### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = GDF5) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "GDF5" "growth differentiation factor 5" "20" "q11.2" "unknown" "NG_008076.3" "UD_132085337945" "" "http://www.LOVD.nl/GDF5" "" "1" "4220" "8200" "601146" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "" "" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2021-12-16 18:33:21" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00008433" "GDF5" "growth differentiation factor 5" "001" "NM_000557.2" "" "NP_000548.1" "" "" "" "-319" "2064" "1506" "34026027" "34021149" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 13 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00184" "BDA2" "brachydactyly, type A2 (BD-A2)" "AD" "112600" "" "" "" "00006" "2013-09-02 22:18:15" "00006" "2021-12-10 21:51:32" "00191" "AMD2A" "dysplasia, acromesomelic, type 2A, Grebe" "AR" "200700" "" "" "" "00006" "2013-09-08 14:51:28" "00006" "2021-12-16 17:35:12" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00729" "SYM" "symphalangism, proximal (SYM)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-11-04 08:50:08" "01032" "AMD2C" "dysplasia, acromesomelic, type 2C, Hunter-Thompson" "AR" "201250" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-16 17:36:32" "01033" "BDC" "brachydactyly, type C (BD-C)" "AD" "113100" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01034" "AMD2B" "dysplasia, acromesomelic, type 2B, Du Pan syndrome" "AR" "228900" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-16 18:29:59" "01035" "SYNS2" "synostoses syndrome, multiple, type 2 (SYNS-2)" "AD" "610017" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01036" "OS5" "sosteoarthritis, susceptibility 5 (OS-5)" "" "612400" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01211" "BDA1" "brachydactyly, type A1 (BDA1)" "AD" "112500" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-04-03 12:20:16" "03821" "BDA1C" "brachydactyly, type A1, C (BD-A1C)" "AR" "615072" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03892" "SYM1B" "symphalangism, proximal, type 1B (SYM1B)" "AD" "615298" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-11-04 08:52:28" "06885" "AMD" "dysplasia, acromesomelic" "" "" "" "" "" "00006" "2021-12-16 18:32:07" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 11 "{{geneid}}" "{{diseaseid}}" "GDF5" "00184" "GDF5" "00191" "GDF5" "00729" "GDF5" "01032" "GDF5" "01033" "GDF5" "01034" "GDF5" "01035" "GDF5" "01036" "GDF5" "03821" "GDF5" "03892" "GDF5" "06885" ## Individuals ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00204283" "" "" "" "1" "" "00019" "" "mild Grebe type chondrodysplasia" "" "" "Pakistan" "" "0" "" "" "" "" "00265899" "" "" "" "1" "" "01741" "" "" "" "" "" "" "0" "" "" "" "" "00292922" "" "" "" "72" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00375525" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" "00377091" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 6 "{{individualid}}" "{{diseaseid}}" "00204283" "01033" "00265899" "01033" "00292922" "00198" "00375525" "01035" "00377091" "01033" "00377091" "01211" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00184, 00191, 00198, 00729, 01032, 01033, 01034, 01035, 01036, 01211, 03821, 03892, 06885 ## Count = 1 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000152787" "01033" "00204283" "00019" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000205312" "00204283" "1" "00019" "00019" "2012-10-14 07:42:47" "00006" "2012-10-23 22:39:27" "SEQ" "DNA" "" "" "0000267019" "00265899" "1" "01741" "01741" "2019-10-11 10:54:25" "" "" "SEQ" "DNA" "" "" "0000294090" "00292922" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000376722" "00375525" "1" "01741" "01741" "2021-06-09 10:46:10" "" "" "SEQ" "DNA" "" "" "0000378295" "00377091" "1" "01741" "01741" "2021-07-01 12:56:50" "" "" "SEQ" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 4 "{{screeningid}}" "{{geneid}}" "0000205312" "GDF5" "0000267019" "GDF5" "0000376722" "GDF5" "0000378295" "GDF5" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 50 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000248006" "0" "10" "20" "34022387" "34022387" "subst" "0.352852" "02325" "GDF5_000006" "g.34022387A>C" "" "" "" "GDF5(NM_000557.4):c.826T>G (p.S276A), GDF5(NM_000557.5):c.826T>G (p.S276A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434589=" "" "benign" "" "0000253267" "0" "10" "20" "34022387" "34022387" "subst" "0.352852" "01943" "GDF5_000006" "g.34022387A>C" "" "" "" "GDF5(NM_000557.4):c.826T>G (p.S276A), GDF5(NM_000557.5):c.826T>G (p.S276A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434589=" "" "benign" "" "0000255519" "0" "90" "20" "34025182" "34025182" "subst" "0" "01943" "GDF5_000001" "g.34025182A>G" "" "" "" "GDF5(NM_000557.4):c.527T>C (p.L176P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35437402A>G" "" "pathogenic" "" "0000256248" "0" "50" "20" "34022185" "34022185" "subst" "0" "01943" "GDF5_000003" "g.34022185A>G" "" "" "" "GDF5(NM_000557.4):c.1028T>C (p.L343P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434387A>G" "" "VUS" "" "0000288275" "0" "10" "20" "34022196" "34022196" "subst" "0.0934341" "01943" "GDF5_000004" "g.34022196C>T" "" "" "" "GDF5(NM_000557.4):c.1017G>A (p.K339=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434398=" "" "benign" "" "0000288276" "0" "50" "20" "34021879" "34021879" "subst" "0" "01943" "GDF5_000002" "g.34021879T>C" "" "" "" "GDF5(NM_000557.4):c.1334A>G (p.N445S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434081T>C" "" "VUS" "" "0000288278" "0" "90" "20" "34025267" "34025267" "subst" "0" "01943" "GDF5_000011" "g.34025267T>A" "" "" "" "GDF5(NM_000557.4):c.442A>T (p.K148*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35437487T>A" "" "pathogenic" "" "0000288280" "0" "90" "20" "34025216" "34025216" "del" "0" "01943" "GDF5_000009" "g.34025216del" "" "" "" "GDF5(NM_000557.4):c.498delC (p.I167Sfs*26)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35437436del" "" "pathogenic" "" "0000288281" "0" "90" "20" "34022501" "34022501" "subst" "0" "01943" "GDF5_000007" "g.34022501C>A" "" "" "" "GDF5(NM_000557.4):c.712G>T (p.E238*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434703C>A" "" "pathogenic" "" "0000288282" "0" "90" "20" "34022312" "34022312" "subst" "0" "01943" "GDF5_000005" "g.34022312G>A" "" "" "" "GDF5(NM_000557.4):c.901C>T (p.R301*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434514G>A" "" "pathogenic" "" "0000337820" "0" "10" "20" "34025756" "34025756" "subst" "0.455423" "02327" "GDF5_000013" "g.34025756A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35437976=" "" "benign" "" "0000337821" "0" "10" "20" "34025983" "34025983" "subst" "0" "02327" "GDF5_000014" "g.34025983A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35438203=" "" "benign" "" "0000339900" "0" "10" "20" "34022196" "34022196" "subst" "0.0934341" "02327" "GDF5_000004" "g.34022196C>T" "" "" "" "GDF5(NM_000557.4):c.1017G>A (p.K339=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434398=" "" "benign" "" "0000348897" "0" "10" "20" "34022387" "34022387" "subst" "0.352852" "02327" "GDF5_000006" "g.34022387A>C" "" "" "" "GDF5(NM_000557.4):c.826T>G (p.S276A), GDF5(NM_000557.5):c.826T>G (p.S276A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.35434589=" "" "benign" "" "0000426648" "0" "95" "20" "34025182" "34025182" "subst" "0" "00019" "GDF5_000001" "g.34025182A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.35437402A>G" "" "pathogenic" "" "0000569480" "0" "50" "20" "34022145" "34022145" "subst" "4.09628E-6" "02327" "GDF5_000016" "g.34022145A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35434347A>T" "" "VUS" "" "0000569481" "0" "90" "20" "34025249" "34025249" "dup" "0" "01943" "GDF5_000017" "g.34025249dup" "" "" "" "GDF5(NM_000557.4):c.464dupC (p.R156Tfs*29)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35437469dup" "" "pathogenic" "" "0000569482" "0" "30" "20" "34025402" "34025402" "subst" "2.0314E-5" "01804" "GDF5_000018" "g.34025402C>T" "" "" "" "GDF5(NM_000557.2):c.307G>A (p.(Gly103Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35437622C>T" "" "likely benign" "" "0000569483" "0" "90" "20" "34025558" "34025558" "dup" "0" "01943" "GDF5_000019" "g.34025558dup" "" "" "" "GDF5(NM_000557.4):c.157dupC (p.L53Pfs*41)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35437778dup" "" "pathogenic" "" "0000597867" "0" "90" "20" "34022221" "34022221" "del" "0" "01741" "GDF5_000021" "g.34022221del" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.35434423del" "" "pathogenic" "" "0000618106" "0" "50" "20" "34021820" "34021820" "subst" "0" "01804" "GDF5_000022" "g.34021820A>G" "" "" "" "GDF5(NM_000557.2):c.1393T>C (p.(Cys465Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35434022A>G" "" "VUS" "" "0000618107" "0" "90" "20" "34022084" "34022084" "subst" "0" "01804" "GDF5_000023" "g.34022084G>A" "" "" "" "GDF5(NM_000557.2):c.1129C>T (p.(Arg377Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35434286G>A" "" "pathogenic" "" "0000618108" "0" "30" "20" "34025407" "34025407" "subst" "6.09434E-5" "01804" "GDF5_000024" "g.34025407G>A" "" "" "" "GDF5(NM_000557.2):c.302C>T (p.(Pro101Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.35437627G>A" "" "likely benign" "" "0000650779" "1" "30" "20" "34025843" "34025843" "subst" "0" "03575" "GDF5_000025" "g.34025843C>T" "72/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "72 heterozygous, no homozygous; {DB:CLININrs73094730}" "Germline" "" "rs73094730" "0" "" "" "g.35438063C>T" "" "likely benign" "" "0000681600" "0" "90" "20" "34025175" "34025194" "dup" "0" "01943" "GDF5_000026" "g.34025175_34025194dup" "" "" "" "GDF5(NM_000557.4):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20), GDF5(NM_000557.5):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000788731" "0" "70" "20" "34021878" "34021878" "subst" "0" "01741" "GDF5_000027" "g.34021878A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "" "" "likely pathogenic" "" "0000791008" "0" "50" "20" "34021927" "34021927" "subst" "0" "01741" "GDF5_000028" "g.34021927C>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "" "0000809222" "0" "90" "20" "34025551" "34025551" "del" "0" "02325" "GDF5_000029" "g.34025551del" "" "" "" "GDF5(NM_000557.5):c.158delT (p.L53Rfs*34)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000866438" "0" "50" "20" "34022104" "34022104" "subst" "4.06947E-6" "01804" "GDF5_000030" "g.34022104T>C" "" "" "" "GDF5(NM_000557.2):c.1109A>G (p.(Tyr370Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866439" "0" "30" "20" "34022234" "34022234" "subst" "0.000696208" "01804" "GDF5_000031" "g.34022234G>C" "" "" "" "GDF5(NM_000557.2):c.979C>G (p.(Leu327Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866440" "0" "90" "20" "34022437" "34022437" "del" "0" "02327" "GDF5_000032" "g.34022437del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000866441" "0" "30" "20" "34025321" "34025321" "subst" "0.0006427" "01943" "GDF5_000033" "g.34025321C>T" "" "" "" "GDF5(NM_000557.2):c.388G>A (p.(Gly130Arg)), GDF5(NM_001319138.1):c.388G>A (p.G130R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866442" "0" "30" "20" "34025321" "34025321" "subst" "0.0006427" "01804" "GDF5_000033" "g.34025321C>T" "" "" "" "GDF5(NM_000557.2):c.388G>A (p.(Gly130Arg)), GDF5(NM_001319138.1):c.388G>A (p.G130R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895285" "0" "50" "20" "34022221" "34022221" "subst" "0" "01804" "GDF5_000034" "g.34022221C>T" "" "" "" "GDF5(NM_000557.2):c.992G>A (p.(Arg331His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895286" "0" "30" "20" "34025212" "34025212" "subst" "0.00734236" "01804" "GDF5_000035" "g.34025212G>T" "" "" "" "GDF5(NM_000557.2):c.497C>A (p.(Pro166His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895287" "0" "50" "20" "34025351" "34025351" "subst" "8.12955E-6" "01804" "GDF5_000036" "g.34025351G>A" "" "" "" "GDF5(NM_000557.2):c.358C>T (p.(Arg120Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000926991" "0" "70" "20" "34025551" "34025551" "del" "0" "02327" "GDF5_000029" "g.34025551del" "" "" "" "GDF5(NM_000557.5):c.158delT (p.L53Rfs*34)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000951428" "0" "90" "20" "34025175" "34025194" "dup" "0" "02325" "GDF5_000026" "g.34025175_34025194dup" "" "" "" "GDF5(NM_000557.4):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20), GDF5(NM_000557.5):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001005353" "0" "50" "20" "34021723" "34021723" "subst" "0" "01804" "GDF5_000037" "g.34021723G>A" "" "" "" "GDF5(NM_000557.2):c.1490C>T (p.(Ser497Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005354" "0" "70" "20" "34022105" "34022106" "ins" "0" "01804" "GDF5_000038" "g.34022105_34022106insT" "" "" "" "GDF5(NM_000557.2):c.1107_1108insA (p.(Tyr370fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005355" "0" "70" "20" "34022107" "34022109" "del" "0" "01804" "GDF5_000039" "g.34022107_34022109del" "" "" "" "GDF5(NM_000557.2):c.1104_1106delCGT (p.(Val369del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001043323" "0" "50" "20" "34021946" "34021946" "subst" "0" "01804" "GDF5_000040" "g.34021946C>G" "" "" "" "GDF5(NM_000557.5):c.1267G>C (p.(Glu423Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043324" "0" "50" "20" "34022004" "34022004" "subst" "3.24881E-5" "01804" "GDF5_000041" "g.34022004C>A" "" "" "" "GDF5(NM_000557.5):c.1209G>T (p.(Lys403Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043325" "0" "50" "20" "34022330" "34022330" "subst" "8.63871E-6" "01804" "GDF5_000042" "g.34022330C>T" "" "" "" "GDF5(NM_000557.5):c.883G>A (p.(Asp295Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043326" "0" "50" "20" "34022546" "34022546" "subst" "4.1085E-6" "01804" "GDF5_000043" "g.34022546C>G" "" "" "" "GDF5(NM_000557.5):c.667G>C (p.(Val223Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056883" "0" "50" "20" "34021940" "34021940" "subst" "8.12183E-6" "01804" "GDF5_000044" "g.34021940C>T" "" "" "" "GDF5(NM_000557.5):c.1273G>A (p.(Glu425Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056884" "0" "50" "20" "34021955" "34021955" "subst" "0" "01804" "GDF5_000045" "g.34021955C>T" "" "" "" "GDF5(NM_000557.5):c.1258G>A (p.(Ala420Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056885" "0" "50" "20" "34022324" "34022324" "subst" "8.52624E-6" "01804" "GDF5_000046" "g.34022324A>G" "" "" "" "GDF5(NM_000557.5):c.889T>C (p.(Trp297Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056886" "0" "50" "20" "34022392" "34022392" "subst" "1.33882E-5" "01804" "GDF5_000047" "g.34022392G>A" "" "" "" "GDF5(NM_000557.5):c.821C>T (p.(Pro274Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067319" "0" "50" "20" "34025965" "34025965" "subst" "0" "02325" "GDF5_000048" "g.34025965T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes GDF5 ## Count = 50 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000248006" "00008433" "10" "826" "0" "826" "0" "c.826T>G" "r.(?)" "p.(Ser276Ala)" "" "0000253267" "00008433" "10" "826" "0" "826" "0" "c.826T>G" "r.(?)" "p.(Ser276Ala)" "" "0000255519" "00008433" "90" "527" "0" "527" "0" "c.527T>C" "r.(?)" "p.(Leu176Pro)" "" "0000256248" "00008433" "50" "1028" "0" "1028" "0" "c.1028T>C" "r.(?)" "p.(Leu343Pro)" "" "0000288275" "00008433" "10" "1017" "0" "1017" "0" "c.1017G>A" "r.(?)" "p.(Lys339=)" "" "0000288276" "00008433" "50" "1334" "0" "1334" "0" "c.1334A>G" "r.(?)" "p.(Asn445Ser)" "" "0000288278" "00008433" "90" "442" "0" "442" "0" "c.442A>T" "r.(?)" "p.(Lys148Ter)" "" "0000288280" "00008433" "90" "498" "0" "498" "0" "c.498del" "r.(?)" "p.(Ile167SerfsTer26)" "" "0000288281" "00008433" "90" "712" "0" "712" "0" "c.712G>T" "r.(?)" "p.(Glu238Ter)" "" "0000288282" "00008433" "90" "901" "0" "901" "0" "c.901C>T" "r.(?)" "p.(Arg301Ter)" "" "0000337820" "00008433" "10" "-48" "0" "-48" "0" "c.-48T>C" "r.(?)" "p.(=)" "" "0000337821" "00008433" "10" "-275" "0" "-275" "0" "c.-275T>C" "r.(?)" "p.(=)" "" "0000339900" "00008433" "10" "1017" "0" "1017" "0" "c.1017G>A" "r.(?)" "p.(Lys339=)" "" "0000348897" "00008433" "10" "826" "0" "826" "0" "c.826T>G" "r.(?)" "p.(Ser276Ala)" "" "0000426648" "00008433" "95" "527" "0" "527" "0" "c.527T>C" "r.(?)" "p.(Leu176Pro)" "1" "0000569480" "00008433" "50" "1068" "0" "1068" "0" "c.1068T>A" "r.(?)" "p.(Asn356Lys)" "" "0000569481" "00008433" "90" "464" "0" "464" "0" "c.464dup" "r.(?)" "p.(Arg156ThrfsTer29)" "" "0000569482" "00008433" "30" "307" "0" "307" "0" "c.307G>A" "r.(?)" "p.(Gly103Ser)" "" "0000569483" "00008433" "90" "157" "0" "157" "0" "c.157dup" "r.(?)" "p.(Leu53ProfsTer41)" "" "0000597867" "00008433" "90" "992" "0" "992" "0" "c.992del" "r.(?)" "p.(Arg331Profs*122)" "" "0000618106" "00008433" "50" "1393" "0" "1393" "0" "c.1393T>C" "r.(?)" "p.(Cys465Arg)" "" "0000618107" "00008433" "90" "1129" "0" "1129" "0" "c.1129C>T" "r.(?)" "p.(Arg377Trp)" "" "0000618108" "00008433" "30" "302" "0" "302" "0" "c.302C>T" "r.(?)" "p.(Pro101Leu)" "" "0000650779" "00008433" "30" "-135" "0" "-135" "0" "c.-135G>A" "r.(=)" "p.(=)" "" "0000681600" "00008433" "90" "517" "0" "536" "0" "c.517_536dup" "r.(?)" "p.(Leu180CysfsTer20)" "" "0000788731" "00008433" "70" "1335" "0" "1335" "0" "c.1335T>A" "r.(?)" "p.(Asn445Lys)" "" "0000791008" "00008433" "50" "1286" "0" "1286" "0" "c.1286G>A" "r.(?)" "p.(Cys429Tyr)" "" "0000809222" "00008433" "90" "158" "0" "158" "0" "c.158del" "r.(?)" "p.(Leu53Argfs*34)" "" "0000866438" "00008433" "50" "1109" "0" "1109" "0" "c.1109A>G" "r.(?)" "p.(Tyr370Cys)" "" "0000866439" "00008433" "30" "979" "0" "979" "0" "c.979C>G" "r.(?)" "p.(Leu327Val)" "" "0000866440" "00008433" "90" "778" "0" "778" "0" "c.778del" "r.(?)" "p.(Ala260Leufs*4)" "" "0000866441" "00008433" "30" "388" "0" "388" "0" "c.388G>A" "r.(?)" "p.(Gly130Arg)" "" "0000866442" "00008433" "30" "388" "0" "388" "0" "c.388G>A" "r.(?)" "p.(Gly130Arg)" "" "0000895285" "00008433" "50" "992" "0" "992" "0" "c.992G>A" "r.(?)" "p.(Arg331His)" "" "0000895286" "00008433" "30" "497" "0" "497" "0" "c.497C>A" "r.(?)" "p.(Pro166His)" "" "0000895287" "00008433" "50" "358" "0" "358" "0" "c.358C>T" "r.(?)" "p.(Arg120Trp)" "" "0000926991" "00008433" "70" "158" "0" "158" "0" "c.158del" "r.(?)" "p.(Leu53Argfs*34)" "" "0000951428" "00008433" "90" "517" "0" "536" "0" "c.517_536dup" "r.(?)" "p.(Leu180CysfsTer20)" "" "0001005353" "00008433" "50" "1490" "0" "1490" "0" "c.1490C>T" "r.(?)" "p.(Ser497Leu)" "" "0001005354" "00008433" "70" "1107" "0" "1108" "0" "c.1107_1108insA" "r.(?)" "p.(Tyr370Ilefs*2)" "" "0001005355" "00008433" "70" "1104" "0" "1106" "0" "c.1104_1106del" "r.(?)" "p.(Val369del)" "" "0001043323" "00008433" "50" "1267" "0" "1267" "0" "c.1267G>C" "r.(?)" "p.(Glu423Gln)" "" "0001043324" "00008433" "50" "1209" "0" "1209" "0" "c.1209G>T" "r.(?)" "p.(Lys403Asn)" "" "0001043325" "00008433" "50" "883" "0" "883" "0" "c.883G>A" "r.(?)" "p.(Asp295Asn)" "" "0001043326" "00008433" "50" "667" "0" "667" "0" "c.667G>C" "r.(?)" "p.(Val223Leu)" "" "0001056883" "00008433" "50" "1273" "0" "1273" "0" "c.1273G>A" "r.(?)" "p.(Glu425Lys)" "" "0001056884" "00008433" "50" "1258" "0" "1258" "0" "c.1258G>A" "r.(?)" "p.(Ala420Thr)" "" "0001056885" "00008433" "50" "889" "0" "889" "0" "c.889T>C" "r.(?)" "p.(Trp297Arg)" "" "0001056886" "00008433" "50" "821" "0" "821" "0" "c.821C>T" "r.(?)" "p.(Pro274Leu)" "" "0001067319" "00008433" "50" "-257" "0" "-257" "0" "c.-257A>G" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 5 "{{screeningid}}" "{{variantid}}" "0000205312" "0000426648" "0000267019" "0000597867" "0000294090" "0000650779" "0000376722" "0000788731" "0000378295" "0000791008"