### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = GATA4)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"GATA4" "GATA binding protein 4" "8" "p23.1-p22" "unknown" "NG_008177.2" "UD_132118986112" "" "https://www.LOVD.nl/GATA4" "" "1" "4173" "2626" "600576" "1" "1" "1" "1" "Change to MANE select NM_001308093.3\r\nWe gratefully acknowledge Aimée Paulussen for acting as a curator untill 2016. Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/GATA4_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2010-04-29 00:00:00" "00006" "2022-05-23 17:39:21" "00000" "2026-01-20 18:57:21"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00008369" "GATA4" "GATA binding protein 4" "001" "NM_002052.3" "" "NP_002043.2" "" "" "" "-554" "2854" "1329" "11561717" "11617509" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 10
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" ""
"00152" "CHD" "heart disease, congenital (CHD)" "" "" "" "" "" "00008" "2013-06-19 09:27:11" "00006" "2015-01-23 22:14:45"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00389" "TOF" "tetralogy of Fallot (TOF)" "AD" "187500" "" "" "" "00006" "2014-05-30 08:58:25" "00006" "2021-10-27 15:03:22"
"02725" "ASD2" "septal defect, atrial, type 2 (ASD2)" "AD" "607941" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03641" "VSD1" "septal defect, ventricular, type 1 (VSD-1)" "AD" "614429" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03642" "AVSD4" "septal defect, atrioventricular, type 4 (AVSD-4)" "AD" "614430" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03995" "TACHD" "testicular anomalies, with/without congenital heart disease (TACHD)" "AD" "615542" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"04173" "LVNC" "ventricular noncompaction, left (LVNC)" "" "" "" "" "" "00006" "2015-01-20 15:35:56" "00006" "2015-10-12 17:03:37"
"05597" "DSD" "disorder of sex development (DSD)" "" "" "" "" "" "00006" "2019-04-28 14:45:24" "" ""
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 5
"{{geneid}}" "{{diseaseid}}"
"GATA4" "00389"
"GATA4" "02725"
"GATA4" "03641"
"GATA4" "03642"
"GATA4" "03995"
## Individuals ## Do not remove or alter this header ##
## Count = 46
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00029030" "" "" "" "1" "" "01195" "{PMID:El Malti 2016:26014430}, {DOI:El Malti 2016:10.1038/ejhg.2015.105}" "" "F" "no" "France" ">12y" "0" "yes" "" "European" "MC180"
"00222788" "" "" "" "1" "" "01162" "" "" "" "yes" "China" "" "0" "" "" "" ""
"00222789" "" "" "" "1" "" "01162" "" "" "" "yes" "China" "" "0" "" "" "" ""
"00222790" "" "" "" "1" "" "01162" "" "" "" "yes" "China" "" "0" "" "" "" ""
"00231440" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "M" "" "" "" "0" "" "" "" "Pat52"
"00231482" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "" "" "" "" "0" "" "" "" "Pat134"
"00231492" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "rF" "" "" "" "0" "" "" "" "Pat157"
"00231521" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "M" "" "" "" "0" "" "" "" "Pat220"
"00231534" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "M" "" "" "" "0" "" "" "" "Pat261"
"00231559" "" "" "" "1" "" "00006" "{PMID:Eggers 2016:27899157}" "" "" "" "" "" "0" "" "" "" "Pat245"
"00294556" "" "" "" "224" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00294557" "" "" "" "19" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00294558" "" "" "" "43" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00305179" "" "" "" "11" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" ""
"00410257" "" "" "" "10" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "?" "Iran" "" "0" "" "" "" ""
"00410436" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410437" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410438" "" "" "" "7" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410439" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410440" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410441" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410442" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410443" "" "" "" "3" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410444" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410445" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410446" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410447" "" "" "" "11" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410448" "" "" "" "15" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410449" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410450" "" "" "" "13" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410451" "" "" "" "10" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410452" "" "" "" "15" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410453" "" "" "" "12" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410454" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410455" "" "" "" "14" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 175 non-syndromic CHD pediatric patients" "" "" "Iran" "" "0" "" "" "" ""
"00410456" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00410457" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00410458" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00410459" "" "" "" "5" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00410460" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00410461" "" "" "" "1" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00410462" "" "" "" "2" "" "04178" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "analysis 115 healthy individuals" "" "" "Iran" "" "0" "" "" "" ""
"00436129" "" "" "" "1" "" "03465" "" "" "" "" "" "" "" "" "" "" ""
"00446748" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat10"
"00446790" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat70"
"00446804" "" "" "" "1" "" "00006" "{PMID:Miszalski-Jamka 2017:28798025}" "case solved" "" "" "" "" "0" "" "" "" "Pat88"
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 46
"{{individualid}}" "{{diseaseid}}"
"00029030" "00152"
"00222788" "00389"
"00222789" "00389"
"00222790" "00389"
"00231440" "05597"
"00231482" "05597"
"00231492" "05597"
"00231521" "05597"
"00231534" "05597"
"00231559" "05597"
"00294556" "00198"
"00294557" "00198"
"00294558" "00198"
"00305179" "00198"
"00410257" "00152"
"00410436" "00152"
"00410437" "00152"
"00410438" "00152"
"00410439" "00152"
"00410440" "00152"
"00410441" "00152"
"00410442" "00152"
"00410443" "00152"
"00410444" "00152"
"00410445" "00152"
"00410446" "00152"
"00410447" "00152"
"00410448" "00152"
"00410449" "00152"
"00410450" "00152"
"00410451" "00152"
"00410452" "00152"
"00410453" "00152"
"00410454" "00152"
"00410455" "00152"
"00410456" "00000"
"00410457" "00000"
"00410458" "00000"
"00410459" "00000"
"00410460" "00000"
"00410461" "00000"
"00410462" "00000"
"00436129" "00152"
"00446748" "04173"
"00446790" "04173"
"00446804" "04173"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00000, 00152, 00198, 00389, 02725, 03641, 03642, 03995, 04173, 05597
## Count = 35
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000025052" "00152" "00029030" "01195" "Familial, autosomal dominant" "" "secundum atrial septal defect" "" "" "" "" "" "" "" "" "" "" ""
"0000167988" "00389" "00222788" "01162" "Familial, autosomal dominant" "" "atrioventricular septal defect, patent ductus arteriosus, atrial fibrillation" "" "" "" "" "" "" "" "" "" "tetralogy of Fallot" ""
"0000167989" "00389" "00222789" "01162" "Familial, autosomal dominant" "" "atrial septal defect" "" "" "" "" "" "" "" "" "" "tetralogy of Fallot" ""
"0000167990" "00389" "00222790" "01162" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "tetralogy of Fallot" ""
"0000173831" "05597" "00231440" "00006" "Unknown" "" "disorders of androgen synthesis or action" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000173873" "05597" "00231482" "00006" "Unknown" "" "disorder of sex development" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000173883" "05597" "00231492" "00006" "Unknown" "" "disorder of sex development" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000173912" "05597" "00231521" "00006" "Unknown" "" "hypospadias" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000173925" "05597" "00231534" "00006" "Unknown" "" "hypospadias" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000173950" "05597" "00231559" "00006" "Unknown" "" "hypospadias" "" "" "" "" "" "" "" "" "" "46,XY disorder of sex development" ""
"0000302362" "00152" "00410257" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302543" "00152" "00410436" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302544" "00152" "00410437" "04178" "Unknown" "" "tetralogy of Fallot" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302545" "00152" "00410438" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302546" "00152" "00410439" "04178" "Unknown" "" "atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302547" "00152" "00410440" "04178" "Unknown" "" "atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302548" "00152" "00410441" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302549" "00152" "00410442" "04178" "Unknown" "" "atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302550" "00152" "00410443" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302551" "00152" "00410444" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302552" "00152" "00410445" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302553" "00152" "00410446" "04178" "Unknown" "" "ventricular septal defect/atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302554" "00152" "00410447" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302555" "00152" "00410448" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302556" "00152" "00410449" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302557" "00152" "00410450" "04178" "Unknown" "" "atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302558" "00152" "00410451" "04178" "Unknown" "" "ventricular septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302559" "00152" "00410452" "04178" "Unknown" "" "tetralogy of Fallot/atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302560" "00152" "00410453" "04178" "Unknown" "" "ventricular septal defect/atrial septal defect" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302561" "00152" "00410454" "04178" "Unknown" "" "tetralogy of Fallot" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000302562" "00152" "00410455" "04178" "Unknown" "" "tetralogy of Fallot" "" "" "" "" "" "" "" "" "" "non-syndromic CHD" ""
"0000326313" "00152" "00436129" "03465" "Isolated (sporadic)" "11 months" "" "" "" "tetralogy of Fallot" "GATA4 Tyr236* mutation" "" "" "" "" "tetralogy of Fallot" "congenital heart disease (CHD), tetralogy of Fallot" ""
"0000335952" "04173" "00446748" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "left ventricular hypertrabeculation" ""
"0000335994" "04173" "00446790" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "left ventricular hypertrabeculation" ""
"0000336008" "04173" "00446804" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "left ventricular hypertrabeculation" ""
## Screenings ## Do not remove or alter this header ##
## Count = 46
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000029071" "00029030" "1" "01195" "01195" "2015-01-19 12:01:21" "01195" "2015-01-19 14:22:41" "SEQ" "DNA" "blood" ""
"0000223860" "00222788" "1" "01162" "01162" "2013-07-31 17:13:12" "00006" "2013-12-24 22:26:44" "SEQ" "DNA" "" ""
"0000223861" "00222789" "1" "01162" "01162" "2013-07-31 17:18:38" "00006" "2013-12-24 22:24:49" "SEQ" "DNA" "" ""
"0000223862" "00222790" "1" "01162" "01162" "2013-07-31 17:23:24" "00006" "2013-12-24 22:25:31" "SEQ" "DNA" "" ""
"0000232539" "00231440" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000232581" "00231482" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000232591" "00231492" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000232620" "00231521" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000232633" "00231534" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000232658" "00231559" "1" "00006" "00006" "2019-05-03 12:21:09" "" "" "SEQ-NG" "DNA" "" "1031 gene panel"
"0000295724" "00294556" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000295725" "00294557" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000295726" "00294558" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000306308" "00305179" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0"
"0000411540" "00410257" "1" "04178" "04178" "2022-05-23 12:14:15" "" "" "CSGE" "DNA" "blood" "SSCP followed by Sanger seq. for the abnormal mobility bands"
"0000411699" "00410436" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411700" "00410437" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411701" "00410438" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411702" "00410439" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411703" "00410440" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411704" "00410441" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411705" "00410442" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411706" "00410443" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411707" "00410444" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411708" "00410445" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411709" "00410446" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411710" "00410447" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411711" "00410448" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411712" "00410449" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411713" "00410450" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411714" "00410451" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411715" "00410452" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411716" "00410453" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411717" "00410454" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411718" "00410455" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411719" "00410456" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411720" "00410457" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411721" "00410458" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411722" "00410459" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411723" "00410460" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411724" "00410461" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000411725" "00410462" "1" "04178" "00006" "2022-05-26 11:23:14" "" "" "SEQ" "DNA" "" ""
"0000437610" "00436129" "1" "03465" "03465" "2023-08-13 22:56:08" "" "" "SEQ" "DNA" "heart" ""
"0000448323" "00446748" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000448365" "00446790" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000448379" "00446804" "1" "00006" "00006" "2024-01-23 17:14:25" "" "" "SEQ;SEQ-NG" "DNA" "" ""
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 42
"{{screeningid}}" "{{geneid}}"
"0000029071" "GATA4"
"0000029071" "NKX2-5"
"0000029071" "ZIC3"
"0000223860" "GATA4"
"0000223861" "GATA4"
"0000223862" "GATA4"
"0000232539" "GATA4"
"0000232581" "GATA4"
"0000232591" "GATA4"
"0000232620" "GATA4"
"0000232633" "GATA4"
"0000232658" "GATA4"
"0000232658" "ZFPM2"
"0000411540" "GATA4"
"0000411699" "GATA4"
"0000411700" "GATA4"
"0000411701" "GATA4"
"0000411702" "GATA4"
"0000411703" "GATA4"
"0000411704" "GATA4"
"0000411705" "GATA4"
"0000411706" "GATA4"
"0000411707" "GATA4"
"0000411708" "GATA4"
"0000411709" "GATA4"
"0000411710" "GATA4"
"0000411711" "GATA4"
"0000411712" "GATA4"
"0000411713" "GATA4"
"0000411714" "GATA4"
"0000411715" "GATA4"
"0000411716" "GATA4"
"0000411717" "GATA4"
"0000411718" "GATA4"
"0000411719" "GATA4"
"0000411720" "GATA4"
"0000411721" "GATA4"
"0000411722" "GATA4"
"0000411723" "GATA4"
"0000411724" "GATA4"
"0000411725" "GATA4"
"0000437610" "GATA4"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 261
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000052423" "11" "70" "8" "11607687" "11607687" "subst" "0" "01195" "GATA4_000004" "g.11607687G>A" "1/156 patients" "{PMID:El Malti 2016:26014430}, {DOI:El Malti 2016:10.1038/ejhg.2015.105}" "" "" "" "Germline" "yes" "" "0" "" "" "g.11750178G>A" "" "likely pathogenic" ""
"0000250702" "0" "10" "8" "11614575" "11614575" "subst" "0.0958295" "02326" "GATA4_000013" "g.11614575A>G" "" "" "" "GATA4(NM_001308093.3):c.1132A>G (p.S378G), GATA4(NM_002052.4):c.1129A>G (p.S377G), GATA4(NM_002052.5):c.1129A>G (p.S377G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11757066A>G" "" "benign" ""
"0000252557" "0" "90" "8" "11612573" "11612573" "subst" "0" "02326" "GATA4_000008" "g.11612573A>G" "" "" "" "GATA4(NM_001308093.2):c.931A>G (p.M311V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11755064A>G" "" "pathogenic" ""
"0000253054" "0" "10" "8" "11614575" "11614575" "subst" "0.0958295" "01943" "GATA4_000013" "g.11614575A>G" "" "" "" "GATA4(NM_001308093.3):c.1132A>G (p.S378G), GATA4(NM_002052.4):c.1129A>G (p.S377G), GATA4(NM_002052.5):c.1129A>G (p.S377G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11757066A>G" "" "benign" ""
"0000253454" "0" "10" "8" "11614559" "11614559" "subst" "0.00193343" "01943" "GATA4_000011" "g.11614559A>G" "" "" "" "GATA4(NM_001308093.1):c.1116A>G (p.(Ser372=)), GATA4(NM_002052.4):c.1113A>G (p.S371=), GATA4(NM_002052.5):c.1113A>G (p.S371=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11757050A>G" "" "benign" ""
"0000280993" "0" "30" "8" "11607658" "11607658" "subst" "0.00212652" "02325" "GATA4_000006" "g.11607658C>T" "" "" "" "GATA4(NM_001308093.1):c.825C>T (p.(Cys275=)), GATA4(NM_002052.4):c.822C>T (p.C274=), GATA4(NM_002052.5):c.822C>T (p.C274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11750149C>T" "" "likely benign" ""
"0000284591" "0" "30" "8" "11614483" "11614483" "subst" "0.00152297" "02326" "GATA4_000010" "g.11614483C>T" "" "" "" "GATA4(NM_001308093.1):c.1040C>T (p.(Ala347Val)), GATA4(NM_001308093.3):c.1040C>T (p.A347V), GATA4(NM_002052.5):c.1037C>T (p.A346V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11756974C>T" "" "likely benign" ""
"0000284592" "0" "10" "8" "11612698" "11612698" "subst" "0" "02326" "GATA4_000009" "g.11612698C>A" "" "" "" "GATA4(NM_001308093.3):c.1000+56C>A, GATA4(NM_002052.5):c.997+56C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11755189C>A" "" "benign" ""
"0000288227" "0" "30" "8" "11607658" "11607658" "subst" "0.00212652" "01943" "GATA4_000006" "g.11607658C>T" "" "" "" "GATA4(NM_001308093.1):c.825C>T (p.(Cys275=)), GATA4(NM_002052.4):c.822C>T (p.C274=), GATA4(NM_002052.5):c.822C>T (p.C274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11750149C>T" "" "likely benign" ""
"0000288228" "0" "30" "8" "11607694" "11607694" "subst" "4.07156E-5" "01943" "GATA4_000007" "g.11607694G>A" "" "" "" "GATA4(NM_001308093.1):c.861G>A (p.(Ala287=)), GATA4(NM_002052.4):c.858G>A (p.A286=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11750185G>A" "" "likely benign" ""
"0000332036" "0" "10" "8" "11614584" "11614584" "subst" "0.00519491" "01804" "GATA4_000012" "g.11614584G>A" "" "" "" "GATA4(NM_001308093.1):c.1141G>A (p.(Val381Met)), GATA4(NM_001308093.3):c.1141G>A (p.V381M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.11757075G>A" "" "benign" ""
"0000455514" "20" "50" "8" "11565846" "11565846" "subst" "0" "01162" "GATA4_000001" "g.11565846G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.11708337G>C" "" "VUS" ""
"0000455515" "20" "50" "8" "11565972" "11565972" "subst" "0" "01162" "GATA4_000002" "g.11565972C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.11708463C>G" "" "VUS" ""
"0000455516" "11" "50" "8" "11607690" "11607690" "subst" "0" "01162" "GATA4_000003" "g.11607690A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.11750181A>G" "" "VUS" ""
"0000474987" "1" "70" "8" "11615875" "11615875" "subst" "0.000527932" "00006" "GATA4_000016" "g.11615875C>A" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.11758366C>A" "" "likely pathogenic" ""
"0000474988" "1" "70" "8" "11615875" "11615875" "subst" "0.000527932" "00006" "GATA4_000016" "g.11615875C>A" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.11758366C>A" "" "likely pathogenic" ""
"0000474989" "1" "70" "8" "11615875" "11615875" "subst" "0.000527932" "00006" "GATA4_000016" "g.11615875C>A" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.11758366C>A" "" "likely pathogenic" ""
"0000474990" "1" "70" "8" "11606495" "11606495" "subst" "0" "00006" "GATA4_000014" "g.11606495G>C" "" "{PMID:Eggers 2016:27899157}" "" "" "father not analysed" "Germline" "" "" "0" "" "46,XY" "g.11748986G>C" "" "likely pathogenic" ""
"0000474991" "1" "50" "8" "11614483" "11614483" "subst" "0.00152297" "00006" "GATA4_000010" "g.11614483C>T" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.11756974C>T" "" "VUS" ""
"0000474992" "0" "50" "8" "11615835" "11615835" "subst" "0.00227993" "00006" "GATA4_000015" "g.11615835C>A" "" "{PMID:Eggers 2016:27899157}" "" "" "" "Germline" "" "" "0" "" "46,XY" "g.11758326C>A" "" "VUS" ""
"0000533559" "0" "10" "8" "11561818" "11561818" "subst" "0" "01804" "GATA4_000018" "g.11561818G>A" "" "" "" "GATA4(NM_002052.3):c.-458+5G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11704309G>A" "" "benign" ""
"0000533560" "0" "30" "8" "11565337" "11565337" "del" "0" "02327" "GATA4_000019" "g.11565337del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11707828del" "" "likely benign" ""
"0000533561" "0" "30" "8" "11565477" "11565477" "subst" "0" "02327" "GATA4_000020" "g.11565477G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11707968G>A" "" "likely benign" ""
"0000533562" "0" "30" "8" "11565796" "11565796" "subst" "3.62266E-5" "02327" "GATA4_000021" "g.11565796A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708287A>G" "" "likely benign" ""
"0000533563" "0" "50" "8" "11565876" "11565876" "subst" "0" "01943" "GATA4_000022" "g.11565876G>A" "" "" "" "GATA4(NM_002052.4):c.55G>A (p.E19K), GATA4(NM_002052.5):c.55G>A (p.E19K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708367G>A" "" "VUS" ""
"0000533564" "0" "30" "8" "11565911" "11565911" "subst" "0" "01804" "GATA4_000023" "g.11565911G>C" "" "" "" "GATA4(NM_001308093.1):c.90G>C (p.(Ala30=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708402G>C" "" "likely benign" ""
"0000533566" "0" "30" "8" "11566159" "11566159" "subst" "0" "01804" "GATA4_000025" "g.11566159C>G" "" "" "" "GATA4(NM_002052.3):c.338C>G (p.(Thr113Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708650C>G" "" "likely benign" ""
"0000533567" "0" "30" "8" "11566169" "11566169" "subst" "0.00109085" "01943" "GATA4_000026" "g.11566169C>T" "" "" "" "GATA4(NM_001308093.1):c.348C>T (p.(Ser116=)), GATA4(NM_001308093.3):c.348C>T (p.S116=), GATA4(NM_002052.4):c.348C>T (p.S116=), GATA4(NM_002052.5):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708660C>T" "" "likely benign" ""
"0000533568" "0" "30" "8" "11566169" "11566169" "subst" "0.00109085" "01804" "GATA4_000026" "g.11566169C>T" "" "" "" "GATA4(NM_001308093.1):c.348C>T (p.(Ser116=)), GATA4(NM_001308093.3):c.348C>T (p.S116=), GATA4(NM_002052.4):c.348C>T (p.S116=), GATA4(NM_002052.5):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708660C>T" "" "likely benign" ""
"0000533569" "0" "30" "8" "11566169" "11566169" "subst" "0.00109085" "02327" "GATA4_000026" "g.11566169C>T" "" "" "" "GATA4(NM_001308093.1):c.348C>T (p.(Ser116=)), GATA4(NM_001308093.3):c.348C>T (p.S116=), GATA4(NM_002052.4):c.348C>T (p.S116=), GATA4(NM_002052.5):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708660C>T" "" "likely benign" ""
"0000533570" "0" "30" "8" "11566169" "11566169" "subst" "0.00109085" "02326" "GATA4_000026" "g.11566169C>T" "" "" "" "GATA4(NM_001308093.1):c.348C>T (p.(Ser116=)), GATA4(NM_001308093.3):c.348C>T (p.S116=), GATA4(NM_002052.4):c.348C>T (p.S116=), GATA4(NM_002052.5):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708660C>T" "" "likely benign" ""
"0000533572" "0" "30" "8" "11566283" "11566283" "subst" "0.00141452" "01804" "GATA4_000028" "g.11566283C>T" "" "" "" "GATA4(NM_001308093.1):c.462C>T (p.(Phe154=)), GATA4(NM_002052.5):c.462C>T (p.F154=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708774C>T" "" "likely benign" ""
"0000533573" "0" "30" "8" "11566283" "11566283" "subst" "0.00141452" "02327" "GATA4_000028" "g.11566283C>T" "" "" "" "GATA4(NM_001308093.1):c.462C>T (p.(Phe154=)), GATA4(NM_002052.5):c.462C>T (p.F154=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708774C>T" "" "likely benign" ""
"0000533574" "0" "30" "8" "11566283" "11566283" "subst" "0.00141452" "02326" "GATA4_000028" "g.11566283C>T" "" "" "" "GATA4(NM_001308093.1):c.462C>T (p.(Phe154=)), GATA4(NM_002052.5):c.462C>T (p.F154=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708774C>T" "" "likely benign" ""
"0000533575" "0" "30" "8" "11566308" "11566308" "subst" "6.1587E-5" "02325" "GATA4_000029" "g.11566308C>T" "" "" "" "GATA4(NM_001308093.1):c.487C>T (p.(Pro163Ser)), GATA4(NM_002052.5):c.487C>T (p.P163S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708799C>T" "" "likely benign" ""
"0000533576" "0" "30" "8" "11566364" "11566364" "subst" "0.000162605" "01943" "GATA4_000030" "g.11566364C>T" "" "" "" "GATA4(NM_001308093.1):c.543C>T (p.(Ala181=)), GATA4(NM_002052.4):c.543C>T (p.A181=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708855C>T" "" "likely benign" ""
"0000533577" "0" "30" "8" "11566430" "11566430" "subst" "4.98761E-5" "02327" "GATA4_000031" "g.11566430C>T" "" "" "" "GATA4(NM_001308093.1):c.609C>T (p.(Pro203=)), GATA4(NM_002052.5):c.609C>T (p.P203=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708921C>T" "" "likely benign" ""
"0000533578" "0" "30" "8" "11566432" "11566432" "subst" "5.83226E-5" "01804" "GATA4_000032" "g.11566432A>G" "" "" "" "GATA4(NM_001308093.1):c.611A>G (p.(Asn204Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708923A>G" "" "likely benign" ""
"0000533579" "0" "30" "8" "11566452" "11566452" "subst" "0.000242874" "02327" "GATA4_000033" "g.11566452G>A" "" "" "" "GATA4(NM_001308093.1):c.616+15G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708943G>A" "" "likely benign" ""
"0000533581" "0" "10" "8" "11606312" "11606312" "subst" "0" "02327" "GATA4_000035" "g.11606312T>C" "" "" "" "GATA4(NM_001308093.3):c.617-113T>C, GATA4(NM_002052.5):c.617-116T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11748803T>C" "" "benign" ""
"0000533582" "0" "30" "8" "11606312" "11606312" "subst" "0" "02326" "GATA4_000035" "g.11606312T>C" "" "" "" "GATA4(NM_001308093.3):c.617-113T>C, GATA4(NM_002052.5):c.617-116T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11748803T>C" "" "likely benign" ""
"0000533583" "0" "10" "8" "11606364" "11606364" "subst" "0" "02327" "GATA4_000036" "g.11606364G>C" "" "" "" "GATA4(NM_001308093.3):c.617-61G>C, GATA4(NM_002052.5):c.617-64G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11748855G>C" "" "benign" ""
"0000533584" "0" "10" "8" "11606364" "11606364" "subst" "0" "02326" "GATA4_000036" "g.11606364G>C" "" "" "" "GATA4(NM_001308093.3):c.617-61G>C, GATA4(NM_002052.5):c.617-64G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11748855G>C" "" "benign" ""
"0000533585" "0" "30" "8" "11606438" "11606438" "subst" "0.000337037" "01943" "GATA4_000037" "g.11606438C>T" "" "" "" "GATA4(NM_001308093.1):c.630C>T (p.(Asp210=)), GATA4(NM_002052.4):c.627C>T (p.D209=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11748929C>T" "" "likely benign" ""
"0000533586" "0" "50" "8" "11606462" "11606462" "subst" "0" "01943" "GATA4_000038" "g.11606462T>G" "" "" "" "GATA4(NM_002052.4):c.651T>G (p.C217W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11748953T>G" "" "VUS" ""
"0000533587" "0" "50" "8" "11606586" "11606586" "subst" "0" "02327" "GATA4_000039" "g.11606586C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11749077C>T" "" "VUS" ""
"0000533588" "0" "50" "8" "11606775" "11606775" "subst" "0" "02327" "GATA4_000040" "g.11606775T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11749266T>G" "" "VUS" ""
"0000533589" "0" "30" "8" "11607504" "11607504" "subst" "0" "02327" "GATA4_000041" "g.11607504G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11749995G>A" "" "likely benign" ""
"0000533590" "0" "30" "8" "11607527" "11607527" "subst" "0" "02327" "GATA4_000042" "g.11607527G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750018G>A" "" "likely benign" ""
"0000533591" "0" "30" "8" "11607658" "11607658" "subst" "0.00212652" "01804" "GATA4_000006" "g.11607658C>T" "" "" "" "GATA4(NM_001308093.1):c.825C>T (p.(Cys275=)), GATA4(NM_002052.4):c.822C>T (p.C274=), GATA4(NM_002052.5):c.822C>T (p.C274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750149C>T" "" "likely benign" ""
"0000533593" "0" "50" "8" "11607693" "11607693" "subst" "4.48124E-5" "01943" "GATA4_000043" "g.11607693C>T" "" "" "" "GATA4(NM_002052.3):c.857C>T (p.(Ala286Val)), GATA4(NM_002052.4):c.857C>T (p.A286V), GATA4(NM_002052.5):c.857C>T (p.A286V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750184C>T" "" "VUS" ""
"0000533594" "0" "50" "8" "11607693" "11607693" "subst" "4.48124E-5" "02326" "GATA4_000043" "g.11607693C>T" "" "" "" "GATA4(NM_002052.3):c.857C>T (p.(Ala286Val)), GATA4(NM_002052.4):c.857C>T (p.A286V), GATA4(NM_002052.5):c.857C>T (p.A286V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750184C>T" "" "VUS" ""
"0000533595" "0" "30" "8" "11607749" "11607749" "subst" "1.22576E-5" "01804" "GATA4_000044" "g.11607749C>A" "" "" "" "GATA4(NM_001308093.1):c.912+4C>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750240C>A" "" "likely benign" ""
"0000533596" "0" "30" "8" "11607770" "11607770" "subst" "0.00523438" "02327" "GATA4_000045" "g.11607770G>A" "" "" "" "GATA4(NM_001308093.3):c.912+25G>A, GATA4(NM_002052.5):c.909+25G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750261G>A" "" "likely benign" ""
"0000533597" "0" "30" "8" "11607770" "11607770" "subst" "0" "02327" "GATA4_000046" "g.11607770G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750261G>C" "" "likely benign" ""
"0000533598" "0" "50" "8" "11612584" "11612584" "subst" "0.00010155" "01804" "GATA4_000047" "g.11612584G>T" "" "" "" "GATA4(NM_001308093.1):c.942G>T (p.(Glu314Asp)), GATA4(NM_002052.4):c.939G>T (p.E313D), GATA4(NM_002052.5):c.939G>T (p.E313D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755075G>T" "" "VUS" ""
"0000533599" "0" "70" "8" "11612604" "11612604" "subst" "0" "02327" "GATA4_000048" "g.11612604G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755095G>A" "" "likely pathogenic" ""
"0000533600" "0" "30" "8" "11612618" "11612618" "subst" "3.25161E-5" "02326" "GATA4_000049" "g.11612618C>G" "" "" "" "GATA4(NM_001308093.1):c.976C>G (p.(Leu326Val)), GATA4(NM_002052.5):c.973C>G (p.L325V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755109C>G" "" "likely benign" ""
"0000533601" "0" "30" "8" "11612647" "11612647" "subst" "0" "02327" "GATA4_000050" "g.11612647G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755138G>A" "" "likely benign" ""
"0000533602" "0" "10" "8" "11612665" "11612665" "subst" "0.0054487" "02327" "GATA4_000051" "g.11612665A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755156A>T" "" "benign" ""
"0000533603" "0" "10" "8" "11612698" "11612698" "subst" "0" "02327" "GATA4_000009" "g.11612698C>A" "" "" "" "GATA4(NM_001308093.3):c.1000+56C>A, GATA4(NM_002052.5):c.997+56C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755189C>A" "" "benign" ""
"0000533604" "0" "10" "8" "11614329" "11614329" "subst" "0" "02327" "GATA4_000052" "g.11614329C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756820C>T" "" "benign" ""
"0000533605" "0" "30" "8" "11614469" "11614469" "subst" "0.00210499" "01804" "GATA4_000053" "g.11614469T>C" "" "" "" "GATA4(NM_001308093.1):c.1026T>C (p.(Pro342=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756960T>C" "" "likely benign" ""
"0000533606" "0" "30" "8" "11614483" "11614483" "subst" "0.00152297" "01804" "GATA4_000010" "g.11614483C>T" "" "" "" "GATA4(NM_001308093.1):c.1040C>T (p.(Ala347Val)), GATA4(NM_001308093.3):c.1040C>T (p.A347V), GATA4(NM_002052.5):c.1037C>T (p.A346V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756974C>T" "" "likely benign" ""
"0000533607" "0" "30" "8" "11614502" "11614502" "subst" "0.00936109" "01804" "GATA4_000054" "g.11614502C>T" "" "" "" "GATA4(NM_001308093.1):c.1059C>T (p.(Asn353=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756993C>T" "" "likely benign" ""
"0000533608" "0" "10" "8" "11614502" "11614502" "subst" "0.00936109" "02327" "GATA4_000054" "g.11614502C>T" "" "" "" "GATA4(NM_001308093.1):c.1059C>T (p.(Asn353=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756993C>T" "" "benign" ""
"0000533609" "0" "30" "8" "11614510" "11614510" "subst" "0.00108837" "01804" "GATA4_000055" "g.11614510C>G" "" "" "" "GATA4(NM_001308093.1):c.1067C>G (p.(Thr356Ser)), GATA4(NM_002052.5):c.1064C>G (p.T355S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757001C>G" "" "likely benign" ""
"0000533610" "0" "30" "8" "11614510" "11614510" "subst" "0.00108837" "02327" "GATA4_000055" "g.11614510C>G" "" "" "" "GATA4(NM_001308093.1):c.1067C>G (p.(Thr356Ser)), GATA4(NM_002052.5):c.1064C>G (p.T355S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757001C>G" "" "likely benign" ""
"0000533611" "0" "30" "8" "11614513" "11614513" "subst" "0" "01804" "GATA4_000056" "g.11614513G>C" "" "" "" "GATA4(NM_002052.3):c.1067G>C (p.(Ser356Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757004G>C" "" "likely benign" ""
"0000533612" "0" "30" "8" "11614513" "11614513" "subst" "1.21837E-5" "01943" "GATA4_000057" "g.11614513G>T" "" "" "" "GATA4(NM_002052.3):c.1067G>T (p.(Ser356Ile)), GATA4(NM_002052.4):c.1067G>T (p.S356I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757004G>T" "" "likely benign" ""
"0000533613" "0" "30" "8" "11614513" "11614513" "subst" "1.21837E-5" "01804" "GATA4_000057" "g.11614513G>T" "" "" "" "GATA4(NM_002052.3):c.1067G>T (p.(Ser356Ile)), GATA4(NM_002052.4):c.1067G>T (p.S356I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757004G>T" "" "likely benign" ""
"0000533614" "0" "50" "8" "11614524" "11614524" "subst" "9.74714E-5" "01804" "GATA4_000058" "g.11614524G>C" "" "" "" "GATA4(NM_001308093.1):c.1081G>C (p.(Glu361Gln)), GATA4(NM_002052.5):c.1078G>C (p.E360Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757015G>C" "" "VUS" ""
"0000533615" "0" "50" "8" "11614524" "11614524" "subst" "9.74714E-5" "02327" "GATA4_000058" "g.11614524G>C" "" "" "" "GATA4(NM_001308093.1):c.1081G>C (p.(Glu361Gln)), GATA4(NM_002052.5):c.1078G>C (p.E360Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757015G>C" "" "VUS" ""
"0000533616" "0" "30" "8" "11614543" "11614543" "subst" "2.43683E-5" "01804" "GATA4_000059" "g.11614543C>T" "" "" "" "GATA4(NM_001308093.1):c.1100C>T (p.(Thr367Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757034C>T" "" "likely benign" ""
"0000533617" "0" "30" "8" "11614559" "11614559" "subst" "0.00193343" "01804" "GATA4_000011" "g.11614559A>G" "" "" "" "GATA4(NM_001308093.1):c.1116A>G (p.(Ser372=)), GATA4(NM_002052.4):c.1113A>G (p.S371=), GATA4(NM_002052.5):c.1113A>G (p.S371=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757050A>G" "" "likely benign" ""
"0000533618" "0" "10" "8" "11614575" "11614575" "subst" "0.0958295" "02327" "GATA4_000013" "g.11614575A>G" "" "" "" "GATA4(NM_001308093.3):c.1132A>G (p.S378G), GATA4(NM_002052.4):c.1129A>G (p.S377G), GATA4(NM_002052.5):c.1129A>G (p.S377G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757066A>G" "" "benign" ""
"0000533619" "0" "30" "8" "11614688" "11614688" "subst" "0" "02327" "GATA4_000060" "g.11614688G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757179G>T" "" "likely benign" ""
"0000533620" "0" "10" "8" "11614769" "11614769" "subst" "0" "02327" "GATA4_000061" "g.11614769C>T" "" "" "" "GATA4(NM_001308093.3):c.1149+177C>T, GATA4(NM_002052.5):c.1146+177C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11757260C>T" "" "benign" ""
"0000533621" "0" "10" "8" "11615695" "11615695" "subst" "0" "02327" "GATA4_000062" "g.11615695A>G" "" "" "" "GATA4(NM_001308093.3):c.1150-107A>G, GATA4(NM_002052.5):c.1147-107A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758186A>G" "" "benign" ""
"0000533622" "0" "10" "8" "11615739" "11615739" "subst" "0" "02327" "GATA4_000063" "g.11615739C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758230C>T" "" "benign" ""
"0000533623" "0" "30" "8" "11615782" "11615782" "subst" "0.00131496" "01804" "GATA4_000064" "g.11615782G>A" "" "" "" "GATA4(NM_001308093.1):c.1150-20G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758273G>A" "" "likely benign" ""
"0000533624" "0" "30" "8" "11615782" "11615782" "subst" "0.00131496" "02327" "GATA4_000064" "g.11615782G>A" "" "" "" "GATA4(NM_001308093.1):c.1150-20G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758273G>A" "" "likely benign" ""
"0000533625" "0" "30" "8" "11615835" "11615835" "subst" "0.00227993" "02327" "GATA4_000015" "g.11615835C>A" "" "" "" "GATA4(NM_001308093.1):c.1183C>A (p.(Pro395Thr)), GATA4(NM_002052.5):c.1180C>A (p.P394T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758326C>A" "" "likely benign" ""
"0000533626" "0" "30" "8" "11615875" "11615875" "subst" "0.000527932" "01804" "GATA4_000016" "g.11615875C>A" "" "" "" "GATA4(NM_002052.3):c.1220C>A (p.(Pro407Gln)), GATA4(NM_002052.4):c.1220C>A (p.P407Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758366C>A" "" "likely benign" ""
"0000533627" "0" "30" "8" "11615876" "11615876" "subst" "0.000767506" "01804" "GATA4_000065" "g.11615876A>C" "" "" "" "GATA4(NM_001308093.1):c.1224A>C (p.(Pro408=)), GATA4(NM_002052.5):c.1221A>C (p.P407=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758367A>C" "" "likely benign" ""
"0000533628" "0" "30" "8" "11615883" "11615883" "subst" "0" "01804" "GATA4_000066" "g.11615883T>A" "" "" "" "GATA4(NM_002052.3):c.1228T>A (p.(Tyr410Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758374T>A" "" "likely benign" ""
"0000533629" "0" "30" "8" "11615887" "11615887" "subst" "0.00373183" "01804" "GATA4_000067" "g.11615887C>T" "" "" "" "GATA4(NM_001308093.1):c.1235C>T (p.(Ala412Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758378C>T" "" "likely benign" ""
"0000533630" "0" "30" "8" "11615928" "11615928" "subst" "0.00201403" "01804" "GATA4_000068" "g.11615928G>A" "" "" "" "GATA4(NM_001308093.1):c.1276G>A (p.(Asp426Asn)), GATA4(NM_002052.5):c.1273G>A (p.D425N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758419G>A" "" "likely benign" ""
"0000533631" "0" "10" "8" "11616338" "11616338" "subst" "0" "02327" "GATA4_000069" "g.11616338A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758829A>C" "" "benign" ""
"0000533632" "0" "10" "8" "11616410" "11616410" "subst" "0" "02327" "GATA4_000070" "g.11616410C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758901C>T" "" "benign" ""
"0000533633" "0" "10" "8" "11616501" "11616501" "subst" "0" "02327" "GATA4_000071" "g.11616501T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758992T>C" "" "benign" ""
"0000533634" "0" "10" "8" "11616516" "11616516" "subst" "0" "02327" "GATA4_000072" "g.11616516T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759007T>C" "" "benign" ""
"0000533635" "0" "10" "8" "11616547" "11616547" "subst" "0" "02327" "GATA4_000073" "g.11616547C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759038C>G" "" "benign" ""
"0000533636" "0" "10" "8" "11616571" "11616571" "subst" "0" "02327" "GATA4_000074" "g.11616571A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759062A>G" "" "benign" ""
"0000533637" "0" "10" "8" "11616836" "11616836" "subst" "0" "02327" "GATA4_000075" "g.11616836G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759327G>A" "" "benign" ""
"0000533638" "0" "10" "8" "11616996" "11616996" "subst" "0" "02327" "GATA4_000076" "g.11616996C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759487C>T" "" "benign" ""
"0000533639" "0" "30" "8" "11617097" "11617097" "subst" "0" "02327" "GATA4_000077" "g.11617097C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759588C>G" "" "likely benign" ""
"0000533640" "0" "10" "8" "11617142" "11617142" "subst" "0" "02327" "GATA4_000078" "g.11617142C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759633C>T" "" "benign" ""
"0000533642" "0" "10" "8" "11617339" "11617339" "subst" "0" "02327" "GATA4_000080" "g.11617339G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759830G>A" "" "benign" ""
"0000533643" "0" "30" "8" "11617505" "11617505" "subst" "0" "02327" "GATA4_000081" "g.11617505C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11759996C>G" "" "likely benign" ""
"0000611405" "0" "50" "8" "11565834" "11565834" "subst" "7.0598E-5" "02327" "GATA4_000082" "g.11565834T>C" "" "" "" "GATA4(NM_001308093.1):c.13T>C (p.(Leu5=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708325T>C" "" "VUS" ""
"0000611406" "0" "70" "8" "11566240" "11566240" "dup" "0" "02327" "GATA4_000083" "g.11566240dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708731dup" "" "likely pathogenic" ""
"0000611407" "0" "50" "8" "11566308" "11566308" "subst" "6.1587E-5" "02327" "GATA4_000029" "g.11566308C>T" "" "" "" "GATA4(NM_001308093.1):c.487C>T (p.(Pro163Ser)), GATA4(NM_002052.5):c.487C>T (p.P163S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708799C>T" "" "VUS" ""
"0000611408" "0" "30" "8" "11566419" "11566419" "subst" "0" "02327" "GATA4_000084" "g.11566419G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708910G>T" "" "likely benign" ""
"0000611409" "0" "30" "8" "11606510" "11606510" "subst" "0.00352462" "01943" "GATA4_000085" "g.11606510G>A" "" "" "" "GATA4(NM_001308093.1):c.702G>A (p.(Thr234=)), GATA4(NM_002052.4):c.699G>A (p.T233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11749001G>A" "" "likely benign" ""
"0000611410" "0" "30" "8" "11606528" "11606528" "subst" "2.84245E-5" "02327" "GATA4_000086" "g.11606528C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11749019C>T" "" "likely benign" ""
"0000611411" "0" "90" "8" "11612603" "11612603" "subst" "0" "01943" "GATA4_000087" "g.11612603C>T" "" "" "" "GATA4(NM_002052.4):c.958C>T (p.R320W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755094C>T" "" "pathogenic" ""
"0000611412" "0" "30" "8" "11615888" "11615888" "subst" "0.000105582" "02327" "GATA4_000090" "g.11615888G>A" "" "" "" "GATA4(NM_001308093.3):c.1236G>A (p.A412=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758379G>A" "" "likely benign" ""
"0000611413" "0" "30" "8" "11615963" "11615963" "subst" "2.84241E-5" "01943" "GATA4_000091" "g.11615963C>T" "" "" "" "GATA4(NM_002052.4):c.1308C>T (p.H436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11758454C>T" "" "likely benign" ""
"0000621983" "0" "30" "8" "11614440" "11614440" "subst" "0.000150462" "01943" "GATA4_000088" "g.11614440C>G" "" "" "" "GATA4(NM_002052.4):c.998-4C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756931C>G" "" "likely benign" ""
"0000621984" "0" "50" "8" "11614494" "11614502" "del" "0" "02325" "GATA4_000089" "g.11614494_11614502del" "" "" "" "GATA4(NM_002052.5):c.1048_1056delTCCAGCAAC (p.S350_N352del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11756985_11756993del" "" "VUS" ""
"0000652413" "1" "10" "8" "11614575" "11614575" "subst" "0.0958295" "03575" "GATA4_000013" "g.11614575A>G" "224/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "224 heterozygous; {DB:CLININrs3729856}" "Germline" "" "rs3729856" "0" "" "" "g.11757066A>G" "" "benign" ""
"0000652414" "1" "50" "8" "11615875" "11615875" "subst" "0.000527932" "03575" "GATA4_000016" "g.11615875C>A" "19/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 19 heterozygous, no homozygous; {DB:CLININrs115099192}" "Germline" "" "rs115099192" "0" "" "" "g.11758366C>A" "" "VUS" ""
"0000652415" "1" "50" "8" "11615928" "11615928" "subst" "0.00201403" "03575" "GATA4_000068" "g.11615928G>A" "43/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 43 heterozygous, no homozygous; {DB:CLININrs56208331}" "Germline" "" "rs56208331" "0" "" "" "g.11758419G>A" "" "VUS" ""
"0000655982" "0" "30" "8" "11566044" "11566044" "subst" "1.98381E-5" "01943" "GATA4_000092" "g.11566044G>C" "" "" "" "GATA4(NM_002052.3):c.223G>C (p.(Ala75Pro)), GATA4(NM_002052.4):c.223G>C (p.A75P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11708535G>C" "" "likely benign" ""
"0000655983" "0" "30" "8" "11606609" "11606609" "subst" "4.92558E-5" "01804" "GATA4_000093" "g.11606609C>T" "" "" "" "GATA4(NM_002052.3):c.783+15C>T (p.(=)), GATA4(NM_002052.5):c.783+15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11749100C>T" "" "likely benign" ""
"0000655984" "0" "50" "8" "11607686" "11607686" "subst" "0" "02326" "GATA4_000094" "g.11607686C>T" "" "" "" "GATA4(NM_002052.5):c.850C>T (p.R284C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11750177C>T" "" "VUS" ""
"0000655985" "0" "30" "8" "11612584" "11612584" "subst" "0.00010155" "01943" "GATA4_000047" "g.11612584G>T" "" "" "" "GATA4(NM_001308093.1):c.942G>T (p.(Glu314Asp)), GATA4(NM_002052.4):c.939G>T (p.E313D), GATA4(NM_002052.5):c.939G>T (p.E313D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.11755075G>T" "" "likely benign" ""
"0000669996" "3" "10" "8" "11614575" "11614575" "subst" "0.0958295" "03575" "GATA4_000013" "g.11614575A>G" "11/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "11 homozygous; {DB:CLININrs3729856}" "Germline" "" "rs3729856" "0" "" "" "g.11757066A>G" "" "benign" ""
"0000678272" "0" "50" "8" "11565869" "11565892" "del" "0" "02325" "GATA4_000095" "g.11565869_11565892del" "" "" "" "GATA4(NM_002052.3):c.42_65del (p.(Tyr18_Ala25del)), GATA4(NM_002052.5):c.48_71delTGCCTACGAGGCGGGCGGCCCCGG (p.Y18_A25del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000678273" "0" "30" "8" "11607770" "11607770" "subst" "0.00523438" "02326" "GATA4_000045" "g.11607770G>A" "" "" "" "GATA4(NM_001308093.3):c.912+25G>A, GATA4(NM_002052.5):c.909+25G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000678275" "0" "50" "8" "11615875" "11615875" "subst" "0.000527932" "01943" "GATA4_000016" "g.11615875C>A" "" "" "" "GATA4(NM_002052.3):c.1220C>A (p.(Pro407Gln)), GATA4(NM_002052.4):c.1220C>A (p.P407Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000690145" "0" "10" "8" "11565920" "11565920" "subst" "0.0035943" "02326" "GATA4_000096" "g.11565920G>T" "" "" "" "GATA4(NM_001308093.1):c.99G>T (p.(Ala33=)), GATA4(NM_002052.5):c.99G>T (p.A33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000690146" "0" "10" "8" "11615928" "11615928" "subst" "0.00201403" "02326" "GATA4_000068" "g.11615928G>A" "" "" "" "GATA4(NM_001308093.1):c.1276G>A (p.(Asp426Asn)), GATA4(NM_002052.5):c.1273G>A (p.D425N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000721768" "0" "30" "8" "11614483" "11614483" "subst" "0.00152297" "02325" "GATA4_000010" "g.11614483C>T" "" "" "" "GATA4(NM_001308093.1):c.1040C>T (p.(Ala347Val)), GATA4(NM_001308093.3):c.1040C>T (p.A347V), GATA4(NM_002052.5):c.1037C>T (p.A346V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000721769" "0" "30" "8" "11614524" "11614524" "subst" "9.74714E-5" "02325" "GATA4_000058" "g.11614524G>C" "" "" "" "GATA4(NM_001308093.1):c.1081G>C (p.(Glu361Gln)), GATA4(NM_002052.5):c.1078G>C (p.E360Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000721770" "0" "50" "8" "11615875" "11615875" "subst" "6.90372E-5" "01943" "GATA4_000097" "g.11615875C>G" "" "" "" "GATA4(NM_001308093.1):c.1223C>G (p.(Pro408Arg)), GATA4(NM_002052.4):c.1220C>G (p.P407R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000803412" "0" "10" "8" "11606312" "11606312" "subst" "0" "02329" "GATA4_000035" "g.11606312T>C" "" "" "" "GATA4(NM_001308093.3):c.617-113T>C, GATA4(NM_002052.5):c.617-116T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803413" "0" "10" "8" "11606364" "11606364" "subst" "0" "02329" "GATA4_000036" "g.11606364G>C" "" "" "" "GATA4(NM_001308093.3):c.617-61G>C, GATA4(NM_002052.5):c.617-64G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803414" "0" "30" "8" "11606609" "11606609" "subst" "4.92558E-5" "02326" "GATA4_000093" "g.11606609C>T" "" "" "" "GATA4(NM_002052.3):c.783+15C>T (p.(=)), GATA4(NM_002052.5):c.783+15C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000803415" "0" "30" "8" "11607658" "11607658" "subst" "0.00212652" "02326" "GATA4_000006" "g.11607658C>T" "" "" "" "GATA4(NM_001308093.1):c.825C>T (p.(Cys275=)), GATA4(NM_002052.4):c.822C>T (p.C274=), GATA4(NM_002052.5):c.822C>T (p.C274=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000803416" "0" "10" "8" "11612698" "11612698" "subst" "0" "02329" "GATA4_000009" "g.11612698C>A" "" "" "" "GATA4(NM_001308093.3):c.1000+56C>A, GATA4(NM_002052.5):c.997+56C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803417" "0" "10" "8" "11612842" "11612842" "subst" "0" "02329" "GATA4_000098" "g.11612842G>A" "" "" "" "GATA4(NM_001308093.3):c.1000+200G>A, GATA4(NM_002052.5):c.997+200G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803418" "0" "10" "8" "11614575" "11614575" "subst" "0.0958295" "02329" "GATA4_000013" "g.11614575A>G" "" "" "" "GATA4(NM_001308093.3):c.1132A>G (p.S378G), GATA4(NM_002052.4):c.1129A>G (p.S377G), GATA4(NM_002052.5):c.1129A>G (p.S377G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803419" "0" "30" "8" "11614600" "11614600" "subst" "0" "02326" "GATA4_000099" "g.11614600C>T" "" "" "" "GATA4(NM_002052.5):c.1146+8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000803420" "0" "10" "8" "11614769" "11614769" "subst" "0" "02329" "GATA4_000061" "g.11614769C>T" "" "" "" "GATA4(NM_001308093.3):c.1149+177C>T, GATA4(NM_002052.5):c.1146+177C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803421" "0" "10" "8" "11615695" "11615695" "subst" "0" "02329" "GATA4_000062" "g.11615695A>G" "" "" "" "GATA4(NM_001308093.3):c.1150-107A>G, GATA4(NM_002052.5):c.1147-107A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000803422" "0" "30" "8" "11615888" "11615888" "subst" "0.000105582" "02329" "GATA4_000090" "g.11615888G>A" "" "" "" "GATA4(NM_001308093.3):c.1236G>A (p.A412=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000851781" "0" "30" "8" "11614510" "11614510" "subst" "0.00108837" "02326" "GATA4_000055" "g.11614510C>G" "" "" "" "GATA4(NM_001308093.1):c.1067C>G (p.(Thr356Ser)), GATA4(NM_002052.5):c.1064C>G (p.T355S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000851782" "0" "70" "8" "11614543" "11614544" "ins" "0" "01943" "GATA4_000113" "g.11614543_11614544insCAAGA" "" "" "" "GATA4(NM_002052.4):c.1097_1098insCAAGA (p.E367Kfs*39)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" ""
"0000861024" "0" "50" "8" "11565869" "11565892" "del" "0" "01804" "GATA4_000095" "g.11565869_11565892del" "" "" "" "GATA4(NM_002052.3):c.42_65del (p.(Tyr18_Ala25del)), GATA4(NM_002052.5):c.48_71delTGCCTACGAGGCGGGCGGCCCCGG (p.Y18_A25del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000861025" "0" "30" "8" "11565920" "11565920" "subst" "0.0035943" "01804" "GATA4_000096" "g.11565920G>T" "" "" "" "GATA4(NM_001308093.1):c.99G>T (p.(Ala33=)), GATA4(NM_002052.5):c.99G>T (p.A33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861026" "0" "30" "8" "11566044" "11566044" "subst" "0.000813363" "01804" "GATA4_000100" "g.11566044G>T" "" "" "" "GATA4(NM_001308093.1):c.223G>T (p.(Ala75Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861027" "0" "30" "8" "11566061" "11566061" "subst" "0" "01804" "GATA4_000101" "g.11566061C>T" "" "" "" "GATA4(NM_002052.3):c.240C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861028" "0" "30" "8" "11566208" "11566208" "subst" "0" "01804" "GATA4_000102" "g.11566208T>A" "" "" "" "GATA4(NM_002052.3):c.387T>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861029" "0" "50" "8" "11566308" "11566308" "subst" "6.1587E-5" "01804" "GATA4_000029" "g.11566308C>T" "" "" "" "GATA4(NM_001308093.1):c.487C>T (p.(Pro163Ser)), GATA4(NM_002052.5):c.487C>T (p.P163S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000861030" "0" "30" "8" "11566322" "11566322" "subst" "0" "01804" "GATA4_000103" "g.11566322C>A" "" "" "" "GATA4(NM_002052.3):c.501C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861031" "0" "30" "8" "11566352" "11566352" "subst" "0.000878679" "01804" "GATA4_000104" "g.11566352C>A" "" "" "" "GATA4(NM_001308093.1):c.531C>A (p.(Ala177=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861032" "0" "30" "8" "11566364" "11566364" "subst" "0.000162605" "01804" "GATA4_000030" "g.11566364C>T" "" "" "" "GATA4(NM_001308093.1):c.543C>T (p.(Ala181=)), GATA4(NM_002052.4):c.543C>T (p.A181=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861033" "0" "30" "8" "11566436" "11566436" "subst" "0" "01804" "GATA4_000105" "g.11566436C>A" "" "" "" "GATA4(NM_002052.3):c.615C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861034" "0" "30" "8" "11606510" "11606510" "subst" "0.00352462" "01804" "GATA4_000085" "g.11606510G>A" "" "" "" "GATA4(NM_001308093.1):c.702G>A (p.(Thr234=)), GATA4(NM_002052.4):c.699G>A (p.T233=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861035" "0" "30" "8" "11606534" "11606534" "subst" "0.000402034" "01804" "GATA4_000106" "g.11606534C>T" "" "" "" "GATA4(NM_001308093.1):c.726C>T (p.(Cys242=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861036" "0" "30" "8" "11607676" "11607676" "subst" "8.13656E-6" "01804" "GATA4_000107" "g.11607676G>A" "" "" "" "GATA4(NM_002052.3):c.840G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861037" "0" "10" "8" "11607721" "11607721" "subst" "0.000317716" "01804" "GATA4_000108" "g.11607721C>T" "" "" "" "GATA4(NM_001308093.1):c.888C>T (p.(Cys296=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000861038" "0" "30" "8" "11607742" "11607742" "subst" "6.1221E-5" "01804" "GATA4_000109" "g.11607742C>T" "" "" "" "GATA4(NM_002052.3):c.906C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861039" "0" "30" "8" "11607761" "11607761" "subst" "2.4597E-5" "01804" "GATA4_000110" "g.11607761G>A" "" "" "" "GATA4(NM_001308093.1):c.912+16G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861040" "0" "30" "8" "11614478" "11614478" "subst" "3.65562E-5" "01804" "GATA4_000111" "g.11614478C>T" "" "" "" "GATA4(NM_002052.3):c.1032C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861041" "0" "50" "8" "11614519" "11614519" "subst" "0.000121845" "01804" "GATA4_000112" "g.11614519G>C" "" "" "" "GATA4(NM_002052.3):c.1073G>C (p.(Ser358Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000861042" "0" "30" "8" "11614544" "11614544" "subst" "4.06138E-6" "01804" "GATA4_000114" "g.11614544G>A" "" "" "" "GATA4(NM_002052.3):c.1098G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861043" "0" "30" "8" "11614547" "11614547" "subst" "8.12262E-6" "01804" "GATA4_000115" "g.11614547G>A" "" "" "" "GATA4(NM_002052.3):c.1101G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861044" "0" "30" "8" "11614583" "11614583" "subst" "0.000349579" "01804" "GATA4_000116" "g.11614583C>T" "" "" "" "GATA4(NM_001308093.1):c.1140C>T (p.(Ser380=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000861045" "0" "10" "8" "11615835" "11615835" "subst" "0.00227993" "01804" "GATA4_000015" "g.11615835C>A" "" "" "" "GATA4(NM_001308093.1):c.1183C>A (p.(Pro395Thr)), GATA4(NM_002052.5):c.1180C>A (p.P394T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000861046" "0" "30" "8" "11615954" "11615954" "subst" "4.06062E-6" "01804" "GATA4_000117" "g.11615954C>T" "" "" "" "GATA4(NM_002052.3):c.1299C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000868693" "1" "70" "8" "11616167" "11616167" "subst" "0" "04178" "GATA4_000118" "g.11616167G>A" "10/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+183G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758658G>A" "" "association" ""
"0000868912" "1" "70" "8" "11616287" "11616287" "subst" "0" "04178" "GATA4_000119" "g.11616287G>C" "1/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+303G>C" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758778G>C" "" "association" ""
"0000868913" "1" "70" "8" "11616292" "11616292" "subst" "0" "04178" "GATA4_000120" "g.11616292G>A" "2/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+308G>A" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758783G>A" "" "association" ""
"0000868914" "1" "70" "8" "11616334" "11616334" "subst" "0" "04178" "GATA4_000121" "g.11616334G>A" "7/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+350G>A" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758825G>A" "" "association" ""
"0000868915" "1" "70" "8" "11616353" "11616353" "subst" "0" "04178" "GATA4_000122" "g.11616353C>A" "2/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+369C>A" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758844C>A" "" "association" ""
"0000868916" "1" "70" "8" "11616354" "11616354" "subst" "0" "04178" "GATA4_000123" "g.11616354C>A" "2/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+370C>A" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758845C>A" "" "association" ""
"0000868917" "1" "70" "8" "11616732" "11616732" "subst" "0" "04178" "GATA4_000125" "g.11616732A>G" "2/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+748A>G" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759223A>G" "" "association" ""
"0000868918" "1" "70" "8" "11616778" "11616778" "subst" "0" "04178" "GATA4_000127" "g.11616778A>G" "1/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+794A>G" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759269A>G" "" "association" ""
"0000868919" "1" "70" "8" "11616804" "11616804" "subst" "0" "04178" "GATA4_000128" "g.11616804A>G" "3/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+820A>G" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759295A>G" "" "association" ""
"0000868920" "1" "70" "8" "11616824" "11616824" "subst" "0" "04178" "GATA4_000129" "g.11616824T>G" "1/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+840T>G" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759315T>G" "" "association" ""
"0000868921" "1" "70" "8" "11616861" "11616861" "subst" "0" "04178" "GATA4_000130" "g.11616861A>G" "2/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+877A>G" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759352A>G" "" "association" ""
"0000868922" "1" "70" "8" "11617145" "11617145" "subst" "0" "04178" "GATA4_000131" "g.11617145G>C" "1/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1161G>C" "not in 115 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759636G>C" "" "association" ""
"0000868923" "1" "50" "8" "11614575" "11614575" "subst" "0.0958295" "04178" "GATA4_000013" "g.11614575A>G" "11/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "NM_001308093.3:c.511A>G (Ser377Gly)" "" "Germline/De novo (untested)" "" "rs3729856" "0" "" "" "g.11757066A>G" "" "association" ""
"0000868924" "1" "50" "8" "11616338" "11616338" "subst" "0" "04178" "GATA4_000069" "g.11616338A>C" "15/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+354A>C" "" "Germline/De novo (untested)" "" "rs867858" "0" "" "" "g.11758829A>C" "" "association" ""
"0000868925" "1" "50" "8" "11616724" "11616724" "subst" "0" "04178" "GATA4_000124" "g.11616724C>G" "2/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+740C>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.11759215C>G" "" "association" ""
"0000868926" "1" "50" "8" "11616765" "11616765" "subst" "0" "04178" "GATA4_000126" "g.11616765C>G" "13/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+781C>G" "" "Germline/De novo (untested)" "" "rs1019796013" "0" "" "" "g.11759256C>G" "" "association" ""
"0000868927" "1" "30" "8" "11616836" "11616836" "subst" "0" "04178" "GATA4_000075" "g.11616836G>A" "10/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+852G>A" "" "Germline/De novo (untested)" "" "rs804290" "0" "" "" "g.11759327G>A" "" "association" ""
"0000868928" "1" "50" "8" "11617142" "11617142" "subst" "0" "04178" "GATA4_000078" "g.11617142C>T" "15/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1158C>T" "" "Germline/De novo (untested)" "" "rs11785481" "0" "" "" "g.11759633C>T" "" "association" ""
"0000868929" "1" "50" "8" "11617240" "11617240" "subst" "0" "04178" "GATA4_000079" "g.11617240A>T" "12/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1256A>T" "" "Germline/De novo (untested)" "" "rs12458" "0" "" "" "g.11759731A>T" "" "association" ""
"0000868930" "3" "30" "8" "11617365" "11617365" "subst" "0" "04178" "GATA4_000132" "g.11617365A>G" "1/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1381A>G" "not in 115 controls" "Germline/De novo (untested)" "" "rs3735812" "0" "" "" "g.11759856A>G" "" "association" ""
"0000868931" "1" "50" "8" "11617505" "11617505" "subst" "0" "04178" "GATA4_000081" "g.11617505C>G" "14/175 cases CHD" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1521C>G" "" "Germline/De novo (untested)" "" "rs3203358" "0" "" "" "g.11759996C>G" "" "association" ""
"0000868932" "1" "50" "8" "11614575" "11614575" "subst" "0.0958295" "04178" "GATA4_000013" "g.11614575A>G" "1/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "NM_001308093.3:c.511A>G (Ser377Gly)" "" "Germline/De novo (untested)" "" "rs3729856" "0" "" "" "g.11757066A>G" "" "association" ""
"0000868933" "1" "50" "8" "11616338" "11616338" "subst" "0" "04178" "GATA4_000069" "g.11616338A>C" "2/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+354A>C" "" "Germline/De novo (untested)" "" "rs867858" "0" "" "" "g.11758829A>C" "" "association" ""
"0000868934" "1" "50" "8" "11616765" "11616765" "subst" "0" "04178" "GATA4_000126" "g.11616765C>G" "1/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+781C>G" "" "Germline/De novo (untested)" "" "rs1019796013" "0" "" "" "g.11759256C>G" "" "association" ""
"0000868935" "1" "30" "8" "11616836" "11616836" "subst" "0" "04178" "GATA4_000075" "g.11616836G>A" "5/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+852G>A" "" "Germline/De novo (untested)" "" "rs804290" "0" "" "" "g.11759327G>A" "" "association" ""
"0000868936" "1" "50" "8" "11617142" "11617142" "subst" "0" "04178" "GATA4_000078" "g.11617142C>T" "1/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1158C>T" "" "Germline/De novo (untested)" "" "rs11785481" "0" "" "" "g.11759633C>T" "" "association" ""
"0000868937" "1" "50" "8" "11617240" "11617240" "subst" "0" "04178" "GATA4_000079" "g.11617240A>T" "1/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1256A>T" "" "Germline/De novo (untested)" "" "rs12458" "0" "" "" "g.11759731A>T" "" "association" ""
"0000868938" "1" "50" "8" "11617505" "11617505" "subst" "0" "04178" "GATA4_000081" "g.11617505C>G" "2/115 controls" "{PMID:Khatami 2022:34652630}, {DOI:Khatami 2022:10.1007/s11596-021-2428-9}" "" "+1521C>G" "" "Germline/De novo (untested)" "" "rs3203358" "0" "" "" "g.11759996C>G" "" "association" ""
"0000888127" "0" "30" "8" "11565834" "11565834" "subst" "7.0598E-5" "01804" "GATA4_000082" "g.11565834T>C" "" "" "" "GATA4(NM_001308093.1):c.13T>C (p.(Leu5=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000888128" "0" "30" "8" "11606543" "11606543" "subst" "0.000320799" "01804" "GATA4_000133" "g.11606543C>T" "" "" "" "GATA4(NM_001308093.1):c.735C>T (p.(Tyr245=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000888129" "0" "30" "8" "11606602" "11606602" "subst" "5.71816E-5" "01804" "GATA4_000134" "g.11606602C>T" "" "" "" "GATA4(NM_001308093.1):c.786+8C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000888130" "0" "50" "8" "11607623" "11607623" "subst" "2.44008E-5" "02325" "GATA4_000135" "g.11607623G>T" "" "" "" "GATA4(NM_002052.5):c.787G>T (p.A263S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000888131" "0" "30" "8" "11612584" "11612584" "subst" "0.00010155" "02325" "GATA4_000047" "g.11612584G>T" "" "" "" "GATA4(NM_001308093.1):c.942G>T (p.(Glu314Asp)), GATA4(NM_002052.4):c.939G>T (p.E313D), GATA4(NM_002052.5):c.939G>T (p.E313D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000888132" "0" "10" "8" "11614559" "11614559" "subst" "0.00193343" "02326" "GATA4_000011" "g.11614559A>G" "" "" "" "GATA4(NM_001308093.1):c.1116A>G (p.(Ser372=)), GATA4(NM_002052.4):c.1113A>G (p.S371=), GATA4(NM_002052.5):c.1113A>G (p.S371=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000888133" "0" "30" "8" "11615876" "11615876" "subst" "0.000767506" "02326" "GATA4_000065" "g.11615876A>C" "" "" "" "GATA4(NM_001308093.1):c.1224A>C (p.(Pro408=)), GATA4(NM_002052.5):c.1221A>C (p.P407=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000912870" "0" "30" "8" "11566151" "11566151" "subst" "0" "01804" "GATA4_000136" "g.11566151C>T" "" "" "" "GATA4(NM_002052.3):c.330C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000912871" "0" "50" "8" "11607693" "11607693" "subst" "4.48124E-5" "01804" "GATA4_000043" "g.11607693C>T" "" "" "" "GATA4(NM_002052.3):c.857C>T (p.(Ala286Val)), GATA4(NM_002052.4):c.857C>T (p.A286V), GATA4(NM_002052.5):c.857C>T (p.A286V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000924816" "0" "30" "8" "11615804" "11615804" "subst" "6.52002E-5" "01804" "GATA4_000137" "g.11615804G>A" "" "" "" "GATA4(NM_002052.3):c.1149G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000929410" "0" "30" "8" "11607694" "11607694" "subst" "4.07156E-5" "01804" "GATA4_000007" "g.11607694G>A" "" "" "" "GATA4(NM_001308093.1):c.861G>A (p.(Ala287=)), GATA4(NM_002052.4):c.858G>A (p.A286=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000929411" "0" "10" "8" "11615835" "11615835" "subst" "0.00227993" "02326" "GATA4_000015" "g.11615835C>A" "" "" "" "GATA4(NM_001308093.1):c.1183C>A (p.(Pro395Thr)), GATA4(NM_002052.5):c.1180C>A (p.P394T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000932923" "0" "90" "8" "11606519" "11606519" "subst" "0" "03465" "GATA4_000138" "g.11606519T>G" "" "" "" "g.72052T>G" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.11749010T>G" "" "pathogenic (dominant)" ""
"0000949004" "0" "30" "8" "11566409" "11566409" "subst" "1.65799E-5" "01804" "GATA4_000139" "g.11566409C>T" "" "" "" "GATA4(NM_002052.3):c.588C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000949005" "0" "30" "8" "11566430" "11566430" "subst" "4.98761E-5" "02326" "GATA4_000031" "g.11566430C>T" "" "" "" "GATA4(NM_001308093.1):c.609C>T (p.(Pro203=)), GATA4(NM_002052.5):c.609C>T (p.P203=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000949006" "0" "30" "8" "11566452" "11566452" "subst" "0.000242874" "01804" "GATA4_000033" "g.11566452G>A" "" "" "" "GATA4(NM_001308093.1):c.616+15G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000949007" "0" "30" "8" "11606486" "11606486" "subst" "3.24844E-5" "01804" "GATA4_000140" "g.11606486C>T" "" "" "" "GATA4(NM_002052.3):c.675C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000949008" "0" "50" "8" "11612577" "11612577" "subst" "0" "02326" "GATA4_000141" "g.11612577G>A" "" "" "" "GATA4(NM_002052.5):c.932G>A (p.R311Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000949009" "0" "50" "8" "11612618" "11612618" "subst" "3.25161E-5" "01804" "GATA4_000049" "g.11612618C>G" "" "" "" "GATA4(NM_001308093.1):c.976C>G (p.(Leu326Val)), GATA4(NM_002052.5):c.973C>G (p.L325V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000949010" "0" "30" "8" "11615981" "11615981" "subst" "0.000105578" "02326" "GATA4_000142" "g.11615981G>A" "" "" "" "GATA4(NM_002052.5):c.1326G>A (p.A442=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000957730" "0" "70" "8" "11612602" "11612602" "subst" "0" "00006" "GATA4_000143" "g.11612602A>T" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.11755093A>T" "" "likely pathogenic" ""
"0000957786" "0" "70" "8" "11614524" "11614524" "subst" "9.74714E-5" "00006" "GATA4_000058" "g.11614524G>C" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.11757015G>C" "" "likely pathogenic" ""
"0000957907" "0" "70" "8" "11615875" "11615875" "subst" "6.90372E-5" "00006" "GATA4_000097" "g.11615875C>G" "" "{PMID:Miszalski-Jamka 2017:28798025}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.11758366C>G" "" "likely pathogenic" ""
"0000964789" "0" "50" "8" "11565876" "11565876" "subst" "0" "02325" "GATA4_000022" "g.11565876G>A" "" "" "" "GATA4(NM_002052.4):c.55G>A (p.E19K), GATA4(NM_002052.5):c.55G>A (p.E19K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000964790" "0" "10" "8" "11612842" "11612842" "subst" "0" "02326" "GATA4_000098" "g.11612842G>A" "" "" "" "GATA4(NM_001308093.3):c.1000+200G>A, GATA4(NM_002052.5):c.997+200G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000964791" "0" "10" "8" "11614584" "11614584" "subst" "0.00519491" "02329" "GATA4_000012" "g.11614584G>A" "" "" "" "GATA4(NM_001308093.1):c.1141G>A (p.(Val381Met)), GATA4(NM_001308093.3):c.1141G>A (p.V381M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000964792" "0" "10" "8" "11614721" "11614721" "subst" "0" "02329" "GATA4_000144" "g.11614721C>T" "" "" "" "GATA4(NM_001308093.3):c.1149+129C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000964793" "0" "10" "8" "11614769" "11614769" "subst" "0" "02326" "GATA4_000061" "g.11614769C>T" "" "" "" "GATA4(NM_001308093.3):c.1149+177C>T, GATA4(NM_002052.5):c.1146+177C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000964794" "0" "10" "8" "11615695" "11615695" "subst" "0" "02326" "GATA4_000062" "g.11615695A>G" "" "" "" "GATA4(NM_001308093.3):c.1150-107A>G, GATA4(NM_002052.5):c.1147-107A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000964795" "0" "50" "8" "11615875" "11615875" "subst" "6.90372E-5" "01804" "GATA4_000097" "g.11615875C>G" "" "" "" "GATA4(NM_001308093.1):c.1223C>G (p.(Pro408Arg)), GATA4(NM_002052.4):c.1220C>G (p.P407R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000964796" "0" "10" "8" "11617240" "11617240" "subst" "0" "02326" "GATA4_000079" "g.11617240A>T" "" "" "" "GATA4(NM_002052.5):c.*1256A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000977994" "0" "50" "8" "11566197" "11566197" "subst" "0" "01804" "GATA4_000145" "g.11566197G>A" "" "" "" "GATA4(NM_001308093.3):c.376G>A (p.(Ala126Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000977995" "0" "30" "8" "11566226" "11566226" "subst" "0" "01804" "GATA4_000146" "g.11566226C>G" "" "" "" "GATA4(NM_002052.3):c.405C>G (p.(Gly135=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000977996" "0" "30" "8" "11606438" "11606438" "subst" "0.000337037" "01804" "GATA4_000037" "g.11606438C>T" "" "" "" "GATA4(NM_001308093.1):c.630C>T (p.(Asp210=)), GATA4(NM_002052.4):c.627C>T (p.D209=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000977997" "0" "50" "8" "11606580" "11606580" "subst" "2.439E-5" "01804" "GATA4_000147" "g.11606580C>T" "" "" "" "GATA4(NM_002052.3):c.769C>T (p.(Pro257Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000977998" "0" "50" "8" "11614503" "11614503" "subst" "2.03064E-5" "01804" "GATA4_000148" "g.11614503G>A" "" "" "" "GATA4(NM_001308093.3):c.1060G>A (p.(Ala354Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000977999" "0" "30" "8" "11614568" "11614568" "subst" "0.000138111" "01804" "GATA4_000149" "g.11614568C>T" "" "" "" "GATA4(NM_001308093.1):c.1125C>T (p.(Tyr375=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000978000" "0" "10" "8" "11615695" "11615695" "subst" "0" "01804" "GATA4_000062" "g.11615695A>G" "" "" "" "GATA4(NM_001308093.3):c.1150-107A>G, GATA4(NM_002052.5):c.1147-107A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000996884" "0" "30" "8" "11566169" "11566169" "subst" "0.00109085" "02329" "GATA4_000026" "g.11566169C>T" "" "" "" "GATA4(NM_001308093.1):c.348C>T (p.(Ser116=)), GATA4(NM_001308093.3):c.348C>T (p.S116=), GATA4(NM_002052.4):c.348C>T (p.S116=), GATA4(NM_002052.5):c..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000996885" "0" "50" "8" "11566302" "11566302" "subst" "0" "01804" "GATA4_000150" "g.11566302C>A" "" "" "" "GATA4(NM_002052.3):c.481C>A (p.(Pro161Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996886" "0" "30" "8" "11566320" "11566320" "subst" "0" "01804" "GATA4_000151" "g.11566320G>A" "" "" "" "GATA4(NM_002052.3):c.499G>A (p.(Ala167Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000996887" "0" "50" "8" "11566326" "11566326" "subst" "0" "01804" "GATA4_000152" "g.11566326G>A" "" "" "" "GATA4(NM_002052.3):c.505G>A (p.(Val169Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996888" "0" "50" "8" "11566351" "11566351" "subst" "0" "01804" "GATA4_000153" "g.11566351C>T" "" "" "" "GATA4(NM_002052.3):c.530C>T (p.(Ala177Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996889" "0" "30" "8" "11607622" "11607622" "subst" "8.94513E-5" "01804" "GATA4_000154" "g.11607622C>T" "" "" "" "GATA4(NM_002052.3):c.786C>T (p.(Ser262Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000996890" "0" "50" "8" "11607703" "11607703" "subst" "0" "01804" "GATA4_000155" "g.11607703G>C" "" "" "" "GATA4(NM_002052.3):c.867G>C (p.(Glu289Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996891" "0" "30" "8" "11612584" "11612584" "subst" "0.00010155" "02326" "GATA4_000047" "g.11612584G>T" "" "" "" "GATA4(NM_001308093.1):c.942G>T (p.(Glu314Asp)), GATA4(NM_002052.4):c.939G>T (p.E313D), GATA4(NM_002052.5):c.939G>T (p.E313D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000996892" "0" "30" "8" "11612896" "11612896" "subst" "0" "02329" "GATA4_000156" "g.11612896T>G" "" "" "" "GATA4(NM_001308093.3):c.1000+254T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000996893" "0" "50" "8" "11614564" "11614564" "subst" "0" "01804" "GATA4_000157" "g.11614564A>G" "" "" "" "GATA4(NM_001308093.1):c.1121A>G (p.(His374Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000996894" "0" "50" "8" "11614607" "11614607" "subst" "0" "01804" "GATA4_000158" "g.11614607T>A" "" "" "" "GATA4(NM_002052.3):c.1146+15T>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001025477" "0" "10" "8" "11607770" "11607770" "subst" "0.00523438" "02329" "GATA4_000045" "g.11607770G>A" "" "" "" "GATA4(NM_001308093.3):c.912+25G>A, GATA4(NM_002052.5):c.909+25G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001025478" "0" "30" "8" "11617152" "11617152" "subst" "0" "02326" "GATA4_000159" "g.11617152T>C" "" "" "" "GATA4(NM_002052.5):c.*1168T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001036700" "0" "50" "8" "11532034" "11532034" "subst" "0" "01804" "GATA4_000160" "g.11532034A>G" "" "" "" "GATA4(NM_001308094.2):c.-2812A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036701" "0" "50" "8" "11569202" "11569202" "subst" "0" "01804" "GATA4_000161" "g.11569202C>A" "" "" "" "GATA4(NM_001308093.3):c.616+2765C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001036702" "0" "30" "8" "11607635" "11607635" "subst" "0.000260108" "02325" "GATA4_000162" "g.11607635G>A" "" "" "" "GATA4(NM_002052.5):c.799G>A (p.V267M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001036703" "0" "30" "8" "11614483" "11614483" "subst" "0.00152297" "02329" "GATA4_000010" "g.11614483C>T" "" "" "" "GATA4(NM_001308093.1):c.1040C>T (p.(Ala347Val)), GATA4(NM_001308093.3):c.1040C>T (p.A347V), GATA4(NM_002052.5):c.1037C>T (p.A346V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001052939" "0" "50" "8" "11566252" "11566252" "subst" "0.000146757" "01804" "GATA4_000163" "g.11566252C>T" "" "" "" "GATA4(NM_001308093.3):c.431C>T (p.(Ala144Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001052940" "0" "50" "8" "11566309" "11566309" "subst" "0" "01804" "GATA4_000164" "g.11566309C>G" "" "" "" "GATA4(NM_001308093.3):c.488C>G (p.(Pro163Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001052941" "0" "50" "8" "11566432" "11566432" "subst" "0" "01804" "GATA4_000165" "g.11566432A>T" "" "" "" "GATA4(NM_001308093.3):c.611A>T (p.(Asn204Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001052942" "0" "10" "8" "11612842" "11612842" "subst" "0" "01804" "GATA4_000098" "g.11612842G>A" "" "" "" "GATA4(NM_001308093.3):c.1000+200G>A, GATA4(NM_002052.5):c.997+200G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001052943" "0" "10" "8" "11614769" "11614769" "subst" "0" "01804" "GATA4_000061" "g.11614769C>T" "" "" "" "GATA4(NM_001308093.3):c.1149+177C>T, GATA4(NM_002052.5):c.1146+177C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001052944" "0" "30" "8" "11615980" "11615980" "subst" "1.62423E-5" "01804" "GATA4_000166" "g.11615980C>T" "" "" "" "GATA4(NM_001308093.3):c.1328C>T (p.(Ala443Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001064885" "0" "50" "8" "11566044" "11566044" "subst" "1.98381E-5" "01804" "GATA4_000092" "g.11566044G>C" "" "" "" "GATA4(NM_002052.3):c.223G>C (p.(Ala75Pro)), GATA4(NM_002052.4):c.223G>C (p.A75P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001064886" "0" "50" "8" "11566187" "11566189" "dup" "0" "01804" "GATA4_000167" "g.11566187_11566189dup" "" "" "" "GATA4(NM_002052.3):c.366_368dup (p.(Ala126dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001064887" "0" "30" "8" "11566406" "11566406" "subst" "0" "01804" "GATA4_000168" "g.11566406G>C" "" "" "" "GATA4(NM_001308093.1):c.585G>C (p.(Arg195=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001064888" "0" "30" "8" "11566430" "11566430" "subst" "4.98761E-5" "01804" "GATA4_000031" "g.11566430C>T" "" "" "" "GATA4(NM_001308093.1):c.609C>T (p.(Pro203=)), GATA4(NM_002052.5):c.609C>T (p.P203=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001064889" "0" "50" "8" "11606569" "11606569" "subst" "4.06362E-6" "01804" "GATA4_000169" "g.11606569C>T" "" "" "" "GATA4(NM_001308093.3):c.761C>T (p.(Pro254Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001064890" "0" "30" "8" "11606610" "11606610" "subst" "5.7536E-5" "01804" "GATA4_000170" "g.11606610G>A" "" "" "" "GATA4(NM_001308093.1):c.786+16G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001064891" "0" "50" "8" "11607629" "11607629" "subst" "1.21943E-5" "02325" "GATA4_000171" "g.11607629C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001064892" "0" "30" "8" "11612618" "11612618" "subst" "3.25161E-5" "02325" "GATA4_000049" "g.11612618C>G" "" "" "" "GATA4(NM_001308093.1):c.976C>G (p.(Leu326Val)), GATA4(NM_002052.5):c.973C>G (p.L325V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001064893" "0" "50" "8" "11617152" "11617152" "subst" "0" "02325" "GATA4_000159" "g.11617152T>C" "" "" "" "GATA4(NM_002052.5):c.*1168T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes GATA4
## Count = 261
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000052423" "00008369" "70" "851" "0" "851" "0" "c.851G>A" "r.(?)" "p.(Arg284His)" "4"
"0000250702" "00008369" "10" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" ""
"0000252557" "00008369" "90" "928" "0" "928" "0" "c.928A>G" "r.(?)" "p.(Met310Val)" ""
"0000253054" "00008369" "10" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" ""
"0000253454" "00008369" "10" "1113" "0" "1113" "0" "c.1113A>G" "r.(?)" "p.(Ser371=)" ""
"0000280993" "00008369" "30" "822" "0" "822" "0" "c.822C>T" "r.(?)" "p.(Cys274=)" ""
"0000284591" "00008369" "30" "1037" "0" "1037" "0" "c.1037C>T" "r.(?)" "p.(Ala346Val)" ""
"0000284592" "00008369" "10" "997" "56" "997" "56" "c.997+56C>A" "r.(=)" "p.(=)" ""
"0000288227" "00008369" "30" "822" "0" "822" "0" "c.822C>T" "r.(?)" "p.(Cys274=)" ""
"0000288228" "00008369" "30" "858" "0" "858" "0" "c.858G>A" "r.(?)" "p.(Ala286=)" ""
"0000332036" "00008369" "10" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Val380Met)" ""
"0000455514" "00008369" "50" "25" "0" "25" "0" "c.25G>C" "r.(?)" "p.(Ala9Pro)" "2"
"0000455515" "00008369" "50" "151" "0" "151" "0" "c.151C>G" "r.(?)" "p.(Leu51Val)" "2"
"0000455516" "00008369" "50" "854" "0" "854" "0" "c.854A>G" "r.(?)" "p.(Asn285Ser)" "4"
"0000474987" "00008369" "70" "1220" "0" "1220" "0" "c.1220C>A" "r.(?)" "p.(Pro407Gln)" ""
"0000474988" "00008369" "70" "1220" "0" "1220" "0" "c.1220C>A" "r.(?)" "p.(Pro407Gln)" ""
"0000474989" "00008369" "70" "1220" "0" "1220" "0" "c.1220C>A" "r.(?)" "p.(Pro407Gln)" ""
"0000474990" "00008369" "70" "684" "0" "684" "0" "c.684G>C" "r.(?)" "p.(Trp228Cys)" ""
"0000474991" "00008369" "50" "1037" "0" "1037" "0" "c.1037C>T" "r.(?)" "p.(Ala346Val)" ""
"0000474992" "00008369" "50" "1180" "0" "1180" "0" "c.1180C>A" "r.(?)" "p.(Pro394Thr)" ""
"0000533559" "00008369" "10" "-458" "5" "-458" "5" "c.-458+5G>A" "r.spl?" "p.?" ""
"0000533560" "00008369" "30" "-457" "-28" "-457" "-28" "c.-457-28del" "r.(=)" "p.(=)" ""
"0000533561" "00008369" "30" "-345" "0" "-345" "0" "c.-345G>A" "r.(?)" "p.(=)" ""
"0000533562" "00008369" "30" "-26" "0" "-26" "0" "c.-26A>G" "r.(?)" "p.(=)" ""
"0000533563" "00008369" "50" "55" "0" "55" "0" "c.55G>A" "r.(?)" "p.(Glu19Lys)" ""
"0000533564" "00008369" "30" "90" "0" "90" "0" "c.90G>C" "r.(?)" "p.(Ala30=)" ""
"0000533566" "00008369" "30" "338" "0" "338" "0" "c.338C>G" "r.(?)" "p.(Thr113Ser)" ""
"0000533567" "00008369" "30" "348" "0" "348" "0" "c.348C>T" "r.(?)" "p.(Ser116=)" ""
"0000533568" "00008369" "30" "348" "0" "348" "0" "c.348C>T" "r.(?)" "p.(Ser116=)" ""
"0000533569" "00008369" "30" "348" "0" "348" "0" "c.348C>T" "r.(?)" "p.(Ser116=)" ""
"0000533570" "00008369" "30" "348" "0" "348" "0" "c.348C>T" "r.(?)" "p.(Ser116=)" ""
"0000533572" "00008369" "30" "462" "0" "462" "0" "c.462C>T" "r.(?)" "p.(Phe154=)" ""
"0000533573" "00008369" "30" "462" "0" "462" "0" "c.462C>T" "r.(?)" "p.(Phe154=)" ""
"0000533574" "00008369" "30" "462" "0" "462" "0" "c.462C>T" "r.(?)" "p.(Phe154=)" ""
"0000533575" "00008369" "30" "487" "0" "487" "0" "c.487C>T" "r.(?)" "p.(Pro163Ser)" ""
"0000533576" "00008369" "30" "543" "0" "543" "0" "c.543C>T" "r.(?)" "p.(Ala181=)" ""
"0000533577" "00008369" "30" "609" "0" "609" "0" "c.609C>T" "r.(?)" "p.(Pro203=)" ""
"0000533578" "00008369" "30" "611" "0" "611" "0" "c.611A>G" "r.(?)" "p.(Asn204Ser)" ""
"0000533579" "00008369" "30" "616" "15" "616" "15" "c.616+15G>A" "r.(=)" "p.(=)" ""
"0000533581" "00008369" "10" "617" "-116" "617" "-116" "c.617-116T>C" "r.(=)" "p.(=)" ""
"0000533582" "00008369" "30" "617" "-116" "617" "-116" "c.617-116T>C" "r.(=)" "p.(=)" ""
"0000533583" "00008369" "10" "617" "-64" "617" "-64" "c.617-64G>C" "r.(=)" "p.(=)" ""
"0000533584" "00008369" "10" "617" "-64" "617" "-64" "c.617-64G>C" "r.(=)" "p.(=)" ""
"0000533585" "00008369" "30" "627" "0" "627" "0" "c.627C>T" "r.(?)" "p.(Asp209=)" ""
"0000533586" "00008369" "50" "651" "0" "651" "0" "c.651T>G" "r.(?)" "p.(Cys217Trp)" ""
"0000533587" "00008369" "50" "775" "0" "775" "0" "c.775C>T" "r.(?)" "p.(Arg259Cys)" ""
"0000533588" "00008369" "50" "783" "181" "783" "181" "c.783+181T>G" "r.(=)" "p.(=)" ""
"0000533589" "00008369" "30" "784" "-116" "784" "-116" "c.784-116G>A" "r.(=)" "p.(=)" ""
"0000533590" "00008369" "30" "784" "-93" "784" "-93" "c.784-93G>A" "r.(=)" "p.(=)" ""
"0000533591" "00008369" "30" "822" "0" "822" "0" "c.822C>T" "r.(?)" "p.(Cys274=)" ""
"0000533593" "00008369" "50" "857" "0" "857" "0" "c.857C>T" "r.(?)" "p.(Ala286Val)" ""
"0000533594" "00008369" "50" "857" "0" "857" "0" "c.857C>T" "r.(?)" "p.(Ala286Val)" ""
"0000533595" "00008369" "30" "909" "4" "909" "4" "c.909+4C>A" "r.spl?" "p.?" ""
"0000533596" "00008369" "30" "909" "25" "909" "25" "c.909+25G>A" "r.(=)" "p.(=)" ""
"0000533597" "00008369" "30" "909" "25" "909" "25" "c.909+25G>C" "r.(=)" "p.(=)" ""
"0000533598" "00008369" "50" "939" "0" "939" "0" "c.939G>T" "r.(?)" "p.(Glu313Asp)" ""
"0000533599" "00008369" "70" "959" "0" "959" "0" "c.959G>A" "r.(?)" "p.(Arg320Gln)" ""
"0000533600" "00008369" "30" "973" "0" "973" "0" "c.973C>G" "r.(?)" "p.(Leu325Val)" ""
"0000533601" "00008369" "30" "997" "5" "997" "5" "c.997+5G>A" "r.spl?" "p.?" ""
"0000533602" "00008369" "10" "997" "23" "997" "23" "c.997+23A>T" "r.(=)" "p.(=)" ""
"0000533603" "00008369" "10" "997" "56" "997" "56" "c.997+56C>A" "r.(=)" "p.(=)" ""
"0000533604" "00008369" "10" "998" "-115" "998" "-115" "c.998-115C>T" "r.(=)" "p.(=)" ""
"0000533605" "00008369" "30" "1023" "0" "1023" "0" "c.1023T>C" "r.(?)" "p.(Pro341=)" ""
"0000533606" "00008369" "30" "1037" "0" "1037" "0" "c.1037C>T" "r.(?)" "p.(Ala346Val)" ""
"0000533607" "00008369" "30" "1056" "0" "1056" "0" "c.1056C>T" "r.(?)" "p.(Asn352=)" ""
"0000533608" "00008369" "10" "1056" "0" "1056" "0" "c.1056C>T" "r.(?)" "p.(Asn352=)" ""
"0000533609" "00008369" "30" "1064" "0" "1064" "0" "c.1064C>G" "r.(?)" "p.(Thr355Ser)" ""
"0000533610" "00008369" "30" "1064" "0" "1064" "0" "c.1064C>G" "r.(?)" "p.(Thr355Ser)" ""
"0000533611" "00008369" "30" "1067" "0" "1067" "0" "c.1067G>C" "r.(?)" "p.(Ser356Thr)" ""
"0000533612" "00008369" "30" "1067" "0" "1067" "0" "c.1067G>T" "r.(?)" "p.(Ser356Ile)" ""
"0000533613" "00008369" "30" "1067" "0" "1067" "0" "c.1067G>T" "r.(?)" "p.(Ser356Ile)" ""
"0000533614" "00008369" "50" "1078" "0" "1078" "0" "c.1078G>C" "r.(?)" "p.(Glu360Gln)" ""
"0000533615" "00008369" "50" "1078" "0" "1078" "0" "c.1078G>C" "r.(?)" "p.(Glu360Gln)" ""
"0000533616" "00008369" "30" "1097" "0" "1097" "0" "c.1097C>T" "r.(?)" "p.(Thr366Met)" ""
"0000533617" "00008369" "30" "1113" "0" "1113" "0" "c.1113A>G" "r.(?)" "p.(Ser371=)" ""
"0000533618" "00008369" "10" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" ""
"0000533619" "00008369" "30" "1146" "96" "1146" "96" "c.1146+96G>T" "r.(=)" "p.(=)" ""
"0000533620" "00008369" "10" "1146" "177" "1146" "177" "c.1146+177C>T" "r.(=)" "p.(=)" ""
"0000533621" "00008369" "10" "1147" "-107" "1147" "-107" "c.1147-107A>G" "r.(=)" "p.(=)" ""
"0000533622" "00008369" "10" "1147" "-63" "1147" "-63" "c.1147-63C>T" "r.(=)" "p.(=)" ""
"0000533623" "00008369" "30" "1147" "-20" "1147" "-20" "c.1147-20G>A" "r.(=)" "p.(=)" ""
"0000533624" "00008369" "30" "1147" "-20" "1147" "-20" "c.1147-20G>A" "r.(=)" "p.(=)" ""
"0000533625" "00008369" "30" "1180" "0" "1180" "0" "c.1180C>A" "r.(?)" "p.(Pro394Thr)" ""
"0000533626" "00008369" "30" "1220" "0" "1220" "0" "c.1220C>A" "r.(?)" "p.(Pro407Gln)" ""
"0000533627" "00008369" "30" "1221" "0" "1221" "0" "c.1221A>C" "r.(?)" "p.(Pro407=)" ""
"0000533628" "00008369" "30" "1228" "0" "1228" "0" "c.1228T>A" "r.(?)" "p.(Tyr410Asn)" ""
"0000533629" "00008369" "30" "1232" "0" "1232" "0" "c.1232C>T" "r.(?)" "p.(Ala411Val)" ""
"0000533630" "00008369" "30" "1273" "0" "1273" "0" "c.1273G>A" "r.(?)" "p.(Asp425Asn)" ""
"0000533631" "00008369" "10" "1683" "0" "1683" "0" "c.*354A>C" "r.(=)" "p.(=)" ""
"0000533632" "00008369" "10" "1755" "0" "1755" "0" "c.*426C>T" "r.(=)" "p.(=)" ""
"0000533633" "00008369" "10" "1846" "0" "1846" "0" "c.*517T>C" "r.(=)" "p.(=)" ""
"0000533634" "00008369" "10" "1861" "0" "1861" "0" "c.*532T>C" "r.(=)" "p.(=)" ""
"0000533635" "00008369" "10" "1892" "0" "1892" "0" "c.*563C>G" "r.(=)" "p.(=)" ""
"0000533636" "00008369" "10" "1916" "0" "1916" "0" "c.*587A>G" "r.(=)" "p.(=)" ""
"0000533637" "00008369" "10" "2181" "0" "2181" "0" "c.*852G>A" "r.(=)" "p.(=)" ""
"0000533638" "00008369" "10" "2341" "0" "2341" "0" "c.*1012C>T" "r.(=)" "p.(=)" ""
"0000533639" "00008369" "30" "2442" "0" "2442" "0" "c.*1113C>G" "r.(=)" "p.(=)" ""
"0000533640" "00008369" "10" "2487" "0" "2487" "0" "c.*1158C>T" "r.(=)" "p.(=)" ""
"0000533642" "00008369" "10" "2684" "0" "2684" "0" "c.*1355G>A" "r.(=)" "p.(=)" ""
"0000533643" "00008369" "30" "2850" "0" "2850" "0" "c.*1521C>G" "r.(=)" "p.(=)" ""
"0000611405" "00008369" "50" "13" "0" "13" "0" "c.13T>C" "r.(?)" "p.(Leu5=)" ""
"0000611406" "00008369" "70" "419" "0" "419" "0" "c.419dup" "r.(?)" "p.(Ala141CysfsTer69)" ""
"0000611407" "00008369" "50" "487" "0" "487" "0" "c.487C>T" "r.(?)" "p.(Pro163Ser)" ""
"0000611408" "00008369" "30" "598" "0" "598" "0" "c.598G>T" "r.(?)" "p.(Ala200Ser)" ""
"0000611409" "00008369" "30" "699" "0" "699" "0" "c.699G>A" "r.(?)" "p.(Thr233=)" ""
"0000611410" "00008369" "30" "717" "0" "717" "0" "c.717C>T" "r.(?)" "p.(Asn239=)" ""
"0000611411" "00008369" "90" "958" "0" "958" "0" "c.958C>T" "r.(?)" "p.(Arg320Trp)" ""
"0000611412" "00008369" "30" "1233" "0" "1233" "0" "c.1233G>A" "r.(?)" "p.(Ala411=)" ""
"0000611413" "00008369" "30" "1308" "0" "1308" "0" "c.1308C>T" "r.(?)" "p.(His436=)" ""
"0000621983" "00008369" "30" "998" "-4" "998" "-4" "c.998-4C>G" "r.spl?" "p.?" ""
"0000621984" "00008369" "50" "1048" "0" "1056" "0" "c.1048_1056del" "r.(?)" "p.(Ser350_Asn352del)" ""
"0000652413" "00008369" "10" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" ""
"0000652414" "00008369" "50" "1220" "0" "1220" "0" "c.1220C>A" "r.(?)" "p.(Pro407Gln)" ""
"0000652415" "00008369" "50" "1273" "0" "1273" "0" "c.1273G>A" "r.(?)" "p.(Asp425Asn)" ""
"0000655982" "00008369" "30" "223" "0" "223" "0" "c.223G>C" "r.(?)" "p.(Ala75Pro)" ""
"0000655983" "00008369" "30" "783" "15" "783" "15" "c.783+15C>T" "r.(=)" "p.(=)" ""
"0000655984" "00008369" "50" "850" "0" "850" "0" "c.850C>T" "r.(?)" "p.(Arg284Cys)" ""
"0000655985" "00008369" "30" "939" "0" "939" "0" "c.939G>T" "r.(?)" "p.(Glu313Asp)" ""
"0000669996" "00008369" "10" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" ""
"0000678272" "00008369" "50" "48" "0" "71" "0" "c.48_71del" "r.(?)" "p.(Tyr18_Ala25del)" ""
"0000678273" "00008369" "30" "909" "25" "909" "25" "c.909+25G>A" "r.(=)" "p.(=)" ""
"0000678275" "00008369" "50" "1220" "0" "1220" "0" "c.1220C>A" "r.(?)" "p.(Pro407Gln)" ""
"0000690145" "00008369" "10" "99" "0" "99" "0" "c.99G>T" "r.(?)" "p.(Ala33=)" ""
"0000690146" "00008369" "10" "1273" "0" "1273" "0" "c.1273G>A" "r.(?)" "p.(Asp425Asn)" ""
"0000721768" "00008369" "30" "1037" "0" "1037" "0" "c.1037C>T" "r.(?)" "p.(Ala346Val)" ""
"0000721769" "00008369" "30" "1078" "0" "1078" "0" "c.1078G>C" "r.(?)" "p.(Glu360Gln)" ""
"0000721770" "00008369" "50" "1220" "0" "1220" "0" "c.1220C>G" "r.(?)" "p.(Pro407Arg)" ""
"0000803412" "00008369" "10" "617" "-116" "617" "-116" "c.617-116T>C" "r.(=)" "p.(=)" ""
"0000803413" "00008369" "10" "617" "-64" "617" "-64" "c.617-64G>C" "r.(=)" "p.(=)" ""
"0000803414" "00008369" "30" "783" "15" "783" "15" "c.783+15C>T" "r.(=)" "p.(=)" ""
"0000803415" "00008369" "30" "822" "0" "822" "0" "c.822C>T" "r.(?)" "p.(Cys274=)" ""
"0000803416" "00008369" "10" "997" "56" "997" "56" "c.997+56C>A" "r.(=)" "p.(=)" ""
"0000803417" "00008369" "10" "997" "200" "997" "200" "c.997+200G>A" "r.(=)" "p.(=)" ""
"0000803418" "00008369" "10" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" ""
"0000803419" "00008369" "30" "1146" "8" "1146" "8" "c.1146+8C>T" "r.(=)" "p.(=)" ""
"0000803420" "00008369" "10" "1146" "177" "1146" "177" "c.1146+177C>T" "r.(=)" "p.(=)" ""
"0000803421" "00008369" "10" "1147" "-107" "1147" "-107" "c.1147-107A>G" "r.(=)" "p.(=)" ""
"0000803422" "00008369" "30" "1233" "0" "1233" "0" "c.1233G>A" "r.(?)" "p.(Ala411=)" ""
"0000851781" "00008369" "30" "1064" "0" "1064" "0" "c.1064C>G" "r.(?)" "p.(Thr355Ser)" ""
"0000851782" "00008369" "70" "1097" "0" "1098" "0" "c.1097_1098insCAAGA" "r.(?)" "p.(Glu367Lysfs*39)" ""
"0000861024" "00008369" "50" "48" "0" "71" "0" "c.48_71del" "r.(?)" "p.(Tyr18_Ala25del)" ""
"0000861025" "00008369" "30" "99" "0" "99" "0" "c.99G>T" "r.(?)" "p.(Ala33=)" ""
"0000861026" "00008369" "30" "223" "0" "223" "0" "c.223G>T" "r.(?)" "p.(Ala75Ser)" ""
"0000861027" "00008369" "30" "240" "0" "240" "0" "c.240C>T" "r.(?)" "p.(Pro80=)" ""
"0000861028" "00008369" "30" "387" "0" "387" "0" "c.387T>A" "r.(?)" "p.(Ala129=)" ""
"0000861029" "00008369" "50" "487" "0" "487" "0" "c.487C>T" "r.(?)" "p.(Pro163Ser)" ""
"0000861030" "00008369" "30" "501" "0" "501" "0" "c.501C>A" "r.(?)" "p.(Ala167=)" ""
"0000861031" "00008369" "30" "531" "0" "531" "0" "c.531C>A" "r.(?)" "p.(Ala177=)" ""
"0000861032" "00008369" "30" "543" "0" "543" "0" "c.543C>T" "r.(?)" "p.(Ala181=)" ""
"0000861033" "00008369" "30" "615" "0" "615" "0" "c.615C>A" "r.(?)" "p.(Leu205=)" ""
"0000861034" "00008369" "30" "699" "0" "699" "0" "c.699G>A" "r.(?)" "p.(Thr233=)" ""
"0000861035" "00008369" "30" "723" "0" "723" "0" "c.723C>T" "r.(?)" "p.(Cys241=)" ""
"0000861036" "00008369" "30" "840" "0" "840" "0" "c.840G>A" "r.(?)" "p.(Thr280=)" ""
"0000861037" "00008369" "10" "885" "0" "885" "0" "c.885C>T" "r.(?)" "p.(Cys295=)" ""
"0000861038" "00008369" "30" "906" "0" "906" "0" "c.906C>T" "r.(?)" "p.(His302=)" ""
"0000861039" "00008369" "30" "909" "16" "909" "16" "c.909+16G>A" "r.(=)" "p.(=)" ""
"0000861040" "00008369" "30" "1032" "0" "1032" "0" "c.1032C>T" "r.(?)" "p.(Ser344=)" ""
"0000861041" "00008369" "50" "1073" "0" "1073" "0" "c.1073G>C" "r.(?)" "p.(Ser358Thr)" ""
"0000861042" "00008369" "30" "1098" "0" "1098" "0" "c.1098G>A" "r.(?)" "p.(Thr366=)" ""
"0000861043" "00008369" "30" "1101" "0" "1101" "0" "c.1101G>A" "r.(?)" "p.(Glu367=)" ""
"0000861044" "00008369" "30" "1137" "0" "1137" "0" "c.1137C>T" "r.(?)" "p.(Ser379=)" ""
"0000861045" "00008369" "10" "1180" "0" "1180" "0" "c.1180C>A" "r.(?)" "p.(Pro394Thr)" ""
"0000861046" "00008369" "30" "1299" "0" "1299" "0" "c.1299C>T" "r.(?)" "p.(Ala433=)" ""
"0000868693" "00008369" "70" "1512" "0" "1512" "0" "c.*183G>A" "r.(?)" "p.(=)" "7"
"0000868912" "00008369" "70" "1632" "0" "1632" "0" "c.*303G>C" "r.(?)" "p.(=)" "7"
"0000868913" "00008369" "70" "1637" "0" "1637" "0" "c.*308G>A" "r.(?)" "p.(=)" "7"
"0000868914" "00008369" "70" "1679" "0" "1679" "0" "c.*350G>A" "r.(?)" "p.(=)" "7"
"0000868915" "00008369" "70" "1698" "0" "1698" "0" "c.*369C>A" "r.(?)" "p.(=)" "7"
"0000868916" "00008369" "70" "1699" "0" "1699" "0" "c.*370C>A" "r.(?)" "p.(=)" "7"
"0000868917" "00008369" "70" "2077" "0" "2077" "0" "c.*748A>G" "r.(?)" "p.(=)" "7"
"0000868918" "00008369" "70" "2123" "0" "2123" "0" "c.*794A>G" "r.(?)" "p.(=)" "7"
"0000868919" "00008369" "70" "2149" "0" "2149" "0" "c.*820A>G" "r.(?)" "p.(=)" "7"
"0000868920" "00008369" "70" "2169" "0" "2169" "0" "c.*840T>G" "r.(?)" "p.(=)" "7"
"0000868921" "00008369" "70" "2206" "0" "2206" "0" "c.*877A>G" "r.(?)" "p.(=)" "7"
"0000868922" "00008369" "70" "2490" "0" "2490" "0" "c.*1161G>C" "r.(?)" "p.(=)" "7"
"0000868923" "00008369" "50" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" "6"
"0000868924" "00008369" "50" "1683" "0" "1683" "0" "c.*354A>C" "r.(?)" "p.(=)" "7"
"0000868925" "00008369" "50" "2069" "0" "2069" "0" "c.*740C>G" "r.(?)" "p.(=)" "7"
"0000868926" "00008369" "50" "2110" "0" "2110" "0" "c.*781C>G" "r.(?)" "p.(=)" "7"
"0000868927" "00008369" "30" "2181" "0" "2181" "0" "c.*852G>A" "r.(?)" "p.(=)" "7"
"0000868928" "00008369" "50" "2487" "0" "2487" "0" "c.*1158C>T" "r.(?)" "p.(=)" "7"
"0000868929" "00008369" "50" "2585" "0" "2585" "0" "c.*1256A>T" "r.(?)" "p.(=)" "7"
"0000868930" "00008369" "30" "2710" "0" "2710" "0" "c.*1381A>G" "r.(?)" "p.(=)" "7"
"0000868931" "00008369" "50" "2850" "0" "2850" "0" "c.*1521C>G" "r.(?)" "p.(=)" "7"
"0000868932" "00008369" "50" "1129" "0" "1129" "0" "c.1129A>G" "r.(?)" "p.(Ser377Gly)" "6"
"0000868933" "00008369" "50" "1683" "0" "1683" "0" "c.*354A>C" "r.(?)" "p.(=)" "7"
"0000868934" "00008369" "50" "2110" "0" "2110" "0" "c.*781C>G" "r.(?)" "p.(=)" "7"
"0000868935" "00008369" "30" "2181" "0" "2181" "0" "c.*852G>A" "r.(?)" "p.(=)" "7"
"0000868936" "00008369" "50" "2487" "0" "2487" "0" "c.*1158C>T" "r.(?)" "p.(=)" "7"
"0000868937" "00008369" "50" "2585" "0" "2585" "0" "c.*1256A>T" "r.(?)" "p.(=)" "7"
"0000868938" "00008369" "50" "2850" "0" "2850" "0" "c.*1521C>G" "r.(?)" "p.(=)" "7"
"0000888127" "00008369" "30" "13" "0" "13" "0" "c.13T>C" "r.(?)" "p.(Leu5=)" ""
"0000888128" "00008369" "30" "732" "0" "732" "0" "c.732C>T" "r.(?)" "p.(Tyr244=)" ""
"0000888129" "00008369" "30" "783" "8" "783" "8" "c.783+8C>T" "r.(=)" "p.(=)" ""
"0000888130" "00008369" "50" "787" "0" "787" "0" "c.787G>T" "r.(?)" "p.(Ala263Ser)" ""
"0000888131" "00008369" "30" "939" "0" "939" "0" "c.939G>T" "r.(?)" "p.(Glu313Asp)" ""
"0000888132" "00008369" "10" "1113" "0" "1113" "0" "c.1113A>G" "r.(?)" "p.(Ser371=)" ""
"0000888133" "00008369" "30" "1221" "0" "1221" "0" "c.1221A>C" "r.(?)" "p.(Pro407=)" ""
"0000912870" "00008369" "30" "330" "0" "330" "0" "c.330C>T" "r.(?)" "p.(Phe110=)" ""
"0000912871" "00008369" "50" "857" "0" "857" "0" "c.857C>T" "r.(?)" "p.(Ala286Val)" ""
"0000924816" "00008369" "30" "1149" "0" "1149" "0" "c.1149G>A" "r.(?)" "p.(Thr383=)" ""
"0000929410" "00008369" "30" "858" "0" "858" "0" "c.858G>A" "r.(?)" "p.(Ala286=)" ""
"0000929411" "00008369" "10" "1180" "0" "1180" "0" "c.1180C>A" "r.(?)" "p.(Pro394Thr)" ""
"0000932923" "00008369" "90" "708" "0" "708" "0" "c.708T>G" "r.(708u>g)" "p.(Tyr236*)" ""
"0000949004" "00008369" "30" "588" "0" "588" "0" "c.588C>T" "r.(?)" "p.(=)" ""
"0000949005" "00008369" "30" "609" "0" "609" "0" "c.609C>T" "r.(?)" "p.(Pro203=)" ""
"0000949006" "00008369" "30" "616" "15" "616" "15" "c.616+15G>A" "r.(=)" "p.(=)" ""
"0000949007" "00008369" "30" "675" "0" "675" "0" "c.675C>T" "r.(?)" "p.(=)" ""
"0000949008" "00008369" "50" "932" "0" "932" "0" "c.932G>A" "r.(?)" "p.(Arg311Gln)" ""
"0000949009" "00008369" "50" "973" "0" "973" "0" "c.973C>G" "r.(?)" "p.(Leu325Val)" ""
"0000949010" "00008369" "30" "1326" "0" "1326" "0" "c.1326G>A" "r.(?)" "p.(=)" ""
"0000957730" "00008369" "70" "957" "0" "957" "0" "c.957A>T" "r.(?)" "p.(Lys319Asn)" ""
"0000957786" "00008369" "70" "1078" "0" "1078" "0" "c.1078G>C" "r.(?)" "p.(Glu360Gln)" ""
"0000957907" "00008369" "70" "1220" "0" "1220" "0" "c.1220C>G" "r.(?)" "p.(Pro407Arg)" ""
"0000964789" "00008369" "50" "55" "0" "55" "0" "c.55G>A" "r.(?)" "p.(Glu19Lys)" ""
"0000964790" "00008369" "10" "997" "200" "997" "200" "c.997+200G>A" "r.(=)" "p.(=)" ""
"0000964791" "00008369" "10" "1138" "0" "1138" "0" "c.1138G>A" "r.(?)" "p.(Val380Met)" ""
"0000964792" "00008369" "10" "1146" "129" "1146" "129" "c.1146+129C>T" "r.(=)" "p.(=)" ""
"0000964793" "00008369" "10" "1146" "177" "1146" "177" "c.1146+177C>T" "r.(=)" "p.(=)" ""
"0000964794" "00008369" "10" "1147" "-107" "1147" "-107" "c.1147-107A>G" "r.(=)" "p.(=)" ""
"0000964795" "00008369" "50" "1220" "0" "1220" "0" "c.1220C>G" "r.(?)" "p.(Pro407Arg)" ""
"0000964796" "00008369" "10" "2585" "0" "2585" "0" "c.*1256A>T" "r.(=)" "p.(=)" ""
"0000977994" "00008369" "50" "376" "0" "376" "0" "c.376G>A" "r.(?)" "p.(Ala126Thr)" ""
"0000977995" "00008369" "30" "405" "0" "405" "0" "c.405C>G" "r.(?)" "p.(=)" ""
"0000977996" "00008369" "30" "627" "0" "627" "0" "c.627C>T" "r.(?)" "p.(Asp209=)" ""
"0000977997" "00008369" "50" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Pro257Ser)" ""
"0000977998" "00008369" "50" "1057" "0" "1057" "0" "c.1057G>A" "r.(?)" "p.(Ala353Thr)" ""
"0000977999" "00008369" "30" "1122" "0" "1122" "0" "c.1122C>T" "r.(?)" "p.(=)" ""
"0000978000" "00008369" "10" "1147" "-107" "1147" "-107" "c.1147-107A>G" "r.(=)" "p.(=)" ""
"0000996884" "00008369" "30" "348" "0" "348" "0" "c.348C>T" "r.(?)" "p.(Ser116=)" ""
"0000996885" "00008369" "50" "481" "0" "481" "0" "c.481C>A" "r.(?)" "p.(Pro161Thr)" ""
"0000996886" "00008369" "30" "499" "0" "499" "0" "c.499G>A" "r.(?)" "p.(Ala167Thr)" ""
"0000996887" "00008369" "50" "505" "0" "505" "0" "c.505G>A" "r.(?)" "p.(Val169Met)" ""
"0000996888" "00008369" "50" "530" "0" "530" "0" "c.530C>T" "r.(?)" "p.(Ala177Val)" ""
"0000996889" "00008369" "30" "786" "0" "786" "0" "c.786C>T" "r.(?)" "p.(=)" ""
"0000996890" "00008369" "50" "867" "0" "867" "0" "c.867G>C" "r.(?)" "p.(Glu289Asp)" ""
"0000996891" "00008369" "30" "939" "0" "939" "0" "c.939G>T" "r.(?)" "p.(Glu313Asp)" ""
"0000996892" "00008369" "30" "997" "254" "997" "254" "c.997+254T>G" "r.(=)" "p.(=)" ""
"0000996893" "00008369" "50" "1118" "0" "1118" "0" "c.1118A>G" "r.(?)" "p.(His373Arg)" ""
"0000996894" "00008369" "50" "1146" "15" "1146" "15" "c.1146+15T>A" "r.(=)" "p.(=)" ""
"0001025477" "00008369" "10" "909" "25" "909" "25" "c.909+25G>A" "r.(=)" "p.(=)" ""
"0001025478" "00008369" "30" "2497" "0" "2497" "0" "c.*1168T>C" "r.(=)" "p.(=)" ""
"0001036700" "00008369" "50" "-30237" "0" "-30237" "0" "c.-30237A>G" "r.(?)" "p.(=)" ""
"0001036701" "00008369" "50" "616" "2765" "616" "2765" "c.616+2765C>A" "r.(=)" "p.(=)" ""
"0001036702" "00008369" "30" "799" "0" "799" "0" "c.799G>A" "r.(?)" "p.(Val267Met)" ""
"0001036703" "00008369" "30" "1037" "0" "1037" "0" "c.1037C>T" "r.(?)" "p.(Ala346Val)" ""
"0001052939" "00008369" "50" "431" "0" "431" "0" "c.431C>T" "r.(?)" "p.(Ala144Val)" ""
"0001052940" "00008369" "50" "488" "0" "488" "0" "c.488C>G" "r.(?)" "p.(Pro163Arg)" ""
"0001052941" "00008369" "50" "611" "0" "611" "0" "c.611A>T" "r.(?)" "p.(Asn204Ile)" ""
"0001052942" "00008369" "10" "997" "200" "997" "200" "c.997+200G>A" "r.(=)" "p.(=)" ""
"0001052943" "00008369" "10" "1146" "177" "1146" "177" "c.1146+177C>T" "r.(=)" "p.(=)" ""
"0001052944" "00008369" "30" "1325" "0" "1325" "0" "c.1325C>T" "r.(?)" "p.(Ala442Val)" ""
"0001064885" "00008369" "50" "223" "0" "223" "0" "c.223G>C" "r.(?)" "p.(Ala75Pro)" ""
"0001064886" "00008369" "50" "366" "0" "368" "0" "c.366_368dup" "r.(?)" "p.(Ala126dup)" ""
"0001064887" "00008369" "30" "585" "0" "585" "0" "c.585G>C" "r.(?)" "p.(=)" ""
"0001064888" "00008369" "30" "609" "0" "609" "0" "c.609C>T" "r.(?)" "p.(Pro203=)" ""
"0001064889" "00008369" "50" "758" "0" "758" "0" "c.758C>T" "r.(?)" "p.(Pro253Leu)" ""
"0001064890" "00008369" "30" "783" "16" "783" "16" "c.783+16G>A" "r.(=)" "p.(=)" ""
"0001064891" "00008369" "50" "793" "0" "793" "0" "c.793C>T" "r.(?)" "p.(Arg265Cys)" ""
"0001064892" "00008369" "30" "973" "0" "973" "0" "c.973C>G" "r.(?)" "p.(Leu325Val)" ""
"0001064893" "00008369" "50" "2497" "0" "2497" "0" "c.*1168T>C" "r.(=)" "p.(=)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 46
"{{screeningid}}" "{{variantid}}"
"0000029071" "0000052423"
"0000223860" "0000455514"
"0000223861" "0000455515"
"0000223862" "0000455516"
"0000232539" "0000474987"
"0000232581" "0000474988"
"0000232591" "0000474989"
"0000232620" "0000474990"
"0000232633" "0000474991"
"0000232658" "0000474992"
"0000295724" "0000652413"
"0000295725" "0000652414"
"0000295726" "0000652415"
"0000306308" "0000669996"
"0000411540" "0000868693"
"0000411699" "0000868912"
"0000411700" "0000868913"
"0000411701" "0000868914"
"0000411702" "0000868915"
"0000411703" "0000868916"
"0000411704" "0000868917"
"0000411705" "0000868918"
"0000411706" "0000868919"
"0000411707" "0000868920"
"0000411708" "0000868921"
"0000411709" "0000868922"
"0000411710" "0000868923"
"0000411711" "0000868924"
"0000411712" "0000868925"
"0000411713" "0000868926"
"0000411714" "0000868927"
"0000411715" "0000868928"
"0000411716" "0000868929"
"0000411717" "0000868930"
"0000411718" "0000868931"
"0000411719" "0000868932"
"0000411720" "0000868933"
"0000411721" "0000868934"
"0000411722" "0000868935"
"0000411723" "0000868936"
"0000411724" "0000868937"
"0000411725" "0000868938"
"0000437610" "0000932923"
"0000448323" "0000957730"
"0000448365" "0000957907"
"0000448379" "0000957786"