### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = GINS1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "GINS1" "GINS complex subunit 1 (Psf1 homolog)" "20" "p11.21" "unknown" "NC_000020.10" "UD_132462842089" "" "https://www.LOVD.nl/GINS1" "" "1" "28980" "9837" "610608" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "" "" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2018-01-26 15:21:57" "00000" "2025-05-05 21:14:00" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00008518" "GINS1" "GINS complex subunit 1 (Psf1 homolog)" "001" "NM_021067.3" "" "NP_066545.3" "" "" "" "-134" "3155" "591" "25388323" "25429191" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00168" "PHARC" "polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, cataract (PHARC)" "AR" "612674" "" "" "" "00006" "2013-07-29 22:25:56" "00006" "2021-12-10 21:51:32" "05793" "IMD74" "immunodeficiency, type 74, COVID19-related, X-linked" "XLR" "301051" "" "" "" "00006" "2020-07-24 22:16:50" "00006" "2025-08-26 15:50:59" "06514" "IMD55" "Immunodeficiency 55" "AR" "617827" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "GINS1" "06514" ## Individuals ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00001632" "" "" "" "1" "" "00101" "{PMID:Chen 2013:24027063}" "3-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "United States" "" "0" "" "" "Germany;British" "24027063-FamPatIII1" "00334321" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" "00334325" "" "" "" "1" "" "04011" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "analysis 233 patients" "" "" "China" "" "" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{individualid}}" "{{diseaseid}}" "00001632" "00168" "00334321" "05793" "00334325" "05793" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00168, 05793, 06514 ## Count = 3 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Hearing/Problems}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000124194" "00168" "00001632" "00006" "Familial, autosomal recessive" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "0000253131" "05793" "00334321" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" "0000253135" "05793" "00334325" "04011" "Unknown" "" "hospitalized after COVID-19 infection," "" "" "" "" "" "" "" "" "" "COVID-19" ## Screenings ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000001442" "00001632" "1" "00101" "00101" "2013-08-01 12:44:41" "" "" "arrayCGH;arrayCNV;PCR;PCRlr;PCRq;RT-PCR;SEQ;TaqMan;Western" "DNA;RNA" "" "" "0000335549" "00334321" "1" "04011" "04011" "2021-02-27 14:15:38" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" "0000335553" "00334325" "1" "04011" "04011" "2021-02-27 14:33:44" "00006" "2021-03-05 11:31:40" "SEQ-NG" "DNA" "PBMC" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 1 "{{screeningid}}" "{{geneid}}" "0000001442" "ABHD12" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 9 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000019239" "21" "90" "20" "25340671" "25399883" "del" "0" "00101" "ABHD12_000005" "g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC]" "" "{PMID:Chen 2013:24027063}" "" "1-192_oGINS1:c.327+1052del" "59 kb deletion" "Germline" "yes" "" "0" "" "" "g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC]" "" "pathogenic" "" "0000328330" "0" "50" "20" "25426586" "25426586" "subst" "0" "01804" "GINS1_000001" "g.25426586C>T" "" "" "" "GINS1(NM_021067.3):c.550C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.25445950C>T" "" "VUS" "" "0000569280" "0" "70" "20" "25394425" "25394425" "subst" "0" "01943" "GINS1_000002" "g.25394425G>A" "" "" "" "GINS1(NM_021067.5):c.76-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25413789G>A" "" "likely pathogenic" "" "0000624135" "0" "30" "20" "25388481" "25388481" "subst" "2.85023E-5" "02326" "GINS1_000003" "g.25388481C>T" "" "" "" "GINS1(NM_021067.5):c.25C>T (p.L9=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25407845C>T" "" "likely benign" "" "0000658733" "0" "70" "20" "25398748" "25398748" "subst" "0.000926009" "01943" "GINS1_000004" "g.25398748C>T" "" "" "" "GINS1(NM_021067.5):c.247C>T (p.R83C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.25418112C>T" "" "likely pathogenic" "" "0000734058" "0" "70" "20" "25397817" "25397817" "subst" "0.000102244" "04011" "GINS1_000005" "g.25397817G>A" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000734074" "0" "70" "20" "25398766" "25398766" "subst" "2.43663E-5" "04011" "GINS1_000006" "g.25398766G>C" "" "{PMID:Luo 2021:33867526}, {DOI:Luo 2021:10.1038/s41431-021-00886-x}" "" "" "" "Germline" "" "" "" "" "" "" "" "VUS" "" "0000926978" "0" "70" "20" "25398748" "25398748" "subst" "0.000926009" "02326" "GINS1_000004" "g.25398748C>T" "" "" "" "GINS1(NM_021067.5):c.247C>T (p.R83C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001043289" "0" "50" "20" "25397816" "25397816" "subst" "0" "01804" "GINS1_000007" "g.25397816C>A" "" "" "" "GINS1(NM_021067.5):c.217C>A (p.(Arg73=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes GINS1 ## Count = 9 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000019239" "00008518" "90" "-47786" "0" "330" "1052" "c.-47786_330+1052delins[75+2104_75+2166;GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT]" "r.0?" "p.0?" "_1_4i" "0000328330" "00008518" "50" "550" "0" "550" "0" "c.550C>T" "r.(?)" "p.(Gln184Ter)" "" "0000569280" "00008518" "70" "76" "-1" "76" "-1" "c.76-1G>A" "r.spl?" "p.?" "" "0000624135" "00008518" "30" "25" "0" "25" "0" "c.25C>T" "r.(?)" "p.(Leu9=)" "" "0000658733" "00008518" "70" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Cys)" "" "0000734058" "00008518" "50" "218" "0" "218" "0" "c.218G>A" "r.(?)" "p.(Arg73Gln)" "" "0000734074" "00008518" "50" "265" "0" "265" "0" "c.265G>C" "r.(?)" "p.(Ala89Pro)" "" "0000926978" "00008518" "70" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Arg83Cys)" "" "0001043289" "00008518" "50" "217" "0" "217" "0" "c.217C>A" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{variantid}}" "0000001442" "0000019239" "0000335549" "0000734058" "0000335553" "0000734074"