000658"	"00024242"	"50"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000000659"	"00024242"	"50"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000000660"	"00024242"	"50"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000000661"	"00024242"	"50"	"1441"	"0"	"1441"	"0"	"c.1441T>C"	"r.(?)"	"p.(Trp481Arg)"	"10"	""
"0000000662"	"00024242"	"50"	"1326"	"1"	"1326"	"1"	"c.1326+1G>A"	"r.spl?"	"p.?"	"8i"	""
"0000000663"	"00024242"	"50"	"2544"	"0"	"2544"	"0"	"c.2544del"	"r.(?)"	"p.(Lys849Argfs*38)"	"18"	""
"0000000664"	"00024242"	"50"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163951"	"00024242"	"90"	"0"	"0"	"0"	"0"	"c.?"	"r.0"	"p.0"	"_1_20_"	""
"0000163952"	"00024242"	"10"	"-82"	"0"	"-82"	"0"	"c.-82G>C"	"r.(?)"	"p.(=)"	"1"	""
"0000163953"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163954"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163955"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163956"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163957"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163958"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163959"	"00024242"	"70"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000163960"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000163961"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000163962"	"00024242"	"90"	"172"	"0"	"172"	"0"	"c.172C>T"	"r.(?)"	"p.(Gln58*)"	"2"	""
"0000163963"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	"2"	""
"0000163964"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271del"	"r.(?)"	"p.(Asp91Ilefs*51)"	"2"	""
"0000163965"	"00024242"	"10"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000163966"	"00024242"	"90"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000163967"	"00024242"	"90"	"309"	"0"	"309"	"0"	"c.309C>A"	"r.(?)"	"p.(Cys103*)"	"2"	""
"0000163968"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(Cys108=)"	"2"	""
"0000163969"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(Cys108=)"	"2"	""
"0000163970"	"00024242"	"90"	"340"	"0"	"341"	"0"	"c.340_341insT"	"r.(?)"	"p.(Lys114Ilefs*32)"	"2"	""
"0000163971"	"00024242"	"90"	"379"	"0"	"380"	"0"	"c.379_380del"	"r.(?)"	"p.(Cys127Leufs*18)"	"2"	""
"0000163972"	"00024242"	"90"	"399"	"0"	"399"	"0"	"c.399C>A"	"r.(?)"	"p.(Tyr133*)"	"2"	""
"0000163973"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	"2"	""
"0000163974"	"00024242"	"10"	"510"	"0"	"510"	"0"	"c.510C>T"	"r.(?)"	"p.(Asp170=)"	"2"	""
"0000163975"	"00024242"	"50"	"524"	"0"	"524"	"0"	"c.524C>G"	"r.(?)"	"p.(Thr175Ser)"	"2"	""
"0000163976"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000163977"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000163978"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000163979"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.[spl, 546g>]"	"p.[?, Thr182=]"	"2"	""
"0000163980"	"00024242"	"90"	"573"	"0"	"573"	"0"	"c.573C>A"	"r.(?)"	"p.(Tyr191*)"	"3"	""
"0000163981"	"00024242"	"10"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	"3"	""
"0000163982"	"00024242"	"90"	"623"	"0"	"623"	"0"	"c.623T>C"	"r.(?)"	"p.(Leu208Pro)"	"3"	""
"0000163983"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(Ser214Ser)"	"3"	""
"0000163984"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(Ser214Ser)"	"3"	""
"0000163985"	"00024242"	"90"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000163986"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	"3"	""
"0000163987"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	"3"	""
"0000163988"	"00024242"	"90"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000163989"	"00024242"	"90"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000163991"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>C"	"r.spl?"	"p.?"	"3i"	""
"0000163992"	"00024242"	"90"	"716"	"0"	"716"	"0"	"c.716del"	"r.(?)"	"p.(Leu239Argfs*29)"	"4"	""
"0000163993"	"00024242"	"50"	"719"	"0"	"719"	"0"	"c.719T>C"	"r.(?)"	"p.(Phe240Ser)"	"4"	""
"0000163994"	"00024242"	"90"	"722"	"0"	"723"	"0"	"c.722_723del"	"r.(?)"	"p.(Phe241Cysfs*88)"	"4"	""
"0000163995"	"00024242"	"90"	"766"	"0"	"785"	"0"	"c.766_785delinsC"	"r.(?)"	"p.(Tyr256Argfs*6)"	"4"	""
"0000163996"	"00024242"	"90"	"766"	"0"	"785"	"0"	"c.766_785delinsC"	"r.(?)"	"p.(Tyr256Argfs*6)"	"4"	""
"0000163997"	"00024242"	"90"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000163998"	"00024242"	"90"	"829"	"0"	"851"	"0"	"c.829_851del"	"r.(?)"	"p.(Thr277Alafs*45)"	"4"	""
"0000163999"	"00024242"	"90"	"854"	"0"	"854"	"0"	"c.854C>G"	"r.(?)"	"p.(Pro285Arg)"	"4"	""
"0000164000"	"00024242"	"10"	"858"	"20"	"858"	"20"	"c.858+20dup"	"r.(?)"	"p.(=)"	"4i"	""
"0000164001"	"00024242"	"10"	"858"	"20"	"858"	"20"	"c.858+20C>G"	"r.(?)"	"p.(=)"	"4i"	""
"0000164002"	"00024242"	"90"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000164003"	"00024242"	"90"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000164004"	"00024242"	"90"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000164005"	"00024242"	"90"	"896"	"0"	"896"	"0"	"c.896T>G"	"r.(?)"	"p.(Leu299Arg)"	"5"	""
"0000164006"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(Ala307=)"	"5"	""
"0000164007"	"00024242"	"90"	"923"	"0"	"923"	"0"	"c.923A>C"	"r.(?)"	"p.(His308Pro)"	"5"	""
"0000164008"	"00024242"	"90"	"923"	"0"	"923"	"0"	"c.923A>T"	"r.(?)"	"p.(His308Leu)"	"5"	""
"0000164009"	"00024242"	"90"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000164010"	"00024242"	"90"	"935"	"0"	"935"	"0"	"c.935T>G"	"r.(?)"	"p.(Leu312Arg)"	"5"	""
"0000164011"	"00024242"	"90"	"953"	"0"	"953"	"0"	"c.953T>C"	"r.(?)"	"p.(Met318Thr)"	"5"	""
"0000164012"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12A>G"	"r.(?)"	"p.(=)"	"5i"	""
"0000164013"	"00024242"	"90"	"971"	"0"	"971"	"0"	"c.971C>T"	"r.(?)"	"p.(Pro324Leu)"	"6"	""
"0000164014"	"00024242"	"90"	"988"	"0"	"988"	"0"	"c.988T>G"	"r.(?)"	"p.(Trp330Gly)"	"6"	""
"0000164015"	"00024242"	"90"	"989"	"0"	"989"	"0"	"c.989G>A"	"r.(?)"	"p.(Trp330*)"	"6"	""
"0000164016"	"00024242"	"90"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000164017"	"00024242"	"90"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000164018"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl"	"p.(Asp319_Val358delinsGlySerArgArgTrpProAla)"	"6i"	""
"0000164019"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl"	"p.(Asp319_Val358delinsGlySerArgArgTrpProAla)"	"6i"	""
"0000164020"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl?"	"p.?"	"6i"	""
"0000164021"	"00024242"	"90"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000164022"	"00024242"	"90"	"1120"	"0"	"1120"	"0"	"c.1120T>C"	"r.(?)"	"p.(Cys374Arg)"	"7"	""
"0000164023"	"00024242"	"90"	"1129"	"0"	"1129"	"0"	"c.1129G>C"	"r.(?)"	"p.(Gly377Arg)"	"7"	""
"0000164024"	"00024242"	"50"	"1194"	"2"	"1194"	"2"	"c.1194+2T>A"	"r.spl?"	"p.?"	"7i"	""
"0000164025"	"00024242"	"90"	"1195"	"-19"	"2190"	"-17"	"c.1195-19_2190-17del"	"r.(?)"	"p.(Asp399Valfs*6)"	"7i_15i"	""
"0000164026"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(Gln401=)"	"8"	""
"0000164027"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(Gln401=)"	"8"	""
"0000164028"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(Gln401=)"	"8"	""
"0000164029"	"00024242"	"90"	"1204"	"0"	"1204"	"0"	"c.1204T>C"	"r.(?)"	"p.(Trp402Arg)"	"8"	""
"0000164030"	"00024242"	"90"	"1210"	"0"	"1210"	"0"	"c.1210G>A"	"r.(?)"	"p.(Asp404Asn)"	"8"	""
"0000164031"	"00024242"	"90"	"1214"	"0"	"1214"	"0"	"c.1214T>C"	"r.(?)"	"p.(Leu405Pro)"	"8"	""
"0000164032"	"00024242"	"90"	"1222"	"0"	"1222"	"0"	"c.1222A>G"	"r.(?)"	"p.(Met408Val)"	"8"	""
"0000164033"	"00024242"	"90"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000164034"	"00024242"	"90"	"1326"	"1"	"1326"	"1"	"c.1326+1G>A"	"r.spl?"	"p.(Val876_Asn882del)"	"8i"	""
"0000164035"	"00024242"	"10"	"1327"	"-18"	"1327"	"-18"	"c.1327-18G>A"	"r.(?)"	"p.(=)"	"8i"	""
"0000164036"	"00024242"	"90"	"1333"	"0"	"1333"	"0"	"c.1333G>C"	"r.(?)"	"p.(Ala445Pro)"	"9"	""
"0000164037"	"00024242"	"90"	"1364"	"0"	"1364"	"0"	"c.1364A>T"	"r.(?)"	"p.(Tyr455Phe)"	"9"	""
"0000164038"	"00024242"	"90"	"1377"	"0"	"1379"	"0"	"c.1377_1379del"	"r.(?)"	"p.(Asp459del)"	"9"	""
"0000164039"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(=)"	"p.(Tyr458=)"	"9"	""
"0000164040"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(=)"	"p.(Tyr458=)"	"9"	""
"0000164041"	"00024242"	"50"	"1408"	"0"	"1410"	"0"	"c.1408_1410del"	"r.(?)"	"p.(Asn470del)"	"9"	""
"0000164042"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000164043"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000164044"	"00024242"	"90"	"1432"	"0"	"1432"	"0"	"c.1432G>A"	"r.(?)"	"p.(Gly478Arg)"	"9"	""
"0000164045"	"00024242"	"90"	"1437"	"2"	"1437"	"2"	"c.1437+2T>C"	"r.spl"	"p.(Asp443_Lys479del)"	"9i"	""
"0000164046"	"00024242"	"10"	"1438"	"-19"	"1438"	"-19"	"c.1438-19C>G"	"r.(?)"	"p.(=)"	"9i"	""
"0000164047"	"00024242"	"90"	"1438"	"-1"	"1438"	"-1"	"c.1438-1G>C"	"r.spl"	"p.(Val480_Ile517del)"	"9i"	""
"0000164048"	"00024242"	"90"	"1441"	"0"	"1441"	"0"	"c.1441del"	"r.(?)"	"p.(Trp481Glyfs*39)"	"10"	""
"0000164049"	"00024242"	"90"	"1441"	"0"	"1441"	"0"	"c.1441T>C"	"r.(?)"	"p.(Trp481Arg)"	"10"	""
"0000164050"	"00024242"	"90"	"1456"	"0"	"1468"	"0"	"c.1456_1468del"	"r.(?)"	"p.(Ala486Serfs*30)"	"10"	""
"0000164051"	"00024242"	"90"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	""
"0000164052"	"00024242"	"90"	"1497"	"0"	"1497"	"0"	"c.1497G>A"	"r.(?)"	"p.(Trp499*)"	"10"	""
"0000164053"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	""
"0000164054"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl?"	"p.(Val480_Ile517del)"	"10i"	""
"0000164055"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl?"	"p.(Val480_Ile517del)"	"10i"	""
"0000164056"	"00024242"	"50"	"1551"	"42"	"1551"	"42"	"c.1551+42G>A"	"r.(=)"	"p.(=)"	"10i"	""
"0000164057"	"00024242"	"90"	"1552"	"-3"	"1552"	"-3"	"c.1552-3C>G"	"r.spl?"	"p.(?)"	"10i"	""
"0000164058"	"00024242"	"90"	"1555"	"0"	"1555"	"0"	"c.1555A>G"	"r.(?)"	"p.(Met519Val)"	"11"	""
"0000164059"	"00024242"	"90"	"1555"	"0"	"1555"	"0"	"c.1555A>G"	"r.(?)"	"p.(Met519Val)"	"11"	""
"0000164060"	"00024242"	"90"	"1556"	"0"	"1556"	"0"	"c.1556T>C"	"r.(?)"	"p.(Met519Thr)"	"11"	""
"0000164061"	"00024242"	"90"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000164062"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	"11"	""
"0000164063"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	"11"	""
"0000164064"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	"11"	""
"0000164065"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	"11"	""
"0000164066"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	"11"	""
"0000164067"	"00024242"	"90"	"1585"	"0"	"1586"	"0"	"c.1585_1586delinsGT"	"r.(?)"	"p.(Ser529Val)"	"11"	""
"0000164068"	"00024242"	"90"	"1585"	"0"	"1586"	"0"	"c.1585_1586delinsGT"	"r.(?)"	"p.(Ser529Val)"	"11"	""
"0000164069"	"00024242"	"50"	"1626"	"0"	"1626"	"0"	"c.1626C>G"	"r.(?)"	"p.(?)"	"11"	""
"0000164070"	"00024242"	"90"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000164071"	"00024242"	"90"	"1645"	"0"	"1645"	"0"	"c.1645G>A"	"r.(?)"	"p.(Gly549Arg)"	"12"	""
"0000164072"	"00024242"	"90"	"1645"	"0"	"1645"	"0"	"c.1645G>C"	"r.(?)"	"p.(Gly549Arg)"	"12"	""
"0000164073"	"00024242"	"90"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000164074"	"00024242"	"70"	"1673"	"0"	"1673"	"0"	"c.1673G>C"	"r.(?)"	"p.(Cys558Ser)"	"12"	""
"0000164075"	"00024242"	"90"	"1687"	"0"	"1687"	"0"	"c.1687C>T"	"r.(?)"	"p.(Gln563*)"	"12"	""
"0000164076"	"00024242"	"90"	"1696"	"0"	"1696"	"0"	"c.1696T>C"	"r.(?)"	"p.(Ser566Pro)"	"12"	""
"0000164077"	"00024242"	"90"	"1696"	"0"	"1696"	"0"	"c.1696T>C"	"r.(?)"	"p.(Ser566Pro)"	"12"	"alpha-glucosidase <0.005, beta-glucosidase 0.9"
"0000164078"	"00024242"	"90"	"1724"	"0"	"1724"	"0"	"c.1724A>C"	"r.(?)"	"p.(Tyr575Ser)"	"12"	""
"0000164079"	"00024242"	"10"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	"12"	""
"0000164080"	"00024242"	"90"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	"12"	""
"0000164081"	"00024242"	"90"	"1754"	"0"	"1754"	"0"	"c.1754G>T"	"r.(?)"	"p.(Arg585Met)"	"12"	""
"0000164082"	"00024242"	"90"	"1776"	"0"	"1776"	"0"	"c.1776del"	"r.(?)"	"p.(Thr593Hisfs*5)"	"13"	""
"0000164083"	"00024242"	"90"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000164084"	"00024242"	"90"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000164085"	"00024242"	"90"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	"13"	""
"0000164086"	"00024242"	"90"	"1819"	"0"	"1836"	"0"	"c.1819_1836del"	"r.(?)"	"p.(Gly607_His612del)"	"13"	""
"0000164087"	"00024242"	"90"	"1820"	"0"	"1820"	"0"	"c.1820G>A"	"r.(?)"	"p.(Gly607Asp)"	"13"	""
"0000164088"	"00024242"	"90"	"1826"	"0"	"1826"	"0"	"c.1826dup"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000164089"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827del"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000164090"	"00024242"	"10"	"1830"	"0"	"1830"	"0"	"c.1830C>T"	"r.(=)"	"p.(Ala610=)"	"13"	""
"0000164091"	"00024242"	"90"	"1833"	"0"	"1839"	"0"	"c.[1833_1839del; 1846G>T; 1847_1848insT]"	"r.spl"	"p.(His612_Asp616delinsArgGlyIle)"	"13"	""
"0000164092"	"00024242"	"90"	"1836"	"0"	"1836"	"0"	"c.1836C>G"	"r.(?)"	"p.(His612Gln)"	"13"	""
"0000164093"	"00024242"	"90"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000164094"	"00024242"	"90"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	"13"	""
"0000164095"	"00024242"	"90"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000164096"	"00024242"	"90"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000164097"	"00024242"	"10"	"1917"	"0"	"1917"	"0"	"c.1917G>A"	"r.(=)"	"p.(Val639=)"	"14"	""
"0000164098"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000164099"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000164100"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.1927g>a"	"p.Gly643Arg"	"14"	"alpha-glucosidase <0.005, beta-glucosidase 0.4"
"0000164101"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000164102"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000164103"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>C"	"r.(?)"	"p.(Asp645His)"	"14"	""
"0000164104"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000164105"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000164106"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000164107"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000164108"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000164109"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000164110"	"00024242"	"90"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000164111"	"00024242"	"90"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000164112"	"00024242"	"90"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000164113"	"00024242"	"90"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	"14"	""
"0000164114"	"00024242"	"90"	"2012"	"0"	"2012"	"0"	"c.2012T>G"	"r.(?)"	"p.(Met671Arg)"	"14"	""
"0000164115"	"00024242"	"90"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000164116"	"00024242"	"90"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000164117"	"00024242"	"90"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	"14"	""
"0000164118"	"00024242"	"90"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	"14"	""
"0000164119"	"00024242"	"90"	"2024"	"0"	"2026"	"0"	"c.2024_2026del"	"r.(?)"	"p.(Asn675del)"	"14"	""
"0000164120"	"00024242"	"10"	"2041"	"-64"	"2041"	"-64"	"c.2041-64A>G"	"r.(?)"	"p.(=)"	"14i"	""
"0000164121"	"00024242"	"90"	"2041"	"-2"	"2041"	"-2"	"c.2041-2A>C"	"r.spl?"	"p.(Pro681_Asp682del)"	"14i"	""
"0000164122"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	"15"	""
"0000164123"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	"15"	""
"0000164124"	"00024242"	"90"	"2066"	"0"	"2070"	"0"	"c.2066_2070dup"	"r.(?)"	"p.(Ala691Serfs*7)"	"15"	""
"0000164125"	"00024242"	"90"	"2104"	"0"	"2104"	"0"	"c.2104C>T"	"r.(?)"	"p.(Arg702Cys)"	"15"	""
"0000164126"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(=)"	"p.(Thr711=)"	"15"	""
"0000164127"	"00024242"	"10"	"2154"	"0"	"2154"	"0"	"c.2154C>T"	"r.(=)"	"p.(Val718=)"	"15"	""
"0000164128"	"00024242"	"90"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000164129"	"00024242"	"90"	"2188"	"0"	"2188"	"0"	"c.2188G>T"	"r.(?)"	"p.(Glu730*)"	"15"	""
"0000164130"	"00024242"	"90"	"2189"	"459"	"3408"	"0"	"c.2189+459_*549del"	"r.spl"	"p.(Glu730_Cys952del)"	"15i_20_"	""
"0000164131"	"00024242"	"90"	"2219"	"0"	"2220"	"0"	"c.2219_2220del"	"r.(?)"	"p.(Val740Glyfs*55)"	"16"	""
"0000164132"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000164133"	"00024242"	"10"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000164134"	"00024242"	"10"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000164135"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000164136"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000164137"	"00024242"	"90"	"2303"	"0"	"2303"	"0"	"c.2303C>G"	"r.(?)"	"p.(Pro768Arg)"	"16"	""
"0000164138"	"00024242"	"90"	"2303"	"0"	"2303"	"0"	"c.2303C>G"	"r.(?)"	"p.(Pro768Arg)"	"16"	""
"0000164139"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>C"	"r.spl?"	"p.(Tyr773fs*3)"	"16i"	""
"0000164140"	"00024242"	"90"	"2331"	"4"	"2331"	"4"	"c.2331+4A>G"	"r.spl?"	"p.?"	"16i"	""
"0000164141"	"00024242"	"10"	"2338"	"0"	"2338"	"0"	"c.2338G>A"	"r.(?)"	"p.(Val780Ile)"	"17"	""
"0000164142"	"00024242"	"90"	"2380"	"0"	"2380"	"0"	"c.2380del"	"r.(?)"	"p.(Arg794Valfs*12)"	"17"	""
"0000164143"	"00024242"	"90"	"2431"	"0"	"2431"	"0"	"c.2431dup"	"r.(?)"	"p.(Leu811Profs*73)"	"17"	""
"0000164144"	"00024242"	"90"	"2432"	"0"	"2432"	"0"	"c.2432del"	"r.(?)"	"p.(Leu811Argfs*37)"	"17"	""
"0000164145"	"00024242"	"10"	"2446"	"0"	"2446"	"0"	"c.2446G>A"	"r.(?)"	"p.(Val816Ile)"	"17"	""
"0000164146"	"00024242"	"10"	"2446"	"0"	"2446"	"0"	"c.2446G>A"	"r.(?)"	"p.(Val816Ile)"	"17"	""
"0000164147"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.?"	"p.(Gly828_Asn882del)"	"17i_18i"	""
"0000164150"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.?"	"p.(Gly828_Asn882del)"	"17i_18i"	""
"0000164153"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.?"	"p.(Gly828_Asn882del)"	"17i_18i"	""
"0000164154"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(Gly851=)"	"18"	""
"0000164155"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(Gly851=)"	"18"	""
"0000164156"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(Gly851=)"	"18"	""
"0000164157"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164158"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164159"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164160"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164161"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164162"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164163"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164164"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000164165"	"00024242"	"90"	"2639"	"0"	"2639"	"0"	"c.2639C>A"	"r.(?)"	"p.(Ala880Asp)"	"18"	""
"0000164166"	"00024242"	"50"	"2646"	"2"	"2646"	"3"	"c.2646+2_2646+3del"	"r.spl"	"p.?"	"18_18i"	""
"0000164167"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl"	"p.(Val876_Asn882del)"	"18i"	""
"0000164168"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl"	"p.(Val876_Asn882del)"	"19"	""
"0000164169"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000164170"	"00024242"	"90"	"2702"	"0"	"2702"	"0"	"c.2702T>A"	"r.(?)"	"p.(Leu901Gln)"	"19"	""
"0000164171"	"00024242"	"90"	"2707"	"0"	"2709"	"0"	"c.2707_2709del"	"r.(?)"	"p.(Lys903del)"	"19"	""
"0000164172"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsCAG"	"r.(?)"	"p.(Gln914Profs*30)"	"19"	"alpha-glucosidase <0.005, beta-glucosidase 1.0"
"0000164173"	"00024242"	"90"	"2758"	"0"	"2775"	"0"	"c.2758_2775dup"	"r.(?)"	"p.(Gly920_Asn925dup)"	"19"	""
"0000164174"	"00024242"	"10"	"2780"	"0"	"2780"	"0"	"c.2780C>T"	"r.(?)"	"p.(Thr927Ile)"	"19"	""
"0000164175"	"00024242"	"10"	"2780"	"0"	"2780"	"0"	"c.2780C>T"	"r.(?)"	"p.(Thr927Ile)"	"19"	""
"0000164176"	"00024242"	"10"	"2808"	"0"	"2808"	"0"	"c.2808C>T"	"r.(?)"	"p.(Asp936=)"	"20"	""
"0000164177"	"00024242"	"90"	"2815"	"0"	"2816"	"0"	"c.2815_2816del"	"r.(?)"	"p.(Val939Leufs*78)"	"20"	""
"0000164178"	"00024242"	"90"	"2846"	"0"	"2846"	"0"	"c.2846T>A"	"r.(?)"	"p.(Val949Asp)"	"20"	""
"0000164179"	"00024242"	"10"	"2862"	"0"	"2862"	"0"	"c.*3G>A"	"r.(?)"	"p.(=)"	"20"	""
"0000164180"	"00024242"	"10"	"2862"	"0"	"2862"	"0"	"c.*3G>A"	"r.(?)"	"p.(=)"	"20"	""
"0000164181"	"00024242"	"10"	"2950"	"0"	"2950"	"0"	"c.*91G>A"	"r.(?)"	"p.(=)"	"20"	""
"0000164182"	"00024242"	"10"	"2999"	"0"	"2999"	"0"	"c.*140del"	"r.(?)"	"p.(=)"	"20"	""
"0000164183"	"00024242"	"10"	"3002"	"0"	"3002"	"0"	"c.*143C>T"	"r.(?)"	"p.(=)"	"20"	""
"0000164184"	"00024242"	"10"	"3082"	"0"	"3082"	"0"	"c.*223C>T"	"r.(?)"	"p.(=)"	"20"	""
"0000164185"	"00024242"	"10"	"3086"	"0"	"3086"	"0"	"c.*227G>C"	"r.(?)"	"p.(=)"	"20"	""
"0000164186"	"00024242"	"10"	"3086"	"0"	"3086"	"0"	"c.*227G>C"	"r.(?)"	"p.(=)"	"20"	""
"0000164187"	"00024242"	"10"	"3277"	"0"	"3277"	"0"	"c.*418T>C"	"r.(?)"	"p.(=)"	"20"	""
"0000164188"	"00024242"	"10"	"3277"	"0"	"3277"	"0"	"c.*418T>C"	"r.(?)"	"p.(=)"	"20"	""
"0000164189"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsCAG"	"r.(?)"	"p.(Gln914Profs*30)"	"19"	"alpha-glucosidase <0.005, beta-glucosidase 0.8"
"0000164190"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsCAG"	"r.(?)"	"p.(Gln914Profs*30)"	"19"	"alpha-glucosidase <0.005, beta-glucosidase 0.5"
"0000164191"	"00024242"	"10"	"1971"	"0"	"1971"	"0"	"c.1971G>A"	"r.(=)"	"p.(Leu657=)"	"14"	""
"0000164192"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(=)"	"p.(Gly851=)"	"18"	""
"0000164193"	"00024242"	"30"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000164194"	"00024242"	"10"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	"3"	""
"0000164195"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	"3"	""
"0000164196"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(Gly851=)"	"18"	""
"0000164197"	"00024242"	"90"	"1696"	"0"	"1696"	"0"	"c.1696T>C"	"r.(?)"	"p.Ser566Pro"	"12"	""
"0000164198"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000164199"	"00024242"	"90"	"2303"	"0"	"2303"	"0"	"c.2303C>G"	"r.(?)"	"p.Pro768Arg"	"16"	""
"0000168219"	"00024242"	"70"	"1829"	"0"	"1829"	"0"	"c.1829C>T"	"r.(?)"	"p.(Ala610Val)"	"13"	"5% residual activity, affects secretion & processing in expression study"
"0000168220"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000168221"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000168222"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000168223"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000168224"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000168225"	"00024242"	"50"	"853"	"0"	"853"	"0"	"c.853C>T"	"r.(?)"	"p.(Pro285Ser)"	"4"	"gives 4,8% residual activity in expression study"
"0000168226"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000168227"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000168228"	"00024242"	"70"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	"13"	"4-6% residual activity, affects secretion & processing in expression study"
"0000168229"	"00024242"	"70"	"1437"	"0"	"1437"	"0"	"c.1437G>A"	"r.[1437g>a, 1327_1437del]"	"p.[=, Asp443_Lys479del]"	"9"	"gives 1,2% residual activity in expression study"
"0000168231"	"00024242"	"90"	"692"	"5"	"692"	"5"	"c.692+5G>T"	"r.spl?"	"p.?"	"3i"	""
"0000168232"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	"3"	""
"0000168233"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(=)"	"11"	""
"0000168234"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(=)"	"2"	""
"0000168235"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(=)"	"8"	""
"0000168236"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	"15"	""
"0000168237"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(=)"	"18"	""
"0000168238"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(=)"	"3"	""
"0000168239"	"00024242"	"50"	"811"	"0"	"811"	"0"	"c.811A>G"	"r.(?)"	"p.(Thr271Ala)"	"4"	"gives 83,6% residual activity in expression study"
"0000168240"	"00024242"	"50"	"2132"	"0"	"2132"	"0"	"c.2132C>G"	"r.(?)"	"p.(Thr711Arg)"	"15"	"86% residual activity, affects processing in expression study"
"0000168241"	"00024242"	"10"	"2780"	"0"	"2780"	"0"	"c.2780C>T"	"r.(?)"	"p.(Thr927Ile)"	"19"	""
"0000168242"	"00024242"	"10"	"2446"	"0"	"2446"	"0"	"c.2446G>A"	"r.(?)"	"p.(Val816Ile)"	"17"	""
"0000168243"	"00024242"	"70"	"752"	"0"	"752"	"0"	"c.752C>T"	"r.(?)"	"p.(Ser251Leu)"	"4"	""
"0000168244"	"00024242"	"70"	"761"	"0"	"761"	"0"	"c.761C>T"	"r.(?)"	"p.(Ser254Leu)"	"4"	""
"0000168245"	"00024242"	"50"	"1754"	"0"	"1754"	"0"	"c.1754G>A"	"r.(?)"	"p.(Arg585Lys)"	"12"	"gives 94% residual activity in expression study"
"0000168246"	"00024242"	"70"	"1456"	"0"	"1456"	"0"	"c.1456G>C"	"r.(?)"	"p.(Ala486Pro)"	"10"	"0% residual activity, affects secretion & processing in expression study"
"0000168247"	"00024242"	"50"	"671"	"0"	"671"	"0"	"c.671G>C"	"r.(?)"	"p.(Arg224Pro)"	"3"	"0% residual activity, affects secretion & processing in expression study"
"0000168248"	"00024242"	"70"	"1781"	"0"	"1781"	"0"	"c.1781G>A"	"r.(?)"	"p.(Arg594His)"	"13"	"0.1% residual activity, affects secretion & processing in expression study"
"0000168249"	"00024242"	"70"	"1781"	"0"	"1781"	"0"	"c.1781G>C"	"r.(?)"	"p.(Arg594Pro)"	"13"	"1,2% residual activity, affects secretion & processing in expression study"
"0000168250"	"00024242"	"70"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	"13"	""
"0000168251"	"00024242"	"70"	"2104"	"0"	"2104"	"0"	"c.2104C>T"	"r.(?)"	"p.(Arg702Cys)"	"15"	""
"0000168252"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	"decreased enzymatic activity in expression study"
"0000168253"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	"<1% residual activity, affects processing in expression study"
"0000168254"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000168255"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	"gives 1,5% (4MU) and 0% (glycogen) residual activity in expression study"
"0000168256"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000168257"	"00024242"	"70"	"2228"	"0"	"2228"	"0"	"c.2228A>G"	"r.(?)"	"p.(Gln743Arg)"	"16"	"0.8% residual activity, affects secretion & processing in expression study"
"0000168258"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000168259"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000168260"	"00024242"	"70"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	"12"	""
"0000168261"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	"gives 0.5% (4MU) and 0% (glycogen) residual activity in expression study"
"0000168262"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000168263"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	"affects  processing in expression study"
"0000168264"	"00024242"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>A"	"r.(?)"	"p.(Gly335Arg)"	"6"	"0.8% residual activity, affects secretion & processing in expression study"
"0000168265"	"00024242"	"70"	"1432"	"0"	"1432"	"0"	"c.1432G>A"	"r.(?)"	"p.(Gly478Arg)"	"9"	""
"0000168266"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000168267"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000168268"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000168269"	"00024242"	"70"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000168270"	"00024242"	"50"	"871"	"0"	"871"	"0"	"c.871C>T"	"r.(?)"	"p.(Leu291Phe)"	"5"	"gives 0.7% residual activity in expression study"
"0000168271"	"00024242"	"70"	"872"	"0"	"872"	"0"	"c.872T>C"	"r.(?)"	"p.(Leu291Pro)"	"5"	"0.7% residual activity, affects secretion & processing in expression study"
"0000168272"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	"0% residual activity, affects secretion & processing in expression study"
"0000168273"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000168274"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000168275"	"00024242"	"50"	"953"	"0"	"953"	"0"	"c.953T>A"	"r.(?)"	"p.(Met318Lys)"	"5"	"3,2% residual activity, affects secretion & processing in expression study"
"0000168276"	"00024242"	"70"	"1222"	"0"	"1222"	"0"	"c.1222A>G"	"r.(?)"	"p.(Met408Val)"	"8"	""
"0000168277"	"00024242"	"50"	"1040"	"0"	"1040"	"0"	"c.1040C>G"	"r.(?)"	"p.(Pro347Arg)"	"6"	"1% residual activity, affects secretion & processing in expression study"
"0000168278"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	"3,9% residual activity, affects secretion & processing in expression study"
"0000168279"	"00024242"	"70"	"1841"	"0"	"1841"	"0"	"c.1841C>A"	"r.(?)"	"p.(Thr614Lys)"	"13"	"1,7% residual activity, affects secretion & processing in expression study"
"0000168280"	"00024242"	"70"	"1441"	"0"	"1441"	"0"	"c.1441T>C"	"r.(?)"	"p.(Trp481Arg)"	"10"	""
"0000168281"	"00024242"	"70"	"2237"	"0"	"2237"	"0"	"c.2237G>C"	"r.(?)"	"p.(Trp746Ser)"	"16"	"0.1% residual activity, affects secretion & processing in expression study"
"0000168282"	"00024242"	"70"	"1396"	"0"	"1396"	"0"	"c.1396G>T"	"r.(?)"	"p.(Val466Phe)"	"9"	"0% residual activity, affects secretion & processing in expression study"
"0000168283"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>A"	"r.(?)"	"p.(Arg702His)"	"15"	"13% residual activity, affects secretion & processing in expression study"
"0000168284"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000168285"	"00024242"	"70"	"1574"	"0"	"1574"	"0"	"c.1574T>A"	"r.(?)"	"p.(Phe525Tyr)"	"11"	"gives 13,4% residual activity in expression study"
"0000168286"	"00024242"	"70"	"796"	"0"	"796"	"0"	"c.796C>T"	"r.(?)"	"p.(Pro266Ser)"	"4"	"gives 18% residual activity in expression study"
"0000168287"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	"gives 29,4% residual activity in expression study"
"0000168288"	"00024242"	"70"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000168289"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.[=,-32_546del,-32_486del]"	"p.[=,0]"	"1i"	""
"0000168290"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl?"	"p.(=)"	"6i"	""
"0000168291"	"00024242"	"10"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	"12"	""
"0000168292"	"00024242"	"50"	"2040"	"0"	"2040"	"0"	"c.2040G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000168293"	"00024242"	"70"	"503"	"0"	"503"	"0"	"c.503G>A"	"r.(?)"	"p.(Arg168Gln)"	"2"	""
"0000168294"	"00024242"	"90"	"2041"	"-1"	"2041"	"-1"	"c.2041-1G>A"	"r.spl"	"p.?"	"14i"	""
"0000168295"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000168296"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	"no protein on western blot"
"0000168297"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	"18"	"no protein on western blot"
"0000168298"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	"2"	""
"0000168299"	"00024242"	"90"	"379"	"0"	"380"	"0"	"c.379_380del"	"r.(?)"	"p.(Cys127Leufs*18)"	"2"	"no protein on western blot"
"0000168300"	"00024242"	"90"	"2269"	"0"	"2269"	"0"	"c.2269C>T"	"r.(?)"	"p.(Gln757*)"	"16"	""
"0000168301"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	"no protein on western blot"
"0000168302"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000168303"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000168304"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000168305"	"00024242"	"70"	"1669"	"0"	"1669"	"0"	"c.1669A>T"	"r.(?)"	"p.(Ile557Phe)"	"12"	"2.9% residual activity, affects secretion & processing in expression study"
"0000168306"	"00024242"	"90"	"1694"	"0"	"1697"	"0"	"c.1694_1697del"	"r.(?)"	"p.(Leu565Profs*12)"	"12"	""
"0000168307"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	"2"	""
"0000168308"	"00024242"	"90"	"236"	"0"	"246"	"0"	"c.236_246del"	"r.(?)"	"p.(Pro79Argfs*13)"	"2"	"no protein on western blot"
"0000168309"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834Argfs*49)"	"18"	""
"0000168310"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000168311"	"00024242"	"90"	"1128"	"0"	"1129"	"0"	"c.1128_1129delinsC"	"r.(?)"	"p.(Trp376Cysfs*16)"	"7"	"no protein on western blot"
"0000168312"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	"no protein on western blot"
"0000168313"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	"no protein on western blot"
"0000168314"	"00024242"	"90"	"1062"	"0"	"1062"	"0"	"c.1062C>G"	"r.(?)"	"p.(Tyr354*)"	"6"	""
"0000168315"	"00024242"	"90"	"1051"	"0"	"1051"	"0"	"c.1051del"	"r.(?)"	"p.(Val351Cysfs*41)"	"6"	""
"0000168316"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396del"	"r.(?)"	"p.(Val466Phefs*11)"	"9"	"no protein on western blot"
"0000168317"	"00024242"	"90"	"1437"	"2"	"1437"	"2"	"c.1437+2T>C"	"r.[1327_1437del]"	"p.(Asp443_Lys479del)"	"9i"	""
"0000168318"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000168319"	"00024242"	"90"	"2841"	"0"	"2841"	"0"	"c.2841dup"	"r.(?)"	"p.(Val939Leufs*78)"	"20"	""
"0000168320"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl"	"p.?"	"10i"	""
"0000168321"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl"	"p.?"	"18i"	""
"0000168322"	"00024242"	"90"	"1327"	"-2"	"1327"	"-2"	"c.1327-2A>G"	"r.spl"	"p.?"	"8i"	""
"0000168323"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000188112"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.525del"	"p.Glu176Argfs*45"	"2"	""
"0000247854"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(Thr711=)"	""	""
"0000247975"	"00024242"	"10"	"-2367"	"0"	"-2367"	"0"	"c.-2367A>G"	"r.(?)"	"p.(=)"	""	""
"0000247976"	"00024242"	"10"	"-2160"	"0"	"-2160"	"0"	"c.-2160A>G"	"r.(?)"	"p.(=)"	""	""
"0000248182"	"00024242"	"10"	"1327"	"-18"	"1327"	"-18"	"c.1327-18A>G"	"r.(=)"	"p.(=)"	""	""
"0000248214"	"00024242"	"10"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	""	""
"0000248238"	"00024242"	"10"	"2040"	"20"	"2040"	"20"	"c.2040+20A>G"	"r.(=)"	"p.(=)"	""	""
"0000250636"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(Thr711=)"	""	""
"0000250691"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(Ala307=)"	""	""
"0000250831"	"00024242"	"90"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	""	""
"0000250835"	"00024242"	"90"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	""	""
"0000250885"	"00024242"	"10"	"1327"	"-18"	"1327"	"-18"	"c.1327-18A>G"	"r.(=)"	"p.(=)"	""	""
"0000250917"	"00024242"	"10"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	""	""
"0000250941"	"00024242"	"10"	"2040"	"20"	"2040"	"20"	"c.2040+20A>G"	"r.(=)"	"p.(=)"	""	""
"0000252988"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(Thr711=)"	""	""
"0000253043"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(Ala307=)"	""	""
"0000253236"	"00024242"	"10"	"-2367"	"0"	"-2367"	"0"	"c.-2367A>G"	"r.(?)"	"p.(=)"	""	""
"0000253237"	"00024242"	"10"	"-2160"	"0"	"-2160"	"0"	"c.-2160A>G"	"r.(?)"	"p.(=)"	""	""
"0000253622"	"00024242"	"10"	"364"	"0"	"364"	"0"	"c.364A>G"	"r.(?)"	"p.(Met122Val)"	""	""
"0000253643"	"00024242"	"10"	"868"	"0"	"868"	"0"	"c.868A>G"	"r.(?)"	"p.(Asn290Asp)"	""	""
"0000255386"	"00024242"	"90"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	""	""
"0000255390"	"00024242"	"90"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	""	""
"0000255589"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsCAG"	"r.(?)"	"p.(Gln914ProfsTer30)"	""	""
"0000255656"	"00024242"	"90"	"1061"	"0"	"1061"	"0"	"c.1061del"	"r.(?)"	"p.(Tyr354SerfsTer38)"	""	""
"0000255666"	"00024242"	"90"	"1724"	"0"	"1724"	"0"	"c.1724A>G"	"r.(?)"	"p.(Tyr575Cys)"	""	""
"0000255763"	"00024242"	"90"	"1327"	"-2"	"1327"	"-2"	"c.1327-2A>G"	"r.spl?"	"p.?"	""	""
"0000255764"	"00024242"	"90"	"1637"	"-2"	"1637"	"-2"	"c.1637-2A>G"	"r.spl?"	"p.?"	""	""
"0000266524"	"00024242"	"10"	"-2133"	"0"	"-2133"	"0"	"c.-2133T>C"	"r.(?)"	"p.(=)"	""	""
"0000266529"	"00024242"	"10"	"-4670"	"0"	"-4670"	"0"	"c.-4670T>C"	"r.(?)"	"p.(=)"	""	""
"0000272775"	"00024242"	"10"	"-2133"	"0"	"-2133"	"0"	"c.-2133T>C"	"r.(?)"	"p.(=)"	""	""
"0000272793"	"00024242"	"10"	"-4670"	"0"	"-4670"	"0"	"c.-4670T>C"	"r.(?)"	"p.(=)"	""	""
"0000280948"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(Gln401=)"	""	""
"0000280949"	"00024242"	"10"	"1438"	"-19"	"1438"	"-19"	"c.1438-19G>C"	"r.(=)"	"p.(=)"	""	""
"0000280950"	"00024242"	"10"	"2331"	"20"	"2331"	"20"	"c.2331+20G>A"	"r.(=)"	"p.(=)"	""	""
"0000280951"	"00024242"	"10"	"2338"	"0"	"2338"	"0"	"c.2338G>A"	"r.(?)"	"p.(Val780Ile)"	""	""
"0000280952"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(Cys108=)"	""	""
"0000280953"	"00024242"	"10"	"547"	"-4"	"547"	"-4"	"c.547-4C>G"	"r.spl?"	"p.?"	""	""
"0000280954"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(Ser214=)"	""	""
"0000280955"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	""	""
"0000280958"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12G>A"	"r.(=)"	"p.(=)"	""	""
"0000284457"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.(=)"	"p.(=)"	"1i"	""
"0000284459"	"00024242"	"30"	"1075"	"13"	"1075"	"13"	"c.1075+13C>T"	"r.(=)"	"p.(=)"	""	""
"0000284460"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(Gln401=)"	""	""
"0000284461"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(?)"	"p.(Tyr458=)"	""	""
"0000284462"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396G>T"	"r.(?)"	"p.(Val466Phe)"	""	""
"0000284463"	"00024242"	"50"	"1437"	"0"	"1437"	"0"	"c.1437G>A"	"r.(?)"	"p.(Lys479=)"	""	""
"0000284464"	"00024242"	"10"	"1438"	"-19"	"1438"	"-19"	"c.1438-19G>C"	"r.(=)"	"p.(=)"	""	""
"0000284465"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516Ter)"	""	""
"0000284466"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>A"	"r.spl?"	"p.?"	""	""
"0000284468"	"00024242"	"30"	"1552"	"-13"	"1552"	"-13"	"c.1552-13G>A"	"r.(=)"	"p.(=)"	""	""
"0000284469"	"00024242"	"90"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	""	""
"0000284470"	"00024242"	"90"	"1657"	"0"	"1657"	"0"	"c.1657C>T"	"r.(?)"	"p.(Gln553Ter)"	""	""
"0000284471"	"00024242"	"10"	"1754"	"12"	"1754"	"12"	"c.1754+12G>A"	"r.(=)"	"p.(=)"	""	""
"0000284472"	"00024242"	"90"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	""	""
"0000284473"	"00024242"	"50"	"1849"	"0"	"1849"	"0"	"c.1849G>A"	"r.(?)"	"p.(Val617Met)"	""	""
"0000284474"	"00024242"	"50"	"1850"	"0"	"1850"	"0"	"c.1850T>C"	"r.(?)"	"p.(Val617Ala)"	""	""
"0000284475"	"00024242"	"90"	"2104"	"0"	"2104"	"0"	"c.2104C>T"	"r.(?)"	"p.(Arg702Cys)"	""	""
"0000284476"	"00024242"	"50"	"2105"	"0"	"2105"	"0"	"c.2105G>A"	"r.(?)"	"p.(Arg702His)"	""	""
"0000284477"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	""	""
"0000284478"	"00024242"	"90"	"2314"	"0"	"2314"	"0"	"c.2314T>C"	"r.(?)"	"p.(Trp772Arg)"	""	""
"0000284479"	"00024242"	"10"	"2331"	"20"	"2331"	"20"	"c.2331+20G>A"	"r.(=)"	"p.(=)"	""	""
"0000284480"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl?"	"p.?"	""	""
"0000284481"	"00024242"	"10"	"2338"	"0"	"2338"	"0"	"c.2338G>A"	"r.(?)"	"p.(Val780Ile)"	""	""
"0000284482"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	""	""
"0000284483"	"00024242"	"90"	"266"	"0"	"266"	"0"	"c.266G>A"	"r.(?)"	"p.(Arg89His)"	""	""
"0000284484"	"00024242"	"30"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	""	""
"0000284485"	"00024242"	"10"	"2780"	"0"	"2780"	"0"	"c.2780C>T"	"r.(?)"	"p.(Thr927Ile)"	""	""
"0000284486"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(Cys108=)"	""	""
"0000284487"	"00024242"	"10"	"547"	"-4"	"547"	"-4"	"c.547-4C>G"	"r.spl?"	"p.?"	""	""
"0000284488"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(Ser214=)"	""	""
"0000284489"	"00024242"	"50"	"665"	"0"	"665"	"0"	"c.665T>G"	"r.(?)"	"p.(Val222Gly)"	""	""
"0000284490"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	""	""
"0000284491"	"00024242"	"50"	"781"	"0"	"781"	"0"	"c.781G>A"	"r.(?)"	"p.(Ala261Thr)"	""	""
"0000284492"	"00024242"	"30"	"852"	"0"	"852"	"0"	"c.852G>A"	"r.(?)"	"p.(Ala284=)"	""	""
"0000284495"	"00024242"	"10"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGCGGGC"	"r.(=)"	"p.(=)"	""	""
"0000284496"	"00024242"	"10"	"858"	"8"	"858"	"8"	"c.858+8G>A"	"r.(=)"	"p.(=)"	""	""
"0000284497"	"00024242"	"50"	"861"	"0"	"861"	"0"	"c.861C>T"	"r.(?)"	"p.(Pro287=)"	""	""
"0000284498"	"00024242"	"90"	"877"	"0"	"877"	"0"	"c.877G>C"	"r.(?)"	"p.(Gly293Arg)"	""	""
"0000284499"	"00024242"	"90"	"896"	"0"	"896"	"0"	"c.896T>A"	"r.(?)"	"p.(Leu299Gln)"	""	""
"0000284500"	"00024242"	"50"	"913"	"0"	"913"	"0"	"c.913G>C"	"r.(?)"	"p.(Gly305Arg)"	""	""
"0000284501"	"00024242"	"90"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	""	""
"0000284502"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12G>A"	"r.(=)"	"p.(=)"	""	""
"0000288023"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.(=)"	"p.(=)"	"1i"	""
"0000288024"	"00024242"	"10"	"2862"	"0"	"2862"	"0"	"c.*3G>A"	"r.(=)"	"p.(=)"	""	""
"0000288025"	"00024242"	"90"	"1004"	"0"	"1004"	"0"	"c.1004G>A"	"r.(?)"	"p.(Gly335Glu)"	""	""
"0000288026"	"00024242"	"90"	"1051"	"0"	"1051"	"0"	"c.1051del"	"r.(?)"	"p.(Val351CysfsTer41)"	""	""
"0000288027"	"00024242"	"90"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	""	""
"0000288028"	"00024242"	"10"	"1075"	"13"	"1075"	"13"	"c.1075+13C>T"	"r.(=)"	"p.(=)"	""	""
"0000288029"	"00024242"	"90"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	""	""
"0000288030"	"00024242"	"90"	"1128"	"0"	"1129"	"0"	"c.1128_1129delinsC"	"r.(?)"	"p.(Trp376CysfsTer16)"	""	""
"0000288031"	"00024242"	"90"	"1190"	"0"	"1190"	"0"	"c.1190C>T"	"r.(?)"	"p.(Pro397Leu)"	""	""
"0000288032"	"00024242"	"10"	"1194"	"17"	"1194"	"17"	"c.1194+17G>T"	"r.(=)"	"p.(=)"	""	""
"0000288033"	"00024242"	"90"	"1209"	"0"	"1209"	"0"	"c.1209C>G"	"r.(?)"	"p.(Asn403Lys)"	""	""
"0000288034"	"00024242"	"90"	"1209"	"0"	"1209"	"0"	"c.1209del"	"r.(?)"	"p.(Asn403LysfsTer37)"	""	""
"0000288035"	"00024242"	"90"	"1221"	"0"	"1221"	"0"	"c.1221del"	"r.(?)"	"p.(Tyr407Ter)"	""	""
"0000288037"	"00024242"	"90"	"1370"	"0"	"1370"	"0"	"c.1370C>A"	"r.(?)"	"p.(Pro457His)"	""	""
"0000288038"	"00024242"	"90"	"1370"	"0"	"1370"	"0"	"c.1370C>T"	"r.(?)"	"p.(Pro457Leu)"	""	""
"0000288039"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(?)"	"p.(Tyr458=)"	""	""
"0000288040"	"00024242"	"50"	"1375"	"0"	"1375"	"0"	"c.1375G>A"	"r.(?)"	"p.(Asp459Asn)"	""	""
"0000288041"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471ProfsTer5)"	""	""
"0000288043"	"00024242"	"90"	"1447"	"0"	"1447"	"0"	"c.1447G>A"	"r.(?)"	"p.(Gly483Arg)"	""	""
"0000288044"	"00024242"	"90"	"1464"	"0"	"1464"	"0"	"c.1464dup"	"r.(?)"	"p.(Asp489ArgfsTer17)"	""	""
"0000288045"	"00024242"	"90"	"1468"	"0"	"1468"	"0"	"c.1468T>C"	"r.(?)"	"p.(Phe490Leu)"	""	""
"0000288046"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516Ter)"	""	""
"0000288047"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>T"	"r.spl?"	"p.?"	""	""
"0000288048"	"00024242"	"10"	"1552"	"-13"	"1552"	"-13"	"c.1552-13G>A"	"r.(=)"	"p.(=)"	""	""
"0000288049"	"00024242"	"90"	"1568"	"0"	"1568"	"0"	"c.1568C>A"	"r.(?)"	"p.(Ser523Tyr)"	""	""
"0000288050"	"00024242"	"90"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	""	""
"0000288051"	"00024242"	"90"	"1657"	"0"	"1657"	"0"	"c.1657C>T"	"r.(?)"	"p.(Gln553Ter)"	""	""
"0000288052"	"00024242"	"90"	"1672"	"0"	"1672"	"0"	"c.1672T>A"	"r.(?)"	"p.(Cys558Ser)"	""	""
"0000288053"	"00024242"	"50"	"1679"	"0"	"1679"	"0"	"c.1679C>G"	"r.(?)"	"p.(Ser560Cys)"	""	""
"0000288055"	"00024242"	"90"	"1726"	"0"	"1726"	"0"	"c.1726G>C"	"r.(?)"	"p.(Gly576Arg)"	""	""
"0000288056"	"00024242"	"90"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	""	""
"0000288057"	"00024242"	"10"	"1754"	"12"	"1754"	"12"	"c.1754+12G>A"	"r.(=)"	"p.(=)"	""	""
"0000288058"	"00024242"	"90"	"1781"	"0"	"1781"	"0"	"c.1781G>A"	"r.(?)"	"p.(Arg594His)"	""	""
"0000288059"	"00024242"	"90"	"1796"	"0"	"1796"	"0"	"c.1796C>T"	"r.(?)"	"p.(Ser599Phe)"	""	""
"0000288060"	"00024242"	"90"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	""	""
"0000288061"	"00024242"	"90"	"1802"	"0"	"1802"	"0"	"c.1802C>T"	"r.(?)"	"p.(Ser601Leu)"	""	""
"0000288062"	"00024242"	"90"	"1822"	"0"	"1822"	"0"	"c.1822C>T"	"r.(?)"	"p.(Arg608Ter)"	""	""
"0000288063"	"00024242"	"10"	"1830"	"0"	"1830"	"0"	"c.1830C>T"	"r.(?)"	"p.(Ala610=)"	""	""
"0000288065"	"00024242"	"10"	"1888"	"21"	"1888"	"21"	"c.1888+21G>A"	"r.(=)"	"p.(=)"	""	""
"0000288066"	"00024242"	"90"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	""	""
"0000288067"	"00024242"	"90"	"1913"	"0"	"1913"	"0"	"c.1913G>T"	"r.(?)"	"p.(Gly638Val)"	""	""
"0000288068"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	""	""
"0000288069"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>T"	"r.(?)"	"p.(Asp645Tyr)"	""	""
"0000288070"	"00024242"	"90"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	""	""
"0000288071"	"00024242"	"90"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	""	""
"0000288072"	"00024242"	"90"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	""	""
"0000288073"	"00024242"	"90"	"1943"	"0"	"1943"	"0"	"c.1943G>A"	"r.(?)"	"p.(Gly648Asp)"	""	""
"0000288074"	"00024242"	"90"	"1951"	"0"	"1952"	"0"	"c.1951_1952delinsT"	"r.(?)"	"p.(Gly651SerfsTer45)"	""	""
"0000288075"	"00024242"	"90"	"1978"	"0"	"1978"	"0"	"c.1978C>T"	"r.(?)"	"p.(Arg660Cys)"	""	""
"0000288077"	"00024242"	"90"	"2102"	"0"	"2102"	"0"	"c.2102T>C"	"r.(?)"	"p.(Leu701Pro)"	""	""
"0000288078"	"00024242"	"90"	"2135"	"0"	"2135"	"0"	"c.2135T>C"	"r.(?)"	"p.(Leu712Pro)"	""	""
"0000288079"	"00024242"	"10"	"2152"	"0"	"2152"	"0"	"c.2152G>A"	"r.(?)"	"p.(Val718Ile)"	""	""
"0000288080"	"00024242"	"50"	"2155"	"0"	"2155"	"0"	"c.2155G>T"	"r.(?)"	"p.(Ala719Ser)"	""	""
"0000288081"	"00024242"	"90"	"2189"	"1"	"2189"	"1"	"c.2189+1G>A"	"r.spl?"	"p.?"	""	""
"0000288082"	"00024242"	"10"	"221"	"0"	"221"	"0"	"c.221G>A"	"r.(?)"	"p.(Arg74His)"	""	""
"0000288083"	"00024242"	"90"	"2227"	"0"	"2227"	"0"	"c.2227C>A"	"r.(?)"	"p.(Gln743Lys)"	""	""
"0000288084"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	""	""
"0000288085"	"00024242"	"90"	"2269"	"0"	"2269"	"0"	"c.2269C>T"	"r.(?)"	"p.(Gln757Ter)"	""	""
"0000288086"	"00024242"	"10"	"2331"	"24"	"2331"	"24"	"c.2331+24T>C"	"r.(=)"	"p.(=)"	""	""
"0000288087"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl?"	"p.?"	""	""
"0000288088"	"00024242"	"90"	"2380"	"0"	"2380"	"0"	"c.2380del"	"r.(?)"	"p.(Arg794ValfsTer12)"	""	""
"0000288089"	"00024242"	"10"	"2446"	"0"	"2446"	"0"	"c.2446G>A"	"r.(?)"	"p.(Val816Ile)"	""	""
"0000288090"	"00024242"	"90"	"2456"	"0"	"2456"	"0"	"c.2456G>C"	"r.(?)"	"p.(Arg819Pro)"	""	""
"0000288091"	"00024242"	"10"	"2481"	"25"	"2481"	"25"	"c.2481+25G>A"	"r.(=)"	"p.(=)"	""	""
"0000288092"	"00024242"	"30"	"2482"	"-13"	"2482"	"-13"	"c.2482-13C>T"	"r.(=)"	"p.(=)"	""	""
"0000288093"	"00024242"	"90"	"2495"	"0"	"2496"	"0"	"c.2495_2496del"	"r.(?)"	"p.(Thr832AsnfsTer51)"	""	""
"0000288094"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834ArgfsTer49)"	""	""
"0000288095"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	""	""
"0000288096"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87GlnfsTer9)"	""	""
"0000288097"	"00024242"	"90"	"2639"	"0"	"2639"	"0"	"c.2639C>A"	"r.(?)"	"p.(Ala880Asp)"	""	""
"0000288098"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl?"	"p.?"	""	""
"0000288099"	"00024242"	"90"	"2647"	"-1"	"2648"	"0"	"c.2647-1_2648del"	"r.spl?"	"p.?"	""	""
"0000288100"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888Ter)"	""	""
"0000288101"	"00024242"	"10"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	""	""
"0000288104"	"00024242"	"90"	"2746"	"0"	"2746"	"0"	"c.2746G>T"	"r.(?)"	"p.(Val916Phe)"	""	""
"0000288105"	"00024242"	"90"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	""	""
"0000288107"	"00024242"	"90"	"340"	"0"	"341"	"0"	"c.340_341insT"	"r.(?)"	"p.(Lys114IlefsTer32)"	""	""
"0000288108"	"00024242"	"90"	"343"	"0"	"343"	"0"	"c.343C>T"	"r.(?)"	"p.(Gln115Ter)"	""	""
"0000288109"	"00024242"	"90"	"379"	"0"	"380"	"0"	"c.379_380del"	"r.(?)"	"p.(Cys127LeufsTer18)"	""	""
"0000288110"	"00024242"	"90"	"380"	"0"	"380"	"0"	"c.380G>T"	"r.(?)"	"p.(Cys127Phe)"	""	""
"0000288111"	"00024242"	"30"	"510"	"0"	"510"	"0"	"c.510C>T"	"r.(?)"	"p.(Asp170=)"	""	""
"0000288112"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176ArgfsTer45)"	""	""
"0000288113"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(Thr182=)"	""	""
"0000288114"	"00024242"	"90"	"573"	"0"	"573"	"0"	"c.573C>A"	"r.(?)"	"p.(Tyr191Ter)"	""	""
"0000288115"	"00024242"	"50"	"576"	"0"	"576"	"0"	"c.576G>C"	"r.(?)"	"p.(Glu192Asp)"	""	""
"0000288117"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(Ser214=)"	""	""
"0000288118"	"00024242"	"10"	"664"	"0"	"664"	"0"	"c.664G>A"	"r.(?)"	"p.(Val222Met)"	""	""
"0000288119"	"00024242"	"90"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	""	""
"0000288120"	"00024242"	"30"	"692"	"17"	"692"	"17"	"c.692+17G>C"	"r.(=)"	"p.(=)"	""	""
"0000288122"	"00024242"	"90"	"766"	"0"	"785"	"0"	"c.766_785delinsC"	"r.(?)"	"p.(Tyr256ArgfsTer6)"	""	""
"0000288123"	"00024242"	"90"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	""	""
"0000288124"	"00024242"	"90"	"836"	"0"	"836"	"0"	"c.836G>A"	"r.(?)"	"p.(Trp279Ter)"	""	""
"0000288125"	"00024242"	"10"	"852"	"0"	"852"	"0"	"c.852G>A"	"r.(?)"	"p.(Ala284=)"	""	""
"0000288126"	"00024242"	"10"	"858"	"11"	"858"	"11"	"c.858+11G>A"	"r.(=)"	"p.(=)"	""	""
"0000288127"	"00024242"	"10"	"858"	"30"	"858"	"30"	"c.858+30T>C"	"r.(=)"	"p.(=)"	""	""
"0000288129"	"00024242"	"90"	"871"	"0"	"871"	"0"	"c.871C>T"	"r.(?)"	"p.(Leu291Phe)"	""	""
"0000288130"	"00024242"	"30"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(Gly305=)"	""	""
"0000288131"	"00024242"	"90"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	""	""
"0000288132"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12G>A"	"r.(=)"	"p.(=)"	""	""
"0000325731"	"00024242"	"50"	"-4654"	"0"	"-4654"	"0"	"c.-4654G>A"	"r.(?)"	"p.(=)"	""	""
"0000325732"	"00024242"	"30"	"-2237"	"0"	"-2237"	"0"	"c.-2237G>A"	"r.(?)"	"p.(=)"	""	""
"0000325734"	"00024242"	"30"	"-2228"	"0"	"-2228"	"0"	"c.-2228G>A"	"r.(?)"	"p.(=)"	""	""
"0000325735"	"00024242"	"50"	"-2222"	"0"	"-2222"	"0"	"c.-2222C>T"	"r.(?)"	"p.(=)"	""	""
"0000325737"	"00024242"	"30"	"-2153"	"0"	"-2153"	"0"	"c.-2153T>C"	"r.(?)"	"p.(=)"	""	""
"0000325739"	"00024242"	"30"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	""	""
"0000325740"	"00024242"	"50"	"384"	"0"	"384"	"0"	"c.384C>G"	"r.(?)"	"p.(Phe128Leu)"	""	""
"0000325741"	"00024242"	"50"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176ArgfsTer45)"	""	""
"0000325746"	"00024242"	"50"	"664"	"0"	"664"	"0"	"c.664G>A"	"r.(?)"	"p.(Val222Met)"	""	""
"0000325748"	"00024242"	"30"	"1352"	"0"	"1352"	"0"	"c.1352C>G"	"r.(?)"	"p.(Pro451Arg)"	""	""
"0000325750"	"00024242"	"30"	"2656"	"0"	"2656"	"0"	"c.2656G>A"	"r.(?)"	"p.(Val886Met)"	""	""
"0000325751"	"00024242"	"30"	"2668"	"0"	"2668"	"0"	"c.2668G>C"	"r.(?)"	"p.(Val890Leu)"	""	""
"0000343224"	"00024242"	"70"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	""	""
"0000343441"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870Ter)"	""	""
"0000344161"	"00024242"	"50"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	""	""
"0000348866"	"00024242"	"50"	"752"	"0"	"752"	"0"	"c.752C>T"	"r.(?)"	"p.(Ser251Leu)"	""	""
"0000348870"	"00024242"	"50"	"761"	"0"	"761"	"0"	"c.761C>T"	"r.(?)"	"p.(Ser254Leu)"	""	""
"0000351375"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.(=)"	"p.(=)"	"1i"	""
"0000405538"	"00024242"	"70"	"1978"	"0"	"1978"	"0"	"c.1978C>T"	"r.(?)"	"p.(Arg660Cys)"	"14"	""
"0000408005"	"00024242"	"97"	"1853"	"0"	"1853"	"0"	"c.1853G>A"	"r.(?)"	"p.(Trp618*)"	"13"	""
"0000408006"	"00024242"	"97"	"1853"	"0"	"1853"	"0"	"c.1853G>A"	"r.(?)"	"p.(Trp618*)"	"13"	""
"0000408007"	"00024242"	"97"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000408008"	"00024242"	"97"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000408009"	"00024242"	"97"	"871"	"0"	"871"	"0"	"c.871C>T"	"r.(?)"	"p.(Leu291Phe)"	"5"	""
"0000408010"	"00024242"	"97"	"871"	"0"	"871"	"0"	"c.871C>T"	"r.(?)"	"p.(Leu291Phe)"	"5"	""
"0000408011"	"00024242"	"97"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000408012"	"00024242"	"97"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000439109"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000463985"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000463986"	"00024242"	"50"	"266"	"0"	"266"	"0"	"c.266G>A"	"r.(?)"	"p.(Arg89His)"	"2"	""
"0000463987"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000463988"	"00024242"	"90"	"1124"	"0"	"1124"	"0"	"c.1124G>T"	"r.(?)"	"p.(Arg375Leu)"	"7"	""
"0000463989"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000463990"	"00024242"	"50"	"2152"	"0"	"2152"	"0"	"c.2152G>A"	"r.(?)"	"p.(Val718Ile)"	"15"	""
"0000463991"	"00024242"	"50"	"280"	"0"	"280"	"0"	"c.280C>A"	"r.(?)"	"p.(Pro94Thr)"	"2"	""
"0000463992"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000463993"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000463994"	"00024242"	"50"	"1930"	"0"	"1930"	"0"	"c.1930G>C"	"r.(?)"	"p.(Ala644Pro)"	"14"	""
"0000463995"	"00024242"	"50"	"2423"	"0"	"2423"	"0"	"c.2423C>T"	"r.(?)"	"p.(Pro808Leu)"	"17"	""
"0000463996"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000463997"	"00024242"	"50"	"1828"	"0"	"1828"	"0"	"c.1828G>A"	"r.(?)"	"p.(Ala610Thr)"	"13"	""
"0000463998"	"00024242"	"50"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000463999"	"00024242"	"50"	"420"	"0"	"420"	"0"	"c.420C>A"	"r.(?)"	"p.(Asn140Lys)"	"2"	""
"0000464000"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464001"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000464002"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464003"	"00024242"	"90"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000464004"	"00024242"	"50"	"1240"	"0"	"1240"	"0"	"c.1240T>C"	"r.(?)"	"p.(Phe414Leu)"	"8"	""
"0000464005"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464006"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464007"	"00024242"	"90"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000464008"	"00024242"	"50"	"2474"	"0"	"2474"	"0"	"c.2474C>G"	"r.(?)"	"p.(Pro825Arg)"	"17"	""
"0000464009"	"00024242"	"90"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000464010"	"00024242"	"50"	"2275"	"0"	"2275"	"0"	"c.2275G>A"	"r.(?)"	"p.(Gly759Arg)"	"16"	""
"0000464011"	"00024242"	"50"	"2323"	"0"	"2323"	"0"	"c.2323C>A"	"r.(?)"	"p.(Leu775Met)"	"16"	""
"0000464012"	"00024242"	"50"	"32"	"0"	"32"	"0"	"c.32G>A"	"r.(?)"	"p.(Arg11Gln)"	"2"	""
"0000464013"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464014"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000464015"	"00024242"	"50"	"1194"	"3"	"1194"	"3"	"c.1194+3G>C"	"r.spl?"	"p.?"	"7i"	""
"0000464016"	"00024242"	"50"	"866"	"0"	"866"	"0"	"c.866C>T"	"r.(?)"	"p.(Ala289Val)"	"5"	""
"0000464017"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464018"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464019"	"00024242"	"50"	"1402"	"0"	"1402"	"0"	"c.1402A>T"	"r.(?)"	"p.(Ile468Phe)"	"9"	""
"0000464020"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464021"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000464022"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464023"	"00024242"	"50"	"2051"	"0"	"2051"	"0"	"c.2051C>T"	"r.(?)"	"p.(Pro684Leu)"	"15"	""
"0000464024"	"00024242"	"50"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000464025"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464026"	"00024242"	"90"	"1051"	"0"	"1051"	"0"	"c.1051del"	"r.(?)"	"p.(Val351Cysfs*41)"	"6"	""
"0000464027"	"00024242"	"50"	"2799"	"4"	"2799"	"4"	"c.2799+4A>G"	"r.spl?"	"p.?"	"19i"	""
"0000464028"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834Argfs*49)"	"18"	""
"0000464029"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464030"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000464031"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464032"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464033"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464034"	"00024242"	"50"	"2155"	"0"	"2155"	"0"	"c.2155G>T"	"r.(?)"	"p.(Ala719Ser)"	"15"	""
"0000464035"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464036"	"00024242"	"50"	"2561"	"0"	"2561"	"0"	"c.2561G>A"	"r.(?)"	"p.(Arg854Gln)"	"18"	""
"0000464037"	"00024242"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Arg422Gln)"	"8"	""
"0000464038"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464039"	"00024242"	"50"	"2404"	"0"	"2404"	"0"	"c.2404G>A"	"r.(?)"	"p.(Gly802Arg)"	"17"	""
"0000464040"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464041"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464042"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464043"	"00024242"	"90"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000464044"	"00024242"	"50"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGTG"	"r.spl"	"p.(=)"	"4i"	""
"0000464045"	"00024242"	"50"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(=)"	"5"	""
"0000464046"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464047"	"00024242"	"50"	"2652"	"0"	"2652"	"0"	"c.2652G>A"	"r.(?)"	"p.(=)"	"19"	""
"0000464048"	"00024242"	"50"	"1781"	"0"	"1781"	"0"	"c.1781G>C"	"r.(?)"	"p.(Arg594Pro)"	"13"	""
"0000464049"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000464050"	"00024242"	"50"	"1019"	"0"	"1019"	"0"	"c.1019A>G"	"r.(?)"	"p.(Tyr340Cys)"	"6"	""
"0000464051"	"00024242"	"50"	"1356"	"0"	"1356"	"0"	"c.1356C>T"	"r.(?)"	"p.(=)"	"9"	""
"0000464052"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464053"	"00024242"	"50"	"2156"	"0"	"2156"	"0"	"c.2156C>A"	"r.(?)"	"p.(Ala719Glu)"	"15"	""
"0000464054"	"00024242"	"50"	"1320"	"0"	"1320"	"0"	"c.1320G>T"	"r.(?)"	"p.(Met440Ile)"	"8"	""
"0000464055"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464056"	"00024242"	"90"	"2140"	"0"	"2140"	"0"	"c.2140del"	"r.(?)"	"p.(His714Thrfs*50)"	"15"	""
"0000464057"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000464058"	"00024242"	"50"	"83"	"0"	"83"	"0"	"c.83G>T"	"r.(?)"	"p.(Gly28Val)"	"2"	""
"0000464059"	"00024242"	"50"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Arg422Gln)"	"8"	""
"0000464060"	"00024242"	"50"	"510"	"0"	"510"	"0"	"c.510C>T"	"r.(?)"	"p.(=)"	"2"	""
"0000464061"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464062"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000464063"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464064"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464065"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464066"	"00024242"	"50"	"2237"	"0"	"2237"	"0"	"c.2237G>T"	"r.(?)"	"p.(Trp746Leu)"	"16"	""
"0000464067"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464068"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464069"	"00024242"	"50"	"2297"	"0"	"2297"	"0"	"c.2297A>G"	"r.(?)"	"p.(Tyr766Cys)"	"16"	""
"0000464070"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000464071"	"00024242"	"50"	"1848"	"0"	"1848"	"0"	"c.1848C>T"	"r.(?)"	"p.(=)"	"13"	""
"0000464072"	"00024242"	"50"	"2647"	"-6"	"2647"	"-6"	"c.2647-6G>A"	"r.spl"	"p.(=)"	"18i"	""
"0000464073"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464074"	"00024242"	"90"	"2140"	"0"	"2140"	"0"	"c.2140del"	"r.(?)"	"p.(His714Thrfs*50)"	"15"	""
"0000464075"	"00024242"	"50"	"841"	"0"	"841"	"0"	"c.841C>T"	"r.(?)"	"p.(Arg281Trp)"	"4"	""
"0000464076"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464077"	"00024242"	"50"	"1447"	"0"	"1447"	"0"	"c.1447G>A"	"r.(?)"	"p.(Gly483Arg)"	"10"	""
"0000464078"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464079"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464080"	"00024242"	"50"	"2656"	"0"	"2656"	"0"	"c.2656G>A"	"r.(?)"	"p.(Val886Met)"	"19"	""
"0000464081"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464082"	"00024242"	"50"	"2417"	"0"	"2417"	"0"	"c.2417C>T"	"r.(?)"	"p.(Thr806Met)"	"17"	""
"0000464083"	"00024242"	"50"	"546"	"3"	"546"	"3"	"c.546+3G>A"	"r.spl?"	"p.?"	"2i"	""
"0000464084"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464085"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464086"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464087"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464088"	"00024242"	"50"	"2561"	"0"	"2561"	"0"	"c.2561G>A"	"r.(?)"	"p.(Arg854Gln)"	"18"	""
"0000464089"	"00024242"	"50"	"685"	"0"	"685"	"0"	"c.685C>T"	"r.(?)"	"p.(Arg229Cys)"	"3"	""
"0000464090"	"00024242"	"90"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000464091"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464092"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464093"	"00024242"	"50"	"271"	"0"	"272"	"0"	"c.271_272delinsAG"	"r.(?)"	"p.(Asp91Ser)"	"2"	""
"0000464094"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464095"	"00024242"	"50"	"1841"	"0"	"1841"	"0"	"c.1841C>T"	"r.(?)"	"p.(Thr614Met)"	"13"	""
"0000464096"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464097"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464098"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464099"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464100"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464101"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464102"	"00024242"	"50"	"913"	"0"	"913"	"0"	"c.913G>A"	"r.(?)"	"p.(Gly305Arg)"	"5"	""
"0000464103"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464104"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464105"	"00024242"	"50"	"2423"	"0"	"2423"	"0"	"c.2423C>T"	"r.(?)"	"p.(Pro808Leu)"	"17"	""
"0000464106"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464107"	"00024242"	"90"	"736"	"0"	"736"	"0"	"c.736del"	"r.(?)"	"p.(Leu246Phefs*22)"	"4"	""
"0000464108"	"00024242"	"50"	"702"	"0"	"702"	"0"	"c.702G>A"	"r.(?)"	"p.(=)"	"4"	""
"0000464109"	"00024242"	"50"	"32"	"0"	"32"	"0"	"c.32G>A"	"r.(?)"	"p.(Arg11Gln)"	"2"	""
"0000464110"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464111"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000464112"	"00024242"	"50"	"2423"	"0"	"2423"	"0"	"c.2423C>T"	"r.(?)"	"p.(Pro808Leu)"	"17"	""
"0000464113"	"00024242"	"50"	"1556"	"0"	"1556"	"0"	"c.1556T>C"	"r.(?)"	"p.(Met519Thr)"	"11"	""
"0000464114"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464115"	"00024242"	"50"	"1188"	"0"	"1188"	"0"	"c.1188C>G"	"r.(?)"	"p.(Phe396Leu)"	"7"	""
"0000464116"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464117"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464118"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827del"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000464119"	"00024242"	"50"	"952"	"0"	"952"	"0"	"c.952A>T"	"r.(?)"	"p.(Met318Leu)"	"5"	""
"0000464120"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464121"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464122"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464123"	"00024242"	"50"	"2415"	"0"	"2415"	"0"	"c.2415G>A"	"r.(?)"	"p.(=)"	"17"	""
"0000464124"	"00024242"	"50"	"1823"	"0"	"1823"	"0"	"c.1823G>A"	"r.(?)"	"p.(Arg608Gln)"	"13"	""
"0000464125"	"00024242"	"50"	"1823"	"0"	"1823"	"0"	"c.1823G>A"	"r.(?)"	"p.(Arg608Gln)"	"13"	""
"0000464126"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000464127"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000464128"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464129"	"00024242"	"50"	"1886"	"0"	"1886"	"0"	"c.1886C>T"	"r.(?)"	"p.(Pro629Leu)"	"13"	""
"0000464130"	"00024242"	"50"	"412"	"0"	"412"	"0"	"c.412C>G"	"r.(?)"	"p.(Leu138Val)"	"2"	""
"0000464131"	"00024242"	"50"	"412"	"0"	"412"	"0"	"c.412C>G"	"r.(?)"	"p.(Leu138Val)"	"2"	""
"0000464132"	"00024242"	"50"	"266"	"0"	"266"	"0"	"c.266G>A"	"r.(?)"	"p.(Arg89His)"	"2"	""
"0000464133"	"00024242"	"50"	"247"	"0"	"247"	"0"	"c.247G>A"	"r.(?)"	"p.(Asp83Asn)"	"2"	""
"0000464134"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464135"	"00024242"	"50"	"247"	"0"	"247"	"0"	"c.247G>A"	"r.(?)"	"p.(Asp83Asn)"	"2"	""
"0000464136"	"00024242"	"50"	"2365"	"0"	"2365"	"0"	"c.2365C>G"	"r.(?)"	"p.(Pro789Ala)"	"17"	""
"0000464137"	"00024242"	"90"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000464138"	"00024242"	"70"	"1552"	"-3"	"1552"	"-3"	"c.1552-3C>G"	"r.spl"	"p.?"	"10i"	""
"0000464139"	"00024242"	"50"	"74"	"0"	"74"	"0"	"c.74C>T"	"r.(?)"	"p.(Ala25Val)"	"2"	""
"0000464140"	"00024242"	"50"	"2051"	"0"	"2051"	"0"	"c.2051C>T"	"r.(?)"	"p.(Pro684Leu)"	"15"	""
"0000464141"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464142"	"00024242"	"50"	"1324"	"0"	"1324"	"0"	"c.1324G>A"	"r.(?)"	"p.(Val442Met)"	"8"	""
"0000464143"	"00024242"	"50"	"2417"	"0"	"2417"	"0"	"c.2417C>T"	"r.(?)"	"p.(Thr806Met)"	"17"	""
"0000464144"	"00024242"	"50"	"913"	"0"	"913"	"0"	"c.913G>A"	"r.(?)"	"p.(Gly305Arg)"	"5"	""
"0000464145"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464146"	"00024242"	"90"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000464147"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464148"	"00024242"	"90"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000464149"	"00024242"	"50"	"11"	"0"	"11"	"0"	"c.11G>A"	"r.(?)"	"p.(Arg4Lys)"	"2"	""
"0000464150"	"00024242"	"50"	"17"	"0"	"17"	"0"	"c.17C>T"	"r.(?)"	"p.(Pro6Leu)"	"2"	""
"0000464151"	"00024242"	"50"	"310"	"0"	"310"	"0"	"c.310G>A"	"r.(?)"	"p.(Glu104Lys)"	"2"	""
"0000464152"	"00024242"	"50"	"1273"	"0"	"1273"	"0"	"c.1273C>T"	"r.(?)"	"p.(Pro425Ser)"	"8"	""
"0000464153"	"00024242"	"50"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(=)"	"5"	""
"0000464154"	"00024242"	"90"	"2236"	"0"	"2236"	"0"	"c.2236T>C"	"r.(?)"	"p.(Trp746Arg)"	"16"	""
"0000464155"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464156"	"00024242"	"50"	"685"	"0"	"685"	"0"	"c.685C>T"	"r.(?)"	"p.(Arg229Cys)"	"3"	""
"0000464157"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000464158"	"00024242"	"90"	"736"	"0"	"736"	"0"	"c.736del"	"r.(?)"	"p.(Leu246Phefs*22)"	"4"	""
"0000464159"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464160"	"00024242"	"70"	"1841"	"0"	"1841"	"0"	"c.1841C>A"	"r.(?)"	"p.(Thr614Lys)"	"13"	""
"0000464161"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464162"	"00024242"	"50"	"1849"	"0"	"1849"	"0"	"c.1849G>A"	"r.(?)"	"p.(Val617Met)"	"13"	""
"0000464163"	"00024242"	"50"	"2275"	"0"	"2275"	"0"	"c.2275G>A"	"r.(?)"	"p.(Gly759Arg)"	"16"	""
"0000464164"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464165"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464166"	"00024242"	"50"	"362"	"0"	"362"	"0"	"c.362A>G"	"r.(?)"	"p.(Gln121Arg)"	"2"	""
"0000464167"	"00024242"	"50"	"2383"	"0"	"2383"	"0"	"c.2383G>A"	"r.(?)"	"p.(Glu795Lys)"	"17"	""
"0000464168"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464169"	"00024242"	"50"	"1418"	"0"	"1418"	"0"	"c.1418G>C"	"r.(?)"	"p.(Gly473Ala)"	"9"	""
"0000464170"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.spl"	"p.?"	"17i_18i"	""
"0000464171"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464172"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464173"	"00024242"	"50"	"667"	"0"	"667"	"0"	"c.667C>T"	"r.(?)"	"p.(Arg223Cys)"	"3"	""
"0000464174"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464175"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464176"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000464177"	"00024242"	"50"	"866"	"0"	"866"	"0"	"c.866C>T"	"r.(?)"	"p.(Ala289Val)"	"5"	""
"0000464178"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464179"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464180"	"00024242"	"50"	"2415"	"0"	"2415"	"0"	"c.2415G>A"	"r.(?)"	"p.(=)"	"17"	""
"0000464181"	"00024242"	"50"	"2739"	"0"	"2739"	"0"	"c.2739C>G"	"r.(?)"	"p.(=)"	"19"	""
"0000464182"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464183"	"00024242"	"50"	"1082"	"0"	"1082"	"0"	"c.1082C>G"	"r.(?)"	"p.(Pro361Arg)"	"7"	""
"0000464184"	"00024242"	"50"	"1387"	"0"	"1387"	"0"	"c.1387C>T"	"r.(?)"	"p.(Arg463Trp)"	"9"	""
"0000464185"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464186"	"00024242"	"50"	"2155"	"0"	"2155"	"0"	"c.2155G>T"	"r.(?)"	"p.(Ala719Ser)"	"15"	""
"0000464187"	"00024242"	"50"	"2652"	"0"	"2652"	"0"	"c.2652G>A"	"r.(?)"	"p.(=)"	"19"	""
"0000464188"	"00024242"	"50"	"70"	"0"	"70"	"0"	"c.70G>A"	"r.(?)"	"p.(Ala24Thr)"	"2"	""
"0000464189"	"00024242"	"50"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(=)"	"5"	""
"0000464190"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.spl"	"p.?"	"17i_18i"	""
"0000464191"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464192"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464193"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464194"	"00024242"	"90"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000464195"	"00024242"	"50"	"1188"	"0"	"1188"	"0"	"c.1188C>G"	"r.(?)"	"p.(Phe396Leu)"	"7"	""
"0000464196"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464197"	"00024242"	"50"	"2051"	"0"	"2051"	"0"	"c.2051C>T"	"r.(?)"	"p.(Pro684Leu)"	"15"	""
"0000464198"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464199"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464200"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464201"	"00024242"	"90"	"2512"	"0"	"2512"	"0"	"c.2512C>T"	"r.(?)"	"p.(Gln838*)"	"18"	""
"0000464202"	"00024242"	"50"	"2523"	"0"	"2523"	"0"	"c.2523G>C"	"r.(?)"	"p.(Met841Ile)"	"18"	""
"0000464203"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464204"	"00024242"	"50"	"1375"	"0"	"1375"	"0"	"c.1375G>C"	"r.(?)"	"p.(Asp459His)"	"9"	""
"0000464205"	"00024242"	"50"	"2417"	"0"	"2417"	"0"	"c.2417C>T"	"r.(?)"	"p.(Thr806Met)"	"17"	""
"0000464206"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464207"	"00024242"	"50"	"460"	"0"	"460"	"0"	"c.460C>T"	"r.(?)"	"p.(Arg154Cys)"	"2"	""
"0000464208"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000464209"	"00024242"	"50"	"2417"	"0"	"2417"	"0"	"c.2417C>T"	"r.(?)"	"p.(Thr806Met)"	"17"	""
"0000464210"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464211"	"00024242"	"50"	"2510"	"0"	"2510"	"0"	"c.2510G>A"	"r.(?)"	"p.(Arg837His)"	"18"	""
"0000464212"	"00024242"	"50"	"841"	"0"	"841"	"0"	"c.841C>T"	"r.(?)"	"p.(Arg281Trp)"	"4"	""
"0000464213"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.spl"	"p.?"	"17i_18i"	""
"0000464214"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464215"	"00024242"	"50"	"1504"	"0"	"1504"	"0"	"c.1504A>G"	"r.(?)"	"p.(Met502Val)"	"10"	""
"0000464216"	"00024242"	"50"	"1661"	"0"	"1661"	"0"	"c.1661C>T"	"r.(?)"	"p.(Ala554Val)"	"12"	""
"0000464217"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	"2"	""
"0000464218"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464219"	"00024242"	"50"	"545"	"0"	"545"	"0"	"c.545C>G"	"r.(?)"	"p.(Thr182Arg)"	"2"	""
"0000464220"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464221"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000464222"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000464223"	"00024242"	"50"	"2408"	"0"	"2408"	"0"	"c.2408A>G"	"r.(?)"	"p.(Gln803Arg)"	"17"	""
"0000464224"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464225"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464226"	"00024242"	"50"	"1123"	"0"	"1123"	"0"	"c.1123C>T"	"r.(?)"	"p.(Arg375Cys)"	"7"	""
"0000464227"	"00024242"	"50"	"794"	"0"	"794"	"0"	"c.794G>A"	"r.(?)"	"p.(Ser265Asn)"	"4"	""
"0000464228"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464229"	"00024242"	"90"	"1143"	"0"	"1143"	"0"	"c.1143del"	"r.(?)"	"p.(Ala382Leufs*10)"	"7"	""
"0000464230"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464231"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464232"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000464233"	"00024242"	"50"	"1888"	"5"	"1888"	"5"	"c.1888+5G>T"	"r.spl?"	"p.?"	"13i"	""
"0000464234"	"00024242"	"50"	"212"	"0"	"212"	"0"	"c.212A>G"	"r.(?)"	"p.(His71Arg)"	"2"	""
"0000464235"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464236"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464237"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464238"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827del"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000464239"	"00024242"	"70"	"1552"	"-3"	"1552"	"-3"	"c.1552-3C>G"	"r.spl"	"p.?"	"10i"	""
"0000464240"	"00024242"	"90"	"1128"	"0"	"1129"	"0"	"c.1128_1129delinsC"	"r.(?)"	"p.(Trp376Cysfs*16)"	"7"	""
"0000464241"	"00024242"	"50"	"5"	"0"	"5"	"0"	"c.5G>C"	"r.(?)"	"p.(Gly2Ala)"	"2"	""
"0000464242"	"00024242"	"50"	"685"	"0"	"685"	"0"	"c.685C>T"	"r.(?)"	"p.(Arg229Cys)"	"3"	""
"0000464243"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464244"	"00024242"	"90"	"1153"	"0"	"1153"	"0"	"c.1153del"	"r.(?)"	"p.(Arg385Alafs*7)"	"7"	""
"0000464245"	"00024242"	"90"	"1438"	"-1"	"1438"	"-1"	"c.1438-1G>C"	"r.spl"	"p.?"	"9i"	""
"0000464246"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464247"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000464248"	"00024242"	"50"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(=)"	"5"	""
"0000464249"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464250"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000464251"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464252"	"00024242"	"50"	"1823"	"0"	"1823"	"0"	"c.1823G>A"	"r.(?)"	"p.(Arg608Gln)"	"13"	""
"0000464253"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000464254"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464255"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000464256"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464257"	"00024242"	"90"	"2512"	"0"	"2512"	"0"	"c.2512C>T"	"r.(?)"	"p.(Gln838*)"	"18"	""
"0000464258"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464259"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464260"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464261"	"00024242"	"50"	"1378"	"0"	"1378"	"0"	"c.1378G>A"	"r.(?)"	"p.(Glu460Lys)"	"9"	""
"0000464262"	"00024242"	"50"	"1288"	"0"	"1288"	"0"	"c.1288G>A"	"r.(?)"	"p.(Glu430Lys)"	"8"	""
"0000464263"	"00024242"	"50"	"1123"	"0"	"1123"	"0"	"c.1123C>T"	"r.(?)"	"p.(Arg375Cys)"	"7"	""
"0000464264"	"00024242"	"70"	"1802"	"0"	"1802"	"0"	"c.1802C>G"	"r.(?)"	"p.(Ser601Trp)"	"13"	""
"0000464265"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464266"	"00024242"	"50"	"2156"	"0"	"2156"	"0"	"c.2156C>A"	"r.(?)"	"p.(Ala719Glu)"	"15"	""
"0000464267"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000464268"	"00024242"	"50"	"1757"	"0"	"1757"	"0"	"c.1757C>T"	"r.(?)"	"p.(Ala586Val)"	"13"	""
"0000470964"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	""	"0.30"
"0000470965"	"00024242"	"70"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0000470966"	"00024242"	"30"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	""	""
"0000470967"	"00024242"	"10"	"1888"	"21"	"1888"	"21"	"c.1888+21G>A"	"r.(=)"	"p.(=)"	""	""
"0000470968"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(=)"	"p.(Thr711=)"	""	""
"0000470969"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(=)"	"p.(=)"	""	""
"0000470970"	"00024242"	"10"	"547"	"-4"	"547"	"-4"	"c.547-4C>G"	"r.(?)"	"p.(=)"	""	""
"0000470971"	"00024242"	"10"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	""	""
"0000470972"	"00024242"	"10"	"858"	"8"	"858"	"8"	"c.858+8G>A"	"r.(=)"	"p.(=)"	""	""
"0000470973"	"00024242"	"10"	"858"	"30"	"858"	"30"	"c.858+30T>C"	"r.(=)"	"p.(=)"	""	""
"0000470974"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(=)"	"p.(=)"	""	""
"0000470975"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	""	""
"0000470976"	"00024242"	"10"	"1551"	"49"	"1551"	"49"	"c.1551+49C>A"	"r.(=)"	"p.(=)"	""	""
"0000478257"	"00024242"	"90"	"0"	"0"	"0"	"0"	"c.0"	"r.0"	"p.0"	"_1_20_"	""
"0000478258"	"00024242"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.0?"	"2"	"gives 0% residual activity in expression study"
"0000478259"	"00024242"	"90"	"1"	"0"	"1"	"0"	"c.1A>G"	"r.(?)"	"p.0?"	"2"	"no protein on western blot"
"0000478260"	"00024242"	"70"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.(?)"	"p.0?"	"2"	"gives 0% residual activity in expression study"
"0000478261"	"00024242"	"90"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.0?"	"2"	""
"0000478262"	"00024242"	"70"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>G"	"r.spl?"	"p.?"	"1i"	""
"0000478263"	"00024242"	"50"	"546"	"5"	"546"	"5"	"c.546+5G>T"	"r.spl?"	"p.?"	"2i"	""
"0000478264"	"00024242"	"10"	"547"	"-4"	"547"	"-4"	"c.547-4C>G"	"r.spl?"	"p.(?)"	"2i"	""
"0000478265"	"00024242"	"50"	"1326"	"5"	"1326"	"5"	"c.1326+5G>A"	"r.spl?"	"p.?"	"8i"	""
"0000478266"	"00024242"	"50"	"1551"	"3"	"1551"	"6"	"c.1551+3_1551+6del"	"r.spl?"	"p.?"	"10i"	""
"0000478267"	"00024242"	"70"	"1552"	"-3"	"1552"	"-3"	"c.1552-3C>G"	"r.[=, 1551_1552ins[1552-30_1552-4;gag], 1551_1552ins[1551+1_1552-4;gag]]"	"p.[=, Val480_Ile517del, Ile517_Asp518insSerHisLeuProAlaAlaLeuLeuLeuGln]"	"10i"	""
"0000478268"	"00024242"	"70"	"1636"	"5"	"1636"	"5"	"c.1636+5G>T"	"r.1636_1637ins[gucac;1636+6_1637-1]"	"p.Gly546fs*145"	"11i"	"gives 13.7% residual activity in expression study"
"0000478269"	"00024242"	"90"	"1636"	"5"	"1636"	"5"	"c.1636+5G>C"	"r.1636_1637ins[gucac;1636+6_1637-1]"	"p.Gly546fs*145"	"11i"	""
"0000478270"	"00024242"	"50"	"2189"	"3"	"2189"	"3"	"c.2189+3G>C"	"r.spl?"	"p.?"	"15i"	""
"0000478271"	"00024242"	"50"	"2331"	"4"	"2331"	"4"	"c.2331+4A>G"	"r.spl?"	"p.?"	"16i"	""
"0000478272"	"00024242"	"50"	"2799"	"4"	"2799"	"4"	"c.2799+4A>G"	"r.spl?"	"p.(?)"	"19i"	""
"0000478273"	"00024242"	"50"	"2800"	"-4"	"2800"	"-4"	"c.2800-4C>G"	"r.spl?"	"p.(?)"	"19i"	""
"0000478274"	"00024242"	"50"	"1194"	"5"	"1194"	"5"	"c.1194+5G>A"	"r.spl?"	"p.?"	"7i"	""
"0000478275"	"00024242"	"50"	"1437"	"4"	"1437"	"4"	"c.1437+4G>C"	"r.spl?"	"p.(?)"	"9i"	""
"0000478276"	"00024242"	"90"	"-32"	"-2"	"-32"	"-2"	"c.-32-2A>G"	"r.spl"	"p.?"	"1i"	""
"0000478277"	"00024242"	"90"	"546"	"1"	"546"	"1"	"c.546+1G>T"	"r.spl"	"p.?"	"2i"	""
"0000478278"	"00024242"	"90"	"546"	"2"	"546"	"2"	"c.546+2T>C"	"r.spl"	"p.?"	"2i"	"no protein on western blot"
"0000478279"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>C"	"r.spl"	"p.?"	"3i"	""
"0000478280"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>A"	"r.spl"	"p.?"	"3i"	""
"0000478281"	"00024242"	"90"	"858"	"2"	"858"	"2"	"c.858+2T>A"	"r.spl"	"p.?"	"4i"	"no protein on western blot"
"0000478282"	"00024242"	"90"	"859"	"-2"	"859"	"-2"	"c.859-2A>T"	"r.spl"	"p.?"	"4i"	""
"0000478283"	"00024242"	"50"	"955"	"2"	"955"	"2"	"c.955+2T>G"	"r.spl"	"p.?"	"5i"	""
"0000478284"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>A"	"r.spl"	"p.?"	"6i"	""
"0000478285"	"00024242"	"90"	"1194"	"2"	"1194"	"2"	"c.1194+2T>A"	"r.spl"	"p.?"	"7i"	""
"0000478286"	"00024242"	"90"	"1194"	"2"	"1194"	"2"	"c.1194+2T>C"	"r.spl"	"p.?"	"7i"	""
"0000478287"	"00024242"	"90"	"1195"	"-2"	"1195"	"-2"	"c.1195-2A>G"	"r.spl"	"p.?"	"7i"	""
"0000478288"	"00024242"	"90"	"1326"	"1"	"1326"	"1"	"c.1326+1G>A"	"r.spl"	"p.?"	"8i"	""
"0000478289"	"00024242"	"90"	"1437"	"1"	"1437"	"1"	"c.1437+1G>A"	"r.spl"	"p.?"	"9i"	""
"0000478290"	"00024242"	"90"	"1438"	"-2"	"1438"	"-2"	"c.1438-2A>G"	"r.spl"	"p.?"	"9i"	""
"0000478291"	"00024242"	"90"	"1438"	"-1"	"1438"	"-1"	"c.1438-1G>C"	"r.spl"	"p.?"	"9i"	""
"0000478292"	"00024242"	"50"	"1438"	"-1"	"1438"	"-1"	"c.1438-1G>T"	"r.spl"	"p.?"	"9i"	""
"0000478293"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>T"	"r.[=, 1438_1551del]"	"p.[=, Val480_Ile517del]"	"10i"	""
"0000478294"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>A"	"r.[=, 1438_1551del]"	"p.[=, Val480_Ile517del]"	"10i"	""
"0000478295"	"00024242"	"90"	"1551"	"2"	"1551"	"2"	"c.1551+2T>G"	"r.spl"	"p.?"	"10i"	""
"0000478296"	"00024242"	"90"	"1636"	"1"	"1636"	"1"	"c.1636+1G>C"	"r.spl"	"p.?"	"11i"	""
"0000478297"	"00024242"	"90"	"1637"	"-2"	"1637"	"-2"	"c.1637-2A>G"	"r.spl"	"p.?"	"11i"	""
"0000478298"	"00024242"	"90"	"1754"	"1"	"1754"	"1"	"c.1754+1G>A"	"r.spl"	"p.?"	"12i"	"no protein on western blot"
"0000478299"	"00024242"	"90"	"1754"	"2"	"1754"	"2"	"c.1754+2T>A"	"r.spl"	"p.?"	"12i"	"no protein on western blot"
"0000478300"	"00024242"	"90"	"1755"	"-1"	"1755"	"-1"	"c.1755-1G>A"	"r.spl"	"p.?"	"12i"	""
"0000478301"	"00024242"	"90"	"1888"	"1"	"1888"	"1"	"c.1888+1G>A"	"r.spl"	"p.?"	"13i"	"no protein on western blot"
"0000478302"	"00024242"	"90"	"2040"	"1"	"2040"	"1"	"c.2040+1G>T"	"r.spl"	"p.?"	"14i"	""
"0000478303"	"00024242"	"90"	"2041"	"-2"	"2041"	"-2"	"c.2041-2A>C"	"r.spl"	"p.?"	"14i"	""
"0000478304"	"00024242"	"50"	"2189"	"1"	"2189"	"1"	"c.2189+1G>A"	"r.spl"	"p.?"	"15i"	""
"0000478305"	"00024242"	"90"	"2331"	"1"	"2331"	"1"	"c.2331+1G>A"	"r.spl"	"p.?"	"16i"	""
"0000478306"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>C"	"r.2316_2331del"	"p.?"	"16i"	""
"0000478307"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	"16i"	"no protein on western blot"
"0000478308"	"00024242"	"50"	"2481"	"1"	"2481"	"1"	"c.2481+1G>A"	"r.spl"	"p.?"	"17i"	""
"0000478309"	"00024242"	"90"	"2481"	"2"	"2481"	"2"	"c.2481+2T>C"	"r.spl"	"p.?"	"17i"	""
"0000478310"	"00024242"	"90"	"546"	"2"	"546"	"5"	"c.546+2_546+5del"	"r.spl"	"p.?"	"2i"	"no protein on western blot"
"0000478311"	"00024242"	"70"	"1585"	"0"	"1586"	"0"	"c.1585_1586delinsGT"	"r.(?)"	"p.(Ser529Val)"	"11"	""
"0000478312"	"00024242"	"50"	"1004"	"0"	"1004"	"0"	"c.1004G>A"	"r.(?)"	"p.(Gly335Glu)"	"6"	"0.2% residual activity, affects secretion & processing in expression study"
"0000478313"	"00024242"	"70"	"1833"	"0"	"1847"	"0"	"c.1833_1847delinsACGGGGTAT"	"r.(?)"	"p.(His612_Asp616delinsArgGlyIle)"	"13"	""
"0000478314"	"00024242"	"90"	"340"	"0"	"341"	"0"	"c.340_341insT"	"r.(?)"	"p.(Lys114Ilefs*32)"	"2"	"no protein on western blot"
"0000478315"	"00024242"	"90"	"685"	"0"	"686"	"0"	"c.685_686insCGGC"	"r.(?)"	"p.(Arg229Profs*102)"	"3"	"no protein on western blot"
"0000478316"	"00024242"	"70"	"954"	"0"	"955"	"0"	"c.954_955insN[21]"	"r.?"	"p.?"	"5"	""
"0000478317"	"00024242"	"90"	"2322"	"0"	"2323"	"0"	"c.2322_2323insGGTGAGTCTGCAAACGGGGAGT"	"r.(?)"	"p.(Leu775Glyfs*28)"	"16"	""
"0000478318"	"00024242"	"50"	"3012"	"0"	"3013"	"0"	"c.*153_*154insG"	"r.(?)"	"p.(?)"	"20"	""
"0000478319"	"00024242"	"50"	"858"	"5"	"858"	"6"	"c.858+5_858+6insN[7]"	"r.spl?"	"p.?"	"4i"	""
"0000478320"	"00024242"	"50"	"858"	"20"	"858"	"20"	"c.858+20dup"	"r.(=)"	"p.(?)"	"4i"	""
"0000478321"	"00024242"	"50"	"858"	"17"	"858"	"23"	"c.858+17_858+23dup"	"r.(=)"	"p.(?)"	"4i"	""
"0000478322"	"00024242"	"50"	"858"	"37"	"858"	"37"	"c.858+37C>T"	"r.(=)"	"p.(?)"	"4i"	""
"0000478323"	"00024242"	"70"	"1377"	"0"	"1379"	"0"	"c.1377_1379del"	"r.(?)"	"p.(Asp459del)"	"9"	""
"0000478324"	"00024242"	"70"	"1320"	"0"	"1322"	"0"	"c.1320_1322del"	"r.(?)"	"p.(Met440del)"	"8"	""
"0000478326"	"00024242"	"90"	"1371"	"0"	"1371"	"0"	"c.1371del"	"r.(?)"	"p.(Tyr458Thrfs*19)"	"9"	""
"0000478327"	"00024242"	"90"	"829"	"0"	"851"	"0"	"c.829_851del"	"r.(?)"	"p.(Thr277Alafs*45)"	"4"	""
"0000478328"	"00024242"	"70"	"1199"	"0"	"1210"	"0"	"c.1199_1210del"	"r.(?)"	"p.(Val400_Asn403del)"	"8"	""
"0000478329"	"00024242"	"50"	"2041"	"-61"	"2041"	"-61"	"c.2041-61del"	"r.(=)"	"p.(?)"	"14i"	"p.(=)"
"0000478330"	"00024242"	"90"	"2605"	"0"	"2605"	"0"	"c.2605del"	"r.(?)"	"p.(Glu869Serfs*18)"	"18"	"p.(Glu869Serfs*18)"
"0000478331"	"00024242"	"50"	"858"	"17"	"858"	"23"	"c.858+17_858+23del"	"r.(=)"	"p.(?)"	"4i"	"p.(=)"
"0000478333"	"00024242"	"90"	"2815"	"0"	"2816"	"0"	"c.2815_2816del"	"r.(?)"	"p.(Val939Leufs*78)"	"20"	""
"0000478334"	"00024242"	"90"	"1195"	"-19"	"2190"	"-20"	"c.1195-19_2190-20del"	"r.(?)"	"p.(Asp399fs*6)"	"7i"	"no protein on western blot"
"0000478335"	"00024242"	"90"	"1322"	"0"	"1326"	"9"	"c.1322_1326+9del"	"r.spl"	"p.(Ile441Argfs*63)"	"8_8i"	""
"0000478336"	"00024242"	"50"	"1889"	"-27"	"2040"	"23"	"c.1889-27_2040+23del"	"r.(1889_2040del)"	"p.(Glu630_Leu680delfs*56)"	"13i_14i"	""
"0000478337"	"00024242"	"70"	"2189"	"459"	"3405"	"0"	"c.2189+459_3405del"	"r.?"	"p.(Glu730_Cys952del)"	"15i_"	""
"0000478338"	"00024242"	"90"	"148"	"0"	"859"	"-11"	"c.148_859-11del"	"r.spl?"	"p.(Glu50_Profs*27)"	"2_4i"	"no protein on western blot"
"0000478339"	"00024242"	"90"	"2646"	"2"	"2646"	"3"	"c.2646+2_2646+3del"	"r.spl"	"p.(Asn882_Lysfs*5)"	"18_18i"	""
"0000478340"	"00024242"	"50"	"-82"	"0"	"-82"	"0"	"c.-82G>C"	"r.(?)"	"p.(?)"	"1"	""
"0000478341"	"00024242"	"90"	"18"	"0"	"25"	"0"	"c.18_25del"	"r.(?)"	"p.(Cys8Profs*24)"	"2"	""
"0000478342"	"00024242"	"90"	"25"	"0"	"25"	"0"	"c.25del"	"r.(?)"	"p.(Ser9Profs*34)"	"2"	""
"0000478343"	"00024242"	"50"	"136"	"0"	"136"	"0"	"c.136T>C"	"r.(?)"	"p.(Ser46Pro)"	"2"	"gives 100% residual activity in expression study"
"0000478344"	"00024242"	"90"	"172"	"0"	"172"	"0"	"c.172C>T"	"r.(?)"	"p.(Gln58*)"	"2"	""
"0000478345"	"00024242"	"50"	"186"	"0"	"196"	"0"	"c.186_196dup"	"r.(?)"	"p.(Arg66Hisfs*80)"	"2"	""
"0000478346"	"00024242"	"90"	"241"	"0"	"241"	"0"	"c.241C>T"	"r.(?)"	"p.(Gln81*)"	"2"	""
"0000478347"	"00024242"	"50"	"266"	"0"	"266"	"0"	"c.266G>A"	"r.(?)"	"p.(Arg89His)"	"2"	"gives 43.5% residual activity in expression study"
"0000478348"	"00024242"	"30"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	"lowers affinity for glycogen (GAA2)"
"0000478349"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271del"	"r.(?)"	"p.(Asp91Ilefs*51)"	"2"	""
"0000478350"	"00024242"	"50"	"307"	"0"	"307"	"0"	"c.307T>C"	"r.(?)"	"p.(Cys103Arg)"	"2"	"0% residual activity, affects secretion & processing in expression study"
"0000478351"	"00024242"	"90"	"309"	"0"	"309"	"0"	"c.309C>A"	"r.(?)"	"p.(Cys103*)"	"2"	""
"0000478352"	"00024242"	"50"	"322"	"0"	"322"	"0"	"c.322T>G"	"r.(?)"	"p.(Cys108Gly)"	"2"	"8.2% residual activity, affects secretion & processing in expression study"
"0000478353"	"00024242"	"50"	"323"	"0"	"323"	"0"	"c.323G>A"	"r.(?)"	"p.(Cys108Ser)"	"2"	""
"0000478354"	"00024242"	"90"	"343"	"0"	"343"	"0"	"c.343C>T"	"r.(?)"	"p.(Gln115*)"	"2"	""
"0000478355"	"00024242"	"90"	"352"	"0"	"352"	"0"	"c.352C>T"	"r.(?)"	"p.(Gln118*)"	"2"	"no protein on western blot"
"0000478356"	"00024242"	"50"	"364"	"0"	"364"	"0"	"c.364A>G"	"r.(?)"	"p.(Met122Val)"	"2"	""
"0000478357"	"00024242"	"90"	"378"	"0"	"378"	"0"	"c.378G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000478358"	"00024242"	"50"	"380"	"0"	"380"	"0"	"c.380G>T"	"r.(?)"	"p.(Cys127Phe)"	"2"	"1.5% residual activity, affects secretion & processing in expression study"
"0000478359"	"00024242"	"90"	"399"	"0"	"399"	"0"	"c.399C>A"	"r.(?)"	"p.(Tyr133*)"	"2"	""
"0000478360"	"00024242"	"50"	"421"	"0"	"421"	"0"	"c.421C>A"	"r.(?)"	"p.(Leu141Met)"	"2"	""
"0000478361"	"00024242"	"90"	"424"	"0"	"440"	"0"	"c.424_440del"	"r.(?)"	"p.(Ser142Lleufs*29)"	"2"	""
"0000478362"	"00024242"	"90"	"444"	"0"	"444"	"0"	"c.444C>G"	"r.(?)"	"p.(Tyr148*)"	"2"	""
"0000478363"	"00024242"	"30"	"447"	"0"	"447"	"0"	"c.447G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000478364"	"00024242"	"70"	"460"	"0"	"465"	"0"	"c.460_465del"	"r.(?)"	"p.(Arg154_Thr155del)"	"2"	""
"0000478365"	"00024242"	"50"	"461"	"0"	"461"	"0"	"c.461G>C"	"r.(?)"	"p.(Arg154Pro)"	"2"	""
"0000478366"	"00024242"	"70"	"461"	"0"	"469"	"0"	"c.461_469del"	"r.(?)"	"p.(Arg154_Thr156del)"	"2"	"0.5% residual activity, affects secretion & processing in expression study"
"0000478367"	"00024242"	"50"	"483"	"0"	"483"	"0"	"c.483dup"	"r.(?)"	"p.(Lys162Glnfs*15)"	"2"	""
"0000478368"	"00024242"	"70"	"503"	"0"	"503"	"0"	"c.503G>C"	"r.(?)"	"p.(Arg168Pro)"	"2"	""
"0000478369"	"00024242"	"50"	"506"	"0"	"506"	"0"	"c.506T>C"	"r.(?)"	"p.(Leu169Pro)"	"2"	""
"0000478370"	"00024242"	"90"	"525"	"0"	"526"	"0"	"c.525_526del"	"r.(?)"	"p.(Asn177Profs*11)"	"2"	"no protein on western blot"
"0000478371"	"00024242"	"50"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Arg178His)"	"2"	""
"0000478372"	"00024242"	"70"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000478373"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000478374"	"00024242"	"70"	"546"	"0"	"546"	"0"	"c.546G>C"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000478375"	"00024242"	"50"	"546"	"45"	"546"	"45"	"c.546+45G>C"	"r.(=)"	"p.(?)"	"2i"	""
"0000478376"	"00024242"	"50"	"547"	"-67"	"547"	"-67"	"c.547-67C>G"	"r.(=)"	"p.(?)"	"2i"	""
"0000478377"	"00024242"	"50"	"547"	"-39"	"547"	"-39"	"c.547-39T>G"	"r.(=)"	"p.(?)"	"2i"	""
"0000478378"	"00024242"	"50"	"569"	"0"	"569"	"0"	"c.569G>A"	"r.(?)"	"p.(Arg190His)"	"3"	"3.9% residual activityand affects secretion & processing in expression study"
"0000478379"	"00024242"	"50"	"572"	"0"	"572"	"0"	"c.572A>G"	"r.(?)"	"p.(Tyr191Cys)"	"3"	"gives 0.6% residual activity in expression study"
"0000478380"	"00024242"	"90"	"573"	"0"	"573"	"0"	"c.573C>A"	"r.(?)"	"p.(Tyr191*)"	"3"	""
"0000478381"	"00024242"	"50"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	"3"	""
"0000478382"	"00024242"	"50"	"623"	"0"	"623"	"0"	"c.623T>C"	"r.(?)"	"p.(Leu208Pro)"	"3"	""
"0000478383"	"00024242"	"90"	"634"	"0"	"634"	"0"	"c.634G>T"	"r.(?)"	"p.(Glu212*)"	"3"	""
"0000478384"	"00024242"	"50"	"650"	"0"	"650"	"0"	"c.650C>T"	"r.(?)"	"p.(Pro217Leu)"	"3"	"13.3% residual activity, affects secretion & processing in expression study"
"0000478385"	"00024242"	"50"	"671"	"0"	"671"	"0"	"c.671G>A"	"r.(?)"	"p.(Arg224Gln)"	"3"	"0.7% residual activity, affects secretion & processing in expression study"
"0000478386"	"00024242"	"10"	"693"	"-49"	"693"	"-49"	"c.693-49C>T"	"r.(=)"	"p.(?)"	"3i"	""
"0000478387"	"00024242"	"50"	"701"	"0"	"701"	"0"	"c.701C>G"	"r.(?)"	"p.(Thr234Arg)"	"4"	"1.6% residual activity in expression study and affects secretion & processing in expression study"
"0000478388"	"00024242"	"50"	"701"	"0"	"701"	"0"	"c.701C>A"	"r.(?)"	"p.(Thr234Lys)"	"4"	"2.7% residual activity in expression study and affects secretion & processing in expression study"
"0000478389"	"00024242"	"50"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	"4"	""
"0000478390"	"00024242"	"90"	"716"	"0"	"716"	"0"	"c.716del"	"r.(?)"	"p.(Leu239Argfs*29)"	"4"	""
"0000478391"	"00024242"	"50"	"719"	"0"	"719"	"0"	"c.719T>C"	"r.(?)"	"p.(Phe240Ser)"	"4"	""
"0000478392"	"00024242"	"90"	"722"	"0"	"723"	"0"	"c.722_723del"	"r.(?)"	"p.(Phe241Cysfs*88)"	"4"	"no protein on western blot"
"0000478393"	"00024242"	"50"	"725"	"0"	"725"	"0"	"c.725C>T"	"r.(?)"	"p.(Ala242Val)"	"4"	"gives 14% residual activity in expression study"
"0000478394"	"00024242"	"50"	"737"	"0"	"737"	"0"	"c.737T>G"	"r.(?)"	"p.(Leu246Arg)"	"4"	""
"0000478395"	"00024242"	"90"	"742"	"0"	"742"	"0"	"c.742del"	"r.(?)"	"p.(Leu248Profs*20)"	"4"	""
"0000478396"	"00024242"	"50"	"743"	"0"	"743"	"0"	"c.743T>G"	"r.(?)"	"p.(Leu248Arg)"	"4"	""
"0000478397"	"00024242"	"50"	"743"	"0"	"743"	"0"	"c.743T>C"	"r.(?)"	"p.(Leu248Pro)"	"4"	"0% residual activity, affects secretion & processing in expression study"
"0000478398"	"00024242"	"90"	"763"	"0"	"763"	"0"	"c.763C>T"	"r.(?)"	"p.(Gln255*)"	"4"	""
"0000478399"	"00024242"	"90"	"766"	"0"	"785"	"0"	"c.766_785delinsC"	"r.[766_785delinsc]"	"p.(Tyr256Argfs*6)"	"4"	"no protein on western blot"
"0000478400"	"00024242"	"50"	"768"	"0"	"768"	"0"	"c.768dup"	"r.(?)"	"p.(Ile257Tyrfs*73)"	"4"	""
"0000478401"	"00024242"	"50"	"776"	"0"	"776"	"0"	"c.776G>T"	"r.(?)"	"p.(Gly259Val)"	"4"	"0% residual activity, affects secretion & processing in expression study"
"0000478402"	"00024242"	"90"	"794"	"0"	"794"	"0"	"c.794del"	"r.(?)"	"p.(Ser265Ilefs*3)"	"4"	""
"0000478403"	"00024242"	"90"	"827"	"0"	"845"	"0"	"c.827_845del"	"r.(?)"	"p.(Ile276Thrfs*32)"	"4"	""
"0000478404"	"00024242"	"90"	"836"	"0"	"836"	"0"	"c.836G>A"	"r.(?)"	"p.(Trp279*)"	"4"	""
"0000478405"	"00024242"	"50"	"844"	"0"	"844"	"0"	"c.844G>C"	"r.(?)"	"p.(Asp282His)"	"4"	""
"0000478406"	"00024242"	"30"	"852"	"0"	"852"	"0"	"c.852G>A"	"r.(?)"	"p.(=)"	"4"	""
"0000478407"	"00024242"	"70"	"854"	"0"	"854"	"0"	"c.854C>G"	"r.(?)"	"p.(Pro285Arg)"	"4"	""
"0000478408"	"00024242"	"10"	"858"	"30"	"858"	"30"	"c.858+30T>C"	"r.(=)"	"p.(?)"	"4i"	""
"0000478409"	"00024242"	"50"	"861"	"0"	"861"	"0"	"c.861C>T"	"r.(?)"	"p.(=)"	"5"	""
"0000478410"	"00024242"	"50"	"872"	"0"	"872"	"0"	"c.872T>A"	"r.(?)"	"p.(Leu291His)"	"5"	"2% residual activity, affects secretion & processing in expression study"
"0000478411"	"00024242"	"50"	"885"	"0"	"885"	"0"	"c.885C>G"	"r.(?)"	"p.(His295Gln)"	"5"	""
"0000478412"	"00024242"	"50"	"893"	"0"	"893"	"0"	"c.893A>C"	"r.(?)"	"p.(Tyr298Ser)"	"5"	""
"0000478413"	"00024242"	"50"	"896"	"0"	"896"	"0"	"c.896T>G"	"r.(?)"	"p.(Leu299Arg)"	"5"	""
"0000478414"	"00024242"	"50"	"917"	"0"	"917"	"0"	"c.917C>T"	"r.(?)"	"p.(Ser306Leu)"	"5"	""
"0000478415"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(=)"	"5"	""
"0000478416"	"00024242"	"70"	"923"	"0"	"923"	"0"	"c.923A>C"	"r.(?)"	"p.(His308Pro)"	"5"	""
"0000478417"	"00024242"	"70"	"923"	"0"	"923"	"0"	"c.923A>T"	"r.(?)"	"p.(His308Leu)"	"5"	""
"0000478418"	"00024242"	"50"	"929"	"0"	"929"	"0"	"c.929T>G"	"r.(?)"	"p.(Val310Gly)"	"5"	""
"0000478419"	"00024242"	"50"	"935"	"0"	"935"	"0"	"c.935T>G"	"r.(?)"	"p.(Leu312Arg)"	"5"	""
"0000478420"	"00024242"	"50"	"947"	"0"	"947"	"0"	"c.947A>T"	"r.(?)"	"p.(Asn316Ile)"	"5"	"0% residual activity, affects secretion & processing in expression study"
"0000478421"	"00024242"	"50"	"953"	"0"	"953"	"0"	"c.953T>C"	"r.(?)"	"p.(Met318Thr)"	"5"	""
"0000478422"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12G>A"	"r.(=)"	"p.(?)"	"5i"	""
"0000478423"	"00024242"	"10"	"956"	"-84"	"956"	"-84"	"c.956-84C>T"	"r.(=)"	"p.(?)"	"5i"	""
"0000478424"	"00024242"	"50"	"971"	"0"	"971"	"0"	"c.971C>T"	"r.(?)"	"p.(Pro324Leu)"	"6"	""
"0000478425"	"00024242"	"50"	"988"	"0"	"988"	"0"	"c.988T>G"	"r.(?)"	"p.(Trp330Gly)"	"6"	""
"0000478426"	"00024242"	"90"	"989"	"0"	"989"	"0"	"c.989G>A"	"r.(?)"	"p.(Trp330*)"	"6"	""
"0000478427"	"00024242"	"50"	"998"	"0"	"998"	"0"	"c.998C>A"	"r.(?)"	"p.(Thr333Lys)"	"6"	""
"0000478428"	"00024242"	"50"	"1000"	"0"	"1000"	"0"	"c.1000G>A"	"r.(?)"	"p.(Gly334Ser)"	"6"	""
"0000478429"	"00024242"	"50"	"1048"	"0"	"1048"	"0"	"c.1048G>A"	"r.(?)"	"p.(Val350Met)"	"6"	""
"0000478430"	"00024242"	"70"	"1075"	"0"	"1075"	"0"	"c.1075G>A"	"r.[1075g>a, 1072_1075del]"	"p.[Gly359Arg, Val358Aspfs*33]"	"6"	"54% residual activity, affects secretion in expression study"
"0000478431"	"00024242"	"90"	"1075"	"0"	"1075"	"0"	"c.1075G>T"	"r.(?)"	"p.(Ily359*)"	"6"	"no protein on western blot"
"0000478432"	"00024242"	"50"	"1075"	"13"	"1075"	"13"	"c.1075+13C>T"	"r.(=)"	"p.(?)"	"6i"	""
"0000478433"	"00024242"	"90"	"1080"	"0"	"1080"	"0"	"c.1080C>G"	"r.(?)"	"p.(Tyr360*)"	"7"	""
"0000478434"	"00024242"	"50"	"1099"	"0"	"1099"	"0"	"c.1099T>C"	"r.(?)"	"p.(Trp367Arg)"	"7"	""
"0000478435"	"00024242"	"90"	"1100"	"0"	"1100"	"0"	"c.1100G>A"	"r.(?)"	"p.(Trp367*)"	"7"	""
"0000478436"	"00024242"	"90"	"1101"	"0"	"1101"	"0"	"c.1101G>A"	"r.(?)"	"p.(Trp367*)"	"7"	""
"0000478437"	"00024242"	"70"	"1106"	"0"	"1106"	"0"	"c.1106T>C"	"r.(?)"	"p.(Leu369Pro)"	"7"	"3.1% residual activity, affects secretion & processing in expression study"
"0000478438"	"00024242"	"50"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	"7"	""
"0000478439"	"00024242"	"50"	"1118"	"0"	"1118"	"0"	"c.1118T>G"	"r.(?)"	"p.(Leu373Arg)"	"7"	""
"0000478440"	"00024242"	"50"	"1120"	"0"	"1120"	"0"	"c.1120T>C"	"r.(?)"	"p.(Cys374Arg)"	"7"	""
"0000478441"	"00024242"	"70"	"1124"	"0"	"1124"	"0"	"c.1124G>T"	"r.(?)"	"p.(Arg375Leu)"	"7"	"gives 0.3% residual activity in expression study"
"0000478442"	"00024242"	"50"	"1124"	"0"	"1124"	"0"	"c.1124G>A"	"r.(?)"	"p.(Arg375His)"	"7"	""
"0000478443"	"00024242"	"70"	"1129"	"0"	"1129"	"0"	"c.1129G>C"	"r.(?)"	"p.(Gly377Arg)"	"7"	"0% residual activity, affects secretion & processing in expression study"
"0000478444"	"00024242"	"50"	"1134"	"0"	"1134"	"0"	"c.1134C>G"	"r.(?)"	"p.(Tyr378*)"	"7"	""
"0000478445"	"00024242"	"90"	"1143"	"0"	"1143"	"0"	"c.1143del"	"r.(?)"	"p.(Ala382Leufs*10)"	"7"	""
"0000478446"	"00024242"	"90"	"1156"	"0"	"1156"	"0"	"c.1156C>T"	"r.(?)"	"p.(Gln386*)"	"7"	""
"0000478447"	"00024242"	"90"	"1157"	"0"	"1157"	"0"	"c.1157dup"	"r.(?)"	"p.(Val387Glyfs*119)"	"7"	"no protein on western blot"
"0000478448"	"00024242"	"90"	"1165"	"0"	"1165"	"0"	"c.1165del"	"r.(?)"	"p.(Glu389Argfs*3)"	"7"	""
"0000478449"	"00024242"	"50"	"1171"	"0"	"1171"	"0"	"c.1171A>G"	"r.(?)"	"p.(Met391Val)"	"7"	""
"0000478450"	"00024242"	"50"	"1190"	"0"	"1190"	"0"	"c.1190C>T"	"r.(?)"	"p.(Pro397Leu)"	"7"	"0% residual activity, affects secretion & processing in expression study"
"0000478451"	"00024242"	"90"	"1192"	"0"	"1192"	"0"	"c.1192dup"	"r.(?)"	"p.(Leu398Profs*108)"	"7"	""
"0000478452"	"00024242"	"50"	"1195"	"-15"	"1195"	"-15"	"c.1195-15G>A"	"r.(=)"	"p.(?)"	"7i"	""
"0000478453"	"00024242"	"50"	"1195"	"-8"	"1195"	"-8"	"c.1195-8G>A"	"r.spl?"	"p.(=)"	"7i"	""
"0000478454"	"00024242"	"70"	"1202"	"0"	"1202"	"0"	"c.1202A>G"	"r.(?)"	"p.(Gln401Arg)"	"8"	"5% residual activity, affects secretion & processing in expression study"
"0000478455"	"00024242"	"50"	"1204"	"0"	"1204"	"0"	"c.1204T>C"	"r.(?)"	"p.(Trp402Arg)"	"8"	""
"0000478456"	"00024242"	"50"	"1209"	"0"	"1209"	"0"	"c.1209C>G"	"r.(?)"	"p.(Asn403Lys)"	"8"	""
"0000478457"	"00024242"	"90"	"1209"	"0"	"1209"	"0"	"c.1209del"	"r.(?)"	"p.(Asn403Lysfs*37)"	"8"	"no protein on western blot"
"0000478458"	"00024242"	"50"	"1210"	"0"	"1210"	"0"	"c.1210G>A"	"r.(?)"	"p.(Asp404Asn)"	"8"	""
"0000478459"	"00024242"	"50"	"1211"	"0"	"1211"	"0"	"c.1211A>G"	"r.(?)"	"p.(Asp404Gly)"	"8"	""
"0000478460"	"00024242"	"50"	"1214"	"0"	"1214"	"0"	"c.1214T>C"	"r.(?)"	"p.(Leu405Pro)"	"8"	""
"0000478461"	"00024242"	"70"	"1239"	"0"	"1239"	"0"	"c.1239C>G"	"r.(?)"	"p.(Asp413Glu)"	"8"	""
"0000478462"	"00024242"	"70"	"1256"	"0"	"1256"	"0"	"c.1256A>T"	"r.[=, 1195_1326del]"	"p.[Asp419Val, Asp339_Val442del]"	"8"	"gives 21.3% residual activity in expression study"
"0000478463"	"00024242"	"50"	"1280"	"0"	"1280"	"0"	"c.1280T>C"	"r.(?)"	"p.(Met427Thr)"	"8"	""
"0000478464"	"00024242"	"30"	"1286"	"0"	"1286"	"0"	"c.1286A>G"	"r.(?)"	"p.(Gln429Arg)"	"8"	""
"0000478465"	"00024242"	"70"	"1291"	"0"	"1299"	"0"	"c.1291_1299del"	"r.(?)"	"p.(Leu431_Gln433del)"	"8"	""
"0000478466"	"00024242"	"90"	"1293"	"0"	"1312"	"0"	"c.1293_1312del"	"r.(?)"	"p.(Gln433Aspfs*66)"	"8"	""
"0000478467"	"00024242"	"50"	"1297"	"0"	"1297"	"0"	"c.1297C>A"	"r.(?)"	"p.(Gln433Lys)"	"8"	""
"0000478468"	"00024242"	"50"	"1310"	"0"	"1310"	"0"	"c.1310G>A"	"r.(?)"	"p.(Arg437His)"	"8"	""
"0000478469"	"00024242"	"50"	"1324"	"0"	"1324"	"0"	"c.1324G>A"	"r.(?)"	"p.(Val442Met)"	"8"	""
"0000478470"	"00024242"	"10"	"1327"	"-18"	"1327"	"-18"	"c.1327-18A>G"	"r.(=)"	"p.(?)"	"8i"	""
"0000478471"	"00024242"	"70"	"1331"	"0"	"1331"	"0"	"c.1331C>G"	"r.(?)"	"p.(Pro444Arg)"	"9"	""
"0000478472"	"00024242"	"50"	"1333"	"0"	"1333"	"0"	"c.1333G>C"	"r.(?)"	"p.(Ala445Pro)"	"9"	"decreased enzymatic activity in expression study"
"0000478473"	"00024242"	"90"	"1354"	"0"	"1372"	"0"	"c.1354_1372del"	"r.(?)"	"p.(Ala452Thrfs*19)"	"9"	""
"0000478474"	"00024242"	"90"	"1356"	"0"	"1356"	"0"	"c.1356del"	"r.(?)"	"p.(Ser454Alafs*23)"	"9"	""
"0000478475"	"00024242"	"70"	"1364"	"0"	"1364"	"0"	"c.1364A>C"	"r.(?)"	"p.(Tyr455Cys)"	"9"	""
"0000478476"	"00024242"	"70"	"1364"	"0"	"1364"	"0"	"c.1364A>T"	"r.(?)"	"p.(Tyr455Phe)"	"9"	""
"0000478477"	"00024242"	"70"	"1370"	"0"	"1370"	"0"	"c.1370C>T"	"r.(?)"	"p.(Pro457Leu)"	"9"	"gives 10% residual activity in expression study"
"0000478478"	"00024242"	"50"	"1370"	"0"	"1370"	"0"	"c.1370C>A"	"r.(?)"	"p.(Pro457His)"	"9"	"0% residual activity, affects secretion & processing in expression study"
"0000478480"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(?)"	"p.(=)"	"9"	""
"0000478481"	"00024242"	"70"	"1375"	"0"	"1375"	"0"	"c.1375G>A"	"r.(?)"	"p.(Asp459Asn)"	"9"	""
"0000478482"	"00024242"	"50"	"1381"	"0"	"1381"	"0"	"c.1381G>A"	"r.(?)"	"p.(Gly461Ser)"	"9"	"0% residual activity, affects secretion & processing in expression study"
"0000478483"	"00024242"	"70"	"1385"	"0"	"1385"	"0"	"c.1385T>C"	"r.(?)"	"p.(Leu462Pro)"	"9"	""
"0000478484"	"00024242"	"70"	"1397"	"0"	"1397"	"0"	"c.1397T>G"	"r.(?)"	"p.(Val466Gly)"	"9"	""
"0000478485"	"00024242"	"70"	"1408"	"0"	"1410"	"0"	"c.1408_1410del"	"r.(?)"	"p.(Asn470del)"	"9"	""
"0000478486"	"00024242"	"70"	"1437"	"0"	"1437"	"0"	"c.1437G>C"	"r.(?)"	"p.[(Lys479Asn), (?)]"	"9"	""
"0000478487"	"00024242"	"10"	"1438"	"-19"	"1438"	"-19"	"c.1438-19G>C"	"r.(=)"	"p.(?)"	"9i"	""
"0000478488"	"00024242"	"90"	"1441"	"0"	"1441"	"0"	"c.1441del"	"r.(?)"	"p.(Trp481Glyfs*39)"	"10"	""
"0000478489"	"00024242"	"90"	"1442"	"0"	"1442"	"0"	"c.1442G>A"	"r.(?)"	"p.(Trp481*)"	"10"	"no protein on western blot"
"0000478490"	"00024242"	"70"	"1445"	"0"	"1445"	"0"	"c.1445C>T"	"r.(?)"	"p.(Pro482Leu)"	"10"	""
"0000478491"	"00024242"	"50"	"1445"	"0"	"1445"	"0"	"c.1445C>G"	"r.(?)"	"p.(Pro482Arg)"	"10"	"0% residual activity in and affects secretion & processing in expression study"
"0000478492"	"00024242"	"70"	"1447"	"0"	"1447"	"0"	"c.1447G>A"	"r.(?)"	"p.(Gly483Arg)"	"10"	"0% residual activity, affects secretion in expression study"
"0000478493"	"00024242"	"50"	"1448"	"0"	"1448"	"0"	"c.1448G>T"	"r.(?)"	"p.(Gly483Val)"	"10"	"0% residual activity, affects secretion & processing in expression study"
"0000478494"	"00024242"	"90"	"1456"	"0"	"1468"	"0"	"c.1456_1468del"	"r.(?)"	"p.(Ala486Serfs*30)"	"10"	""
"0000478495"	"00024242"	"70"	"1460"	"0"	"1460"	"0"	"c.1460T>C"	"r.(?)"	"p.(Phe487Ser)"	"10"	"0% residual activity, affects secretion & processing in expression study"
"0000478496"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>T"	"r.(?)"	"p.(Asp489Tyr)"	"10"	""
"0000478497"	"00024242"	"70"	"1466"	"0"	"1466"	"0"	"c.1466A>G"	"r.(?)"	"p.(Asp489Gly)"	"10"	""
"0000478498"	"00024242"	"50"	"1468"	"0"	"1468"	"0"	"c.1468T>C"	"r.(?)"	"p.(Phe490Leu)"	"10"	""
"0000478499"	"00024242"	"50"	"1478"	"0"	"1478"	"0"	"c.1478C>T"	"r.(?)"	"p.(Pro493Leu)"	"10"	""
"0000478500"	"00024242"	"50"	"1495"	"0"	"1495"	"0"	"c.1495T>A"	"r.(?)"	"p.(Trp499Arg)"	"10"	""
"0000478501"	"00024242"	"90"	"1496"	"0"	"1496"	"0"	"c.1496G>A"	"r.(?)"	"p.(Trp499*)"	"10"	"no protein on western blot"
"0000478502"	"00024242"	"90"	"1497"	"0"	"1497"	"0"	"c.1497G>A"	"r.(?)"	"p.(Trp499*)"	"10"	"no protein on western blot"
"0000478503"	"00024242"	"50"	"1504"	"0"	"1504"	"0"	"c.1504A>G"	"r.(?)"	"p.(Met502Val)"	"10"	""
"0000478504"	"00024242"	"70"	"1509"	"0"	"1511"	"0"	"c.1509_1511del"	"r.(?)"	"p.(Ala504del)"	"10"	""
"0000478505"	"00024242"	"50"	"1540"	"0"	"1540"	"0"	"c.1540G>C"	"r.(?)"	"p.(Gly514Arg)"	"10"	""
"0000478506"	"00024242"	"50"	"1544"	"0"	"1544"	"0"	"c.1544T>A"	"r.(?)"	"p.(Met515Lys)"	"10"	""
"0000478507"	"00024242"	"50"	"1551"	"42"	"1551"	"42"	"c.1551+42G>A"	"r.(=)"	"p.(?)"	"10i"	""
"0000478508"	"00024242"	"10"	"1551"	"49"	"1551"	"49"	"c.1551+49C>A"	"r.(=)"	"p.(?)"	"10i"	""
"0000478509"	"00024242"	"70"	"1555"	"0"	"1555"	"0"	"c.1555A>G"	"r.(?)"	"p.(Met519Val)"	"11"	""
"0000478510"	"00024242"	"70"	"1556"	"0"	"1556"	"0"	"c.1556T>C"	"r.(?)"	"p.(Met519Thr)"	"11"	""
"0000478511"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>C"	"r.(?)"	"p.(Glu521Gln)"	"11"	"0% residual activity, affects secretion & processing in expression study"
"0000478512"	"00024242"	"70"	"1562"	"0"	"1562"	"0"	"c.1562A>T"	"r.(?)"	"p.(Glu521Val)"	"11"	""
"0000478513"	"00024242"	"70"	"1564"	"0"	"1564"	"0"	"c.1564C>G"	"r.(?)"	"p.(Pro522Ala)"	"11"	"gives 0% residual activity in expression study"
"0000478514"	"00024242"	"70"	"1564"	"0"	"1564"	"0"	"c.1564C>A"	"r.(?)"	"p.(Pro522Thr)"	"11"	""
"0000478515"	"00024242"	"50"	"1564"	"0"	"1564"	"0"	"c.1564C>T"	"r.(?)"	"p.(Pro522Ser)"	"11"	"0.8% residual activity, affects secretion & processing in expression study"
"0000478516"	"00024242"	"50"	"1568"	"0"	"1568"	"0"	"c.1568C>A"	"r.(?)"	"p.(Ser523Tyr)"	"11"	"0% residual activity, affects processing in expression study"
"0000478517"	"00024242"	"90"	"1582"	"0"	"1583"	"0"	"c.1582_1583del"	"r.(?)"	"p.(Gly528Leufs*2)"	"11"	""
"0000478518"	"00024242"	"90"	"1591"	"0"	"1591"	"0"	"c.1591dup"	"r.(?)"	"p.(Asp531Glyfs*7)"	"11"	"no protein on western blot"
"0000478519"	"00024242"	"50"	"1626"	"0"	"1626"	"0"	"c.1626C>G"	"r.(?)"	"p.(=)"	"11"	""
"0000478520"	"00024242"	"70"	"1642"	"0"	"1642"	"0"	"c.1642G>T"	"r.(?)"	"p.(Val548Phe)"	"12"	""
"0000478521"	"00024242"	"70"	"1645"	"0"	"1645"	"0"	"c.1645G>A"	"r.(?)"	"p.(Gly549Arg)"	"12"	""
"0000478522"	"00024242"	"70"	"1645"	"0"	"1645"	"0"	"c.1645G>C"	"r.(?)"	"p.(Gly549Arg)"	"12"	""
"0000478523"	"00024242"	"90"	"1650"	"0"	"1650"	"0"	"c.1650dup"	"r.(?)"	"p.(Thr551Aspfs*85)"	"12"	"no protein on western blot"
"0000478524"	"00024242"	"90"	"1654"	"0"	"1654"	"0"	"c.1654del"	"r.(?)"	"p.(Leu552Serfs*26)"	"12"	"no protein on western blot"
"0000478525"	"00024242"	"70"	"1666"	"0"	"1666"	"0"	"c.1666A>G"	"r.(?)"	"p.(Thr556Ala)"	"12"	""
"0000478526"	"00024242"	"50"	"1672"	"0"	"1672"	"0"	"c.1672T>A"	"r.(?)"	"p.(Cys558Ser)"	"12"	"4.8% residual activity, affects secretion & processing in expression study"
"0000478527"	"00024242"	"70"	"1673"	"0"	"1673"	"0"	"c.1673G>C"	"r.(?)"	"p.(Cys558Ser)"	"12"	"2.1% residual activity, affects secretion & processing in expression study"
"0000478528"	"00024242"	"90"	"1687"	"0"	"1687"	"0"	"c.1687C>T"	"r.(?)"	"p.(Gln563*)"	"12"	"no protein on western blot"
"0000478529"	"00024242"	"70"	"1696"	"0"	"1696"	"0"	"c.1696T>C"	"r.(?)"	"p.(Ser566Pro)"	"12"	""
"0000478530"	"00024242"	"70"	"1703"	"0"	"1703"	"0"	"c.1703A>T"	"r.(?)"	"p.(His568Leu)"	"12"	""
"0000478531"	"00024242"	"70"	"1704"	"0"	"1704"	"0"	"c.1704C>G"	"r.(?)"	"p.(His568Gln)"	"12"	""
"0000478532"	"00024242"	"90"	"1705"	"0"	"1705"	"0"	"c.1705dup"	"r.(?)"	"p.(tyr569Leufs*67)"	"12"	"no protein on western blot"
"0000478533"	"00024242"	"70"	"1710"	"0"	"1710"	"0"	"c.1710C>G"	"r.(?)"	"p.(Asn570Lys)"	"12"	"0.9% residual activity, affects secretion & processing in expression study"
"0000478534"	"00024242"	"70"	"1716"	"0"	"1716"	"0"	"c.1716C>G"	"r.(?)"	"p.(His572Gln)"	"12"	"0% residual activity, affects secretion & processing in expression study"
"0000478535"	"00024242"	"50"	"1717"	"0"	"1717"	"0"	"c.1717A>C"	"r.(?)"	"p.(Asn573His)"	"12"	"0% residual activity, affects secretion & processing in expression study"
"0000478536"	"00024242"	"50"	"1719"	"0"	"1719"	"0"	"c.1719C>A"	"r.(?)"	"p.(Asn573Lys)"	"12"	""
"0000478537"	"00024242"	"50"	"1724"	"0"	"1724"	"0"	"c.1724A>C"	"r.(?)"	"p.(Tyr575Ser)"	"12"	""
"0000478538"	"00024242"	"50"	"1724"	"0"	"1724"	"0"	"c.1724A>G"	"r.(?)"	"p.(Tyr575Cys)"	"12"	"2% residual activity, affects processing in expression study"
"0000478539"	"00024242"	"90"	"1725"	"0"	"1725"	"0"	"c.1725C>A"	"r.(?)"	"p.(Tyr575*)"	"12"	""
"0000478540"	"00024242"	"70"	"1726"	"0"	"1726"	"0"	"c.1726G>C"	"r.(?)"	"p.(Gly576Arg)"	"12"	"3.8% residual activity, affects secretion & processing in expression study"
"0000478541"	"00024242"	"50"	"1727"	"0"	"1727"	"0"	"c.1727G>A"	"r.(?)"	"p.(Gly576Asp)"	"12"	"0% residual activity, affects secretion & processing in expression study"
"0000478542"	"00024242"	"70"	"1748"	"0"	"1748"	"0"	"c.1748C>T"	"r.(?)"	"p.(Ser583Phe)"	"12"	"0% residual activity, affects secretion & processing in expression study"
"0000478543"	"00024242"	"50"	"1754"	"0"	"1754"	"0"	"c.1754G>T"	"r.(?)"	"p.(Arg585Met)"	"12"	""
"0000478544"	"00024242"	"10"	"1754"	"12"	"1754"	"12"	"c.1754+12G>A"	"r.(=)"	"p.(?)"	"12i"	""
"0000478545"	"00024242"	"50"	"1760"	"0"	"1760"	"0"	"c.1760T>C"	"r.(?)"	"p.(Leu587Pro)"	"13"	""
"0000478546"	"00024242"	"50"	"1771"	"0"	"1771"	"0"	"c.1771C>T"	"r.(?)"	"p.(Arg591Trp)"	"13"	""
"0000478547"	"00024242"	"90"	"1776"	"0"	"1776"	"0"	"c.1776del"	"r.(?)"	"p.(Thr593Hisfs*5)"	"13"	""
"0000478548"	"00024242"	"70"	"1796"	"0"	"1796"	"0"	"c.1796C>A"	"r.(?)"	"p.(Ser599Tyr)"	"13"	"gives 0% residual activity in expression study"
"0000478549"	"00024242"	"50"	"1796"	"0"	"1796"	"0"	"c.1796C>T"	"r.(?)"	"p.(Ser599Phe)"	"13"	""
"0000478550"	"00024242"	"50"	"1799"	"0"	"1799"	"0"	"c.1799G>T"	"r.(?)"	"p.(Arg600Leu)"	"13"	""
"0000478551"	"00024242"	"90"	"1802"	"0"	"1802"	"0"	"c.1802C>A"	"r.(?)"	"p.(Ser601*)"	"13"	""
"0000478552"	"00024242"	"50"	"1802"	"0"	"1802"	"0"	"c.1802C>G"	"r.(?)"	"p.(Ser601Trp)"	"13"	""
"0000478553"	"00024242"	"70"	"1802"	"0"	"1802"	"0"	"c.1802C>T"	"r.(?)"	"p.(Ser601Leu)"	"13"	"0.4% residual activity, affects secretion & processing in expression study"
"0000478554"	"00024242"	"50"	"1804"	"0"	"1804"	"0"	"c.1804A>G"	"r.(?)"	"p.(Thr602Ala)"	"13"	"5.8% residual activity, affects secretion & processing in expression study"
"0000478555"	"00024242"	"50"	"1814"	"0"	"1814"	"0"	"c.1814G>A"	"r.(?)"	"p.(Gly605Asp)"	"13"	""
"0000478556"	"00024242"	"70"	"1819"	"0"	"1836"	"0"	"c.1819_1836del"	"r.(?)"	"p.(Gly607_His612del)"	"13"	""
"0000478557"	"00024242"	"50"	"1820"	"0"	"1820"	"0"	"c.1820G>A"	"r.(?)"	"p.(Gly607Asp)"	"13"	""
"0000478558"	"00024242"	"90"	"1822"	"0"	"1822"	"0"	"c.1822C>T"	"r.(?)"	"p.(Arg608*)"	"13"	"no protein on western blot"
"0000478559"	"00024242"	"90"	"1824"	"0"	"1828"	"0"	"c.1824_1828dup"	"r.(?)"	"p.(Ala610Aspfs*88)"	"13"	""
"0000478560"	"00024242"	"90"	"1826"	"0"	"1826"	"0"	"c.1826dup"	"r.(?)"	"p.(Tyr609*)"	"13"	"no protein on western blot"
"0000478561"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827del"	"r.(?)"	"p.(Tyr609*)"	"13"	"no protein on western blot"
"0000478562"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827C>G"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000478563"	"00024242"	"50"	"1832"	"0"	"1832"	"0"	"c.1832G>A"	"r.(?)"	"p.(Gly611Asp)"	"13"	""
"0000478564"	"00024242"	"70"	"1834"	"0"	"1834"	"0"	"c.1834C>T"	"r.(?)"	"p.(His612Tyr)"	"13"	"0% residual activity, affects secretion & processing in expression study"
"0000478565"	"00024242"	"50"	"1836"	"0"	"1836"	"0"	"c.1836C>G"	"r.(?)"	"p.(His612Gln)"	"13"	"decreased enzymatic activity in expression study"
"0000478566"	"00024242"	"50"	"1846"	"0"	"1846"	"0"	"c.1846G>A"	"r.(?)"	"p.(Asp616Asn)"	"13"	""
"0000478567"	"00024242"	"90"	"1848"	"0"	"1848"	"0"	"c.1848dup"	"r.(?)"	"p.(Val617Argfs*19)"	"13"	""
"0000478568"	"00024242"	"50"	"1879"	"0"	"1879"	"0"	"c.1879T>C"	"r.(?)"	"p.(Ser627Pro)"	"13"	"0.5% residual activity, affects secretion & processing in expression study"
"0000478569"	"00024242"	"50"	"1880"	"0"	"1880"	"0"	"c.1880C>T"	"r.(?)"	"p.(Ser627Phe)"	"13"	""
"0000478570"	"00024242"	"10"	"1888"	"21"	"1888"	"21"	"c.1888+21G>A"	"r.(=)"	"p.(?)"	"13i"	""
"0000478571"	"00024242"	"70"	"1905"	"0"	"1905"	"0"	"c.1905C>A"	"r.(?)"	"p.(Asn635Lys)"	"14"	"0% residual activity, affects secretion & processing in expression study"
"0000478572"	"00024242"	"70"	"1913"	"0"	"1913"	"0"	"c.1913G>T"	"r.(?)"	"p.(Gly638Val)"	"14"	""
"0000478573"	"00024242"	"50"	"1921"	"0"	"1921"	"0"	"c.1921C>G"	"r.(?)"	"p.(Leu641Val)"	"14"	""
"0000478574"	"00024242"	"50"	"1924"	"0"	"1924"	"0"	"c.1924G>T"	"r.(?)"	"p.(Val642Phe)"	"14"	""
"0000478575"	"00024242"	"90"	"1930"	"0"	"1936"	"0"	"c.1930_1936dup"	"r.(?)"	"p.(Val646Glyfs*93)"	"14"	""
"0000478576"	"00024242"	"50"	"1930"	"0"	"1930"	"0"	"c.1930G>C"	"r.(?)"	"p.(Ala644Pro)"	"14"	""
"0000478577"	"00024242"	"50"	"1933"	"0"	"1933"	"0"	"c.1933G>C"	"r.(?)"	"p.(Asp645His)"	"14"	""
"0000478578"	"00024242"	"70"	"1933"	"0"	"1933"	"0"	"c.1933G>T"	"r.(?)"	"p.(Asp645Tyr)"	"14"	"0% residual activity, affects secretion & processing in expression study"
"0000478579"	"00024242"	"70"	"1943"	"0"	"1943"	"0"	"c.1943G>A"	"r.(?)"	"p.(Gly648Asp)"	"14"	"0% residual activity, affects secretion & processing in expression study"
"0000478580"	"00024242"	"50"	"1951"	"0"	"1952"	"0"	"c.1951_1952delinsT"	"r.(?)"	"p.(Gly651Serfs*45)"	"14"	""
"0000478581"	"00024242"	"50"	"1958"	"0"	"1958"	"0"	"c.1958C>A"	"r.(?)"	"p.(Thr653Asn)"	"14"	""
"0000478582"	"00024242"	"50"	"1960"	"0"	"1960"	"0"	"c.1960T>C"	"r.(?)"	"p.(Ser654Pro)"	"14"	""
"0000478583"	"00024242"	"50"	"1962"	"0"	"1964"	"0"	"c.1962_1964del"	"r.(?)"	"p.(Glu656del)"	"14"	"0% residual activity, affects secretion & processing in expression study"
"0000478584"	"00024242"	"50"	"1978"	"0"	"1978"	"0"	"c.1978C>T"	"r.(?)"	"p.(Arg660Cys)"	"14"	""
"0000478585"	"00024242"	"70"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	"14"	""
"0000478586"	"00024242"	"50"	"1981"	"0"	"1981"	"0"	"c.1981T>G"	"r.(?)"	"p.(Trp661Gly)"	"14"	"2% residual activity, affects secretion & processing in expression study"
"0000478587"	"00024242"	"90"	"1987"	"0"	"1987"	"0"	"c.1987del"	"r.(?)"	"p.(Gln663Serfs*33)"	"14"	""
"0000478588"	"00024242"	"50"	"1993"	"0"	"1993"	"0"	"c.1993G>A"	"r.(?)"	"p.(Gly665Arg)"	"14"	""
"0000478589"	"00024242"	"50"	"2012"	"0"	"2012"	"0"	"c.2012T>A"	"r.(?)"	"p.(Met671Lys)"	"14"	""
"0000478590"	"00024242"	"50"	"2012"	"0"	"2012"	"0"	"c.2012T>G"	"r.(?)"	"p.(Met671Arg)"	"14"	""
"0000478591"	"00024242"	"70"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	"14"	""
"0000478592"	"00024242"	"70"	"2024"	"0"	"2026"	"0"	"c.2024_2026del"	"r.(?)"	"p.(Asn675del)"	"14"	""
"0000478593"	"00024242"	"10"	"2040"	"20"	"2040"	"20"	"c.2040+20A>G"	"r.(=)"	"p.(?)"	"14i"	""
"0000478594"	"00024242"	"10"	"2041"	"-64"	"2041"	"-64"	"c.2041-64G>A"	"r.(=)"	"p.(?)"	"14i"	""
"0000478595"	"00024242"	"50"	"2045"	"0"	"2045"	"0"	"c.2045A>G"	"r.(?)"	"p.(Gln682Arg)"	"15"	""
"0000478596"	"00024242"	"90"	"2055"	"0"	"2055"	"0"	"c.2055C>A"	"r.(?)"	"p.(Tyr685*)"	"15"	""
"0000478597"	"00024242"	"90"	"2066"	"0"	"2070"	"0"	"c.2066_2070dup"	"r.(?)"	"p.(Ala691Serfs*7)"	"15"	""
"0000478598"	"00024242"	"90"	"2078"	"0"	"2078"	"0"	"c.2078dup"	"r.(?)"	"p.(Ala694Glyfs*43)"	"15"	""
"0000478599"	"00024242"	"50"	"2097"	"0"	"2102"	"0"	"c.2097_2102del"	"r.(?)"	"p.(Thr700_Leu701del)"	"15"	""
"0000478600"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>T"	"r.(?)"	"p.(Arg702Leu)"	"15"	"0.4% residual activity, affects secretion & processing in expression study"
"0000478601"	"00024242"	"50"	"2114"	"0"	"2114"	"0"	"c.2114T>C"	"r.(?)"	"p.(Leu705Pro)"	"15"	""
"0000478602"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(=)"	"15"	""
"0000478603"	"00024242"	"70"	"2135"	"0"	"2135"	"0"	"c.2135T>C"	"r.(?)"	"p.(Leu712Pro)"	"15"	"0.4% residual activity, affects secretion & processing in expression study"
"0000478604"	"00024242"	"90"	"2136"	"0"	"2137"	"0"	"c.2136_2137del"	"r.(?)"	"p.(Phe713Profs*23)"	"15"	""
"0000478605"	"00024242"	"90"	"2140"	"0"	"2140"	"0"	"c.2140del"	"r.(?)"	"p.(His714Thrfs*50)"	"15"	""
"0000478606"	"00024242"	"50"	"2161"	"0"	"2161"	"0"	"c.2161dup"	"r.(?)"	"p.(Glu721Glyfs*16)"	"15"	""
"0000478607"	"00024242"	"90"	"2161"	"0"	"2161"	"0"	"c.2161G>T"	"r.(?)"	"p.(Glu721*)"	"15"	""
"0000478608"	"00024242"	"50"	"2167"	"0"	"2167"	"0"	"c.2167G>A"	"r.(?)"	"p.(Val723Met)"	"15"	""
"0000478609"	"00024242"	"50"	"2171"	"0"	"2171"	"0"	"c.2171C>A"	"r.(?)"	"p.(Ala724Asp)"	"15"	""
"0000478610"	"00024242"	"50"	"2174"	"0"	"2174"	"0"	"c.2174G>C"	"r.(?)"	"p.(Arg725Pro)"	"15"	""
"0000478611"	"00024242"	"50"	"2177"	"0"	"2177"	"0"	"c.2177C>G"	"r.(?)"	"p.(Pro726Arg)"	"15"	""
"0000478612"	"00024242"	"90"	"2185"	"0"	"2185"	"0"	"c.2185del"	"r.(?)"	"p.(Leu729Trpfs*35)"	"15"	""
"0000478613"	"00024242"	"90"	"2188"	"0"	"2188"	"0"	"c.2188G>T"	"r.(?)"	"p.(Glu730*)"	"15"	""
"0000478614"	"00024242"	"70"	"2210"	"0"	"2210"	"0"	"c.2210C>A"	"r.(?)"	"p.(Thr737Asn)"	"16"	"0% residual activity, affects secretion & processing in expression study"
"0000478615"	"00024242"	"90"	"2214"	"0"	"2214"	"0"	"c.2214G>A"	"r.(?)"	"p.(Trp738*)"	"16"	""
"0000478616"	"00024242"	"90"	"2219"	"0"	"2220"	"0"	"c.2219_2220del"	"r.(?)"	"p.(Val740Glyfs*55)"	"16"	""
"0000478617"	"00024242"	"50"	"2227"	"0"	"2227"	"0"	"c.2227C>A"	"r.(?)"	"p.(Gln743Lys)"	"16"	"4.1% residual activity, affects secretion & processing in expression study"
"0000478618"	"00024242"	"90"	"2227"	"0"	"2227"	"0"	"c.2227C>T"	"r.(?)"	"p.(Gln743*)"	"16"	""
"0000478619"	"00024242"	"70"	"2236"	"0"	"2236"	"0"	"c.2236T>C"	"r.(?)"	"p.(Trp746Arg)"	"16"	"3.5% residual activity, affects secretion & processing in expression study"
"0000478620"	"00024242"	"50"	"2236"	"0"	"2236"	"0"	"c.2236T>G"	"r.(?)"	"p.(Trp746Gly)"	"16"	"2.1% residual activity, affects secretion & processing in expression study"
"0000478621"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>A"	"r.(?)"	"p.(Trp746*)"	"16"	"0% residual activity, affects secretion & processing in expression study"
"0000478622"	"00024242"	"50"	"2242"	"0"	"2242"	"0"	"c.2242G>T"	"r.(?)"	"p.(Glu748*)"	"16"	""
"0000478623"	"00024242"	"70"	"2255"	"0"	"2257"	"0"	"c.2255_2257del"	"r.(?)"	"p.(Ile752del)"	"16"	""
"0000478624"	"00024242"	"90"	"2274"	"0"	"2274"	"0"	"c.2274dup"	"r.(?)"	"p.(Gly759Argfs*37)"	"16"	""
"0000478625"	"00024242"	"50"	"2276"	"0"	"2276"	"0"	"c.2276G>C"	"r.(?)"	"p.(Gly759Ala)"	"16"	""
"0000478626"	"00024242"	"90"	"2281"	"0"	"2281"	"0"	"c.2281delinsAT"	"r.(?)"	"p.(Ala761Ilefs*35)"	"16"	""
"0000478627"	"00024242"	"50"	"2284"	"0"	"2284"	"0"	"c.2284G>A"	"r.(?)"	"p.(Glu762Lys)"	"16"	""
"0000478628"	"00024242"	"50"	"2297"	"0"	"2297"	"0"	"c.2297A>G"	"r.(?)"	"p.(Tyr766Cys)"	"16"	""
"0000478629"	"00024242"	"90"	"2298"	"0"	"2301"	"0"	"c.2298_2301delinsAAAGTA"	"r.(?)"	"p.(Tyr766*)"	"16"	""
"0000478630"	"00024242"	"90"	"2300"	"0"	"2300"	"0"	"c.2300del"	"r.(?)"	"p.(Phe767Serfs*14)"	"16"	"no protein on western blot"
"0000478631"	"00024242"	"50"	"2303"	"0"	"2303"	"0"	"c.2303C>G"	"r.(?)"	"p.(Pro768Arg)"	"16"	""
"0000478632"	"00024242"	"50"	"2303"	"0"	"2303"	"0"	"c.2303C>T"	"r.(?)"	"p.(Pro768Leu)"	"16"	""
"0000478633"	"00024242"	"70"	"2314"	"0"	"2314"	"0"	"c.2314T>C"	"r.(?)"	"p.(Trp772Arg)"	"16"	"5% residual activity, affects secretion & processing in expression study"
"0000478634"	"00024242"	"90"	"2326"	"0"	"2326"	"0"	"c.2326C>T"	"r.(?)"	"p.(Gln776*)"	"16"	""
"0000478635"	"00024242"	"10"	"2331"	"20"	"2331"	"20"	"c.2331+20G>A"	"r.(=)"	"p.(?)"	"16i"	""
"0000478636"	"00024242"	"10"	"2331"	"24"	"2331"	"24"	"c.2331+24T>C"	"r.(=)"	"p.(?)"	"16i"	""
"0000478637"	"00024242"	"10"	"2338"	"0"	"2338"	"0"	"c.2338G>A"	"r.(?)"	"p.(Val780Ile)"	"17"	""
"0000478638"	"00024242"	"50"	"2357"	"0"	"2357"	"0"	"c.2357dup"	"r.(?)"	"p.(Pro788Thrfs*8)"	"17"	""
"0000478639"	"00024242"	"90"	"2373"	"0"	"2376"	"0"	"c.2373_2376delinsTGCTCA"	"r.(?)"	"p.(Pro793Hisfs*14)"	"17"	""
"0000478640"	"00024242"	"90"	"2380"	"0"	"2380"	"0"	"c.2380del"	"r.(?)"	"p.(Arg794Valfs*12)"	"17"	""
"0000478641"	"00024242"	"90"	"2385"	"0"	"2385"	"0"	"c.2385del"	"r.(?)"	"p.(Glu795Aspfs*11)"	"17"	""
"0000478642"	"00024242"	"50"	"2395"	"0"	"2395"	"0"	"c.2395C>G"	"r.(?)"	"p.(His799Asp)"	"17"	""
"0000478643"	"00024242"	"70"	"2407"	"0"	"2412"	"0"	"c.2407_2412del"	"r.(?)"	"p.(Gln803_Trp804del)"	"17"	""
"0000478644"	"00024242"	"90"	"2408"	"0"	"2426"	"0"	"c.2408_2426del"	"r.(?)"	"p.(Gln803Profs*39)"	"17"	""
"0000478645"	"00024242"	"90"	"2431"	"0"	"2431"	"0"	"c.2431dup"	"r.(?)"	"p.(Leu811Profs*73)"	"17"	""
"0000478646"	"00024242"	"90"	"2431"	"0"	"2431"	"0"	"c.2431del"	"r.(?)"	"p.(Leu811Trpfs*37)"	"17"	""
"0000478647"	"00024242"	"90"	"2432"	"0"	"2432"	"0"	"c.2432del"	"r.(?)"	"p.(Leu811Argfs*37)"	"17"	"no protein on western blot"
"0000478648"	"00024242"	"90"	"2439"	"0"	"2439"	"0"	"c.2439dup"	"r.(?)"	"p.(Ile814Hisfs*70)"	"17"	"no protein on western blot"
"0000478649"	"00024242"	"70"	"2456"	"0"	"2456"	"0"	"c.2456G>C"	"r.(?)"	"p.(Arg819Pro)"	"17"	"0.4% residual activity, affects secretion & processing in expression study"
"0000478650"	"00024242"	"50"	"2495"	"0"	"2496"	"0"	"c.2495_2496del"	"r.(?)"	"p.(Thr832Asnfs*51)"	"18"	""
"0000478651"	"00024242"	"90"	"2512"	"0"	"2512"	"0"	"c.2512C>T"	"r.(?)"	"p.(Gln838*)"	"18"	""
"0000478652"	"00024242"	"50"	"2528"	"0"	"2528"	"0"	"c.2528T>C"	"r.(?)"	"p.(Leu843Pro)"	"18"	""
"0000478653"	"00024242"	"70"	"2530"	"0"	"2541"	"0"	"c.2530_2541del"	"r.(?)"	"p.(Ala844_Leu847del)"	"18"	""
"0000478654"	"00024242"	"90"	"2600"	"0"	"2604"	"0"	"c.2600_2604delinsA"	"r.(?)"	"p.(Val867Glufs*19)"	"18"	""
"0000478655"	"00024242"	"50"	"2639"	"0"	"2639"	"0"	"c.2639C>A"	"r.(?)"	"p.(Ala880Asp)"	"18"	""
"0000478656"	"00024242"	"50"	"2646"	"39"	"2646"	"39"	"c.2646+39G>A"	"r.(=)"	"p.(?)"	"18i"	""
"0000478657"	"00024242"	"50"	"2647"	"-20"	"2647"	"-20"	"c.2647-20T>G"	"r.spl?"	"p.(=)"	"18i"	""
"0000478658"	"00024242"	"50"	"2647"	"-7"	"2647"	"-7"	"c.2647-7G>A"	"r.spl?"	"p.(=)"	"18i"	""
"0000478659"	"00024242"	"70"	"2702"	"0"	"2702"	"0"	"c.2702T>A"	"r.(?)"	"p.(Leu901Gln)"	"19"	"affects processing in expression study"
"0000478660"	"00024242"	"90"	"2706"	"0"	"2706"	"0"	"c.2706del"	"r.(?)"	"p.(Lys903Argfs*2)"	"19"	"no protein on western blot"
"0000478661"	"00024242"	"70"	"2707"	"0"	"2709"	"0"	"c.2707_2709del"	"r.(?)"	"p.(Lys903del)"	"19"	""
"0000478662"	"00024242"	"50"	"2738"	"0"	"2738"	"0"	"c.2738C>G"	"r.(?)"	"p.(Pro913Arg)"	"19"	""
"0000478663"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsGAC"	"r.(?)"	"p.(Gln914Argfs*30)"	"19"	"no protein on western blot"
"0000478664"	"00024242"	"50"	"2744"	"0"	"2744"	"0"	"c.2744A>C"	"r.(?)"	"p.(Gln915Pro)"	"19"	""
"0000478665"	"00024242"	"70"	"2746"	"0"	"2746"	"0"	"c.2746G>T"	"r.(?)"	"p.(Val916Phe)"	"19"	"0% residual activity, affects secretion & processing in expression study"
"0000478666"	"00024242"	"70"	"2758"	"0"	"2775"	"0"	"c.2758_2775dup"	"r.(?)"	"p.(Gly920_Asn925dup)"	"19"	""
"0000478667"	"00024242"	"50"	"2783"	"0"	"2783"	"0"	"c.2783A>G"	"r.(?)"	"p.(Tyr928Cys)"	"19"	""
"0000478668"	"00024242"	"50"	"2804"	"0"	"2804"	"0"	"c.2804T>C"	"r.(?)"	"p.(Leu935Pro)"	"20"	"0.5% residual activity, affects secretion & processing in expression study"
"0000478670"	"00024242"	"50"	"2846"	"0"	"2846"	"0"	"c.2846T>A"	"r.(?)"	"p.(Val949Asp)"	"20"	""
"0000478671"	"00024242"	"10"	"2950"	"0"	"2950"	"0"	"c.*91G>A"	"r.(?)"	"p.(?)"	"20"	""
"0000478672"	"00024242"	"10"	"3082"	"0"	"3082"	"0"	"c.*223C>T"	"r.(?)"	"p.(?)"	"20"	""
"0000478673"	"00024242"	"30"	"32"	"0"	"32"	"0"	"c.32G>A"	"r.(?)"	"p.(Arg11Gln)"	"2"	"gives 115% residual activity in expression study"
"0000478674"	"00024242"	"50"	"54"	"0"	"54"	"0"	"c.54C>T"	"r.(?)"	"p.(=)"	"2"	""
"0000478675"	"00024242"	"50"	"199"	"0"	"199"	"0"	"c.199G>A"	"r.(?)"	"p.(Asp67Asn)"	"2"	""
"0000478676"	"00024242"	"30"	"221"	"0"	"221"	"0"	"c.221G>A"	"r.(?)"	"p.(Arg74His)"	"2"	"gives 103% residual activity in expression study"
"0000478677"	"00024242"	"50"	"363"	"0"	"363"	"0"	"c.363G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000478678"	"00024242"	"50"	"510"	"0"	"510"	"0"	"c.510C>T"	"r.(?)"	"p.(=)"	"2"	""
"0000478679"	"00024242"	"30"	"532"	"0"	"532"	"0"	"c.532C>T"	"r.(?)"	"p.(Arg178Cys)"	"2"	"gives 134% residual activity in expression study"
"0000478680"	"00024242"	"50"	"546"	"24"	"546"	"24"	"c.546+24G>A"	"r.(=)"	"p.(?)"	"2i"	""
"0000478681"	"00024242"	"30"	"658"	"0"	"658"	"0"	"c.658G>T"	"r.(?)"	"p.(Val220Leu)"	"3"	"gives 100% residual activity in expression study"
"0000478682"	"00024242"	"50"	"664"	"0"	"664"	"0"	"c.664G>A"	"r.(?)"	"p.(Val222Met)"	"3"	"gives 98% residual activity in expression study"
"0000478683"	"00024242"	"50"	"858"	"6"	"858"	"6"	"c.858+6G>A"	"r.(=)"	"p.(?)"	"4i"	""
"0000478684"	"00024242"	"50"	"858"	"21"	"858"	"21"	"c.858+21C>G"	"r.(=)"	"p.(?)"	"4i"	""
"0000478685"	"00024242"	"50"	"868"	"0"	"868"	"0"	"c.868A>G"	"r.(?)"	"p.(Asn290Asp)"	"5"	"gives 71% residual activity in expression study"
"0000478686"	"00024242"	"50"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(=)"	"5"	""
"0000478687"	"00024242"	"50"	"1195"	"-44"	"1195"	"-44"	"c.1195-44C>T"	"r.(=)"	"p.(?)"	"7i"	""
"0000478688"	"00024242"	"30"	"1229"	"0"	"1229"	"0"	"c.1229C>T"	"r.(?)"	"p.(Ser410Phe)"	"8"	"gives 111% residual activity in expression study"
"0000478689"	"00024242"	"50"	"1373"	"0"	"1373"	"0"	"c.1373A>G"	"r.(?)"	"p.(Tyr458Cys)"	"9"	"45% residual activity, affects secretion & processing in expression study"
"0000478690"	"00024242"	"50"	"1551"	"49"	"1551"	"49"	"c.1551+49C>T"	"r.(=)"	"p.(?)"	"10i"	""
"0000478691"	"00024242"	"50"	"1754"	"16"	"1754"	"16"	"c.1754+16C>T"	"r.(=)"	"p.(?)"	"12i"	""
"0000478692"	"00024242"	"50"	"1830"	"0"	"1830"	"0"	"c.1830C>T"	"r.(?)"	"p.(=)"	"13"	""
"0000478693"	"00024242"	"50"	"1850"	"0"	"1850"	"0"	"c.1850T>C"	"r.(?)"	"p.(Val617Ala)"	"13"	"gives 65% residual activity in expression study"
"0000478694"	"00024242"	"50"	"1872"	"0"	"1872"	"0"	"c.1872C>T"	"r.(?)"	"p.(=)"	"13"	""
"0000478695"	"00024242"	"50"	"1886"	"0"	"1886"	"0"	"c.1886C>T"	"r.(?)"	"p.(Pro629Leu)"	"13"	"gives 49% residual activity in expression study"
"0000478696"	"00024242"	"50"	"1917"	"0"	"1917"	"0"	"c.1917G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000478697"	"00024242"	"50"	"1920"	"0"	"1920"	"0"	"c.1920T>G"	"r.(?)"	"p.(=)"	"14"	""
"0000478698"	"00024242"	"50"	"1923"	"0"	"1923"	"0"	"c.1923G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000478699"	"00024242"	"50"	"1971"	"0"	"1971"	"0"	"c.1971G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000478700"	"00024242"	"50"	"2040"	"12"	"2040"	"12"	"c.2040+12G>A"	"r.(=)"	"p.(?)"	"14i"	""
"0000478701"	"00024242"	"50"	"2040"	"20"	"2040"	"20"	"c.2040+20A>T"	"r.(=)"	"p.(?)"	"14i"	""
"0000478702"	"00024242"	"50"	"2040"	"22"	"2040"	"22"	"c.2040+22G>T"	"r.(=)"	"p.(?)"	"14i"	""
"0000478703"	"00024242"	"50"	"2061"	"0"	"2061"	"0"	"c.2061C>T"	"r.(?)"	"p.(=)"	"15"	""
"0000478704"	"00024242"	"30"	"2152"	"0"	"2152"	"0"	"c.2152G>A"	"r.(?)"	"p.(Val718Ile)"	"16"	"gives 124% residual activity in expression study"
"0000478705"	"00024242"	"50"	"2154"	"0"	"2154"	"0"	"c.2154C>T"	"r.(?)"	"p.(=)"	"15"	""
"0000478706"	"00024242"	"50"	"2190"	"-53"	"2190"	"-53"	"c.2190-53C>G"	"r.(=)"	"p.(?)"	"15i"	""
"0000478707"	"00024242"	"50"	"2724"	"0"	"2724"	"0"	"c.2724C>G"	"r.(?)"	"p.(=)"	"19"	""
"0000478708"	"00024242"	"30"	"2770"	"0"	"2770"	"0"	"c.2770T>C"	"r.(?)"	"p.(Ser924Pro)"	"19"	"167% residual activity, affects secretion in expression study"
"0000478709"	"00024242"	"50"	"2800"	"-60"	"2800"	"-60"	"c.2800-60G>A"	"r.(=)"	"p.(?)"	"19i"	""
"0000478710"	"00024242"	"50"	"2808"	"0"	"2808"	"0"	"c.2808C>T"	"r.(?)"	"p.(=)"	"20"	""
"0000478711"	"00024242"	"50"	"2862"	"0"	"2862"	"0"	"c.*3G>A"	"r.(?)"	"p.(?)"	"20"	""
"0000478712"	"00024242"	"50"	"2875"	"0"	"2875"	"0"	"c.*16T>A"	"r.(?)"	"p.(?)"	"20"	""
"0000478713"	"00024242"	"50"	"2999"	"0"	"2999"	"0"	"c.*140del"	"r.(?)"	"p.(?)"	"20"	""
"0000478714"	"00024242"	"50"	"3002"	"0"	"3002"	"0"	"c.*143C>T"	"r.(?)"	"p.(?)"	"20"	""
"0000478715"	"00024242"	"50"	"3086"	"0"	"3086"	"0"	"c.*227G>C"	"r.(?)"	"p.(?)"	"20"	""
"0000478716"	"00024242"	"50"	"3277"	"0"	"3277"	"0"	"c.*418T>C"	"r.(?)"	"p.(?)"	"20"	""
"0000478806"	"00024242"	"50"	"2999"	"0"	"2999"	"0"	"c.*140del"	"r.(?)"	"p.(?)"	"20"	""
"0000478807"	"00024242"	"50"	"3002"	"0"	"3002"	"0"	"c.*143C>T"	"r.(?)"	"p.(?)"	"20"	""
"0000478808"	"00024242"	"50"	"3012"	"0"	"3013"	"0"	"c.*153_*154insG"	"r.(?)"	"p.(?)"	"20"	""
"0000478809"	"00024242"	"50"	"2875"	"0"	"2875"	"0"	"c.*16T>A"	"r.(?)"	"p.(?)"	"20"	""
"0000478810"	"00024242"	"50"	"3086"	"0"	"3086"	"0"	"c.*227G>C"	"r.(?)"	"p.(?)"	"20"	""
"0000478811"	"00024242"	"50"	"2862"	"0"	"2862"	"0"	"c.*3G>A"	"r.(?)"	"p.(?)"	"20"	""
"0000478812"	"00024242"	"50"	"3277"	"0"	"3277"	"0"	"c.*418T>C"	"r.(?)"	"p.(?)"	"20"	""
"0000478813"	"00024242"	"50"	"1004"	"0"	"1004"	"0"	"c.1004G>A"	"r.(?)"	"p.(Gly335Glu)"	"6"	""
"0000478814"	"00024242"	"50"	"1040"	"0"	"1040"	"0"	"c.1040C>G"	"r.(?)"	"p.(Pro347Arg)"	"6"	""
"0000478815"	"00024242"	"90"	"1075"	"0"	"1075"	"0"	"c.1075G>T"	"r.(?)"	"p.(Ily359*)"	"6"	""
"0000478816"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000478817"	"00024242"	"50"	"1118"	"0"	"1118"	"0"	"c.1118T>G"	"r.(?)"	"p.(Leu373Arg)"	"7"	""
"0000478818"	"00024242"	"50"	"1171"	"0"	"1171"	"0"	"c.1171A>G"	"r.(?)"	"p.(Met391Val)"	"7"	""
"0000478819"	"00024242"	"50"	"1194"	"5"	"1194"	"5"	"c.1194+5G>A"	"r.spl?"	"p.?"	"7i"	""
"0000478820"	"00024242"	"90"	"1195"	"-2"	"1195"	"-2"	"c.1195-2A>G"	"r.spl"	"p.?"	"7i"	""
"0000478821"	"00024242"	"50"	"1195"	"-44"	"1195"	"-44"	"c.1195-44C>T"	"r.(=)"	"p.(?)"	"7i"	""
"0000478822"	"00024242"	"90"	"1209"	"0"	"1209"	"0"	"c.1209del"	"r.(?)"	"p.(Asn403Lysfs*37)"	"8"	""
"0000478823"	"00024242"	"30"	"1229"	"0"	"1229"	"0"	"c.1229C>T"	"r.(?)"	"p.(Ser410Phe)"	"8"	""
"0000478824"	"00024242"	"50"	"1310"	"0"	"1310"	"0"	"c.1310G>A"	"r.(?)"	"p.(Arg437His)"	"8"	""
"0000478825"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000478826"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000478827"	"00024242"	"90"	"1356"	"0"	"1356"	"0"	"c.1356del"	"r.(?)"	"p.(Ser454Alafs*23)"	"9"	""
"0000478828"	"00024242"	"50"	"1373"	"0"	"1373"	"0"	"c.1373A>G"	"r.(?)"	"p.(Tyr458Cys)"	"9"	""
"0000478829"	"00024242"	"70"	"1432"	"0"	"1432"	"0"	"c.1432G>A"	"r.(?)"	"p.(Gly478Arg)"	"9"	""
"0000478830"	"00024242"	"50"	"1437"	"4"	"1437"	"4"	"c.1437+4G>C"	"r.spl?"	"p.(?)"	"9i"	""
"0000478831"	"00024242"	"70"	"1437"	"0"	"1437"	"0"	"c.1437G>A"	"r.[1437g>a, 1327_1437del]"	"p.[=, Asp443_Lys479del]"	"9"	""
"0000478832"	"00024242"	"90"	"1441"	"0"	"1441"	"0"	"c.1441del"	"r.(?)"	"p.(Trp481Glyfs*39)"	"10"	""
"0000478833"	"00024242"	"90"	"1442"	"0"	"1442"	"0"	"c.1442G>A"	"r.(?)"	"p.(Trp481*)"	"10"	""
"0000478834"	"00024242"	"70"	"1466"	"0"	"1466"	"0"	"c.1466A>G"	"r.(?)"	"p.(Asp489Gly)"	"10"	""
"0000478835"	"00024242"	"90"	"1496"	"0"	"1496"	"0"	"c.1496G>A"	"r.(?)"	"p.(Trp499*)"	"10"	""
"0000478836"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	""
"0000478837"	"00024242"	"50"	"1551"	"49"	"1551"	"49"	"c.1551+49C>T"	"r.(=)"	"p.(?)"	"10i"	""
"0000478838"	"00024242"	"70"	"1556"	"0"	"1556"	"0"	"c.1556T>C"	"r.(?)"	"p.(Met519Thr)"	"11"	""
"0000478839"	"00024242"	"70"	"1585"	"0"	"1586"	"0"	"c.1585_1586delinsGT"	"r.(?)"	"p.(Ser529Val)"	"11"	""
"0000478840"	"00024242"	"90"	"1591"	"0"	"1591"	"0"	"c.1591dup"	"r.(?)"	"p.(Asp531Glyfs*7)"	"11"	""
"0000478841"	"00024242"	"90"	"1636"	"5"	"1636"	"5"	"c.1636+5G>C"	"r.1636_1637ins[gucac;1636+6_1637-1]"	"p.Gly546fs*145"	"11i"	""
"0000478842"	"00024242"	"70"	"1645"	"0"	"1645"	"0"	"c.1645G>A"	"r.(?)"	"p.(Gly549Arg)"	"12"	""
"0000478843"	"00024242"	"90"	"1654"	"0"	"1654"	"0"	"c.1654del"	"r.(?)"	"p.(Leu552Serfs*26)"	"12"	""
"0000478844"	"00024242"	"90"	"1687"	"0"	"1687"	"0"	"c.1687C>T"	"r.(?)"	"p.(Gln563*)"	"12"	""
"0000478845"	"00024242"	"50"	"1719"	"0"	"1719"	"0"	"c.1719C>A"	"r.(?)"	"p.(Asn573Lys)"	"12"	""
"0000478846"	"00024242"	"70"	"1726"	"0"	"1726"	"0"	"c.1726G>C"	"r.(?)"	"p.(Gly576Arg)"	"12"	""
"0000478847"	"00024242"	"50"	"1754"	"16"	"1754"	"16"	"c.1754+16C>T"	"r.(=)"	"p.(?)"	"12i"	""
"0000478848"	"00024242"	"90"	"1754"	"1"	"1754"	"1"	"c.1754+1G>A"	"r.spl"	"p.?"	"12i"	""
"0000478849"	"00024242"	"90"	"1754"	"2"	"1754"	"2"	"c.1754+2T>A"	"r.spl"	"p.?"	"12i"	""
"0000478850"	"00024242"	"50"	"1771"	"0"	"1771"	"0"	"c.1771C>T"	"r.(?)"	"p.(Arg591Trp)"	"13"	""
"0000478851"	"00024242"	"50"	"1830"	"0"	"1830"	"0"	"c.1830C>T"	"r.(?)"	"p.(=)"	"13"	""
"0000478852"	"00024242"	"50"	"1832"	"0"	"1832"	"0"	"c.1832G>A"	"r.(?)"	"p.(Gly611Asp)"	"13"	""
"0000478853"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000478854"	"00024242"	"90"	"1848"	"0"	"1848"	"0"	"c.1848dup"	"r.(?)"	"p.(Val617Argfs*19)"	"13"	""
"0000478855"	"00024242"	"50"	"1850"	"0"	"1850"	"0"	"c.1850T>C"	"r.(?)"	"p.(Val617Ala)"	"13"	""
"0000478856"	"00024242"	"70"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	"13"	""
"0000478857"	"00024242"	"50"	"1872"	"0"	"1872"	"0"	"c.1872C>T"	"r.(?)"	"p.(=)"	"13"	""
"0000478858"	"00024242"	"50"	"1886"	"0"	"1886"	"0"	"c.1886C>T"	"r.(?)"	"p.(Pro629Leu)"	"13"	""
"0000478859"	"00024242"	"70"	"1913"	"0"	"1913"	"0"	"c.1913G>T"	"r.(?)"	"p.(Gly638Val)"	"14"	""
"0000478860"	"00024242"	"50"	"1917"	"0"	"1917"	"0"	"c.1917G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000478861"	"00024242"	"50"	"1920"	"0"	"1920"	"0"	"c.1920T>G"	"r.(?)"	"p.(=)"	"14"	""
"0000478862"	"00024242"	"50"	"1923"	"0"	"1923"	"0"	"c.1923G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000478863"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000478864"	"00024242"	"90"	"1930"	"0"	"1936"	"0"	"c.1930_1936dup"	"r.(?)"	"p.(Val646Glyfs*93)"	"14"	""
"0000478865"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000478866"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000478867"	"00024242"	"50"	"1971"	"0"	"1971"	"0"	"c.1971G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000478868"	"00024242"	"50"	"199"	"0"	"199"	"0"	"c.199G>A"	"r.(?)"	"p.(Asp67Asn)"	"2"	""
"0000478869"	"00024242"	"50"	"2040"	"12"	"2040"	"12"	"c.2040+12G>A"	"r.(=)"	"p.(?)"	"14i"	""
"0000478870"	"00024242"	"50"	"2040"	"20"	"2040"	"20"	"c.2040+20A>T"	"r.(=)"	"p.(?)"	"14i"	""
"0000478871"	"00024242"	"50"	"2040"	"22"	"2040"	"22"	"c.2040+22G>T"	"r.(=)"	"p.(?)"	"14i"	""
"0000478872"	"00024242"	"50"	"2041"	"-61"	"2041"	"-61"	"c.2041-61del"	"r.(=)"	"p.(?)"	"14i"	""
"0000478873"	"00024242"	"50"	"2061"	"0"	"2061"	"0"	"c.2061C>T"	"r.(?)"	"p.(=)"	"15"	""
"0000478874"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>T"	"r.(?)"	"p.(Arg702Leu)"	"15"	""
"0000478875"	"00024242"	"30"	"2152"	"0"	"2152"	"0"	"c.2152G>A"	"r.(?)"	"p.(Val718Ile)"	"16"	""
"0000478876"	"00024242"	"50"	"2154"	"0"	"2154"	"0"	"c.2154C>T"	"r.(?)"	"p.(=)"	"15"	""
"0000478877"	"00024242"	"50"	"2189"	"3"	"2189"	"3"	"c.2189+3G>C"	"r.spl?"	"p.?"	"15i"	""
"0000478878"	"00024242"	"50"	"2190"	"-53"	"2190"	"-53"	"c.2190-53C>G"	"r.(=)"	"p.(?)"	"15i"	""
"0000478879"	"00024242"	"30"	"221"	"0"	"221"	"0"	"c.221G>A"	"r.(?)"	"p.(Arg74His)"	"2"	""
"0000478880"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000478881"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000478882"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000478883"	"00024242"	"90"	"2300"	"0"	"2300"	"0"	"c.2300del"	"r.(?)"	"p.(Phe767Serfs*14)"	"16"	""
"0000478884"	"00024242"	"90"	"2373"	"0"	"2376"	"0"	"c.2373_2376delinsTGCTCA"	"r.(?)"	"p.(Pro793Hisfs*14)"	"17"	""
"0000478885"	"00024242"	"90"	"2408"	"0"	"2426"	"0"	"c.2408_2426del"	"r.(?)"	"p.(Gln803Profs*39)"	"17"	""
"0000478886"	"00024242"	"90"	"2439"	"0"	"2439"	"0"	"c.2439dup"	"r.(?)"	"p.(Ile814Hisfs*70)"	"17"	""
"0000478887"	"00024242"	"70"	"2456"	"0"	"2456"	"0"	"c.2456G>C"	"r.(?)"	"p.(Arg819Pro)"	"17"	""
"0000478888"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000478889"	"00024242"	"90"	"2481"	"2"	"2481"	"2"	"c.2481+2T>C"	"r.spl"	"p.?"	"17i"	""
"0000478890"	"00024242"	"50"	"2528"	"0"	"2528"	"0"	"c.2528T>C"	"r.(?)"	"p.(Leu843Pro)"	"18"	""
"0000478891"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000478892"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000478893"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000478894"	"00024242"	"50"	"266"	"0"	"266"	"0"	"c.266G>A"	"r.(?)"	"p.(Arg89His)"	"2"	""
"0000478895"	"00024242"	"90"	"2706"	"0"	"2706"	"0"	"c.2706del"	"r.(?)"	"p.(Lys903Argfs*2)"	"19"	""
"0000478896"	"00024242"	"50"	"2724"	"0"	"2724"	"0"	"c.2724C>G"	"r.(?)"	"p.(=)"	"19"	""
"0000478897"	"00024242"	"70"	"2758"	"0"	"2775"	"0"	"c.2758_2775dup"	"r.(?)"	"p.(Gly920_Asn925dup)"	"19"	""
"0000478898"	"00024242"	"30"	"2770"	"0"	"2770"	"0"	"c.2770T>C"	"r.(?)"	"p.(Ser924Pro)"	"19"	""
"0000478899"	"00024242"	"50"	"2783"	"0"	"2783"	"0"	"c.2783A>G"	"r.(?)"	"p.(Tyr928Cys)"	"19"	""
"0000478900"	"00024242"	"50"	"2800"	"-60"	"2800"	"-60"	"c.2800-60G>A"	"r.(=)"	"p.(?)"	"19i"	""
"0000478901"	"00024242"	"50"	"2808"	"0"	"2808"	"0"	"c.2808C>T"	"r.(?)"	"p.(=)"	"20"	""
"0000478902"	"00024242"	"90"	"2815"	"0"	"2816"	"0"	"c.2815_2816del"	"r.(?)"	"p.(Val939Leufs*78)"	"20"	""
"0000478903"	"00024242"	"30"	"32"	"0"	"32"	"0"	"c.32G>A"	"r.(?)"	"p.(Arg11Gln)"	"2"	""
"0000478904"	"00024242"	"90"	"352"	"0"	"352"	"0"	"c.352C>T"	"r.(?)"	"p.(Gln118*)"	"2"	""
"0000478905"	"00024242"	"50"	"363"	"0"	"363"	"0"	"c.363G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000478906"	"00024242"	"70"	"460"	"0"	"465"	"0"	"c.460_465del"	"r.(?)"	"p.(Arg154_Thr155del)"	"2"	""
"0000478907"	"00024242"	"50"	"510"	"0"	"510"	"0"	"c.510C>T"	"r.(?)"	"p.(=)"	"2"	""
"0000478908"	"00024242"	"30"	"532"	"0"	"532"	"0"	"c.532C>T"	"r.(?)"	"p.(Arg178Cys)"	"2"	""
"0000478909"	"00024242"	"50"	"546"	"24"	"546"	"24"	"c.546+24G>A"	"r.(=)"	"p.(?)"	"2i"	""
"0000478910"	"00024242"	"50"	"54"	"0"	"54"	"0"	"c.54C>T"	"r.(?)"	"p.(=)"	"2"	""
"0000478911"	"00024242"	"50"	"572"	"0"	"572"	"0"	"c.572A>G"	"r.(?)"	"p.(Tyr191Cys)"	"3"	""
"0000478912"	"00024242"	"30"	"658"	"0"	"658"	"0"	"c.658G>T"	"r.(?)"	"p.(Val220Leu)"	"3"	""
"0000478913"	"00024242"	"50"	"664"	"0"	"664"	"0"	"c.664G>A"	"r.(?)"	"p.(Val222Met)"	"3"	""
"0000478914"	"00024242"	"50"	"671"	"0"	"671"	"0"	"c.671G>C"	"r.(?)"	"p.(Arg224Pro)"	"3"	""
"0000478915"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>A"	"r.spl"	"p.?"	"3i"	""
"0000478916"	"00024242"	"90"	"742"	"0"	"742"	"0"	"c.742del"	"r.(?)"	"p.(Leu248Profs*20)"	"4"	""
"0000478917"	"00024242"	"90"	"766"	"0"	"785"	"0"	"c.766_785delinsC"	"r.[766_785delinsc]"	"p.(Tyr256Argfs*6)"	"4"	""
"0000478918"	"00024242"	"50"	"858"	"17"	"858"	"23"	"c.858+17_858+23del"	"r.(=)"	"p.(?)"	"4i"	""
"0000478919"	"00024242"	"50"	"858"	"17"	"858"	"23"	"c.858+17_858+23del"	"r.(=)"	"p.(?)"	"4i"	""
"0000478920"	"00024242"	"50"	"858"	"17"	"858"	"23"	"c.858+17_858+23dup"	"r.(=)"	"p.(?)"	"4i"	""
"0000478921"	"00024242"	"50"	"858"	"20"	"858"	"20"	"c.858+20dup"	"r.(=)"	"p.(?)"	"4i"	""
"0000478922"	"00024242"	"50"	"858"	"21"	"858"	"21"	"c.858+21C>G"	"r.(=)"	"p.(?)"	"4i"	""
"0000478923"	"00024242"	"50"	"858"	"37"	"858"	"37"	"c.858+37C>T"	"r.(=)"	"p.(?)"	"4i"	""
"0000478924"	"00024242"	"50"	"858"	"6"	"858"	"6"	"c.858+6G>A"	"r.(=)"	"p.(?)"	"4i"	""
"0000478925"	"00024242"	"50"	"868"	"0"	"868"	"0"	"c.868A>G"	"r.(?)"	"p.(Asn290Asp)"	"5"	""
"0000478926"	"00024242"	"70"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000478927"	"00024242"	"70"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000478928"	"00024242"	"50"	"915"	"0"	"915"	"0"	"c.915G>A"	"r.(?)"	"p.(=)"	"5"	""
"0000478929"	"00024242"	"50"	"917"	"0"	"917"	"0"	"c.917C>T"	"r.(?)"	"p.(Ser306Leu)"	"5"	""
"0000478930"	"00024242"	"50"	"953"	"0"	"953"	"0"	"c.953T>C"	"r.(?)"	"p.(Met318Thr)"	"5"	""
"0000478931"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12G>A"	"r.(=)"	"p.(?)"	"5i"	""
"0000478932"	"00024242"	"10"	"956"	"-84"	"956"	"-84"	"c.956-84C>T"	"r.(=)"	"p.(?)"	"5i"	""
"0000478933"	"00024242"	"50"	"-82"	"0"	"-82"	"0"	"c.-82G>C"	"r.(?)"	"p.(?)"	"1"	""
"0000478934"	"00024242"	"10"	"3082"	"0"	"3082"	"0"	"c.*223C>T"	"r.(?)"	"p.(?)"	"20"	""
"0000478935"	"00024242"	"10"	"2950"	"0"	"2950"	"0"	"c.*91G>A"	"r.(?)"	"p.(?)"	"20"	""
"0000478936"	"00024242"	"50"	"1075"	"13"	"1075"	"13"	"c.1075+13C>T"	"r.(=)"	"p.(?)"	"6i"	""
"0000478937"	"00024242"	"50"	"1134"	"0"	"1134"	"0"	"c.1134C>G"	"r.(?)"	"p.(Tyr378*)"	"7"	""
"0000478938"	"00024242"	"50"	"1190"	"0"	"1190"	"0"	"c.1190C>T"	"r.(?)"	"p.(Pro397Leu)"	"7"	""
"0000478939"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(=)"	"8"	""
"0000478940"	"00024242"	"50"	"1204"	"0"	"1204"	"0"	"c.1204T>C"	"r.(?)"	"p.(Trp402Arg)"	"8"	""
"0000478941"	"00024242"	"30"	"1286"	"0"	"1286"	"0"	"c.1286A>G"	"r.(?)"	"p.(Gln429Arg)"	"8"	""
"0000478942"	"00024242"	"50"	"1326"	"5"	"1326"	"5"	"c.1326+5G>A"	"r.spl?"	"p.?"	"8i"	""
"0000478943"	"00024242"	"10"	"1327"	"-18"	"1327"	"-18"	"c.1327-18A>G"	"r.(=)"	"p.(?)"	"8i"	""
"0000478944"	"00024242"	"50"	"1370"	"0"	"1370"	"0"	"c.1370C>A"	"r.(?)"	"p.(Pro457His)"	"9"	""
"0000478945"	"00024242"	"90"	"1371"	"0"	"1371"	"0"	"c.1371del"	"r.(?)"	"p.(Tyr458Thrfs*19)"	"9"	""
"0000478946"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(?)"	"p.(=)"	"9"	""
"0000478947"	"00024242"	"50"	"1381"	"0"	"1381"	"0"	"c.1381G>A"	"r.(?)"	"p.(Gly461Ser)"	"9"	""
"0000478948"	"00024242"	"10"	"1438"	"-19"	"1438"	"-19"	"c.1438-19G>C"	"r.(=)"	"p.(?)"	"9i"	""
"0000478949"	"00024242"	"50"	"1438"	"-1"	"1438"	"-1"	"c.1438-1G>T"	"r.spl"	"p.?"	"9i"	""
"0000478950"	"00024242"	"50"	"1445"	"0"	"1445"	"0"	"c.1445C>G"	"r.(?)"	"p.(Pro482Arg)"	"10"	""
"0000478951"	"00024242"	"50"	"1448"	"0"	"1448"	"0"	"c.1448G>T"	"r.(?)"	"p.(Gly483Val)"	"10"	""
"0000478952"	"00024242"	"50"	"1468"	"0"	"1468"	"0"	"c.1468T>C"	"r.(?)"	"p.(Phe490Leu)"	"10"	""
"0000478953"	"00024242"	"50"	"1551"	"42"	"1551"	"42"	"c.1551+42G>A"	"r.(=)"	"p.(?)"	"10i"	""
"0000478954"	"00024242"	"10"	"1551"	"49"	"1551"	"49"	"c.1551+49C>A"	"r.(=)"	"p.(?)"	"10i"	""
"0000478955"	"00024242"	"50"	"1564"	"0"	"1564"	"0"	"c.1564C>T"	"r.(?)"	"p.(Pro522Ser)"	"11"	""
"0000478956"	"00024242"	"50"	"1568"	"0"	"1568"	"0"	"c.1568C>A"	"r.(?)"	"p.(Ser523Tyr)"	"11"	""
"0000478957"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(=)"	"11"	""
"0000478958"	"00024242"	"50"	"1672"	"0"	"1672"	"0"	"c.1672T>A"	"r.(?)"	"p.(Cys558Ser)"	"12"	""
"0000478959"	"00024242"	"50"	"1717"	"0"	"1717"	"0"	"c.1717A>C"	"r.(?)"	"p.(Asn573His)"	"12"	""
"0000478960"	"00024242"	"50"	"1724"	"0"	"1724"	"0"	"c.1724A>G"	"r.(?)"	"p.(Tyr575Cys)"	"12"	""
"0000478961"	"00024242"	"10"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	"12"	""
"0000478962"	"00024242"	"50"	"1727"	"0"	"1727"	"0"	"c.1727G>A"	"r.(?)"	"p.(Gly576Asp)"	"12"	""
"0000478963"	"00024242"	"10"	"1754"	"12"	"1754"	"12"	"c.1754+12G>A"	"r.(=)"	"p.(?)"	"12i"	""
"0000478964"	"00024242"	"50"	"1804"	"0"	"1804"	"0"	"c.1804A>G"	"r.(?)"	"p.(Thr602Ala)"	"13"	""
"0000478965"	"00024242"	"50"	"186"	"0"	"196"	"0"	"c.186_196dup"	"r.(?)"	"p.(Arg66Hisfs*80)"	"2"	""
"0000478966"	"00024242"	"50"	"1879"	"0"	"1879"	"0"	"c.1879T>C"	"r.(?)"	"p.(Ser627Pro)"	"13"	""
"0000478967"	"00024242"	"10"	"1888"	"21"	"1888"	"21"	"c.1888+21G>A"	"r.(=)"	"p.(?)"	"13i"	""
"0000478968"	"00024242"	"50"	"1889"	"-27"	"2040"	"23"	"c.1889-27_2040+23del"	"r.(1889_2040del)"	"p.(Glu630_Leu680delfs*56)"	"13i_14i"	""
"0000478969"	"00024242"	"50"	"1951"	"0"	"1952"	"0"	"c.1951_1952delinsT"	"r.(?)"	"p.(Gly651Serfs*45)"	"14"	""
"0000478970"	"00024242"	"50"	"1962"	"0"	"1964"	"0"	"c.1962_1964del"	"r.(?)"	"p.(Glu656del)"	"14"	""
"0000478971"	"00024242"	"50"	"1981"	"0"	"1981"	"0"	"c.1981T>G"	"r.(?)"	"p.(Trp661Gly)"	"14"	""
"0000478972"	"00024242"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.(?)"	"p.0?"	"2"	""
"0000478973"	"00024242"	"10"	"2040"	"20"	"2040"	"20"	"c.2040+20A>G"	"r.(=)"	"p.(?)"	"14i"	""
"0000478974"	"00024242"	"10"	"2041"	"-64"	"2041"	"-64"	"c.2041-64G>A"	"r.(=)"	"p.(?)"	"14i"	""
"0000478975"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	"15"	""
"0000478976"	"00024242"	"50"	"2097"	"0"	"2102"	"0"	"c.2097_2102del"	"r.(?)"	"p.(Thr700_Leu701del)"	"15"	""
"0000478977"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(=)"	"15"	""
"0000478978"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(=)"	"15"	""
"0000478979"	"00024242"	"50"	"2161"	"0"	"2161"	"0"	"c.2161dup"	"r.(?)"	"p.(Glu721Glyfs*16)"	"15"	""
"0000478980"	"00024242"	"90"	"2161"	"0"	"2161"	"0"	"c.2161G>T"	"r.(?)"	"p.(Glu721*)"	"15"	""
"0000478981"	"00024242"	"50"	"2189"	"1"	"2189"	"1"	"c.2189+1G>A"	"r.spl"	"p.?"	"15i"	""
"0000478982"	"00024242"	"50"	"2227"	"0"	"2227"	"0"	"c.2227C>A"	"r.(?)"	"p.(Gln743Lys)"	"16"	""
"0000478983"	"00024242"	"50"	"2236"	"0"	"2236"	"0"	"c.2236T>G"	"r.(?)"	"p.(Trp746Gly)"	"16"	""
"0000478984"	"00024242"	"50"	"2242"	"0"	"2242"	"0"	"c.2242G>T"	"r.(?)"	"p.(Glu748*)"	"16"	""
"0000478985"	"00024242"	"50"	"2284"	"0"	"2284"	"0"	"c.2284G>A"	"r.(?)"	"p.(Glu762Lys)"	"16"	""
"0000478986"	"00024242"	"10"	"2331"	"20"	"2331"	"20"	"c.2331+20G>A"	"r.(=)"	"p.(?)"	"16i"	""
"0000478987"	"00024242"	"10"	"2331"	"24"	"2331"	"24"	"c.2331+24T>C"	"r.(=)"	"p.(?)"	"16i"	""
"0000478988"	"00024242"	"10"	"2338"	"0"	"2338"	"0"	"c.2338G>A"	"r.(?)"	"p.(Val780Ile)"	"17"	""
"0000478989"	"00024242"	"50"	"2357"	"0"	"2357"	"0"	"c.2357dup"	"r.(?)"	"p.(Pro788Thrfs*8)"	"17"	""
"0000478990"	"00024242"	"50"	"2395"	"0"	"2395"	"0"	"c.2395C>G"	"r.(?)"	"p.(His799Asp)"	"17"	""
"0000478991"	"00024242"	"10"	"2446"	"0"	"2446"	"0"	"c.2446G>A"	"r.(?)"	"p.(Val816Ile)"	"17"	""
"0000478992"	"00024242"	"50"	"2481"	"1"	"2481"	"1"	"c.2481+1G>A"	"r.spl"	"p.?"	"17i"	""
"0000478993"	"00024242"	"90"	"2481"	"2"	"2481"	"2"	"c.2481+2T>C"	"r.spl"	"p.?"	"17i"	""
"0000478994"	"00024242"	"50"	"2495"	"0"	"2496"	"0"	"c.2495_2496del"	"r.(?)"	"p.(Thr832Asnfs*51)"	"18"	""
"0000478995"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(=)"	"18"	""
"0000478996"	"00024242"	"50"	"2646"	"39"	"2646"	"39"	"c.2646+39G>A"	"r.(=)"	"p.(?)"	"18i"	""
"0000478997"	"00024242"	"30"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	""
"0000478998"	"00024242"	"10"	"2780"	"0"	"2780"	"0"	"c.2780C>T"	"r.(?)"	"p.(Thr927Ile)"	"19"	""
"0000478999"	"00024242"	"50"	"2804"	"0"	"2804"	"0"	"c.2804T>C"	"r.(?)"	"p.(Leu935Pro)"	"20"	""
"0000479000"	"00024242"	"50"	"307"	"0"	"307"	"0"	"c.307T>C"	"r.(?)"	"p.(Cys103Arg)"	"2"	""
"0000479001"	"00024242"	"50"	"322"	"0"	"322"	"0"	"c.322T>G"	"r.(?)"	"p.(Cys108Gly)"	"2"	""
"0000479002"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(=)"	"2"	""
"0000479003"	"00024242"	"30"	"447"	"0"	"447"	"0"	"c.447G>A"	"r.(?)"	"p.(=)"	"2"	""
"0000479004"	"00024242"	"50"	"483"	"0"	"483"	"0"	"c.483dup"	"r.(?)"	"p.(Lys162Glnfs*15)"	"2"	""
"0000479005"	"00024242"	"50"	"546"	"45"	"546"	"45"	"c.546+45G>C"	"r.(=)"	"p.(?)"	"2i"	""
"0000479006"	"00024242"	"10"	"547"	"-4"	"547"	"-4"	"c.547-4C>G"	"r.spl?"	"p.(?)"	"2i"	""
"0000479007"	"00024242"	"50"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	"3"	""
"0000479008"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(=)"	"3"	""
"0000479009"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	"3"	""
"0000479010"	"00024242"	"10"	"693"	"-49"	"693"	"-49"	"c.693-49C>T"	"r.(=)"	"p.(?)"	"3i"	""
"0000479011"	"00024242"	"50"	"701"	"0"	"701"	"0"	"c.701C>G"	"r.(?)"	"p.(Thr234Arg)"	"4"	""
"0000479012"	"00024242"	"50"	"725"	"0"	"725"	"0"	"c.725C>T"	"r.(?)"	"p.(Ala242Val)"	"4"	""
"0000479013"	"00024242"	"50"	"743"	"0"	"743"	"0"	"c.743T>C"	"r.(?)"	"p.(Leu248Pro)"	"4"	""
"0000479014"	"00024242"	"50"	"768"	"0"	"768"	"0"	"c.768dup"	"r.(?)"	"p.(Ile257Tyrfs*73)"	"4"	""
"0000479015"	"00024242"	"50"	"776"	"0"	"776"	"0"	"c.776G>T"	"r.(?)"	"p.(Gly259Val)"	"4"	""
"0000479016"	"00024242"	"30"	"852"	"0"	"852"	"0"	"c.852G>A"	"r.(?)"	"p.(=)"	"4"	""
"0000479017"	"00024242"	"10"	"858"	"30"	"858"	"30"	"c.858+30T>C"	"r.(=)"	"p.(?)"	"4i"	""
"0000479018"	"00024242"	"50"	"858"	"5"	"858"	"6"	"c.858+5_858+6insN[7]"	"r.spl?"	"p.?"	"4i"	""
"0000479019"	"00024242"	"50"	"872"	"0"	"872"	"0"	"c.872T>A"	"r.(?)"	"p.(Leu291His)"	"5"	""
"0000479020"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(=)"	"5"	""
"0000479021"	"00024242"	"50"	"929"	"0"	"929"	"0"	"c.929T>G"	"r.(?)"	"p.(Val310Gly)"	"5"	""
"0000479022"	"00024242"	"50"	"947"	"0"	"947"	"0"	"c.947A>T"	"r.(?)"	"p.(Asn316Ile)"	"5"	""
"0000479023"	"00024242"	"50"	"955"	"2"	"955"	"2"	"c.955+2T>G"	"r.spl"	"p.?"	"5i"	""
"0000479024"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479025"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479026"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479027"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479028"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479029"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479030"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479031"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479032"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479033"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479034"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479035"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479036"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479037"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479038"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479039"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479040"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479041"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479042"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479043"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479044"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479045"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479046"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479047"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000479048"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl?"	"p.(=)"	"6i"	""
"0000479049"	"00024242"	"50"	"1099"	"0"	"1099"	"0"	"c.1099T>C"	"r.(?)"	"p.(Trp367Arg)"	"7"	""
"0000479050"	"00024242"	"70"	"1124"	"0"	"1124"	"0"	"c.1124G>T"	"r.(?)"	"p.(Arg375Leu)"	"7"	""
"0000479051"	"00024242"	"90"	"1157"	"0"	"1157"	"0"	"c.1157dup"	"r.(?)"	"p.(Val387Glyfs*119)"	"7"	""
"0000479052"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000479053"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000479054"	"00024242"	"90"	"1195"	"-2"	"1195"	"-2"	"c.1195-2A>G"	"r.spl"	"p.?"	"7i"	""
"0000479055"	"00024242"	"90"	"1209"	"0"	"1209"	"0"	"c.1209del"	"r.(?)"	"p.(Asn403Lysfs*37)"	"8"	""
"0000479056"	"00024242"	"50"	"1214"	"0"	"1214"	"0"	"c.1214T>C"	"r.(?)"	"p.(Leu405Pro)"	"8"	""
"0000479057"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000479058"	"00024242"	"90"	"1327"	"-2"	"1327"	"-2"	"c.1327-2A>G"	"r.spl"	"p.?"	"8i"	""
"0000479059"	"00024242"	"90"	"1327"	"-2"	"1327"	"-2"	"c.1327-2A>G"	"r.spl"	"p.?"	"8i"	""
"0000479060"	"00024242"	"70"	"1364"	"0"	"1364"	"0"	"c.1364A>T"	"r.(?)"	"p.(Tyr455Phe)"	"9"	""
"0000479061"	"00024242"	"70"	"1377"	"0"	"1379"	"0"	"c.1377_1379del"	"r.(?)"	"p.(Asp459del)"	"9"	""
"0000479062"	"00024242"	"90"	"1437"	"1"	"1437"	"1"	"c.1437+1G>A"	"r.spl"	"p.?"	"9i"	""
"0000479063"	"00024242"	"70"	"1437"	"0"	"1437"	"0"	"c.1437G>A"	"r.[1437g>a, 1327_1437del]"	"p.[=, Asp443_Lys479del]"	"9"	""
"0000479064"	"00024242"	"70"	"1437"	"0"	"1437"	"0"	"c.1437G>A"	"r.[1437g>a, 1327_1437del]"	"p.[=, Asp443_Lys479del]"	"9"	""
"0000479065"	"00024242"	"90"	"148"	"0"	"859"	"-11"	"c.148_859-11del"	"r.spl?"	"p.(Glu50_Profs*27)"	"2_4i"	""
"0000479066"	"00024242"	"50"	"1540"	"0"	"1540"	"0"	"c.1540G>C"	"r.(?)"	"p.(Gly514Arg)"	"10"	""
"0000479067"	"00024242"	"70"	"1552"	"-3"	"1552"	"-3"	"c.1552-3C>G"	"r.[=, 1551_1552ins[1552-30_1552-4;gag], 1551_1552ins[1551+1_1552-4;gag]]"	"p.[=, Val480_Ile517del, Ile517_Asp518insSerHisLeuProAlaAlaLeuLeuLeuGln]"	"10i"	""
"0000479068"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000479069"	"00024242"	"70"	"1585"	"0"	"1586"	"0"	"c.1585_1586delinsGT"	"r.(?)"	"p.(Ser529Val)"	"11"	""
"0000479070"	"00024242"	"50"	"1626"	"0"	"1626"	"0"	"c.1626C>G"	"r.(?)"	"p.(=)"	"11"	""
"0000479071"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000479072"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000479073"	"00024242"	"90"	"1637"	"-2"	"1637"	"-2"	"c.1637-2A>G"	"r.spl"	"p.?"	"11i"	""
"0000479074"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479075"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479076"	"00024242"	"70"	"1696"	"0"	"1696"	"0"	"c.1696T>C"	"r.(?)"	"p.(Ser566Pro)"	"12"	""
"0000479077"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000479078"	"00024242"	"50"	"1820"	"0"	"1820"	"0"	"c.1820G>A"	"r.(?)"	"p.(Gly607Asp)"	"13"	""
"0000479079"	"00024242"	"90"	"1824"	"0"	"1828"	"0"	"c.1824_1828dup"	"r.(?)"	"p.(Ala610Aspfs*88)"	"13"	""
"0000479080"	"00024242"	"50"	"1832"	"0"	"1832"	"0"	"c.1832G>A"	"r.(?)"	"p.(Gly611Asp)"	"13"	""
"0000479081"	"00024242"	"70"	"1833"	"0"	"1847"	"0"	"c.1833_1847delinsACGGGGTAT"	"r.(?)"	"p.(His612_Asp616delinsArgGlyIle)"	"13"	""
"0000479082"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000479083"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000479084"	"00024242"	"90"	"1888"	"1"	"1888"	"1"	"c.1888+1G>A"	"r.spl"	"p.?"	"13i"	""
"0000479085"	"00024242"	"70"	"1905"	"0"	"1905"	"0"	"c.1905C>A"	"r.(?)"	"p.(Asn635Lys)"	"14"	""
"0000479086"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479087"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479088"	"00024242"	"90"	"1930"	"0"	"1936"	"0"	"c.1930_1936dup"	"r.(?)"	"p.(Val646Glyfs*93)"	"14"	""
"0000479089"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479090"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479091"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479092"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479093"	"00024242"	"50"	"1933"	"0"	"1933"	"0"	"c.1933G>C"	"r.(?)"	"p.(Asp645His)"	"14"	""
"0000479094"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479095"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479096"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479097"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479098"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479099"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479100"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479101"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479102"	"00024242"	"90"	"1987"	"0"	"1987"	"0"	"c.1987del"	"r.(?)"	"p.(Gln663Serfs*33)"	"14"	""
"0000479103"	"00024242"	"90"	"1"	"0"	"1"	"0"	"c.1A>G"	"r.(?)"	"p.0?"	"2"	""
"0000479104"	"00024242"	"70"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	"14"	""
"0000479105"	"00024242"	"70"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	"14"	""
"0000479106"	"00024242"	"50"	"2045"	"0"	"2045"	"0"	"c.2045A>G"	"r.(?)"	"p.(Gln682Arg)"	"15"	""
"0000479107"	"00024242"	"90"	"2078"	"0"	"2078"	"0"	"c.2078dup"	"r.(?)"	"p.(Ala694Glyfs*43)"	"15"	""
"0000479108"	"00024242"	"90"	"2185"	"0"	"2185"	"0"	"c.2185del"	"r.(?)"	"p.(Leu729Trpfs*35)"	"15"	""
"0000479109"	"00024242"	"70"	"2189"	"459"	"3405"	"0"	"c.2189+459_3405del"	"r.?"	"p.(Glu730_Cys952del)"	"15i_"	""
"0000479110"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479111"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479112"	"00024242"	"50"	"2303"	"0"	"2303"	"0"	"c.2303C>G"	"r.(?)"	"p.(Pro768Arg)"	"16"	""
"0000479113"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	"16i"	""
"0000479114"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>C"	"r.2316_2331del"	"p.?"	"16i"	""
"0000479115"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>C"	"r.2316_2331del"	"p.?"	"16i"	""
"0000479116"	"00024242"	"90"	"236"	"0"	"246"	"0"	"c.236_246del"	"r.(?)"	"p.(Pro79Argfs*13)"	"2"	""
"0000479117"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479118"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479119"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479120"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479121"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479122"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479123"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479124"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479125"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479126"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479127"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	"18"	""
"0000479128"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479129"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsGAC"	"r.(?)"	"p.(Gln914Argfs*30)"	"19"	""
"0000479130"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsGAC"	"r.(?)"	"p.(Gln914Argfs*30)"	"19"	""
"0000479131"	"00024242"	"90"	"2741"	"0"	"2741"	"0"	"c.2741delinsGAC"	"r.(?)"	"p.(Gln914Argfs*30)"	"19"	""
"0000479132"	"00024242"	"50"	"2744"	"0"	"2744"	"0"	"c.2744A>C"	"r.(?)"	"p.(Gln915Pro)"	"19"	""
"0000479133"	"00024242"	"90"	"309"	"0"	"309"	"0"	"c.309C>A"	"r.(?)"	"p.(Cys103*)"	"2"	""
"0000479134"	"00024242"	"90"	"340"	"0"	"341"	"0"	"c.340_341insT"	"r.(?)"	"p.(Lys114Ilefs*32)"	"2"	""
"0000479135"	"00024242"	"90"	"340"	"0"	"341"	"0"	"c.340_341insT"	"r.(?)"	"p.(Lys114Ilefs*32)"	"2"	""
"0000479136"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479137"	"00024242"	"90"	"399"	"0"	"399"	"0"	"c.399C>A"	"r.(?)"	"p.(Tyr133*)"	"2"	""
"0000479138"	"00024242"	"90"	"525"	"0"	"526"	"0"	"c.525_526del"	"r.(?)"	"p.(Asn177Profs*11)"	"2"	""
"0000479139"	"00024242"	"90"	"525"	"0"	"526"	"0"	"c.525_526del"	"r.(?)"	"p.(Asn177Profs*11)"	"2"	""
"0000479140"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479141"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479142"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479143"	"00024242"	"90"	"546"	"2"	"546"	"2"	"c.546+2T>C"	"r.spl"	"p.?"	"2i"	""
"0000479144"	"00024242"	"50"	"546"	"5"	"546"	"5"	"c.546+5G>T"	"r.spl?"	"p.?"	"2i"	""
"0000479145"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000479146"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479147"	"00024242"	"90"	"858"	"2"	"858"	"2"	"c.858+2T>A"	"r.spl"	"p.?"	"4i"	""
"0000479148"	"00024242"	"70"	"872"	"0"	"872"	"0"	"c.872T>C"	"r.(?)"	"p.(Leu291Pro)"	"5"	""
"0000479149"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	""
"0000479150"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	""
"0000479151"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	""
"0000479152"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479153"	"00024242"	"50"	"935"	"0"	"935"	"0"	"c.935T>G"	"r.(?)"	"p.(Leu312Arg)"	"5"	""
"0000479154"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479155"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479156"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479157"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479158"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479159"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479160"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479161"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479162"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479163"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479164"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479165"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479166"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479167"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479168"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479169"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479170"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479171"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479172"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479173"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479174"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479175"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479176"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479177"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479178"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479179"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479180"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479181"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479182"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479183"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479184"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479185"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479186"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479187"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479188"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479189"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479190"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479191"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479192"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479193"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479194"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479195"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479196"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479197"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479198"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479199"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479200"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479201"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479202"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479203"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479204"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479205"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479206"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479207"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479208"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479209"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479210"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479211"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479212"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479213"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479214"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479215"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479216"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479217"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479218"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479219"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479220"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479221"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479222"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479223"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479224"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479225"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479226"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479227"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479228"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479229"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479230"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479231"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479232"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479233"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479234"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479235"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479236"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479237"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479238"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479239"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479240"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479241"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479242"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479243"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479244"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479245"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479246"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479247"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479248"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479249"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479250"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479251"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479252"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479253"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479254"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479255"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479256"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479257"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479258"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479259"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479260"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479261"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479262"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479263"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479264"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479265"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479266"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479267"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479268"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479269"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479270"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479271"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479272"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479273"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479274"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479275"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479276"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479277"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479278"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479279"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479280"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479281"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479282"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479283"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479284"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479285"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479286"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479287"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479288"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479289"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479290"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479291"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479292"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479293"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479294"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479295"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479296"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479297"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479298"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479299"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479300"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479301"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479302"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479303"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479304"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479305"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479306"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479307"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479308"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479309"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479310"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479311"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479312"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479313"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479314"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479315"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479316"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479317"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479318"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479319"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479320"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479321"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479322"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479323"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479324"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479325"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479326"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479327"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479328"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479329"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479330"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479331"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479332"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479333"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479334"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479335"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479336"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000479337"	"00024242"	"90"	"-32"	"-2"	"-32"	"-2"	"c.-32-2A>G"	"r.spl"	"p.?"	"1i"	""
"0000479338"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479339"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479340"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479341"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479342"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.spl?"	"p.?"	"1i"	""
"0000479343"	"00024242"	"70"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>G"	"r.spl?"	"p.?"	"1i"	""
"0000479344"	"00024242"	"50"	"1000"	"0"	"1000"	"0"	"c.1000G>A"	"r.(?)"	"p.(Gly334Ser)"	"6"	""
"0000479345"	"00024242"	"90"	"1062"	"0"	"1062"	"0"	"c.1062C>G"	"r.(?)"	"p.(Tyr354*)"	"6"	""
"0000479346"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479347"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479348"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479349"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479350"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000479351"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000479352"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl?"	"p.(=)"	"6i"	""
"0000479353"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl?"	"p.(=)"	"6i"	""
"0000479354"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl?"	"p.(=)"	"6i"	""
"0000479355"	"00024242"	"90"	"1076"	"-22"	"1076"	"-22"	"c.1076-22T>G"	"r.spl?"	"p.(=)"	"6i"	""
"0000479356"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000479357"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000479358"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000479359"	"00024242"	"50"	"1099"	"0"	"1099"	"0"	"c.1099T>C"	"r.(?)"	"p.(Trp367Arg)"	"7"	""
"0000479360"	"00024242"	"90"	"1101"	"0"	"1101"	"0"	"c.1101G>A"	"r.(?)"	"p.(Trp367*)"	"7"	""
"0000479361"	"00024242"	"50"	"1124"	"0"	"1124"	"0"	"c.1124G>A"	"r.(?)"	"p.(Arg375His)"	"7"	""
"0000479362"	"00024242"	"90"	"1128"	"0"	"1129"	"0"	"c.1128_1129delinsC"	"r.(?)"	"p.(Trp376Cysfs*16)"	"7"	""
"0000479363"	"00024242"	"90"	"1128"	"0"	"1129"	"0"	"c.1128_1129delinsC"	"r.(?)"	"p.(Trp376Cysfs*16)"	"7"	""
"0000479364"	"00024242"	"70"	"1129"	"0"	"1129"	"0"	"c.1129G>C"	"r.(?)"	"p.(Gly377Arg)"	"7"	""
"0000479365"	"00024242"	"90"	"1156"	"0"	"1156"	"0"	"c.1156C>T"	"r.(?)"	"p.(Gln386*)"	"7"	""
"0000479366"	"00024242"	"90"	"1165"	"0"	"1165"	"0"	"c.1165del"	"r.(?)"	"p.(Glu389Argfs*3)"	"7"	""
"0000479367"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000479368"	"00024242"	"90"	"1194"	"2"	"1194"	"2"	"c.1194+2T>C"	"r.spl"	"p.?"	"7i"	""
"0000479369"	"00024242"	"50"	"1195"	"-15"	"1195"	"-15"	"c.1195-15G>A"	"r.(=)"	"p.(?)"	"7i"	""
"0000479370"	"00024242"	"90"	"1195"	"-19"	"2190"	"-20"	"c.1195-19_2190-20del"	"r.(?)"	"p.(Asp399fs*6)"	"7i"	""
"0000479371"	"00024242"	"50"	"1195"	"-8"	"1195"	"-8"	"c.1195-8G>A"	"r.spl?"	"p.(=)"	"7i"	""
"0000479372"	"00024242"	"50"	"1195"	"-8"	"1195"	"-8"	"c.1195-8G>A"	"r.spl?"	"p.(=)"	"7i"	""
"0000479373"	"00024242"	"70"	"1199"	"0"	"1210"	"0"	"c.1199_1210del"	"r.(?)"	"p.(Val400_Asn403del)"	"8"	""
"0000479374"	"00024242"	"70"	"1199"	"0"	"1210"	"0"	"c.1199_1210del"	"r.(?)"	"p.(Val400_Asn403del)"	"8"	""
"0000479375"	"00024242"	"70"	"1202"	"0"	"1202"	"0"	"c.1202A>G"	"r.(?)"	"p.(Gln401Arg)"	"8"	""
"0000479376"	"00024242"	"50"	"1210"	"0"	"1210"	"0"	"c.1210G>A"	"r.(?)"	"p.(Asp404Asn)"	"8"	""
"0000479377"	"00024242"	"50"	"1211"	"0"	"1211"	"0"	"c.1211A>G"	"r.(?)"	"p.(Asp404Gly)"	"8"	""
"0000479378"	"00024242"	"70"	"1222"	"0"	"1222"	"0"	"c.1222A>G"	"r.(?)"	"p.(Met408Val)"	"8"	""
"0000479379"	"00024242"	"70"	"1239"	"0"	"1239"	"0"	"c.1239C>G"	"r.(?)"	"p.(Asp413Glu)"	"8"	""
"0000479380"	"00024242"	"70"	"1256"	"0"	"1256"	"0"	"c.1256A>T"	"r.[=, 1195_1326del]"	"p.[Asp419Val, Asp339_Val442del]"	"8"	""
"0000479381"	"00024242"	"50"	"1280"	"0"	"1280"	"0"	"c.1280T>C"	"r.(?)"	"p.(Met427Thr)"	"8"	""
"0000479382"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000479383"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000479384"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000479385"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000479386"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000479387"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000479388"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000479389"	"00024242"	"70"	"1320"	"0"	"1322"	"0"	"c.1320_1322del"	"r.(?)"	"p.(Met440del)"	"8"	""
"0000479390"	"00024242"	"90"	"1322"	"0"	"1326"	"9"	"c.1322_1326+9del"	"r.spl"	"p.(Ile441Argfs*63)"	"8_8i"	""
"0000479391"	"00024242"	"50"	"1324"	"0"	"1324"	"0"	"c.1324G>A"	"r.(?)"	"p.(Val442Met)"	"8"	""
"0000479392"	"00024242"	"90"	"1326"	"1"	"1326"	"1"	"c.1326+1G>A"	"r.spl"	"p.?"	"8i"	""
"0000479393"	"00024242"	"90"	"1326"	"1"	"1326"	"1"	"c.1326+1G>A"	"r.spl"	"p.?"	"8i"	""
"0000479394"	"00024242"	"50"	"1333"	"0"	"1333"	"0"	"c.1333G>C"	"r.(?)"	"p.(Ala445Pro)"	"9"	""
"0000479395"	"00024242"	"90"	"1356"	"0"	"1356"	"0"	"c.1356del"	"r.(?)"	"p.(Ser454Alafs*23)"	"9"	""
"0000479396"	"00024242"	"70"	"1364"	"0"	"1364"	"0"	"c.1364A>C"	"r.(?)"	"p.(Tyr455Cys)"	"9"	""
"0000479397"	"00024242"	"70"	"1364"	"0"	"1364"	"0"	"c.1364A>T"	"r.(?)"	"p.(Tyr455Phe)"	"9"	""
"0000479398"	"00024242"	"70"	"1385"	"0"	"1385"	"0"	"c.1385T>C"	"r.(?)"	"p.(Leu462Pro)"	"9"	""
"0000479399"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396del"	"r.(?)"	"p.(Val466Phefs*11)"	"9"	""
"0000479400"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396del"	"r.(?)"	"p.(Val466Phefs*11)"	"9"	""
"0000479401"	"00024242"	"70"	"1396"	"0"	"1396"	"0"	"c.1396G>T"	"r.(?)"	"p.(Val466Phe)"	"9"	""
"0000479402"	"00024242"	"70"	"1397"	"0"	"1397"	"0"	"c.1397T>G"	"r.(?)"	"p.(Val466Gly)"	"9"	""
"0000479403"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479404"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479405"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479406"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479407"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479408"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479409"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000479410"	"00024242"	"90"	"1437"	"2"	"1437"	"2"	"c.1437+2T>C"	"r.[1327_1437del]"	"p.(Asp443_Lys479del)"	"9i"	""
"0000479411"	"00024242"	"70"	"1437"	"0"	"1437"	"0"	"c.1437G>C"	"r.(?)"	"p.[(Lys479Asn), (?)]"	"9"	""
"0000479412"	"00024242"	"90"	"1456"	"0"	"1468"	"0"	"c.1456_1468del"	"r.(?)"	"p.(Ala486Serfs*30)"	"10"	""
"0000479413"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	""
"0000479414"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>T"	"r.(?)"	"p.(Asp489Tyr)"	"10"	""
"0000479415"	"00024242"	"90"	"148"	"0"	"859"	"-11"	"c.148_859-11del"	"r.spl?"	"p.(Glu50_Profs*27)"	"2_4i"	""
"0000479416"	"00024242"	"50"	"1478"	"0"	"1478"	"0"	"c.1478C>T"	"r.(?)"	"p.(Pro493Leu)"	"10"	""
"0000479417"	"00024242"	"70"	"1509"	"0"	"1511"	"0"	"c.1509_1511del"	"r.(?)"	"p.(Ala504del)"	"10"	""
"0000479418"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	""
"0000479419"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>A"	"r.spl"	"p.?"	"10i"	""
"0000479420"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl"	"p.?"	"10i"	""
"0000479421"	"00024242"	"90"	"1551"	"2"	"1551"	"2"	"c.1551+2T>G"	"r.spl"	"p.?"	"10i"	""
"0000479422"	"00024242"	"50"	"1551"	"3"	"1551"	"6"	"c.1551+3_1551+6del"	"r.spl?"	"p.?"	"10i"	""
"0000479423"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000479424"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000479425"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000479426"	"00024242"	"70"	"1562"	"0"	"1562"	"0"	"c.1562A>T"	"r.(?)"	"p.(Glu521Val)"	"11"	""
"0000479427"	"00024242"	"70"	"1562"	"0"	"1562"	"0"	"c.1562A>T"	"r.(?)"	"p.(Glu521Val)"	"11"	""
"0000479428"	"00024242"	"70"	"1564"	"0"	"1564"	"0"	"c.1564C>G"	"r.(?)"	"p.(Pro522Ala)"	"11"	""
"0000479429"	"00024242"	"70"	"1574"	"0"	"1574"	"0"	"c.1574T>A"	"r.(?)"	"p.(Phe525Tyr)"	"11"	""
"0000479430"	"00024242"	"70"	"1574"	"0"	"1574"	"0"	"c.1574T>A"	"r.(?)"	"p.(Phe525Tyr)"	"11"	""
"0000479431"	"00024242"	"70"	"1585"	"0"	"1586"	"0"	"c.1585_1586delinsGT"	"r.(?)"	"p.(Ser529Val)"	"11"	""
"0000479432"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000479433"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000479434"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000479435"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479436"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479437"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479438"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479439"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479440"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479441"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479442"	"00024242"	"70"	"1669"	"0"	"1669"	"0"	"c.1669A>T"	"r.(?)"	"p.(Ile557Phe)"	"12"	""
"0000479443"	"00024242"	"70"	"1703"	"0"	"1703"	"0"	"c.1703A>T"	"r.(?)"	"p.(His568Leu)"	"12"	""
"0000479444"	"00024242"	"70"	"1710"	"0"	"1710"	"0"	"c.1710C>G"	"r.(?)"	"p.(Asn570Lys)"	"12"	""
"0000479445"	"00024242"	"70"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	"12"	""
"0000479446"	"00024242"	"70"	"1748"	"0"	"1748"	"0"	"c.1748C>T"	"r.(?)"	"p.(Ser583Phe)"	"12"	""
"0000479447"	"00024242"	"50"	"1754"	"0"	"1754"	"0"	"c.1754G>A"	"r.(?)"	"p.(Arg585Lys)"	"12"	""
"0000479448"	"00024242"	"50"	"1760"	"0"	"1760"	"0"	"c.1760T>C"	"r.(?)"	"p.(Leu587Pro)"	"13"	""
"0000479449"	"00024242"	"70"	"1781"	"0"	"1781"	"0"	"c.1781G>C"	"r.(?)"	"p.(Arg594Pro)"	"13"	""
"0000479450"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000479451"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000479452"	"00024242"	"70"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	"13"	""
"0000479453"	"00024242"	"70"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	"13"	""
"0000479454"	"00024242"	"50"	"1799"	"0"	"1799"	"0"	"c.1799G>T"	"r.(?)"	"p.(Arg600Leu)"	"13"	""
"0000479455"	"00024242"	"90"	"18"	"0"	"25"	"0"	"c.18_25del"	"r.(?)"	"p.(Cys8Profs*24)"	"2"	""
"0000479456"	"00024242"	"50"	"1814"	"0"	"1814"	"0"	"c.1814G>A"	"r.(?)"	"p.(Gly605Asp)"	"13"	""
"0000479457"	"00024242"	"70"	"1829"	"0"	"1829"	"0"	"c.1829C>T"	"r.(?)"	"p.(Ala610Val)"	"13"	""
"0000479458"	"00024242"	"70"	"1829"	"0"	"1829"	"0"	"c.1829C>T"	"r.(?)"	"p.(Ala610Val)"	"13"	""
"0000479459"	"00024242"	"70"	"1834"	"0"	"1834"	"0"	"c.1834C>T"	"r.(?)"	"p.(His612Tyr)"	"13"	""
"0000479460"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479461"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479462"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479463"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479464"	"00024242"	"70"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	"13"	""
"0000479465"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000479466"	"00024242"	"70"	"1905"	"0"	"1905"	"0"	"c.1905C>A"	"r.(?)"	"p.(Asn635Lys)"	"14"	""
"0000479467"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479468"	"00024242"	"50"	"1924"	"0"	"1924"	"0"	"c.1924G>T"	"r.(?)"	"p.(Val642Phe)"	"14"	""
"0000479469"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479470"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479471"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479472"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479473"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479474"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479475"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479476"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479477"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479478"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479479"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479480"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479481"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479482"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479483"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479484"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479485"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479486"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479487"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479488"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479489"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479490"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479491"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479492"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479493"	"00024242"	"50"	"2012"	"0"	"2012"	"0"	"c.2012T>G"	"r.(?)"	"p.(Met671Arg)"	"14"	""
"0000479494"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000479495"	"00024242"	"70"	"2104"	"0"	"2104"	"0"	"c.2104C>T"	"r.(?)"	"p.(Arg702Cys)"	"15"	""
"0000479496"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>T"	"r.(?)"	"p.(Arg702Leu)"	"15"	""
"0000479497"	"00024242"	"50"	"2132"	"0"	"2132"	"0"	"c.2132C>G"	"r.(?)"	"p.(Thr711Arg)"	"15"	""
"0000479498"	"00024242"	"70"	"2236"	"0"	"2236"	"0"	"c.2236T>C"	"r.(?)"	"p.(Trp746Arg)"	"16"	""
"0000479499"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479500"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479501"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479502"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479503"	"00024242"	"50"	"2276"	"0"	"2276"	"0"	"c.2276G>C"	"r.(?)"	"p.(Gly759Ala)"	"16"	""
"0000479504"	"00024242"	"90"	"236"	"0"	"246"	"0"	"c.236_246del"	"r.(?)"	"p.(Pro79Argfs*13)"	"2"	""
"0000479505"	"00024242"	"90"	"241"	"0"	"241"	"0"	"c.241C>T"	"r.(?)"	"p.(Gln81*)"	"2"	""
"0000479506"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479507"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479508"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479509"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479510"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834Argfs*49)"	"18"	""
"0000479511"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479512"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271del"	"r.(?)"	"p.(Asp91Ilefs*51)"	"2"	""
"0000479513"	"00024242"	"70"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.(?)"	"p.0?"	"2"	""
"0000479514"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000479515"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000479516"	"00024242"	"50"	"323"	"0"	"323"	"0"	"c.323G>A"	"r.(?)"	"p.(Cys108Ser)"	"2"	""
"0000479517"	"00024242"	"90"	"343"	"0"	"343"	"0"	"c.343C>T"	"r.(?)"	"p.(Gln115*)"	"2"	""
"0000479518"	"00024242"	"90"	"343"	"0"	"343"	"0"	"c.343C>T"	"r.(?)"	"p.(Gln115*)"	"2"	""
"0000479519"	"00024242"	"50"	"364"	"0"	"364"	"0"	"c.364A>G"	"r.(?)"	"p.(Met122Val)"	"2"	""
"0000479520"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479521"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479522"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479523"	"00024242"	"90"	"378"	"0"	"378"	"0"	"c.378G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479524"	"00024242"	"90"	"379"	"0"	"380"	"0"	"c.379_380del"	"r.(?)"	"p.(Cys127Leufs*18)"	"2"	""
"0000479525"	"00024242"	"50"	"380"	"0"	"380"	"0"	"c.380G>T"	"r.(?)"	"p.(Cys127Phe)"	"2"	""
"0000479526"	"00024242"	"90"	"3"	"0"	"3"	"0"	"c.3G>A"	"r.(?)"	"p.0?"	"2"	""
"0000479527"	"00024242"	"50"	"421"	"0"	"421"	"0"	"c.421C>A"	"r.(?)"	"p.(Leu141Met)"	"2"	""
"0000479528"	"00024242"	"90"	"424"	"0"	"440"	"0"	"c.424_440del"	"r.(?)"	"p.(Ser142Lleufs*29)"	"2"	""
"0000479529"	"00024242"	"90"	"424"	"0"	"440"	"0"	"c.424_440del"	"r.(?)"	"p.(Ser142Lleufs*29)"	"2"	""
"0000479530"	"00024242"	"90"	"444"	"0"	"444"	"0"	"c.444C>G"	"r.(?)"	"p.(Tyr148*)"	"2"	""
"0000479531"	"00024242"	"50"	"461"	"0"	"461"	"0"	"c.461G>C"	"r.(?)"	"p.(Arg154Pro)"	"2"	""
"0000479532"	"00024242"	"70"	"503"	"0"	"503"	"0"	"c.503G>A"	"r.(?)"	"p.(Arg168Gln)"	"2"	""
"0000479533"	"00024242"	"70"	"503"	"0"	"503"	"0"	"c.503G>A"	"r.(?)"	"p.(Arg168Gln)"	"2"	""
"0000479534"	"00024242"	"70"	"503"	"0"	"503"	"0"	"c.503G>C"	"r.(?)"	"p.(Arg168Pro)"	"2"	""
"0000479535"	"00024242"	"70"	"503"	"0"	"503"	"0"	"c.503G>C"	"r.(?)"	"p.(Arg168Pro)"	"2"	""
"0000479536"	"00024242"	"50"	"506"	"0"	"506"	"0"	"c.506T>C"	"r.(?)"	"p.(Leu169Pro)"	"2"	""
"0000479537"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479538"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479539"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479540"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479541"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479542"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479543"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479544"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479545"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479546"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479547"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479548"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479549"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479550"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479551"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479552"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479553"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479554"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479555"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479556"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479557"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479558"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479559"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479560"	"00024242"	"90"	"546"	"2"	"546"	"5"	"c.546+2_546+5del"	"r.spl"	"p.?"	"2i"	""
"0000479561"	"00024242"	"50"	"546"	"5"	"546"	"5"	"c.546+5G>T"	"r.spl?"	"p.?"	"2i"	""
"0000479562"	"00024242"	"70"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000479563"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000479564"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000479565"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000479566"	"00024242"	"50"	"547"	"-39"	"547"	"-39"	"c.547-39T>G"	"r.(=)"	"p.(?)"	"2i"	""
"0000479567"	"00024242"	"50"	"569"	"0"	"569"	"0"	"c.569G>A"	"r.(?)"	"p.(Arg190His)"	"3"	""
"0000479568"	"00024242"	"90"	"573"	"0"	"573"	"0"	"c.573C>A"	"r.(?)"	"p.(Tyr191*)"	"3"	""
"0000479569"	"00024242"	"50"	"650"	"0"	"650"	"0"	"c.650C>T"	"r.(?)"	"p.(Pro217Leu)"	"3"	""
"0000479570"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479571"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479572"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479573"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479574"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479575"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000479576"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000479577"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000479578"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000479579"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>C"	"r.spl"	"p.?"	"3i"	""
"0000479580"	"00024242"	"90"	"692"	"5"	"692"	"5"	"c.692+5G>T"	"r.spl?"	"p.?"	"3i"	""
"0000479581"	"00024242"	"50"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	"4"	""
"0000479582"	"00024242"	"50"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	"4"	""
"0000479583"	"00024242"	"90"	"716"	"0"	"716"	"0"	"c.716del"	"r.(?)"	"p.(Leu239Argfs*29)"	"4"	""
"0000479584"	"00024242"	"50"	"719"	"0"	"719"	"0"	"c.719T>C"	"r.(?)"	"p.(Phe240Ser)"	"4"	""
"0000479585"	"00024242"	"90"	"722"	"0"	"723"	"0"	"c.722_723del"	"r.(?)"	"p.(Phe241Cysfs*88)"	"4"	""
"0000479586"	"00024242"	"90"	"722"	"0"	"723"	"0"	"c.722_723del"	"r.(?)"	"p.(Phe241Cysfs*88)"	"4"	""
"0000479587"	"00024242"	"90"	"722"	"0"	"723"	"0"	"c.722_723del"	"r.(?)"	"p.(Phe241Cysfs*88)"	"4"	""
"0000479588"	"00024242"	"70"	"752"	"0"	"752"	"0"	"c.752C>T"	"r.(?)"	"p.(Ser251Leu)"	"4"	""
"0000479589"	"00024242"	"90"	"766"	"0"	"785"	"0"	"c.766_785delinsC"	"r.[766_785delinsc]"	"p.(Tyr256Argfs*6)"	"4"	""
"0000479590"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479591"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479592"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479593"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479594"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479595"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479596"	"00024242"	"70"	"796"	"0"	"796"	"0"	"c.796C>T"	"r.(?)"	"p.(Pro266Ser)"	"4"	""
"0000479597"	"00024242"	"70"	"796"	"0"	"796"	"0"	"c.796C>T"	"r.(?)"	"p.(Pro266Ser)"	"4"	""
"0000479598"	"00024242"	"70"	"796"	"0"	"796"	"0"	"c.796C>T"	"r.(?)"	"p.(Pro266Ser)"	"4"	""
"0000479599"	"00024242"	"70"	"796"	"0"	"796"	"0"	"c.796C>T"	"r.(?)"	"p.(Pro266Ser)"	"4"	""
"0000479600"	"00024242"	"70"	"796"	"0"	"796"	"0"	"c.796C>T"	"r.(?)"	"p.(Pro266Ser)"	"4"	""
"0000479601"	"00024242"	"90"	"827"	"0"	"845"	"0"	"c.827_845del"	"r.(?)"	"p.(Ile276Thrfs*32)"	"4"	""
"0000479602"	"00024242"	"90"	"829"	"0"	"851"	"0"	"c.829_851del"	"r.(?)"	"p.(Thr277Alafs*45)"	"4"	""
"0000479603"	"00024242"	"50"	"853"	"0"	"853"	"0"	"c.853C>T"	"r.(?)"	"p.(Pro285Ser)"	"4"	""
"0000479604"	"00024242"	"50"	"853"	"0"	"853"	"0"	"c.853C>T"	"r.(?)"	"p.(Pro285Ser)"	"4"	""
"0000479605"	"00024242"	"70"	"854"	"0"	"854"	"0"	"c.854C>G"	"r.(?)"	"p.(Pro285Arg)"	"4"	""
"0000479606"	"00024242"	"90"	"859"	"-2"	"859"	"-2"	"c.859-2A>T"	"r.spl"	"p.?"	"4i"	""
"0000479607"	"00024242"	"50"	"861"	"0"	"861"	"0"	"c.861C>T"	"r.(?)"	"p.(=)"	"5"	""
"0000479608"	"00024242"	"50"	"871"	"0"	"871"	"0"	"c.871C>T"	"r.(?)"	"p.(Leu291Phe)"	"5"	""
"0000479609"	"00024242"	"70"	"872"	"0"	"872"	"0"	"c.872T>C"	"r.(?)"	"p.(Leu291Pro)"	"5"	""
"0000479610"	"00024242"	"70"	"872"	"0"	"872"	"0"	"c.872T>C"	"r.(?)"	"p.(Leu291Pro)"	"5"	""
"0000479611"	"00024242"	"70"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000479612"	"00024242"	"70"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000479613"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000479614"	"00024242"	"50"	"885"	"0"	"885"	"0"	"c.885C>G"	"r.(?)"	"p.(His295Gln)"	"5"	""
"0000479615"	"00024242"	"50"	"893"	"0"	"893"	"0"	"c.893A>C"	"r.(?)"	"p.(Tyr298Ser)"	"5"	""
"0000479616"	"00024242"	"50"	"896"	"0"	"896"	"0"	"c.896T>G"	"r.(?)"	"p.(Leu299Arg)"	"5"	""
"0000479617"	"00024242"	"70"	"923"	"0"	"923"	"0"	"c.923A>T"	"r.(?)"	"p.(His308Leu)"	"5"	""
"0000479618"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479619"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479620"	"00024242"	"50"	"953"	"0"	"953"	"0"	"c.953T>A"	"r.(?)"	"p.(Met318Lys)"	"5"	""
"0000479621"	"00024242"	"70"	"954"	"0"	"955"	"0"	"c.954_955insN[21]"	"r.?"	"p.?"	"5"	""
"0000479622"	"00024242"	"50"	"971"	"0"	"971"	"0"	"c.971C>T"	"r.(?)"	"p.(Pro324Leu)"	"6"	""
"0000479623"	"00024242"	"50"	"988"	"0"	"988"	"0"	"c.988T>G"	"r.(?)"	"p.(Trp330Gly)"	"6"	""
"0000479624"	"00024242"	"90"	"989"	"0"	"989"	"0"	"c.989G>A"	"r.(?)"	"p.(Trp330*)"	"6"	""
"0000479625"	"00024242"	"50"	"998"	"0"	"998"	"0"	"c.998C>A"	"r.(?)"	"p.(Thr333Lys)"	"6"	""
"0000479626"	"00024242"	"90"	"0"	"0"	"0"	"0"	"c.0"	"r.0"	"p.0"	""	""
"0000479627"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479628"	"00024242"	"70"	"752"	"0"	"752"	"0"	"c.752C>T"	"r.(?)"	"p.(Ser251Leu)"	"4"	""
"0000479629"	"00024242"	"70"	"752"	"0"	"752"	"0"	"c.752C>T"	"r.(?)"	"p.(Ser251Leu)"	"4"	""
"0000479630"	"00024242"	"50"	"1003"	"0"	"1003"	"0"	"c.1003G>A"	"r.(?)"	"p.(Gly335Arg)"	"6"	""
"0000479631"	"00024242"	"50"	"1048"	"0"	"1048"	"0"	"c.1048G>A"	"r.(?)"	"p.(Val350Met)"	"6"	""
"0000479632"	"00024242"	"50"	"1048"	"0"	"1048"	"0"	"c.1048G>A"	"r.(?)"	"p.(Val350Met)"	"6"	""
"0000479633"	"00024242"	"90"	"1051"	"0"	"1051"	"0"	"c.1051del"	"r.(?)"	"p.(Val351Cysfs*41)"	"6"	""
"0000479634"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000479635"	"00024242"	"70"	"1075"	"0"	"1075"	"0"	"c.1075G>A"	"r.[1075g>a, 1072_1075del]"	"p.[Gly359Arg, Val358Aspfs*33]"	"6"	""
"0000479636"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>A"	"r.spl"	"p.?"	"6i"	""
"0000479637"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000479638"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000479639"	"00024242"	"90"	"1100"	"0"	"1100"	"0"	"c.1100G>A"	"r.(?)"	"p.(Trp367*)"	"7"	""
"0000479640"	"00024242"	"50"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	"7"	""
"0000479641"	"00024242"	"90"	"1143"	"0"	"1143"	"0"	"c.1143del"	"r.(?)"	"p.(Ala382Leufs*10)"	"7"	""
"0000479642"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000479643"	"00024242"	"90"	"118"	"0"	"118"	"0"	"c.118C>T"	"r.(?)"	"p.(Arg40*)"	"2"	""
"0000479644"	"00024242"	"90"	"1192"	"0"	"1192"	"0"	"c.1192dup"	"r.(?)"	"p.(Leu398Profs*108)"	"7"	""
"0000479645"	"00024242"	"90"	"1194"	"2"	"1194"	"2"	"c.1194+2T>A"	"r.spl"	"p.?"	"7i"	""
"0000479646"	"00024242"	"50"	"1210"	"0"	"1210"	"0"	"c.1210G>A"	"r.(?)"	"p.(Asp404Asn)"	"8"	""
"0000479647"	"00024242"	"70"	"1291"	"0"	"1299"	"0"	"c.1291_1299del"	"r.(?)"	"p.(Leu431_Gln433del)"	"8"	""
"0000479648"	"00024242"	"90"	"1293"	"0"	"1312"	"0"	"c.1293_1312del"	"r.(?)"	"p.(Gln433Aspfs*66)"	"8"	""
"0000479649"	"00024242"	"50"	"1297"	"0"	"1297"	"0"	"c.1297C>A"	"r.(?)"	"p.(Gln433Lys)"	"8"	""
"0000479650"	"00024242"	"50"	"1297"	"0"	"1297"	"0"	"c.1297C>A"	"r.(?)"	"p.(Gln433Lys)"	"8"	""
"0000479651"	"00024242"	"70"	"1331"	"0"	"1331"	"0"	"c.1331C>G"	"r.(?)"	"p.(Pro444Arg)"	"9"	""
"0000479652"	"00024242"	"90"	"1371"	"0"	"1371"	"0"	"c.1371del"	"r.(?)"	"p.(Tyr458Thrfs*19)"	"9"	""
"0000479653"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396del"	"r.(?)"	"p.(Val466Phefs*11)"	"9"	""
"0000479654"	"00024242"	"70"	"1432"	"0"	"1432"	"0"	"c.1432G>A"	"r.(?)"	"p.(Gly478Arg)"	"9"	""
"0000479655"	"00024242"	"90"	"1437"	"2"	"1437"	"2"	"c.1437+2T>C"	"r.[1327_1437del]"	"p.(Asp443_Lys479del)"	"9i"	""
"0000479656"	"00024242"	"90"	"1437"	"2"	"1437"	"2"	"c.1437+2T>C"	"r.[1327_1437del]"	"p.(Asp443_Lys479del)"	"9i"	""
"0000479657"	"00024242"	"90"	"1438"	"-1"	"1438"	"-1"	"c.1438-1G>C"	"r.spl"	"p.?"	"9i"	""
"0000479658"	"00024242"	"90"	"1438"	"-2"	"1438"	"-2"	"c.1438-2A>G"	"r.spl"	"p.?"	"9i"	""
"0000479659"	"00024242"	"70"	"1441"	"0"	"1441"	"0"	"c.1441T>C"	"r.(?)"	"p.(Trp481Arg)"	"10"	""
"0000479660"	"00024242"	"70"	"1456"	"0"	"1456"	"0"	"c.1456G>C"	"r.(?)"	"p.(Ala486Pro)"	"10"	""
"0000479661"	"00024242"	"70"	"1460"	"0"	"1460"	"0"	"c.1460T>C"	"r.(?)"	"p.(Phe487Ser)"	"10"	""
"0000479662"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	""
"0000479663"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	""
"0000479664"	"00024242"	"50"	"1495"	"0"	"1495"	"0"	"c.1495T>A"	"r.(?)"	"p.(Trp499Arg)"	"10"	""
"0000479665"	"00024242"	"50"	"1495"	"0"	"1495"	"0"	"c.1495T>A"	"r.(?)"	"p.(Trp499Arg)"	"10"	""
"0000479666"	"00024242"	"50"	"1504"	"0"	"1504"	"0"	"c.1504A>G"	"r.(?)"	"p.(Met502Val)"	"10"	""
"0000479667"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	""
"0000479668"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	""
"0000479669"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl"	"p.?"	"10i"	""
"0000479670"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl"	"p.?"	"10i"	""
"0000479671"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>T"	"r.[=, 1438_1551del]"	"p.[=, Val480_Ile517del]"	"10i"	""
"0000479672"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000479673"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>A"	"r.(?)"	"p.(Glu521Lys)"	"11"	""
"0000479674"	"00024242"	"70"	"1564"	"0"	"1564"	"0"	"c.1564C>A"	"r.(?)"	"p.(Pro522Thr)"	"11"	""
"0000479675"	"00024242"	"70"	"1564"	"0"	"1564"	"0"	"c.1564C>G"	"r.(?)"	"p.(Pro522Ala)"	"11"	""
"0000479676"	"00024242"	"90"	"1636"	"1"	"1636"	"1"	"c.1636+1G>C"	"r.spl"	"p.?"	"11i"	""
"0000479677"	"00024242"	"70"	"1636"	"5"	"1636"	"5"	"c.1636+5G>T"	"r.1636_1637ins[gucac;1636+6_1637-1]"	"p.Gly546fs*145"	"11i"	""
"0000479678"	"00024242"	"70"	"1642"	"0"	"1642"	"0"	"c.1642G>T"	"r.(?)"	"p.(Val548Phe)"	"12"	""
"0000479679"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479680"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479681"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479682"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479683"	"00024242"	"70"	"1673"	"0"	"1673"	"0"	"c.1673G>C"	"r.(?)"	"p.(Cys558Ser)"	"12"	""
"0000479684"	"00024242"	"90"	"1694"	"0"	"1697"	"0"	"c.1694_1697del"	"r.(?)"	"p.(Leu565Profs*12)"	"12"	""
"0000479685"	"00024242"	"90"	"1694"	"0"	"1697"	"0"	"c.1694_1697del"	"r.(?)"	"p.(Leu565Profs*12)"	"12"	""
"0000479686"	"00024242"	"90"	"1694"	"0"	"1697"	"0"	"c.1694_1697del"	"r.(?)"	"p.(Leu565Profs*12)"	"12"	""
"0000479687"	"00024242"	"50"	"1724"	"0"	"1724"	"0"	"c.1724A>C"	"r.(?)"	"p.(Tyr575Ser)"	"12"	""
"0000479688"	"00024242"	"50"	"1754"	"0"	"1754"	"0"	"c.1754G>T"	"r.(?)"	"p.(Arg585Met)"	"12"	""
"0000479689"	"00024242"	"90"	"1755"	"-1"	"1755"	"-1"	"c.1755-1G>A"	"r.spl"	"p.?"	"12i"	""
"0000479690"	"00024242"	"90"	"1776"	"0"	"1776"	"0"	"c.1776del"	"r.(?)"	"p.(Thr593Hisfs*5)"	"13"	""
"0000479691"	"00024242"	"50"	"1802"	"0"	"1802"	"0"	"c.1802C>G"	"r.(?)"	"p.(Ser601Trp)"	"13"	""
"0000479692"	"00024242"	"70"	"1802"	"0"	"1802"	"0"	"c.1802C>T"	"r.(?)"	"p.(Ser601Leu)"	"13"	""
"0000479693"	"00024242"	"70"	"1802"	"0"	"1802"	"0"	"c.1802C>T"	"r.(?)"	"p.(Ser601Leu)"	"13"	""
"0000479694"	"00024242"	"70"	"1819"	"0"	"1836"	"0"	"c.1819_1836del"	"r.(?)"	"p.(Gly607_His612del)"	"13"	""
"0000479695"	"00024242"	"90"	"1826"	"0"	"1826"	"0"	"c.1826dup"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000479696"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827del"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000479697"	"00024242"	"70"	"1833"	"0"	"1847"	"0"	"c.1833_1847delinsACGGGGTAT"	"r.(?)"	"p.(His612_Asp616delinsArgGlyIle)"	"13"	""
"0000479698"	"00024242"	"50"	"1836"	"0"	"1836"	"0"	"c.1836C>G"	"r.(?)"	"p.(His612Gln)"	"13"	""
"0000479699"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479700"	"00024242"	"90"	"1888"	"1"	"1888"	"1"	"c.1888+1G>A"	"r.spl"	"p.?"	"13i"	""
"0000479701"	"00024242"	"90"	"1888"	"1"	"1888"	"1"	"c.1888+1G>A"	"r.spl"	"p.?"	"13i"	""
"0000479702"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479703"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479704"	"00024242"	"70"	"1913"	"0"	"1913"	"0"	"c.1913G>T"	"r.(?)"	"p.(Gly638Val)"	"14"	""
"0000479705"	"00024242"	"50"	"1921"	"0"	"1921"	"0"	"c.1921C>G"	"r.(?)"	"p.(Leu641Val)"	"14"	""
"0000479706"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479707"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479708"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479709"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479710"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479711"	"00024242"	"70"	"1933"	"0"	"1933"	"0"	"c.1933G>T"	"r.(?)"	"p.(Asp645Tyr)"	"14"	""
"0000479712"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479713"	"00024242"	"70"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000479714"	"00024242"	"70"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000479715"	"00024242"	"70"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000479716"	"00024242"	"70"	"1943"	"0"	"1943"	"0"	"c.1943G>A"	"r.(?)"	"p.(Gly648Asp)"	"14"	""
"0000479717"	"00024242"	"70"	"1943"	"0"	"1943"	"0"	"c.1943G>A"	"r.(?)"	"p.(Gly648Asp)"	"14"	""
"0000479718"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000479719"	"00024242"	"90"	"2041"	"-1"	"2041"	"-1"	"c.2041-1G>A"	"r.spl"	"p.?"	"14i"	""
"0000479720"	"00024242"	"90"	"2055"	"0"	"2055"	"0"	"c.2055C>A"	"r.(?)"	"p.(Tyr685*)"	"15"	""
"0000479721"	"00024242"	"90"	"2066"	"0"	"2070"	"0"	"c.2066_2070dup"	"r.(?)"	"p.(Ala691Serfs*7)"	"15"	""
"0000479722"	"00024242"	"70"	"2104"	"0"	"2104"	"0"	"c.2104C>T"	"r.(?)"	"p.(Arg702Cys)"	"15"	""
"0000479723"	"00024242"	"70"	"2104"	"0"	"2104"	"0"	"c.2104C>T"	"r.(?)"	"p.(Arg702Cys)"	"15"	""
"0000479724"	"00024242"	"50"	"2114"	"0"	"2114"	"0"	"c.2114T>C"	"r.(?)"	"p.(Leu705Pro)"	"15"	""
"0000479725"	"00024242"	"70"	"2135"	"0"	"2135"	"0"	"c.2135T>C"	"r.(?)"	"p.(Leu712Pro)"	"15"	""
"0000479726"	"00024242"	"90"	"2136"	"0"	"2137"	"0"	"c.2136_2137del"	"r.(?)"	"p.(Phe713Profs*23)"	"15"	""
"0000479727"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000479728"	"00024242"	"90"	"2214"	"0"	"2214"	"0"	"c.2214G>A"	"r.(?)"	"p.(Trp738*)"	"16"	""
"0000479729"	"00024242"	"90"	"2219"	"0"	"2220"	"0"	"c.2219_2220del"	"r.(?)"	"p.(Val740Glyfs*55)"	"16"	""
"0000479730"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479731"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479732"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000479733"	"00024242"	"70"	"2255"	"0"	"2257"	"0"	"c.2255_2257del"	"r.(?)"	"p.(Ile752del)"	"16"	""
"0000479734"	"00024242"	"90"	"2269"	"0"	"2269"	"0"	"c.2269C>T"	"r.(?)"	"p.(Gln757*)"	"16"	""
"0000479735"	"00024242"	"90"	"2281"	"0"	"2281"	"0"	"c.2281delinsAT"	"r.(?)"	"p.(Ala761Ilefs*35)"	"16"	""
"0000479736"	"00024242"	"90"	"2298"	"0"	"2301"	"0"	"c.2298_2301delinsAAAGTA"	"r.(?)"	"p.(Tyr766*)"	"16"	""
"0000479737"	"00024242"	"90"	"2298"	"0"	"2301"	"0"	"c.2298_2301delinsAAAGTA"	"r.(?)"	"p.(Tyr766*)"	"16"	""
"0000479738"	"00024242"	"70"	"2314"	"0"	"2314"	"0"	"c.2314T>C"	"r.(?)"	"p.(Trp772Arg)"	"16"	""
"0000479739"	"00024242"	"90"	"2322"	"0"	"2323"	"0"	"c.2322_2323insGGTGAGTCTGCAAACGGGGAGT"	"r.(?)"	"p.(Leu775Glyfs*28)"	"16"	""
"0000479740"	"00024242"	"90"	"2331"	"1"	"2331"	"1"	"c.2331+1G>A"	"r.spl"	"p.?"	"16i"	""
"0000479741"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	"16i"	""
"0000479742"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	"16i"	""
"0000479743"	"00024242"	"90"	"2431"	"0"	"2431"	"0"	"c.2431dup"	"r.(?)"	"p.(Leu811Profs*73)"	"17"	""
"0000479744"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479745"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479746"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479747"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479748"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479749"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479750"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479751"	"00024242"	"70"	"2530"	"0"	"2541"	"0"	"c.2530_2541del"	"r.(?)"	"p.(Ala844_Leu847del)"	"18"	""
"0000479752"	"00024242"	"70"	"2530"	"0"	"2541"	"0"	"c.2530_2541del"	"r.(?)"	"p.(Ala844_Leu847del)"	"18"	""
"0000479753"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479754"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479755"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479756"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479757"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	"2"	""
"0000479758"	"00024242"	"90"	"25"	"0"	"25"	"0"	"c.25del"	"r.(?)"	"p.(Ser9Profs*34)"	"2"	""
"0000479759"	"00024242"	"90"	"2605"	"0"	"2605"	"0"	"c.2605del"	"r.(?)"	"p.(Glu869Serfs*18)"	"18"	""
"0000479760"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	"18"	""
"0000479761"	"00024242"	"90"	"2646"	"2"	"2646"	"3"	"c.2646+2_2646+3del"	"r.spl"	"p.(Asn882_Lysfs*5)"	"18_18i"	""
"0000479762"	"00024242"	"50"	"2647"	"-20"	"2647"	"-20"	"c.2647-20T>G"	"r.spl?"	"p.(=)"	"18i"	""
"0000479763"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479764"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479765"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271del"	"r.(?)"	"p.(Asp91Ilefs*51)"	"2"	""
"0000479766"	"00024242"	"50"	"2738"	"0"	"2738"	"0"	"c.2738C>G"	"r.(?)"	"p.(Pro913Arg)"	"19"	""
"0000479767"	"00024242"	"70"	"2746"	"0"	"2746"	"0"	"c.2746G>T"	"r.(?)"	"p.(Val916Phe)"	"19"	""
"0000479768"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000479769"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000479770"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000479771"	"00024242"	"70"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.(?)"	"p.(Cys103Gly)"	"2"	""
"0000479772"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479773"	"00024242"	"90"	"379"	"0"	"380"	"0"	"c.379_380del"	"r.(?)"	"p.(Cys127Leufs*18)"	"2"	""
"0000479774"	"00024242"	"70"	"461"	"0"	"469"	"0"	"c.461_469del"	"r.(?)"	"p.(Arg154_Thr156del)"	"2"	""
"0000479775"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	"2"	""
"0000479776"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	"2"	""
"0000479777"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479778"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479779"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479780"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479781"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479782"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479783"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479784"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479785"	"00024242"	"90"	"546"	"1"	"546"	"1"	"c.546+1G>T"	"r.spl"	"p.?"	"2i"	""
"0000479786"	"00024242"	"70"	"546"	"0"	"546"	"0"	"c.546G>C"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000479787"	"00024242"	"50"	"623"	"0"	"623"	"0"	"c.623T>C"	"r.(?)"	"p.(Leu208Pro)"	"3"	""
"0000479788"	"00024242"	"90"	"634"	"0"	"634"	"0"	"c.634G>T"	"r.(?)"	"p.(Glu212*)"	"3"	""
"0000479789"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479790"	"00024242"	"70"	"655"	"0"	"655"	"0"	"c.655G>A"	"r.(?)"	"p.(Gly219Arg)"	"3"	""
"0000479791"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>C"	"r.spl"	"p.?"	"3i"	""
"0000479792"	"00024242"	"50"	"701"	"0"	"701"	"0"	"c.701C>A"	"r.(?)"	"p.(Thr234Lys)"	"4"	""
"0000479793"	"00024242"	"50"	"719"	"0"	"719"	"0"	"c.719T>C"	"r.(?)"	"p.(Phe240Ser)"	"4"	""
"0000479794"	"00024242"	"50"	"737"	"0"	"737"	"0"	"c.737T>G"	"r.(?)"	"p.(Leu246Arg)"	"4"	""
"0000479795"	"00024242"	"50"	"743"	"0"	"743"	"0"	"c.743T>G"	"r.(?)"	"p.(Leu248Arg)"	"4"	""
"0000479796"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000479797"	"00024242"	"90"	"794"	"0"	"794"	"0"	"c.794del"	"r.(?)"	"p.(Ser265Ilefs*3)"	"4"	""
"0000479798"	"00024242"	"90"	"836"	"0"	"836"	"0"	"c.836G>A"	"r.(?)"	"p.(Trp279*)"	"4"	""
"0000479799"	"00024242"	"50"	"844"	"0"	"844"	"0"	"c.844G>C"	"r.(?)"	"p.(Asp282His)"	"4"	""
"0000479800"	"00024242"	"70"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	"5"	""
"0000479801"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000479802"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000479803"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000479804"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	""
"0000479805"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	""
"0000479806"	"00024242"	"70"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	"5"	""
"0000479807"	"00024242"	"70"	"923"	"0"	"923"	"0"	"c.923A>C"	"r.(?)"	"p.(His308Pro)"	"5"	""
"0000479808"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479809"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479810"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479811"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000479812"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479813"	"00024242"	"70"	"1447"	"0"	"1447"	"0"	"c.1447G>A"	"r.(?)"	"p.(Gly483Arg)"	"10"	""
"0000479814"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479815"	"00024242"	"70"	"1905"	"0"	"1905"	"0"	"c.1905C>A"	"r.(?)"	"p.(Asn635Lys)"	"14"	""
"0000479816"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000479817"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	"2"	""
"0000479818"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>A"	"r.spl"	"p.?"	"10i"	""
"0000479819"	"00024242"	"70"	"1222"	"0"	"1222"	"0"	"c.1222A>G"	"r.(?)"	"p.(Met408Val)"	"8"	""
"0000479820"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479821"	"00024242"	"70"	"1106"	"0"	"1106"	"0"	"c.1106T>C"	"r.(?)"	"p.(Leu369Pro)"	"7"	""
"0000479822"	"00024242"	"50"	"1120"	"0"	"1120"	"0"	"c.1120T>C"	"r.(?)"	"p.(Cys374Arg)"	"7"	""
"0000479823"	"00024242"	"70"	"1666"	"0"	"1666"	"0"	"c.1666A>G"	"r.(?)"	"p.(Thr556Ala)"	"12"	""
"0000479824"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479825"	"00024242"	"50"	"1930"	"0"	"1930"	"0"	"c.1930G>C"	"r.(?)"	"p.(Ala644Pro)"	"14"	""
"0000479826"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000479827"	"00024242"	"70"	"1841"	"0"	"1841"	"0"	"c.1841C>A"	"r.(?)"	"p.(Thr614Lys)"	"13"	""
"0000479828"	"00024242"	"70"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000479829"	"00024242"	"70"	"1942"	"0"	"1942"	"0"	"c.1942G>A"	"r.(?)"	"p.(Gly648Ser)"	"14"	""
"0000479830"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479831"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000479832"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl"	"p.?"	"10i"	""
"0000479833"	"00024242"	"70"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	"14"	""
"0000479834"	"00024242"	"70"	"1802"	"0"	"1802"	"0"	"c.1802C>T"	"r.(?)"	"p.(Ser601Leu)"	"13"	""
"0000479835"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479836"	"00024242"	"70"	"1375"	"0"	"1375"	"0"	"c.1375G>A"	"r.(?)"	"p.(Asp459Asn)"	"9"	""
"0000479837"	"00024242"	"70"	"1370"	"0"	"1370"	"0"	"c.1370C>T"	"r.(?)"	"p.(Pro457Leu)"	"9"	""
"0000479838"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479839"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479840"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000479841"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479842"	"00024242"	"50"	"2647"	"-7"	"2647"	"-7"	"c.2647-7G>A"	"r.spl?"	"p.(=)"	"18i"	""
"0000479843"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479844"	"00024242"	"50"	"2800"	"-4"	"2800"	"-4"	"c.2800-4C>G"	"r.spl?"	"p.(?)"	"19i"	""
"0000479845"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl"	"p.?"	"18i"	""
"0000479846"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000479847"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	"2"	""
"0000479848"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479849"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479850"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479851"	"00024242"	"90"	"2432"	"0"	"2432"	"0"	"c.2432del"	"r.(?)"	"p.(Leu811Argfs*37)"	"17"	""
"0000479852"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000479853"	"00024242"	"70"	"1408"	"0"	"1410"	"0"	"c.1408_1410del"	"r.(?)"	"p.(Asn470del)"	"9"	""
"0000479854"	"00024242"	"70"	"2228"	"0"	"2228"	"0"	"c.2228A>G"	"r.(?)"	"p.(Gln743Arg)"	"16"	""
"0000479855"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>T"	"r.[=, 1438_1551del]"	"p.[=, Val480_Ile517del]"	"10i"	""
"0000479856"	"00024242"	"50"	"2012"	"0"	"2012"	"0"	"c.2012T>A"	"r.(?)"	"p.(Met671Lys)"	"14"	""
"0000479857"	"00024242"	"50"	"1544"	"0"	"1544"	"0"	"c.1544T>A"	"r.(?)"	"p.(Met515Lys)"	"10"	""
"0000479858"	"00024242"	"90"	"1822"	"0"	"1822"	"0"	"c.1822C>T"	"r.(?)"	"p.(Arg608*)"	"13"	""
"0000479859"	"00024242"	"50"	"2177"	"0"	"2177"	"0"	"c.2177C>G"	"r.(?)"	"p.(Pro726Arg)"	"15"	""
"0000479860"	"00024242"	"90"	"2326"	"0"	"2326"	"0"	"c.2326C>T"	"r.(?)"	"p.(Gln776*)"	"16"	""
"0000479861"	"00024242"	"90"	"1582"	"0"	"1583"	"0"	"c.1582_1583del"	"r.(?)"	"p.(Gly528Leufs*2)"	"11"	""
"0000479862"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000479863"	"00024242"	"70"	"2407"	"0"	"2412"	"0"	"c.2407_2412del"	"r.(?)"	"p.(Gln803_Trp804del)"	"17"	""
"0000479864"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479865"	"00024242"	"50"	"2171"	"0"	"2171"	"0"	"c.2171C>A"	"r.(?)"	"p.(Ala724Asp)"	"15"	""
"0000479866"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479867"	"00024242"	"70"	"1441"	"0"	"1441"	"0"	"c.1441T>C"	"r.(?)"	"p.(Trp481Arg)"	"10"	""
"0000479868"	"00024242"	"70"	"1555"	"0"	"1555"	"0"	"c.1555A>G"	"r.(?)"	"p.(Met519Val)"	"11"	""
"0000479869"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479870"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479871"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479872"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000479873"	"00024242"	"70"	"1669"	"0"	"1669"	"0"	"c.1669A>T"	"r.(?)"	"p.(Ile557Phe)"	"12"	""
"0000479874"	"00024242"	"90"	"1705"	"0"	"1705"	"0"	"c.1705dup"	"r.(?)"	"p.(tyr569Leufs*67)"	"12"	""
"0000479875"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479876"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479877"	"00024242"	"50"	"1978"	"0"	"1978"	"0"	"c.1978C>T"	"r.(?)"	"p.(Arg660Cys)"	"14"	""
"0000479878"	"00024242"	"70"	"1843"	"0"	"1843"	"0"	"c.1843G>A"	"r.(?)"	"p.(Gly615Arg)"	"13"	""
"0000479879"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479880"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479881"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479882"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479883"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479884"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479885"	"00024242"	"90"	"1551"	"1"	"1551"	"1"	"c.1551+1G>C"	"r.spl"	"p.?"	"10i"	""
"0000479886"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479887"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479888"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000479889"	"00024242"	"90"	"1827"	"0"	"1827"	"0"	"c.1827C>G"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000479890"	"00024242"	"90"	"685"	"0"	"686"	"0"	"c.685_686insCGGC"	"r.(?)"	"p.(Arg229Profs*102)"	"3"	""
"0000479891"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479892"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479893"	"00024242"	"50"	"2799"	"4"	"2799"	"4"	"c.2799+4A>G"	"r.spl?"	"p.(?)"	"19i"	""
"0000479894"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000479895"	"00024242"	"90"	"1755"	"-1"	"1755"	"-1"	"c.1755-1G>A"	"r.spl"	"p.?"	"12i"	""
"0000479896"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479897"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479898"	"00024242"	"90"	"2140"	"0"	"2140"	"0"	"c.2140del"	"r.(?)"	"p.(His714Thrfs*50)"	"15"	""
"0000479899"	"00024242"	"90"	"2161"	"0"	"2161"	"0"	"c.2161G>T"	"r.(?)"	"p.(Glu721*)"	"15"	""
"0000479900"	"00024242"	"50"	"2297"	"0"	"2297"	"0"	"c.2297A>G"	"r.(?)"	"p.(Tyr766Cys)"	"16"	""
"0000479901"	"00024242"	"70"	"1781"	"0"	"1781"	"0"	"c.1781G>A"	"r.(?)"	"p.(Arg594His)"	"13"	""
"0000479902"	"00024242"	"70"	"1781"	"0"	"1781"	"0"	"c.1781G>A"	"r.(?)"	"p.(Arg594His)"	"13"	""
"0000479903"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479904"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479905"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479906"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479907"	"00024242"	"90"	"1725"	"0"	"1725"	"0"	"c.1725C>A"	"r.(?)"	"p.(Tyr575*)"	"12"	""
"0000479908"	"00024242"	"50"	"1993"	"0"	"1993"	"0"	"c.1993G>A"	"r.(?)"	"p.(Gly665Arg)"	"14"	""
"0000479909"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479910"	"00024242"	"70"	"1704"	"0"	"1704"	"0"	"c.1704C>G"	"r.(?)"	"p.(His568Gln)"	"12"	""
"0000479911"	"00024242"	"70"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	"13"	""
"0000479912"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479913"	"00024242"	"90"	"2041"	"-2"	"2041"	"-2"	"c.2041-2A>C"	"r.spl"	"p.?"	"14i"	""
"0000479914"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479915"	"00024242"	"90"	"2432"	"0"	"2432"	"0"	"c.2432del"	"r.(?)"	"p.(Leu811Argfs*37)"	"17"	""
"0000479916"	"00024242"	"90"	"2600"	"0"	"2604"	"0"	"c.2600_2604delinsA"	"r.(?)"	"p.(Val867Glufs*19)"	"18"	""
"0000479917"	"00024242"	"50"	"2132"	"0"	"2132"	"0"	"c.2132C>G"	"r.(?)"	"p.(Thr711Arg)"	"15"	""
"0000479918"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000479919"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479920"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000479921"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000479922"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479923"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479924"	"00024242"	"70"	"1941"	"0"	"1941"	"0"	"c.1941C>G"	"r.(?)"	"p.(Cys647Trp)"	"14"	""
"0000479925"	"00024242"	"70"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	"14"	""
"0000479926"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>T"	"r.(?)"	"p.(Arg702Leu)"	"15"	""
"0000479927"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479928"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479929"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	"14"	""
"0000479930"	"00024242"	"50"	"136"	"0"	"136"	"0"	"c.136T>C"	"r.(?)"	"p.(Ser46Pro)"	"2"	""
"0000479931"	"00024242"	"50"	"1846"	"0"	"1846"	"0"	"c.1846G>A"	"r.(?)"	"p.(Asp616Asn)"	"13"	""
"0000479932"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479933"	"00024242"	"70"	"1912"	"0"	"1912"	"0"	"c.1912G>T"	"r.(?)"	"p.(Gly638Trp)"	"14"	""
"0000479934"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479935"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479936"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479937"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479938"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479939"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000479940"	"00024242"	"70"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	"14"	""
"0000479941"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834Argfs*49)"	"18"	""
"0000479942"	"00024242"	"70"	"1913"	"0"	"1913"	"0"	"c.1913G>T"	"r.(?)"	"p.(Gly638Val)"	"14"	""
"0000479943"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>A"	"r.(?)"	"p.(Arg702His)"	"15"	""
"0000479944"	"00024242"	"50"	"2040"	"0"	"2040"	"0"	"c.2040G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000479945"	"00024242"	"50"	"2040"	"0"	"2040"	"0"	"c.2040G>A"	"r.(?)"	"p.(=)"	"14"	""
"0000479946"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	"15"	""
"0000479947"	"00024242"	"90"	"236"	"0"	"246"	"0"	"c.236_246del"	"r.(?)"	"p.(Pro79Argfs*13)"	"2"	""
"0000479948"	"00024242"	"90"	"2242"	"0"	"2242"	"0"	"c.2242dup"	"r.(?)"	"p.(Glu748Glyfs*48)"	"16"	""
"0000479949"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834Argfs*49)"	"18"	""
"0000479950"	"00024242"	"70"	"2702"	"0"	"2702"	"0"	"c.2702T>A"	"r.(?)"	"p.(Leu901Gln)"	"19"	""
"0000479951"	"00024242"	"50"	"1960"	"0"	"1960"	"0"	"c.1960T>C"	"r.(?)"	"p.(Ser654Pro)"	"14"	""
"0000479952"	"00024242"	"70"	"2024"	"0"	"2026"	"0"	"c.2024_2026del"	"r.(?)"	"p.(Asn675del)"	"14"	""
"0000479953"	"00024242"	"70"	"2024"	"0"	"2026"	"0"	"c.2024_2026del"	"r.(?)"	"p.(Asn675del)"	"14"	""
"0000479954"	"00024242"	"70"	"2024"	"0"	"2026"	"0"	"c.2024_2026del"	"r.(?)"	"p.(Asn675del)"	"14"	""
"0000479955"	"00024242"	"90"	"2040"	"1"	"2040"	"1"	"c.2040+1G>T"	"r.spl"	"p.?"	"14i"	""
"0000479956"	"00024242"	"50"	"2174"	"0"	"2174"	"0"	"c.2174G>C"	"r.(?)"	"p.(Arg725Pro)"	"15"	""
"0000479957"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479958"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479959"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479960"	"00024242"	"90"	"2274"	"0"	"2274"	"0"	"c.2274dup"	"r.(?)"	"p.(Gly759Argfs*37)"	"16"	""
"0000479961"	"00024242"	"50"	"2303"	"0"	"2303"	"0"	"c.2303C>T"	"r.(?)"	"p.(Pro768Leu)"	"16"	""
"0000479962"	"00024242"	"90"	"2380"	"0"	"2380"	"0"	"c.2380del"	"r.(?)"	"p.(Arg794Valfs*12)"	"17"	""
"0000479963"	"00024242"	"90"	"2380"	"0"	"2380"	"0"	"c.2380del"	"r.(?)"	"p.(Arg794Valfs*12)"	"17"	""
"0000479964"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479965"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479966"	"00024242"	"90"	"2841"	"0"	"2841"	"0"	"c.2841dup"	"r.(?)"	"p.(Leu948Serfs*70)"	"20"	""
"0000479967"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479968"	"00024242"	"70"	"2189"	"459"	"3405"	"0"	"c.2189+459_3405del"	"r.?"	"p.(Glu730_Cys952del)"	"15i_"	""
"0000479969"	"00024242"	"90"	"2385"	"0"	"2385"	"0"	"c.2385del"	"r.(?)"	"p.(Glu795Aspfs*11)"	"17"	""
"0000479970"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479971"	"00024242"	"90"	"2512"	"0"	"2512"	"0"	"c.2512C>T"	"r.(?)"	"p.(Gln838*)"	"18"	""
"0000479972"	"00024242"	"50"	"2167"	"0"	"2167"	"0"	"c.2167G>A"	"r.(?)"	"p.(Val723Met)"	"15"	""
"0000479973"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479974"	"00024242"	"70"	"2237"	"0"	"2237"	"0"	"c.2237G>C"	"r.(?)"	"p.(Trp746Ser)"	"16"	""
"0000479975"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000479976"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479977"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000479978"	"00024242"	"50"	"2647"	"-7"	"2647"	"-7"	"c.2647-7G>A"	"r.spl?"	"p.(=)"	"18i"	""
"0000479979"	"00024242"	"90"	"377"	"0"	"377"	"0"	"c.377G>A"	"r.(?)"	"p.(Trp126*)"	"2"	""
"0000479980"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000479981"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479982"	"00024242"	"50"	"2639"	"0"	"2639"	"0"	"c.2639C>A"	"r.(?)"	"p.(Ala880Asp)"	"18"	""
"0000479983"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl"	"p.?"	"18i"	""
"0000479984"	"00024242"	"70"	"2707"	"0"	"2709"	"0"	"c.2707_2709del"	"r.(?)"	"p.(Lys903del)"	"19"	""
"0000479985"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000479986"	"00024242"	"50"	"2846"	"0"	"2846"	"0"	"c.2846T>A"	"r.(?)"	"p.(Val949Asp)"	"20"	""
"0000479987"	"00024242"	"50"	"2331"	"4"	"2331"	"4"	"c.2331+4A>G"	"r.spl?"	"p.?"	"16i"	""
"0000479988"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000479989"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	""
"0000479990"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	"2"	""
"0000479991"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000479992"	"00024242"	"90"	"1076"	"-1"	"1076"	"-1"	"c.1076-1G>C"	"r.spl"	"p.?"	"6i"	""
"0000479993"	"00024242"	"70"	"1445"	"0"	"1445"	"0"	"c.1445C>T"	"r.(?)"	"p.(Pro482Leu)"	"10"	""
"0000479994"	"00024242"	"50"	"1796"	"0"	"1796"	"0"	"c.1796C>T"	"r.(?)"	"p.(Ser599Phe)"	"13"	""
"0000479995"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479996"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000479997"	"00024242"	"90"	"2501"	"0"	"2502"	"0"	"c.2501_2502del"	"r.(?)"	"p.(Thr834Argfs*49)"	"18"	""
"0000479998"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000479999"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000480000"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000480001"	"00024242"	"70"	"923"	"0"	"923"	"0"	"c.923A>C"	"r.(?)"	"p.(His308Pro)"	"5"	""
"0000480002"	"00024242"	"90"	"1411"	"0"	"1414"	"0"	"c.1411_1414del"	"r.(?)"	"p.(Glu471Profs*5)"	"9"	""
"0000480003"	"00024242"	"50"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Arg178His)"	"2"	""
"0000480004"	"00024242"	"50"	"811"	"0"	"811"	"0"	"c.811A>G"	"r.(?)"	"p.(Thr271Ala)"	"4"	""
"0000480005"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000480006"	"00024242"	"90"	"2227"	"0"	"2227"	"0"	"c.2227C>T"	"r.(?)"	"p.(Gln743*)"	"16"	""
"0000480007"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000480008"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000480009"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000480010"	"00024242"	"70"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	"7"	""
"0000480011"	"00024242"	"70"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	"10"	""
"0000480012"	"00024242"	"50"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	"7"	""
"0000480013"	"00024242"	"50"	"1209"	"0"	"1209"	"0"	"c.1209C>G"	"r.(?)"	"p.(Asn403Lys)"	"8"	""
"0000480014"	"00024242"	"90"	"1437"	"2"	"1437"	"2"	"c.1437+2T>C"	"r.[1327_1437del]"	"p.(Asp443_Lys479del)"	"9i"	""
"0000480015"	"00024242"	"50"	"1478"	"0"	"1478"	"0"	"c.1478C>T"	"r.(?)"	"p.(Pro493Leu)"	"10"	""
"0000480016"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	"10"	""
"0000480017"	"00024242"	"70"	"1556"	"0"	"1556"	"0"	"c.1556T>C"	"r.(?)"	"p.(Met519Thr)"	"11"	""
"0000480018"	"00024242"	"70"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	"11"	""
"0000480019"	"00024242"	"90"	"172"	"0"	"172"	"0"	"c.172C>T"	"r.(?)"	"p.(Gln58*)"	"2"	""
"0000480020"	"00024242"	"70"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	"12"	""
"0000480021"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000480022"	"00024242"	"90"	"1802"	"0"	"1802"	"0"	"c.1802C>A"	"r.(?)"	"p.(Ser601*)"	"13"	""
"0000480023"	"00024242"	"90"	"1826"	"0"	"1826"	"0"	"c.1826dup"	"r.(?)"	"p.(Tyr609*)"	"13"	""
"0000480024"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000480025"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000480026"	"00024242"	"70"	"2210"	"0"	"2210"	"0"	"c.2210C>A"	"r.(?)"	"p.(Thr737Asn)"	"16"	""
"0000480027"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000480028"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000480029"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000480030"	"00024242"	"70"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.(?)"	"p.(=), p.(?)"	"2"	""
"0000480031"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000480032"	"00024242"	"70"	"670"	"0"	"670"	"0"	"c.670C>T"	"r.(?)"	"p.(Arg224Trp)"	"3"	""
"0000480033"	"00024242"	"50"	"671"	"0"	"671"	"0"	"c.671G>C"	"r.(?)"	"p.(Arg224Pro)"	"3"	""
"0000480034"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000480035"	"00024242"	"90"	"1650"	"0"	"1650"	"0"	"c.1650dup"	"r.(?)"	"p.(Thr551Aspfs*85)"	"12"	""
"0000480036"	"00024242"	"90"	"1080"	"0"	"1080"	"0"	"c.1080C>G"	"r.(?)"	"p.(Tyr360*)"	"7"	""
"0000480037"	"00024242"	"90"	"2041"	"-1"	"2041"	"-1"	"c.2041-1G>A"	"r.spl"	"p.?"	"14i"	""
"0000480038"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000480039"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000480040"	"00024242"	"50"	"2171"	"0"	"2171"	"0"	"c.2171C>A"	"r.(?)"	"p.(Ala724Asp)"	"15"	""
"0000480041"	"00024242"	"50"	"547"	"-67"	"547"	"-67"	"c.547-67C>G"	"r.(=)"	"p.(?)"	"2i"	""
"0000480042"	"00024242"	"70"	"1447"	"0"	"1447"	"0"	"c.1447G>A"	"r.(?)"	"p.(Gly483Arg)"	"10"	""
"0000480043"	"00024242"	"90"	"2646"	"2"	"2646"	"2"	"c.2646+2T>A"	"r.spl"	"p.?"	"18i"	""
"0000480044"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000480045"	"00024242"	"70"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	"12"	""
"0000480046"	"00024242"	"70"	"1796"	"0"	"1796"	"0"	"c.1796C>A"	"r.(?)"	"p.(Ser599Tyr)"	"13"	""
"0000480047"	"00024242"	"70"	"1799"	"0"	"1799"	"0"	"c.1799G>A"	"r.(?)"	"p.(Arg600His)"	"13"	""
"0000480048"	"00024242"	"70"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	"4"	""
"0000480049"	"00024242"	"70"	"923"	"0"	"923"	"0"	"c.923A>C"	"r.(?)"	"p.(His308Pro)"	"5"	""
"0000480050"	"00024242"	"70"	"1064"	"0"	"1064"	"0"	"c.1064T>C"	"r.(?)"	"p.(Leu355Pro)"	"6"	""
"0000480051"	"00024242"	"70"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	"14"	""
"0000480052"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000480053"	"00024242"	"90"	"763"	"0"	"763"	"0"	"c.763C>T"	"r.(?)"	"p.(Gln255*)"	"4"	""
"0000480054"	"00024242"	"70"	"1645"	"0"	"1645"	"0"	"c.1645G>C"	"r.(?)"	"p.(Gly549Arg)"	"12"	""
"0000480055"	"00024242"	"50"	"1211"	"0"	"1211"	"0"	"c.1211A>G"	"r.(?)"	"p.(Asp404Gly)"	"8"	""
"0000480056"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000480057"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000480058"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000480059"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.(Gly293Arg)"	"5"	""
"0000480060"	"00024242"	"90"	"1687"	"0"	"1687"	"0"	"c.1687C>T"	"r.(?)"	"p.(Gln563*)"	"12"	""
"0000480061"	"00024242"	"90"	"1687"	"0"	"1687"	"0"	"c.1687C>T"	"r.(?)"	"p.(Gln563*)"	"12"	""
"0000480062"	"00024242"	"90"	"1754"	"1"	"1754"	"1"	"c.1754+1G>A"	"r.spl"	"p.?"	"12i"	""
"0000480063"	"00024242"	"70"	"761"	"0"	"761"	"0"	"c.761C>T"	"r.(?)"	"p.(Ser254Leu)"	"4"	""
"0000480064"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000480065"	"00024242"	"70"	"1124"	"0"	"1124"	"0"	"c.1124G>T"	"r.(?)"	"p.(Arg375Leu)"	"7"	""
"0000480066"	"00024242"	"90"	"1356"	"0"	"1356"	"0"	"c.1356del"	"r.(?)"	"p.(Ser454Alafs*23)"	"9"	""
"0000480067"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396del"	"r.(?)"	"p.(Val466Phefs*11)"	"9"	""
"0000480068"	"00024242"	"70"	"1561"	"0"	"1561"	"0"	"c.1561G>C"	"r.(?)"	"p.(Glu521Gln)"	"11"	""
"0000480069"	"00024242"	"70"	"1564"	"0"	"1564"	"0"	"c.1564C>G"	"r.(?)"	"p.(Pro522Ala)"	"11"	""
"0000480070"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000480071"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000480072"	"00024242"	"70"	"1309"	"0"	"1309"	"0"	"c.1309C>T"	"r.(?)"	"p.(Arg437Cys)"	"8"	""
"0000480073"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000480074"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	"8"	""
"0000480075"	"00024242"	"70"	"2105"	"0"	"2105"	"0"	"c.2105G>A"	"r.(?)"	"p.(Arg702His)"	"15"	""
"0000480076"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000480077"	"00024242"	"90"	"2188"	"0"	"2188"	"0"	"c.2188G>T"	"r.(?)"	"p.(Glu730*)"	"15"	""
"0000480078"	"00024242"	"90"	"1354"	"0"	"1372"	"0"	"c.1354_1372del"	"r.(?)"	"p.(Ala452Thrfs*19)"	"9"	""
"0000480079"	"00024242"	"90"	"2237"	"0"	"2237"	"0"	"c.2237G>A"	"r.(?)"	"p.(Trp746*)"	"16"	""
"0000480080"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000480081"	"00024242"	"90"	"2662"	"0"	"2662"	"0"	"c.2662G>T"	"r.(?)"	"p.(Glu888*)"	"19"	""
"0000480082"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000480083"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	"16"	""
"0000480084"	"00024242"	"70"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.(?)"	"p.(Arg600Cys)"	"13"	""
"0000480085"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000480086"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	"13"	""
"0000480087"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854*)"	"18"	""
"0000480088"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000480089"	"00024242"	"90"	"1128"	"0"	"1129"	"0"	"c.1128_1129delinsC"	"r.(?)"	"p.(Trp376Cysfs*16)"	"7"	""
"0000480090"	"00024242"	"70"	"1375"	"0"	"1375"	"0"	"c.1375G>A"	"r.(?)"	"p.(Asp459Asn)"	"9"	""
"0000480091"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000480092"	"00024242"	"70"	"2014"	"0"	"2014"	"0"	"c.2014C>T"	"r.(?)"	"p.(Arg672Trp)"	"14"	""
"0000480093"	"00024242"	"90"	"2269"	"0"	"2269"	"0"	"c.2269C>T"	"r.(?)"	"p.(Gln757*)"	"16"	""
"0000480094"	"00024242"	"90"	"2481"	"110"	"2646"	"39"	"c.2481+110_2646+39del"	"r.2482_2646del"	"p.(Gly828_Asn882del)"	"17i"	""
"0000480095"	"00024242"	"90"	"1822"	"0"	"1822"	"0"	"c.1822C>T"	"r.(?)"	"p.(Arg608*)"	"13"	""
"0000480096"	"00024242"	"70"	"1716"	"0"	"1716"	"0"	"c.1716C>G"	"r.(?)"	"p.(His572Gln)"	"12"	""
"0000480097"	"00024242"	"90"	"1497"	"0"	"1497"	"0"	"c.1497G>A"	"r.(?)"	"p.(Trp499*)"	"10"	""
"0000480098"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000480099"	"00024242"	"70"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	"12"	""
"0000480100"	"00024242"	"90"	"2815"	"0"	"2816"	"0"	"c.2815_2816del"	"r.(?)"	"p.(Val939Leufs*78)"	"20"	""
"0000480101"	"00024242"	"70"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	"5"	""
"0000480102"	"00024242"	"90"	"2431"	"0"	"2431"	"0"	"c.2431del"	"r.(?)"	"p.(Leu811Trpfs*37)"	"17"	""
"0000480103"	"00024242"	"70"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	"14"	""
"0000480104"	"00024242"	"70"	"761"	"0"	"761"	"0"	"c.761C>T"	"r.(?)"	"p.(Ser254Leu)"	"4"	""
"0000480105"	"00024242"	"50"	"1880"	"0"	"1880"	"0"	"c.1880C>T"	"r.(?)"	"p.(Ser627Phe)"	"13"	""
"0000480106"	"00024242"	"70"	"761"	"0"	"761"	"0"	"c.761C>T"	"r.(?)"	"p.(Ser254Leu)"	"4"	""
"0000480107"	"00024242"	"50"	"1958"	"0"	"1958"	"0"	"c.1958C>A"	"r.(?)"	"p.(Thr653Asn)"	"14"	""
"0000487412"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>A"	"r.[-32_486del, -32_546del]"	"p.0?"	"1i"	""
"0000487413"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>G"	"r.[-32_486del, -32_546del]"	"p.0?"	"1i"	""
"0000487414"	"00024242"	"90"	"-32"	"-2"	"-32"	"-2"	"c.-32-2A>G"	"r.[-32_486del, -32_546del]"	"p.0?"	"1i"	""
"0000487415"	"00024242"	"90"	"1"	"0"	"1"	"0"	"c.1A>T"	"r.[1a>u, -32_486del, -32_546del]"	"p.0?"	"2"	""
"0000487416"	"00024242"	"90"	"2"	"0"	"2"	"0"	"c.2T>C"	"r.2u>c"	"p.0?"	"2"	""
"0000487417"	"00024242"	"90"	"32"	"0"	"32"	"0"	"c.32G>A"	"r.[32g>a, -32_486del, -32_546del]"	"p.[Arg11Gln, 0?]"	"2"	""
"0000487418"	"00024242"	"90"	"54"	"0"	"54"	"0"	"c.54C>T"	"r.[54c>u, -32_486del, -32_546del]"	"p.[Leu18=, 0?]"	"2"	""
"0000487419"	"00024242"	"50"	"199"	"0"	"199"	"0"	"c.199G>A"	"r.199g>a"	"p.Arg67Asn"	"2"	""
"0000487420"	"00024242"	"90"	"241"	"0"	"241"	"0"	"c.241C>T"	"r.[241g>u, -32_486del, -32_546del]"	"p.[Gln81*, 0?]"	"2"	""
"0000487421"	"00024242"	"90"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.[271g>a, -32_486del, -32_546del]"	"p.[Asp91=, 0?]"	"2"	""
"0000487422"	"00024242"	"90"	"307"	"0"	"307"	"0"	"c.307T>C"	"r.[307u>c, –32_486del, -32_546del]"	"p.[Cys103Arg, 0?]"	"2"	""
"0000487423"	"00024242"	"50"	"307"	"0"	"307"	"0"	"c.307T>G"	"r.307u>g"	"p.Cys103Gly"	"2"	""
"0000487424"	"00024242"	"50"	"323"	"0"	"323"	"0"	"c.323G>A"	"r.323g>a"	"p.Cys108Ser"	"2"	""
"0000487425"	"00024242"	"90"	"343"	"0"	"343"	"0"	"c.343C>T"	"r.[343c>u, -32_486del, -32_546del]"	"p.[Gln115*, 0?]"	"2"	""
"0000487426"	"00024242"	"10"	"363"	"0"	"363"	"0"	"c.363G>A"	"r.363g>a"	"p.Gln12="	"2"	""
"0000487427"	"00024242"	"50"	"503"	"0"	"503"	"0"	"c.503G>A"	"r.503g>a"	"p.Arg168Gln"	"2"	""
"0000487428"	"00024242"	"90"	"503"	"0"	"503"	"0"	"c.503G>C"	"r.[503g>c, -32_486del, -32_546del]"	"p.[Arg168Pro, 0?]"	"2"	""
"0000487429"	"00024242"	"50"	"506"	"0"	"506"	"0"	"c.506T>C"	"r.506u>c"	"p.Leu169Pro"	"2"	""
"0000487430"	"00024242"	"50"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.533g>a"	"p.Arg78His"	"2"	""
"0000487431"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>A"	"r.-32_546del"	"p.0?"	"2"	""
"0000487432"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>C"	"r.-32_546del"	"p.0?"	"2"	""
"0000487433"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.-32_546del"	"p.0?"	"2"	""
"0000487434"	"00024242"	"90"	"546"	"1"	"546"	"1"	"c.546+1G>T"	"r.-32_546del"	"p.0?"	"2"	""
"0000487435"	"00024242"	"90"	"546"	"2"	"546"	"2"	"c.546+2T>C"	"r.-32_546del"	"p.0?"	"2i"	""
"0000487436"	"00024242"	"90"	"546"	"2"	"546"	"5"	"c.546+2_546+5del"	"r.-32_546del"	"p.0?"	"2i"	""
"0000487437"	"00024242"	"90"	"546"	"5"	"546"	"5"	"c.546+5G>T"	"r.-32_546del"	"p.0?"	"2i"	""
"0000487438"	"00024242"	"10"	"546"	"24"	"546"	"24"	"c.546+24G>A"	"r.="	"p.="	"2i"	""
"0000487439"	"00024242"	"10"	"546"	"45"	"546"	"45"	"c.546+45G>C"	"r.="	"p.="	"2i"	""
"0000500691"	"00024242"	"50"	"665"	"0"	"665"	"0"	"c.665T>G"	"r.(?)"	"p.(Val222Gly)"	""	""
"0000500692"	"00024242"	"50"	"692"	"0"	"692"	"0"	"c.692T>C"	"r.(?)"	"p.(Leu231Pro)"	""	""
"0000500693"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>T"	"r.spl"	"p.?"	""	""
"0000500694"	"00024242"	"90"	"693"	"-2"	"693"	"-2"	"c.693-2A>C"	"r.spl"	"p.?"	""	""
"0000500695"	"00024242"	"90"	"766"	"0"	"784"	"0"	"c.766_784del"	"r.(?)"	"p.(Tyr256Serfs*6)"	""	""
"0000500696"	"00024242"	"70"	"878"	"0"	"878"	"0"	"c.878G>T"	"r.(?)"	"p.(Gly293Val)"	""	""
"0000500697"	"00024242"	"50"	"930"	"0"	"932"	"0"	"c.930_932del"	"r.(?)"	"p.(Phe311del)"	""	""
"0000500698"	"00024242"	"50"	"950"	"0"	"950"	"0"	"c.950C>T"	"r.(?)"	"p.(Ala317Val)"	""	""
"0000500699"	"00024242"	"90"	"994"	"0"	"995"	"0"	"c.994_995insTT"	"r.(?)"	"p.(Ser332Phefs*61)"	""	""
"0000500700"	"00024242"	"70"	"1109"	"0"	"1109"	"0"	"c.1109G>A"	"r.(?)"	"p.(Gly370Asp)"	""	""
"0000500701"	"00024242"	"70"	"1114"	"0"	"1114"	"0"	"c.1114C>G"	"r.(?)"	"p.(His372Asp)"	""	""
"0000500702"	"00024242"	"70"	"1114"	"0"	"1114"	"0"	"c.1114C>T"	"r.(?)"	"p.(His372Tyr)"	""	""
"0000500703"	"00024242"	"70"	"1121"	"0"	"1121"	"0"	"c.1121G>A"	"r.(?)"	"p.(Cys374Tyr)"	""	""
"0000500704"	"00024242"	"70"	"1211"	"0"	"1211"	"0"	"c.1211A>T"	"r.(?)"	"p.(Asp404Val)"	""	""
"0000500705"	"00024242"	"90"	"1388"	"0"	"1406"	"0"	"c.1388_1406del"	"r.(?)"	"p.(Arg463Profs*8)"	""	""
"0000500853"	"00024242"	"50"	"1409"	"0"	"1409"	"0"	"c.1409A>G"	"r.(?)"	"p.(Asn470Ser)"	""	""
"0000500854"	"00024242"	"50"	"1477"	"0"	"1477"	"0"	"c.1477C>T"	"r.(?)"	"p.(Pro493Ser)"	""	""
"0000500855"	"00024242"	"50"	"1526"	"0"	"1526"	"0"	"c.1526A>T"	"r.(?)"	"p.(Gln509Leu)"	""	""
"0000500856"	"00024242"	"50"	"1559"	"0"	"1559"	"0"	"c.1559A>G"	"r.(?)"	"p.(Asn520Ser)"	""	""
"0000500857"	"00024242"	"50"	"1551"	"3"	"1551"	"3"	"c.1551+3A>T"	"r.spl?"	"p.?"	""	""
"0000500858"	"00024242"	"70"	"1670"	"0"	"1670"	"0"	"c.1670T>G"	"r.(?)"	"p.(Ile557Ser)"	""	""
"0000500859"	"00024242"	"90"	"1681"	"0"	"1699"	"0"	"c.1681_1699dup"	"r.(?)"	"p.(Thr567Lysfs*75)"	""	""
"0000500860"	"00024242"	"90"	"1754"	"1"	"1754"	"1"	"c.1754+1dup"	"r.spl"	"p.?"	""	""
"0000500861"	"00024242"	"70"	"1825"	"0"	"1825"	"0"	"c.1825T>G"	"r.(?)"	"p.(Tyr609Asp)"	""	""
"0000500862"	"00024242"	"90"	"1847"	"0"	"1847"	"0"	"c.1847dup"	"r.(?)"	"p.(Asp616Glufs*20)"	""	""
"0000500863"	"00024242"	"50"	"1839"	"0"	"1839"	"0"	"c.1839G>C"	"r.(?)"	"p.(Trp613Cys)"	""	""
"0000500864"	"00024242"	"50"	"1876"	"0"	"1878"	"0"	"c.1876_1878del"	"r.(?)"	"p.(Ser627del)"	""	""
"0000500865"	"00024242"	"90"	"1944"	"0"	"1950"	"0"	"c.1944_1950del"	"r.(?)"	"p.(Phe649Alafs*45)"	""	""
"0000500866"	"00024242"	"90"	"1961"	"0"	"1961"	"0"	"c.1961C>G"	"r.(?)"	"p.(Ser654*)"	""	""
"0000500867"	"00024242"	"50"	"2020"	"0"	"2020"	"0"	"c.2020C>T"	"r.(?)"	"p.(His674Tyr)"	""	""
"0000500868"	"00024242"	"90"	"2041"	"-2"	"2041"	"-2"	"c.2041-2A>G"	"r.spl"	"p.?"	""	""
"0000500869"	"00024242"	"90"	"2084"	"0"	"2084"	"0"	"c.2084dup"	"r.(?)"	"p.(Met695Ilefs*42)"	""	""
"0000500870"	"00024242"	"50"	"2096"	"0"	"2096"	"0"	"c.2096T>C"	"r.(?)"	"p.(Leu699Pro)"	""	""
"0000500872"	"00024242"	"90"	"2109"	"0"	"2109"	"0"	"c.2109del"	"r.(?)"	"p.(Tyr703*)"	""	""
"0000500873"	"00024242"	"50"	"2146"	"0"	"2146"	"0"	"c.2146G>C"	"r.(?)"	"p.(Ala716Pro)"	""	""
"0000500874"	"00024242"	"90"	"2153"	"0"	"2156"	"0"	"c.2153_2156delinsACGCCG"	"r.(?)"	"p.(Val718Aspfs*47)"	""	""
"0000500875"	"00024242"	"70"	"2237"	"0"	"2237"	"0"	"c.2237G>T"	"r.(?)"	"p.(Trp746Leu)"	""	""
"0000500876"	"00024242"	"50"	"2240"	"0"	"2240"	"0"	"c.2240G>A"	"r.(?)"	"p.(Gly747Glu)"	""	""
"0000500877"	"00024242"	"90"	"2261"	"0"	"2261"	"0"	"c.2261dup"	"r.(?)"	"p.(Val755Serfs*41)"	""	""
"0000500878"	"00024242"	"90"	"2261"	"0"	"2261"	"0"	"c.2261dup"	"r.(?)"	"p.(Val755Serfs*41)"	""	""
"0000500879"	"00024242"	"50"	"2331"	"101"	"2331"	"101"	"c.2331+101del"	"r.(=)"	"p.(=)"	""	""
"0000500880"	"00024242"	"90"	"2407"	"0"	"2407"	"0"	"c.2407C>T"	"r.(?)"	"p.(Gln803*)"	""	""
"0000500881"	"00024242"	"50"	"2459"	"0"	"2461"	"0"	"c.2459_2461del"	"r.(?)"	"p.(Ala820del)"	""	""
"0000500882"	"00024242"	"90"	"2460"	"0"	"2460"	"0"	"c.2460dup"	"r.(?)"	"p.(Gly821Trpfs*63)"	""	""
"0000500883"	"00024242"	"50"	"2480"	"0"	"2480"	"0"	"c.2480A>G"	"r.(?)"	"p.(Gln827Arg)"	""	""
"0000500884"	"00024242"	"90"	"2515"	"0"	"2515"	"0"	"c.2515C>T"	"r.(?)"	"p.(Gln839*)"	""	""
"0000500885"	"00024242"	"90"	"2619"	"0"	"2619"	"0"	"c.2619C>G"	"r.(?)"	"p.(Tyr873*)"	""	""
"0000500886"	"00024242"	"90"	"2655"	"0"	"2656"	"0"	"c.2655_2656del"	"r.(?)"	"p.(Val886Glufs*2)"	""	""
"0000500887"	"00024242"	"50"	"2720"	"0"	"2720"	"0"	"c.2720T>C"	"r.(?)"	"p.(Leu907Pro)"	""	""
"0000500888"	"00024242"	"90"	"2740"	"0"	"2740"	"0"	"c.2740dup"	"r.(?)"	"p.(Gln914Profs*104)"	""	""
"0000500890"	"00024242"	"90"	"2742"	"0"	"2742"	"0"	"c.2742dup"	"r.(?)"	"p.(Gln915Alafs*103)"	""	""
"0000500891"	"00024242"	"90"	"2757"	"0"	"2757"	"0"	"c.2757del"	"r.(?)"	"p.(Asn919Lysfs*24)"	""	""
"0000500892"	"00024242"	"90"	"2757"	"0"	"2757"	"0"	"c.2757del"	"r.(?)"	"p.(Asn919Lysfs*24)"	""	""
"0000500893"	"00024242"	"90"	"2800"	"-1"	"2800"	"-1"	"c.2800-1G>C"	"r.spl"	"p.?"	""	""
"0000563485"	"00024242"	"90"	"-4571"	"0"	"-4571"	"0"	"c.-4571del"	"r.(?)"	"p.(=)"	""	""
"0000563488"	"00024242"	"50"	"-2237"	"0"	"-2237"	"0"	"c.-2237G>A"	"r.(?)"	"p.(=)"	""	""
"0000563491"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.(=)"	"p.(=)"	"1i"	""
"0000563492"	"00024242"	"90"	"186"	"0"	"196"	"0"	"c.186_196dup"	"r.(?)"	"p.(Arg66HisfsTer80)"	""	""
"0000563495"	"00024242"	"50"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	""	""
"0000563496"	"00024242"	"10"	"324"	"0"	"324"	"0"	"c.324T>C"	"r.(?)"	"p.(Cys108=)"	""	""
"0000563497"	"00024242"	"10"	"447"	"0"	"447"	"0"	"c.447G>A"	"r.(?)"	"p.(Thr149=)"	""	""
"0000563498"	"00024242"	"30"	"447"	"0"	"447"	"0"	"c.447G>A"	"r.(?)"	"p.(Thr149=)"	""	""
"0000563499"	"00024242"	"30"	"447"	"0"	"447"	"0"	"c.447G>A"	"r.(?)"	"p.(Thr149=)"	""	""
"0000563500"	"00024242"	"90"	"465"	"0"	"465"	"0"	"c.465dup"	"r.(?)"	"p.(Thr156HisfsTer21)"	""	""
"0000563501"	"00024242"	"30"	"533"	"0"	"533"	"0"	"c.533G>A"	"r.(?)"	"p.(Arg178His)"	""	""
"0000563502"	"00024242"	"10"	"547"	"-39"	"547"	"-39"	"c.547-39T>G"	"r.(=)"	"p.(=)"	""	""
"0000563503"	"00024242"	"10"	"547"	"-39"	"547"	"-39"	"c.547-39T>G"	"r.(=)"	"p.(=)"	""	""
"0000563504"	"00024242"	"10"	"547"	"-4"	"547"	"-4"	"c.547-4C>G"	"r.spl?"	"p.?"	""	""
"0000563505"	"00024242"	"10"	"596"	"0"	"596"	"0"	"c.596A>G"	"r.(?)"	"p.(His199Arg)"	""	""
"0000563506"	"00024242"	"10"	"658"	"0"	"658"	"0"	"c.658G>T"	"r.(?)"	"p.(Val220Leu)"	""	""
"0000563507"	"00024242"	"50"	"658"	"0"	"658"	"0"	"c.658G>T"	"r.(?)"	"p.(Val220Leu)"	""	""
"0000563508"	"00024242"	"10"	"668"	"0"	"668"	"0"	"c.668G>A"	"r.(?)"	"p.(Arg223His)"	""	""
"0000563510"	"00024242"	"30"	"726"	"0"	"726"	"0"	"c.726G>A"	"r.(?)"	"p.(Ala242=)"	""	""
"0000563511"	"00024242"	"50"	"851"	"0"	"851"	"0"	"c.851C>T"	"r.(?)"	"p.(Ala284Val)"	""	""
"0000563513"	"00024242"	"10"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGCGGGC"	"r.(=)"	"p.(=)"	""	""
"0000563514"	"00024242"	"10"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGCGGGC"	"r.(=)"	"p.(=)"	""	""
"0000563515"	"00024242"	"30"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGCGGGC"	"r.(=)"	"p.(=)"	""	""
"0000563516"	"00024242"	"10"	"858"	"30"	"858"	"30"	"c.858+30T>C"	"r.(=)"	"p.(=)"	""	""
"0000563517"	"00024242"	"50"	"912"	"0"	"912"	"0"	"c.912C>T"	"r.(?)"	"p.(Gly304=)"	""	""
"0000563518"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(Ala307=)"	""	""
"0000563519"	"00024242"	"10"	"955"	"12"	"955"	"12"	"c.955+12G>A"	"r.(=)"	"p.(=)"	""	""
"0000563520"	"00024242"	"90"	"956"	"-2"	"956"	"-2"	"c.956-2A>G"	"r.spl?"	"p.?"	""	""
"0000563521"	"00024242"	"30"	"1075"	"13"	"1075"	"13"	"c.1075+13C>T"	"r.(=)"	"p.(=)"	""	""
"0000563522"	"00024242"	"50"	"1194"	"3"	"1194"	"3"	"c.1194+3G>C"	"r.spl?"	"p.?"	""	""
"0000563523"	"00024242"	"10"	"1203"	"0"	"1203"	"0"	"c.1203G>A"	"r.(?)"	"p.(Gln401=)"	""	""
"0000563524"	"00024242"	"10"	"1327"	"-18"	"1327"	"-18"	"c.1327-18A>G"	"r.(=)"	"p.(=)"	""	""
"0000563525"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(?)"	"p.(Tyr458=)"	""	""
"0000563526"	"00024242"	"10"	"1438"	"-19"	"1438"	"-19"	"c.1438-19G>C"	"r.(=)"	"p.(=)"	""	""
"0000563527"	"00024242"	"90"	"1551"	"3"	"1551"	"4"	"c.1551+3_1551+4insT"	"r.spl?"	"p.?"	""	""
"0000563528"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	""	""
"0000563529"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	""	""
"0000563530"	"00024242"	"10"	"1581"	"0"	"1581"	"0"	"c.1581G>A"	"r.(?)"	"p.(Arg527=)"	""	""
"0000563531"	"00024242"	"90"	"1634"	"0"	"1634"	"0"	"c.1634C>T"	"r.(?)"	"p.(Pro545Leu)"	""	""
"0000563532"	"00024242"	"90"	"1681"	"0"	"1699"	"0"	"c.1681_1699dup"	"r.(?)"	"p.(Thr567LysfsTer75)"	""	""
"0000563533"	"00024242"	"90"	"1802"	"0"	"1802"	"0"	"c.1802C>A"	"r.(?)"	"p.(Ser601Ter)"	""	""
"0000563534"	"00024242"	"30"	"1830"	"0"	"1830"	"0"	"c.1830C>T"	"r.(?)"	"p.(Ala610=)"	""	""
"0000563535"	"00024242"	"90"	"1853"	"0"	"1853"	"0"	"c.1853G>A"	"r.(?)"	"p.(Trp618Ter)"	""	""
"0000563536"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	""	""
"0000563537"	"00024242"	"50"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	""	""
"0000563538"	"00024242"	"90"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	""	""
"0000563539"	"00024242"	"10"	"2040"	"20"	"2040"	"20"	"c.2040+20A>G"	"r.(=)"	"p.(=)"	""	""
"0000563540"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	""	""
"0000563541"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	""	""
"0000563542"	"00024242"	"90"	"2078"	"0"	"2078"	"0"	"c.2078dup"	"r.(?)"	"p.(Ala694GlyfsTer43)"	""	""
"0000563543"	"00024242"	"50"	"2105"	"0"	"2105"	"0"	"c.2105G>A"	"r.(?)"	"p.(Arg702His)"	""	""
"0000563544"	"00024242"	"50"	"2312"	"0"	"2312"	"0"	"c.2312C>T"	"r.(?)"	"p.(Thr771Ile)"	""	""
"0000563545"	"00024242"	"10"	"2331"	"20"	"2331"	"20"	"c.2331+20G>A"	"r.(=)"	"p.(=)"	""	""
"0000563546"	"00024242"	"10"	"2338"	"0"	"2338"	"0"	"c.2338G>A"	"r.(?)"	"p.(Val780Ile)"	""	""
"0000563547"	"00024242"	"30"	"2392"	"0"	"2392"	"0"	"c.2392A>G"	"r.(?)"	"p.(Ile798Val)"	""	""
"0000563548"	"00024242"	"30"	"2481"	"16"	"2481"	"16"	"c.2481+16G>A"	"r.(=)"	"p.(=)"	""	""
"0000563549"	"00024242"	"30"	"2481"	"16"	"2481"	"16"	"c.2481+16G>A"	"r.(=)"	"p.(=)"	""	""
"0000563550"	"00024242"	"10"	"2482"	"-90"	"2482"	"-90"	"c.2482-90dup"	"r.(=)"	"p.(=)"	""	""
"0000563551"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(Gly851=)"	""	""
"0000563552"	"00024242"	"10"	"2553"	"0"	"2553"	"0"	"c.2553G>A"	"r.(?)"	"p.(Gly851=)"	""	""
"0000563553"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	""	""
"0000563554"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870Ter)"	""	""
"0000563555"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870Ter)"	""	""
"0000563556"	"00024242"	"30"	"2739"	"0"	"2739"	"0"	"c.2739C>G"	"r.(?)"	"p.(Pro913=)"	""	""
"0000563557"	"00024242"	"90"	"2740"	"0"	"2740"	"0"	"c.2740dup"	"r.(?)"	"p.(Gln914ProfsTer104)"	""	""
"0000563558"	"00024242"	"90"	"2742"	"0"	"2742"	"0"	"c.2742dup"	"r.(?)"	"p.(Gln915AlafsTer103)"	""	""
"0000577984"	"00024242"	"70"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000577985"	"00024242"	"70"	"877"	"0"	"877"	"0"	"c.877G>A"	"r.(?)"	"p.Gly293Arg"	""	""
"0000616880"	"00024242"	"50"	"134"	"0"	"134"	"0"	"c.134C>T"	"r.(?)"	"p.(Ser45Phe)"	""	""
"0000616881"	"00024242"	"30"	"265"	"0"	"265"	"0"	"c.265C>T"	"r.(?)"	"p.(Arg89Cys)"	""	""
"0000616882"	"00024242"	"50"	"420"	"0"	"420"	"0"	"c.420C>A"	"r.(?)"	"p.(Asn140Lys)"	""	""
"0000616883"	"00024242"	"30"	"631"	"0"	"631"	"0"	"c.631G>A"	"r.(?)"	"p.(Val211Met)"	""	""
"0000616884"	"00024242"	"50"	"896"	"0"	"896"	"0"	"c.896T>C"	"r.(?)"	"p.(Leu299Pro)"	""	""
"0000616886"	"00024242"	"30"	"1265"	"0"	"1265"	"0"	"c.1265G>A"	"r.(?)"	"p.(Arg422Gln)"	""	""
"0000616887"	"00024242"	"30"	"1437"	"8"	"1437"	"8"	"c.1437+8G>A"	"r.(=)"	"p.(=)"	""	""
"0000616888"	"00024242"	"70"	"1464"	"0"	"1464"	"0"	"c.1464dup"	"r.(?)"	"p.(Asp489ArgfsTer17)"	""	""
"0000616889"	"00024242"	"30"	"1536"	"0"	"1536"	"0"	"c.1536C>A"	"r.(?)"	"p.(Phe512Leu)"	""	""
"0000616890"	"00024242"	"30"	"1636"	"8"	"1636"	"8"	"c.1636+8C>T"	"r.(=)"	"p.(=)"	""	""
"0000616891"	"00024242"	"90"	"2024"	"0"	"2026"	"0"	"c.2024_2026del"	"r.(?)"	"p.(Asn675del)"	""	""
"0000616892"	"00024242"	"30"	"2190"	"-4"	"2190"	"-4"	"c.2190-4G>A"	"r.spl?"	"p.?"	""	""
"0000616893"	"00024242"	"30"	"2202"	"0"	"2202"	"0"	"c.2202C>T"	"r.(?)"	"p.(Asp734=)"	""	""
"0000616894"	"00024242"	"70"	"2237"	"0"	"2237"	"0"	"c.2237G>C"	"r.(?)"	"p.(Trp746Ser)"	""	""
"0000616895"	"00024242"	"30"	"2544"	"0"	"2544"	"0"	"c.2544C>T"	"r.(?)"	"p.(Thr848=)"	""	""
"0000616896"	"00024242"	"30"	"2652"	"0"	"2652"	"0"	"c.2652G>A"	"r.(?)"	"p.(Thr884=)"	""	""
"0000616897"	"00024242"	"30"	"2780"	"0"	"2780"	"0"	"c.2780C>T"	"r.(?)"	"p.(Thr927Ile)"	""	""
"0000616898"	"00024242"	"50"	"2819"	"0"	"2819"	"0"	"c.2819C>T"	"r.(?)"	"p.(Ser940Leu)"	""	""
"0000629481"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000629482"	"00024242"	"90"	"1841"	"0"	"1841"	"0"	"c.1841C>A"	"r.(?)"	"p.(Thr614Lys)"	""	""
"0000629612"	"00024242"	"70"	"1822"	"0"	"1822"	"0"	"c.1822C>T"	"r.(?)"	"p.(Arg608*)"	""	""
"0000629613"	"00024242"	"70"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	""	""
"0000629614"	"00024242"	"70"	"1857"	"0"	"1857"	"0"	"c.1857C>G"	"r.(?)"	"p.(Ser619Arg)"	""	""
"0000629615"	"00024242"	"70"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	""	""
"0000629616"	"00024242"	"70"	"1316"	"0"	"1316"	"0"	"c.1316T>A"	"r.(?)"	"p.(Met439Lys)"	""	""
"0000629617"	"00024242"	"70"	"2015"	"0"	"2015"	"0"	"c.2015G>A"	"r.(?)"	"p.(Arg672Gln)"	""	""
"0000649731"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	"1i"	""
"0000649732"	"00024242"	"10"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	""	""
"0000649733"	"00024242"	"50"	"710"	"0"	"710"	"0"	"c.710C>T"	"r.(?)"	"p.(Ala237Val)"	""	""
"0000649734"	"00024242"	"30"	"1343"	"0"	"1343"	"0"	"c.1343G>C"	"r.(?)"	"p.(Ser448Thr)"	""	""
"0000649735"	"00024242"	"70"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	""	""
"0000649736"	"00024242"	"30"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0000649737"	"00024242"	"70"	"2173"	"0"	"2173"	"0"	"c.2173C>T"	"r.(?)"	"p.(Arg725Trp)"	""	""
"0000653385"	"00024242"	"50"	"2102"	"0"	"2102"	"0"	"c.2102T>C"	"r.(?)"	"p.Leu701Pro"	""	"0 nmol/mg/h"
"0000653388"	"00024242"	"50"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(?)"	"p.(Asp645Glu)"	""	"0 nmol/mg/h"
"0000653389"	"00024242"	"50"	"538"	"0"	"538"	"0"	"c.538C>A"	"r.(?)"	"p.(His180Asn)"	""	""
"0000653390"	"00024242"	"50"	"2096"	"0"	"2096"	"0"	"c.2096T>C"	"r.(?)"	"p.(Leu699Pro)"	""	"0.81 nmol/mg/h"
"0000653501"	"00024242"	"50"	"1935"	"0"	"1935"	"0"	"c.1935C>A"	"r.(1935c>a)"	"p.(Asp645Glu)"	""	""
"0000653502"	"00024242"	"50"	"1703"	"0"	"1703"	"0"	"c.1703A>T"	"r.(1703a>u)"	"p.(His568Leu)"	"12"	""
"0000658286"	"00024242"	"10"	"642"	"0"	"642"	"0"	"c.642C>T"	"r.(?)"	"p.(Ser214=)"	""	""
"0000658287"	"00024242"	"10"	"2133"	"0"	"2133"	"0"	"c.2133A>G"	"r.(?)"	"p.(Thr711=)"	""	""
"0000666079"	"00024242"	"90"	"875"	"0"	"875"	"0"	"c.875A>G"	"r.(?)"	"p.(Tyr292Cys)"	""	""
"0000666080"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000669424"	"00024242"	"30"	"1343"	"0"	"1343"	"0"	"c.1343G>C"	"r.(?)"	"p.(Ser448Thr)"	""	""
"0000669425"	"00024242"	"30"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0000670583"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670584"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670585"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670586"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670587"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670588"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670589"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670590"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670591"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670592"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670593"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670594"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670595"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670596"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670597"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670598"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670599"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670600"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670601"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670602"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670603"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670604"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670605"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670606"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670607"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670608"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	""	""
"0000670609"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670610"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670611"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670612"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670613"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670614"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670615"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670616"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670617"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670618"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670619"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670620"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670621"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670622"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670623"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670624"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670625"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670626"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670627"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670628"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670629"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670630"	"00024242"	"90"	"1"	"-45"	"1"	"-45"	"c.1-45T>G"	"r.spl"	"p.?"	""	""
"0000670631"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670632"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670633"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000670634"	"00024242"	"90"	"2219"	"0"	"2220"	"0"	"c.2219_2220del"	"r.(?)"	"p.(Val740Glyfs*55)"	""	""
"0000670635"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	""	""
"0000670636"	"00024242"	"90"	"1564"	"0"	"1564"	"0"	"c.1564C>G"	"r.(?)"	"p.(Pro522Ala)"	""	""
"0000670637"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670638"	"00024242"	"90"	"2261"	"0"	"2261"	"0"	"c.2261dup"	"r.(?)"	"p.(Val755Serfs*41)"	""	""
"0000670639"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670640"	"00024242"	"90"	"2482"	"-1"	"2646"	"1"	"c.(2481+1_2482-1)_(2646+1_2647-1)del"	"r.?"	"p.?"	"17i_18i"	""
"0000670641"	"00024242"	"90"	"956"	"0"	"962"	"0"	"c.956_962del"	"r.spl"	"p.(Asp319AlafsTer71)"	""	""
"0000670642"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	""	""
"0000670643"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	""	""
"0000670644"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	""	""
"0000670645"	"00024242"	"90"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	""	""
"0000670646"	"00024242"	"90"	"2482"	"-1"	"2646"	"1"	"c.(2481+1_2482-1)_(2646+1_2647-1)del"	"r.?"	"p.?"	"17i_18i"	""
"0000670647"	"00024242"	"90"	"2482"	"-1"	"2646"	"1"	"c.(2481+1_2482-1)_(2646+1_2647-1)del"	"r.?"	"p.?"	"17i_18i"	""
"0000670648"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670649"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670650"	"00024242"	"90"	"2482"	"-1"	"2646"	"1"	"c.(2481+1_2482-1)_(2646+1_2647-1)del"	"r.?"	"p.?"	"17i_18i"	""
"0000670651"	"00024242"	"90"	"692"	"1"	"692"	"1"	"c.692+1G>T"	"r.spl"	"p.?"	""	""
"0000670652"	"00024242"	"90"	"1610"	"0"	"1610"	"0"	"c.1610del"	"r.(?)"	"p.(Glu537Glyfs*41)"	""	""
"0000670653"	"00024242"	"90"	"1610"	"0"	"1610"	"0"	"c.1610del"	"r.(?)"	"p.(Glu537Glyfs*41)"	""	""
"0000670654"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	""	""
"0000670655"	"00024242"	"90"	"2482"	"-1"	"2646"	"1"	"c.(2481+1_2482-1)_(2646+1_2647-1)del"	"r.?"	"p.?"	"17i_18i"	""
"0000670656"	"00024242"	"90"	"1655"	"0"	"1655"	"0"	"c.1655T>C"	"r.(?)"	"p.(Leu552Pro)"	""	""
"0000670657"	"00024242"	"90"	"1839"	"0"	"1839"	"0"	"c.1839G>C"	"r.(?)"	"p.(Trp613Cys)"	""	""
"0000670658"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	""	""
"0000670659"	"00024242"	"90"	"1121"	"0"	"1121"	"0"	"c.1121G>A"	"r.(?)"	"p.(Cys374Tyr)"	""	""
"0000670660"	"00024242"	"90"	"923"	"0"	"923"	"0"	"c.923A>C"	"r.(?)"	"p.(His308Pro)"	""	""
"0000670661"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670662"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	""	""
"0000670663"	"00024242"	"70"	"1710"	"0"	"1710"	"0"	"c.1710C>G"	"r.(?)"	"p.(Asn570Lys)"	""	""
"0000670664"	"00024242"	"90"	"2482"	"-1"	"2646"	"1"	"c.(2481+1_2482-1)_(2646+1_2647-1)del"	"r.?"	"p.?"	"17i_18i"	""
"0000670665"	"00024242"	"90"	"1681"	"0"	"1699"	"0"	"c.1681_1699dup"	"r.(?)"	"p.(Thr567Lysfs*75)"	""	""
"0000670666"	"00024242"	"90"	"1681"	"0"	"1699"	"0"	"c.1681_1699dup"	"r.(?)"	"p.(Thr567Lysfs*75)"	""	""
"0000670667"	"00024242"	"90"	"1075"	"0"	"1075"	"0"	"c.1075G>A"	"r.(?)"	"p.(Gly359Arg)"	""	""
"0000670668"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	""	""
"0000670669"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	""	""
"0000670670"	"00024242"	"90"	"482"	"0"	"483"	"0"	"c.482_483del"	"r.(?)"	"p.(Pro161Glnfs*15)"	""	""
"0000670671"	"00024242"	"90"	"2261"	"0"	"2261"	"0"	"c.2261dup"	"r.(?)"	"p.(Val755Serfs*41)"	""	""
"0000670672"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	""	""
"0000670673"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670674"	"00024242"	"90"	"186"	"0"	"196"	"0"	"c.186_196dup"	"r.(?)"	"p.(Arg66Hisfs*80)"	""	""
"0000670675"	"00024242"	"90"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	""	""
"0000670676"	"00024242"	"90"	"701"	"0"	"701"	"0"	"c.701C>G"	"r.(?)"	"p.(Thr234Arg)"	""	""
"0000670677"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87Glnfs*9)"	""	""
"0000670678"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	""	""
"0000670679"	"00024242"	"90"	"2608"	"0"	"2608"	"0"	"c.2608C>T"	"r.(?)"	"p.(Arg870*)"	""	""
"0000670680"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	""	""
"0000670681"	"00024242"	"90"	"1115"	"0"	"1115"	"0"	"c.1115A>T"	"r.(?)"	"p.(His372Leu)"	""	""
"0000670682"	"00024242"	"90"	"1548"	"0"	"1548"	"0"	"c.1548G>A"	"r.(?)"	"p.(Trp516*)"	""	""
"0000670683"	"00024242"	"50"	"1923"	"0"	"1923"	"0"	"c.1923G>A"	"r.(?)"	"p.(=)"	""	""
"0000674675"	"00024242"	"90"	"1464"	"0"	"1464"	"0"	"c.1464dup"	"r.[0,1464dup]"	"p.[0,Asp489Argfs*17]"	"10"	""
"0000674676"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.[1927g>a,1755_1928del,1889_1928del]"	"p.[Gly643Arg,Leu587_Ala644del,Glu630Gly*53]"	"14"	""
"0000674677"	"00024242"	"90"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.[-32_546del,546g>u,546g>u;546_547ins546+1_546+184]"	"p.[0,=,Ile183Valfs*67]"	"2"	""
"0000674678"	"00024242"	"90"	"1798"	"0"	"1798"	"0"	"c.1798C>T"	"r.1798c>u"	"p.Arg600Cys"	"13"	"absent"
"0000674679"	"00024242"	"70"	"1726"	"0"	"1726"	"0"	"c.1726G>C"	"r.(1726g>c)"	"p.(Gly576Arg)"	"12"	""
"0000674680"	"00024242"	"90"	"2481"	"2"	"2481"	"2"	"c.2481+2T>C"	"r.[2331_2332ins2332-109_2332-1;2462_2481del,2462_2481del,2332_2481del]"	"p.[Val778AlaSerTer,Tyr822Profs*55,Val778_Gln827del]"	"17i"	""
"0000674681"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.[=,-32_546del,-32_486del]"	"p.[=,0]"	"1i"	""
"0000674683"	"00024242"	"90"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.[2315_2331delins2332-109_2332-1,2315_2331del]"	"p.[Trp772Cysfs*40,Trp772Cysfs*18]"	"16i"	""
"0000675110"	"00024242"	"50"	"0"	"0"	"0"	"0"	"c.="	"r.[=,1075_1076ins1075+1_1076-1,1754_1755ins1755-110_1755-1,r.1755_1888del"	"p.[=,Tyr360Argfs*172,Arg585Serfs*18,p.Ala586Asnfs*5]"	""	""
"0000681061"	"00024242"	"90"	"693"	"-2"	"693"	"-2"	"c.693-2A>G"	"r.spl?"	"p.?"	""	""
"0000681062"	"00024242"	"30"	"2481"	"16"	"2481"	"16"	"c.2481+16G>A"	"r.(=)"	"p.(=)"	""	""
"0000692503"	"00024242"	"30"	"2319"	"0"	"2319"	"0"	"c.2319C>T"	"r.(?)"	"p.(Tyr773=)"	""	""
"0000697572"	"00024242"	"70"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl?"	"p.?"	""	""
"0000697573"	"00024242"	"70"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176Argfs*45)"	""	""
"0000697574"	"00024242"	"70"	"343"	"0"	"343"	"0"	"c.343C>T"	"r.(?)"	"p.(Gln115*)"	""	""
"0000697575"	"00024242"	"70"	"569"	"0"	"569"	"0"	"c.569G>A"	"r.(?)"	"p.(Arg190His)"	""	""
"0000697576"	"00024242"	"70"	"955"	"43"	"955"	"43"	"c.955+43G>C"	"r.spl?"	"p.?"	""	""
"0000697577"	"00024242"	"70"	"1192"	"0"	"1192"	"0"	"c.1192del"	"r.(?)"	"p.(Leu398Trpfs*42)"	""	""
"0000697578"	"00024242"	"70"	"2020"	"0"	"2020"	"0"	"c.2020C>G"	"r.(?)"	"p.(His674Asp)"	""	""
"0000697579"	"00024242"	"70"	"2051"	"0"	"2051"	"0"	"c.2051C>G"	"r.(?)"	"p.(Pro684Arg)"	""	""
"0000697580"	"00024242"	"70"	"2066"	"0"	"2070"	"0"	"c.2066_2070dup"	"r.(?)"	"p.(Ala691Serfs*7)"	""	""
"0000697581"	"00024242"	"70"	"2269"	"0"	"2269"	"0"	"c.2269C>T"	"r.(?)"	"p.(Gln757*)"	""	""
"0000697582"	"00024242"	"70"	"2331"	"2"	"2331"	"2"	"c.2331+2T>A"	"r.spl"	"p.?"	""	""
"0000697583"	"00024242"	"70"	"2716"	"0"	"2716"	"0"	"c.2716G>A"	"r.(?)"	"p.(Val906Ile)"	""	""
"0000726739"	"00024242"	"30"	"-4654"	"0"	"-4654"	"0"	"c.-4654G>A"	"r.(?)"	"p.(=)"	""	""
"0000726740"	"00024242"	"30"	"-2169"	"0"	"-2169"	"0"	"c.-2169C>G"	"r.(?)"	"p.(=)"	""	""
"0000726741"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.(=)"	"p.(=)"	""	""
"0000726742"	"00024242"	"30"	"258"	"0"	"258"	"0"	"c.258C>A"	"r.(?)"	"p.(Pro86=)"	""	""
"0000726743"	"00024242"	"90"	"258"	"0"	"258"	"0"	"c.258dup"	"r.(?)"	"p.(Asn87GlnfsTer9)"	""	""
"0000726744"	"00024242"	"90"	"525"	"0"	"525"	"0"	"c.525del"	"r.(?)"	"p.(Glu176ArgfsTer45)"	""	""
"0000726745"	"00024242"	"30"	"2041"	"-9"	"2041"	"-9"	"c.2041-9G>A"	"r.(=)"	"p.(=)"	""	""
"0000786865"	"00024242"	"50"	"857"	"0"	"857"	"0"	"c.857C>T"	"r.(?)"	"p.(Thr286Met)"	"4"	""
"0000787476"	"00024242"	"90"	"1927"	"0"	"1927"	"0"	"c.1927G>A"	"r.(?)"	"p.(Gly643Arg)"	"14"	""
"0000795659"	"00024242"	"70"	"266"	"0"	"266"	"0"	"c.266G>A"	"r.(?)"	"p.(Arg89His)"	""	""
"0000808308"	"00024242"	"30"	"664"	"0"	"664"	"0"	"c.664G>A"	"r.(?)"	"p.(Val222Met)"	""	""
"0000808309"	"00024242"	"30"	"693"	"-4"	"693"	"-4"	"c.693-4G>T"	"r.spl?"	"p.?"	""	""
"0000808310"	"00024242"	"30"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGCGGGC"	"r.(=)"	"p.(=)"	""	""
"0000808311"	"00024242"	"70"	"1004"	"0"	"1004"	"0"	"c.1004G>A"	"r.(?)"	"p.(Gly335Glu)"	""	""
"0000808312"	"00024242"	"50"	"1144"	"0"	"1144"	"0"	"c.1144G>A"	"r.(?)"	"p.(Ala382Thr)"	""	""
"0000808313"	"00024242"	"30"	"2151"	"0"	"2151"	"0"	"c.2151C>T"	"r.(?)"	"p.(His717=)"	""	""
"0000819037"	"00024242"	"70"	"794"	"0"	"794"	"0"	"c.794G>A"	"r.(?)"	"p.(Ser265Asn)"	""	""
"0000819184"	"00024242"	"90"	"1"	"0"	"1"	"0"	"c.1A>G"	"r.(?)"	"p.(Met1?)"	""	""
"0000819185"	"00024242"	"70"	"1841"	"0"	"1841"	"0"	"c.1841C>T"	"r.(?)"	"p.(Thr614Met)"	""	""
"0000819253"	"00024242"	"70"	"1831"	"0"	"1831"	"0"	"c.1831G>A"	"r.(?)"	"p.(Gly611Ser)"	""	""
"0000819271"	"00024242"	"50"	"2725"	"0"	"2725"	"0"	"c.2725G>A"	"r.(?)"	"p.(Val909Met)"	""	""
"0000842492"	"00024242"	"70"	"1461"	"0"	"1461"	"0"	"c.1461C>A"	"r.(?)"	"p.(Phe487Leu)"	""	""
"0000842493"	"00024242"	"90"	"1082"	"0"	"1082"	"0"	"c.1082C>T"	"r.(?)"	"p.(Pro361Leu)"	""	""
"0000842494"	"00024242"	"70"	"1937"	"0"	"1942"	"0"	"c.1937_1942del"	"r.(?)"	"p.(Val646_Cys647del)"	""	""
"0000842495"	"00024242"	"70"	"971"	"0"	"971"	"0"	"c.971C>T"	"r.(?)"	"p.(Pro324Leu)"	""	""
"0000842496"	"00024242"	"90"	"1396"	"0"	"1396"	"0"	"c.1396dup"	"r.(?)"	"p.(Val466Glyfs*40)"	""	""
"0000842497"	"00024242"	"70"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000842498"	"00024242"	"50"	"794"	"0"	"794"	"0"	"c.794G>A"	"r.(?)"	"p.(Ser265Asn)"	""	""
"0000842499"	"00024242"	"70"	"546"	"0"	"546"	"0"	"c.546G>T"	"r.spl"	"p.?"	""	""
"0000855143"	"00024242"	"30"	"-2328"	"0"	"-2328"	"0"	"c.-2328C>T"	"r.(?)"	"p.(=)"	""	""
"0000855144"	"00024242"	"30"	"2647"	"-8"	"2647"	"-8"	"c.2647-8C>T"	"r.(=)"	"p.(=)"	""	""
"0000865535"	"00024242"	"30"	"912"	"0"	"912"	"0"	"c.912C>T"	"r.(?)"	"p.(Gly304=)"	""	""
"0000865536"	"00024242"	"50"	"1194"	"3"	"1194"	"3"	"c.1194+3G>C"	"r.spl?"	"p.?"	""	""
"0000865537"	"00024242"	"30"	"1536"	"0"	"1536"	"0"	"c.1536C>T"	"r.(?)"	"p.(Phe512=)"	""	""
"0000865538"	"00024242"	"30"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0000865539"	"00024242"	"50"	"2156"	"0"	"2156"	"0"	"c.2156C>A"	"r.(?)"	"p.(Ala719Glu)"	""	""
"0000865540"	"00024242"	"30"	"2415"	"0"	"2415"	"0"	"c.2415G>A"	"r.(?)"	"p.(Val805=)"	""	""
"0000872026"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	"1i"	""
"0000872056"	"00024242"	"90"	"1755"	"-1"	"1755"	"-1"	"c.1755-1G>A"	"r.spl"	"p.?"	"12i"	""
"0000872065"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	"18"	""
"0000872073"	"00024242"	"70"	"1559"	"0"	"1559"	"0"	"c.1559A>G"	"r.(?)"	"p.(Asn520Ser)"	"11"	""
"0000872443"	"00024242"	"50"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0000872444"	"00024242"	"50"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	""	""
"0000872446"	"00024242"	"50"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0000872447"	"00024242"	"50"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	""	""
"0000873651"	"00024242"	"70"	"953"	"0"	"953"	"0"	"c.953T>A"	"r.(?)"	"p.(Met318Lys)"	""	""
"0000873652"	"00024242"	"70"	"2185"	"0"	"2185"	"0"	"c.2185del"	"r.(?)"	"p.(Leu729Trpfs*35)"	""	""
"0000880080"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000880081"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000894329"	"00024242"	"30"	"498"	"0"	"498"	"0"	"c.498C>G"	"r.(?)"	"p.(Thr166=)"	""	""
"0000894330"	"00024242"	"30"	"692"	"17"	"692"	"17"	"c.692+17G>C"	"r.(=)"	"p.(=)"	""	""
"0000894332"	"00024242"	"50"	"2530"	"0"	"2530"	"0"	"c.2530G>T"	"r.(?)"	"p.(Ala844Ser)"	""	""
"0000906020"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000906021"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000906097"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000906098"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0000906099"	"00024242"	"90"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	""	""
"0000906155"	"00024242"	"90"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	""	""
"0000906156"	"00024242"	"90"	"1856"	"0"	"1856"	"0"	"c.1856G>A"	"r.(?)"	"p.(Ser619Asn)"	""	""
"0000906157"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	""	""
"0000908866"	"00024242"	"50"	"861"	"0"	"861"	"0"	"c.861C>T"	"r.0"	"p.0"	""	""
"0000908930"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.[-32_546del,-33_-32ins[-32-154_-32-14;g;-32-12_-32-1],-32_486del]"	"p.?"	""	""
"0000914989"	"00024242"	"30"	"1552"	"-13"	"1552"	"-13"	"c.1552-13G>A"	"r.(=)"	"p.(=)"	""	""
"0000914990"	"00024242"	"30"	"2090"	"0"	"2090"	"0"	"c.2090A>C"	"r.(?)"	"p.(Lys697Thr)"	""	""
"0000914991"	"00024242"	"30"	"2751"	"0"	"2751"	"0"	"c.2751C>T"	"r.(?)"	"p.(Leu917=)"	""	""
"0000926656"	"00024242"	"30"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	""	""
"0000926657"	"00024242"	"10"	"693"	"-49"	"693"	"-49"	"c.693-49C>T"	"r.(=)"	"p.(=)"	""	""
"0000926658"	"00024242"	"10"	"858"	"30"	"858"	"30"	"c.858+30T>C"	"r.(=)"	"p.(=)"	""	""
"0000926659"	"00024242"	"50"	"912"	"0"	"912"	"0"	"c.912C>T"	"r.(?)"	"p.(Gly304=)"	""	""
"0000926660"	"00024242"	"10"	"921"	"0"	"921"	"0"	"c.921A>T"	"r.(?)"	"p.(Ala307=)"	""	""
"0000926661"	"00024242"	"90"	"925"	"0"	"925"	"0"	"c.925G>A"	"r.(?)"	"p.(Gly309Arg)"	""	""
"0000926662"	"00024242"	"10"	"1374"	"0"	"1374"	"0"	"c.1374C>T"	"r.(?)"	"p.(Tyr458=)"	""	""
"0000926663"	"00024242"	"90"	"1465"	"0"	"1465"	"0"	"c.1465G>A"	"r.(?)"	"p.(Asp489Asn)"	""	""
"0000926664"	"00024242"	"10"	"1551"	"49"	"1551"	"49"	"c.1551+49C>A"	"r.(=)"	"p.(=)"	""	""
"0000946005"	"00024242"	"90"	"1979"	"0"	"1979"	"0"	"c.1979G>A"	"r.(?)"	"p.(Arg660His)"	""	""
"0000969266"	"00024242"	"90"	"379"	"0"	"380"	"0"	"c.379_380del"	"r.(?)"	"p.(Cys127LeufsTer18)"	""	""
"0000982857"	"00024242"	"10"	"852"	"0"	"852"	"0"	"c.852G>A"	"r.(?)"	"p.(Ala284=)"	""	""
"0000982858"	"00024242"	"30"	"858"	"7"	"858"	"8"	"c.858+7_858+8insAGCAGGC"	"r.(=)"	"p.(=)"	""	""
"0000982859"	"00024242"	"50"	"868"	"0"	"868"	"0"	"c.868A>G"	"r.(?)"	"p.(Asn290Asp)"	""	""
"0000982860"	"00024242"	"50"	"1411"	"0"	"1411"	"0"	"c.1411G>A"	"r.(?)"	"p.(Glu471Lys)"	""	""
"0000982861"	"00024242"	"50"	"1828"	"0"	"1828"	"0"	"c.1828G>A"	"r.(?)"	"p.(Ala610Thr)"	""	""
"0000982862"	"00024242"	"50"	"2408"	"0"	"2408"	"0"	"c.2408A>G"	"r.(?)"	"p.(Gln803Arg)"	""	""
"0001003771"	"00024242"	"90"	"-32"	"-3"	"-32"	"-3"	"c.-32-3C>G"	"r.spl?"	"p.?"	""	""
"0001003772"	"00024242"	"90"	"1933"	"0"	"1933"	"0"	"c.1933G>A"	"r.(?)"	"p.(Asp645Asn)"	""	""
"0001003773"	"00024242"	"50"	"2671"	"0"	"2671"	"0"	"c.2671C>T"	"r.(?)"	"p.(Arg891Cys)"	""	""
"0001007223"	"00024242"	"10"	"271"	"0"	"271"	"0"	"c.271G>A"	"r.(?)"	"p.(Asp91Asn)"	"2"	"Reduced"
"0001008325"	"00024242"	"90"	"1819"	"0"	"1819"	"0"	"c.1819G>A"	"r.(?)"	"p.(Gly607Ser)"	""	""
"0001008326"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0001008344"	"00024242"	"90"	"1437"	"0"	"1437"	"0"	"c.1437G>C"	"r.(?)"	"p.(Lys479Asn)"	""	""
"0001012449"	"00024242"	"50"	"1367"	"0"	"1367"	"0"	"c.1367G>T"	"r.(?)"	"p.(Arg456Met)"	""	""
"0001015631"	"00024242"	"90"	"-4571"	"0"	"-4571"	"0"	"c.-4571del"	"r.(?)"	"p.(=)"	""	""
"0001015632"	"00024242"	"10"	"-33"	"219"	"-33"	"219"	"c.-33+219G>C"	"r.(=)"	"p.(=)"	""	""
"0001015633"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.(=)"	"p.(=)"	""	""
"0001015634"	"00024242"	"10"	"547"	"-243"	"547"	"-243"	"c.547-243C>G"	"r.(=)"	"p.(=)"	""	""
"0001015635"	"00024242"	"70"	"671"	"0"	"671"	"0"	"c.671G>A"	"r.(?)"	"p.(Arg224Gln)"	""	""
"0001015636"	"00024242"	"10"	"692"	"144"	"692"	"144"	"c.692+144A>G"	"r.(=)"	"p.(=)"	""	""
"0001015637"	"00024242"	"10"	"956"	"-84"	"956"	"-84"	"c.956-84C>T"	"r.(=)"	"p.(=)"	""	""
"0001015638"	"00024242"	"10"	"1551"	"49"	"1551"	"49"	"c.1551+49C>A"	"r.(=)"	"p.(=)"	""	""
"0001015639"	"00024242"	"10"	"2332"	"-198"	"2332"	"-198"	"c.2332-198A>T"	"r.(=)"	"p.(=)"	""	""
"0001015640"	"00024242"	"10"	"3082"	"0"	"3082"	"0"	"c.*223C>T"	"r.(=)"	"p.(=)"	""	""
"0001017262"	"00024242"	"90"	"2577"	"0"	"2577"	"0"	"c.2577G>A"	"r.2577g>a"	"p.Trp859Ter"	""	""
"0001017263"	"00024242"	"30"	"-524"	"0"	"-524"	"0"	"c.-524C>G"	"r.(=)"	"p.(=)"	"_1"	""
"0001017264"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.[=,-32_546del]"	"p.[0?,=]"	"1i"	""
"0001021251"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0001021259"	"00024242"	"90"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0001021284"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	""	""
"0001021288"	"00024242"	"90"	"1408"	"0"	"1410"	"0"	"c.1408_1410del"	"r.(?)"	"p.(Asn470del)"	""	""
"0001027070"	"00024242"	"90"	"-4639"	"0"	"-4639"	"0"	"c.-4639G>T"	"r.(?)"	"p.(=)"	""	""
"0001027071"	"00024242"	"70"	"-4591"	"0"	"-4591"	"0"	"c.-4591del"	"r.(?)"	"p.(=)"	""	""
"0001027072"	"00024242"	"50"	"510"	"0"	"510"	"0"	"c.510C>T"	"r.(?)"	"p.(Asp170=)"	""	""
"0001027073"	"00024242"	"10"	"1726"	"0"	"1726"	"0"	"c.1726G>A"	"r.(?)"	"p.(Gly576Ser)"	""	""
"0001027074"	"00024242"	"90"	"1735"	"0"	"1735"	"0"	"c.1735G>A"	"r.(?)"	"p.(Glu579Lys)"	""	""
"0001042229"	"00024242"	"50"	"545"	"0"	"545"	"0"	"c.545C>G"	"r.(?)"	"p.(Thr182Arg)"	""	""
"0001042230"	"00024242"	"90"	"896"	"0"	"896"	"0"	"c.896T>G"	"r.(?)"	"p.(Leu299Arg)"	""	""
"0001042231"	"00024242"	"50"	"1310"	"0"	"1310"	"0"	"c.1310G>A"	"r.(?)"	"p.(Arg437His)"	""	""
"0001042232"	"00024242"	"50"	"1346"	"0"	"1346"	"0"	"c.1346C>T"	"r.(?)"	"p.(Ser449Leu)"	""	""
"0001042233"	"00024242"	"30"	"2113"	"0"	"2113"	"0"	"c.2113C>G"	"r.(?)"	"p.(Leu705Val)"	""	""
"0001042234"	"00024242"	"50"	"2135"	"0"	"2135"	"0"	"c.2135T>C"	"r.(?)"	"p.(Leu712Pro)"	""	""
"0001042235"	"00024242"	"90"	"2238"	"0"	"2238"	"0"	"c.2238G>C"	"r.(?)"	"p.(Trp746Cys)"	""	""
"0001042237"	"00024242"	"90"	"2560"	"0"	"2560"	"0"	"c.2560C>T"	"r.(?)"	"p.(Arg854Ter)"	""	""
"0001046675"	"00024242"	"10"	"-260"	"0"	"-260"	"0"	"c.-260G>C"	"r.(?)"	"p.(=)"	""	""
"0001046676"	"00024242"	"10"	"546"	"293"	"546"	"293"	"c.546+293G>A"	"r.(=)"	"p.(=)"	""	""
"0001046677"	"00024242"	"10"	"547"	"-238"	"547"	"-238"	"c.547-238T>C"	"r.(=)"	"p.(=)"	""	""
"0001046678"	"00024242"	"10"	"547"	"-67"	"547"	"-67"	"c.547-67C>G"	"r.(=)"	"p.(=)"	""	""
"0001046679"	"00024242"	"10"	"692"	"509"	"692"	"509"	"c.692+509T>G"	"r.(=)"	"p.(=)"	""	""
"0001046680"	"00024242"	"10"	"2040"	"66"	"2040"	"66"	"c.2040+66C>T"	"r.(=)"	"p.(=)"	""	""
"0001046681"	"00024242"	"10"	"2040"	"69"	"2040"	"69"	"c.2040+69A>G"	"r.(=)"	"p.(=)"	""	""
"0001046682"	"00024242"	"10"	"2190"	"-444"	"2190"	"-444"	"c.2190-444A>G"	"r.(=)"	"p.(=)"	""	""
"0001046922"	"00024242"	"90"	"784"	"0"	"784"	"0"	"c.784G>A"	"r.(?)"	"p.(Glu262Lys)"	""	""
"0001056214"	"00024242"	"50"	"924"	"0"	"924"	"0"	"c.924C>T"	"r.(?)"	"p.(=)"	""	""
"0001056215"	"00024242"	"50"	"1123"	"0"	"1123"	"0"	"c.1123C>T"	"r.(?)"	"p.(Arg375Cys)"	""	""
"0001056216"	"00024242"	"50"	"1284"	"0"	"1284"	"0"	"c.1284G>A"	"r.(?)"	"p.(=)"	""	""
"0001056217"	"00024242"	"50"	"1775"	"0"	"1775"	"0"	"c.1775G>T"	"r.(?)"	"p.(Gly592Val)"	""	""
"0001056218"	"00024242"	"10"	"2065"	"0"	"2065"	"0"	"c.2065G>A"	"r.(?)"	"p.(Glu689Lys)"	""	""
"0001057914"	"00024242"	"70"	"-32"	"-13"	"-32"	"-13"	"c.-32-13T>G"	"r.spl"	"p.?"	""	""
"0001057923"	"00024242"	"50"	"452"	"0"	"452"	"0"	"c.452C>T"	"r.(?)"	"p.(Thr151Ile)"	""	""
"0001057950"	"00024242"	"70"	"1357"	"0"	"1357"	"0"	"c.1357G>A"	"r.(?)"	"p.(Gly453Arg)"	""	""


## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 2122
"{{screeningid}}"	"{{variantid}}"
"0000000004"	"0000000661"
"0000000004"	"0000000662"
"0000000031"	"0000000655"
"0000000031"	"0000000663"
"0000000031"	"0000000664"
"0000000033"	"0000000659"
"0000000033"	"0000000660"
"0000000039"	"0000000654"
"0000000048"	"0000000650"
"0000000057"	"0000000651"
"0000000075"	"0000000657"
"0000000075"	"0000000658"
"0000000076"	"0000000656"
"0000000083"	"0000000652"
"0000000084"	"0000000653"
"0000101390"	"0000164169"
"0000101391"	"0000163952"
"0000101392"	"0000163968"
"0000101393"	"0000163969"
"0000101394"	"0000163965"
"0000101395"	"0000163981"
"0000101396"	"0000163983"
"0000101397"	"0000163984"
"0000101398"	"0000164026"
"0000101399"	"0000164027"
"0000101400"	"0000164028"
"0000101401"	"0000164029"
"0000101402"	"0000164062"
"0000101403"	"0000164063"
"0000101404"	"0000164064"
"0000101405"	"0000164065"
"0000101406"	"0000164066"
"0000101407"	"0000164141"
"0000101408"	"0000164154"
"0000101409"	"0000164155"
"0000101410"	"0000164156"
"0000101411"	"0000164183"
"0000101412"	"0000164184"
"0000101413"	"0000164185"
"0000101414"	"0000164186"
"0000101415"	"0000164187"
"0000101416"	"0000164188"
"0000101417"	"0000164182"
"0000101418"	"0000163951"
"0000101418"	"0000164011"
"0000101419"	"0000164061"
"0000101420"	"0000164006"
"0000101421"	"0000164039"
"0000101422"	"0000164040"
"0000101423"	"0000164104"
"0000101424"	"0000164105"
"0000101425"	"0000164106"
"0000101426"	"0000164107"
"0000101427"	"0000164108"
"0000101428"	"0000164109"
"0000101429"	"0000164098"
"0000101430"	"0000164099"
"0000101430"	"0000164128"
"0000101431"	"0000164100"
"0000101431"	"0000164193"
"0000101431"	"0000164194"
"0000101431"	"0000164195"
"0000101431"	"0000164196"
"0000101432"	"0000164126"
"0000101433"	"0000164145"
"0000101434"	"0000164146"
"0000101435"	"0000164157"
"0000101436"	"0000164158"
"0000101437"	"0000164159"
"0000101438"	"0000164160"
"0000101439"	"0000164174"
"0000101440"	"0000164175"
"0000101441"	"0000164179"
"0000101442"	"0000164180"
"0000101443"	"0000163976"
"0000101444"	"0000163977"
"0000101445"	"0000163978"
"0000101446"	"0000163956"
"0000101447"	"0000163957"
"0000101448"	"0000163958"
"0000101449"	"0000164054"
"0000101450"	"0000164055"
"0000101451"	"0000164050"
"0000101452"	"0000164058"
"0000101453"	"0000164059"
"0000101454"	"0000164070"
"0000101455"	"0000164110"
"0000101456"	"0000164111"
"0000101457"	"0000164122"
"0000101458"	"0000164123"
"0000101459"	"0000164133"
"0000101460"	"0000164134"
"0000101461"	"0000164147"
"0000101464"	"0000164150"
"0000101467"	"0000164153"
"0000101468"	"0000163986"
"0000101469"	"0000163987"
"0000101470"	"0000164005"
"0000101471"	"0000164012"
"0000101472"	"0000164044"
"0000101473"	"0000164035"
"0000101474"	"0000164046"
"0000101475"	"0000164060"
"0000101476"	"0000164079"
"0000101477"	"0000164076"
"0000101478"	"0000164077"
"0000101478"	"0000164192"
"0000101479"	"0000164097"
"0000101480"	"0000164103"
"0000101481"	"0000164137"
"0000101482"	"0000164138"
"0000101482"	"0000164191"
"0000101483"	"0000164172"
"0000101484"	"0000164171"
"0000101485"	"0000164176"
"0000101486"	"0000164042"
"0000101487"	"0000164043"
"0000101488"	"0000164067"
"0000101489"	"0000164068"
"0000101490"	"0000163973"
"0000101491"	"0000163960"
"0000101492"	"0000163961"
"0000101493"	"0000164018"
"0000101494"	"0000164019"
"0000101495"	"0000164139"
"0000101496"	"0000164143"
"0000101497"	"0000163963"
"0000101498"	"0000163964"
"0000101499"	"0000163971"
"0000101500"	"0000163995"
"0000101501"	"0000163996"
"0000101502"	"0000164009"
"0000101503"	"0000164096"
"0000101504"	"0000164112"
"0000101505"	"0000164101"
"0000101506"	"0000164102"
"0000101507"	"0000164117"
"0000101508"	"0000164118"
"0000101509"	"0000164115"
"0000101510"	"0000164116"
"0000101511"	"0000164127"
"0000101512"	"0000164132"
"0000101513"	"0000164135"
"0000101514"	"0000164136"
"0000101515"	"0000164173"
"0000101516"	"0000164178"
"0000101517"	"0000163962"
"0000101518"	"0000164002"
"0000101519"	"0000164003"
"0000101520"	"0000164034"
"0000101521"	"0000164048"
"0000101522"	"0000164049"
"0000101523"	"0000164085"
"0000101524"	"0000164093"
"0000101525"	"0000164119"
"0000101526"	"0000164130"
"0000101527"	"0000164142"
"0000101528"	"0000164177"
"0000101529"	"0000163982"
"0000101530"	"0000164008"
"0000101531"	"0000164013"
"0000101532"	"0000164052"
"0000101533"	"0000164081"
"0000101534"	"0000164083"
"0000101535"	"0000164084"
"0000101536"	"0000164086"
"0000101537"	"0000163994"
"0000101538"	"0000164045"
"0000101539"	"0000164047"
"0000101540"	"0000164075"
"0000101541"	"0000163980"
"0000101542"	"0000163985"
"0000101543"	"0000163997"
"0000101544"	"0000163999"
"0000101545"	"0000164032"
"0000101546"	"0000164025"
"0000101547"	"0000164041"
"0000101548"	"0000164073"
"0000101549"	"0000164120"
"0000101550"	"0000164167"
"0000101551"	"0000164168"
"0000101552"	"0000163988"
"0000101553"	"0000163989"
"0000101554"	"0000163998"
"0000101555"	"0000164000"
"0000101556"	"0000164001"
"0000101557"	"0000164015"
"0000101558"	"0000164021"
"0000101559"	"0000164033"
"0000101560"	"0000164095"
"0000101561"	"0000164113"
"0000101562"	"0000164129"
"0000101563"	"0000164181"
"0000101564"	"0000163966"
"0000101565"	"0000163967"
"0000101566"	"0000163970"
"0000101567"	"0000163974"
"0000101568"	"0000163979"
"0000101568"	"0000188112"
"0000101569"	"0000163972"
"0000101570"	"0000163992"
"0000101571"	"0000164004"
"0000101572"	"0000164007"
"0000101573"	"0000164010"
"0000101574"	"0000164016"
"0000101575"	"0000164017"
"0000101576"	"0000164022"
"0000101577"	"0000164031"
"0000101578"	"0000164037"
"0000101579"	"0000164038"
"0000101580"	"0000164053"
"0000101581"	"0000164071"
"0000101582"	"0000164078"
"0000101583"	"0000164080"
"0000101584"	"0000164087"
"0000101585"	"0000164088"
"0000101586"	"0000164089"
"0000101587"	"0000164090"
"0000101588"	"0000164121"
"0000101589"	"0000164125"
"0000101590"	"0000164165"
"0000101591"	"0000164170"
"0000101592"	"0000163993"
"0000101594"	"0000163991"
"0000101595"	"0000164014"
"0000101596"	"0000164023"
"0000101597"	"0000164020"
"0000101598"	"0000164024"
"0000101599"	"0000164030"
"0000101600"	"0000164036"
"0000101601"	"0000164051"
"0000101602"	"0000164057"
"0000101603"	"0000164069"
"0000101604"	"0000164072"
"0000101605"	"0000164094"
"0000101606"	"0000164082"
"0000101607"	"0000164091"
"0000101608"	"0000164092"
"0000101609"	"0000164114"
"0000101610"	"0000164124"
"0000101611"	"0000164140"
"0000101612"	"0000164131"
"0000101613"	"0000164144"
"0000101614"	"0000164166"
"0000101615"	"0000163959"
"0000101615"	"0000164074"
"0000101616"	"0000163975"
"0000101617"	"0000163953"
"0000101617"	"0000164056"
"0000101617"	"0000164161"
"0000101618"	"0000163954"
"0000101618"	"0000164162"
"0000101619"	"0000163955"
"0000101619"	"0000164163"
"0000101620"	"0000164164"
"0000101621"	"0000164189"
"0000101622"	"0000164190"
"0000181842"	"0000405538"
"0000184041"	"0000408005"
"0000184041"	"0000408006"
"0000184042"	"0000408007"
"0000184042"	"0000408008"
"0000184043"	"0000408009"
"0000184043"	"0000408010"
"0000184044"	"0000408011"
"0000184044"	"0000408012"
"0000220554"	"0000463985"
"0000220560"	"0000463986"
"0000220573"	"0000463987"
"0000220573"	"0000463988"
"0000220622"	"0000463989"
"0000220640"	"0000463990"
"0000220646"	"0000463991"
"0000220652"	"0000463992"
"0000220653"	"0000463993"
"0000220655"	"0000463994"
"0000220676"	"0000463995"
"0000220692"	"0000463996"
"0000220693"	"0000463997"
"0000220704"	"0000463998"
"0000220705"	"0000463999"
"0000220730"	"0000464000"
"0000220730"	"0000464001"
"0000220731"	"0000464002"
"0000220731"	"0000464003"
"0000220737"	"0000464004"
"0000220737"	"0000464005"
"0000220748"	"0000464006"
"0000220748"	"0000464007"
"0000220751"	"0000464008"
"0000220751"	"0000464009"
"0000220787"	"0000464010"
"0000220787"	"0000464011"
"0000220787"	"0000464012"
"0000220795"	"0000464013"
"0000220807"	"0000464014"
"0000220827"	"0000464015"
"0000220834"	"0000464016"
"0000220834"	"0000464017"
"0000220837"	"0000464018"
"0000220841"	"0000464019"
"0000220841"	"0000464020"
"0000220855"	"0000464021"
"0000220867"	"0000464022"
"0000220886"	"0000464023"
"0000220888"	"0000464024"
"0000220909"	"0000464025"
"0000220925"	"0000464026"
"0000220937"	"0000464027"
"0000220937"	"0000464028"
"0000220942"	"0000464029"
"0000220942"	"0000464030"
"0000220951"	"0000464031"
"0000220953"	"0000464032"
"0000220959"	"0000464033"
"0000220961"	"0000464034"
"0000220993"	"0000464035"
"0000220994"	"0000464036"
"0000221000"	"0000464037"
"0000221000"	"0000464038"
"0000221001"	"0000464039"
"0000221002"	"0000464040"
"0000221021"	"0000464041"
"0000221024"	"0000464042"
"0000221024"	"0000464043"
"0000221028"	"0000464044"
"0000221115"	"0000464045"
"0000221115"	"0000464046"
"0000221122"	"0000464047"
"0000221136"	"0000464048"
"0000221136"	"0000464049"
"0000221143"	"0000464050"
"0000221165"	"0000464051"
"0000221239"	"0000464052"
"0000221247"	"0000464053"
"0000221299"	"0000464054"
"0000221352"	"0000464055"
"0000221388"	"0000464056"
"0000221401"	"0000464057"
"0000221457"	"0000464058"
"0000221461"	"0000464059"
"0000221468"	"0000464060"
"0000221468"	"0000464061"
"0000221517"	"0000464062"
"0000221534"	"0000464063"
"0000221552"	"0000464064"
"0000221553"	"0000464065"
"0000221558"	"0000464066"
"0000221574"	"0000464067"
"0000221577"	"0000464068"
"0000221582"	"0000464069"
"0000221582"	"0000464070"
"0000221591"	"0000464071"
"0000221591"	"0000464072"
"0000221610"	"0000464073"
"0000221610"	"0000464074"
"0000221625"	"0000464075"
"0000221642"	"0000464076"
"0000221644"	"0000464077"
"0000221644"	"0000464078"
"0000221644"	"0000464079"
"0000221648"	"0000464080"
"0000221656"	"0000464081"
"0000221664"	"0000464082"
"0000221665"	"0000464083"
"0000221675"	"0000464084"
"0000221676"	"0000464085"
"0000221681"	"0000464086"
"0000221724"	"0000464087"
"0000221736"	"0000464088"
"0000221739"	"0000464089"
"0000221748"	"0000464090"
"0000221758"	"0000464091"
"0000221771"	"0000464092"
"0000221778"	"0000464093"
"0000221778"	"0000464094"
"0000221779"	"0000464095"
"0000221779"	"0000464096"
"0000221804"	"0000464097"
"0000221809"	"0000464098"
"0000221817"	"0000464099"
"0000221830"	"0000464100"
"0000221858"	"0000464101"
"0000221861"	"0000464102"
"0000221863"	"0000464103"
"0000221867"	"0000464104"
"0000221874"	"0000464105"
"0000221874"	"0000464106"
"0000221890"	"0000464107"
"0000221894"	"0000464108"
"0000221918"	"0000464109"
"0000221929"	"0000464110"
"0000221929"	"0000464111"
"0000221974"	"0000464112"
"0000221982"	"0000464113"
"0000221983"	"0000464114"
"0000222003"	"0000464115"
"0000222003"	"0000464116"
"0000222049"	"0000464117"
"0000222049"	"0000464118"
"0000222076"	"0000464119"
"0000222083"	"0000464120"
"0000222099"	"0000464121"
"0000222105"	"0000464122"
"0000222125"	"0000464123"
"0000222131"	"0000464124"
"0000222131"	"0000464125"
"0000222155"	"0000464126"
"0000222155"	"0000464127"
"0000222156"	"0000464128"
"0000222162"	"0000464129"
"0000222207"	"0000464130"
"0000222207"	"0000464131"
"0000222219"	"0000464132"
"0000222226"	"0000464133"
"0000222228"	"0000464134"
"0000222262"	"0000464135"
"0000222265"	"0000464136"
"0000222268"	"0000464137"
"0000222272"	"0000464138"
"0000222283"	"0000464139"
"0000222287"	"0000464140"
"0000222288"	"0000464141"
"0000222353"	"0000464142"
"0000222372"	"0000464143"
"0000222377"	"0000464144"
"0000222386"	"0000464145"
"0000222386"	"0000464146"
"0000222405"	"0000464147"
"0000222415"	"0000464148"
"0000222437"	"0000464149"
"0000222454"	"0000464150"
"0000222478"	"0000464151"
"0000222519"	"0000464152"
"0000222520"	"0000464153"
"0000222520"	"0000464154"
"0000222527"	"0000464155"
"0000222541"	"0000464156"
"0000222555"	"0000464157"
"0000222555"	"0000464158"
"0000222564"	"0000464159"
"0000222569"	"0000464160"
"0000222569"	"0000464161"
"0000222582"	"0000464162"
"0000222591"	"0000464163"
"0000222592"	"0000464164"
"0000222599"	"0000464165"
"0000222600"	"0000464166"
"0000222604"	"0000464167"
"0000222606"	"0000464168"
"0000222653"	"0000464169"
"0000222668"	"0000464170"
"0000222668"	"0000464171"
"0000222694"	"0000464172"
"0000222705"	"0000464173"
"0000222723"	"0000464174"
"0000222753"	"0000464175"
"0000222753"	"0000464176"
"0000222757"	"0000464177"
"0000222777"	"0000464178"
"0000222806"	"0000464179"
"0000222808"	"0000464180"
"0000222814"	"0000464181"
"0000222831"	"0000464182"
"0000222838"	"0000464183"
"0000222864"	"0000464184"
"0000222880"	"0000464185"
"0000222914"	"0000464186"
"0000222916"	"0000464187"
"0000222922"	"0000464188"
"0000222922"	"0000464189"
"0000222938"	"0000464190"
"0000222938"	"0000464191"
"0000222938"	"0000464192"
"0000222949"	"0000464193"
"0000222949"	"0000464194"
"0000222971"	"0000464195"
"0000222993"	"0000464196"
"0000223005"	"0000464197"
"0000223017"	"0000464198"
"0000223022"	"0000464199"
"0000223061"	"0000464200"
"0000223061"	"0000464201"
"0000223090"	"0000464202"
"0000223094"	"0000464203"
"0000223101"	"0000464204"
"0000223132"	"0000464205"
"0000223145"	"0000464206"
"0000223146"	"0000464207"
"0000223149"	"0000464208"
"0000223157"	"0000464209"
"0000223180"	"0000464210"
"0000223182"	"0000464211"
"0000223203"	"0000464212"
"0000223208"	"0000464213"
"0000223208"	"0000464214"
"0000223209"	"0000464215"
"0000223229"	"0000464216"
"0000223253"	"0000464217"
"0000223279"	"0000464218"
"0000223281"	"0000464219"
"0000223300"	"0000464220"
"0000223300"	"0000464221"
"0000223304"	"0000464222"
"0000223309"	"0000464223"
"0000223310"	"0000464224"
"0000223314"	"0000464225"
"0000223337"	"0000464226"
"0000223342"	"0000464227"
"0000223350"	"0000464228"
"0000223350"	"0000464229"
"0000223401"	"0000464230"
"0000223424"	"0000464231"
"0000223424"	"0000464232"
"0000223427"	"0000464233"
"0000223427"	"0000464234"
"0000223434"	"0000464235"
"0000223441"	"0000464236"
"0000223444"	"0000464237"
"0000223451"	"0000464238"
"0000223455"	"0000464239"
"0000223461"	"0000464240"
"0000223465"	"0000464241"
"0000223474"	"0000464242"
"0000223484"	"0000464243"
"0000223484"	"0000464244"
"0000223517"	"0000464245"
"0000223527"	"0000464246"
"0000223527"	"0000464247"
"0000223529"	"0000464248"
"0000223535"	"0000464249"
"0000223546"	"0000464250"
"0000223569"	"0000464251"
"0000223586"	"0000464252"
"0000223589"	"0000464253"
"0000223610"	"0000464254"
"0000223624"	"0000464255"
"0000223649"	"0000464256"
"0000223676"	"0000464257"
"0000223697"	"0000464258"
"0000223708"	"0000464259"
"0000223713"	"0000464260"
"0000223742"	"0000464261"
"0000223752"	"0000464262"
"0000223758"	"0000464263"
"0000223766"	"0000464264"
"0000223766"	"0000464265"
"0000223780"	"0000464266"
"0000223787"	"0000464267"
"0000223813"	"0000464268"
"0000229758"	"0000470964"
"0000229758"	"0000470965"
"0000229758"	"0000470966"
"0000229758"	"0000470967"
"0000229758"	"0000470968"
"0000229758"	"0000470969"
"0000229758"	"0000470970"
"0000229758"	"0000470971"
"0000229758"	"0000470972"
"0000229758"	"0000470973"
"0000229758"	"0000470974"
"0000229758"	"0000470975"
"0000229758"	"0000470976"
"0000235579"	"0000478806"
"0000235580"	"0000478807"
"0000235581"	"0000478808"
"0000235582"	"0000478809"
"0000235583"	"0000478810"
"0000235584"	"0000478811"
"0000235585"	"0000478812"
"0000235586"	"0000478813"
"0000235587"	"0000478814"
"0000235588"	"0000478815"
"0000235589"	"0000478816"
"0000235590"	"0000478817"
"0000235591"	"0000478818"
"0000235592"	"0000478819"
"0000235593"	"0000478820"
"0000235594"	"0000478821"
"0000235595"	"0000478822"
"0000235596"	"0000478823"
"0000235597"	"0000478824"
"0000235598"	"0000478825"
"0000235599"	"0000478826"
"0000235600"	"0000478827"
"0000235601"	"0000478828"
"0000235602"	"0000478829"
"0000235603"	"0000478830"
"0000235604"	"0000478831"
"0000235605"	"0000478832"
"0000235606"	"0000478833"
"0000235607"	"0000478834"
"0000235608"	"0000478835"
"0000235609"	"0000478836"
"0000235610"	"0000478837"
"0000235611"	"0000478838"
"0000235612"	"0000478839"
"0000235613"	"0000478840"
"0000235614"	"0000478841"
"0000235615"	"0000478842"
"0000235616"	"0000478843"
"0000235617"	"0000478844"
"0000235618"	"0000478845"
"0000235619"	"0000478846"
"0000235620"	"0000478847"
"0000235621"	"0000478848"
"0000235622"	"0000478849"
"0000235623"	"0000478850"
"0000235624"	"0000478851"
"0000235625"	"0000478852"
"0000235626"	"0000478853"
"0000235627"	"0000478854"
"0000235628"	"0000478855"
"0000235629"	"0000478856"
"0000235630"	"0000478857"
"0000235631"	"0000478858"
"0000235632"	"0000478859"
"0000235633"	"0000478860"
"0000235634"	"0000478861"
"0000235635"	"0000478862"
"0000235636"	"0000478863"
"0000235637"	"0000478864"
"0000235638"	"0000478865"
"0000235639"	"0000478866"
"0000235640"	"0000478867"
"0000235641"	"0000478868"
"0000235642"	"0000478869"
"0000235643"	"0000478870"
"0000235644"	"0000478871"
"0000235645"	"0000478872"
"0000235646"	"0000478873"
"0000235647"	"0000478874"
"0000235648"	"0000478875"
"0000235649"	"0000478876"
"0000235650"	"0000478877"
"0000235651"	"0000478878"
"0000235652"	"0000478879"
"0000235653"	"0000478880"
"0000235654"	"0000478881"
"0000235655"	"0000478882"
"0000235656"	"0000478883"
"0000235657"	"0000478884"
"0000235658"	"0000478885"
"0000235659"	"0000478886"
"0000235660"	"0000478887"
"0000235661"	"0000478888"
"0000235662"	"0000478889"
"0000235663"	"0000478890"
"0000235664"	"0000478891"
"0000235665"	"0000478892"
"0000235666"	"0000478893"
"0000235667"	"0000478894"
"0000235668"	"0000478895"
"0000235669"	"0000478896"
"0000235670"	"0000478897"
"0000235671"	"0000478898"
"0000235672"	"0000478899"
"0000235673"	"0000478900"
"0000235674"	"0000478901"
"0000235675"	"0000478902"
"0000235676"	"0000478903"
"0000235677"	"0000478904"
"0000235678"	"0000478905"
"0000235679"	"0000478906"
"0000235680"	"0000478907"
"0000235681"	"0000478908"
"0000235682"	"0000478909"
"0000235683"	"0000478910"
"0000235684"	"0000478911"
"0000235685"	"0000478912"
"0000235686"	"0000478913"
"0000235687"	"0000478914"
"0000235688"	"0000478915"
"0000235689"	"0000478916"
"0000235690"	"0000478917"
"0000235691"	"0000478918"
"0000235692"	"0000478919"
"0000235693"	"0000478920"
"0000235694"	"0000478921"
"0000235695"	"0000478922"
"0000235696"	"0000478923"
"0000235697"	"0000478924"
"0000235698"	"0000478925"
"0000235699"	"0000478926"
"0000235700"	"0000478927"
"0000235701"	"0000478928"
"0000235702"	"0000478929"
"0000235703"	"0000478930"
"0000235704"	"0000478931"
"0000235705"	"0000478932"
"0000235706"	"0000478933"
"0000235707"	"0000478934"
"0000235708"	"0000478935"
"0000235709"	"0000478936"
"0000235710"	"0000478937"
"0000235711"	"0000478938"
"0000235712"	"0000478939"
"0000235713"	"0000478940"
"0000235714"	"0000478941"
"0000235715"	"0000478942"
"0000235716"	"0000478943"
"0000235717"	"0000478944"
"0000235718"	"0000478945"
"0000235719"	"0000478946"
"0000235720"	"0000478947"
"0000235721"	"0000478948"
"0000235722"	"0000478949"
"0000235723"	"0000478950"
"0000235724"	"0000478951"
"0000235725"	"0000478952"
"0000235726"	"0000478953"
"0000235727"	"0000478954"
"0000235728"	"0000478955"
"0000235729"	"0000478956"
"0000235730"	"0000478957"
"0000235731"	"0000478958"
"0000235732"	"0000478959"
"0000235733"	"0000478960"
"0000235734"	"0000478961"
"0000235735"	"0000478962"
"0000235736"	"0000478963"
"0000235737"	"0000478964"
"0000235738"	"0000478965"
"0000235739"	"0000478966"
"0000235740"	"0000478967"
"0000235741"	"0000478968"
"0000235742"	"0000478969"
"0000235743"	"0000478970"
"0000235744"	"0000478971"
"0000235745"	"0000478972"
"0000235746"	"0000478973"
"0000235747"	"0000478974"
"0000235748"	"0000478975"
"0000235749"	"0000478976"
"0000235750"	"0000478977"
"0000235751"	"0000478978"
"0000235752"	"0000478979"
"0000235753"	"0000478980"
"0000235754"	"0000478981"
"0000235755"	"0000478982"
"0000235756"	"0000478983"
"0000235757"	"0000478984"
"0000235758"	"0000478985"
"0000235759"	"0000478986"
"0000235760"	"0000478987"
"0000235761"	"0000478988"
"0000235762"	"0000478989"
"0000235763"	"0000478990"
"0000235764"	"0000478991"
"0000235765"	"0000478992"
"0000235766"	"0000478993"
"0000235767"	"0000478994"
"0000235768"	"0000478995"
"0000235769"	"0000478996"
"0000235770"	"0000478997"
"0000235771"	"0000478998"
"0000235772"	"0000478999"
"0000235773"	"0000479000"
"0000235774"	"0000479001"
"0000235775"	"0000479002"
"0000235776"	"0000479003"
"0000235777"	"0000479004"
"0000235778"	"0000479005"
"0000235779"	"0000479006"
"0000235780"	"0000479007"
"0000235781"	"0000479008"
"0000235782"	"0000479009"
"0000235783"	"0000479010"
"0000235784"	"0000479011"
"0000235785"	"0000479012"
"0000235786"	"0000479013"
"0000235787"	"0000479014"
"0000235788"	"0000479015"
"0000235789"	"0000479016"
"0000235790"	"0000479017"
"0000235791"	"0000479018"
"0000235792"	"0000479019"
"0000235793"	"0000479020"
"0000235794"	"0000479021"
"0000235795"	"0000479022"
"0000235796"	"0000479023"
"0000235797"	"0000479024"
"0000235798"	"0000479025"
"0000235799"	"0000479026"
"0000235800"	"0000479027"
"0000235801"	"0000479028"
"0000235802"	"0000479029"
"0000235803"	"0000479030"
"0000235804"	"0000479031"
"0000235805"	"0000479032"
"0000235806"	"0000479033"
"0000235807"	"0000479034"
"0000235808"	"0000479035"
"0000235809"	"0000479036"
"0000235810"	"0000479037"
"0000235811"	"0000479038"
"0000235812"	"0000479039"
"0000235813"	"0000479040"
"0000235814"	"0000479041"
"0000235815"	"0000479042"
"0000235816"	"0000479043"
"0000235817"	"0000479044"
"0000235818"	"0000479045"
"0000235819"	"0000479046"
"0000235820"	"0000479047"
"0000235821"	"0000479048"
"0000235822"	"0000479049"
"0000235823"	"0000479050"
"0000235824"	"0000479051"
"0000235825"	"0000479052"
"0000235826"	"0000479053"
"0000235827"	"0000479054"
"0000235828"	"0000479055"
"0000235829"	"0000479056"
"0000235830"	"0000479057"
"0000235831"	"0000479058"
"0000235832"	"0000479059"
"0000235833"	"0000479060"
"0000235834"	"0000479061"
"0000235835"	"0000479062"
"0000235836"	"0000479063"
"0000235837"	"0000479064"
"0000235838"	"0000479065"
"0000235839"	"0000479066"
"0000235840"	"0000479067"
"0000235841"	"0000479068"
"0000235842"	"0000479069"
"0000235843"	"0000479070"
"0000235844"	"0000479071"
"0000235845"	"0000479072"
"0000235846"	"0000479073"
"0000235847"	"0000479074"
"0000235848"	"0000479075"
"0000235849"	"0000479076"
"0000235850"	"0000479077"
"0000235851"	"0000479078"
"0000235852"	"0000479079"
"0000235853"	"0000479080"
"0000235854"	"0000479081"
"0000235855"	"0000479082"
"0000235856"	"0000479083"
"0000235857"	"0000479084"
"0000235858"	"0000479085"
"0000235859"	"0000479086"
"0000235860"	"0000479087"
"0000235861"	"0000479088"
"0000235862"	"0000479089"
"0000235863"	"0000479090"
"0000235864"	"0000479091"
"0000235865"	"0000479092"
"0000235866"	"0000479093"
"0000235867"	"0000479094"
"0000235868"	"0000479095"
"0000235869"	"0000479096"
"0000235870"	"0000479097"
"0000235871"	"0000479098"
"0000235872"	"0000479099"
"0000235873"	"0000479100"
"0000235874"	"0000479101"
"0000235875"	"0000479102"
"0000235876"	"0000479103"
"0000235877"	"0000479104"
"0000235878"	"0000479105"
"0000235879"	"0000479106"
"0000235880"	"0000479107"
"0000235881"	"0000479108"
"0000235882"	"0000479109"
"0000235883"	"0000479110"
"0000235884"	"0000479111"
"0000235885"	"0000479112"
"0000235886"	"0000479113"
"0000235887"	"0000479114"
"0000235888"	"0000479115"
"0000235889"	"0000479116"
"0000235890"	"0000479117"
"0000235891"	"0000479118"
"0000235892"	"0000479119"
"0000235893"	"0000479120"
"0000235894"	"0000479121"
"0000235895"	"0000479122"
"0000235896"	"0000479123"
"0000235897"	"0000479124"
"0000235898"	"0000479125"
"0000235899"	"0000479126"
"0000235900"	"0000479127"
"0000235901"	"0000479128"
"0000235902"	"0000479129"
"0000235903"	"0000479130"
"0000235904"	"0000479131"
"0000235905"	"0000479132"
"0000235906"	"0000479133"
"0000235907"	"0000479134"
"0000235908"	"0000479135"
"0000235909"	"0000479136"
"0000235910"	"0000479137"
"0000235911"	"0000479138"
"0000235912"	"0000479139"
"0000235913"	"0000479140"
"0000235914"	"0000479141"
"0000235915"	"0000479142"
"0000235916"	"0000479143"
"0000235917"	"0000479144"
"0000235918"	"0000479145"
"0000235919"	"0000479146"
"0000235920"	"0000479147"
"0000235921"	"0000479148"
"0000235922"	"0000479149"
"0000235923"	"0000479150"
"0000235924"	"0000479151"
"0000235925"	"0000479152"
"0000235926"	"0000479153"
"0000235927"	"0000479154"
"0000235928"	"0000479155"
"0000235928"	"0000479630"
"0000235929"	"0000479156"
"0000235929"	"0000479631"
"0000235930"	"0000479157"
"0000235930"	"0000479632"
"0000235931"	"0000479158"
"0000235931"	"0000479633"
"0000235932"	"0000479159"
"0000235932"	"0000479634"
"0000235933"	"0000479160"
"0000235933"	"0000479635"
"0000235934"	"0000479161"
"0000235934"	"0000479636"
"0000235935"	"0000479162"
"0000235935"	"0000479637"
"0000235936"	"0000479163"
"0000235936"	"0000479638"
"0000235937"	"0000479164"
"0000235937"	"0000479639"
"0000235938"	"0000479165"
"0000235938"	"0000479640"
"0000235939"	"0000479166"
"0000235939"	"0000479641"
"0000235940"	"0000479167"
"0000235940"	"0000479642"
"0000235941"	"0000479168"
"0000235941"	"0000479643"
"0000235942"	"0000479169"
"0000235942"	"0000479644"
"0000235943"	"0000479170"
"0000235943"	"0000479645"
"0000235944"	"0000479171"
"0000235944"	"0000479646"
"0000235945"	"0000479172"
"0000235945"	"0000479647"
"0000235946"	"0000479173"
"0000235946"	"0000479648"
"0000235947"	"0000479174"
"0000235947"	"0000479649"
"0000235948"	"0000479175"
"0000235948"	"0000479650"
"0000235949"	"0000479176"
"0000235949"	"0000479651"
"0000235950"	"0000479177"
"0000235950"	"0000479652"
"0000235951"	"0000479178"
"0000235951"	"0000479653"
"0000235952"	"0000479179"
"0000235952"	"0000479654"
"0000235953"	"0000479180"
"0000235953"	"0000479655"
"0000235954"	"0000479181"
"0000235954"	"0000479656"
"0000235955"	"0000479182"
"0000235955"	"0000479657"
"0000235956"	"0000479183"
"0000235956"	"0000479658"
"0000235957"	"0000479184"
"0000235957"	"0000479659"
"0000235958"	"0000479185"
"0000235958"	"0000479660"
"0000235959"	"0000479186"
"0000235959"	"0000479661"
"0000235960"	"0000479187"
"0000235960"	"0000479662"
"0000235961"	"0000479188"
"0000235961"	"0000479663"
"0000235962"	"0000479189"
"0000235962"	"0000479664"
"0000235963"	"0000479190"
"0000235963"	"0000479665"
"0000235964"	"0000479191"
"0000235964"	"0000479666"
"0000235965"	"0000479192"
"0000235965"	"0000479667"
"0000235966"	"0000479193"
"0000235966"	"0000479668"
"0000235967"	"0000479194"
"0000235967"	"0000479669"
"0000235968"	"0000479195"
"0000235968"	"0000479670"
"0000235969"	"0000479196"
"0000235969"	"0000479671"
"0000235970"	"0000479197"
"0000235970"	"0000479672"
"0000235971"	"0000479198"
"0000235971"	"0000479673"
"0000235972"	"0000479199"
"0000235972"	"0000479674"
"0000235973"	"0000479200"
"0000235973"	"0000479675"
"0000235974"	"0000479201"
"0000235974"	"0000479676"
"0000235975"	"0000479202"
"0000235975"	"0000479677"
"0000235976"	"0000479203"
"0000235976"	"0000479678"
"0000235976"	"0000480105"
"0000235977"	"0000479204"
"0000235977"	"0000479679"
"0000235978"	"0000479205"
"0000235978"	"0000479680"
"0000235979"	"0000479206"
"0000235979"	"0000479681"
"0000235980"	"0000479207"
"0000235980"	"0000479682"
"0000235981"	"0000479208"
"0000235981"	"0000479683"
"0000235982"	"0000479209"
"0000235982"	"0000479684"
"0000235983"	"0000479210"
"0000235983"	"0000479685"
"0000235984"	"0000479211"
"0000235984"	"0000479686"
"0000235985"	"0000479212"
"0000235985"	"0000479687"
"0000235986"	"0000479213"
"0000235986"	"0000479688"
"0000235987"	"0000479214"
"0000235987"	"0000479689"
"0000235988"	"0000479215"
"0000235988"	"0000479690"
"0000235989"	"0000479216"
"0000235989"	"0000479691"
"0000235990"	"0000479217"
"0000235990"	"0000479692"
"0000235991"	"0000479218"
"0000235991"	"0000479693"
"0000235992"	"0000479219"
"0000235992"	"0000479694"
"0000235993"	"0000479220"
"0000235993"	"0000479695"
"0000235994"	"0000479221"
"0000235994"	"0000479696"
"0000235995"	"0000479222"
"0000235995"	"0000479697"
"0000235996"	"0000479223"
"0000235996"	"0000479698"
"0000235997"	"0000479224"
"0000235997"	"0000479699"
"0000235998"	"0000479225"
"0000235998"	"0000479700"
"0000235999"	"0000479226"
"0000235999"	"0000479701"
"0000236000"	"0000479227"
"0000236000"	"0000479702"
"0000236001"	"0000479228"
"0000236001"	"0000479703"
"0000236002"	"0000479229"
"0000236002"	"0000479704"
"0000236003"	"0000479230"
"0000236003"	"0000479705"
"0000236004"	"0000479231"
"0000236004"	"0000479706"
"0000236005"	"0000479232"
"0000236005"	"0000479707"
"0000236006"	"0000479233"
"0000236006"	"0000479708"
"0000236007"	"0000479234"
"0000236007"	"0000479709"
"0000236008"	"0000479235"
"0000236008"	"0000479710"
"0000236009"	"0000479236"
"0000236009"	"0000479711"
"0000236010"	"0000479237"
"0000236010"	"0000479712"
"0000236011"	"0000479238"
"0000236011"	"0000479713"
"0000236012"	"0000479239"
"0000236012"	"0000479714"
"0000236013"	"0000479240"
"0000236013"	"0000479715"
"0000236014"	"0000479241"
"0000236014"	"0000479716"
"0000236015"	"0000479242"
"0000236015"	"0000479717"
"0000236016"	"0000479243"
"0000236016"	"0000479718"
"0000236017"	"0000479244"
"0000236017"	"0000479719"
"0000236018"	"0000479245"
"0000236018"	"0000479720"
"0000236019"	"0000479246"
"0000236019"	"0000479721"
"0000236020"	"0000479247"
"0000236020"	"0000479722"
"0000236021"	"0000479248"
"0000236021"	"0000479723"
"0000236022"	"0000479249"
"0000236022"	"0000479724"
"0000236023"	"0000479250"
"0000236023"	"0000479725"
"0000236024"	"0000479251"
"0000236024"	"0000479726"
"0000236025"	"0000479252"
"0000236025"	"0000479727"
"0000236026"	"0000479253"
"0000236026"	"0000479728"
"0000236027"	"0000479254"
"0000236027"	"0000479729"
"0000236028"	"0000479255"
"0000236028"	"0000479730"
"0000236029"	"0000479256"
"0000236029"	"0000479731"
"0000236030"	"0000479257"
"0000236030"	"0000479732"
"0000236031"	"0000479258"
"0000236031"	"0000479733"
"0000236032"	"0000479259"
"0000236032"	"0000479734"
"0000236033"	"0000479260"
"0000236033"	"0000479735"
"0000236034"	"0000479261"
"0000236034"	"0000479736"
"0000236035"	"0000479262"
"0000236035"	"0000479737"
"0000236036"	"0000479263"
"0000236036"	"0000479738"
"0000236037"	"0000479264"
"0000236037"	"0000479739"
"0000236038"	"0000479265"
"0000236038"	"0000479740"
"0000236039"	"0000479266"
"0000236039"	"0000479741"
"0000236040"	"0000479267"
"0000236040"	"0000479742"
"0000236041"	"0000479268"
"0000236041"	"0000479743"
"0000236042"	"0000479269"
"0000236042"	"0000479744"
"0000236043"	"0000479270"
"0000236043"	"0000479745"
"0000236044"	"0000479271"
"0000236044"	"0000479746"
"0000236045"	"0000479272"
"0000236045"	"0000479747"
"0000236046"	"0000479273"
"0000236046"	"0000479748"
"0000236047"	"0000479274"
"0000236047"	"0000479749"
"0000236048"	"0000479275"
"0000236048"	"0000479750"
"0000236049"	"0000479276"
"0000236049"	"0000479751"
"0000236050"	"0000479277"
"0000236050"	"0000479752"
"0000236051"	"0000479278"
"0000236051"	"0000479753"
"0000236052"	"0000479279"
"0000236052"	"0000479754"
"0000236053"	"0000479280"
"0000236053"	"0000479755"
"0000236054"	"0000479281"
"0000236054"	"0000479756"
"0000236055"	"0000479282"
"0000236055"	"0000479757"
"0000236056"	"0000479283"
"0000236056"	"0000479758"
"0000236057"	"0000479284"
"0000236057"	"0000479759"
"0000236058"	"0000479285"
"0000236058"	"0000479760"
"0000236059"	"0000479286"
"0000236059"	"0000479761"
"0000236060"	"0000479287"
"0000236060"	"0000479762"
"0000236061"	"0000479288"
"0000236061"	"0000479763"
"0000236062"	"0000479289"
"0000236062"	"0000479764"
"0000236063"	"0000479290"
"0000236063"	"0000479765"
"0000236064"	"0000479291"
"0000236064"	"0000479766"
"0000236065"	"0000479292"
"0000236065"	"0000479767"
"0000236066"	"0000479293"
"0000236066"	"0000479768"
"0000236067"	"0000479294"
"0000236067"	"0000479769"
"0000236068"	"0000479295"
"0000236068"	"0000479770"
"0000236069"	"0000479296"
"0000236069"	"0000479771"
"0000236070"	"0000479297"
"0000236070"	"0000479772"
"0000236071"	"0000479298"
"0000236071"	"0000479773"
"0000236072"	"0000479299"
"0000236072"	"0000479774"
"0000236073"	"0000479300"
"0000236073"	"0000479775"
"0000236074"	"0000479301"
"0000236074"	"0000479776"
"0000236075"	"0000479302"
"0000236075"	"0000479777"
"0000236076"	"0000479303"
"0000236076"	"0000479778"
"0000236077"	"0000479304"
"0000236077"	"0000479779"
"0000236078"	"0000479305"
"0000236078"	"0000479780"
"0000236079"	"0000479306"
"0000236079"	"0000479781"
"0000236080"	"0000479307"
"0000236080"	"0000479782"
"0000236081"	"0000479308"
"0000236081"	"0000479783"
"0000236082"	"0000479309"
"0000236082"	"0000479784"
"0000236083"	"0000479310"
"0000236083"	"0000479785"
"0000236084"	"0000479311"
"0000236084"	"0000479786"
"0000236085"	"0000479312"
"0000236085"	"0000479787"
"0000236086"	"0000479313"
"0000236086"	"0000479788"
"0000236087"	"0000479314"
"0000236087"	"0000479789"
"0000236088"	"0000479315"
"0000236088"	"0000479790"
"0000236089"	"0000479316"
"0000236089"	"0000479791"
"0000236090"	"0000479317"
"0000236090"	"0000479792"
"0000236091"	"0000479318"
"0000236091"	"0000479793"
"0000236092"	"0000479319"
"0000236092"	"0000479794"
"0000236093"	"0000479320"
"0000236093"	"0000479795"
"0000236094"	"0000479321"
"0000236094"	"0000479796"
"0000236095"	"0000479322"
"0000236095"	"0000479797"
"0000236096"	"0000479323"
"0000236096"	"0000479798"
"0000236097"	"0000479324"
"0000236097"	"0000479799"
"0000236098"	"0000479325"
"0000236098"	"0000479800"
"0000236099"	"0000479326"
"0000236099"	"0000479801"
"0000236100"	"0000479327"
"0000236100"	"0000479802"
"0000236101"	"0000479328"
"0000236101"	"0000479803"
"0000236102"	"0000479329"
"0000236102"	"0000479804"
"0000236103"	"0000479330"
"0000236103"	"0000479805"
"0000236104"	"0000479331"
"0000236104"	"0000479806"
"0000236105"	"0000479332"
"0000236105"	"0000479807"
"0000236106"	"0000479333"
"0000236106"	"0000479808"
"0000236107"	"0000479334"
"0000236107"	"0000479809"
"0000236108"	"0000479335"
"0000236108"	"0000479810"
"0000236109"	"0000479336"
"0000236109"	"0000479811"
"0000236110"	"0000479337"
"0000236110"	"0000479812"
"0000236111"	"0000479338"
"0000236111"	"0000479813"
"0000236112"	"0000479339"
"0000236112"	"0000479814"
"0000236113"	"0000479340"
"0000236113"	"0000479815"
"0000236114"	"0000479341"
"0000236114"	"0000479816"
"0000236115"	"0000479342"
"0000236115"	"0000479817"
"0000236116"	"0000479343"
"0000236116"	"0000479818"
"0000236117"	"0000479344"
"0000236117"	"0000479819"
"0000236118"	"0000479345"
"0000236118"	"0000479820"
"0000236119"	"0000479346"
"0000236119"	"0000479821"
"0000236120"	"0000479347"
"0000236120"	"0000479822"
"0000236121"	"0000479348"
"0000236121"	"0000479823"
"0000236122"	"0000479349"
"0000236122"	"0000479824"
"0000236123"	"0000479350"
"0000236123"	"0000479825"
"0000236124"	"0000479351"
"0000236124"	"0000479826"
"0000236125"	"0000479352"
"0000236125"	"0000479827"
"0000236126"	"0000479353"
"0000236126"	"0000479828"
"0000236127"	"0000479354"
"0000236127"	"0000479829"
"0000236128"	"0000479355"
"0000236128"	"0000479830"
"0000236129"	"0000479356"
"0000236129"	"0000479831"
"0000236130"	"0000479357"
"0000236130"	"0000479832"
"0000236131"	"0000479358"
"0000236131"	"0000479833"
"0000236132"	"0000479359"
"0000236132"	"0000479834"
"0000236133"	"0000479360"
"0000236133"	"0000479835"
"0000236134"	"0000479361"
"0000236134"	"0000479836"
"0000236135"	"0000479362"
"0000236135"	"0000479837"
"0000236136"	"0000479363"
"0000236136"	"0000479838"
"0000236137"	"0000479364"
"0000236137"	"0000479839"
"0000236138"	"0000479365"
"0000236138"	"0000479840"
"0000236139"	"0000479366"
"0000236139"	"0000479841"
"0000236140"	"0000479367"
"0000236140"	"0000479842"
"0000236141"	"0000479368"
"0000236141"	"0000479843"
"0000236142"	"0000479369"
"0000236142"	"0000479844"
"0000236143"	"0000479370"
"0000236143"	"0000479845"
"0000236144"	"0000479371"
"0000236144"	"0000479846"
"0000236145"	"0000479372"
"0000236145"	"0000479847"
"0000236146"	"0000479373"
"0000236146"	"0000479848"
"0000236147"	"0000479374"
"0000236147"	"0000479849"
"0000236148"	"0000479375"
"0000236148"	"0000479850"
"0000236149"	"0000479376"
"0000236149"	"0000479851"
"0000236150"	"0000479377"
"0000236150"	"0000479852"
"0000236151"	"0000479378"
"0000236151"	"0000479853"
"0000236152"	"0000479379"
"0000236152"	"0000479854"
"0000236153"	"0000479380"
"0000236153"	"0000479855"
"0000236154"	"0000479381"
"0000236154"	"0000479856"
"0000236155"	"0000479382"
"0000236155"	"0000479857"
"0000236156"	"0000479383"
"0000236156"	"0000479858"
"0000236157"	"0000479384"
"0000236157"	"0000479859"
"0000236158"	"0000479385"
"0000236158"	"0000479860"
"0000236159"	"0000479386"
"0000236159"	"0000479861"
"0000236160"	"0000479387"
"0000236160"	"0000479862"
"0000236161"	"0000479388"
"0000236161"	"0000479863"
"0000236162"	"0000479389"
"0000236162"	"0000479864"
"0000236163"	"0000479390"
"0000236163"	"0000479865"
"0000236164"	"0000479391"
"0000236164"	"0000479866"
"0000236165"	"0000479392"
"0000236165"	"0000479867"
"0000236166"	"0000479393"
"0000236166"	"0000479868"
"0000236167"	"0000479394"
"0000236167"	"0000479869"
"0000236168"	"0000479395"
"0000236168"	"0000479870"
"0000236169"	"0000479396"
"0000236169"	"0000479871"
"0000236170"	"0000479397"
"0000236170"	"0000479872"
"0000236171"	"0000479398"
"0000236171"	"0000479873"
"0000236172"	"0000479399"
"0000236172"	"0000479874"
"0000236173"	"0000479400"
"0000236173"	"0000479875"
"0000236174"	"0000479401"
"0000236174"	"0000479876"
"0000236175"	"0000479402"
"0000236175"	"0000479877"
"0000236176"	"0000479403"
"0000236176"	"0000479878"
"0000236177"	"0000479404"
"0000236177"	"0000479879"
"0000236178"	"0000479405"
"0000236178"	"0000479880"
"0000236179"	"0000479406"
"0000236179"	"0000479881"
"0000236180"	"0000479407"
"0000236180"	"0000479882"
"0000236181"	"0000479408"
"0000236181"	"0000479883"
"0000236182"	"0000479409"
"0000236182"	"0000479884"
"0000236183"	"0000479410"
"0000236183"	"0000479885"
"0000236184"	"0000479411"
"0000236184"	"0000479886"
"0000236185"	"0000479412"
"0000236185"	"0000479887"
"0000236186"	"0000479413"
"0000236186"	"0000479888"
"0000236187"	"0000479414"
"0000236187"	"0000479889"
"0000236188"	"0000479415"
"0000236188"	"0000479890"
"0000236189"	"0000479416"
"0000236189"	"0000479891"
"0000236190"	"0000479417"
"0000236190"	"0000479892"
"0000236191"	"0000479418"
"0000236191"	"0000479893"
"0000236192"	"0000479419"
"0000236192"	"0000479894"
"0000236193"	"0000479420"
"0000236193"	"0000479895"
"0000236194"	"0000479421"
"0000236194"	"0000479896"
"0000236195"	"0000479422"
"0000236195"	"0000479897"
"0000236196"	"0000479423"
"0000236196"	"0000479898"
"0000236197"	"0000479424"
"0000236197"	"0000479899"
"0000236198"	"0000479425"
"0000236198"	"0000479900"
"0000236199"	"0000479426"
"0000236199"	"0000479901"
"0000236200"	"0000479427"
"0000236200"	"0000479902"
"0000236201"	"0000479428"
"0000236201"	"0000479903"
"0000236202"	"0000479429"
"0000236202"	"0000479904"
"0000236203"	"0000479430"
"0000236203"	"0000479905"
"0000236204"	"0000479431"
"0000236204"	"0000479906"
"0000236205"	"0000479432"
"0000236205"	"0000479907"
"0000236206"	"0000479433"
"0000236206"	"0000479908"
"0000236207"	"0000479434"
"0000236207"	"0000479909"
"0000236208"	"0000479435"
"0000236208"	"0000479910"
"0000236209"	"0000479436"
"0000236209"	"0000479911"
"0000236210"	"0000479437"
"0000236210"	"0000479912"
"0000236211"	"0000479438"
"0000236211"	"0000479913"
"0000236212"	"0000479439"
"0000236212"	"0000479914"
"0000236213"	"0000479440"
"0000236213"	"0000479915"
"0000236214"	"0000479441"
"0000236214"	"0000479916"
"0000236215"	"0000479442"
"0000236215"	"0000479917"
"0000236216"	"0000479443"
"0000236216"	"0000479918"
"0000236217"	"0000479444"
"0000236217"	"0000479919"
"0000236218"	"0000479445"
"0000236218"	"0000479920"
"0000236219"	"0000479446"
"0000236219"	"0000479921"
"0000236220"	"0000479447"
"0000236220"	"0000479922"
"0000236221"	"0000479448"
"0000236221"	"0000479923"
"0000236222"	"0000479449"
"0000236222"	"0000479924"
"0000236223"	"0000479450"
"0000236223"	"0000479925"
"0000236224"	"0000479451"
"0000236224"	"0000479926"
"0000236225"	"0000479452"
"0000236225"	"0000479927"
"0000236226"	"0000479453"
"0000236226"	"0000479928"
"0000236227"	"0000479454"
"0000236227"	"0000479929"
"0000236228"	"0000479455"
"0000236228"	"0000479930"
"0000236229"	"0000479456"
"0000236229"	"0000479931"
"0000236230"	"0000479457"
"0000236230"	"0000479932"
"0000236231"	"0000479458"
"0000236231"	"0000479933"
"0000236232"	"0000479459"
"0000236232"	"0000479934"
"0000236233"	"0000479460"
"0000236233"	"0000479935"
"0000236234"	"0000479461"
"0000236234"	"0000479936"
"0000236235"	"0000479462"
"0000236235"	"0000479937"
"0000236236"	"0000479463"
"0000236236"	"0000479938"
"0000236237"	"0000479464"
"0000236237"	"0000479939"
"0000236238"	"0000479465"
"0000236238"	"0000479940"
"0000236239"	"0000479466"
"0000236239"	"0000479941"
"0000236240"	"0000479467"
"0000236240"	"0000479942"
"0000236241"	"0000479468"
"0000236241"	"0000479943"
"0000236242"	"0000479469"
"0000236242"	"0000479944"
"0000236243"	"0000479470"
"0000236243"	"0000479945"
"0000236244"	"0000479471"
"0000236244"	"0000479946"
"0000236245"	"0000479472"
"0000236245"	"0000479947"
"0000236246"	"0000479473"
"0000236246"	"0000479948"
"0000236247"	"0000479474"
"0000236247"	"0000479949"
"0000236248"	"0000479475"
"0000236248"	"0000479950"
"0000236249"	"0000479476"
"0000236249"	"0000479951"
"0000236250"	"0000479477"
"0000236250"	"0000479952"
"0000236251"	"0000479478"
"0000236251"	"0000479953"
"0000236252"	"0000479479"
"0000236252"	"0000479954"
"0000236253"	"0000479480"
"0000236253"	"0000479955"
"0000236254"	"0000479481"
"0000236254"	"0000479956"
"0000236255"	"0000479482"
"0000236255"	"0000479957"
"0000236256"	"0000479483"
"0000236256"	"0000479958"
"0000236257"	"0000479484"
"0000236257"	"0000479959"
"0000236258"	"0000479485"
"0000236258"	"0000479960"
"0000236259"	"0000479486"
"0000236259"	"0000479961"
"0000236260"	"0000479487"
"0000236260"	"0000479962"
"0000236261"	"0000479488"
"0000236261"	"0000479963"
"0000236262"	"0000479489"
"0000236262"	"0000479964"
"0000236263"	"0000479490"
"0000236263"	"0000479965"
"0000236264"	"0000479491"
"0000236264"	"0000479966"
"0000236265"	"0000479492"
"0000236265"	"0000479967"
"0000236266"	"0000479493"
"0000236266"	"0000479968"
"0000236267"	"0000479494"
"0000236267"	"0000479969"
"0000236268"	"0000479495"
"0000236268"	"0000479970"
"0000236269"	"0000479496"
"0000236269"	"0000479971"
"0000236270"	"0000479497"
"0000236270"	"0000479972"
"0000236271"	"0000479498"
"0000236271"	"0000479973"
"0000236272"	"0000479499"
"0000236272"	"0000479974"
"0000236273"	"0000479500"
"0000236273"	"0000479975"
"0000236274"	"0000479501"
"0000236274"	"0000479976"
"0000236275"	"0000479502"
"0000236275"	"0000479977"
"0000236276"	"0000479503"
"0000236276"	"0000479978"
"0000236277"	"0000479504"
"0000236277"	"0000479979"
"0000236278"	"0000479505"
"0000236278"	"0000479980"
"0000236279"	"0000479506"
"0000236279"	"0000479981"
"0000236280"	"0000479507"
"0000236280"	"0000479982"
"0000236281"	"0000479508"
"0000236281"	"0000479983"
"0000236282"	"0000479509"
"0000236282"	"0000479984"
"0000236283"	"0000479510"
"0000236283"	"0000479985"
"0000236284"	"0000479511"
"0000236284"	"0000479986"
"0000236285"	"0000479512"
"0000236285"	"0000479987"
"0000236286"	"0000479513"
"0000236286"	"0000479988"
"0000236287"	"0000479514"
"0000236287"	"0000479989"
"0000236288"	"0000479515"
"0000236288"	"0000479990"
"0000236289"	"0000479516"
"0000236289"	"0000479991"
"0000236290"	"0000479517"
"0000236290"	"0000479992"
"0000236291"	"0000479518"
"0000236291"	"0000479993"
"0000236292"	"0000479519"
"0000236292"	"0000479994"
"0000236293"	"0000479520"
"0000236293"	"0000479995"
"0000236294"	"0000479521"
"0000236294"	"0000479996"
"0000236295"	"0000479522"
"0000236295"	"0000479997"
"0000236296"	"0000479523"
"0000236296"	"0000479998"
"0000236297"	"0000479524"
"0000236297"	"0000479999"
"0000236298"	"0000479525"
"0000236298"	"0000480000"
"0000236299"	"0000479526"
"0000236299"	"0000480001"
"0000236300"	"0000479527"
"0000236300"	"0000480002"
"0000236301"	"0000479528"
"0000236301"	"0000480003"
"0000236302"	"0000479529"
"0000236302"	"0000480004"
"0000236303"	"0000479530"
"0000236303"	"0000480005"
"0000236304"	"0000479531"
"0000236304"	"0000480006"
"0000236305"	"0000479532"
"0000236305"	"0000480007"
"0000236306"	"0000479533"
"0000236306"	"0000480008"
"0000236307"	"0000479534"
"0000236307"	"0000480009"
"0000236308"	"0000479535"
"0000236308"	"0000480010"
"0000236309"	"0000479536"
"0000236309"	"0000480011"
"0000236310"	"0000479537"
"0000236310"	"0000480012"
"0000236311"	"0000479538"
"0000236311"	"0000480013"
"0000236312"	"0000479539"
"0000236312"	"0000480014"
"0000236313"	"0000479540"
"0000236313"	"0000480015"
"0000236314"	"0000479541"
"0000236314"	"0000480016"
"0000236315"	"0000479542"
"0000236315"	"0000480017"
"0000236316"	"0000479543"
"0000236316"	"0000480018"
"0000236317"	"0000479544"
"0000236317"	"0000480019"
"0000236318"	"0000479545"
"0000236318"	"0000480020"
"0000236319"	"0000479546"
"0000236319"	"0000480021"
"0000236320"	"0000479547"
"0000236320"	"0000480022"
"0000236321"	"0000479548"
"0000236321"	"0000480023"
"0000236322"	"0000479549"
"0000236322"	"0000480024"
"0000236323"	"0000479550"
"0000236323"	"0000480025"
"0000236324"	"0000479551"
"0000236324"	"0000480026"
"0000236325"	"0000479552"
"0000236325"	"0000480027"
"0000236326"	"0000479553"
"0000236326"	"0000480028"
"0000236327"	"0000479554"
"0000236327"	"0000480029"
"0000236328"	"0000479555"
"0000236328"	"0000480030"
"0000236329"	"0000479556"
"0000236329"	"0000480031"
"0000236330"	"0000479557"
"0000236330"	"0000480032"
"0000236331"	"0000479558"
"0000236331"	"0000480033"
"0000236332"	"0000479559"
"0000236332"	"0000480034"
"0000236333"	"0000479560"
"0000236333"	"0000480035"
"0000236334"	"0000479561"
"0000236334"	"0000480036"
"0000236335"	"0000479562"
"0000236335"	"0000480037"
"0000236336"	"0000479563"
"0000236336"	"0000480038"
"0000236337"	"0000479564"
"0000236337"	"0000480039"
"0000236338"	"0000479565"
"0000236338"	"0000480040"
"0000236339"	"0000479566"
"0000236339"	"0000480041"
"0000236340"	"0000479567"
"0000236340"	"0000480042"
"0000236341"	"0000479568"
"0000236341"	"0000480043"
"0000236342"	"0000479569"
"0000236342"	"0000480044"
"0000236343"	"0000479570"
"0000236343"	"0000480045"
"0000236344"	"0000479571"
"0000236344"	"0000480046"
"0000236345"	"0000479572"
"0000236345"	"0000480047"
"0000236346"	"0000479573"
"0000236346"	"0000480048"
"0000236347"	"0000479574"
"0000236347"	"0000480049"
"0000236348"	"0000479575"
"0000236348"	"0000480050"
"0000236349"	"0000479576"
"0000236349"	"0000480051"
"0000236350"	"0000479577"
"0000236350"	"0000480052"
"0000236351"	"0000479578"
"0000236351"	"0000480053"
"0000236352"	"0000479579"
"0000236352"	"0000480054"
"0000236353"	"0000479580"
"0000236353"	"0000480055"
"0000236354"	"0000479581"
"0000236354"	"0000480056"
"0000236355"	"0000479582"
"0000236355"	"0000480057"
"0000236356"	"0000479583"
"0000236356"	"0000480058"
"0000236357"	"0000479584"
"0000236357"	"0000480059"
"0000236358"	"0000479585"
"0000236358"	"0000480060"
"0000236359"	"0000479586"
"0000236359"	"0000480061"
"0000236360"	"0000479587"
"0000236360"	"0000480062"
"0000236361"	"0000479588"
"0000236361"	"0000480063"
"0000236362"	"0000479589"
"0000236362"	"0000480064"
"0000236363"	"0000479590"
"0000236363"	"0000480065"
"0000236364"	"0000479591"
"0000236364"	"0000480066"
"0000236365"	"0000479592"
"0000236365"	"0000480067"
"0000236366"	"0000479593"
"0000236366"	"0000480068"
"0000236367"	"0000479594"
"0000236367"	"0000480069"
"0000236368"	"0000479595"
"0000236368"	"0000480070"
"0000236369"	"0000479596"
"0000236369"	"0000480071"
"0000236370"	"0000479597"
"0000236370"	"0000480072"
"0000236371"	"0000479598"
"0000236371"	"0000480073"
"0000236372"	"0000479599"
"0000236372"	"0000480074"
"0000236373"	"0000479600"
"0000236373"	"0000480075"
"0000236374"	"0000479601"
"0000236374"	"0000480076"
"0000236375"	"0000479602"
"0000236375"	"0000480077"
"0000236376"	"0000479603"
"0000236376"	"0000480078"
"0000236377"	"0000479604"
"0000236377"	"0000480079"
"0000236378"	"0000479605"
"0000236378"	"0000480080"
"0000236379"	"0000479606"
"0000236379"	"0000480081"
"0000236380"	"0000479607"
"0000236380"	"0000480082"
"0000236381"	"0000479608"
"0000236381"	"0000480083"
"0000236382"	"0000479609"
"0000236382"	"0000480084"
"0000236383"	"0000479610"
"0000236383"	"0000480085"
"0000236384"	"0000479611"
"0000236384"	"0000480086"
"0000236385"	"0000479612"
"0000236385"	"0000480087"
"0000236386"	"0000479613"
"0000236386"	"0000480088"
"0000236387"	"0000479614"
"0000236387"	"0000480089"
"0000236388"	"0000479615"
"0000236388"	"0000480090"
"0000236389"	"0000479616"
"0000236389"	"0000480091"
"0000236390"	"0000479617"
"0000236390"	"0000480092"
"0000236391"	"0000479618"
"0000236391"	"0000480093"
"0000236392"	"0000479619"
"0000236392"	"0000480094"
"0000236393"	"0000479620"
"0000236393"	"0000480095"
"0000236394"	"0000479621"
"0000236394"	"0000480096"
"0000236395"	"0000479622"
"0000236395"	"0000480097"
"0000236396"	"0000479623"
"0000236396"	"0000480098"
"0000236397"	"0000479624"
"0000236397"	"0000480099"
"0000236398"	"0000479625"
"0000236398"	"0000480100"
"0000236399"	"0000479626"
"0000236399"	"0000480101"
"0000236400"	"0000479627"
"0000236400"	"0000480102"
"0000236401"	"0000479628"
"0000236401"	"0000480103"
"0000236401"	"0000480106"
"0000236402"	"0000479629"
"0000236402"	"0000480104"
"0000236402"	"0000480107"
"0000247806"	"0000500691"
"0000247807"	"0000500692"
"0000247808"	"0000500693"
"0000247809"	"0000500694"
"0000247810"	"0000500695"
"0000247811"	"0000500696"
"0000247812"	"0000500697"
"0000247813"	"0000500698"
"0000247814"	"0000500699"
"0000247815"	"0000500700"
"0000247816"	"0000500701"
"0000247817"	"0000500702"
"0000247818"	"0000500703"
"0000247819"	"0000500704"
"0000247820"	"0000500705"
"0000247821"	"0000500853"
"0000247969"	"0000500854"
"0000247970"	"0000500855"
"0000247971"	"0000500856"
"0000247972"	"0000500857"
"0000247973"	"0000500858"
"0000247974"	"0000500859"
"0000247975"	"0000500860"
"0000247976"	"0000500861"
"0000247977"	"0000500862"
"0000247978"	"0000500863"
"0000247979"	"0000500864"
"0000247980"	"0000500865"
"0000247981"	"0000500866"
"0000247982"	"0000500867"
"0000247983"	"0000500868"
"0000247984"	"0000500869"
"0000247985"	"0000500870"
"0000247987"	"0000500872"
"0000247988"	"0000500873"
"0000247989"	"0000500874"
"0000247990"	"0000500875"
"0000247991"	"0000500876"
"0000247992"	"0000500877"
"0000247993"	"0000500878"
"0000247994"	"0000500879"
"0000247995"	"0000500880"
"0000247996"	"0000500881"
"0000247997"	"0000500882"
"0000247998"	"0000500883"
"0000247999"	"0000500884"
"0000248000"	"0000500885"
"0000248001"	"0000500886"
"0000248003"	"0000500887"
"0000248004"	"0000500888"
"0000248005"	"0000500890"
"0000248006"	"0000500891"
"0000248006"	"0000500892"
"0000248007"	"0000500893"
"0000249255"	"0000577984"
"0000249255"	"0000577985"
"0000275467"	"0000629481"
"0000275467"	"0000629482"
"0000275565"	"0000629612"
"0000275565"	"0000629613"
"0000275566"	"0000629614"
"0000275566"	"0000629615"
"0000275567"	"0000629616"
"0000275567"	"0000629617"
"0000293042"	"0000649731"
"0000293043"	"0000649732"
"0000293044"	"0000649733"
"0000293045"	"0000649734"
"0000293046"	"0000649735"
"0000293047"	"0000649736"
"0000293048"	"0000649737"
"0000296692"	"0000653385"
"0000296692"	"0000653388"
"0000296696"	"0000653389"
"0000296696"	"0000653501"
"0000296697"	"0000653390"
"0000296697"	"0000653502"
"0000302733"	"0000666079"
"0000302733"	"0000666080"
"0000305736"	"0000669424"
"0000305737"	"0000669425"
"0000306814"	"0000670583"
"0000306814"	"0000670634"
"0000306815"	"0000670584"
"0000306815"	"0000670635"
"0000306816"	"0000670585"
"0000306816"	"0000670636"
"0000306817"	"0000670586"
"0000306817"	"0000670637"
"0000306818"	"0000670587"
"0000306818"	"0000670638"
"0000306819"	"0000670588"
"0000306819"	"0000670639"
"0000306820"	"0000670589"
"0000306820"	"0000670640"
"0000306821"	"0000670590"
"0000306821"	"0000670641"
"0000306822"	"0000670591"
"0000306822"	"0000670642"
"0000306823"	"0000670592"
"0000306824"	"0000670593"
"0000306824"	"0000670643"
"0000306825"	"0000670594"
"0000306825"	"0000670644"
"0000306826"	"0000670595"
"0000306826"	"0000670645"
"0000306827"	"0000670596"
"0000306828"	"0000670597"
"0000306828"	"0000670646"
"0000306829"	"0000670598"
"0000306829"	"0000670647"
"0000306830"	"0000670599"
"0000306830"	"0000670648"
"0000306831"	"0000670600"
"0000306831"	"0000670649"
"0000306832"	"0000670601"
"0000306832"	"0000670650"
"0000306833"	"0000670602"
"0000306833"	"0000670651"
"0000306834"	"0000670603"
"0000306834"	"0000670652"
"0000306835"	"0000670604"
"0000306835"	"0000670653"
"0000306836"	"0000670605"
"0000306836"	"0000670654"
"0000306837"	"0000670606"
"0000306837"	"0000670655"
"0000306838"	"0000670607"
"0000306838"	"0000670656"
"0000306839"	"0000670608"
"0000306839"	"0000670657"
"0000306840"	"0000670609"
"0000306840"	"0000670658"
"0000306841"	"0000670610"
"0000306841"	"0000670659"
"0000306842"	"0000670611"
"0000306842"	"0000670660"
"0000306843"	"0000670612"
"0000306843"	"0000670661"
"0000306844"	"0000670613"
"0000306844"	"0000670662"
"0000306845"	"0000670614"
"0000306845"	"0000670663"
"0000306845"	"0000670683"
"0000306846"	"0000670615"
"0000306846"	"0000670664"
"0000306847"	"0000670616"
"0000306847"	"0000670665"
"0000306848"	"0000670617"
"0000306848"	"0000670666"
"0000306849"	"0000670618"
"0000306849"	"0000670667"
"0000306850"	"0000670619"
"0000306850"	"0000670668"
"0000306851"	"0000670620"
"0000306851"	"0000670669"
"0000306852"	"0000670621"
"0000306852"	"0000670670"
"0000306853"	"0000670622"
"0000306853"	"0000670671"
"0000306854"	"0000670623"
"0000306854"	"0000670672"
"0000306855"	"0000670624"
"0000306855"	"0000670673"
"0000306856"	"0000670625"
"0000306856"	"0000670674"
"0000306857"	"0000670626"
"0000306857"	"0000670675"
"0000306858"	"0000670627"
"0000306858"	"0000670676"
"0000306859"	"0000670628"
"0000306859"	"0000670677"
"0000306860"	"0000670629"
"0000306860"	"0000670678"
"0000306861"	"0000670630"
"0000306861"	"0000670679"
"0000306862"	"0000670631"
"0000306862"	"0000670680"
"0000306863"	"0000670632"
"0000306863"	"0000670681"
"0000306864"	"0000670633"
"0000306864"	"0000670682"
"0000307863"	"0000674675"
"0000307863"	"0000674676"
"0000307864"	"0000674677"
"0000307864"	"0000674678"
"0000307865"	"0000674679"
"0000307865"	"0000674680"
"0000307866"	"0000674681"
"0000307866"	"0000674683"
"0000308226"	"0000675110"
"0000315483"	"0000697572"
"0000315484"	"0000697573"
"0000315485"	"0000697574"
"0000315486"	"0000697575"
"0000315487"	"0000697576"
"0000315488"	"0000697577"
"0000315489"	"0000697578"
"0000315490"	"0000697579"
"0000315491"	"0000697580"
"0000315492"	"0000697581"
"0000315493"	"0000697582"
"0000315494"	"0000697583"
"0000375514"	"0000786865"
"0000375514"	"0000787476"
"0000382025"	"0000795659"
"0000389241"	"0000819037"
"0000389913"	"0000819184"
"0000389913"	"0000819253"
"0000389914"	"0000819185"
"0000389933"	"0000819271"
"0000406222"	"0000842492"
"0000406223"	"0000842493"
"0000406224"	"0000842494"
"0000406224"	"0000842497"
"0000406225"	"0000842495"
"0000406225"	"0000842498"
"0000406226"	"0000842496"
"0000406226"	"0000842499"
"0000414375"	"0000872026"
"0000414375"	"0000872065"
"0000414405"	"0000872056"
"0000414405"	"0000872073"
"0000414735"	"0000872443"
"0000414735"	"0000872444"
"0000414736"	"0000872446"
"0000414736"	"0000872447"
"0000415761"	"0000873651"
"0000415761"	"0000873652"
"0000419897"	"0000880081"
"0000419898"	"0000880080"
"0000428297"	"0000906020"
"0000428298"	"0000906021"
"0000428372"	"0000906097"
"0000428372"	"0000906155"
"0000428373"	"0000906098"
"0000428373"	"0000906156"
"0000428374"	"0000906099"
"0000428374"	"0000906157"
"0000429393"	"0000908866"
"0000429393"	"0000908930"
"0000444148"	"0000946005"
"0000455196"	"0001007223"
"0000456156"	"0001008325"
"0000456157"	"0001008326"
"0000456157"	"0001008344"
"0000457874"	"0001012449"
"0000459284"	"0001017262"
"0000459284"	"0001017263"
"0000459284"	"0001017264"
"0000461883"	"0001021251"
"0000461883"	"0001021284"
"0000461895"	"0001021259"
"0000461895"	"0001021288"
"0000469895"	"0001057950"
"0000469899"	"0001057914"
"0000469908"	"0001057923"