### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = GNAS) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "GNAS" "GNAS complex locus" "20" "q13.2-q13.3" "unknown" "NC_000020.10" "UD_128999639654" "" "https://www.LOVD.nl/GNAS" "" "1" "4392" "2778" "139320" "1" "1" "1" "1" "We gratefully acknowledge the support of Francesca Marta Elli, acting as curator for this gene from 2015-2023.\r\nEstablishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "c" "http://databases.lovd.nl/shared/refseq/GNAS_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2008-07-18 00:00:00" "00006" "2026-02-13 09:20:24" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00024010" "GNAS" "transcript variant 4" "001" "NM_016592.2" "" "NP_057676.1" "" "" "" "-367" "2195" "738" "57414795" "57486250" "00006" "2015-01-23 15:17:15" "" "" "00024158" "GNAS" "transcript variant 1" "006" "NM_000516.4" "" "NP_000507.1" "" "" "" "-356" "1551" "1185" "57466426" "57486250" "01200" "2016-08-24 10:47:27" "" "" "00025229" "GNAS" "transcript variant 2" "002" "NM_080425.2" "" "NP_536350.2" "" "" "" "-285" "3480" "3114" "57428036" "57486250" "01199" "2017-08-21 17:05:17" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00222" "PHP1B" "pseudohypoparathyroidism, type Ib (PHP-1B)" "AD" "603233" "" "" "" "00006" "2013-10-09 19:05:31" "00006" "2021-12-10 21:51:32" "00223" "PHP1A" "pseudohypoparathyroidism, type Ia (PHP-1A, Albright hereditary osteodystrophy (AHO))" "AD;IC" "103580" "" "round face, full cheeks, depressed nasal bridge; seizure (HP:0001250)no hypotonia (-HP:0001252); no hypotonia (-HP:0001252); short stature (HP:0004322); obesity (HP:0001513); digital abnormalities (HP_0011297); multiple hormone resistance, subcutaneous calcification" "" "00006" "2013-10-09 19:11:03" "00006" "2023-01-03 20:49:54" "00224" "PHP1C" "pseudohypoparathyroidism, type Ic (PHP-1C)" "PI" "612462" "" "round face, full cheeks, depressed nasal bridge; seizure (HP:0001250)no hypotonia (-HP:0001252); no hypotonia (-HP:0001252); short stature (HP:0004322); obesity (HP:0001513); digital abnormalities (HP_0011297); multiple hormone resistance, subcutaneous calcification" "" "00006" "2013-10-09 19:12:21" "00006" "2023-01-03 20:48:48" "00225" "PPHP" "pseudopseudohypoparathyroidism (PPHP)" "AD" "612463" "" "" "" "00006" "2013-10-09 19:13:52" "00006" "2021-12-10 21:51:32" "00226" "POH" "heteroplasia, osseous, progressive (POH)" "AD" "166350" "" "" "" "00006" "2013-10-09 19:15:39" "00006" "2021-12-10 21:51:32" "00227" "MAS;POFD" "McCune-Albright syndrome (MAS, polyostotic fibrous dysplasia (POFD))" "" "174800" "" "" "" "00006" "2013-10-09 19:16:35" "00006" "2016-03-20 12:13:59" "00228" "AIMAH1" "hyperplasia, adrenal, ACTH-independent, macronodular, type 1 (AIMAH-1)" "SMu" "219080" "" "" "" "00006" "2013-10-09 19:19:48" "00006" "2021-12-10 21:51:32" "00399" "NPHS" "nephrotic syndrome (NPHS)" "" "" "" "" "" "00006" "2014-06-06 10:05:35" "00006" "2018-07-03 16:45:22" "01043" "-" "bleeding time, prolonged, brachydactyly and mental retardation" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2016-03-20 12:15:43" "01044" "PAGH1" "pituitary adenoma, type 1, multiple types (PITA1)" "AD;SMu" "102200" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01531" "PHA1A" "pseudohypoaldosteronism type 1 autosomal dominant (PHA-1A)" "AD" "177735" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01544" "RB1" "retinoblastoma, type 1" "AD;SMu" "180200" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-01-14 18:01:23" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "06512" "PITA3" "Pituitary adenoma 3, multiple types, somatic" "" "617686" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 11 "{{geneid}}" "{{diseaseid}}" "GNAS" "00139" "GNAS" "00222" "GNAS" "00223" "GNAS" "00224" "GNAS" "00225" "GNAS" "00226" "GNAS" "00227" "GNAS" "00228" "GNAS" "01043" "GNAS" "01044" "GNAS" "06512" ## Individuals ## Do not remove or alter this header ## ## Count = 110 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00029629" "" "" "" "2" "" "00688" "" "sibling also affected by PHP1b" "M" "no" "New Caledonia" "" "0" "" "" "white" "" "00029630" "" "" "" "2" "" "00688" "" "sibling also affected by PHP1b" "M" "no" "" "" "0" "" "" "white" "" "00029631" "" "" "" "1" "" "00688" "" "" "M" "no" "" "" "0" "" "" "white" "" "00079670" "" "" "" "1" "" "00006" "contact me for details" "2-generation family, unaffected parents" "F" "no" "" "" "0" "" "" "" "private email" "00081316" "" "" "" "2" "" "01744" "{PMID:Klaassens 2010:19863504}" "2-generation family, 2 affecteds" "F;M" "" "(Netherlands)" "" "0" "" "" "" "" "00081317" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "M" "" "(United States)" "" "0" "" "" "" "" "00081319" "" "" "" "3" "" "01744" "{PMID:Germain-Lee 2003:12970262}" "2-generation family, 3 affecteds (2 siblings, mother)" "F" "" "(United States)" "" "0" "" "GH" "" "" "00081709" "" "" "00081316" "1" "" "01744" "{PMID:Klaassens 2010:19863504}" "" "F" "" "(Netherlands)" "" "0" "" "thyroid hormone replacement therapy" "" "" "00081710" "" "" "" "2" "" "01744" "{PMID:Long 2007:17164301}" "2 generation family; 2 affecteds (proband:son; mother)" "F;M" "" "(United States)" "" "0" "" "" "" "" "00081711" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081712" "" "" "" "2" "" "01744" "{PMID:Long 2007:17164301}" "2 generation family; 2 afecteds (proband:daughter, mother)" "F" "" "(United States)" "" "0" "" "" "" "" "00081713" "" "" "" "5" "" "01744" "{PMID:Long 2007:17164301}" "3-generation family; 5 affecteds" "F;M" "" "(United States)" "" "0" "" "" "" "" "00081714" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081720" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "M" "" "(United States)" "" "0" "" "" "" "" "00081723" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081724" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "M" "" "(United States)" "" "0" "" "" "" "" "00081818" "" "" "" "1" "" "01199" "{PMID:Garin 2015:25594858}" "" "M" "no" "(France)" "" "0" "" "" "" "" "00081820" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081821" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081822" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081823" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00081824" "" "" "" "1" "" "01744" "{PMID:Long 2007:17164301}" "" "M" "" "(United States)" "" "0" "" "" "" "" "00087209" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "M" "" "(France)" "" "0" "" "" "" "" "00087210" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "PHP1A POH-like" "M" "" "(France)" "" "0" "" "" "" "" "00087211" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "F" "" "(France)" "" "0" "" "" "" "" "00087212" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "F" "" "(France)" "" "0" "" "" "" "" "00087213" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "F" "" "(France)" "" "0" "" "" "" "" "00087214" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "M" "" "(France)" "" "0" "" "" "" "" "00087215" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "F" "" "(France)" "" "0" "" "" "" "" "00087216" "" "" "" "1" "" "01744" "" "" "M" "" "(France)" "" "0" "" "" "" "" "00087217" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "M" "" "(France)" "" "0" "" "" "" "" "00087218" "" "" "" "5" "" "01744" "{PMID:Lebrun 2010:20427508}" "3-generation family, 5 affecteds (Proband showed POH/PPHP overlap)" "F;M" "" "(France)" "" "0" "" "" "" "" "00087219" "" "" "" "2" "" "01744" "{PMID:Lebrun 2010:20427508}" "2-generation family, 3 affecteds (mother and 2 siblings)" "M" "" "(France)" "" "0" "" "" "" "" "00087220" "" "" "00087219" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "2-generation family, 3 affecteds (mother and 2 siblings)" "M" "" "(France)" "" "0" "" "" "" "" "00087221" "" "" "" "2" "" "01744" "{PMID:Lebrun 2010:20427508}" "2 twins affected (de novo)" "M" "" "(France)" "" "0" "" "" "" "" "00087222" "" "" "00087221" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "2 twins affected (de novo)" "M" "" "(France)" "" "0" "" "" "" "" "00087223" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "M" "" "(France)" "" "0" "" "" "" "" "00087224" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "F" "" "(France)" "" "0" "" "" "" "" "00087226" "" "" "" "1" "" "01744" "{PMID:Lebrun 2010:20427508}" "" "F" "" "(France)" "" "0" "" "" "" "" "00088254" "" "" "" "1" "" "01744" "{PMID:Pereda 2015:25865609}" "Double pregnancy by ICSI (twin brother healthy)" "F" "" "(Spain)" "" "0" "" "" "" "" "00088256" "" "" "" "1" "" "01744" "{PMID:Pereda 2015:25865609}" "" "M" "" "(Spain)" "" "0" "" "" "" "" "00089034" "" "" "00081319" "1" "" "01744" "{PMID:Germain-Lee 2003:12970262}" "2-generation family, 3 affecteds (2 siblings, mother)" "M" "" "(United States)" "" "0" "" "" "" "" "00089141" "" "" "" "1" "" "01744" "{PMID:Germain-Lee 2003:12970262}" "" "F" "" "(United States)" "" "0" "" "" "" "" "00092284" "" "" "" "1" "" "01744" "NOT PUBLISHED" "2-generation family, 2 affecteds (mother and son)" "M" "" "(Spain)" "" "0" "" "Euritox 37.5mcg/day" "" "" "00100243" "" "" "" "4" "" "01744" "NOT PUBLISHED" "2-generatin family, 4 affecteds (mother, 2 siblings)" "F" "" "(Portugal)" "" "0" "" "ITT; LT4 (2.5mcg/Kg/d)" "" "" "00100255" "" "" "00100243" "1" "" "01744" "NOT PUBLISHED" "" "F" "" "(Portugal)" "" "0" "" "" "" "" "00100258" "" "" "00100243" "1" "" "01744" "NOT PUBLISHED" "" "M" "" "(Portugal)" "" "0" "" "LT4 (2.8mcg/Kg/d)" "" "" "00100260" "" "" "00100243" "1" "" "01744" "NOT PUBLISHED" "" "M" "" "(Portugal)" "" "0" "" "LT4" "" "" "00100646" "" "" "" "1" "" "01202" "" "" "F" "no" "France" "" "0" "" "" "" "" "00100648" "" "" "" "1" "" "01202" "" "" "M" "no" "France" "" "0" "" "" "" "" "00100650" "" "" "" "1" "" "01202" "" "" "M" "?" "France" "" "0" "" "" "" "" "00100651" "" "" "" "1" "" "01202" "" "" "F" "?" "France" "" "0" "" "" "" "" "00103954" "" "" "" "1" "" "01744" "{PMID:Park 2010:20689139}" "" "M" "no" "(Korea, South (Republic))" "" "0" "" "" "" "" "00104887" "" "" "" "1" "" "01744" "{PMID:Wu, Y. L. 2014:24651309}" "" "F" "?" "China" "" "0" "" "" "" "Member 3A" "00104888" "" "" "" "1" "" "01744" "{PMID:Wu, Y. L. 2014:24651309}" "" "M" "?" "China" "" "0" "" "" "" "member 4A" "00104889" "" "" "" "1" "" "01744" "{PMID:Wu, Y. L. 2014: 24651309}" "" "F" "?" "China" "" "0" "" "" "" "member 5A" "00104892" "" "" "" "1" "" "01744" "NOT PUBLISHED" "" "M" "" "Spain" "" "0" "" "" "" "" "00105919" "" "" "" "1" "" "01744" "NOT PUBLISHED" "" "F" "" "Russian Federation" "" "0" "" "" "" "" "00107544" "" "" "" "3" "" "01744" "{PMID:Pinsker 2006:16995592}" "" "F" "?" "(England)" "" "0" "" "" "" "" "00107545" "" "" "00107544" "1" "" "01744" "{PMID:Pinsker 2006:16995592}" "" "F" "?" "England" "" "0" "" "" "" "3-year-old sister" "00107546" "" "" "00107544" "1" "" "01744" "{PMID:Pinsker 2006:16995592}" "" "F" "?" "(England)" "" "0" "" "" "" "Mother" "00107714" "" "" "" "1" "" "01744" "{PMID:Lim 2002:11926205}" "" "M" "" "(Singapore)" "" "0" "" "" "" "" "00107715" "" "" "" "1" "" "01744" "{PMID:Lim 2002:11926205}" "" "M" "?" "(Singapore)" "" "0" "" "" "" "" "00107716" "" "" "" "1" "" "01744" "{PMID:Lim 2002:11926205}" "" "M" "?" "(Singapore)" "" "0" "" "" "" "" "00111415" "" "" "" "1" "" "00729" "{PMID:Popp 2017:29158550}, {DOI:Popp 2017:10.1038/s41431-017-0022-1}" "" "F" "no" "" "" "0" "" "" "" "S_066" "00117961" "" "" "" "1" "" "01744" "NOT DESCRIBED" "" "M" "?" "Spain" "" "0" "" "neuroleptics" "" "" "00121856" "" "" "00029427" "1" "" "01744" "{PMID:Aldred 2000:11073544}" "maternal germ-line mosaicism; loss of function" "M" "no" "Greece" "" "0" "" "" "" "" "00131908" "" "" "" "1" "" "01202" "" "Only affected individual in the family" "M" "no" "France" "" "0" "" "" "" "" "00131909" "" "" "" "1" "" "01202" "" "Only affected individual" "M" "no" "France" "" "0" "" "" "" "" "00131910" "" "" "" "1" "" "01202" "" "" "F" "no" "France" "" "0" "" "" "" "" "00131911" "" "" "" "1" "" "01202" "" "Only affected individual" "M" "?" "(France)" "" "0" "" "" "" "" "00131912" "" "" "" "2" "" "01202" "" "One affected parent" "F" "no" "France" "" "0" "" "" "" "" "00131913" "" "" "00131912" "1" "" "01202" "" "One affected child" "F" "no" "France" "" "0" "" "" "" "" "00131914" "" "" "" "1" "" "01202" "" "Only affected individual" "M" "-" "France" "" "0" "" "" "" "" "00131915" "" "" "" "1" "" "01202" "" "Only affected individual" "F" "no" "Switzerland" "" "0" "" "" "" "" "00131916" "" "" "" "1" "" "01202" "" "" "F" "no" "France" "" "0" "" "" "" "" "00131917" "" "" "" "1" "" "01202" "" "" "F" "?" "(Switzerland)" "" "0" "" "" "" "" "00131918" "" "" "" "1" "" "01202" "" "Only affected individual" "M" "" "France" "" "0" "" "" "" "" "00131919" "" "" "" "1" "" "01202" "" "" "F" "?" "France" "" "0" "" "" "" "" "00131921" "" "" "" "1" "" "01202" "" "" "M" "" "(France)" "" "0" "" "" "" "" "00131925" "" "" "" "1" "" "01202" "" "" "F" "" "France" "" "0" "" "" "" "" "00131929" "" "" "" "1" "" "01202" "" "" "" "no" "France" "" "0" "" "" "" "" "00131932" "" "" "" "1" "" "01202" "" "" "M" "" "Greece" "" "0" "" "" "" "" "00131942" "" "" "" "1" "" "01202" "" "" "M" "" "France" "" "0" "" "" "" "" "00132024" "" "" "" "1" "" "01202" "" "" "F" "" "France" "" "0" "" "Levothyroxine, alfacalcidol, calcium, GH" "" "" "00132069" "" "" "" "1" "" "01396" "" "" "F" "no" "Brazil" "" "0" "" "" "" "1" "00143690" "" "" "" "1" "" "01744" "NOT PUBLISHED" "" "M" "no" "Spain" "" "0" "" "" "" "" "00144440" "" "" "" "3" "" "01744" "NOT PUBLISHED" "2-generation family, 3 affecteds (2 daughter and father)" "F" "no" "(Spain)" "" "0" "" "" "Latino Americans" "" "00144441" "" "" "00144440" "1" "" "01744" "NOT PUBLISHED" "" "F" "no" "(Spain)" "" "0" "" "" "Latino Americans" "" "00144442" "" "" "00144440" "1" "" "01744" "NOT PUBLISHED" "the father apparently only shows short stature" "M" "?" "(Spain)" "" "0" "" "" "Latino Americans" "" "00229574" "" "" "" "3" "" "01261" "{PMID:Yakoreva 2019:31186545}, {DOI:Yakoreva 2019:10.1038/s41431-019-0446-x}" "2-generation family, 2 affected sibs (variant on maternal allele); mother has variant on paternal allele causing pseudopseudohypoparathyroidism" "F" "" "Estonia" "" "0" "" "" "" "" "00229575" "" "" "" "1" "" "01261" "{PMID:Yakoreva 2019:31186545}, {DOI:Yakoreva 2019:10.1038/s41431-019-0446-x}" "" "F" "" "Estonia" "" "0" "" "" "" "" "00229576" "" "" "" "4" "" "01261" "{PMID:Yakoreva 2019:31186545}, {DOI:Yakoreva 2019:10.1038/s41431-019-0446-x}" "2-generation family, 3 affected sibs; mother has pseudopseudohypoparathyreoidism and variant on paternal allele" "F" "" "Estonia" "" "0" "" "" "" "" "00235448" "" "" "" "3" "" "00006" "{PMID:Miyado 2019:30962325}" "3-generation family, 3 affected heterozygous carriers (3F)" "F" "" "Japan" "" "0" "" "" "" "Family A" "00235449" "" "" "" "2" "" "00006" "{PMID:Miyado 2019:30962325}" "3-generation family, 3 affected heterozygous carriers (2F)" "F" "" "Japan" "" "0" "" "" "" "Family B" "00292959" "" "" "" "112" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00304866" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00307142" "" "" "" "1" "" "03753" "{PMID:Mendonca 2021:34478740}" "" "M" "-" "Brazil" "" "0" "" "" "" "Patient 06" "00307260" "" "" "" "1" "" "03753" "{PMID:Mendonca 2021:34478740}" "" "F" "" "Brazil" "" "" "" "" "" "Patient 75" "00331461" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "M" "" "" "" "0" "" "" "Arab" "13DG0035" "00358751" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "176373" "00359406" "" "" "" "1" "" "03149" "" "" "F" "no" "Brazil" "" "" "" "" "" "03149" "00359407" "" "" "" "1" "" "03149" "" "" "F" "no" "Brazil" "" "" "" "" "" "03149" "00361641" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "simplex case" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "13DG0035" "00419577" "" "" "" "1" "" "02300" "{PMID:Marinakis 2021:34008892}" "" "F" "" "Greece" "" "0" "" "" "" "20075" "00419619" "" "" "" "1" "" "02300" "{PMID:Marinakis 2021:34008892}" "" "M" "" "Greece" "" "0" "" "" "" "8108" "00457811" "" "" "" "1" "" "00006" "{PMID:Koruga 2021:37189872}" "2-generation family, 1 affected, unaffected non carrier parents" "F" "" "Croatia (Hrvatska)" "" "0" "" "" "" "patient" "00467269" "" "" "" "1" "" "00006" "{PMID:Soden 2014:25473036}" "family, 1 affected" "" "" "United States" "" "0" "" "" "" "CMH021" "00468949" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00469826" "" "" "" "1" "" "00006" "{PMID:Jacob 2025:39706863}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "" "India" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 116 "{{individualid}}" "{{diseaseid}}" "00029629" "00222" "00029630" "00222" "00029631" "00222" "00079670" "00198" "00081316" "00223" "00081316" "00225" "00081317" "00225" "00081319" "00223" "00081709" "00225" "00081710" "00223" "00081710" "00225" "00081711" "00223" "00081712" "00223" "00081712" "00225" "00081713" "00223" "00081713" "00225" "00081714" "00223" "00081720" "00223" "00081723" "00223" "00081724" "00225" "00081818" "00223" "00081820" "00223" "00081821" "00223" "00081822" "00223" "00081823" "00223" "00081824" "00226" "00087209" "00226" "00087210" "00226" "00087211" "00226" "00087212" "00226" "00087213" "00226" "00087214" "00226" "00087215" "00226" "00087216" "00226" "00087217" "00226" "00087218" "00223" "00087218" "00225" "00087218" "00226" "00087219" "00223" "00087220" "00223" "00087221" "00223" "00087222" "00223" "00087223" "00223" "00087224" "00223" "00087226" "00223" "00088254" "00225" "00088256" "00226" "00089034" "00223" "00089141" "00223" "00092284" "00223" "00100243" "01531" "00100255" "00225" "00100258" "00223" "00100260" "00223" "00100646" "00223" "00100648" "00223" "00100650" "00223" "00100651" "00225" "00103954" "00223" "00104887" "00223" "00104888" "00223" "00104889" "00225" "00104892" "00225" "00105919" "00225" "00107544" "00223" "00107545" "00223" "00107546" "00223" "00107714" "00223" "00107715" "00223" "00107716" "00223" "00111415" "00139" "00117961" "00225" "00121856" "00223" "00131908" "00223" "00131909" "00223" "00131910" "00223" "00131911" "00223" "00131912" "00223" "00131913" "00225" "00131914" "00223" "00131915" "00223" "00131916" "00223" "00131917" "00225" "00131918" "00223" "00131919" "00223" "00131921" "00223" "00131925" "00223" "00131929" "00223" "00131932" "00223" "00131942" "00223" "00132024" "00224" "00132069" "00223" "00143690" "00225" "00144440" "00225" "00144441" "00225" "00144442" "00225" "00229574" "00198" "00229575" "00225" "00229576" "00223" "00235448" "00399" "00235449" "00399" "00292959" "00198" "00304866" "00198" "00307142" "01544" "00307260" "01544" "00331461" "05517" "00358751" "00223" "00359406" "00227" "00359407" "00227" "00361641" "00139" "00419577" "00198" "00419619" "00198" "00457811" "05611" "00467269" "00198" "00468949" "00198" "00469826" "05517" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00198, 00222, 00223, 00224, 00225, 00226, 00227, 00228, 00399, 01043, 01044, 01531, 01544, 05517, 05611, 06512 ## Count = 101 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Length/Stature}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Growth}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Intellectual_dis/HPO_0001249}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000025661" "00222" "00029629" "00688" "Familial" "" "diagnosed 12y: activity-induced fatigue and cramps" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000025662" "00222" "00029630" "00688" "Familial" "" "diagnosed 17y: activity-induced fatigue, hyperphosphataemia, hypocalcaemia; 21y-bilateral cortical calcifications" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000025663" "00222" "00029631" "00688" "Familial" "" "diagnosed 2y: growth failure, rapid weight gain, mild global developmental delay" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000061340" "00223" "00081316" "01744" "Familial, autosomal dominant" "02y" "born after ICSI; developed\r\nseveral problems after born: (necrotizing enterocolitis, aspiration pneumonia, hypothyroidism); frontal bossing; depressed nasal bridge; on the neck: regional abnormality of skin, hyperpigmented\r\nmacules, dermal atrophy; palpable subcutaneous calcifications in the neck and on the helix of right ear; developmental delay; inspiratory stridor; hoarse voice with vocal cord paralysis; hypotonic seizures (3y); biochemical test: elevated serum PTH (64,8 pmol/L; N=1,3-6,8); serum calcium 1,17 mmol/L (N=2,2–2,6), urine calcium 0,0 mmol in 24 h (N= <7,5), serum phosphate\r\n3,89 mmol/L (N= 0,8–2,0), urine phosphate 1,0 mmol in 24 h (N= 13–40).; round face (HP:0000311); truncal obesity (HP:0001956); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "" "02y" "" "03y" "" "" "" "" "" "" "" "" "" "" "0000061342" "00225" "00081317" "01744" "Unknown" "11y" "Height SDS: -0.60; Weight SDS: 1.33; BMI: 14.8; BMI %: 7.3; no short stature (-HP:0004322); no obesity (-HP:0001513);" "-" "" "" "11y" "" "" "" "n/a" "" "" "" "" "" "" "0000061343" "00223" "00081710" "01744" "Familial, autosomal dominant" "21y" "Height SDS: -3.13; Weight SDS: 1.06; BMI: 35.7; BMI %: 98.7; short stature (HP:0004322); obesity (HP:0001513);" "yes (<3rd centile)" "" "" "21y" "" "" "" "n/a" "" "" "" "" "" "" "0000061348" "00223" "00081711" "01744" "Unknown" "10y04m" "Height SDS: 0.26; Weight SDS: 1.46; BMI: 23.8; BMI %: 95.8; normal stature; obesity (HP:0001513);" "-" "" "" "10y04m" "" "" "" "n/a" "" "" "" "" "" "" "0000061349" "00223" "00081712" "01744" "Familial, autosomal dominant" "07y" "Height SDS: 1.31; Weight SDS: 2.72; BMI: 25.7; BMI %: 99.4; normal stature; obesity (HP:0001513);" "-" "" "" "07y" "" "" "" "n/a" "" "" "" "" "" "" "0000061351" "00223" "00081713" "01744" "Familial, autosomal dominant" "06y04m" "Height SDS: 0.75; Weight SDS: 3.10; BMI: 30.2; BMI %: 99.8; normal stature; obesity (HP:0001513);" "-" "" "" "06y04m" "" "" "" "n/a" "" "" "" "" "" "" "0000061352" "00225" "00081713" "01744" "Familial, autosomal dominant" "14y" "Height SDS: -1.61; Weight SDS: -1.13; BMI: 18.8; BMI %: 13.6; no short stature (-HP:0004322); no obesity (-HP:0001513);" "-" "" "" "14y" "" "" "" "n/a" "" "" "" "" "" "" "0000061353" "00225" "00081713" "01744" "Familial, autosomal dominant" "33y" "Height SDS: -2.43; Weight SDS: -0.63; BMI: 24.3; BMI %: 73.9; short stature (HP:0004322); no obesity (-HP:0001513);" "stature, short (HPO_0004322)" "" "" "" "" "" "" "n/a" "" "" "" "" "" "" "0000061354" "00225" "00081713" "01744" "Familial, autosomal dominant" "42y" "Height SDS: -2.33; Weight SDS: -0.31; BMI: 26.3; BMI %: 80.8; short stature (HP:0004322); no obesity (-HP:0001513);" "stature, short (HPO_0004322)" "" "" "" "" "" "" "n/a" "" "" "" "" "" "" "0000061355" "00225" "00081713" "01744" "Familial, autosomal dominant" "82y" "Height SDS: -1.98; Weight SDS: 0.84; BMI: 31.0; BMI %: 95.5; short stature (HP:0004322); obesity (HP:0001513);" "stature, short (HPO_0004322)" "" "" "" "" "" "" "n/a" "" "" "" "" "" "" "0000061356" "00223" "00081714" "01744" "Unknown" "19y" "Height SDS: -1.75; weight SDS: 2.18; BMI: 42.4; BMI %: 98.8; normal stature; obesity (HP:0001513);" "-" "" "" "19y" "" "" "" "n/a" "" "" "" "" "" "" "0000061360" "00223" "00081720" "01744" "Unknown" "03y04m" "Height SDS: -1.29; Weight SDS: 4.18; BMI: 23.6; BMI %: 100.0; normal stature; obesity (HP:0001513);" "-" "" "" "03y04m" "" "" "" "n/a" "" "" "" "" "" "" "0000061364" "00223" "00081723" "01744" "Unknown" "03y04m" "Height SDS: 2.60; Weight SDS: 5.28; BMI: 39.3; BMI %: 100.0; short stature (HP:0004322); obesity (HP:0001513);" "stature, short (HPO_0004322)" "" "" "03y04m" "" "" "" "n/a" "" "" "" "" "" "" "0000061366" "00225" "00081724" "01744" "Unknown" "16y06m" "Height SDS: -2.22; Weight SDS: 0.66; BMI: 28.6; BMI %: 90.8; short stature (HP:0004322); no obesity (-HP:0001513);" "stature, short (HPO_0004322)" "" "" "16y06m" "" "" "" "n/a" "" "" "" "" "" "" "0000061463" "00223" "00081818" "01199" "Familial, autosomal dominant" "04y" "normal stature; intellectual disability (HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly, type E (HP:0005863); ectopic ossification (HP:0011986);" "-" "04y" "" "08y" "" "" "" "yes" "" "" "" "" "" "" "0000061464" "00223" "00081820" "01744" "Unknown" "52y" "Height SDS: -4.81; Weight SDS: -1.11; BMI: 28.4; BMI %: 90.4; short stature (HP:0004322); no obesity (-HP:0001513);" "stature, short (HPO_0004322)" "" "" "" "" "" "" "n/a" "" "" "" "" "" "" "0000061465" "00223" "00081821" "01744" "Unknown" "06y09m" "Height SDS: -1.35; Weight SDS: 1.17; BMI: 21.5; BMI %: 98; normal stature; obesity (HP:0001513);" "-" "" "" "06y09m" "" "" "" "n/a" "" "" "" "" "" "" "0000061466" "00223" "00081822" "01744" "Unknown" "14y02m" "Height SDS: -1.08; Weight SDS: 2.53; BMI: 42; BMI %: 99.5; normal stature; obesity (HP:0001513);" "-" "" "" "" "" "" "" "n/a" "" "" "" "" "" "" "0000061467" "00223" "00081823" "01744" "Unknown" "18y" "Height SDS: -1.46; Weight SDS: 0.96; BMI: 28.8; BMI %: 92.6; normal stature; no obesity (-HP:0001513);" "-" "" "" "" "" "" "" "n/a" "" "" "" "" "" "" "0000066740" "00223" "00087219" "01744" "Familial, autosomal dominant" "00y" "At birth: at term; weight= 2650 g" "" "" "" "04y04m" "" "" "" "" "" "" "" "" "" "" "0000066741" "00223" "00087219" "01744" "Familial, autosomal dominant" "04y04m" "weight= +3.5 SD; height= +0.3 SD; BMI= 21.9; local subcutaneous ossifications (abdomen and knees) and cerebral calcifications; Ca= 1.7 (mmol/L; 2.2–2.6); P= 3.0 (mmol/L; 1.1-2.0); PTH= 398 (pg/mL; 10–71); TSH= 7.4 (mUl/mL; 0.5–4.5); Gsα activity= 67 (80–110%); normal stature; intellectual disability (HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "-" "" "" "04y04m" "" "" "" "yes" "" "" "" "" "" "" "0000066742" "00223" "00087219" "01744" "Familial, autosomal dominant" "08y" "Under treatment: Ca= 2.32 (mmol/L; 2.2–2.6); P= 1.87 (mmol/L; 1.1-2.0); PTH= 348 (pg/mL; 10–71); TSH= 0.9 (mUl/mL; 0.5–4.5); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "" "" "" "04y04m" "" "" "" "" "" "" "" "" "" "" "0000066743" "00223" "00087220" "01744" "Familial, autosomal dominant" "00y" "At birth: term= 38.5 week; weight= 2500 g; height= 44 cm; head circumference= 34 cm; IUGR (3rd centile)" "" "" "" "07.5m" "" "" "" "" "" "" "" "" "" "" "0000066744" "00223" "00087220" "01744" "Familial, autosomal dominant" "00y07m" "weight= -0.5 SD; height= -2 SD; numerous inflammatory subcutaneous ossifications; Ca= 2.4 (mmol/L; 2.2–2.6); P= 2.1 (mmol/L; 1.1-2.0); PTH= 25 (pg/mL; 10–71); TSH= 9.6 (mUl/mL; 0.5–4.5); Gsα activity= 60 (80–110%); mild short stature (HP:0003502); intellectual disability (HP:0001249); no dysmorphic face (-HP:0001999); no obesity (-HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "stature, short, mild (HPO_0003502)" "" "" "7.5m" "" "" "" "yes" "" "" "" "" "" "" "0000066745" "00223" "00087220" "01744" "Familial, autosomal dominant" "04y" "Under treatment: Ca= 2.35 (mmol/L; 2.2–2.6); P= 2 (mmol/L; 1.1-2.0); PTH= 260 (pg/mL; 10–71); TSH= 0.2 (mUl/mL; 0.5–4.5); intellectual disability (HP:0001249); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "" "" "" "7.5m" "" "" "" "yes" "" "" "" "" "" "" "0000066746" "00223" "00087221" "01744" "Isolated (sporadic)" "01y08m" "weight= +1 SD; height= -1 SD; no IUGR; multiple subcutaneous ossifications (10 cm of diameter\r\nfor the largest); Ca= 2.6 (mmol/L; 2.2–2.6); P= 2.3 (mmol/L; 1.1-2.0); PTH= 149 (pg/mL; 10–71); TSH= 0.6 under treatment (mUl/mL; 0.5–4.5); Gsα activity= 55 (80–110%); normal stature; round face (HP:0000311); no obesity (-HP:0001513); brachydactyly, type E (HP:0005863); ectopic ossification (HP:0011986);" "-" "" "" "7.5m" "" "" "" "?" "" "" "" "" "" "" "0000066747" "00223" "00087222" "01744" "Isolated (sporadic)" "01y08m" "weight= +1 SD; height= -1 SD; no IUGR; multiple subcutaneous ossifications; Ca= 2.6 (mmol/L; 2.2–2.6); P= 2.1 (mmol/L; 1.1-2.0); PTH= 83 (pg/mL; 10–71); TSH= 0.1 under treatment (mUl/mL; 0.5–4.5); Gsα activity= 58 (80–110%); normal stature; round face (HP:0000311); no obesity (-HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "-" "" "" "7.5m" "" "" "" "?" "" "" "" "" "" "" "0000066748" "00223" "00087223" "01744" "Familial, autosomal dominant" "01y" "weight= +5 SD; height= +0.7 SD; Ca= 2.2 (mmol/L; 2.2–2.6); PTH= 79 (pg/mL; 10–65); TSH= 5.8 (mUl/mL; 0.5–4.5); normal stature; intellectual disability (HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "-" "" "" "00y09m" "" "" "" "yes" "" "" "" "" "" "" "0000066749" "00223" "00087224" "01744" "Isolated (sporadic)" "06y" "Ca= 1.7 (mmol/L; 2.2–2.6); P= 2.1 (mmol/L; 1.1-2.0); PTH= 500 (pg/mL; 10–71); TSH= 8.9 (mUl/mL; 0.5–4.5)" "n/a" "" "" "27y" "" "" "" "" "" "" "" "" "" "" "0000066750" "00223" "00087224" "01744" "Isolated (sporadic)" "27y" "weight= 61 kg; height= 150 cm; PTH (under treatment)= 85 (pg/mL; 10–71); short stature (HP:0004322); no intellectual disability (-HP:0001249); round face (HP:0000311); no obesity (-HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986);" "stature, short (HPO_0004322)" "" "" "27y" "" "" "" "no" "" "" "" "" "" "" "0000066754" "00223" "00087226" "01744" "Familial, autosomal dominant" "00y04m" "ectopic ossification (HP:0011986);" "?" "00y04m" "" "00y04m" "" "" "" "?" "" "" "" "" "" "" "0000068433" "00223" "00081319" "01744" "Familial, autosomal dominant" "18y01m" "secondary amenorrhea; short stature (HP:0004322); intellectual disability (HP:0001249); normal onset puberty; round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986); no hypercalcemia (-HP:0003072); high follicle stimulating hormone (HP:0008232), growth hormone deficiency (HP:0000824),high luteinizing hormone (HP:0011969), high circulating parathyroid hormone (HP:0003165), thyroid-stimulating hormone excess (HP:0002925)" "yes (<3rd centile)" "02y06m" "" "" "" "" "" "yes" "" "" "" "" "" "" "0000068434" "00223" "00089034" "01744" "Familial, autosomal dominant" "21y" "secondary amenorrhea; BMI=35.70; severe short stature (HP:0003510); intellectual disability (HP:0001249); normal onset puberty; round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986); no hypercalcemia (-HP:0003072); growth hormone deficiency (HP:0000824), high circulating parathyroid hormone (HP:0003165), thyroid-stimulating hormone excess (HP:0002925)" "stature, short, severe (HPO_0003510)" "12y03m" "?" "" "" "" "" "yes" "" "" "" "" "" "" "0000068528" "00223" "00089141" "01744" "Isolated (sporadic)" "06y09m" "mild short stature (HP:0003502); mild intellectual disability (HP:0001256); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); normal bone age; ectopic ossification (HP:0011986); no hypercalcemia (-HP:0003072); high circulating parathyroid hormone (HP:0003165), thyroid-stimulating hormone excess (HP:0002925)" "stature, short, mild (HPO_0003502)" "" "" "" "" "" "" "mild" "" "" "" "" "" "" "0000070624" "00223" "00092284" "01744" "Unknown" "00y11m" "normal stature; obesity (HP:0001513); no calcifications; thyroid-stimulating hormone excess (HP:0002925)" "-" "00y00m" "" "02y05m" "" "" "" "" "" "" "" "" "" "" "0000070625" "00223" "00092284" "01744" "Unknown" "00y13m" "normal stature; obesity (HP:0001513);" "-" "00y00m" "" "02y05m" "" "" "" "" "" "" "" "" "" "" "0000070626" "00223" "00092284" "01744" "Unknown" "00y16m" "normal stature; obesity (HP:0001513);" "-" "00y00m" "" "02y05m" "" "" "" "" "" "" "" "" "" "" "0000070627" "00223" "00092284" "01744" "Unknown" "01y07m" "mild short stature (HP:0003502); obesity (HP:0001513);" "stature, short, mild (HPO_0003502)" "00y00m" "" "02y05m" "" "" "" "" "" "" "" "" "" "" "0000070628" "00223" "00092284" "01744" "Unknown" "02y03m" "Growth: 15.3cm/year (p>99, 4.08 DE); global developmental delay; fine psychomotor retardation;; normal stature; no growth abnormality (-HP:0001507); round face (HP:0000311); no obesity (-HP:0001513); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high circulating parathyroid hormone (HP:0003165)" "-" "00y00m" "normal" "02y05m" "" "" "" "" "" "" "" "" "" "" "0000078482" "00223" "00100243" "01744" "Familial, autosomal dominant" "27y" "short left femur;absent GH response; low estradiol; vitamin D deficiency (HP:0100512); short stature (HP:0004322); delayed growth (HP:00001510); intellectual disability (HP:0001249); normal onset puberty; round face (HP:0000311); obesity (HP:0001513); brachydactyly, type E (HP:0005863); no hypercalcemia (-HP:0003072); hyperphosphatemia (HP:0002905); high circulating parathyroid hormone (HP:0003165), thyroid-stimulating hormone excess (HP:0002925)" "yes (<3rd centile)" "09y" "delayed" "27y" "primary hypothyroidism" "" "" "yes" "" "" "" "" "" "" "0000078483" "00225" "00100255" "01744" "Familial, autosomal dominant" "" "short stature (HP:0004322) (<3rd centile);" "yes (<3rd centile)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000078484" "00223" "00100258" "01744" "Familial, autosomal dominant" "33y" "vitamin D deficiency (HP:0100512); short stature (HP:0004322); intellectual disability (HP:0001249); obesity (HP:0001513); brachydactyly, type E (HP:0005863); no hypercalcemia (-HP:0003072); hyperphosphatemia (HP:0002905); high circulating parathyroid hormone (HP:0003165), thyroid-stimulating hormone excess (HP:0002925)" "yes (<3rd centile)" "05y" "" "33y" "primary hypothyroidism" "" "" "yes" "" "" "" "" "" "" "0000078485" "00223" "00100260" "01744" "Familial, autosomal dominant" "35y" "vitamin D deficiency (HP:0100512); short stature (HP:0004322); intellectual disability (HP:0001249); dysmorphic face (HP:0001999); obesity (HP:0001513); brachydactyly, type E (HP:0005863); no hypercalcemia (-HP:0003072); hyperphosphatemia (HP:0002905); high circulating parathyroid hormone (HP:0003165), thyroid-stimulating hormone excess (HP:0002925)" "yes (<3rd centile)" "19y" "" "35y" "short stature" "" "" "yes" "" "" "" "" "" "" "0000078874" "00223" "00100646" "01202" "Familial" "00y03m" "moderate prenatal growth retardation (HP:0011408); dysmorphic face (HP:0001999); ectopic ossification (HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "" "00y01m" "retardation prenatal moderate" "00y03m" "" "" "" "?" "" "" "" "" "" "" "0000078876" "00223" "00100648" "01202" "Familial, autosomal dominant" "03y06m" "at 3years 1/2:\r\n+ 4sd Height\r\n+ 4sd Weight; dysmorphic face (HP:0001999); obesity (HP:0001513); brachydactyly (HP:000156); widely spaced teeth (HP:0000687); accelerated bone age (HP:0002805); ectopic ossification (HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "" "" "" "03y06m" "" "" "" "?" "" "" "" "" "" "" "0000078877" "00223" "00100650" "01202" "Familial, autosomal dominant" "05y04m" "intellectual disability (HP:0001249); dysmorphic face (HP:0001999); brachydactyly (HP:000156); no ectopic ossification (-HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "" "" "" "05y04m" "" "" "" "yes" "" "" "" "" "" "" "0000081882" "00223" "00103954" "01744" "Isolated (sporadic)" "07y" "short stature (HP:0004322); no growth abnormality (-HP:0001507); no intellectual disability (-HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "stature, short (HPO_0004322)" "" "normal" "07y" "" "" "" "no" "" "" "" "" "" "" "0000082779" "00223" "00104887" "01744" "Unknown" "14y06m" "short stature (HP:0004322); intellectual disability (HP:0001249); round face (HP:0000311); no obesity (-HP:0001513); ectopic ossification (HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "stature, short (HPO_0004322)" "" "n/a" "14y06m" "" "" "" "yes" "" "" "" "" "" "" "0000082780" "00223" "00104888" "01744" "Unknown" "13y" "short stature (HP:0004322); intellectual disability (HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "stature, short (HPO_0004322)" "" "n/a" "13y" "" "" "" "yes" "" "" "" "" "" "" "0000082781" "00225" "00104889" "01744" "Unknown" "13y03m" "short stature (HP:0004322); brain calcification; round face (HP:0000311); normal hormone levels; no hpercalciuria (-HP:0002150); no intellectual disability (-HP:0001249); hyperphosphatemia; no obesity (-HP:0001513); no ectopic ossification (-HP:0011986);" "stature, short (HPO_0004322)" "" "n/a" "13y03m" "" "" "" "no" "" "" "" "" "" "" "0000083825" "00225" "00105919" "01744" "Unknown" "16y" "mild macrocephaly (PC= 51cm); Broad forehead; Almond shaped eyes; Depressed nasal bridge; midfacial hypoplasia with mandibular prognathia; acromelic limb shortening; Cafe-au-lait spots (left forearm and left scapula); fetal alcohol syndrome history; short stature (HP:0004322); delayed growth (HP:00001510); flat nasal bridge (HP:0005280); normal teeth; brachydactyly-E (HP:0005863); metacapal short; normal hormone levels; no hpercalciuria (-HP:0002150); intellectual disability (HP:0001249); no obesity (-HP:0001513);" "stature, short (HPO_0004322)" "06y" "delayed" "18y" "6y" "" "" "yes" "" "" "" "" "" "" "0000085338" "00223" "00107544" "01744" "Familial" "02y02m" "normal stature; no growth abnormality (-HP:0001507); mild intellectual disability (HP:0001256); brachydactyly (HP:000156); ectopic ossification (HP:0011986); calcification cartilage (HP:0100593); hypercalcemia (HP:0003072); thyroid-stimulating hormone excess (HP:0002925)" "-" "" "normal" "" "" "" "" "mild" "" "" "" "" "" "" "0000085339" "00223" "00107545" "01744" "Familial" "00y00m05d" "short stature (HP:0004322); delayed growth (HP:00001510); mild intellectual disability (HP:0001256); brachydactyly (HP:000156); hypercalcemia (HP:0003072); abnormal chloride homeostasis (HP:0011422); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "stature, short (HPO_0004322)" "" "delayed" "" "" "" "" "mild" "" "" "" "" "" "" "0000085340" "00223" "00107546" "01744" "Unknown" "14y" "delayed puberty (HP:0000823); ectopic ossification (HP:0011986); high parathyroid hormone, hyperparathyroidism (HP:0000843)" "?" "" "?" "" "" "" "" "?" "" "" "" "" "" "" "0000085479" "00223" "00107714" "01744" "Familial" "" "short stature (HP:0004322); mild intellectual disability (HP:0001256); delayed puberty (HP:0000823); no dysmorphic face (-HP:0001999); brachydactyly (HP:000156); widely spaced teeth (HP:0000687); no ectopic ossification (-HP:0011986); no calcifications; hypercalcemia (HP:0003072); high parathyroid hormone, hyperparathyroidism (HP:0000843), thyroid-stimulating hormone excess (HP:0002925)" "stature, short (HPO_0004322)" "" "n/a" "15y08m" "" "" "" "mild" "" "" "" "" "" "" "0000085480" "00223" "00107715" "01744" "Unknown" "" "normal stature; moderate intellectual disability (HP:0002342); round face (HP:0000311); brachydactyly (HP:000156); small teeth (HP:0000691); no ectopic ossification (-HP:0011986); brain/intracerebral/intracranial calcification (HP:0002514); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843)" "-" "" "n/a" "04y08m" "" "" "" "moderate" "" "" "" "" "" "" "0000085481" "00223" "00107716" "01744" "Unknown" "08y07m" "normal stature; moderate intellectual disability (HP:0002342); round face (HP:0000311); brachydactyly (HP:000156); widely spaced teeth (HP:0000687); ectopic ossification (HP:0011986); no hypercalcemia (-HP:0003072); hyperphosphatemia (HP:0002905); high parathyroid hormone, hyperparathyroidism (HP:0000843)" "-" "" "n/a" "" "" "" "" "moderate" "" "" "" "" "" "" "0000087501" "00139" "00111415" "00729" "Isolated (sporadic)" "" "Mild ID, obesity, normal growth, several fractures, hypertonia lower limbs, movement anomalies; mild intellectual disability (HP:0001256); mild global developmental delay (HP:0011342)" "" "" "" "" "" "" "" "mild" "" "" "" "" "" "" "0000093339" "00225" "00117961" "01744" "Unknown" "30y" "IUGR; Low birth weight (1600g); supernumerary ribs (13 pairs); hyperactivity; hypoacusia; delayed language acquisition; malar hypoplasia; high-arched palate; thorax asymmetry; pectum excavatum; short stature (HP:0004322); delayed growth (HP:00001510); brachydactyly-E (HP:0005863); broad face; finger short thumb;metacapal short 4rd, metacapal short 5th; thyroid-stimulating hormone excess (HP:0002925); no hpercalciuria (-HP:0002150); mild intellectual disability; no obesity (-HP:0001513);" "stature, short (HPO_0004322)" "10y" "delayed" "30y" "" "" "" "mild" "" "" "" "" "" "" "0000094168" "00223" "00121856" "01199" "Familial, autosomal dominant" "00y" "pancreatic insufficiency; loose stools; dysmorphic face (HP:0001999); brachydactyly (HP:000156); high circulating parathyroid hormone (HP:0003165)" "?" "03y04m" "?" "03y04m" "" "" "" "?" "" "" "" "" "" "" "0000104127" "00223" "00131908" "01202" "Isolated (sporadic)" "" "Hypothyroidism (HP:0000821), overweight (HP:0025502), osteoma cutis (HP:0025027), muscle cramps (HP:0003394),; short stature (HP:0004322); borderline intellectual disability (HP:0006889); brachydactyly, type E (HP:0005863); high circulating parathyroid hormone (HP:0003165)" "stature, short (HPO_0004322)" "" "" "02y" "" "" "" "borderline" "" "" "" "" "" "" "0000104128" "00223" "00131909" "01202" "Isolated (sporadic)" "" "Pseudohypoparathyroidism (HP:0000852); intellectual disability (HP:0001249); round face (HP:0000311); brachydactyly, type E (HP:0005863); no ectopic ossification (-HP:0011986); no calcifications; hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905);" "" "" "" "06y" "" "" "" "yes" "" "" "" "" "" "" "0000104129" "00223" "00131910" "01202" "Isolated (sporadic)" "" "Hypothyroidism (HP:0000821), Broad foot (HP:0001769), short nose (HP:0003196), neck pterygia (HP:0009759), narrow chest (HP:0000774), Pseudohypoparathyroidism (HP:0000852); no growth abnormality (-HP:0001507); round face (HP:0000311); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905);" "?" "04y" "normal" "" "" "" "" "" "" "" "" "" "" "" "0000104130" "00223" "00131911" "01202" "Isolated (sporadic)" "" "cafe-au-lait spot (HP:0000957),cryptorchidism (HP:0000028), hypothyroidism (HP:0000821); no dysmorphic face (-HP:0001999); obesity (HP:0001513); brachydactyly (HP:000156); ectopic ossification (HP:0011986); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905); high circulating parathyroid hormone (HP:0003165)" "" "" "" "07y" "subcutaneous calcification (HP:0007618)" "" "" "" "" "" "" "" "" "" "0000104131" "00223" "00131912" "01202" "Familial, autosomal dominant" "" "Pseudohypoparathyroidism (HP:0000852), hypothyroidism (HP:0000821), subcutaneous calcification (HP:0007618); short stature (HP:0004322); no intellectual disability (-HP:0001249); round face (HP:0000311); brachydactyly (HP:000156); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905);" "stature, short (HPO_0004322)" "" "" "04y" "" "" "" "no" "" "" "" "" "" "" "0000104132" "00225" "00131913" "01202" "Unknown" "" "Calcinosis (HP:0003761), subcutaneous calcification (HP:0007618), periarticular calcification (HP:0025477), no hypothyroidism (-HP:0000821), no elevated circulating parathyroid hormone level (-HP:0003165); short stature (HP:0004322); round face (HP:0000311); hypercalcemia; hypophosphatemia; normal onset puberty;" "stature, short (HPO_0004322)" "" "" "59y" "" "" "" "" "" "" "" "" "" "" "0000104133" "00223" "00131914" "01202" "Isolated (sporadic)" "" "Subcutaneous calcification (HP:0007618), no hypocalcemia (-HP:0002901), hypothyroidism (HP:0000821); hyperphosphatemia (HP:0002905);" "" "01y" "" "01y" "" "" "" "" "" "" "" "" "" "" "0000104134" "00223" "00131915" "01202" "Isolated (sporadic)" "" "Osteopenia (HP:0000938), asthma (HP:0002099), sleep apnea (HP:0010535), cardiorespiratory arrest (HP:0006543), hypothyroidism (HP:0000821), pseudohypoparathyroidism (HP:0000852); intellectual disability (HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905);" "" "" "" "04y" "" "" "" "yes" "" "" "" "" "" "" "0000104135" "00223" "00131916" "01202" "Isolated (sporadic)" "" "Pseudohypoparathyroidism (HP:0000852), hypothyroidism (HP:0000821), subcutaneous calcification (HP:0007618); no intellectual disability (-HP:0001249); round face (HP:0000311); brachydactyly, type E (HP:0005863); hyperphosphatemia (HP:0002905);" "" "" "" "01y" "" "" "" "no" "" "" "" "" "" "" "0000104136" "00225" "00131917" "01202" "Isolated (sporadic)" "" "Subcutaneous calcification (HP:0007618); brachydactyly-E (HP:0005863); no hpercalciuria (-HP:0002150); vitamin D deficiency (HP:0100512)" "" "" "" "" "" "" "" "?" "" "" "" "" "" "" "0000104137" "00223" "00131918" "01202" "Isolated (sporadic)" "" "Pseudohypoparathyroidism (HP:0000852), hypothyroidism (HP:0000821), asthma (HP:0002099); intellectual disability (HP:0001249); round face (HP:0000311); brachydactyly, type E (HP:0005863); hyperphosphatemia (HP:0002905);" "" "" "" "01y" "" "" "" "yes" "" "" "" "" "" "" "0000104138" "00223" "00131919" "01202" "Unknown" "" "Hypothyroidism (HP:0000821); short stature (HP:0004322); growth abnormality (HP:0001507); intellectual disability (HP:0001249); normal onset puberty; round face (HP:0000311); obesity (HP:0001513); brachydactyly, type E (HP:0005863); no ectopic ossification (-HP:0011986); no calcifications;" "stature, short (HPO_0004322)" "" "abnormal" "12y" "obesity (HP:0001513), absent pubertal growth spurt (HP:0031087)" "" "" "yes" "" "" "" "" "" "" "0000104140" "00223" "00131921" "01202" "Unknown" "" "Subcutaneous calcification (HP:0007618), cryptorchidism (HP:0000028), hypothyroidism (HP:0000821), pseudohypoparathyroidism (HP:0000852), global developmental delay (HP:0001263), sagittal craniosynostosis (HP:0004442), gait ataxia (HP:0002066); round face (HP:0000311); brachydactyly, type E (HP:0005863); brain/intracerebral/intracranial calcification (HP:0002514); hypocalcemic seizures (HP:0002199);" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000104144" "00223" "00131925" "01202" "Familial, autosomal dominant" "" "Pseudohypoparathyroidism (HP:0000852)" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000104148" "00223" "00131929" "01202" "Isolated (sporadic)" "" "hypothyroidism (HP:0000821); no intellectual disability (-HP:0001249); round face (HP:0000311); brachydactyly, type E (HP:0005863); hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905);" "" "" "" "" "" "" "" "no" "" "" "" "" "" "" "0000104151" "00223" "00131932" "01202" "Isolated (sporadic)" "" "Low urinary cyclic AMP response to PTH administration (HP:0003456), hypothyroidism (HP:0000821), pseudohypoparathyroidism (HP:0000852); intellectual disability (HP:0001249); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); no calcifications; hypercalcemia (HP:0003072); hyperphosphatemia (HP:0002905);" "" "" "" "00y17m" "" "" "" "yes" "" "" "" "" "" "" "0000104160" "00223" "00131942" "01202" "Isolated (sporadic)" "" "Pseudohypoparathyroidism (HP:0000852), hypothyroidism (HP:0000821); no intellectual disability (-HP:0001249); precocious male puberty (HP:0008185); round face (HP:0000311); obesity (HP:0001513); brachydactyly (HP:000156); accelerated bone age (HP:0002805); no calcifications; no hypercalcemia (-HP:0003072); hyperphosphatemia (HP:0002905);" "" "" "" "08y" "obesity (HP:0001513)" "" "" "no" "" "" "" "" "" "" "0000104240" "00224" "00132024" "01202" "Isolated (sporadic)" "" "pseudohypoparathyroidism (HP:0000852), hypothyroidism (HP:0000821); obesity (HP:0001513); delayed puberty (HP:0000853); growth hormone deficiency (HP:0000824)" "" "" "" "11y" "" "" "" "" "" "" "" "" "" "" "0000104273" "00223" "00132069" "01396" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000116451" "00225" "00143690" "01744" "Isolated (sporadic)" "17y" "short stature (HP:0004322) (<3rd centile); brachydactyly-E (HP:0005863); no calcification; metacapal short 3rd;metacapal short 4rd, metacapal short 5th; normal hormone levels; no hpercalciuria (-HP:0002150); borderline intellectual disability; no obesity (-HP:0001513); no ectopic ossification (-HP:0011986); normal vitamins" "yes (<3rd centile)" "" "n/a" "17y" "" "" "" "borderline" "" "" "" "" "" "" "0000117207" "00225" "00144440" "01744" "Familial, autosomal dominant" "11y04m" "growth delay (HP:0001510); short stature (HP:0004322) (<3rd centile); delayed growth (HP:00001510); no nasal bridge; normal teeth; brachydactyly-E (HP:0005863); normal skin; no calcification; normal face; metacapal short 3rd;metacapal short 4rd, metacapal short 5th; normal hormone levels; no hpercalciuria (-HP:0002150); no intellectual disability (-HP:0001249); decreased body weight (HP:0004325);" "yes (<3rd centile)" "" "delayed" "11y04m" "growth delay (HP:0001510)" "" "" "no" "" "" "" "" "" "" "0000117208" "00225" "00144441" "01744" "Familial, autosomal dominant" "" "short stature (HP:0004322) (<3rd centile);" "yes (<3rd centile)" "" "" "20y" "" "" "" "" "" "" "" "" "" "" "0000117209" "00225" "00144442" "01744" "Familial, autosomal dominant" "52y" "short stature (HP:0004322) (<3rd centile);" "yes (<3rd centile)" "" "" "52y" "" "" "" "" "" "" "" "" "" "" "0000175708" "00399" "00235448" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "dominantly inherited nephrogenic syndrome of inappropriate antidiuresis (NSIAD)" "" "0000175709" "00399" "00235449" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "dominantly inherited nephrogenic syndrome of inappropriate antidiuresis (NSIAD)" "" "0000232946" "01544" "00307142" "03753" "-" "" "Unilateral" "" "" "" "00y35m" "HP:0000555" "" "" "" "" "" "" "" "" "" "0000233064" "01544" "00307260" "03753" "Unknown" "" "Unilateral" "" "" "" "00y25m" "HP:0000486" "" "" "" "" "" "" "" "" "" "0000249653" "05517" "00331461" "00000" "Familial, autosomal dominant" "" "Metopic synostosis, Hydronephrosis, Gray matter heterotopias, Hypoplasia of the corpus Yes" "" "" "" "" "" "" "" "" "" "" "" "Acromelic dysplasias" "skeletal dysplasia" "" "0000253966" "00223" "00358751" "01164" "Unknown" "15y" "(+) Strabismus,(+) Pseudohypoparathyroidism,(+) Osteopenia,(+) Brachydactyly,(+) Seizure,(+) Basal ganglia calcification,(+) Scoliosis,(+) Paresthesia,(+) Back pain,(+) Subcortical white matter calcifications,(+) Compensated hypothyroidism,(+) Fibroma,(+) Calcification of muscles,(+) Cognitive impairment,(+) Calcinosis cutis,(+) Cautious gait,(+) Pain in head and neck region; no growth abnormality (-HP:0001507);" "" "" "normal" "" "" "" "" "" "" "" "" "" "" "" "0000257046" "00139" "00361641" "00006" "Isolated (sporadic)" "2y" "syndromic; global developmental delay, hypoplastic scortum with fistula, asymmetrical face, metopic craniosynostosis,hydronephrosis, brain heterotopia, thyroid agenesis" "" "" "" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000279785" "00198" "00229574" "00006" "Familial" "" "see paper; ..., pseudohypoparathyroidism; mother has variant on paternal allele causing pseudopseudohypoparathyroidism" "" "" "" "" "" "" "" "" "" "" "" "" "pseudohypoparathyroidism" "" "0000279786" "00223" "00229576" "00006" "Familial, autosomal dominant" "" "see paper; ..., pseudohypoparathyroidism; mother pseudopseudohypoparathyreoidism (variant on paternal allele)" "" "" "" "" "" "" "" "" "" "" "" "" "pseudohypoparathyroidism" "" "0000310858" "00198" "00419577" "02300" "Isolated (sporadic)" "13y" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000310900" "00198" "00419619" "02300" "Isolated (sporadic)" "12y" "" "" "" "" "" "" "" "" "" "" "" "" "" "skeletal and/or connective tissue abnormality" "" "0000346260" "05611" "00457811" "00006" "Isolated (sporadic)" "02y" "see paper; ..., birth weight ≤2SD; motor delay; delayed speech/ language development; no intellectual disability; MRI brain abnormal; no broad forehead; no facial asymmetry; no broad nasal tip; no thick lower lip vermilion; pointed chin; no ear abnormality; no eye abnormalities; skeletal abnormalities; large open spinal dysraphism; bladder/bowel incontinence" "" "" "" "" "" "" "" "" "" "" "" "GADEVS" "facial dysmorphism, mildly delayed motor/speech development" "" "0000352476" "00198" "00467269" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "PHP1A" "parathyroidism" "" "0000354102" "00198" "00468949" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "multiple congenital anomalies" "" "0000354971" "05517" "00469826" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "PHP1A" "skeletal dysplasia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 110 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000029672" "00029629" "1" "00688" "00688" "2014-04-08 17:58:38" "01200" "2014-04-09 13:58:25" "SEQ-NG-I" "DNA" "" "" "0000029673" "00029630" "1" "00688" "00688" "2014-04-08 18:03:36" "01200" "2014-04-09 14:00:33" "SEQ-NG-I" "DNA" "" "" "0000029674" "00029631" "1" "00688" "00688" "2014-04-08 18:11:05" "01200" "2014-04-09 14:00:33" "SEQ;SEQ-NG-I" "DNA" "" "" "0000079744" "00079670" "1" "00006" "00006" "2016-08-17 12:54:21" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000081427" "00081316" "1" "01744" "01744" "2016-10-04 11:42:52" "" "" "SEQ" "DNA" "peripheral blood" "" "0000081429" "00081317" "1" "01744" "01744" "2016-10-04 19:49:44" "01199" "2016-10-21 15:19:07" "SEQ" "DNA" "peripheral blood" "" "0000081430" "00081319" "1" "01744" "01744" "2016-10-05 11:57:22" "" "" "SEQ" "DNA" "peripheral blood" "" "0000081839" "00081710" "1" "01744" "01744" "2016-10-19 14:01:47" "01744" "2016-10-24 15:23:01" "SEQ" "DNA" "peripheral blood" "" "0000081840" "00081711" "1" "01744" "01744" "2016-10-19 15:27:16" "01744" "2016-10-24 15:23:51" "SEQ" "DNA" "peripheral blood" "" "0000081841" "00081712" "1" "01744" "01744" "2016-10-19 15:41:22" "01744" "2016-10-24 15:29:28" "SEQ" "DNA" "peripheral blood" "" "0000081842" "00081713" "1" "01744" "01744" "2016-10-19 16:00:43" "01744" "2016-10-24 15:30:27" "SEQ" "DNA" "peripheral blood" "" "0000081843" "00081714" "1" "01744" "01744" "2016-10-19 18:37:25" "01744" "2016-10-24 15:40:13" "SEQ" "DNA" "peripheral blood" "" "0000081845" "00081709" "1" "01744" "01744" "2016-10-20 13:34:19" "" "" "SEQ" "DNA" "peripheral blood" "" "0000081849" "00081720" "1" "01744" "01744" "2016-10-21 11:14:43" "01744" "2016-10-24 15:31:53" "SEQ" "DNA" "peripheral blood" "" "0000081852" "00081723" "1" "01744" "01744" "2016-10-21 13:41:50" "01744" "2016-10-24 15:33:02" "SEQ" "DNA" "peripheral blood" "" "0000081853" "00081724" "1" "01744" "01744" "2016-10-21 13:50:44" "01744" "2016-10-24 15:34:16" "SEQ" "DNA" "peripheral blood" "" "0000081948" "00081818" "1" "01199" "01199" "2016-10-24 13:36:26" "" "" "arraySNP;MLPA-ms" "DNA" "" "" "0000081950" "00081820" "1" "01744" "01744" "2016-10-24 15:16:18" "01744" "2016-10-24 15:35:35" "SEQ" "DNA" "peripheral blood" "" "0000081951" "00081821" "1" "01744" "01744" "2016-10-24 15:50:44" "" "" "SEQ" "DNA" "peripheral blood" "" "0000081952" "00081822" "1" "01744" "01744" "2016-10-24 16:04:53" "" "" "SEQ" "DNA" "peripheral blood" "" "0000081953" "00081823" "1" "01744" "01744" "2016-10-24 16:13:47" "" "" "SEQ" "DNA" "peripheral blood" "" "0000081954" "00081824" "1" "01744" "01744" "2016-10-24 16:26:29" "" "" "SEQ" "DNA" "peripheral blood" "" "0000087347" "00087209" "1" "01744" "01744" "2016-11-15 13:51:17" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087348" "00087210" "1" "01744" "01744" "2016-11-15 14:20:17" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087349" "00087211" "1" "01744" "01744" "2016-11-15 14:34:33" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087350" "00087212" "1" "01744" "01744" "2016-11-15 15:14:39" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087351" "00087213" "1" "01744" "01744" "2016-11-15 16:39:20" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087352" "00087214" "1" "01744" "01744" "2016-11-15 17:12:19" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087353" "00087215" "1" "01744" "01744" "2016-11-15 19:34:02" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087354" "00087216" "1" "01744" "01744" "2016-11-15 19:55:48" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087355" "00087217" "1" "01744" "01744" "2016-11-15 20:21:58" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087356" "00087218" "1" "01744" "01744" "2016-11-15 20:41:00" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087357" "00087219" "1" "01744" "01744" "2016-11-15 21:30:52" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087358" "00087220" "1" "01744" "01744" "2016-11-15 21:38:41" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087359" "00087221" "1" "01744" "01744" "2016-11-15 22:26:14" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087360" "00087222" "1" "01744" "01744" "2016-11-15 22:49:34" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087361" "00087223" "1" "01744" "01744" "2016-11-15 23:02:44" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087362" "00087224" "1" "01744" "01744" "2016-11-15 23:44:58" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000087364" "00087226" "1" "01744" "01744" "2016-11-16 00:05:28" "" "" "SEQ" "DNA" "blood leukocytes" "" "0000088397" "00088254" "1" "01744" "01744" "2016-11-25 11:13:58" "" "" "SEQ" "DNA" "peripheral blood" "" "0000088399" "00088256" "1" "01744" "01744" "2016-11-25 14:16:39" "" "" "RT-PCR;SEQ" "DNA;RNA" "peripheral blood" "" "0000089179" "00089034" "1" "01744" "01744" "2016-11-28 12:08:35" "" "" "SEQ" "DNA" "peripheral blood" "" "0000089287" "00089141" "1" "01744" "01744" "2016-11-30 12:36:11" "" "" "SEQ" "DNA" "peripheral blood" "" "0000092424" "00092284" "1" "01744" "01744" "2016-12-20 16:53:48" "" "" "SEQ" "DNA" "peripheral blood" "" "0000100647" "00100243" "1" "01744" "01744" "2017-02-08 13:17:54" "" "" "SEQ" "DNA" "peripheral blood" "" "0000100658" "00100255" "1" "01744" "01744" "2017-02-09 11:54:54" "" "" "SEQ" "DNA" "peripheral blood" "" "0000100661" "00100258" "1" "01744" "01744" "2017-02-09 12:09:41" "" "" "SEQ" "DNA" "peripheral blood" "" "0000100663" "00100260" "1" "01744" "01744" "2017-02-09 12:19:59" "" "" "SEQ" "DNA" "peripheral blood" "" "0000101063" "00100646" "1" "01202" "01202" "2017-03-07 16:50:03" "" "" "SEQ" "DNA" "blood" "" "0000101068" "00100648" "1" "01202" "01202" "2017-03-07 17:35:35" "" "" "SEQ" "DNA" "blood" "" "0000101069" "00100650" "1" "01202" "01202" "2017-03-07 18:10:39" "" "" "SEQ" "DNA" "blood" "" "0000101071" "00100651" "1" "01202" "01202" "2017-03-07 18:47:44" "" "" "SEQ" "DNA" "blood" "" "0000104412" "00103954" "1" "01744" "01744" "2017-04-24 12:14:21" "" "" "SEQ" "DNA" "peripheral blood leukocytes" "" "0000105361" "00104887" "1" "01744" "01744" "2017-06-06 11:50:24" "" "" "SEQ" "DNA" "Peripheral blood lymphocytes" "" "0000105362" "00104888" "1" "01744" "01744" "2017-06-06 12:36:14" "" "" "SEQ" "DNA" "Peripheral blood lymphocytes" "" "0000105363" "00104889" "1" "01744" "01744" "2017-06-06 12:45:46" "" "" "SEQ" "DNA" "Peripheral blood lymphocytes" "" "0000105365" "00104892" "1" "01744" "01744" "2017-06-07 19:46:28" "" "" "SEQ" "DNA" "peripheral blood" "" "0000106391" "00105919" "1" "01744" "01744" "2017-06-27 14:30:34" "01744" "2017-07-18 09:03:29" "RT-PCR;SEQ" "DNA;RNA" "peripheral blood" "" "0000108015" "00107544" "1" "01744" "01744" "2017-07-14 12:29:00" "" "" "SEQ" "DNA" "" "" "0000108016" "00107545" "1" "01744" "01744" "2017-07-14 12:37:07" "" "" "SEQ" "DNA" "" "" "0000108017" "00107546" "1" "01744" "01744" "2017-07-14 12:42:21" "" "" "SEQ" "DNA" "" "" "0000108185" "00107714" "1" "01744" "01744" "2017-07-17 13:27:45" "" "" "SEQ" "DNA" "Peripheral blood lymphocytes" "" "0000108186" "00107715" "1" "01744" "01744" "2017-07-17 13:56:53" "" "" "SEQ" "DNA" "Peripheral blood lymphocytes" "" "0000108187" "00107716" "1" "01744" "01744" "2017-07-17 14:06:30" "" "" "SEQ" "DNA" "Peripheral blood lymphocytes" "" "0000111880" "00111415" "1" "00729" "00729" "2017-08-03 07:55:26" "01199" "2017-08-21 17:19:38" "SEQ-NG" "DNA" "" "" "0000118425" "00117961" "1" "01744" "01199" "2017-09-05 12:42:06" "" "" "SEQ" "DNA" "peripheral blood" "" "0000122324" "00121856" "1" "01744" "01199" "2017-09-12 12:49:01" "" "" "SEQ" "DNA" "peripheral blood" "" "0000132751" "00131908" "1" "01202" "01202" "2017-09-29 10:27:43" "" "" "SEQ-NG-IT" "DNA" "" "" "0000132752" "00131909" "1" "01202" "01202" "2017-09-29 11:12:59" "01199" "2017-09-29 14:58:07" "SEQ" "DNA" "" "" "0000132753" "00131910" "1" "01202" "01202" "2017-09-29 13:29:50" "" "" "SEQ" "DNA" "" "" "0000132754" "00131911" "1" "01202" "01202" "2017-09-29 14:05:43" "" "" "SEQ" "DNA" "" "" "0000132755" "00131912" "1" "01202" "01202" "2017-09-29 14:21:35" "" "" "SEQ" "DNA" "" "" "0000132756" "00131913" "1" "01202" "01202" "2017-09-29 14:34:09" "" "" "SEQ" "DNA" "" "" "0000132757" "00131914" "1" "01202" "01202" "2017-09-29 16:36:59" "" "" "SEQ" "DNA" "" "" "0000132758" "00131915" "1" "01202" "01202" "2017-09-29 16:59:36" "" "" "SEQ" "DNA" "" "" "0000132759" "00131916" "1" "01202" "01202" "2017-09-29 17:22:05" "" "" "SEQ" "DNA;RNA" "" "" "0000132760" "00131917" "1" "01202" "01202" "2017-10-02 09:33:31" "" "" "SEQ" "DNA" "" "" "0000132761" "00131918" "1" "01202" "01202" "2017-10-02 10:27:18" "" "" "SEQ" "DNA" "" "" "0000132762" "00131919" "1" "01202" "01202" "2017-10-02 11:43:48" "" "" "SEQ" "DNA" "" "" "0000132764" "00131921" "1" "01202" "01202" "2017-10-02 14:26:41" "" "" "SEQ" "DNA" "" "" "0000132769" "00131925" "1" "01202" "01202" "2017-10-02 15:34:15" "" "" "SEQ" "DNA" "" "" "0000132771" "00131929" "1" "01202" "01202" "2017-10-03 08:32:35" "" "" "SEQ" "DNA" "" "" "0000132774" "00131932" "1" "01202" "01202" "2017-10-03 11:55:38" "" "" "SEQ" "DNA" "" "" "0000132782" "00131942" "1" "01202" "01202" "2017-10-04 10:46:40" "" "" "SEQ" "DNA" "" "" "0000132864" "00132024" "1" "01202" "01202" "2017-10-09 17:10:21" "" "" "SEQ" "DNA" "blood" "" "0000132908" "00132069" "1" "01396" "01396" "2017-10-18 18:21:33" "" "" "SEQ-NG-I" "DNA" "" "" "0000144547" "00143690" "1" "01744" "01199" "2017-12-04 12:31:23" "" "" "RT-PCR;SEQ" "DNA;RNA" "peripheral blood" "" "0000145298" "00144440" "1" "01744" "01199" "2017-12-14 13:27:23" "" "" "SEQ" "DNA" "peripheral blood" "" "0000145299" "00144441" "1" "01744" "01199" "2017-12-14 13:34:09" "" "" "SEQ" "DNA" "peripheral blood" "" "0000145300" "00144442" "1" "01744" "01199" "2017-12-14 13:43:52" "" "" "SEQ" "DNA" "peripheral blood" "" "0000230666" "00229574" "1" "01261" "01261" "2019-03-30 16:02:54" "" "" "SEQ-NG-I" "DNA" "blood" "TruSight One panel (4813 genes)" "0000230667" "00229575" "1" "01261" "01261" "2019-03-30 16:12:45" "" "" "SEQ-NG-I" "DNA" "blood" "WES" "0000230668" "00229576" "1" "01261" "01261" "2019-03-30 16:24:04" "" "" "SEQ-NG-I" "DNA" "blood" "Trio WES" "0000236552" "00235448" "1" "00006" "00006" "2019-05-27 14:19:06" "" "" "SEQ" "DNA" "" "" "0000236553" "00235449" "1" "00006" "00006" "2019-05-27 14:24:36" "" "" "SEQ" "DNA" "" "" "0000294127" "00292959" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000305995" "00304866" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000308283" "00307142" "1" "03753" "03753" "2020-08-04 07:20:11" "" "" "SEQ-NG-I" "DNA" "blood/FFPE tumor" "gene panel" "0000308402" "00307260" "1" "03753" "03753" "2020-08-07 03:50:40" "" "" "SEQ-NG-I" "DNA" "blood/FFPE tumor" "160 genes" "0000332680" "00331461" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000359981" "00358751" "1" "01164" "01164" "2021-03-11 16:11:26" "" "" "SEQ-NG-I" "DNA" "" "" "0000360648" "00359406" "1" "03149" "03149" "2021-03-20 18:29:35" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000360649" "00359407" "1" "03149" "03149" "2021-03-20 18:40:19" "" "" "SEQ-NG-I" "DNA" "" "" "0000362869" "00361641" "1" "00006" "00006" "2021-04-07 19:07:03" "" "" "SEQ-NG" "DNA" "" "WES" "0000420881" "00419577" "1" "02300" "00006" "2022-10-20 16:24:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000420923" "00419619" "1" "02300" "00006" "2022-10-20 16:24:48" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000459431" "00457811" "1" "00006" "00006" "2024-11-19 15:24:10" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000468932" "00467269" "1" "00006" "00006" "2025-10-10 16:20:58" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000470617" "00468949" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000471494" "00469826" "1" "00006" "00006" "2025-11-20 12:33:13" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 95 "{{screeningid}}" "{{geneid}}" "0000029672" "GNAS" "0000029673" "GNAS" "0000029674" "GNAS" "0000079744" "GNAS" "0000081427" "GNAS" "0000081429" "GNAS" "0000081430" "GNAS" "0000081839" "GNAS" "0000081840" "GNAS" "0000081841" "GNAS" "0000081842" "GNAS" "0000081843" "GNAS" "0000081845" "GNAS" "0000081849" "GNAS" "0000081852" "GNAS" "0000081853" "GNAS" "0000081948" "GNAS" "0000081950" "GNAS" "0000081951" "GNAS" "0000081952" "GNAS" "0000081953" "GNAS" "0000081954" "GNAS" "0000087347" "GNAS" "0000087348" "GNAS" "0000087349" "GNAS" "0000087350" "GNAS" "0000087351" "GNAS" "0000087352" "GNAS" "0000087353" "GNAS" "0000087354" "GNAS" "0000087355" "GNAS" "0000087356" "GNAS" "0000087357" "GNAS" "0000087358" "GNAS" "0000087359" "GNAS" "0000087360" "GNAS" "0000087361" "GNAS" "0000087362" "GNAS" "0000087364" "GNAS" "0000088397" "GNAS" "0000088399" "GNAS" "0000089179" "GNAS" "0000089287" "GNAS" "0000092424" "GNAS" "0000100647" "GNAS" "0000100658" "GNAS" "0000100661" "GNAS" "0000100663" "GNAS" "0000101063" "GNAS" "0000101068" "GNAS" "0000101069" "GNAS" "0000101071" "GNAS" "0000104412" "GNAS" "0000105361" "GNAS" "0000105362" "GNAS" "0000105363" "GNAS" "0000105365" "GNAS" "0000106391" "GNAS" "0000108015" "GNAS" "0000108016" "GNAS" "0000108017" "GNAS" "0000108185" "GNAS" "0000108186" "GNAS" "0000108187" "GNAS" "0000111880" "GNAS" "0000118425" "GNAS" "0000122324" "GNAS" "0000132751" "GNAS" "0000132752" "GNAS" "0000132753" "GNAS" "0000132754" "GNAS" "0000132755" "GNAS" "0000132756" "GNAS" "0000132757" "GNAS" "0000132758" "GNAS" "0000132759" "GNAS" "0000132760" "GNAS" "0000132761" "GNAS" "0000132762" "GNAS" "0000132764" "GNAS" "0000132769" "GNAS" "0000132771" "GNAS" "0000132774" "GNAS" "0000132782" "GNAS" "0000132864" "GNAS" "0000132908" "GNAS" "0000144547" "GNAS" "0000145298" "GNAS" "0000145299" "GNAS" "0000145300" "GNAS" "0000236552" "GNAS" "0000236553" "GNAS" "0000332680" "GNAS" "0000359981" "GNAS" "0000362869" "GNAS" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 490 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000053052" "21" "70" "20" "57416653" "57416693" "del" "0" "00688" "GNAS_000174" "g.57416653_57416693del" "" "" "" "" "variant in first intron NESP55" "Germline" "yes" "" "0" "" "" "g.58841598_58841638del" "" "likely pathogenic" "" "0000053053" "21" "70" "20" "57416653" "57416693" "del" "0" "00688" "GNAS_000174" "g.57416653_57416693del" "" "" "" "" "variant in intron 1 NESP55" "Germline" "yes" "" "0" "" "" "g.58841598_58841638del" "" "likely pathogenic" "" "0000053054" "0" "50" "20" "57418256" "57418290" "del" "0" "00688" "GNAS_000176" "g.57418256_57418290del" "" "" "" "" "deletion intron 1 NESP55; no coding variants of GNAS exons 2-13" "Germline" "yes" "" "0" "hypomethylation of GNAS-AS, XLAS, GNASA/B; hypermethylation NESP55 DMRs" "" "g.58843201_58843235del" "" "VUS" "" "0000128520" "0" "50" "20" "57485814" "57485814" "subst" "0" "00006" "GNAS_000231" "g.57485814T>C" "" "for submitter, unpublished" "" "NM_000516:c.1115T>C (I372T)" "variant found by whole-exome sequencing; association with phenotype considered likely, please contact when you have found this variant" "De novo" "-" "" "1" "" "" "g.58910759T>C" "" "VUS" "" "0000130563" "21" "90" "20" "57466782" "57466782" "subst" "0" "01744" "GNAS_000005" "g.57466782A>G" "" "{PMID:Klaassens et al. 2010:19863504}" "" "" "" "Germline" "" "" "0" "" "" "g.58891727A>G" "" "pathogenic" "" "0000130565" "10" "70" "20" "57466783" "57466783" "subst" "0" "01744" "GNAS_000232" "g.57466783T>G" "" "{PMID:Long et al. 2007: 17164301}" "" "" "" "Germline" "" "" "0" "" "" "g.58891728T>G" "" "likely pathogenic" "" "0000130566" "21" "70" "20" "57466802" "57466802" "dup" "0" "01744" "GNAS_000126" "g.57466802dup" "" "{PMID:Germain-Lee et al. 2003:12970262}" "" "c.21insT" "" "Germline" "yes" "" "0" "" "" "g.58891747dup" "" "likely pathogenic" "" "0000132519" "11" "70" "20" "57466802" "57466802" "dup" "0" "01744" "GNAS_000126" "g.57466802dup" "" "{PMID:Long et al. 2007: 17164301}" "" "c.21insT" "" "Germline" "yes" "" "0" "" "" "g.58891747dup" "" "likely pathogenic" "" "0000132520" "20" "70" "20" "57466866" "57466866" "subst" "0" "01744" "GNAS_000127" "g.57466866C>T" "" "{PMID:Long et al. 2007: 17164301}" "" "" "" "Germline" "" "" "0" "" "" "g.58891811C>T" "" "likely pathogenic" "" "0000132521" "21" "70" "20" "57466866" "57466866" "subst" "0" "01744" "GNAS_000127" "g.57466866C>T" "" "{PMID:Long et al. 2007: 17164301}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891811C>T" "" "likely pathogenic" "" "0000132522" "11" "70" "20" "57466866" "57466866" "subst" "0" "01744" "GNAS_000127" "g.57466866C>T" "" "{PMID:Long et al. 2007: 17164301}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891811C>T" "" "likely pathogenic" "" "0000132523" "20" "70" "20" "57466884" "57466884" "subst" "0" "01744" "GNAS_000057" "g.57466884C>T" "" "{PMID:Long et al. 2007:17164301}" "" "" "" "Germline" "" "" "0" "" "" "g.58891829C>T" "" "likely pathogenic" "" "0000132525" "10" "90" "20" "57466782" "57466782" "subst" "0" "01744" "GNAS_000005" "g.57466782A>G" "" "{PMID:Klaassens et al. 2010:19863504}" "" "" "" "Unknown" "yes" "" "0" "" "" "g.58891727A>G" "" "pathogenic" "" "0000132530" "20" "70" "20" "57480475" "57480477" "del" "0" "01744" "GNAS_000237" "g.57480475_57480477del" "" "{PMID:Long et al. 2007: 17164301}" "" "c.469-471del (E157del)" "" "Germline" "" "" "0" "" "" "g.58905420_58905422del" "" "likely pathogenic" "" "0000132536" "20" "70" "20" "57484404" "57484404" "subst" "0" "01744" "GNAS_000240" "g.57484404G>T" "" "{PMID:Long et al. 2007: 17164301}" "" "c.586-1G>T" "" "Germline" "" "" "0" "" "" "g.58909349G>T" "" "likely pathogenic" "" "0000132551" "10" "70" "20" "57484792" "57484792" "subst" "0" "01744" "GNAS_000034" "g.57484792C>T" "" "{PMID:Long et al. 2007: 17164301}" "" "c.772C>T (R258N)" "" "Germline" "" "" "0" "" "" "g.58909737C>T" "" "likely pathogenic" "" "0000134722" "21" "70" "20" "57224346" "59795557" "del" "0" "01199" "GNAS_000233" "g.57224346_59795557del" "" "{PMID:Garin et al. 2015:25594858}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000134724" "20" "70" "20" "57484770" "57484770" "subst" "0" "01744" "GNAS_000033" "g.57484770C>G" "" "{PMID:Long et al. 2007: 17164301}" "" "c.750C>G (S250R)" "" "Germline" "" "" "0" "" "" "g.58909715C>G" "" "likely pathogenic" "" "0000134725" "20" "70" "20" "57485781" "57485781" "dup" "0" "01744" "GNAS_000244" "g.57485781dup" "" "{PMID:Long et al. 2007: 17164301}" "" "c.1083insC" "" "Germline" "" "" "0" "" "" "g.58910726dup" "" "likely pathogenic" "" "0000134726" "20" "70" "20" "57485784" "57485784" "subst" "0" "01744" "GNAS_000060" "g.57485784A>C" "" "{PMID:Long et al. 2007: 17164301}" "" "c.1088A>C (H362P)" "" "Germline" "" "" "0" "" "" "g.58910729A>C" "" "likely pathogenic" "" "0000134727" "20" "70" "20" "57485873" "57485873" "subst" "0" "01744" "GNAS_000050" "g.57485873G>A" "" "{PMID:Long et al. 2007: 17164301}" "" "c.1174G>A (E392K)" "" "Germline" "" "" "0" "" "" "g.58910818G>A" "" "likely pathogenic" "" "0000134728" "11" "70" "20" "57470742" "57470745" "del" "0" "01744" "GNAS_000236" "g.57470742_57470745del" "" "{PMID:Long et al. 2007: 17164301}" "" "c.212+3delAAGT" "" "Germline" "" "" "0" "" "" "g.58895687_58895690del" "" "likely pathogenic" "" "0000134730" "11" "70" "20" "57466784" "57466784" "subst" "0" "01744" "GNAS_000159" "g.57466784G>A" "" "{PMID:Puzhko et al. 2011:21713996}" "" "" "" "De novo" "" "" "0" "" "" "g.58891729G>A" "" "likely pathogenic" "" "0000140517" "11" "90" "20" "57466866" "57466866" "subst" "0" "01744" "GNAS_000127" "g.57466866C>T" "" "{PMID:Lebrun et al. 2010:20427508}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891811C>T" "" "pathogenic" "" "0000140518" "21" "90" "20" "57466866" "57466866" "subst" "0" "01744" "GNAS_000127" "g.57466866C>T" "" "{PMID:Lebrun et al. 2010:20427508}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891811C>T" "" "pathogenic" "" "0000140520" "0" "90" "20" "57466866" "57466866" "subst" "0" "01744" "GNAS_000127" "g.57466866C>T" "" "{PMID:Lebrun et al. 2010:20427508}" "" "" "" "Unknown" "" "" "0" "" "" "g.58891811C>T" "" "pathogenic" "" "0000140521" "11" "90" "20" "57466921" "57466921" "subst" "0" "01744" "GNAS_000234" "g.57466921G>C" "" "{PMID:Lebrun et al. 2010:20427508}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891866G>C" "" "pathogenic" "" "0000140522" "11" "70" "20" "57478758" "57478759" "ins" "0" "01744" "GNAS_000080" "g.57478758_57478759insT" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.345_346insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58903703_58903704insT" "" "likely pathogenic" "" "0000140523" "11" "90" "20" "57484251" "57484254" "del" "0" "01744" "GNAS_000238" "g.57484251_57484254del" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.565_568delGACT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909196_58909199del" "" "pathogenic" "" "0000140524" "11" "90" "20" "57484251" "57484254" "del" "0" "01744" "GNAS_000238" "g.57484251_57484254del" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.565_568delGACT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909196_58909199del" "" "pathogenic" "" "0000140526" "11" "70" "20" "57484258" "57484259" "del" "0" "01744" "GNAS_000239" "g.57484258_57484259del" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.571_572delGT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909203_58909204del" "" "likely pathogenic" "" "0000140527" "11" "70" "20" "57484443" "57484443" "dup" "0" "01744" "GNAS_000241" "g.57484443dup" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.623_624insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909388dup" "" "likely pathogenic" "" "0000140528" "11" "70" "20" "57485737" "57485737" "subst" "0" "01744" "GNAS_000243" "g.57485737G>A" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.1039-1G>A" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58910682G>A" "" "likely pathogenic" "" "0000140529" "21" "70" "20" "57466921" "57466921" "subst" "0" "01744" "GNAS_000235" "g.57466921G>T" "" "{PMID:Lebrun et al. 2010:20427508}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891866G>T" "" "likely pathogenic" "" "0000140530" "21" "90" "20" "57466921" "57466921" "subst" "0" "01744" "GNAS_000234" "g.57466921G>C" "" "{PMID:Lebrun et al. 2010:20427508}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891866G>C" "" "pathogenic" "" "0000140531" "21" "90" "20" "57478758" "57478759" "ins" "0" "01744" "GNAS_000080" "g.57478758_57478759insT" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.345_346insT" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.58903703_58903704insT" "" "pathogenic" "" "0000140532" "21" "70" "20" "57478758" "57478759" "ins" "0" "01744" "GNAS_000080" "g.57478758_57478759insT" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.345_346insT" "" "Germline/De novo (untested)" "yes" "" "0" "" "" "g.58903703_58903704insT" "" "likely pathogenic" "" "0000140533" "21" "90" "20" "57478758" "57478759" "ins" "0" "01744" "GNAS_000080" "g.57478758_57478759insT" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.345_346insT" "" "Germline" "" "" "0" "" "" "g.58903703_58903704insT" "" "pathogenic" "" "0000140534" "21" "90" "20" "57484251" "57484254" "del" "0" "01744" "GNAS_000238" "g.57484251_57484254del" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.565_568delGACT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909196_58909199del" "" "pathogenic" "" "0000140535" "21" "90" "20" "57484251" "57484254" "del" "0" "01744" "GNAS_000238" "g.57484251_57484254del" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.565_568delGACT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909196_58909199del" "" "pathogenic" "" "0000140536" "21" "90" "20" "57485737" "57485737" "subst" "0" "01744" "GNAS_000243" "g.57485737G>A" "" "{PMID:Lebrun et al. 2010:20427508}" "" "c.1039-1G>A" "" "Germline" "" "" "0" "" "" "g.58910682G>A" "" "pathogenic" "" "0000146068" "11" "70" "20" "57484751" "57484751" "subst" "0" "01744" "GNAS_000242" "g.57484751T>C" "" "{PMID:Pereda et al. 2015:25865609}" "" "c.733T> C (p.Ile244Thr) (mistakenly)" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909696T>C" "" "likely pathogenic" "" "0000146072" "11" "90" "20" "57484251" "57484254" "del" "0" "01744" "GNAS_000238" "g.57484251_57484254del" "" "{PMID:Pereda et al. 2015:25865609}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909196_58909199del" "" "pathogenic" "" "0000147092" "21" "70" "20" "57466802" "57466802" "dup" "0" "01744" "GNAS_000126" "g.57466802dup" "" "{PMID:Germain-Lee et al. 2003:12970262}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891747dup" "" "likely pathogenic" "" "0000147093" "10" "70" "20" "57466802" "57466802" "dup" "0" "01744" "GNAS_000126" "g.57466802dup" "" "{PMID:Germain-Lee et al. 2003:12970262}" "" "" "" "Unknown" "" "" "0" "" "" "g.58891747dup" "" "likely pathogenic" "" "0000147215" "20" "70" "20" "57485781" "57485781" "dup" "0" "01744" "GNAS_000244" "g.57485781dup" "" "{PMID:Germain-Lee et al. 2003:12970262}" "" "c.1083insC" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58910726dup" "" "likely pathogenic" "" "0000150749" "21" "70" "20" "57485806" "57485806" "dup" "0" "01744" "GNAS_000250" "g.57485806dup" "" "NOT PUBLISHED" "" "" "" "Germline" "yes" "" "0" "" "" "g.58910751dup" "" "likely pathogenic" "" "0000162953" "21" "70" "20" "57484847" "57484847" "subst" "0" "01744" "GNAS_000249" "g.57484847T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58909792T>G" "" "likely pathogenic" "" "0000162966" "10" "70" "20" "57484847" "57484847" "subst" "0" "01744" "GNAS_000249" "g.57484847T>G" "" "NOT PUBLISHED" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909792T>G" "" "likely pathogenic" "" "0000162969" "21" "70" "20" "57484847" "57484847" "subst" "0" "01744" "GNAS_000249" "g.57484847T>G" "" "NOT PUBLISHED" "" "" "" "Germline" "yes" "" "0" "" "" "g.58909792T>G" "" "likely pathogenic" "" "0000162971" "21" "70" "20" "57484847" "57484847" "subst" "0" "01744" "GNAS_000249" "g.57484847T>G" "" "NOT PUBLISHED" "" "" "" "Germline" "yes" "" "0" "" "" "g.58909792T>G" "" "likely pathogenic" "" "0000163509" "21" "70" "20" "57466809" "57466809" "subst" "0" "01202" "GNAS_000245" "g.57466809G>T" "" "" "" "" "germline mosaicism in mother (20% VAF)" "Germline" "yes" "" "0" "" "" "g.58891754G>T" "" "likely pathogenic" "" "0000163512" "21" "70" "20" "57466851" "57466851" "subst" "0" "01202" "GNAS_000246" "g.57466851A>T" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891796A>T" "" "likely pathogenic" "" "0000163513" "21" "70" "20" "57466870" "57466870" "subst" "0" "01202" "GNAS_000177" "g.57466870T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58891815T>C" "" "likely pathogenic" "" "0000163514" "10" "70" "20" "57466918" "57466920" "del" "0" "01202" "GNAS_000247" "g.57466918_57466920del" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.58891863_58891865del" "" "likely pathogenic" "" "0000169138" "20" "90" "20" "57478758" "57478759" "ins" "0" "01744" "GNAS_000080" "g.57478758_57478759insT" "" "{PMID:Park et a. 2010:20689139}" "" "c.344_345insT" "" "De novo" "?" "" "0" "" "" "g.58903703_58903704insT" "" "pathogenic" "" "0000170755" "0" "90" "20" "57485004" "57485004" "subst" "0" "01744" "GNAS_000255" "g.57485004A>G" "" "{PMID:Wu, Y. L. et al. 2014:24651309}" "" "" "" "De novo" "?" "" "0" "" "" "g.58909949A>G" "" "pathogenic" "" "0000170756" "20" "90" "20" "57485445" "57485446" "del" "0" "01744" "GNAS_000256" "g.57485445_57485446del" "" "{PMID:Wu, Y. L. et al. 2014:24651309}" "" "c.1027_1028delGA" "" "De novo" "yes" "" "0" "" "" "g.58910390_58910391del" "" "pathogenic" "" "0000170757" "0" "90" "20" "57485873" "57485873" "subst" "0" "01744" "GNAS_000050" "g.57485873G>A" "" "{PMID:Wu, Y. L. et al. 2014: 24651309}" "" "" "" "De novo" "yes" "" "0" "" "" "g.58910818G>A" "" "pathogenic" "" "0000170759" "1" "70" "20" "57485043" "57485043" "subst" "0" "01744" "GNAS_000253" "g.57485043A>G" "" "NOT PUBLISHED" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909988A>G" "" "likely pathogenic" "" "0000171996" "11" "90" "20" "57484255" "57484255" "subst" "0" "01744" "GNAS_000254" "g.57484255A>C" "" "NOT PUBLISHED" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909200A>C" "" "pathogenic" "" "0000173840" "21" "90" "20" "57478633" "57478633" "subst" "0" "01744" "GNAS_000074" "g.57478633C>A" "" "{PMID:Pinsker et al. 2006:16995592}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58903578C>A" "" "pathogenic" "" "0000173841" "21" "90" "20" "57478633" "57478633" "subst" "0" "01744" "GNAS_000074" "g.57478633C>A" "" "{PMID:Pinsker et al. 2006:16995592}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58903578C>A" "" "pathogenic" "" "0000173842" "20" "90" "20" "57478633" "57478633" "subst" "0" "01744" "GNAS_000074" "g.57478633C>A" "" "{PMID:Pinsker et al. 2006:16995592}" "" "" "" "Unknown" "yes" "" "0" "" "" "g.58903578C>A" "" "pathogenic" "" "0000174065" "21" "90" "20" "57478636" "57478636" "subst" "0" "01744" "GNAS_000012" "g.57478636T>C" "" "{PMID:Lim et al. 2002:11926205}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58903581T>C" "" "pathogenic" "" "0000174066" "20" "90" "20" "57484251" "57484254" "del" "0" "01744" "GNAS_000238" "g.57484251_57484254del" "" "{PMID:Lim et al. 2002:11926205}" "" "" "" "De novo" "?" "" "0" "" "" "g.58909196_58909199del" "" "pathogenic" "" "0000174067" "20" "90" "20" "57478762" "57478762" "del" "0" "01744" "GNAS_000014" "g.57478762del" "" "{PMID: Lim et al.: 11926205}" "" "" "" "De novo" "?" "" "0" "" "" "g.58903707del" "" "pathogenic" "" "0000179037" "0" "75" "20" "57428795" "57428795" "subst" "0" "00729" "GNAS_000258" "g.57428795G>A" "" "" "" "" "affects to Xlas transcript" "De novo" "?" "" "0" "" "" "g.58853740G>A" "" "likely pathogenic" "" "0000194530" "0" "77" "20" "57484475" "57484475" "subst" "0" "01744" "GNAS_000261" "g.57484475T>C" "" "NOT PUBLISHED" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58909420T>C" "" "likely pathogenic" "" "0000211215" "21" "99" "20" "57485796" "57485807" "dup" "0" "01744" "GNAS_000045" "g.57485796_57485807dup" "" "{PMID:Aldred et al. 2000:11073544}" "" "1107_1108ins12" "maternal germ-line mosaicism; loss of function" "Germline" "yes" "" "0" "" "" "g.58910741_58910752dup" "" "pathogenic" "" "0000221933" "20" "70" "20" "57466915" "57466915" "subst" "0" "01202" "GNAS_000267" "g.57466915T>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891860T>C" "" "likely pathogenic" "" "0000221934" "0" "70" "20" "57466789" "57466789" "subst" "0" "01202" "GNAS_000263" "g.57466789G>A" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891734G>A" "" "likely pathogenic" "" "0000221935" "0" "70" "20" "57466824" "57466824" "subst" "0" "01202" "GNAS_000264" "g.57466824G>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891769G>T" "" "likely pathogenic" "" "0000221936" "20" "70" "20" "57466881" "57466881" "subst" "0" "01202" "GNAS_000266" "g.57466881A>T" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58891826A>T" "" "likely pathogenic" "" "0000221937" "20" "70" "20" "57466850" "57466850" "del" "0" "01202" "GNAS_000265" "g.57466850del" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891795del" "" "likely pathogenic" "" "0000221938" "0" "70" "20" "57466850" "57466850" "del" "0" "01202" "GNAS_000265" "g.57466850del" "" "" "" "" "" "Unknown" "yes" "" "0" "" "" "g.58891795del" "" "likely pathogenic" "" "0000221939" "0" "70" "20" "57470684" "57470684" "subst" "0" "01202" "GNAS_000268" "g.57470684A>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58895629A>G" "" "likely pathogenic" "" "0000221940" "0" "90" "20" "57470688" "57470688" "subst" "0" "01202" "GNAS_000269" "g.57470688G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58895633G>A" "" "pathogenic" "" "0000221941" "0" "70" "20" "57470694" "57470695" "del" "0" "01202" "GNAS_000270" "g.57470694_57470695delinsG" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58895639_58895640delinsG" "" "likely pathogenic" "" "0000221942" "0" "70" "20" "57470743" "57470743" "dup" "0" "01202" "GNAS_000271" "g.57470743dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.58895688dup" "" "likely pathogenic" "" "0000221943" "0" "70" "20" "57478806" "57478806" "dup" "0" "01202" "GNAS_000272" "g.57478806dup" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58903751dup" "" "likely pathogenic" "" "0000221944" "20" "70" "20" "57478840" "57478841" "ins" "0" "01202" "GNAS_000273" "g.57478840_57478841insTCC" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58903785_58903786insTCC" "" "likely pathogenic" "" "0000221946" "0" "70" "20" "57478848" "57478848" "subst" "0" "01202" "GNAS_000274" "g.57478848T>G" "" "" "" "" "Variant Error [EBUILDMISMATCH]: This variant seems to mismatch; the genomic variants on hg19 and hg38 seem to not belong together. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "g.58903793T>C" "" "likely pathogenic" "" "0000221950" "21" "70" "20" "57478843" "57478843" "dup" "0" "01202" "GNAS_000275" "g.57478843dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.58903788dup" "" "likely pathogenic" "" "0000221952" "0" "30" "20" "57474028" "57474028" "subst" "0" "01202" "GNAS_000276" "g.57474028G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.58898973G>A" "" "likely benign" "" "0000221953" "0" "70" "20" "57485764" "57485764" "dup" "0" "01202" "GNAS_000277" "g.57485764dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.58910709dup" "" "likely pathogenic" "" "0000221956" "0" "70" "20" "57480472" "57480472" "subst" "0" "01202" "GNAS_000278" "g.57480472A>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58905417A>G" "" "likely pathogenic" "" "0000221966" "21" "70" "20" "57480499" "57480499" "subst" "0" "01202" "GNAS_000279" "g.57480499G>A" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58905444G>A" "" "likely pathogenic" "" "0000222050" "21" "70" "20" "57485872" "57485872" "subst" "0" "01202" "GNAS_000299" "g.57485872C>G" "" "" "" "" "" "De novo" "" "" "0" "" "" "g.58910817C>G" "" "likely pathogenic" "" "0000222090" "0" "77" "20" "57478847" "57478847" "subst" "0" "01396" "GNAS_000300" "g.57478847G>C" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58903792G>C" "" "likely pathogenic" "" "0000235017" "11" "99" "20" "57478847" "57478847" "subst" "0" "01744" "GNAS_000017" "g.57478847G>A" "" "NOT PUBLISHED" "" "" "this mutation induces exon 5 skipping" "De novo" "" "" "0" "" "" "g.58903792G>A" "" "pathogenic" "" "0000236397" "11" "77" "20" "57478616" "57478618" "dup" "0" "01744" "GNAS_000262" "g.57478616_57478618dup" "" "NOT PUBLISHED" "" "" "" "Germline" "?" "" "0" "" "" "g.58903561_58903563dup" "" "likely pathogenic" "" "0000236398" "11" "77" "20" "57478616" "57478618" "dup" "0" "01744" "GNAS_000262" "g.57478616_57478618dup" "" "NOT PUBLISHED" "" "" "" "Germline" "?" "" "0" "" "" "g.58903561_58903563dup" "" "likely pathogenic" "" "0000236399" "11" "77" "20" "57478616" "57478618" "dup" "0" "01744" "GNAS_000262" "g.57478616_57478618dup" "" "NOT PUBLISHED" "" "" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.58903561_58903563dup" "" "likely pathogenic" "" "0000248128" "0" "30" "20" "57428804" "57428804" "subst" "0.00260012" "02325" "GNAS_000351" "g.57428804A>G" "" "" "" "GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853749A>G" "" "likely benign" "" "0000254118" "0" "30" "20" "57428804" "57428804" "subst" "0.00260012" "01943" "GNAS_000351" "g.57428804A>G" "" "" "" "GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853749A>G" "" "likely benign" "" "0000256740" "0" "50" "20" "57484481" "57484481" "subst" "0" "01943" "GNAS_000390" "g.57484481A>G" "" "" "" "GNAS(NM_001077490.2):c.*520+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909426A>G" "" "VUS" "" "0000281096" "0" "10" "20" "57429775" "57429775" "subst" "0.002565" "02325" "GNAS_000379" "g.57429775C>A" "" "" "" "GNAS(NM_001077490.1):c.1268C>A (p.(Pro423His)), GNAS(NM_001077490.2):c.1268C>A (p.P423H), GNAS(NM_001077490.3):c.1268C>A (p.P423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854720C>A" "" "benign" "" "0000281097" "0" "10" "20" "57430118" "57430118" "subst" "0.00629488" "02325" "GNAS_000382" "g.57430118C>G" "" "" "" "GNAS(NM_001077490.1):c.1611C>G (p.(Ala537=)), GNAS(NM_080425.4):c.1798C>G (p.R600G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58855063C>G" "" "benign" "" "0000281098" "0" "10" "20" "57478807" "57478807" "subst" "0.541623" "02325" "GNAS_000386" "g.57478807C>T" "" "" "" "GNAS(NM_080425.3):c.2322C>T (p.I774=), GNAS(NM_080425.4):c.2322C>T (p.I774=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58903752C>T" "" "benign" "" "0000281099" "0" "50" "20" "57429040" "57429040" "subst" "4.19988E-6" "02325" "GNAS_000357" "g.57429040G>A" "" "" "" "GNAS(NM_001077490.3):c.533G>A (p.R178Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853985G>A" "" "VUS" "" "0000284728" "0" "10" "20" "57480420" "57480420" "subst" "0.0340169" "02326" "GNAS_000388" "g.57480420T>C" "" "" "" "GNAS(NM_000516.4):c.433-18T>C (p.(=)), GNAS(NM_001077490.2):c.*294-18T>C, GNAS(NM_001077490.3):c.*294-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58905365T>C" "" "benign" "" "0000284729" "0" "10" "20" "57478807" "57478807" "subst" "0.541623" "02326" "GNAS_000386" "g.57478807C>T" "" "" "" "GNAS(NM_080425.3):c.2322C>T (p.I774=), GNAS(NM_080425.4):c.2322C>T (p.I774=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58903752C>T" "" "benign" "" "0000284730" "0" "10" "20" "57478846" "57478846" "subst" "0.00221708" "02326" "GNAS_000387" "g.57478846C>T" "" "" "" "GNAS(NM_000516.4):c.432C>T (p.(=)), GNAS(NM_080425.3):c.2361C>T (p.P787=), GNAS(NM_080425.4):c.2361C>T (p.P787=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58903791C>T" "" "benign" "" "0000284731" "0" "50" "20" "57480481" "57480481" "subst" "0" "02326" "GNAS_000389" "g.57480481T>C" "" "" "" "GNAS(NM_080425.3):c.2405T>C (p.V802A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58905426T>C" "" "VUS" "" "0000284732" "0" "10" "20" "57484241" "57484241" "subst" "0.027098" "02326" "GNAS_000022" "g.57484241C>T" "" "" "" "GNAS(NM_000516.4):c.555C>T (p.(=)), GNAS(NM_080425.3):c.2484C>T (p.I828=), GNAS(NM_080425.4):c.2484C>T (p.I828=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909186C>T" "" "benign" "" "0000284733" "0" "90" "20" "57484420" "57484420" "subst" "0" "02326" "GNAS_000026" "g.57484420C>T" "" "" "" "GNAS(NM_080425.3):c.2530C>T (p.R844C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909365C>T" "" "pathogenic" "" "0000284734" "0" "70" "20" "57484814" "57484814" "subst" "0" "02326" "GNAS_000105" "g.57484814G>A" "" "" "" "GNAS(NM_080425.3):c.2723G>A (p.R908H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909759G>A" "" "likely pathogenic" "" "0000284735" "0" "90" "20" "57485403" "57485403" "subst" "0" "02326" "GNAS_000394" "g.57485403G>T" "" "" "" "GNAS(NM_080425.3):c.2914G>T (p.G972*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58910348G>T" "" "pathogenic" "" "0000284736" "0" "90" "20" "57485795" "57485795" "subst" "0" "02326" "GNAS_000202" "g.57485795G>A" "" "" "" "GNAS(NM_000516.6):c.1096G>A (p.A366T), GNAS(NM_080425.4):c.3025G>A (p.A1009T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58910740G>A" "" "pathogenic" "" "0000284737" "0" "10" "20" "57485812" "57485812" "subst" "0.0214584" "02326" "GNAS_000046" "g.57485812C>T" "" "" "" "GNAS(NM_000516.4):c.1113C>T (p.(=)), GNAS(NM_080425.3):c.3042C>T (p.N1014=), GNAS(NM_080425.4):c.3042C>T (p.N1014=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58910757C>T" "" "benign" "" "0000284738" "0" "10" "20" "57428947" "57428947" "subst" "0.00800366" "02326" "GNAS_000354" "g.57428947G>A" "" "" "" "GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K), GNAS(NM_001077490.3):c.440G>A (p.R147K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853892G>A" "" "benign" "" "0000284739" "0" "70" "20" "57484620" "57484620" "subst" "0" "02326" "GNAS_000391" "g.57484620T>C" "" "" "" "GNAS(NM_000516.6):c.704T>C (p.I235T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909565T>C" "" "likely pathogenic" "" "0000288531" "0" "30" "20" "57429541" "57429541" "subst" "0.00093337" "01943" "GNAS_000367" "g.57429541C>G" "" "" "" "GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R), GNAS(NM_001077490.3):c.1034C>G (p.P345R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854486C>G" "" "likely benign" "" "0000288532" "0" "10" "20" "57429553" "57429579" "del" "0" "01943" "GNAS_000368" "g.57429553_57429579del" "" "" "" "GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del), GNAS...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854498_58854524del" "" "benign" "" "0000288533" "0" "30" "20" "57429748" "57429748" "subst" "0.000994617" "01943" "GNAS_000377" "g.57429748C>G" "" "" "" "GNAS(NM_001077490.1):c.1241C>G (p.(Pro414Arg)), GNAS(NM_001077490.2):c.1241C>G (p.P414R), GNAS(NM_001077490.3):c.1241C>G (p.P414R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854693C>G" "" "likely benign" "" "0000288534" "0" "50" "20" "57429650" "57429650" "subst" "2.15638E-5" "01943" "GNAS_000370" "g.57429650G>A" "" "" "" "GNAS(NM_080425.3):c.1330G>A (p.G444R), GNAS(NM_080425.4):c.1330G>A (p.G444R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854595G>A" "" "VUS" "" "0000288535" "0" "30" "20" "57429838" "57429838" "subst" "0" "01943" "GNAS_000380" "g.57429838G>A" "" "" "" "GNAS(NM_001077490.2):c.1331G>A (p.G444E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854783G>A" "" "likely benign" "" "0000288536" "0" "50" "20" "57429686" "57429686" "subst" "7.8504E-6" "01943" "GNAS_000371" "g.57429686G>A" "" "" "" "GNAS(NM_080425.3):c.1366G>A (p.G456R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854631G>A" "" "VUS" "" "0000288537" "0" "50" "20" "57484578" "57484578" "subst" "0" "01943" "GNAS_000188" "g.57484578T>C" "" "" "" "GNAS(NM_080425.3):c.2591T>C (p.M864T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909523T>C" "" "VUS" "" "0000288538" "0" "30" "20" "57428948" "57428948" "subst" "0.00127917" "01943" "GNAS_000355" "g.57428948G>C" "" "" "" "GNAS(NM_001077490.2):c.441G>C (p.R147S), GNAS(NM_001077490.3):c.441G>C (p.R147S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853893G>C" "" "likely benign" "" "0000288539" "0" "50" "20" "57428998" "57428998" "subst" "9.5257E-5" "01943" "GNAS_000356" "g.57428998T>G" "" "" "" "GNAS(NM_001077490.2):c.491T>G (p.L164W), GNAS(NM_080425.4):c.678T>G (p.(Phe226Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853943T>G" "" "VUS" "" "0000288540" "0" "30" "20" "57429217" "57429217" "subst" "0.000119471" "01943" "GNAS_000359" "g.57429217C>A" "" "" "" "GNAS(NM_001077490.2):c.710C>A (p.A237D), GNAS(NM_001077490.3):c.710C>A (p.A237D), GNAS(NM_080425.4):c.897C>A (p.(Ser299Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854162C>A" "" "likely benign" "" "0000288541" "0" "30" "20" "57429310" "57429310" "subst" "1.63885E-5" "01943" "GNAS_000361" "g.57429310C>T" "" "" "" "GNAS(NM_001077490.2):c.803C>T (p.S268L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854255C>T" "" "likely benign" "" "0000288542" "0" "50" "20" "57429345" "57429345" "subst" "0" "01943" "GNAS_000362" "g.57429345C>A" "" "" "" "GNAS(NM_001077490.2):c.838C>A (p.P280T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854290C>A" "" "VUS" "" "0000288543" "0" "90" "20" "57466866" "57466866" "subst" "0" "01943" "GNAS_000127" "g.57466866C>T" "" "" "" "GNAS(NM_001077488.3):c.85C>T (p.Q29*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58891811C>T" "" "pathogenic" "" "0000328507" "0" "50" "20" "57415559" "57415559" "subst" "6.1296E-5" "01804" "GNAS-AS1_000001" "g.57415559C>T" "" "" "" "GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.5):c.398C>T (p.P133L, p.(Pro133Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58840504C>T" "" "VUS" "" "0000328508" "0" "50" "20" "57415700" "57415700" "subst" "0" "01804" "GNAS-AS1_000002" "g.57415700C>T" "" "" "" "GNAS(NM_016592.2):c.539C>T (p.(Pro180Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58840645C>T" "" "VUS" "" "0000328509" "0" "50" "20" "57415798" "57415800" "del" "0" "01804" "GNAS-AS1_000003" "g.57415798_57415800del" "" "" "" "GNAS(NM_016592.2):c.632_634del (p.(Glu213del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58840743_58840745del" "" "VUS" "" "0000328512" "0" "50" "20" "57428474" "57428474" "subst" "0.000113984" "01804" "GNAS_000350" "g.57428474G>A" "" "" "" "GNAS(NM_001077490.1):c.-34G>A (p.(=)), GNAS(NM_080425.3):c.154G>A (p.E52K), GNAS(NM_080425.4):c.154G>A (p.E52K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853419G>A" "" "VUS" "" "0000328513" "0" "30" "20" "57428820" "57428820" "subst" "0.00164914" "01804" "GNAS_000352" "g.57428820A>G" "" "" "" "GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.3):c.313A>G (p.T105A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853765A>G" "" "likely benign" "" "0000328514" "0" "30" "20" "57428845" "57428845" "subst" "0.00174878" "01804" "GNAS_000353" "g.57428845T>C" "" "" "" "GNAS(NM_001077490.1):c.338T>C (p.(Val113Ala)), GNAS(NM_001077490.3):c.338T>C (p.V113A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58853790T>C" "" "likely benign" "" "0000328518" "0" "50" "20" "57429424" "57429424" "subst" "0" "01804" "GNAS_000363" "g.57429424G>A" "" "" "" "GNAS(NM_001077490.1):c.917G>A (p.(Arg306Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854369G>A" "" "VUS" "" "0000328519" "0" "30" "20" "57429487" "57429487" "subst" "0" "01804" "GNAS_000364" "g.57429487T>A" "" "" "" "GNAS(NM_001077490.1):c.980T>A (p.(Ile327Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854432T>A" "" "likely benign" "" "0000328520" "0" "30" "20" "57429508" "57429516" "dup" "0" "01804" "GNAS_000366" "g.57429508_57429516dup" "" "" "" "GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Leu334_Pro336dup)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup), GNAS(NM_00107749...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854453_58854461dup" "" "likely benign" "" "0000328521" "0" "50" "20" "57429541" "57429541" "subst" "0.00093337" "01804" "GNAS_000367" "g.57429541C>G" "" "" "" "GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R), GNAS(NM_001077490.3):c.1034C>G (p.P345R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854486C>G" "" "VUS" "" "0000328523" "0" "50" "20" "57429553" "57429579" "del" "0" "01804" "GNAS_000368" "g.57429553_57429579del" "" "" "" "GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del), GNAS...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854498_58854524del" "" "VUS" "" "0000328525" "0" "50" "20" "57429600" "57429600" "subst" "0.000264075" "01804" "GNAS_000369" "g.57429600C>A" "" "" "" "GNAS(NM_001077490.1):c.1093C>A (p.(Pro365Thr)), GNAS(NM_001077490.2):c.1093C>A (p.P365T), GNAS(NM_001077490.3):c.1093C>A (p.P365T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854545C>A" "" "VUS" "" "0000328526" "0" "30" "20" "57429714" "57429715" "ins" "0" "01804" "GNAS_000373" "g.57429714_57429715insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "" "" "" "GNAS(NM_001077490.1):c.1207_1208insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC (p.(Ile402_Gln403insProThrProGlyArgProValThrProGlnProIle)), GNAS(NM_001077...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854659_58854660insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "" "likely benign" "" "0000328527" "0" "50" "20" "57429715" "57429715" "subst" "0" "01804" "GNAS_000374" "g.57429715A>C" "" "" "" "GNAS(NM_001077490.1):c.1208A>C (p.(Gln403Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854660A>C" "" "VUS" "" "0000328529" "0" "50" "20" "57429718" "57429718" "subst" "0" "01804" "GNAS_000375" "g.57429718T>C" "" "" "" "GNAS(NM_001077490.1):c.1211T>C (p.(Met404Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854663T>C" "" "VUS" "" "0000328531" "0" "50" "20" "57429719" "57429719" "subst" "0" "01804" "GNAS_000376" "g.57429719G>T" "" "" "" "GNAS(NM_001077490.1):c.1212G>T (p.(Met404Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854664G>T" "" "VUS" "" "0000328533" "0" "30" "20" "57429748" "57429748" "subst" "0.000994617" "01804" "GNAS_000377" "g.57429748C>G" "" "" "" "GNAS(NM_001077490.1):c.1241C>G (p.(Pro414Arg)), GNAS(NM_001077490.2):c.1241C>G (p.P414R), GNAS(NM_001077490.3):c.1241C>G (p.P414R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854693C>G" "" "likely benign" "" "0000328534" "0" "50" "20" "57429765" "57429765" "subst" "1.62096E-5" "01804" "GNAS_000378" "g.57429765C>T" "" "" "" "GNAS(NM_001077490.1):c.1258C>T (p.(Pro420Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854710C>T" "" "VUS" "" "0000328535" "0" "30" "20" "57429775" "57429775" "subst" "0.002565" "01804" "GNAS_000379" "g.57429775C>A" "" "" "" "GNAS(NM_001077490.1):c.1268C>A (p.(Pro423His)), GNAS(NM_001077490.2):c.1268C>A (p.P423H), GNAS(NM_001077490.3):c.1268C>A (p.P423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854720C>A" "" "likely benign" "" "0000328538" "0" "50" "20" "57430000" "57430000" "subst" "0" "01804" "GNAS_000381" "g.57430000C>A" "" "" "" "GNAS(NM_001077490.1):c.1493C>A (p.(Ala498Asp)), GNAS(NM_001077490.2):c.1493C>A (p.A498D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58854945C>A" "" "VUS" "" "0000328540" "0" "50" "20" "57430322" "57430322" "subst" "0" "01804" "GNAS_000384" "g.57430322C>T" "" "" "" "GNAS(NM_001077490.1):c.1815C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58855267C>T" "" "VUS" "" "0000328543" "0" "50" "20" "57485086" "57485086" "subst" "0" "01804" "GNAS_000392" "g.57485086A>G" "" "" "" "GNAS(NM_000516.4):c.920A>G (p.(Lys307Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58910031A>G" "" "VUS" "" "0000328544" "0" "50" "20" "57485130" "57485130" "subst" "0" "01804" "GNAS_000393" "g.57485130G>A" "" "" "" "GNAS(NM_000516.4):c.964G>A (p.(Glu322Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58910075G>A" "" "VUS" "" "0000342444" "0" "70" "20" "57484793" "57484793" "subst" "0" "02327" "GNAS_000395" "g.57484793G>A" "" "" "" "GNAS(NM_080425.3):c.2702G>A (p.R901Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58909738G>A" "" "likely pathogenic" "" "0000342666" "0" "70" "20" "57485424" "57485424" "subst" "0" "02327" "GNAS_000054" "g.57485424C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.58910369C>T" "" "likely pathogenic" "" "0000472241" "21" "90" "20" "57466884" "57466884" "subst" "0" "01261" "GNAS_000057" "g.57466884C>T" "" "{PMID:Yakoreva 2019:31186545}, {DOI:Yakoreva 2019:10.1038/s41431-019-0446-x}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58891829C>T" "" "pathogenic" "" "0000472242" "11" "90" "20" "57478628" "57478628" "subst" "0" "01261" "GNAS_000396" "g.57478628A>C" "" "{PMID:Yakoreva 2019:31186545}, {DOI:Yakoreva 2019:10.1038/s41431-019-0446-x}" "" "" "" "De novo" "" "" "0" "" "" "g.58903573A>C" "" "likely pathogenic" "" "0000472243" "21" "90" "20" "57478633" "57478633" "subst" "0" "01261" "GNAS_000075" "g.57478633C>T" "" "{PMID:Yakoreva 2019:31186545}, {DOI:Yakoreva 2019:10.1038/s41431-019-0446-x}" "" "" "" "Germline" "yes" "" "0" "" "" "g.58903578C>T" "" "likely pathogenic" "" "0000480550" "1" "90" "20" "57470728" "57470736" "del" "0" "00006" "GNAS_000397" "g.57470728_57470736del" "" "{PMID:Miyado 2019:30962325}" "" "" "ACMG PS3, PM2, PM4, PP1 , PP4" "Germline" "yes" "" "0" "" "" "g.58895673_58895681del" "" "pathogenic" "ACMG" "0000480551" "0" "70" "20" "57484783" "57484783" "subst" "0" "00006" "GNAS_000398" "g.57484783A>G" "" "{PMID:Miyado 2019:30962325}" "" "" "ACMG PS3, PM2, PP1, PP3, PP4" "Germline" "yes" "" "0" "" "" "g.58909728A>G" "" "likely pathogenic" "ACMG" "0000570038" "0" "30" "20" "57415218" "57415218" "subst" "3.31027E-5" "01943" "GNAS_000399" "g.57415218C>T" "" "" "" "GNAS(NM_016592.3):c.57C>T (p.D19=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840163C>T" "" "likely benign" "" "0000570039" "0" "30" "20" "57415229" "57415229" "subst" "1.65596E-5" "01804" "GNAS_000400" "g.57415229C>T" "" "" "" "GNAS(NM_016592.2):c.68C>T (p.(Pro23Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840174C>T" "" "likely benign" "" "0000570040" "0" "10" "20" "57415455" "57415455" "subst" "0.0298887" "02330" "GNAS_000401" "g.57415455C>T" "" "" "" "GNAS(NM_001309861.1):c.-1514C>T (p.(=)), GNAS(NM_016592.5):c.294C>T (p.P98=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840400C>T" "" "benign" "" "0000570041" "0" "30" "20" "57415548" "57415571" "del" "0" "01804" "GNAS_000402" "g.57415548_57415571del" "" "" "" "GNAS(NM_016592.2):c.382_405del (p.(Ala132_Thr139del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840493_58840516del" "" "likely benign" "" "0000570043" "0" "30" "20" "57415722" "57415722" "subst" "0" "01804" "GNAS_000404" "g.57415722C>A" "" "" "" "GNAS(NM_016592.2):c.561C>A (p.(Ser187Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840667C>A" "" "likely benign" "" "0000570044" "0" "30" "20" "57415753" "57415753" "subst" "8.16186E-5" "01804" "GNAS_000405" "g.57415753G>A" "" "" "" "GNAS(NM_016592.2):c.592G>A (p.(Asp198Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840698G>A" "" "likely benign" "" "0000570045" "0" "30" "20" "57415800" "57415800" "subst" "0.000142486" "01943" "GNAS_000406" "g.57415800G>A" "" "" "" "GNAS(NM_016592.3):c.639G>A (p.E213=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840745G>A" "" "likely benign" "" "0000570046" "0" "10" "20" "57415812" "57415812" "subst" "0.00626613" "02330" "GNAS_000407" "g.57415812T>A" "" "" "" "GNAS(NM_016592.5):c.651T>A (p.R217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840757T>A" "" "benign" "" "0000570047" "0" "10" "20" "57415876" "57415876" "subst" "0.00294844" "01804" "GNAS_000408" "g.57415876C>A" "" "" "" "GNAS(NM_001309861.1):c.-1093C>A (p.(=)), GNAS(NM_016592.4):c.715C>A (p.P239T), GNAS(NM_016592.5):c.715C>A (p.P239T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840821C>A" "" "benign" "" "0000570048" "0" "30" "20" "57428331" "57428331" "subst" "0.000114284" "01804" "GNAS_000409" "g.57428331G>A" "" "" "" "GNAS(NM_001077490.1):c.-177G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853276G>A" "" "likely benign" "" "0000570049" "0" "30" "20" "57428478" "57428478" "subst" "5.07675E-5" "01943" "GNAS_000410" "g.57428478C>G" "" "" "" "GNAS(NM_080425.3):c.158C>G (p.P53R), GNAS(NM_080425.4):c.158C>G (p.P53R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853423C>G" "" "likely benign" "" "0000570051" "0" "30" "20" "57428804" "57428804" "subst" "0.00260012" "02330" "GNAS_000351" "g.57428804A>G" "" "" "" "GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853749A>G" "" "likely benign" "" "0000570052" "0" "30" "20" "57428804" "57428804" "subst" "0.00260012" "01804" "GNAS_000351" "g.57428804A>G" "" "" "" "GNAS(NM_001077490.1):c.297A>G (p.(=)), GNAS(NM_080425.3):c.484A>G (p.M162V), GNAS(NM_080425.4):c.484A>G (p.M162V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853749A>G" "" "likely benign" "" "0000570053" "0" "10" "20" "57428820" "57428820" "subst" "0.00164914" "02330" "GNAS_000352" "g.57428820A>G" "" "" "" "GNAS(NM_001077490.1):c.313A>G (p.(Thr105Ala)), GNAS(NM_001077490.3):c.313A>G (p.T105A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853765A>G" "" "benign" "" "0000570054" "0" "50" "20" "57428858" "57428858" "subst" "0.000106967" "02327" "GNAS_000412" "g.57428858C>T" "" "" "" "GNAS(NM_080425.3):c.538C>T (p.Q180*), GNAS(NM_080425.4):c.538C>T (p.Q180*, p.(Gln180Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853803C>T" "" "VUS" "" "0000570055" "0" "50" "20" "57428898" "57428898" "subst" "9.5378E-6" "01943" "GNAS_000413" "g.57428898G>A" "" "" "" "GNAS(NM_001077490.2):c.391G>A (p.G131R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853843G>A" "" "VUS" "" "0000570056" "0" "30" "20" "57428947" "57428947" "subst" "0.00800366" "01804" "GNAS_000354" "g.57428947G>A" "" "" "" "GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K), GNAS(NM_001077490.3):c.440G>A (p.R147K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853892G>A" "" "likely benign" "" "0000570057" "0" "30" "20" "57429094" "57429094" "subst" "0" "01804" "GNAS_000414" "g.57429094C>T" "" "" "" "GNAS(NM_001077490.1):c.587C>T (p.(Ser196Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854039C>T" "" "likely benign" "" "0000570058" "0" "50" "20" "57429141" "57429141" "subst" "0" "01943" "GNAS_000415" "g.57429141C>T" "" "" "" "GNAS(NM_001077490.1):c.634C>T (p.(Pro212Ser)), GNAS(NM_001077490.2):c.634C>T (p.P212S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854086C>T" "" "VUS" "" "0000570059" "0" "30" "20" "57429208" "57429208" "subst" "4.13733E-6" "01943" "GNAS_000416" "g.57429208G>A" "" "" "" "GNAS(NM_001077490.2):c.701G>A (p.R234Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854153G>A" "" "likely benign" "" "0000570060" "0" "30" "20" "57429259" "57429259" "subst" "0" "01804" "GNAS_000417" "g.57429259C>G" "" "" "" "GNAS(NM_001077490.1):c.752C>G (p.(Ala251Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854204C>G" "" "likely benign" "" "0000570062" "0" "10" "20" "57429447" "57429447" "subst" "0.0220554" "02330" "GNAS_000419" "g.57429447C>T" "" "" "" "GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W), GNAS(NM_001077490.3):c.940C>T (p.R314W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854392C>T" "" "benign" "" "0000570063" "0" "30" "20" "57429447" "57429447" "subst" "0.0220554" "01804" "GNAS_000419" "g.57429447C>T" "" "" "" "GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W), GNAS(NM_001077490.3):c.940C>T (p.R314W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854392C>T" "" "likely benign" "" "0000570064" "0" "10" "20" "57429447" "57429447" "subst" "0.0220554" "02326" "GNAS_000419" "g.57429447C>T" "" "" "" "GNAS(NM_001077490.1):c.940C>T (p.(Arg314Trp)), GNAS(NM_001077490.2):c.940C>T (p.R314W), GNAS(NM_001077490.3):c.940C>T (p.R314W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854392C>T" "" "benign" "" "0000570065" "0" "30" "20" "57429449" "57429449" "subst" "0" "01804" "GNAS_000420" "g.57429449G>C" "" "" "" "GNAS(NM_001077490.1):c.942G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854394G>C" "" "likely benign" "" "0000570067" "0" "10" "20" "57429508" "57429516" "dup" "0" "02330" "GNAS_000366" "g.57429508_57429516dup" "" "" "" "GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Leu334_Pro336dup)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup), GNAS(NM_00107749...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854453_58854461dup" "" "benign" "" "0000570068" "0" "10" "20" "57429508" "57429516" "dup" "0" "01943" "GNAS_000366" "g.57429508_57429516dup" "" "" "" "GNAS(NM_001077490.1):c.992_993insGCAGCCCCT (p.(Leu334_Pro336dup)), GNAS(NM_001077490.2):c.1001_1009dupTGCAGCCCC (p.L334_P336dup), GNAS(NM_00107749...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854453_58854461dup" "" "benign" "" "0000570069" "0" "30" "20" "57429521" "57429521" "subst" "4.22529E-5" "01804" "GNAS_000422" "g.57429521G>A" "" "" "" "GNAS(NM_001077490.1):c.1014G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854466G>A" "" "likely benign" "" "0000570071" "0" "30" "20" "57429619" "57429619" "subst" "0.000104095" "01804" "GNAS_000423" "g.57429619A>G" "" "" "" "GNAS(NM_001077490.1):c.1112A>G (p.(Gln371Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854564A>G" "" "likely benign" "" "0000570072" "0" "30" "20" "57429627" "57429627" "subst" "0" "02330" "GNAS_000424" "g.57429627C>A" "" "" "" "GNAS(NM_001077490.1):c.1120C>A (p.(Pro374Thr)), GNAS(NM_001077490.3):c.1120C>A (p.P374T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854572C>A" "" "likely benign" "" "0000570073" "0" "30" "20" "57429627" "57429627" "subst" "0" "01804" "GNAS_000424" "g.57429627C>A" "" "" "" "GNAS(NM_001077490.1):c.1120C>A (p.(Pro374Thr)), GNAS(NM_001077490.3):c.1120C>A (p.P374T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854572C>A" "" "likely benign" "" "0000570075" "0" "30" "20" "57429655" "57429655" "subst" "0" "01804" "GNAS_000426" "g.57429655G>A" "" "" "" "GNAS(NM_001077490.1):c.1148G>A (p.(Arg383Gln)), GNAS(NM_001077490.2):c.1148G>A (p.R383Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854600G>A" "" "likely benign" "" "0000570076" "0" "30" "20" "57429663" "57429663" "subst" "0" "01804" "GNAS_000427" "g.57429663A>C" "" "" "" "GNAS(NM_001077490.1):c.1156A>C (p.(Thr386Pro)), GNAS(NM_001077490.3):c.1156A>C (p.T386P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854608A>C" "" "likely benign" "" "0000570077" "0" "30" "20" "57429696" "57429696" "subst" "0.00956966" "02330" "GNAS_000428" "g.57429696C>G" "" "" "" "GNAS(NM_001077490.1):c.1189C>G (p.(Leu397Val)), GNAS(NM_001077490.2):c.1189C>G (p.L397V), GNAS(NM_001077490.3):c.1189C>G (p.L397V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854641C>G" "" "likely benign" "" "0000570080" "0" "30" "20" "57429782" "57429782" "subst" "0.000126674" "01804" "GNAS_000430" "g.57429782G>A" "" "" "" "GNAS(NM_001077490.1):c.1275G>A (p.(=)), GNAS(NM_080425.3):c.1462G>A (p.A488T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854727G>A" "" "likely benign" "" "0000570081" "0" "10" "20" "57429844" "57429844" "subst" "0.000101021" "01943" "GNAS_000431" "g.57429844C>T" "" "" "" "GNAS(NM_001077490.1):c.1337C>T (p.(Pro446Leu)), GNAS(NM_001077490.2):c.1337C>T (p.P446L), GNAS(NM_001077490.3):c.1337C>T (p.P446L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854789C>T" "" "benign" "" "0000570082" "0" "30" "20" "57429844" "57429844" "subst" "0.000101021" "01804" "GNAS_000431" "g.57429844C>T" "" "" "" "GNAS(NM_001077490.1):c.1337C>T (p.(Pro446Leu)), GNAS(NM_001077490.2):c.1337C>T (p.P446L), GNAS(NM_001077490.3):c.1337C>T (p.P446L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854789C>T" "" "likely benign" "" "0000570083" "0" "50" "20" "57429868" "57429868" "subst" "0" "01943" "GNAS_000432" "g.57429868A>T" "" "" "" "GNAS(NM_001077490.2):c.1361A>T (p.Q454L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854813A>T" "" "VUS" "" "0000570084" "0" "50" "20" "57429873" "57429873" "subst" "0" "01943" "GNAS_000433" "g.57429873C>T" "" "" "" "GNAS(NM_080425.3):c.1553C>T (p.P518L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854818C>T" "" "VUS" "" "0000570085" "0" "30" "20" "57429891" "57429891" "subst" "6.21706E-5" "01943" "GNAS_000434" "g.57429891G>A" "" "" "" "GNAS(NM_001077490.2):c.1384G>A (p.A462T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854836G>A" "" "likely benign" "" "0000570086" "0" "50" "20" "57429910" "57429910" "subst" "3.32602E-5" "01804" "GNAS_000435" "g.57429910C>T" "" "" "" "GNAS(NM_001077490.3):c.1403C>T (p.(Pro468Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854855C>T" "" "VUS" "" "0000570087" "0" "50" "20" "57429968" "57429968" "subst" "2.39418E-5" "02325" "GNAS_000436" "g.57429968G>A" "" "" "" "GNAS(NM_080425.2):c.1648G>A (p.(Ala550Thr)), GNAS(NM_080425.4):c.1648G>A (p.A550T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854913G>A" "" "VUS" "" "0000570088" "0" "10" "20" "57430118" "57430118" "subst" "0.00629488" "02330" "GNAS_000382" "g.57430118C>G" "" "" "" "GNAS(NM_001077490.1):c.1611C>G (p.(Ala537=)), GNAS(NM_080425.4):c.1798C>G (p.R600G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855063C>G" "" "benign" "" "0000570089" "0" "30" "20" "57430118" "57430118" "subst" "0.00629488" "01804" "GNAS_000382" "g.57430118C>G" "" "" "" "GNAS(NM_001077490.1):c.1611C>G (p.(Ala537=)), GNAS(NM_080425.4):c.1798C>G (p.R600G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855063C>G" "" "likely benign" "" "0000570090" "0" "50" "20" "57430243" "57430243" "subst" "0.000187137" "01943" "GNAS_000437" "g.57430243G>C" "" "" "" "GNAS(NM_001077490.2):c.1736G>C (p.W579S), GNAS(NM_001077490.3):c.1736G>C (p.W579S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855188G>C" "" "VUS" "" "0000570092" "0" "30" "20" "57430259" "57430259" "subst" "0" "01804" "GNAS_000438" "g.57430259C>G" "" "" "" "GNAS(NM_001077490.1):c.1752C>G (p.(Asp584Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855204C>G" "" "likely benign" "" "0000570093" "0" "10" "20" "57466779" "57466781" "del" "0" "02330" "GNAS_000439" "g.57466779_57466781del" "" "" "" "GNAS(NM_001077488.5):c.-3_-1delGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58891724_58891726del" "" "benign" "" "0000570094" "0" "10" "20" "57466790" "57466790" "subst" "0.000642156" "02330" "GNAS_000440" "g.57466790C>T" "" "" "" "GNAS(NM_000516.7):c.9C>T (p.(Cys3=)), GNAS(NM_001077488.3):c.9C>T (p.C3=), GNAS(NM_001077488.5):c.9C>T (p.C3=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58891735C>T" "" "benign" "" "0000570095" "0" "30" "20" "57466790" "57466790" "subst" "0.000642156" "01943" "GNAS_000440" "g.57466790C>T" "" "" "" "GNAS(NM_000516.7):c.9C>T (p.(Cys3=)), GNAS(NM_001077488.3):c.9C>T (p.C3=), GNAS(NM_001077488.5):c.9C>T (p.C3=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58891735C>T" "" "likely benign" "" "0000570096" "0" "10" "20" "57466889" "57466889" "subst" "3.00228E-5" "02330" "GNAS_000441" "g.57466889C>T" "" "" "" "GNAS(NM_001077488.5):c.108C>T (p.V36=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58891834C>T" "" "benign" "" "0000570097" "0" "50" "20" "57470704" "57470704" "subst" "0" "02329" "GNAS_000442" "g.57470704G>C" "" "" "" "GNAS(NM_080425.4):c.2106G>C (p.Q702H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58895649G>C" "" "VUS" "" "0000570098" "0" "10" "20" "57478634" "57478634" "subst" "0.000312673" "02330" "GNAS_000443" "g.57478634G>A" "" "" "" "GNAS(NM_080425.4):c.2235G>A (p.A745=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903579G>A" "" "benign" "" "0000570099" "0" "50" "20" "57478731" "57478731" "subst" "0" "02327" "GNAS_000257" "g.57478731T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903676T>C" "" "VUS" "" "0000570100" "0" "30" "20" "57478771" "57478771" "subst" "0.000105575" "02330" "GNAS_000444" "g.57478771G>A" "" "" "" "GNAS(NM_080425.3):c.2286G>A (p.L762=), GNAS(NM_080425.4):c.2286G>A (p.L762=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903716G>A" "" "likely benign" "" "0000570101" "0" "30" "20" "57478771" "57478771" "subst" "0.000105575" "01943" "GNAS_000444" "g.57478771G>A" "" "" "" "GNAS(NM_080425.3):c.2286G>A (p.L762=), GNAS(NM_080425.4):c.2286G>A (p.L762=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903716G>A" "" "likely benign" "" "0000570102" "0" "10" "20" "57478780" "57478780" "subst" "0.00139277" "01943" "GNAS_000445" "g.57478780C>T" "" "" "" "GNAS(NM_000516.4):c.366C>T (p.(Pro122=)), GNAS(NM_080425.3):c.2295C>T (p.P765=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903725C>T" "" "benign" "" "0000570103" "0" "30" "20" "57478780" "57478780" "subst" "0.00139277" "01804" "GNAS_000445" "g.57478780C>T" "" "" "" "GNAS(NM_000516.4):c.366C>T (p.(Pro122=)), GNAS(NM_080425.3):c.2295C>T (p.P765=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903725C>T" "" "likely benign" "" "0000570104" "0" "10" "20" "57478798" "57478798" "subst" "0.00144962" "01943" "GNAS_000446" "g.57478798G>A" "" "" "" "GNAS(NM_000516.4):c.384G>A (p.(Val128=)), GNAS(NM_080425.3):c.2313G>A (p.V771=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903743G>A" "" "benign" "" "0000570105" "0" "30" "20" "57478798" "57478798" "subst" "0.00144962" "01804" "GNAS_000446" "g.57478798G>A" "" "" "" "GNAS(NM_000516.4):c.384G>A (p.(Val128=)), GNAS(NM_080425.3):c.2313G>A (p.V771=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903743G>A" "" "likely benign" "" "0000570106" "0" "10" "20" "57478807" "57478807" "subst" "0.541623" "02330" "GNAS_000386" "g.57478807C>T" "" "" "" "GNAS(NM_080425.3):c.2322C>T (p.I774=), GNAS(NM_080425.4):c.2322C>T (p.I774=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903752C>T" "" "benign" "" "0000570107" "0" "30" "20" "57478846" "57478846" "subst" "0.00221708" "01804" "GNAS_000387" "g.57478846C>T" "" "" "" "GNAS(NM_000516.4):c.432C>T (p.(=)), GNAS(NM_080425.3):c.2361C>T (p.P787=), GNAS(NM_080425.4):c.2361C>T (p.P787=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903791C>T" "" "likely benign" "" "0000570108" "0" "10" "20" "57480420" "57480420" "subst" "0.0340169" "02330" "GNAS_000388" "g.57480420T>C" "" "" "" "GNAS(NM_000516.4):c.433-18T>C (p.(=)), GNAS(NM_001077490.2):c.*294-18T>C, GNAS(NM_001077490.3):c.*294-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58905365T>C" "" "benign" "" "0000570109" "0" "10" "20" "57484241" "57484241" "subst" "0.027098" "02330" "GNAS_000022" "g.57484241C>T" "" "" "" "GNAS(NM_000516.4):c.555C>T (p.(=)), GNAS(NM_080425.3):c.2484C>T (p.I828=), GNAS(NM_080425.4):c.2484C>T (p.I828=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909186C>T" "" "benign" "" "0000570111" "0" "50" "20" "57484633" "57484633" "subst" "4.06072E-5" "01943" "GNAS_000448" "g.57484633C>T" "" "" "" "GNAS(NM_080425.3):c.2646C>T (p.N882=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909578C>T" "" "VUS" "" "0000570112" "0" "90" "20" "57484792" "57484792" "subst" "0" "01943" "GNAS_000034" "g.57484792C>T" "" "" "" "GNAS(NM_080425.3):c.2701C>T (p.R901W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909737C>T" "" "pathogenic" "" "0000570113" "0" "50" "20" "57484793" "57484793" "subst" "0" "02326" "GNAS_000395" "g.57484793G>A" "" "" "" "GNAS(NM_080425.3):c.2702G>A (p.R901Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909738G>A" "" "VUS" "" "0000570114" "0" "50" "20" "57484813" "57484813" "subst" "0" "02329" "GNAS_000449" "g.57484813C>T" "" "" "" "GNAS(NM_080425.4):c.2722C>T (p.R908C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909758C>T" "" "VUS" "" "0000570115" "0" "50" "20" "57484864" "57484864" "subst" "0" "01943" "GNAS_000450" "g.57484864G>C" "" "" "" "GNAS(NM_001077490.2):c.*700+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909809G>C" "" "VUS" "" "0000570116" "0" "50" "20" "57485394" "57485394" "subst" "0" "02327" "GNAS_000451" "g.57485394C>T" "" "" "" "GNAS(NM_080425.4):c.2905C>T (p.P969S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910339C>T" "" "VUS" "" "0000570117" "0" "30" "20" "57485396" "57485396" "subst" "1.62487E-5" "01943" "GNAS_000452" "g.57485396C>T" "" "" "" "GNAS(NM_000516.7):c.978C>T (p.(Pro326=)), GNAS(NM_080425.3):c.2907C>T (p.P969=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910341C>T" "" "likely benign" "" "0000570118" "0" "50" "20" "57485432" "57485432" "subst" "0" "02327" "GNAS_000453" "g.57485432G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910377G>T" "" "VUS" "" "0000570119" "0" "30" "20" "57485444" "57485444" "subst" "0" "01943" "GNAS_000454" "g.57485444A>G" "" "" "" "GNAS(NM_080425.3):c.2955A>G (p.R985=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910389A>G" "" "likely benign" "" "0000570120" "0" "10" "20" "57485812" "57485812" "subst" "0.0214584" "02330" "GNAS_000046" "g.57485812C>T" "" "" "" "GNAS(NM_000516.4):c.1113C>T (p.(=)), GNAS(NM_080425.3):c.3042C>T (p.N1014=), GNAS(NM_080425.4):c.3042C>T (p.N1014=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910757C>T" "" "benign" "" "0000570121" "0" "30" "20" "57485878" "57485878" "subst" "4.06095E-6" "01943" "GNAS_000455" "g.57485878G>T" "" "" "" "GNAS(NM_080425.3):c.3108G>T (p.L1036=), GNAS(NM_080425.4):c.3108G>T (p.L1036=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910823G>T" "" "likely benign" "" "0000618220" "0" "30" "20" "57415307" "57415307" "subst" "2.50294E-5" "01943" "GNAS_000456" "g.57415307A>G" "" "" "" "GNAS(NM_016592.3):c.146A>G (p.N49S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840252A>G" "" "likely benign" "" "0000618221" "0" "30" "20" "57415366" "57415366" "subst" "0.000366699" "01804" "GNAS_000457" "g.57415366C>A" "" "" "" "GNAS(NM_016592.2):c.205C>A (p.(His69Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840311C>A" "" "likely benign" "" "0000618222" "0" "30" "20" "57415559" "57415559" "subst" "6.1296E-5" "01943" "GNAS-AS1_000001" "g.57415559C>T" "" "" "" "GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.5):c.398C>T (p.P133L, p.(Pro133Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840504C>T" "" "likely benign" "" "0000618223" "0" "10" "20" "57415698" "57415698" "subst" "0.0007244" "02330" "GNAS_000458" "g.57415698G>A" "" "" "" "GNAS(NM_016592.3):c.537G>A (p.P179=), GNAS(NM_016592.5):c.537G>A (p.P179=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840643G>A" "" "benign" "" "0000618224" "0" "10" "20" "57415876" "57415876" "subst" "0.00294844" "02330" "GNAS_000408" "g.57415876C>A" "" "" "" "GNAS(NM_001309861.1):c.-1093C>A (p.(=)), GNAS(NM_016592.4):c.715C>A (p.P239T), GNAS(NM_016592.5):c.715C>A (p.P239T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840821C>A" "" "benign" "" "0000618225" "0" "30" "20" "57428403" "57428403" "subst" "0" "01804" "GNAS_000460" "g.57428403A>G" "" "" "" "GNAS(NM_001077490.1):c.-105A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853348A>G" "" "likely benign" "" "0000618226" "0" "30" "20" "57428947" "57428947" "subst" "0.00800366" "02330" "GNAS_000354" "g.57428947G>A" "" "" "" "GNAS(NM_001077490.1):c.440G>A (p.(Arg147Lys)), GNAS(NM_001077490.2):c.440G>A (p.R147K), GNAS(NM_001077490.3):c.440G>A (p.R147K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853892G>A" "" "likely benign" "" "0000618227" "0" "50" "20" "57429278" "57429280" "del" "0" "01943" "GNAS_000463" "g.57429278_57429280del" "" "" "" "GNAS(NM_001077490.2):c.771_773delGAC (p.T258del), GNAS(NM_001077490.3):c.771_773delGAC (p.T258del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854223_58854225del" "" "VUS" "" "0000618228" "0" "30" "20" "57429560" "57429560" "subst" "0" "01943" "GNAS_000464" "g.57429560G>A" "" "" "" "GNAS(NM_080425.3):c.1240G>A (p.G414R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854505G>A" "" "likely benign" "" "0000618229" "0" "50" "20" "57429619" "57429654" "del" "0" "01804" "GNAS_000465" "g.57429619_57429654del" "" "" "" "GNAS(NM_001077490.1):c.1090_1125del (p.(Gln371_Gly382del)), GNAS(NM_001077490.3):c.1112_1147del (p.Q371_G382del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854564_58854599del" "" "VUS" "" "0000618230" "0" "50" "20" "57429717" "57429718" "ins" "0" "01804" "GNAS_000466" "g.57429717_57429718insC" "" "" "" "GNAS(NM_001077490.1):c.1210_1211insC (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854662_58854663insC" "" "VUS" "" "0000618231" "0" "50" "20" "57429858" "57429858" "subst" "5.77707E-5" "02327" "GNAS_000467" "g.57429858C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854803C>T" "" "VUS" "" "0000618232" "0" "30" "20" "57430345" "57430345" "subst" "0" "01943" "GNAS_000468" "g.57430345C>G" "" "" "" "GNAS(NM_001077490.2):c.1838C>G (p.T613R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855290C>G" "" "likely benign" "" "0000618233" "0" "30" "20" "57430557" "57430557" "subst" "0" "01804" "GNAS_000469" "g.57430557A>T" "" "" "" "GNAS(NM_001077490.1):c.*169A>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855502A>T" "" "likely benign" "" "0000618234" "0" "30" "20" "57430568" "57430568" "subst" "0.000626009" "01804" "GNAS_000470" "g.57430568A>T" "" "" "" "GNAS(NM_001077490.1):c.*180A>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58855513A>T" "" "likely benign" "" "0000618235" "0" "10" "20" "57466871" "57466871" "subst" "7.84645E-5" "02330" "GNAS_000472" "g.57466871G>A" "" "" "" "GNAS(NM_001077488.3):c.90G>A (p.L30=), GNAS(NM_001077488.5):c.90G>A (p.L30=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58891816G>A" "" "benign" "" "0000618236" "0" "70" "20" "57466920" "57466920" "subst" "0" "02327" "GNAS_000473" "g.57466920G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58891865G>C" "" "likely pathogenic" "" "0000618237" "0" "30" "20" "57474002" "57474002" "subst" "0.000682233" "01943" "GNAS_000474" "g.57474002C>T" "" "" "" "GNAS(NM_080425.3):c.2148C>T (p.G716=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58898947C>T" "" "likely benign" "" "0000618238" "0" "10" "20" "57474026" "57474026" "subst" "0" "02330" "GNAS_000475" "g.57474026G>A" "" "" "" "GNAS(NM_080425.4):c.2172G>A (p.R724=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58898971G>A" "" "benign" "" "0000618239" "0" "30" "20" "57478607" "57478607" "subst" "0" "01804" "GNAS_000476" "g.57478607G>A" "" "" "" "GNAS(NM_000516.4):c.279G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58903552G>A" "" "likely benign" "" "0000618240" "0" "30" "20" "57484241" "57484241" "subst" "0.027098" "01804" "GNAS_000022" "g.57484241C>T" "" "" "" "GNAS(NM_000516.4):c.555C>T (p.(=)), GNAS(NM_080425.3):c.2484C>T (p.I828=), GNAS(NM_080425.4):c.2484C>T (p.I828=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909186C>T" "" "likely benign" "" "0000618241" "0" "70" "20" "57484770" "57484770" "subst" "0" "02327" "GNAS_000033" "g.57484770C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909715C>G" "" "likely pathogenic" "" "0000618242" "0" "30" "20" "57485812" "57485812" "subst" "0.0214584" "01804" "GNAS_000046" "g.57485812C>T" "" "" "" "GNAS(NM_000516.4):c.1113C>T (p.(=)), GNAS(NM_080425.3):c.3042C>T (p.N1014=), GNAS(NM_080425.4):c.3042C>T (p.N1014=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910757C>T" "" "likely benign" "" "0000624175" "0" "30" "20" "57415737" "57415737" "subst" "0" "01943" "GNAS_000459" "g.57415737G>A" "" "" "" "GNAS(NM_016592.3):c.576G>A (p.E192=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840682G>A" "" "likely benign" "" "0000624176" "0" "50" "20" "57428858" "57428858" "subst" "0.000106967" "01943" "GNAS_000412" "g.57428858C>T" "" "" "" "GNAS(NM_080425.3):c.538C>T (p.Q180*), GNAS(NM_080425.4):c.538C>T (p.Q180*, p.(Gln180Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58853803C>T" "" "VUS" "" "0000624177" "0" "90" "20" "57429067" "57429067" "subst" "4.28449E-6" "01943" "GNAS_000461" "g.57429067C>A" "" "" "" "GNAS(NM_001077490.2):c.560C>A (p.S187*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854012C>A" "" "pathogenic" "" "0000624178" "0" "30" "20" "57429233" "57429233" "subst" "0.000188957" "02330" "GNAS_000462" "g.57429233T>C" "" "" "" "GNAS(NM_080425.3):c.913T>C (p.S305P), GNAS(NM_080425.4):c.913T>C (p.S305P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854178T>C" "" "likely benign" "" "0000624180" "0" "30" "20" "57485454" "57485454" "subst" "2.84845E-5" "01943" "GNAS_000477" "g.57485454C>T" "" "" "" "GNAS(NM_080425.3):c.2965C>T (p.L989=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910399C>T" "" "likely benign" "" "0000650816" "1" "10" "20" "57480420" "57480420" "subst" "0.0340169" "03575" "GNAS_000388" "g.57480420T>C" "112/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "112 heterozygous; {DB:CLININrs3730170}" "Germline" "" "rs3730170" "0" "" "" "g.58905365T>C" "" "benign" "" "0000658783" "0" "30" "20" "57415455" "57415455" "subst" "0.0298887" "01804" "GNAS_000401" "g.57415455C>T" "" "" "" "GNAS(NM_001309861.1):c.-1514C>T (p.(=)), GNAS(NM_016592.5):c.294C>T (p.P98=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58840400C>T" "" "likely benign" "" "0000658784" "0" "30" "20" "57429600" "57429600" "subst" "0.000264075" "01943" "GNAS_000369" "g.57429600C>A" "" "" "" "GNAS(NM_001077490.1):c.1093C>A (p.(Pro365Thr)), GNAS(NM_001077490.2):c.1093C>A (p.P365T), GNAS(NM_001077490.3):c.1093C>A (p.P365T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854545C>A" "" "likely benign" "" "0000658785" "0" "30" "20" "57429691" "57429691" "subst" "8.00448E-6" "01943" "GNAS_000478" "g.57429691G>C" "" "" "" "GNAS(NM_001077490.2):c.1184G>C (p.R395P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58854636G>C" "" "likely benign" "" "0000658786" "0" "30" "20" "57484204" "57484207" "del" "0" "02326" "GNAS_000479" "g.57484204_57484207del" "" "" "" "GNAS(NM_001077490.2):c.*392-13_*392-10delCTTT, GNAS(NM_001077490.3):c.*392-13_*392-10delCTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58909149_58909152del" "" "likely benign" "" "0000658787" "0" "30" "20" "57485057" "57485057" "subst" "0" "01943" "GNAS_000480" "g.57485057C>A" "" "" "" "GNAS(NM_080425.3):c.2820C>A (p.L940=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910002C>A" "" "likely benign" "" "0000658788" "0" "90" "20" "57485806" "57485807" "del" "0" "02330" "GNAS_000481" "g.57485806_57485807del" "" "" "" "GNAS(NM_080425.4):c.3036_3037delTG (p.N1014Hfs*10)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.58910751_58910752del" "" "pathogenic" "" "0000669683" "3" "10" "20" "57480420" "57480420" "subst" "0.0340169" "03575" "GNAS_000388" "g.57480420T>C" "3/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 homozygous; {DB:CLININrs3730170}" "Germline" "" "rs3730170" "0" "" "" "g.58905365T>C" "" "benign" "" "0000675197" "0" "70" "20" "57430093" "57430093" "subst" "0" "03753" "GNAS_000487" "g.57430093G>A" "0.037" "{PMID:Mendonca 2021:34478740}" "" "" "" "Somatic" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000681656" "0" "30" "20" "57428516" "57428516" "subst" "0.000324999" "01943" "GNAS_000482" "g.57428516G>A" "" "" "" "GNAS(NM_001077490.1):c.9G>A (p.(=)), GNAS(NM_080425.3):c.196G>A (p.E66K), GNAS(NM_080425.4):c.196G>A (p.E66K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681657" "0" "50" "20" "57429087" "57429087" "subst" "0" "01943" "GNAS_000483" "g.57429087C>T" "" "" "" "GNAS(NM_001077490.2):c.580C>T (p.R194W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681659" "0" "50" "20" "57429643" "57429643" "subst" "6.9076E-6" "01943" "GNAS_000485" "g.57429643C>T" "" "" "" "GNAS(NM_001077490.2):c.1136C>T (p.P379L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681660" "0" "30" "20" "57429696" "57429696" "subst" "0.00956966" "01804" "GNAS_000428" "g.57429696C>G" "" "" "" "GNAS(NM_001077490.1):c.1189C>G (p.(Leu397Val)), GNAS(NM_001077490.2):c.1189C>G (p.L397V), GNAS(NM_001077490.3):c.1189C>G (p.L397V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681661" "0" "30" "20" "57429782" "57429782" "subst" "0.000126674" "01943" "GNAS_000430" "g.57429782G>A" "" "" "" "GNAS(NM_001077490.1):c.1275G>A (p.(=)), GNAS(NM_080425.3):c.1462G>A (p.A488T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681662" "0" "30" "20" "57430006" "57430006" "subst" "0.000112425" "01943" "GNAS_000486" "g.57430006C>T" "" "" "" "GNAS(NM_001077490.2):c.1499C>T (p.A500V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681663" "0" "30" "20" "57430273" "57430273" "subst" "0" "01804" "GNAS_000488" "g.57430273A>T" "" "" "" "GNAS(NM_001077490.1):c.1766A>T (p.(Lys589Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681664" "0" "30" "20" "57438033" "57438033" "del" "0" "01804" "GNAS_000489" "g.57438033del" "" "" "" "GNAS(NM_001077490.1):c.*7631del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681665" "0" "10" "20" "57480420" "57480420" "subst" "0.0340169" "01804" "GNAS_000388" "g.57480420T>C" "" "" "" "GNAS(NM_000516.4):c.433-18T>C (p.(=)), GNAS(NM_001077490.2):c.*294-18T>C, GNAS(NM_001077490.3):c.*294-18T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000681666" "0" "50" "20" "57480483" "57480483" "subst" "0" "02325" "GNAS_000019" "g.57480483C>T" "" "" "" "GNAS(NM_080425.4):c.2407C>T (p.R803C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000681667" "0" "50" "20" "57484814" "57484814" "subst" "0" "01943" "GNAS_000105" "g.57484814G>A" "" "" "" "GNAS(NM_080425.3):c.2723G>A (p.R908H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000682766" "0" "70" "20" "57484618" "57484618" "subst" "0" "03753" "GNAS_000490" "g.57484618G>A" "0.091" "{PMID:Mendonca 2021:34478740}" "" "" "" "Somatic" "" "" "" "" "" "" "" "pathogenic" "ACMG" "0000693007" "0" "50" "20" "57415401" "57415401" "del" "0" "02325" "GNAS-AS1_000004" "g.57415401del" "" "" "" "GNAS(NM_016592.5):c.240delC (p.E81Nfs*21)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693008" "0" "30" "20" "57415698" "57415698" "subst" "0.0007244" "01943" "GNAS_000458" "g.57415698G>A" "" "" "" "GNAS(NM_016592.3):c.537G>A (p.P179=), GNAS(NM_016592.5):c.537G>A (p.P179=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693009" "0" "50" "20" "57428997" "57428997" "subst" "3.31461E-5" "01943" "GNAS_000491" "g.57428997T>C" "" "" "" "GNAS(NM_001077490.2):c.490T>C (p.L164=), GNAS(NM_080425.3):c.677T>C (p.F226S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693010" "0" "50" "20" "57430328" "57430328" "subst" "0" "01943" "GNAS_000492" "g.57430328G>A" "" "" "" "GNAS(NM_080425.3):c.2008G>A (p.D670N), GNAS(NM_080425.4):c.2008G>A (p.(Asp670Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693011" "0" "30" "20" "57466849" "57466849" "subst" "0" "01943" "GNAS_000493" "g.57466849A>G" "" "" "" "GNAS(NM_001077488.3):c.68A>G (p.N23S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000693012" "0" "50" "20" "57475010" "57475012" "del" "0" "01943" "GNAS_000494" "g.57475010_57475012del" "" "" "" "GNAS(NM_001309842.1):c.262_264delTAA (p.*88Yext*2), GNAS(NM_001309842.2):c.262_264delTAA (p.*88Yext*2), GNAS(NM_001309842.2):c.264_*2del (p.(*88T...))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727761" "0" "30" "20" "57415297" "57415297" "subst" "2.50146E-5" "01804" "GNAS-AS1_000005" "g.57415297G>C" "" "" "" "GNAS(NM_001309861.1):c.-1672G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727762" "0" "50" "20" "57415491" "57415514" "dup" "0" "02330" "GNAS-AS1_000006" "g.57415491_57415514dup" "" "" "" "GNAS(NM_016592.5):c.330_353dupGACCGAGAGCGAGACCGAGTCCGA (p.T111_E118dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727763" "0" "10" "20" "57415557" "57415557" "subst" "0" "02330" "GNAS-AS1_000007" "g.57415557C>A" "" "" "" "GNAS(NM_016592.5):c.396C>A (p.A132=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000727764" "0" "30" "20" "57415675" "57415675" "subst" "0" "02330" "GNAS-AS1_000008" "g.57415675G>A" "" "" "" "GNAS(NM_016592.3):c.514G>A (p.D172N), GNAS(NM_016592.5):c.514G>A (p.D172N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727765" "0" "50" "20" "57415769" "57415769" "subst" "0" "02330" "GNAS-AS1_000009" "g.57415769A>T" "" "" "" "GNAS(NM_016592.5):c.608A>T (p.D203V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727766" "0" "30" "20" "57428327" "57428327" "subst" "2.69288E-5" "01943" "GNAS_000496" "g.57428327G>A" "" "" "" "GNAS(NM_080425.3):c.7G>A (p.V3M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727767" "0" "50" "20" "57428474" "57428474" "subst" "0.000113984" "01943" "GNAS_000350" "g.57428474G>A" "" "" "" "GNAS(NM_001077490.1):c.-34G>A (p.(=)), GNAS(NM_080425.3):c.154G>A (p.E52K), GNAS(NM_080425.4):c.154G>A (p.E52K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727768" "0" "50" "20" "57428780" "57428780" "subst" "8.13292E-6" "02330" "GNAS_000411" "g.57428780T>C" "" "" "" "GNAS(NM_080425.3):c.460T>C (p.Y154H), GNAS(NM_080425.4):c.460T>C (p.Y154H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727769" "0" "50" "20" "57428858" "57428858" "subst" "0.000106967" "02330" "GNAS_000412" "g.57428858C>T" "" "" "" "GNAS(NM_080425.3):c.538C>T (p.Q180*), GNAS(NM_080425.4):c.538C>T (p.Q180*, p.(Gln180Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727770" "0" "30" "20" "57428948" "57428948" "subst" "0.00127917" "02330" "GNAS_000355" "g.57428948G>C" "" "" "" "GNAS(NM_001077490.2):c.441G>C (p.R147S), GNAS(NM_001077490.3):c.441G>C (p.R147S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727771" "0" "30" "20" "57429098" "57429098" "subst" "4.35078E-6" "02330" "GNAS_000497" "g.57429098G>T" "" "" "" "GNAS(NM_080425.4):c.778G>T (p.A260S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727772" "0" "50" "20" "57429116" "57429116" "subst" "4.31887E-6" "01804" "GNAS_000498" "g.57429116C>T" "" "" "" "GNAS(NM_001077490.1):c.609C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727773" "0" "50" "20" "57429278" "57429280" "del" "0" "02325" "GNAS_000463" "g.57429278_57429280del" "" "" "" "GNAS(NM_001077490.2):c.771_773delGAC (p.T258del), GNAS(NM_001077490.3):c.771_773delGAC (p.T258del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727774" "0" "30" "20" "57429321" "57429321" "subst" "7.01679E-5" "02330" "GNAS_000418" "g.57429321G>A" "" "" "" "GNAS(NM_001077490.2):c.814G>A (p.A272T), GNAS(NM_001077490.3):c.814G>A (p.A272T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727775" "0" "30" "20" "57429541" "57429541" "subst" "0.00093337" "02330" "GNAS_000367" "g.57429541C>G" "" "" "" "GNAS(NM_001077490.1):c.1034C>G (p.(Pro345Arg)), GNAS(NM_001077490.2):c.1034C>G (p.P345R), GNAS(NM_001077490.3):c.1034C>G (p.P345R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727776" "0" "30" "20" "57429590" "57429590" "subst" "0" "01943" "GNAS_000499" "g.57429590G>C" "" "" "" "GNAS(NM_080425.3):c.1270G>C (p.A424P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727777" "0" "30" "20" "57429600" "57429600" "subst" "0.000264075" "02330" "GNAS_000369" "g.57429600C>A" "" "" "" "GNAS(NM_001077490.1):c.1093C>A (p.(Pro365Thr)), GNAS(NM_001077490.2):c.1093C>A (p.P365T), GNAS(NM_001077490.3):c.1093C>A (p.P365T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727778" "0" "30" "20" "57429629" "57429629" "subst" "2.7004E-5" "01943" "GNAS_000500" "g.57429629G>T" "" "" "" "GNAS(NM_080425.3):c.1309G>T (p.A437S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727779" "0" "30" "20" "57429650" "57429650" "subst" "2.15638E-5" "02330" "GNAS_000370" "g.57429650G>A" "" "" "" "GNAS(NM_080425.3):c.1330G>A (p.G444R), GNAS(NM_080425.4):c.1330G>A (p.G444R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727780" "0" "30" "20" "57429655" "57429655" "subst" "0" "01943" "GNAS_000426" "g.57429655G>A" "" "" "" "GNAS(NM_001077490.1):c.1148G>A (p.(Arg383Gln)), GNAS(NM_001077490.2):c.1148G>A (p.R383Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727781" "0" "30" "20" "57429663" "57429663" "subst" "0" "02330" "GNAS_000427" "g.57429663A>C" "" "" "" "GNAS(NM_001077490.1):c.1156A>C (p.(Thr386Pro)), GNAS(NM_001077490.3):c.1156A>C (p.T386P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727782" "0" "10" "20" "57429714" "57429715" "ins" "0" "02330" "GNAS_000373" "g.57429714_57429715insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "" "" "" "GNAS(NM_001077490.1):c.1207_1208insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC (p.(Ile402_Gln403insProThrProGlyArgProValThrProGlnProIle)), GNAS(NM_001077...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000727783" "0" "30" "20" "57429748" "57429748" "subst" "0.000994617" "02330" "GNAS_000377" "g.57429748C>G" "" "" "" "GNAS(NM_001077490.1):c.1241C>G (p.(Pro414Arg)), GNAS(NM_001077490.2):c.1241C>G (p.P414R), GNAS(NM_001077490.3):c.1241C>G (p.P414R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727784" "0" "30" "20" "57429749" "57429749" "subst" "7.4859E-5" "01943" "GNAS_000501" "g.57429749C>T" "" "" "" "GNAS(NM_080425.3):c.1429C>T (p.P477S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727785" "0" "30" "20" "57429760" "57429760" "subst" "4.90348E-5" "02330" "GNAS_000502" "g.57429760T>A" "" "" "" "GNAS(NM_001077490.3):c.1253T>A (p.L418Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727786" "0" "30" "20" "57429775" "57429775" "subst" "0.002565" "02330" "GNAS_000379" "g.57429775C>A" "" "" "" "GNAS(NM_001077490.1):c.1268C>A (p.(Pro423His)), GNAS(NM_001077490.2):c.1268C>A (p.P423H), GNAS(NM_001077490.3):c.1268C>A (p.P423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727787" "0" "50" "20" "57429782" "57429850" "del" "0" "02325" "GNAS_000503" "g.57429782_57429850del" "" "" "" "GNAS(NM_001077490.3):c.1275_1343del (p.P426_S448del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727788" "0" "30" "20" "57430074" "57430074" "subst" "0" "01804" "GNAS_000504" "g.57430074C>A" "" "" "" "GNAS(NM_001077490.1):c.1567C>A (p.(Pro523Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727789" "0" "30" "20" "57430243" "57430243" "subst" "0.000187137" "02330" "GNAS_000437" "g.57430243G>C" "" "" "" "GNAS(NM_001077490.2):c.1736G>C (p.W579S), GNAS(NM_001077490.3):c.1736G>C (p.W579S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727790" "0" "10" "20" "57466748" "57466777" "del" "0" "02330" "GNAS_000505" "g.57466748_57466777del" "" "" "" "GNAS(NM_001077488.5):c.-34_-5delAGCCCGGCCGCGCCCCGCCGCCGCCGCCGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000727791" "0" "30" "20" "57466748" "57466780" "del" "0" "02330" "GNAS_000506" "g.57466748_57466780del" "" "" "" "GNAS(NM_001077488.5):c.-34_-2del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727792" "0" "30" "20" "57466776" "57466781" "del" "0" "02330" "GNAS_000507" "g.57466776_57466781del" "" "" "" "GNAS(NM_000516.4):c.-6_-1delGCCGCC (p.?), GNAS(NM_001077488.5):c.-6_-1delGCCGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727793" "0" "30" "20" "57466796" "57466796" "subst" "0" "02330" "GNAS_000508" "g.57466796G>A" "" "" "" "GNAS(NM_001077488.5):c.15G>A (p.G5=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727794" "0" "30" "20" "57475010" "57475012" "del" "0" "02330" "GNAS_000494" "g.57475010_57475012del" "" "" "" "GNAS(NM_001309842.1):c.262_264delTAA (p.*88Yext*2), GNAS(NM_001309842.2):c.262_264delTAA (p.*88Yext*2), GNAS(NM_001309842.2):c.264_*2del (p.(*88T...))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727795" "0" "50" "20" "57478643" "57478643" "subst" "0" "02330" "GNAS_000509" "g.57478643A>G" "" "" "" "GNAS(NM_001077490.3):c.*173+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727796" "0" "30" "20" "57478657" "57478657" "subst" "0.000203028" "02330" "GNAS_000510" "g.57478657T>C" "" "" "" "GNAS(NM_001077490.2):c.*173+17T>C, GNAS(NM_001077490.3):c.*173+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727797" "0" "30" "20" "57478861" "57478861" "subst" "0.000471035" "02330" "GNAS_000511" "g.57478861G>A" "" "" "" "GNAS(NM_001077490.3):c.*293+15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727798" "0" "50" "20" "57480495" "57480495" "subst" "0" "02330" "GNAS_000512" "g.57480495G>A" "" "" "" "GNAS(NM_080425.4):c.2419G>A (p.E807K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727799" "0" "70" "20" "57480498" "57480498" "subst" "0" "02327" "GNAS_000021" "g.57480498C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000727800" "0" "30" "20" "57484204" "57484207" "del" "0" "02330" "GNAS_000479" "g.57484204_57484207del" "" "" "" "GNAS(NM_001077490.2):c.*392-13_*392-10delCTTT, GNAS(NM_001077490.3):c.*392-13_*392-10delCTTT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727801" "0" "50" "20" "57484478" "57484478" "subst" "0" "02329" "GNAS_000447" "g.57484478A>C" "" "" "" "GNAS(NM_080425.4):c.2588A>C (p.H863P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727802" "0" "30" "20" "57485102" "57485102" "subst" "1.62484E-5" "02330" "GNAS_000513" "g.57485102T>C" "" "" "" "GNAS(NM_080425.3):c.2865T>C (p.F955=), GNAS(NM_080425.4):c.2865T>C (p.F955=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727803" "0" "30" "20" "57485102" "57485102" "subst" "1.62484E-5" "01943" "GNAS_000513" "g.57485102T>C" "" "" "" "GNAS(NM_080425.3):c.2865T>C (p.F955=), GNAS(NM_080425.4):c.2865T>C (p.F955=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727804" "0" "50" "20" "57485394" "57485394" "subst" "0" "02330" "GNAS_000451" "g.57485394C>T" "" "" "" "GNAS(NM_080425.4):c.2905C>T (p.P969S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727805" "0" "50" "20" "57485765" "57485765" "subst" "0" "02330" "GNAS_000514" "g.57485765C>T" "" "" "" "GNAS(NM_080425.4):c.2995C>T (p.R999C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000727806" "0" "70" "20" "57485795" "57485795" "subst" "0" "02329" "GNAS_000202" "g.57485795G>A" "" "" "" "GNAS(NM_000516.6):c.1096G>A (p.A366T), GNAS(NM_080425.4):c.3025G>A (p.A1009T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000729962" "0" "90" "20" "57480481" "57480481" "subst" "0" "00000" "GNAS_000389" "g.57480481T>C" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_080425.2:c.2405T>C:p.(Val802Ala)" "" "De novo" "" "" "0" "" "" "g.58905426T>C" "" "likely pathogenic (dominant)" "" "0000759623" "20" "90" "20" "57480523" "57480526" "del" "0" "01164" "GNAS_000163" "g.57480523_57480526del" "" "PMID: 23533243" "" "" "ACMG: PVS1, PM2_SUP; PP4; class 5" "Germline" "?" "" "0" "" "" "g.58905468_58905471del" "" "pathogenic (dominant)" "ACMG" "0000760708" "20" "90" "20" "57478847" "57478847" "subst" "0" "03149" "GNAS_000300" "g.57478847G>C" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000760709" "0" "70" "20" "57478824" "57478825" "ins" "0" "03149" "GNAS_000515" "g.57478824_57478825insA" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.58903769_58903770insA" "" "likely pathogenic (dominant)" "ACMG" "0000763243" "1" "70" "20" "57480481" "57480481" "subst" "0" "00006" "GNAS_000389" "g.57480481T>C" "" "{PMID:Anazi 2017:27431290}" "" "NM_080425.3:c.2405T>C" "ACMG PS2, PM2, PP3" "De novo" "" "" "0" "" "" "g.58905426T>C" "" "likely pathogenic" "ACMG" "0000809288" "0" "30" "20" "57415299" "57415299" "subst" "9.17186E-5" "01943" "GNAS-AS1_000010" "g.57415299C>A" "" "" "" "GNAS(NM_016592.3):c.138C>A (p.A46=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809289" "0" "50" "20" "57415559" "57415559" "subst" "6.1296E-5" "02330" "GNAS-AS1_000001" "g.57415559C>T" "" "" "" "GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.5):c.398C>T (p.P133L, p.(Pro133Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809290" "0" "10" "20" "57415602" "57415602" "subst" "0.000330375" "02330" "GNAS-AS1_000011" "g.57415602G>A" "" "" "" "GNAS(NM_016592.3):c.441G>A (p.P147=), GNAS(NM_016592.5):c.441G>A (p.P147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809291" "0" "30" "20" "57415881" "57415881" "subst" "0.000124204" "01943" "GNAS-AS1_000012" "g.57415881C>A" "" "" "" "GNAS(NM_016592.3):c.720C>A (p.I240=), GNAS(NM_016592.5):c.720C>A (p.I240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809292" "0" "30" "20" "57428516" "57428516" "subst" "0.000324999" "02330" "GNAS_000482" "g.57428516G>A" "" "" "" "GNAS(NM_001077490.1):c.9G>A (p.(=)), GNAS(NM_080425.3):c.196G>A (p.E66K), GNAS(NM_080425.4):c.196G>A (p.E66K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809293" "0" "10" "20" "57428845" "57428845" "subst" "0.00174878" "02330" "GNAS_000353" "g.57428845T>C" "" "" "" "GNAS(NM_001077490.1):c.338T>C (p.(Val113Ala)), GNAS(NM_001077490.3):c.338T>C (p.V113A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809294" "0" "90" "20" "57429050" "57429050" "subst" "4.23015E-6" "01943" "GNAS_000516" "g.57429050C>T" "" "" "" "GNAS(NM_080425.3):c.730C>T (p.R244*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000809295" "0" "30" "20" "57429217" "57429217" "subst" "0.000119471" "02330" "GNAS_000359" "g.57429217C>A" "" "" "" "GNAS(NM_001077490.2):c.710C>A (p.A237D), GNAS(NM_001077490.3):c.710C>A (p.A237D), GNAS(NM_080425.4):c.897C>A (p.(Ser299Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809296" "0" "30" "20" "57429340" "57429340" "subst" "8.50615E-5" "01943" "GNAS_000517" "g.57429340C>T" "" "" "" "GNAS(NM_001077490.2):c.833C>T (p.P278L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809297" "0" "30" "20" "57429384" "57429384" "subst" "0.000161078" "01943" "GNAS_000518" "g.57429384A>G" "" "" "" "GNAS(NM_001077490.2):c.877A>G (p.R293G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809298" "0" "30" "20" "57429587" "57429587" "subst" "6.21968E-5" "01943" "GNAS_000519" "g.57429587G>C" "" "" "" "GNAS(NM_080425.3):c.1267G>C (p.G423R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809299" "0" "30" "20" "57466776" "57466781" "dup" "0" "02330" "GNAS_000520" "g.57466776_57466781dup" "" "" "" "GNAS(NM_001077488.5):c.-8_-3dupCCGCCG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809300" "0" "10" "20" "57466868" "57466868" "subst" "2.44959E-5" "02330" "GNAS_000521" "g.57466868G>A" "" "" "" "GNAS(NM_001077488.5):c.87G>A (p.Q29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809301" "0" "30" "20" "57466871" "57466871" "subst" "7.84645E-5" "01943" "GNAS_000472" "g.57466871G>A" "" "" "" "GNAS(NM_001077488.3):c.90G>A (p.L30=), GNAS(NM_001077488.5):c.90G>A (p.L30=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809302" "0" "10" "20" "57466911" "57466911" "subst" "0" "02330" "GNAS_000522" "g.57466911C>T" "" "" "" "GNAS(NM_001077488.5):c.130C>T (p.L44=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809303" "0" "30" "20" "57473991" "57473991" "subst" "6.90344E-5" "01943" "GNAS_000523" "g.57473991A>G" "" "" "" "GNAS(NM_001077488.3):c.213-5A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809304" "0" "90" "20" "57480499" "57480499" "subst" "0" "02330" "GNAS_000279" "g.57480499G>A" "" "" "" "GNAS(NM_080425.4):c.2423G>A (p.R808H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000809305" "0" "30" "20" "57480545" "57480545" "subst" "0.000166525" "02330" "GNAS_000524" "g.57480545C>T" "" "" "" "GNAS(NM_001077490.3):c.*391+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809306" "0" "10" "20" "57484198" "57484198" "subst" "8.12341E-6" "02330" "GNAS_000525" "g.57484198G>A" "" "" "" "GNAS(NM_001077490.3):c.*392-19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809307" "0" "90" "20" "57484421" "57484421" "subst" "0" "02325" "GNAS_000027" "g.57484421G>A" "" "" "" "GNAS(NM_000516.7):c.602G>A (p.R201H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000809308" "0" "70" "20" "57484598" "57484598" "subst" "0" "02330" "GNAS_000526" "g.57484598C>T" "" "" "" "GNAS(NM_000516.7):c.682C>T (p.R228C), GNAS(NM_080425.4):c.2611C>T (p.R871C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809309" "0" "70" "20" "57484748" "57484748" "subst" "0" "02327" "GNAS_000527" "g.57484748C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000809310" "0" "30" "20" "57485002" "57485002" "subst" "0" "02330" "GNAS_000528" "g.57485002G>A" "" "" "" "GNAS(NM_001077490.3):c.*701-4G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809311" "0" "10" "20" "57485117" "57485117" "subst" "0.00150295" "02330" "GNAS_000529" "g.57485117C>T" "" "" "" "GNAS(NM_080425.4):c.2880C>T (p.R960=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809312" "0" "10" "20" "57485464" "57485464" "subst" "8.14637E-6" "02330" "GNAS_000530" "g.57485464G>C" "" "" "" "GNAS(NM_001077490.3):c.*899+8G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000842558" "0" "90" "20" "57466920" "57466920" "subst" "0" "03779" "GNAS_000334" "g.57466920G>T" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000842559" "0" "90" "20" "57466889" "57466889" "subst" "0" "03779" "GNAS_000531" "g.57466889C>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000842560" "0" "10" "20" "57485812" "57485812" "subst" "0.0214584" "03779" "GNAS_000046" "g.57485812C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs8386" "0" "" "" "" "" "benign" "" "0000842561" "0" "10" "20" "57485812" "57485812" "subst" "0.0214584" "03779" "GNAS_000046" "g.57485812C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs8386" "0" "" "" "" "" "benign" "" "0000855881" "0" "50" "20" "57415289" "57415289" "subst" "2.91898E-5" "01943" "GNAS-AS1_000013" "g.57415289G>A" "" "" "" "GNAS(NM_016592.3):c.128G>A (p.R43H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855882" "0" "50" "20" "57415645" "57415645" "subst" "1.22903E-5" "01943" "GNAS-AS1_000015" "g.57415645C>A" "" "" "" "GNAS(NM_016592.3):c.484C>A (p.R162S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855883" "0" "50" "20" "57428474" "57428474" "subst" "0.000113984" "02330" "GNAS_000350" "g.57428474G>A" "" "" "" "GNAS(NM_001077490.1):c.-34G>A (p.(=)), GNAS(NM_080425.3):c.154G>A (p.E52K), GNAS(NM_080425.4):c.154G>A (p.E52K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000855884" "0" "30" "20" "57428780" "57428780" "subst" "8.13292E-6" "01943" "GNAS_000411" "g.57428780T>C" "" "" "" "GNAS(NM_080425.3):c.460T>C (p.Y154H), GNAS(NM_080425.4):c.460T>C (p.Y154H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855885" "0" "30" "20" "57428981" "57428981" "subst" "8.38645E-6" "01943" "GNAS_000533" "g.57428981G>A" "" "" "" "GNAS(NM_080425.3):c.661G>A (p.E221K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855886" "0" "30" "20" "57429306" "57429306" "subst" "0" "02330" "GNAS_000535" "g.57429306C>G" "" "" "" "GNAS(NM_001077490.3):c.799C>G (p.Q267E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855887" "0" "30" "20" "57429484" "57429484" "subst" "0" "02330" "GNAS_000536" "g.57429484G>A" "" "" "" "GNAS(NM_001077490.3):c.977G>A (p.R326Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855888" "0" "10" "20" "57429553" "57429579" "del" "0" "02330" "GNAS_000368" "g.57429553_57429579del" "" "" "" "GNAS(NM_001077490.1):c.1041_1067del (p.(Pro349_Ile357del)), GNAS(NM_001077490.2):c.1046_1072delCGACTCCGGGACAGCACCAGCCGATCC (p.P349_I357del), GNAS...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000855889" "0" "30" "20" "57429714" "57429715" "ins" "0" "02326" "GNAS_000373" "g.57429714_57429715insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "" "" "" "GNAS(NM_001077490.1):c.1207_1208insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC (p.(Ile402_Gln403insProThrProGlyArgProValThrProGlnProIle)), GNAS(NM_001077...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855890" "0" "30" "20" "57466779" "57466781" "dup" "0" "02330" "GNAS_000539" "g.57466779_57466781dup" "" "" "" "GNAS(NM_001077488.5):c.-5_-3dupCCG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000855891" "0" "10" "20" "57484262" "57484262" "subst" "4.87302E-5" "02330" "GNAS_000541" "g.57484262G>T" "" "" "" "GNAS(NM_080425.3):c.2505G>T (p.P835=), GNAS(NM_080425.4):c.2505G>T (p.P835=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000855892" "0" "30" "20" "57484262" "57484262" "subst" "4.87302E-5" "01943" "GNAS_000541" "g.57484262G>T" "" "" "" "GNAS(NM_080425.3):c.2505G>T (p.P835=), GNAS(NM_080425.4):c.2505G>T (p.P835=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866535" "0" "30" "20" "57415536" "57415536" "subst" "0" "01943" "GNAS-AS1_000014" "g.57415536C>G" "" "" "" "GNAS(NM_016592.3):c.375C>G (p.F125L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866536" "0" "30" "20" "57415602" "57415602" "subst" "0.000330375" "01943" "GNAS-AS1_000011" "g.57415602G>A" "" "" "" "GNAS(NM_016592.3):c.441G>A (p.P147=), GNAS(NM_016592.5):c.441G>A (p.P147=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866537" "0" "30" "20" "57415675" "57415675" "subst" "0" "01943" "GNAS-AS1_000008" "g.57415675G>A" "" "" "" "GNAS(NM_016592.3):c.514G>A (p.D172N), GNAS(NM_016592.5):c.514G>A (p.D172N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866538" "0" "30" "20" "57415692" "57415692" "subst" "0" "02330" "GNAS-AS1_000016" "g.57415692C>A" "" "" "" "GNAS(NM_016592.5):c.531C>A (p.R177=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866539" "0" "30" "20" "57428948" "57428948" "subst" "0.000113401" "01943" "GNAS_000532" "g.57428948G>T" "" "" "" "GNAS(NM_001077490.2):c.441G>T (p.R147S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866540" "0" "50" "20" "57429136" "57429136" "subst" "2.10455E-5" "01804" "GNAS_000534" "g.57429136G>A" "" "" "" "GNAS(NM_001077490.1):c.629G>A (p.(Arg210His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866541" "0" "50" "20" "57429141" "57429141" "subst" "0" "01804" "GNAS_000415" "g.57429141C>T" "" "" "" "GNAS(NM_001077490.1):c.634C>T (p.(Pro212Ser)), GNAS(NM_001077490.2):c.634C>T (p.P212S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866542" "0" "50" "20" "57429233" "57429233" "subst" "0.000188957" "01943" "GNAS_000462" "g.57429233T>C" "" "" "" "GNAS(NM_080425.3):c.913T>C (p.S305P), GNAS(NM_080425.4):c.913T>C (p.S305P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866543" "0" "30" "20" "57429321" "57429321" "subst" "7.01679E-5" "01943" "GNAS_000418" "g.57429321G>A" "" "" "" "GNAS(NM_001077490.2):c.814G>A (p.A272T), GNAS(NM_001077490.3):c.814G>A (p.A272T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866544" "0" "30" "20" "57429604" "57429604" "subst" "0" "01804" "GNAS_000537" "g.57429604T>G" "" "" "" "GNAS(NM_001077490.1):c.1097T>G (p.(Ile366Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866545" "0" "50" "20" "57430000" "57430000" "subst" "0" "01943" "GNAS_000381" "g.57430000C>A" "" "" "" "GNAS(NM_001077490.1):c.1493C>A (p.(Ala498Asp)), GNAS(NM_001077490.2):c.1493C>A (p.A498D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866546" "0" "30" "20" "57430117" "57430117" "subst" "0.000150954" "01804" "GNAS_000538" "g.57430117C>T" "" "" "" "GNAS(NM_001077490.1):c.1610C>T (p.(Ala537Val)), GNAS(NM_001077490.3):c.1610C>T (p.A537V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866547" "0" "50" "20" "57466878" "57466878" "subst" "0" "02325" "GNAS_000131" "g.57466878G>A" "" "" "" "GNAS(NM_000516.7):c.97G>A (p.D33N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866548" "0" "90" "20" "57484607" "57484607" "subst" "0" "02327" "GNAS_000098" "g.57484607C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000866549" "0" "50" "20" "57484739" "57484739" "subst" "0" "01804" "GNAS_000542" "g.57484739A>G" "" "" "" "GNAS(NM_000516.4):c.719A>G (p.(Asp240Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000867674" "0" "70" "20" "57478802" "57478802" "subst" "0" "03779" "GNAS_000540" "g.57478802T>C" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000881240" "0" "99" "20" "57480498" "57480498" "subst" "0" "02300" "GNAS_000021" "g.57480498C>T" "" "{PMID:Marinakis 2021:34008892}" "" "NM_001077488.2:c.496C>T" "ACMG PM1, PM2, PP2, PP3, PP5" "Germline/De novo (untested)" "" "rs137854532" "0" "" "" "g.58905443C>T" "" "pathogenic (dominant)" "ACMG" "0000881282" "0" "70" "20" "57478778" "57478778" "subst" "0" "02300" "GNAS_000543" "g.57478778C>G" "" "{PMID:Marinakis 2021:34008892}" "" "NM_080425.3:c.2293C>G (Pro765Ala)" "ACMG PM1, PM2, PP2, PP3" "Germline/De novo (untested)" "" "" "0" "" "" "g.58903723C>G" "" "likely pathogenic (dominant)" "ACMG" "0000895383" "0" "50" "20" "57429310" "57429310" "subst" "0" "02327" "GNAS_000544" "g.57429310C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895384" "0" "30" "20" "57429619" "57429654" "del" "0" "02330" "GNAS_000465" "g.57429619_57429654del" "" "" "" "GNAS(NM_001077490.1):c.1090_1125del (p.(Gln371_Gly382del)), GNAS(NM_001077490.3):c.1112_1147del (p.Q371_G382del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895385" "0" "30" "20" "57429696" "57429696" "subst" "0.00956966" "02326" "GNAS_000428" "g.57429696C>G" "" "" "" "GNAS(NM_001077490.1):c.1189C>G (p.(Leu397Val)), GNAS(NM_001077490.2):c.1189C>G (p.L397V), GNAS(NM_001077490.3):c.1189C>G (p.L397V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895386" "0" "30" "20" "57429775" "57429775" "subst" "0.002565" "02326" "GNAS_000379" "g.57429775C>A" "" "" "" "GNAS(NM_001077490.1):c.1268C>A (p.(Pro423His)), GNAS(NM_001077490.2):c.1268C>A (p.P423H), GNAS(NM_001077490.3):c.1268C>A (p.P423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895387" "0" "30" "20" "57430587" "57430587" "subst" "0.00707412" "01804" "GNAS_000545" "g.57430587G>C" "" "" "" "GNAS(NM_001077490.1):c.*199G>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895388" "0" "30" "20" "57478657" "57478657" "subst" "0.000203028" "02326" "GNAS_000510" "g.57478657T>C" "" "" "" "GNAS(NM_001077490.2):c.*173+17T>C, GNAS(NM_001077490.3):c.*173+17T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895389" "0" "70" "20" "57484780" "57484780" "subst" "0" "02327" "GNAS_000546" "g.57484780A>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000895390" "0" "50" "20" "57485837" "57485837" "subst" "0" "02330" "GNAS_000547" "g.57485837C>T" "" "" "" "GNAS(NM_080425.4):c.3067C>T (p.R1023C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000902941" "0" "70" "20" "57466917" "57466919" "dup" "0" "03779" "GNAS_000166" "g.57466917_57466919dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000902969" "0" "90" "20" "57466917" "57466919" "dup" "0" "03779" "GNAS_000166" "g.57466917_57466919dup" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0000915409" "0" "30" "20" "57428516" "57428516" "subst" "0.000324999" "01804" "GNAS_000482" "g.57428516G>A" "" "" "" "GNAS(NM_001077490.1):c.9G>A (p.(=)), GNAS(NM_080425.3):c.196G>A (p.E66K), GNAS(NM_080425.4):c.196G>A (p.E66K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915410" "0" "30" "20" "57466877" "57466877" "subst" "0" "02330" "GNAS_000548" "g.57466877G>A" "" "" "" "GNAS(NM_001077488.5):c.96G>A (p.K32=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915411" "0" "10" "20" "57478846" "57478846" "subst" "0.00221708" "02330" "GNAS_000387" "g.57478846C>T" "" "" "" "GNAS(NM_000516.4):c.432C>T (p.(=)), GNAS(NM_080425.3):c.2361C>T (p.P787=), GNAS(NM_080425.4):c.2361C>T (p.P787=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000915412" "0" "30" "20" "57485860" "57485860" "subst" "2.03041E-5" "02326" "GNAS_000549" "g.57485860C>T" "" "" "" "GNAS(NM_080425.3):c.3090C>T (p.H1030=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927026" "0" "30" "20" "57415194" "57415194" "subst" "0" "02330" "GNAS-AS1_000017" "g.57415194C>T" "" "" "" "GNAS(NM_016592.5):c.33C>T (p.R11=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927027" "0" "30" "20" "57415559" "57415559" "subst" "6.1296E-5" "02325" "GNAS-AS1_000001" "g.57415559C>T" "" "" "" "GNAS(NM_016592.3):c.398C>T (p.P133L), GNAS(NM_016592.5):c.398C>T (p.P133L, p.(Pro133Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927028" "0" "30" "20" "57415690" "57415690" "subst" "0" "02330" "GNAS-AS1_000018" "g.57415690C>T" "" "" "" "GNAS(NM_016592.5):c.529C>T (p.R177C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927029" "0" "10" "20" "57415876" "57415876" "subst" "0.00294844" "02326" "GNAS_000408" "g.57415876C>A" "" "" "" "GNAS(NM_001309861.1):c.-1093C>A (p.(=)), GNAS(NM_016592.4):c.715C>A (p.P239T), GNAS(NM_016592.5):c.715C>A (p.P239T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000927030" "0" "30" "20" "57429520" "57429520" "subst" "0" "01804" "GNAS_000550" "g.57429520C>A" "" "" "" "GNAS(NM_001077490.1):c.1013C>A (p.(Pro338Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927031" "0" "30" "20" "57430117" "57430117" "subst" "0.000150954" "02330" "GNAS_000538" "g.57430117C>T" "" "" "" "GNAS(NM_001077490.1):c.1610C>T (p.(Ala537Val)), GNAS(NM_001077490.3):c.1610C>T (p.A537V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927032" "0" "30" "20" "57470728" "57470728" "subst" "4.06124E-5" "02330" "GNAS_000551" "g.57470728G>A" "" "" "" "GNAS(NM_080425.4):c.2130G>A (p.G710=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927033" "0" "30" "20" "57485830" "57485830" "subst" "6.09127E-5" "02330" "GNAS_000552" "g.57485830C>T" "" "" "" "GNAS(NM_080425.4):c.3060C>T (p.N1020=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931189" "0" "50" "20" "57428872" "57428872" "subst" "8.88636E-6" "01804" "GNAS_000553" "g.57428872T>C" "" "" "" "GNAS(NM_001077490.1):c.365T>C (p.(Leu122Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000931190" "0" "30" "20" "57478856" "57478856" "subst" "0.000194906" "02330" "GNAS_000554" "g.57478856A>T" "" "" "" "GNAS(NM_000516.7):c.432+10A>T, GNAS(NM_001077490.3):c.*293+10A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951452" "0" "50" "20" "57415420" "57415420" "subst" "0" "01804" "GNAS-AS1_000019" "g.57415420G>A" "" "" "" "GNAS(NM_001309861.1):c.-1549G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951453" "0" "30" "20" "57415881" "57415881" "subst" "0.000124204" "02330" "GNAS-AS1_000012" "g.57415881C>A" "" "" "" "GNAS(NM_016592.3):c.720C>A (p.I240=), GNAS(NM_016592.5):c.720C>A (p.I240=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951454" "0" "30" "20" "57429174" "57429174" "subst" "2.51752E-5" "02330" "GNAS_000555" "g.57429174C>T" "" "" "" "GNAS(NM_001077490.3):c.667C>T (p.P223S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951455" "0" "30" "20" "57466773" "57466781" "dup" "0" "02330" "GNAS_000556" "g.57466773_57466781dup" "" "" "" "GNAS(NM_001077488.5):c.-11_-3dupCCGCCGCCG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951456" "0" "30" "20" "57478863" "57478863" "subst" "8.1213E-6" "02330" "GNAS_000557" "g.57478863C>A" "" "" "" "GNAS(NM_001077490.3):c.*293+17C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000951457" "0" "50" "20" "57484813" "57484813" "subst" "0" "02330" "GNAS_000449" "g.57484813C>T" "" "" "" "GNAS(NM_080425.4):c.2722C>T (p.R908C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000951458" "0" "30" "20" "57485878" "57485878" "subst" "4.06095E-6" "02330" "GNAS_000455" "g.57485878G>T" "" "" "" "GNAS(NM_080425.3):c.3108G>T (p.L1036=), GNAS(NM_080425.4):c.3108G>T (p.L1036=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970200" "0" "30" "20" "57429844" "57429844" "subst" "0.000101021" "02330" "GNAS_000431" "g.57429844C>T" "" "" "" "GNAS(NM_001077490.1):c.1337C>T (p.(Pro446Leu)), GNAS(NM_001077490.2):c.1337C>T (p.P446L), GNAS(NM_001077490.3):c.1337C>T (p.P446L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000970202" "0" "30" "20" "57470749" "57470749" "subst" "1.62536E-5" "02330" "GNAS_000558" "g.57470749A>T" "" "" "" "GNAS(NM_001077490.3):c.*73+10A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983859" "0" "50" "20" "57415579" "57415579" "subst" "1.63168E-5" "02325" "GNAS-AS1_000020" "g.57415579G>C" "" "" "" "GNAS(NM_016592.5):c.418G>C (p.E140Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983860" "0" "50" "20" "57428316" "57428316" "subst" "0" "01804" "GNAS_000559" "g.57428316G>A" "" "" "" "GNAS(NM_080425.4):c.-5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983861" "0" "50" "20" "57428829" "57428829" "subst" "0" "01804" "GNAS_000560" "g.57428829C>T" "" "" "" "GNAS(NM_080425.4):c.509C>T (p.(Ala170Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983862" "0" "30" "20" "57428967" "57428967" "subst" "0" "01804" "GNAS_000561" "g.57428967A>G" "" "" "" "GNAS(NM_080425.4):c.647A>G (p.(Tyr216Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983863" "0" "30" "20" "57428977" "57428977" "subst" "8.85142E-5" "01804" "GNAS_000562" "g.57428977C>T" "" "" "" "GNAS(NM_001077490.3):c.470C>T (p.(Pro157Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983864" "0" "50" "20" "57430104" "57430104" "subst" "4.09229E-6" "01804" "GNAS_000563" "g.57430104G>A" "" "" "" "GNAS(NM_001077490.3):c.1597G>A (p.(Gly533Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983865" "0" "30" "20" "57466790" "57466790" "subst" "0.000642156" "01804" "GNAS_000440" "g.57466790C>T" "" "" "" "GNAS(NM_000516.7):c.9C>T (p.(Cys3=)), GNAS(NM_001077488.3):c.9C>T (p.C3=), GNAS(NM_001077488.5):c.9C>T (p.C3=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983866" "0" "30" "20" "57484758" "57484758" "subst" "3.65545E-5" "01804" "GNAS_000564" "g.57484758C>T" "" "" "" "GNAS(NM_000516.7):c.738C>T (p.(Phe246=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005486" "0" "50" "20" "57415519" "57415519" "subst" "0" "01804" "GNAS-AS1_000021" "g.57415519G>A" "" "" "" "GNAS(NM_016592.2):c.358G>A (p.(Glu120Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005487" "0" "50" "20" "57415749" "57415749" "del" "0" "01804" "GNAS-AS1_000022" "g.57415749del" "" "" "" "GNAS(NM_016592.2):c.588delC (p.(Glu197fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005488" "0" "30" "20" "57415754" "57415754" "subst" "0" "01804" "GNAS-AS1_000023" "g.57415754A>G" "" "" "" "GNAS(NM_016592.2):c.593A>G (p.(Asp198Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005489" "0" "30" "20" "57428754" "57428754" "subst" "4.06788E-6" "01804" "GNAS_000565" "g.57428754G>A" "" "" "" "GNAS(NM_080425.2):c.434G>A (p.(Ser145Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005490" "0" "50" "20" "57429252" "57429252" "subst" "0" "01804" "GNAS_000566" "g.57429252T>C" "" "" "" "GNAS(NM_080425.2):c.932T>C (p.(Ile311Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005491" "0" "30" "20" "57429968" "57429968" "subst" "2.39418E-5" "01804" "GNAS_000436" "g.57429968G>A" "" "" "" "GNAS(NM_080425.2):c.1648G>A (p.(Ala550Thr)), GNAS(NM_080425.4):c.1648G>A (p.A550T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005492" "0" "30" "20" "57466776" "57466781" "del" "0" "01804" "GNAS_000507" "g.57466776_57466781del" "" "" "" "GNAS(NM_000516.4):c.-6_-1delGCCGCC (p.?), GNAS(NM_001077488.5):c.-6_-1delGCCGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005493" "0" "30" "20" "57466811" "57466811" "subst" "0" "01804" "GNAS_000567" "g.57466811G>C" "" "" "" "GNAS(NM_000516.4):c.30G>C (p.(Glu10Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005494" "0" "50" "20" "57466919" "57466919" "subst" "5.49058E-6" "01804" "GNAS_000568" "g.57466919G>A" "" "" "" "GNAS(NM_000516.4):c.138G>A (p.(Leu46Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005495" "0" "30" "20" "57480546" "57480546" "subst" "0.000113743" "01804" "GNAS_000569" "g.57480546G>A" "" "" "" "GNAS(NM_000516.4):c.530+11G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005496" "0" "90" "20" "57484251" "57484254" "del" "0" "01804" "GNAS_000023" "g.57484251_57484254del" "" "" "" "GNAS(NM_000516.4):c.565_568delGACT (p.(Asp189fs)), GNAS(NM_080425.4):c.2494_2497delGACT (p.D832Mfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001005497" "0" "70" "20" "57484598" "57484598" "subst" "0" "02325" "GNAS_000526" "g.57484598C>T" "" "" "" "GNAS(NM_000516.7):c.682C>T (p.R228C), GNAS(NM_080425.4):c.2611C>T (p.R871C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005498" "0" "50" "20" "57484611" "57484611" "subst" "0" "01804" "GNAS_000570" "g.57484611G>A" "" "" "" "GNAS(NM_000516.4):c.695G>A (p.(Arg232His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005499" "0" "70" "20" "57485820" "57485820" "subst" "0" "02327" "GNAS_000571" "g.57485820G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001015874" "0" "30" "20" "57428478" "57428478" "subst" "5.07675E-5" "02330" "GNAS_000410" "g.57428478C>G" "" "" "" "GNAS(NM_080425.3):c.158C>G (p.P53R), GNAS(NM_080425.4):c.158C>G (p.P53R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015875" "0" "50" "20" "57428858" "57428858" "subst" "0.000106967" "02325" "GNAS_000412" "g.57428858C>T" "" "" "" "GNAS(NM_080425.3):c.538C>T (p.Q180*), GNAS(NM_080425.4):c.538C>T (p.Q180*, p.(Gln180Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015876" "0" "50" "20" "57429909" "57429909" "subst" "9.57744E-6" "02325" "GNAS_000572" "g.57429909C>G" "" "" "" "GNAS(NM_001077490.3):c.1402C>G (p.P468A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001015877" "0" "90" "20" "57484251" "57484254" "del" "0" "02330" "GNAS_000023" "g.57484251_57484254del" "" "" "" "GNAS(NM_000516.4):c.565_568delGACT (p.(Asp189fs)), GNAS(NM_080425.4):c.2494_2497delGACT (p.D832Mfs*14)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001017457" "21" "70" "20" "57429867" "57429867" "subst" "0" "00006" "GNAS_000573" "g.57429867C>T" "" "{PMID:Koruga 2021:37189872}" "" "1360C>T (Gln454*)" "" "Germline" "" "" "0" "" "" "g.58854812C>T" "" "likely pathogenic" "" "0001027329" "0" "30" "20" "57415543" "57415543" "subst" "3.27257E-5" "02325" "GNAS-AS1_000024" "g.57415543G>A" "" "" "" "GNAS(NM_016592.5):c.382G>A (p.E128K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001027330" "0" "70" "20" "57478633" "57478633" "subst" "0" "02329" "GNAS_000075" "g.57478633C>T" "" "" "" "GNAS(NM_000516.7):c.305C>T (p.A102V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001030941" "0" "50" "20" "57485864" "57485864" "subst" "0" "03779" "GNAS_000574" "g.57485864C>T" "" "" "" "" "" "Unknown" "" "rs2146306963" "0" "" "" "" "" "VUS" "" "0001043438" "0" "50" "20" "57415583" "57415583" "del" "0" "01804" "GNAS_000575" "g.57415583del" "" "" "" "GNAS(NM_016592.5):c.422del (p.(Pro141Leufs*126))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043439" "0" "30" "20" "57415677" "57415677" "subst" "0" "01804" "GNAS_000576" "g.57415677C>G" "" "" "" "GNAS(NM_016592.5):c.516C>G (p.(Asp172Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043440" "0" "30" "20" "57428531" "57428531" "subst" "0" "01804" "GNAS_000577" "g.57428531C>A" "" "" "" "GNAS(NM_080425.4):c.211C>A (p.(Pro71Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043441" "0" "50" "20" "57428858" "57428858" "subst" "0.000106967" "01804" "GNAS_000412" "g.57428858C>T" "" "" "" "GNAS(NM_080425.3):c.538C>T (p.Q180*), GNAS(NM_080425.4):c.538C>T (p.Q180*, p.(Gln180Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043442" "0" "50" "20" "57428876" "57428876" "subst" "4.58245E-6" "01804" "GNAS_000578" "g.57428876C>G" "" "" "" "GNAS(NM_080425.4):c.556C>G (p.(Pro186Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043443" "0" "50" "20" "57428998" "57428998" "subst" "9.5257E-5" "01804" "GNAS_000356" "g.57428998T>G" "" "" "" "GNAS(NM_001077490.2):c.491T>G (p.L164W), GNAS(NM_080425.4):c.678T>G (p.(Phe226Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043444" "0" "30" "20" "57429217" "57429217" "subst" "0.000119471" "01804" "GNAS_000359" "g.57429217C>A" "" "" "" "GNAS(NM_001077490.2):c.710C>A (p.A237D), GNAS(NM_001077490.3):c.710C>A (p.A237D), GNAS(NM_080425.4):c.897C>A (p.(Ser299Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043445" "0" "50" "20" "57429450" "57429450" "subst" "1.80388E-5" "01804" "GNAS_000579" "g.57429450G>T" "" "" "" "GNAS(NM_001077490.3):c.943G>T (p.(Gly315Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043446" "0" "50" "20" "57429783" "57429783" "subst" "0" "01804" "GNAS_000580" "g.57429783C>T" "" "" "" "GNAS(NM_001077490.3):c.1276C>T (p.(Pro426Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043447" "0" "30" "20" "57429918" "57429918" "subst" "1.43375E-5" "01804" "GNAS_000581" "g.57429918C>G" "" "" "" "GNAS(NM_001077490.3):c.1411C>G (p.(Pro471Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043448" "0" "50" "20" "57430328" "57430328" "subst" "0" "01804" "GNAS_000492" "g.57430328G>A" "" "" "" "GNAS(NM_080425.3):c.2008G>A (p.D670N), GNAS(NM_080425.4):c.2008G>A (p.(Asp670Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043449" "0" "50" "20" "57466902" "57466902" "subst" "0" "01804" "GNAS_000582" "g.57466902C>A" "" "" "" "GNAS(NM_000516.7):c.121C>A (p.(His41Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043450" "0" "30" "20" "57478578" "57478578" "subst" "0" "01804" "GNAS_000583" "g.57478578C>T" "" "" "" "GNAS(NM_000516.7):c.258-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043451" "0" "30" "20" "57484863" "57484863" "subst" "0" "01804" "GNAS_000584" "g.57484863T>G" "" "" "" "GNAS(NM_000516.7):c.839+4T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043452" "0" "30" "20" "57485396" "57485396" "subst" "1.62487E-5" "01804" "GNAS_000452" "g.57485396C>T" "" "" "" "GNAS(NM_000516.7):c.978C>T (p.(Pro326=)), GNAS(NM_080425.3):c.2907C>T (p.P969=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001049026" "0" "90" "20" "57484219" "57484219" "subst" "0" "00006" "GNAS_000585" "g.57484219T>C" "" "{PMID:Soden 2014:25473036}" "" "ref?:c.536T>C" "" "De novo" "" "" "0" "" "" "g.58909164T>C" "" "pathogenic (dominant)" "" "0001049440" "0" "90" "20" "57484420" "57484420" "subst" "0" "03779" "GNAS_000026" "g.57484420C>T" "" "" "" "" "" "Unknown" "" "rs11554273" "0" "" "" "" "" "pathogenic" "" "0001056934" "0" "50" "20" "57415184" "57415184" "subst" "0" "01804" "GNAS_000586" "g.57415184A>T" "" "" "" "GNAS(NM_016592.5):c.23A>T (p.(Gln8Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056935" "0" "30" "20" "57428366" "57428366" "subst" "0.000100091" "01804" "GNAS_000587" "g.57428366C>T" "" "" "" "GNAS(NM_080425.4):c.46C>T (p.(Arg16Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056936" "0" "30" "20" "57428438" "57428438" "subst" "6.73747E-5" "01804" "GNAS_000588" "g.57428438G>A" "" "" "" "GNAS(NM_080425.4):c.118G>A (p.(Gly40Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056937" "0" "50" "20" "57429074" "57429074" "subst" "0" "01804" "GNAS_000589" "g.57429074A>C" "" "" "" "GNAS(NM_080425.4):c.754A>C (p.(Ser252Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056938" "0" "50" "20" "57430373" "57430373" "subst" "0" "01804" "GNAS_000590" "g.57430373C>T" "" "" "" "GNAS(NM_080425.4):c.2053C>T (p.(Arg685Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056939" "0" "50" "20" "57475010" "57475012" "del" "0" "01804" "GNAS_000494" "g.57475010_57475012del" "" "" "" "GNAS(NM_001309842.1):c.262_264delTAA (p.*88Yext*2), GNAS(NM_001309842.2):c.262_264delTAA (p.*88Yext*2), GNAS(NM_001309842.2):c.264_*2del (p.(*88T...))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001056940" "0" "30" "20" "57477979" "57477979" "subst" "0" "01804" "GNAS_000591" "g.57477979C>T" "" "" "" "GNAS(NM_000516.7):c.258-607C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056941" "0" "30" "20" "57478856" "57478856" "subst" "0.000194906" "01804" "GNAS_000554" "g.57478856A>T" "" "" "" "GNAS(NM_000516.7):c.432+10A>T, GNAS(NM_001077490.3):c.*293+10A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001058739" "0" "90" "20" "57466782" "57466791" "del" "0" "00006" "GNAS_000592" "g.57466782_57466791del" "" "{PMID:Retterer 2016:26633542}" "" "1_10del10" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.58891727_58891736del" "" "pathogenic" "" "0001059642" "0" "70" "20" "57466784" "57466784" "subst" "0" "00006" "GNAS_000593" "g.57466784G>T" "" "{PMID:Jacob 2025:39706863}" "" "" "" "De novo" "" "" "0" "" "" "g.58891729G>T" "SCV002054014.1" "likely pathogenic (dominant)" "" "0001067354" "0" "50" "20" "57428367" "57428367" "subst" "0" "01804" "GNAS_000594" "g.57428367G>A" "" "" "" "GNAS(NM_080425.4):c.47G>A (p.(Arg16His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067355" "0" "50" "20" "57429037" "57429037" "subst" "0" "01804" "GNAS_000595" "g.57429037C>T" "" "" "" "GNAS(NM_001077490.3):c.530C>T (p.(Pro177Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067356" "0" "50" "20" "57429934" "57429934" "subst" "0" "02325" "GNAS_000596" "g.57429934C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067357" "0" "50" "20" "57466805" "57466805" "subst" "0" "02325" "GNAS_000597" "g.57466805G>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067358" "0" "90" "20" "57470711" "57470711" "dup" "0" "02325" "GNAS_000598" "g.57470711dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes GNAS ## Count = 1287 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000053052" "00024010" "70" "780" "712" "780" "752" "c.*42+712_*42+752del" "r.(=)" "p.(=)" "1i" "0000053053" "00024010" "70" "780" "712" "780" "752" "c.*42+712_*42+752del" "r.(=)" "p.(=)" "1i" "0000053054" "00024010" "50" "780" "2315" "780" "2349" "c.*42+2315_*42+2349del" "r.(=)" "p.(=)" "1i" "0000128520" "00024010" "00" "1759" "0" "1759" "0" "c.*1021T>C" "r.(=)" "p.(=)" "" "0000130563" "00024158" "90" "1" "0" "1" "0" "c.1A>G" "r.?" "p.?" "1" "0000130563" "00024010" "50" "781" "-3885" "781" "-3885" "c.*43-3885A>G" "r.(=)" "p.(=)" "" "0000130565" "00024158" "70" "2" "0" "2" "0" "c.2T>G" "r.(?)" "p.(Met1?)" "1" "0000130565" "00024010" "50" "781" "-3884" "781" "-3884" "c.*43-3884T>G" "r.(=)" "p.(=)" "" "0000130566" "00024158" "70" "21" "0" "21" "0" "c.21dupT" "r.(?)" "p.(Lys8*)" "1" "0000130566" "00024010" "50" "781" "-3865" "781" "-3865" "c.*43-3865dupT" "r.(=)" "p.(=)" "" "0000132519" "00024158" "70" "21" "0" "21" "0" "c.21dupT" "r.(?)" "p.(Lys8*)" "1" "0000132519" "00024010" "50" "781" "-3865" "781" "-3865" "c.*43-3865dupT" "r.(=)" "p.(=)" "" "0000132520" "00024158" "70" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29*)" "1" "0000132520" "00024010" "70" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000132521" "00024158" "70" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29*)" "1" "0000132521" "00024010" "50" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000132522" "00024158" "70" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29*)" "1" "0000132522" "00024010" "50" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000132523" "00024158" "70" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Gln35*)" "1" "0000132523" "00024010" "50" "781" "-3783" "781" "-3783" "c.*43-3783C>T" "r.(=)" "p.(=)" "" "0000132525" "00024158" "90" "1" "0" "1" "0" "c.1A>G" "r.?" "p.0?" "1" "0000132525" "00024010" "50" "781" "-3885" "781" "-3885" "c.*43-3885A>G" "r.(=)" "p.(=)" "" "0000132530" "00024158" "70" "470" "0" "472" "0" "c.470_472del" "r.(?)" "p.(Glu157del)" "6" "0000132530" "00024010" "50" "1114" "0" "1116" "0" "c.*376_*378del" "r.(=)" "p.(=)" "" "0000132536" "00024158" "70" "586" "-1" "586" "-1" "c.586-1G>T" "r.spl?" "p.?" "7i" "0000132536" "00024010" "50" "1230" "-1" "1230" "-1" "c.*492-1G>T" "r.spl?" "p.?" "" "0000132551" "00024158" "70" "772" "0" "772" "0" "c.772C>T" "r.(?)" "p.(Arg258Trp)" "10" "0000132551" "00024010" "50" "1416" "0" "1416" "0" "c.*678C>T" "r.(=)" "p.(=)" "" "0000134722" "00024010" "00" "-190816" "0" "2311502" "0" "c.-190816_*2310764del" "r.0" "p.0" "" "0000134724" "00024158" "70" "750" "0" "750" "0" "c.750C>G" "r.(?)" "p.(Ser250Arg)" "10" "0000134724" "00024010" "50" "1394" "0" "1394" "0" "c.*656C>G" "r.(=)" "p.(=)" "" "0000134725" "00024158" "70" "1082" "0" "1082" "0" "c.1082dup" "r.(?)" "p.(His362Serfs*9)" "13" "0000134725" "00024010" "50" "1726" "0" "1726" "0" "c.*988dup" "r.(=)" "p.(=)" "" "0000134726" "00024158" "70" "1085" "0" "1085" "0" "c.1085A>C" "r.(?)" "p.(His362Pro)" "13" "0000134726" "00024010" "50" "1729" "0" "1729" "0" "c.*991A>C" "r.(=)" "p.(=)" "" "0000134727" "00024158" "70" "1174" "0" "1174" "0" "c.1174G>A" "r.(?)" "p.(Glu392Lys)" "13" "0000134727" "00024010" "50" "1818" "0" "1818" "0" "c.*1080G>A" "r.(=)" "p.(=)" "" "0000134728" "00024158" "70" "212" "3" "212" "6" "c.212+3_212+6del" "r.spl?" "p.?" "2i" "0000134728" "00024010" "50" "853" "3" "853" "6" "c.*115+3_*115+6del" "r.spl?" "p.?" "" "0000134730" "00024158" "70" "3" "0" "3" "0" "c.3G>A" "r.?" "p.?" "1" "0000134730" "00024010" "50" "781" "-3883" "781" "-3883" "c.*43-3883G>A" "r.(=)" "p.(=)" "" "0000140517" "00024158" "90" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29*)" "1" "0000140517" "00024010" "50" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000140518" "00024158" "90" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29*)" "1" "0000140518" "00024010" "50" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000140520" "00024158" "90" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29*)" "1" "0000140520" "00024010" "50" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000140521" "00024158" "90" "139" "1" "139" "1" "c.139+1G>C" "r.spl?" "p.?" "1i" "0000140521" "00024010" "50" "781" "-3746" "781" "-3746" "c.*43-3746G>C" "r.(=)" "p.(=)" "" "0000140522" "00024158" "70" "344" "0" "345" "0" "c.344_345insT" "r.(?)" "p.(Val117Argfs*23)" "5" "0000140522" "00024010" "50" "988" "0" "989" "0" "c.*250_*251insT" "r.(=)" "p.(=)" "" "0000140523" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "7" "0000140523" "00024010" "50" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0000140524" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "7" "0000140524" "00024010" "50" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0000140526" "00024158" "70" "572" "0" "573" "0" "c.572_573del" "r.(?)" "p.(Val191Alafs*18)" "7" "0000140526" "00024010" "50" "1216" "0" "1217" "0" "c.*478_*479del" "r.(=)" "p.(=)" "" "0000140527" "00024158" "70" "624" "0" "624" "0" "c.624dup" "r.(?)" "p.(Glu209*)" "8" "0000140527" "00024010" "50" "1268" "0" "1268" "0" "c.*530dup" "r.(=)" "p.(=)" "" "0000140528" "00024158" "70" "1039" "-1" "1039" "-1" "c.1039-1G>A" "r.spl?" "p.?" "12i" "0000140528" "00024010" "50" "1683" "-1" "1683" "-1" "c.*945-1G>A" "r.spl?" "p.?" "" "0000140529" "00024158" "70" "139" "1" "139" "1" "c.139+1G>T" "r.spl?" "p.?" "1i" "0000140529" "00024010" "50" "781" "-3746" "781" "-3746" "c.*43-3746G>T" "r.(=)" "p.(=)" "" "0000140530" "00024158" "90" "139" "1" "139" "1" "c.139+1G>C" "r.spl?" "p.?" "1i" "0000140530" "00024010" "50" "781" "-3746" "781" "-3746" "c.*43-3746G>C" "r.(=)" "p.(=)" "" "0000140531" "00024158" "90" "344" "0" "345" "0" "c.344_345insT" "r.(?)" "p.(Val117Argfs*23)" "5" "0000140531" "00024010" "50" "988" "0" "989" "0" "c.*250_*251insT" "r.(=)" "p.(=)" "" "0000140532" "00024158" "90" "344" "0" "345" "0" "c.344_345insT" "r.(?)" "p.(Val117Argfs*23)" "5" "0000140532" "00024010" "50" "988" "0" "989" "0" "c.*250_*251insT" "r.(=)" "p.(=)" "" "0000140533" "00024158" "90" "344" "0" "345" "0" "c.344_345insT" "r.(?)" "p.(Val117Argfs*23)" "5" "0000140533" "00024010" "50" "988" "0" "989" "0" "c.*250_*251insT" "r.(=)" "p.(=)" "" "0000140534" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "7" "0000140534" "00024010" "50" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0000140535" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "7" "0000140535" "00024010" "50" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0000140536" "00024158" "70" "1039" "-1" "1039" "-1" "c.1039-1G>A" "r.spl?" "p.?" "12i" "0000140536" "00024010" "50" "1683" "-1" "1683" "-1" "c.*945-1G>A" "r.spl?" "p.?" "" "0000146068" "00024158" "70" "731" "0" "731" "0" "c.731T>C" "r.(?)" "p.(Ile244Thr)" "10" "0000146068" "00024010" "50" "1375" "0" "1375" "0" "c.*637T>C" "r.(=)" "p.(=)" "" "0000146072" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "7" "0000146072" "00024010" "50" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0000147092" "00024158" "70" "21" "0" "21" "0" "c.21dupT" "r.(?)" "p.(Lys8*)" "1" "0000147092" "00024010" "50" "781" "-3865" "781" "-3865" "c.*43-3865dupT" "r.(=)" "p.(=)" "" "0000147093" "00024158" "70" "21" "0" "21" "0" "c.21dupT" "r.(?)" "p.(Lys8*)" "1" "0000147093" "00024010" "50" "781" "-3865" "781" "-3865" "c.*43-3865dupT" "r.(=)" "p.(=)" "" "0000147215" "00024158" "70" "1082" "0" "1082" "0" "c.1082dup" "r.(?)" "p.(His362Serfs*9)" "13" "0000147215" "00024010" "50" "1726" "0" "1726" "0" "c.*988dup" "r.(=)" "p.(=)" "" "0000150749" "00024158" "70" "1107" "0" "1107" "0" "c.1107dup" "r.(?)" "p.(Glu370*)" "13" "0000150749" "00024010" "50" "1751" "0" "1751" "0" "c.*1013dup" "r.(=)" "p.(=)" "" "0000162953" "00024158" "70" "827" "0" "827" "0" "c.827T>G" "r.(?)" "p.(Ile276Ser)" "10" "0000162953" "00024010" "50" "1471" "0" "1471" "0" "c.*733T>G" "r.(=)" "p.(=)" "" "0000162966" "00024158" "70" "827" "0" "827" "0" "c.827T>G" "r.(?)" "p.(Ile276Ser)" "10" "0000162969" "00024158" "70" "827" "0" "827" "0" "c.827T>G" "r.(?)" "p.(Ile276Ser)" "10" "0000162971" "00024158" "70" "827" "0" "827" "0" "c.827T>G" "r.(?)" "p.(Ile276Ser)" "10" "0000163509" "00024158" "70" "28" "0" "28" "0" "c.28G>T" "r.(?)" "p.(Glu10*)" "1" "0000163512" "00024158" "70" "70" "0" "70" "0" "c.70A>T" "r.(?)" "p.(Lys24*)" "1" "0000163513" "00024158" "70" "89" "0" "89" "0" "c.89T>C" "r.(?)" "p.(Leu30Pro)" "1" "0000163514" "00024158" "70" "137" "0" "139" "0" "c.137_139del" "r.(?)" "p.(Leu46_Gly47delinsArg)" "1" "0000169138" "00024158" "90" "344" "0" "345" "0" "c.344_345insT" "r.(?)" "p.(Val117Argfs*23)" "5" "0000170755" "00024158" "90" "840" "-2" "840" "-2" "c.840-2A>G" "r.840_970del" "p.Arg280SerfsTer21" "10i" "0000170756" "00024158" "90" "1027" "0" "1028" "0" "c.1027_1028del" "r.(?)" "p.(Asp343*)" "12" "0000170757" "00024158" "90" "1174" "0" "1174" "0" "c.1174G>A" "r.(?)" "p.(Glu392Lys)" "13" "0000170759" "00024158" "70" "877" "0" "877" "0" "c.877A>G" "r.(?)" "p.(Lys293Glu)" "11" "0000171996" "00024158" "70" "569" "0" "569" "0" "c.569A>C" "r.(?)" "p.(Tyr190Ser)" "7" "0000173840" "00024158" "90" "305" "0" "305" "0" "c.305C>A" "r.(?)" "p.(Ala102Glu)" "4" "0000173841" "00024158" "90" "305" "0" "305" "0" "c.305C>A" "r.(?)" "p.(Ala102Glu)" "5" "0000173842" "00024158" "90" "305" "0" "305" "0" "c.305C>A" "r.(?)" "p.(Ala102Glu)" "4" "0000174065" "00024158" "90" "308" "0" "308" "0" "c.308T>C" "r.(?)" "p.(Ile103Thr)" "4" "0000174066" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "7" "0000174067" "00024158" "90" "348" "0" "348" "0" "c.348delC" "r.(?)" "p.(Val117Trpfs*16)" "5" "0000179037" "00025229" "55" "475" "0" "475" "0" "c.475G>A" "r.(?)" "p.(Glu159Lys)" "1" "0000194530" "00024158" "00" "656" "0" "656" "0" "c.656T>C" "r.(?)" "p.(Phe219Ser)" "8" "0000211215" "00024158" "99" "1097" "0" "1108" "0" "c.1097_1108dupCTGTGGACACTG" "r.(?)" "p.(Ala366_Thr369dup)" "13" "0000221933" "00024158" "70" "134" "0" "134" "0" "c.134T>C" "r.(?)" "p.(Leu45Pro)" "1" "0000221934" "00024158" "70" "8" "0" "8" "0" "c.8G>A" "r.(?)" "p.(Cys3Tyr)" "1" "0000221935" "00024158" "70" "43" "0" "43" "0" "c.43G>T" "r.(?)" "p.(Glu15*)" "1" "0000221936" "00024158" "70" "100" "0" "100" "0" "c.100A>T" "r.(?)" "p.(Lys34*)" "1" "0000221937" "00024158" "70" "69" "0" "69" "0" "c.69del" "r.(?)" "p.(Asn23Lysfs*35)" "1" "0000221938" "00024158" "70" "69" "0" "69" "0" "c.69del" "r.(?)" "p.(Asn23Lysfs*35)" "1" "0000221939" "00024158" "70" "157" "0" "157" "0" "c.157A>G" "r.(?)" "p.(Lys53Glu)" "2" "0000221940" "00024158" "70" "161" "0" "161" "0" "c.161G>A" "r.(?)" "p.(Ser54Asn)" "2" "0000221941" "00024158" "70" "167" "0" "168" "0" "c.167_168delinsG" "r.167_168delinsG" "p.Ile56Argfs*2" "2" "0000221942" "00024158" "70" "212" "4" "212" "4" "c.212+4dup" "r.(spl?)" "p.?" "2i" "0000221943" "00024158" "70" "392" "0" "392" "0" "c.392dup" "r.(?)" "p.(Leu132Profs*8)" "5" "0000221944" "00024158" "70" "426" "0" "427" "0" "c.426_427insTCC" "r.(?)" "p.(Phe142_Pro143insSer)" "5" "0000221946" "00024158" "70" "432" "2" "432" "2" "c.432+2T>C" "r.spl?" "p.?" "5i" "0000221950" "00024158" "70" "429" "0" "429" "0" "c.429dup" "r.(?)" "p.(Pro144Serfs*5)" "5" "0000221952" "00024158" "30" "245" "0" "245" "0" "c.245G>A" "r.(?)" "p.(Ser82Asn)" "3" "0000221953" "00024158" "70" "1065" "0" "1065" "0" "c.1065dup" "r.(?)" "p.(Arg356Alafs*15)" "13" "0000221956" "00024158" "70" "467" "0" "467" "0" "c.467A>G" "r.(?)" "p.(Asp156Gly)" "6" "0000221966" "00024158" "70" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Arg165His)" "6" "0000222050" "00024158" "70" "1173" "0" "1173" "0" "c.1173C>G" "r.(?)" "p.(Tyr391*)" "13" "0000222090" "00024158" "07" "432" "1" "432" "1" "c.432+1G>C" "r.spl?" "p.?" "5i" "0000235017" "00024158" "99" "432" "1" "432" "1" "c.432+1G>A" "r.313_432del" "p.(Thr105_Pro144del)" "5i" "0000236397" "00024158" "77" "288" "0" "290" "0" "c.288_290dup" "r.(?)" "p.(Lys96dup)" "4" "0000236398" "00024158" "77" "288" "0" "290" "0" "c.288_290dup" "r.(?)" "p.(Lys96dup)" "4" "0000236399" "00024158" "77" "288" "0" "290" "0" "c.288_290dup" "r.(?)" "p.(Lys96dup)" "4" "0000248128" "00024158" "30" "-37978" "0" "-37978" "0" "c.-37978A>G" "r.(?)" "p.(=)" "" "0000248128" "00025229" "30" "484" "0" "484" "0" "c.484A>G" "r.(?)" "p.(Met162Val)" "" "0000248128" "00024010" "30" "780" "12863" "780" "12863" "c.*42+12863A>G" "r.(=)" "p.(=)" "" "0000254118" "00024158" "30" "-37978" "0" "-37978" "0" "c.-37978A>G" "r.(?)" "p.(=)" "" "0000254118" "00025229" "30" "484" "0" "484" "0" "c.484A>G" "r.(?)" "p.(Met162Val)" "" "0000254118" "00024010" "30" "780" "12863" "780" "12863" "c.*42+12863A>G" "r.(=)" "p.(=)" "" "0000256740" "00024158" "50" "659" "3" "659" "3" "c.659+3A>G" "r.spl?" "p.?" "" "0000256740" "00025229" "50" "2588" "3" "2588" "3" "c.2588+3A>G" "r.spl?" "p.?" "" "0000256740" "00024010" "50" "1303" "3" "1303" "3" "c.*565+3A>G" "r.spl?" "p.?" "" "0000281096" "00024158" "10" "-37007" "0" "-37007" "0" "c.-37007C>A" "r.(?)" "p.(=)" "" "0000281096" "00025229" "10" "1455" "0" "1455" "0" "c.1455C>A" "r.(?)" "p.(Ala485=)" "" "0000281096" "00024010" "10" "780" "13834" "780" "13834" "c.*42+13834C>A" "r.(=)" "p.(=)" "" "0000281097" "00024158" "10" "-36664" "0" "-36664" "0" "c.-36664C>G" "r.(?)" "p.(=)" "" "0000281097" "00025229" "10" "1798" "0" "1798" "0" "c.1798C>G" "r.(?)" "p.(Arg600Gly)" "" "0000281097" "00024010" "10" "780" "14177" "780" "14177" "c.*42+14177C>G" "r.(=)" "p.(=)" "" "0000281098" "00024158" "10" "393" "0" "393" "0" "c.393C>T" "r.(?)" "p.(Ile131=)" "" "0000281098" "00025229" "10" "2322" "0" "2322" "0" "c.2322C>T" "r.(?)" "p.(Ile774=)" "" "0000281098" "00024010" "10" "1037" "0" "1037" "0" "c.*299C>T" "r.(=)" "p.(=)" "" "0000281099" "00024158" "50" "-37742" "0" "-37742" "0" "c.-37742G>A" "r.(?)" "p.(=)" "" "0000281099" "00025229" "50" "720" "0" "720" "0" "c.720G>A" "r.(?)" "p.(Pro240=)" "" "0000281099" "00024010" "50" "780" "13099" "780" "13099" "c.*42+13099G>A" "r.(=)" "p.(=)" "" "0000284728" "00024158" "10" "433" "-18" "433" "-18" "c.433-18T>C" "r.(=)" "p.(=)" "" "0000284728" "00025229" "10" "2362" "-18" "2362" "-18" "c.2362-18T>C" "r.(=)" "p.(=)" "" "0000284728" "00024010" "10" "1077" "-18" "1077" "-18" "c.*339-18T>C" "r.(=)" "p.(=)" "" "0000284729" "00024158" "10" "393" "0" "393" "0" "c.393C>T" "r.(?)" "p.(Ile131=)" "" "0000284729" "00025229" "10" "2322" "0" "2322" "0" "c.2322C>T" "r.(?)" "p.(Ile774=)" "" "0000284729" "00024010" "10" "1037" "0" "1037" "0" "c.*299C>T" "r.(=)" "p.(=)" "" "0000284730" "00024158" "10" "432" "0" "432" "0" "c.432C>T" "r.(?)" "p.(Pro144=)" "" "0000284730" "00025229" "10" "2361" "0" "2361" "0" "c.2361C>T" "r.(?)" "p.(Pro787=)" "" "0000284730" "00024010" "10" "1076" "0" "1076" "0" "c.*338C>T" "r.(=)" "p.(=)" "" "0000284731" "00024158" "50" "476" "0" "476" "0" "c.476T>C" "r.(?)" "p.(Val159Ala)" "" "0000284731" "00025229" "50" "2405" "0" "2405" "0" "c.2405T>C" "r.(?)" "p.(Val802Ala)" "" "0000284731" "00024010" "50" "1120" "0" "1120" "0" "c.*382T>C" "r.(=)" "p.(=)" "" "0000284732" "00024158" "10" "555" "0" "555" "0" "c.555C>T" "r.(?)" "p.(Ile185=)" "" "0000284732" "00025229" "10" "2484" "0" "2484" "0" "c.2484C>T" "r.(?)" "p.(Ile828=)" "" "0000284732" "00024010" "10" "1199" "0" "1199" "0" "c.*461C>T" "r.(=)" "p.(=)" "" "0000284733" "00024158" "90" "601" "0" "601" "0" "c.601C>T" "r.(?)" "p.(Arg201Cys)" "" "0000284733" "00025229" "90" "2530" "0" "2530" "0" "c.2530C>T" "r.(?)" "p.(Arg844Cys)" "" "0000284733" "00024010" "90" "1245" "0" "1245" "0" "c.*507C>T" "r.(=)" "p.(=)" "" "0000284734" "00024158" "70" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265His)" "" "0000284734" "00025229" "70" "2723" "0" "2723" "0" "c.2723G>A" "r.(?)" "p.(Arg908His)" "" "0000284734" "00024010" "70" "1438" "0" "1438" "0" "c.*700G>A" "r.(=)" "p.(=)" "" "0000284735" "00024158" "90" "985" "0" "985" "0" "c.985G>T" "r.(?)" "p.(Gly329Ter)" "" "0000284735" "00025229" "90" "2914" "0" "2914" "0" "c.2914G>T" "r.(?)" "p.(Gly972Ter)" "" "0000284735" "00024010" "90" "1629" "0" "1629" "0" "c.*891G>T" "r.(=)" "p.(=)" "" "0000284736" "00024158" "90" "1096" "0" "1096" "0" "c.1096G>A" "r.(?)" "p.(Ala366Thr)" "" "0000284736" "00025229" "90" "3025" "0" "3025" "0" "c.3025G>A" "r.(?)" "p.(Ala1009Thr)" "" "0000284736" "00024010" "90" "1740" "0" "1740" "0" "c.*1002G>A" "r.(=)" "p.(=)" "" "0000284737" "00024158" "10" "1113" "0" "1113" "0" "c.1113C>T" "r.(?)" "p.(Asn371=)" "" "0000284737" "00025229" "10" "3042" "0" "3042" "0" "c.3042C>T" "r.(?)" "p.(Asn1014=)" "" "0000284737" "00024010" "10" "1757" "0" "1757" "0" "c.*1019C>T" "r.(=)" "p.(=)" "" "0000284738" "00024158" "10" "-37835" "0" "-37835" "0" "c.-37835G>A" "r.(?)" "p.(=)" "" "0000284738" "00025229" "10" "627" "0" "627" "0" "c.627G>A" "r.(?)" "p.(Lys209=)" "" "0000284738" "00024010" "10" "780" "13006" "780" "13006" "c.*42+13006G>A" "r.(=)" "p.(=)" "" "0000284739" "00024158" "70" "704" "0" "704" "0" "c.704T>C" "r.(?)" "p.(Ile235Thr)" "" "0000284739" "00025229" "70" "2633" "0" "2633" "0" "c.2633T>C" "r.(?)" "p.(Ile878Thr)" "" "0000284739" "00024010" "70" "1348" "0" "1348" "0" "c.*610T>C" "r.(=)" "p.(=)" "" "0000288531" "00024158" "30" "-37241" "0" "-37241" "0" "c.-37241C>G" "r.(?)" "p.(=)" "" "0000288531" "00025229" "30" "1221" "0" "1221" "0" "c.1221C>G" "r.(?)" "p.(Thr407=)" "" "0000288531" "00024010" "30" "780" "13600" "780" "13600" "c.*42+13600C>G" "r.(=)" "p.(=)" "" "0000288532" "00024158" "10" "-37229" "0" "-37203" "0" "c.-37229_-37203del" "r.(?)" "p.(=)" "" "0000288532" "00025229" "10" "1233" "0" "1259" "0" "c.1233_1259del" "r.(?)" "p.(Thr415_Gly423del)" "" "0000288532" "00024010" "10" "780" "13612" "780" "13638" "c.*42+13612_*42+13638del" "r.(=)" "p.(=)" "" "0000288533" "00024158" "30" "-37034" "0" "-37034" "0" "c.-37034C>G" "r.(?)" "p.(=)" "" "0000288533" "00025229" "30" "1428" "0" "1428" "0" "c.1428C>G" "r.(?)" "p.(Ala476=)" "" "0000288533" "00024010" "30" "780" "13807" "780" "13807" "c.*42+13807C>G" "r.(=)" "p.(=)" "" "0000288534" "00024158" "50" "-37132" "0" "-37132" "0" "c.-37132G>A" "r.(?)" "p.(=)" "" "0000288534" "00025229" "50" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Gly444Arg)" "" "0000288534" "00024010" "50" "780" "13709" "780" "13709" "c.*42+13709G>A" "r.(=)" "p.(=)" "" "0000288535" "00024158" "30" "-36944" "0" "-36944" "0" "c.-36944G>A" "r.(?)" "p.(=)" "" "0000288535" "00025229" "30" "1518" "0" "1518" "0" "c.1518G>A" "r.(?)" "p.(Arg506=)" "" "0000288535" "00024010" "30" "780" "13897" "780" "13897" "c.*42+13897G>A" "r.(=)" "p.(=)" "" "0000288536" "00024158" "50" "-37096" "0" "-37096" "0" "c.-37096G>A" "r.(?)" "p.(=)" "" "0000288536" "00025229" "50" "1366" "0" "1366" "0" "c.1366G>A" "r.(?)" "p.(Gly456Arg)" "" "0000288536" "00024010" "50" "780" "13745" "780" "13745" "c.*42+13745G>A" "r.(=)" "p.(=)" "" "0000288537" "00024158" "50" "662" "0" "662" "0" "c.662T>C" "r.(?)" "p.(Met221Thr)" "" "0000288537" "00025229" "50" "2591" "0" "2591" "0" "c.2591T>C" "r.(?)" "p.(Met864Thr)" "" "0000288537" "00024010" "50" "1306" "0" "1306" "0" "c.*568T>C" "r.(=)" "p.(=)" "" "0000288538" "00024158" "30" "-37834" "0" "-37834" "0" "c.-37834G>C" "r.(?)" "p.(=)" "" "0000288538" "00025229" "30" "628" "0" "628" "0" "c.628G>C" "r.(?)" "p.(Ala210Pro)" "" "0000288538" "00024010" "30" "780" "13007" "780" "13007" "c.*42+13007G>C" "r.(=)" "p.(=)" "" "0000288539" "00024158" "50" "-37784" "0" "-37784" "0" "c.-37784T>G" "r.(?)" "p.(=)" "" "0000288539" "00025229" "50" "678" "0" "678" "0" "c.678T>G" "r.(?)" "p.(Phe226Leu)" "" "0000288539" "00024010" "50" "780" "13057" "780" "13057" "c.*42+13057T>G" "r.(=)" "p.(=)" "" "0000288540" "00024158" "30" "-37565" "0" "-37565" "0" "c.-37565C>A" "r.(?)" "p.(=)" "" "0000288540" "00025229" "30" "897" "0" "897" "0" "c.897C>A" "r.(?)" "p.(Ser299Arg)" "" "0000288540" "00024010" "30" "780" "13276" "780" "13276" "c.*42+13276C>A" "r.(=)" "p.(=)" "" "0000288541" "00024158" "30" "-37472" "0" "-37472" "0" "c.-37472C>T" "r.(?)" "p.(=)" "" "0000288541" "00025229" "30" "990" "0" "990" "0" "c.990C>T" "r.(?)" "p.(Ile330=)" "" "0000288541" "00024010" "30" "780" "13369" "780" "13369" "c.*42+13369C>T" "r.(=)" "p.(=)" "" "0000288542" "00024158" "50" "-37437" "0" "-37437" "0" "c.-37437C>A" "r.(?)" "p.(=)" "" "0000288542" "00025229" "50" "1025" "0" "1025" "0" "c.1025C>A" "r.(?)" "p.(Ala342Asp)" "" "0000288542" "00024010" "50" "780" "13404" "780" "13404" "c.*42+13404C>A" "r.(=)" "p.(=)" "" "0000288543" "00024158" "90" "85" "0" "85" "0" "c.85C>T" "r.(?)" "p.(Gln29Ter)" "" "0000288543" "00025229" "90" "2069" "-3801" "2069" "-3801" "c.2069-3801C>T" "r.(=)" "p.(=)" "" "0000288543" "00024010" "90" "781" "-3801" "781" "-3801" "c.*43-3801C>T" "r.(=)" "p.(=)" "" "0000328507" "00024158" "50" "-51223" "0" "-51223" "0" "c.-51223C>T" "r.(?)" "p.(=)" "" "0000328507" "00025229" "50" "-12762" "0" "-12762" "0" "c.-12762C>T" "r.(?)" "p.(=)" "" "0000328507" "00024010" "50" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Pro133Leu)" "" "0000328508" "00024158" "50" "-51082" "0" "-51082" "0" "c.-51082C>T" "r.(?)" "p.(=)" "" "0000328508" "00025229" "50" "-12621" "0" "-12621" "0" "c.-12621C>T" "r.(?)" "p.(=)" "" "0000328508" "00024010" "50" "539" "0" "539" "0" "c.539C>T" "r.(?)" "p.(Pro180Leu)" "" "0000328509" "00024158" "50" "-50984" "0" "-50982" "0" "c.-50984_-50982del" "r.(?)" "p.(=)" "" "0000328509" "00025229" "50" "-12523" "0" "-12521" "0" "c.-12523_-12521del" "r.(?)" "p.(=)" "" "0000328509" "00024010" "50" "637" "0" "639" "0" "c.637_639del" "r.(?)" "p.(Glu213del)" "" "0000328512" "00024158" "50" "-38308" "0" "-38308" "0" "c.-38308G>A" "r.(?)" "p.(=)" "" "0000328512" "00025229" "50" "154" "0" "154" "0" "c.154G>A" "r.(?)" "p.(Glu52Lys)" "" "0000328512" "00024010" "50" "780" "12533" "780" "12533" "c.*42+12533G>A" "r.(=)" "p.(=)" "" "0000328513" "00024158" "30" "-37962" "0" "-37962" "0" "c.-37962A>G" "r.(?)" "p.(=)" "" "0000328513" "00025229" "30" "500" "0" "500" "0" "c.500A>G" "r.(?)" "p.(Asp167Gly)" "" "0000328513" "00024010" "30" "780" "12879" "780" "12879" "c.*42+12879A>G" "r.(=)" "p.(=)" "" "0000328514" "00024158" "30" "-37937" "0" "-37937" "0" "c.-37937T>C" "r.(?)" "p.(=)" "" "0000328514" "00025229" "30" "525" "0" "525" "0" "c.525T>C" "r.(?)" "p.(Ser175=)" "" "0000328514" "00024010" "30" "780" "12904" "780" "12904" "c.*42+12904T>C" "r.(=)" "p.(=)" "" "0000328518" "00024158" "50" "-37358" "0" "-37358" "0" "c.-37358G>A" "r.(?)" "p.(=)" "" "0000328518" "00025229" "50" "1104" "0" "1104" "0" "c.1104G>A" "r.(?)" "p.(Ala368=)" "" "0000328518" "00024010" "50" "780" "13483" "780" "13483" "c.*42+13483G>A" "r.(=)" "p.(=)" "" "0000328519" "00024158" "30" "-37295" "0" "-37295" "0" "c.-37295T>A" "r.(?)" "p.(=)" "" "0000328519" "00025229" "30" "1167" "0" "1167" "0" "c.1167T>A" "r.(?)" "p.(Asp389Glu)" "" "0000328519" "00024010" "30" "780" "13546" "780" "13546" "c.*42+13546T>A" "r.(=)" "p.(=)" "" "0000328520" "00024158" "30" "-37274" "0" "-37266" "0" "c.-37274_-37266dup" "r.(?)" "p.(=)" "" "0000328520" "00025229" "30" "1188" "0" "1196" "0" "c.1188_1196dup" "r.(?)" "p.(Ala398_Ala400dup)" "" "0000328520" "00024010" "30" "780" "13567" "780" "13575" "c.*42+13567_*42+13575dup" "r.(=)" "p.(=)" "" "0000328521" "00024158" "50" "-37241" "0" "-37241" "0" "c.-37241C>G" "r.(?)" "p.(=)" "" "0000328521" "00025229" "50" "1221" "0" "1221" "0" "c.1221C>G" "r.(?)" "p.(Thr407=)" "" "0000328521" "00024010" "50" "780" "13600" "780" "13600" "c.*42+13600C>G" "r.(=)" "p.(=)" "" "0000328523" "00024158" "50" "-37229" "0" "-37203" "0" "c.-37229_-37203del" "r.(?)" "p.(=)" "" "0000328523" "00025229" "50" "1233" "0" "1259" "0" "c.1233_1259del" "r.(?)" "p.(Thr415_Gly423del)" "" "0000328523" "00024010" "50" "780" "13612" "780" "13638" "c.*42+13612_*42+13638del" "r.(=)" "p.(=)" "" "0000328525" "00024158" "50" "-37182" "0" "-37182" "0" "c.-37182C>A" "r.(?)" "p.(=)" "" "0000328525" "00025229" "50" "1280" "0" "1280" "0" "c.1280C>A" "r.(?)" "p.(Ala427Asp)" "" "0000328525" "00024010" "50" "780" "13659" "780" "13659" "c.*42+13659C>A" "r.(=)" "p.(=)" "" "0000328526" "00024158" "30" "-37068" "0" "-37067" "0" "c.-37068_-37067insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(?)" "p.(=)" "" "0000328526" "00025229" "30" "1394" "0" "1395" "0" "c.1394_1395insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(?)" "p.(Asp466_Ala467insSerGlyAlaAlaArgAspAlaProAlaAspProAsp)" "" "0000328526" "00024010" "30" "780" "13773" "780" "13774" "c.*42+13773_*42+13774insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(=)" "p.(=)" "" "0000328527" "00024158" "50" "-37067" "0" "-37067" "0" "c.-37067A>C" "r.(?)" "p.(=)" "" "0000328527" "00025229" "50" "1395" "0" "1395" "0" "c.1395A>C" "r.(?)" "p.(Pro465=)" "" "0000328527" "00024010" "50" "780" "13774" "780" "13774" "c.*42+13774A>C" "r.(=)" "p.(=)" "" "0000328529" "00024158" "50" "-37064" "0" "-37064" "0" "c.-37064T>C" "r.(?)" "p.(=)" "" "0000328529" "00025229" "50" "1398" "0" "1398" "0" "c.1398T>C" "r.(?)" "p.(Asp466=)" "" "0000328529" "00024010" "50" "780" "13777" "780" "13777" "c.*42+13777T>C" "r.(=)" "p.(=)" "" "0000328531" "00024158" "50" "-37063" "0" "-37063" "0" "c.-37063G>T" "r.(?)" "p.(=)" "" "0000328531" "00025229" "50" "1399" "0" "1399" "0" "c.1399G>T" "r.(?)" "p.(Ala467Ser)" "" "0000328531" "00024010" "50" "780" "13778" "780" "13778" "c.*42+13778G>T" "r.(=)" "p.(=)" "" "0000328533" "00024158" "30" "-37034" "0" "-37034" "0" "c.-37034C>G" "r.(?)" "p.(=)" "" "0000328533" "00025229" "30" "1428" "0" "1428" "0" "c.1428C>G" "r.(?)" "p.(Ala476=)" "" "0000328533" "00024010" "30" "780" "13807" "780" "13807" "c.*42+13807C>G" "r.(=)" "p.(=)" "" "0000328534" "00024158" "50" "-37017" "0" "-37017" "0" "c.-37017C>T" "r.(?)" "p.(=)" "" "0000328534" "00025229" "50" "1445" "0" "1445" "0" "c.1445C>T" "r.(?)" "p.(Thr482Ile)" "" "0000328534" "00024010" "50" "780" "13824" "780" "13824" "c.*42+13824C>T" "r.(=)" "p.(=)" "" "0000328535" "00024158" "30" "-37007" "0" "-37007" "0" "c.-37007C>A" "r.(?)" "p.(=)" "" "0000328535" "00025229" "30" "1455" "0" "1455" "0" "c.1455C>A" "r.(?)" "p.(Ala485=)" "" "0000328535" "00024010" "30" "780" "13834" "780" "13834" "c.*42+13834C>A" "r.(=)" "p.(=)" "" "0000328538" "00024158" "50" "-36782" "0" "-36782" "0" "c.-36782C>A" "r.(?)" "p.(=)" "" "0000328538" "00025229" "50" "1680" "0" "1680" "0" "c.1680C>A" "r.(?)" "p.(Gly560=)" "" "0000328538" "00024010" "50" "780" "14059" "780" "14059" "c.*42+14059C>A" "r.(=)" "p.(=)" "" "0000328540" "00024158" "50" "-36460" "0" "-36460" "0" "c.-36460C>T" "r.(?)" "p.(=)" "" "0000328540" "00025229" "50" "2002" "0" "2002" "0" "c.2002C>T" "r.(?)" "p.(Leu668Phe)" "" "0000328540" "00024010" "50" "780" "14381" "780" "14381" "c.*42+14381C>T" "r.(=)" "p.(=)" "" "0000328543" "00024158" "50" "920" "0" "920" "0" "c.920A>G" "r.(?)" "p.(Lys307Arg)" "" "0000328543" "00025229" "50" "2849" "0" "2849" "0" "c.2849A>G" "r.(?)" "p.(Lys950Arg)" "" "0000328543" "00024010" "50" "1564" "0" "1564" "0" "c.*826A>G" "r.(=)" "p.(=)" "" "0000328544" "00024158" "50" "964" "0" "964" "0" "c.964G>A" "r.(?)" "p.(Glu322Lys)" "" "0000328544" "00025229" "50" "2893" "0" "2893" "0" "c.2893G>A" "r.(?)" "p.(Glu965Lys)" "" "0000328544" "00024010" "50" "1608" "0" "1608" "0" "c.*870G>A" "r.(=)" "p.(=)" "" "0000342444" "00024158" "70" "773" "0" "773" "0" "c.773G>A" "r.(?)" "p.(Arg258Gln)" "" "0000342444" "00025229" "70" "2702" "0" "2702" "0" "c.2702G>A" "r.(?)" "p.(Arg901Gln)" "" "0000342444" "00024010" "70" "1417" "0" "1417" "0" "c.*679G>A" "r.(=)" "p.(=)" "" "0000342666" "00024158" "70" "1006" "0" "1006" "0" "c.1006C>T" "r.(?)" "p.(Arg336Trp)" "" "0000342666" "00025229" "70" "2935" "0" "2935" "0" "c.2935C>T" "r.(?)" "p.(Arg979Trp)" "" "0000342666" "00024010" "70" "1650" "0" "1650" "0" "c.*912C>T" "r.(=)" "p.(=)" "" "0000472241" "00024158" "90" "103" "0" "103" "0" "c.103C>T" "r.(?)" "p.(Gln35*)" "" "0000472241" "00025229" "50" "2069" "-3783" "2069" "-3783" "c.2069-3783C>T" "r.(=)" "p.(=)" "" "0000472241" "00024010" "50" "781" "-3783" "781" "-3783" "c.*43-3783C>T" "r.(=)" "p.(=)" "" "0000472242" "00024158" "90" "300" "0" "300" "0" "c.300A>C" "r.(?)" "p.(Lys100Asn)" "" "0000472242" "00025229" "90" "2229" "0" "2229" "0" "c.2229A>C" "r.(?)" "p.(Lys743Asn)" "" "0000472242" "00024010" "50" "944" "0" "944" "0" "c.*206A>C" "r.(=)" "p.(=)" "" "0000472243" "00024158" "90" "305" "0" "305" "0" "c.305C>T" "r.(?)" "p.(Ala102Val)" "" "0000472243" "00025229" "90" "2234" "0" "2234" "0" "c.2234C>T" "r.(?)" "p.(Ala745Val)" "" "0000472243" "00024010" "50" "949" "0" "949" "0" "c.*211C>T" "r.(=)" "p.(=)" "" "0000480550" "00024158" "90" "201" "0" "209" "0" "c.201_209del" "r.(?)" "p.(Phe68_Gly70del)" "" "0000480550" "00025229" "90" "2130" "0" "2138" "0" "c.2130_2138del" "r.(?)" "p.(Phe711_Gly713del)" "" "0000480551" "00024158" "70" "763" "0" "763" "0" "c.763A>G" "r.(?)" "p.(Met255Val)" "" "0000480551" "00025229" "70" "2692" "0" "2692" "0" "c.2692A>G" "r.(?)" "p.(Met898Val)" "" "0000570038" "00024158" "30" "-51564" "0" "-51564" "0" "c.-51564C>T" "r.(?)" "p.(=)" "" "0000570038" "00025229" "30" "-13103" "0" "-13103" "0" "c.-13103C>T" "r.(?)" "p.(=)" "" "0000570038" "00024010" "30" "57" "0" "57" "0" "c.57C>T" "r.(?)" "p.(Asp19=)" "" "0000570039" "00024158" "30" "-51553" "0" "-51553" "0" "c.-51553C>T" "r.(?)" "p.(=)" "" "0000570039" "00025229" "30" "-13092" "0" "-13092" "0" "c.-13092C>T" "r.(?)" "p.(=)" "" "0000570039" "00024010" "30" "68" "0" "68" "0" "c.68C>T" "r.(?)" "p.(Pro23Leu)" "" "0000570040" "00024158" "10" "-51327" "0" "-51327" "0" "c.-51327C>T" "r.(?)" "p.(=)" "" "0000570040" "00025229" "10" "-12866" "0" "-12866" "0" "c.-12866C>T" "r.(?)" "p.(=)" "" "0000570040" "00024010" "10" "294" "0" "294" "0" "c.294C>T" "r.(?)" "p.(Pro98=)" "" "0000570041" "00024158" "30" "-51234" "0" "-51211" "0" "c.-51234_-51211del" "r.(?)" "p.(=)" "" "0000570041" "00025229" "30" "-12773" "0" "-12750" "0" "c.-12773_-12750del" "r.(?)" "p.(=)" "" "0000570041" "00024010" "30" "387" "0" "410" "0" "c.387_410del" "r.(?)" "p.(Ala132_Thr139del)" "" "0000570043" "00024158" "30" "-51060" "0" "-51060" "0" "c.-51060C>A" "r.(?)" "p.(=)" "" "0000570043" "00025229" "30" "-12599" "0" "-12599" "0" "c.-12599C>A" "r.(?)" "p.(=)" "" "0000570043" "00024010" "30" "561" "0" "561" "0" "c.561C>A" "r.(?)" "p.(Ser187Arg)" "" "0000570044" "00024158" "30" "-51029" "0" "-51029" "0" "c.-51029G>A" "r.(?)" "p.(=)" "" "0000570044" "00025229" "30" "-12568" "0" "-12568" "0" "c.-12568G>A" "r.(?)" "p.(=)" "" "0000570044" "00024010" "30" "592" "0" "592" "0" "c.592G>A" "r.(?)" "p.(Asp198Asn)" "" "0000570045" "00024158" "30" "-50982" "0" "-50982" "0" "c.-50982G>A" "r.(?)" "p.(=)" "" "0000570045" "00025229" "30" "-12521" "0" "-12521" "0" "c.-12521G>A" "r.(?)" "p.(=)" "" "0000570045" "00024010" "30" "639" "0" "639" "0" "c.639G>A" "r.(?)" "p.(Glu213=)" "" "0000570046" "00024158" "10" "-50970" "0" "-50970" "0" "c.-50970T>A" "r.(?)" "p.(=)" "" "0000570046" "00025229" "10" "-12509" "0" "-12509" "0" "c.-12509T>A" "r.(?)" "p.(=)" "" "0000570046" "00024010" "10" "651" "0" "651" "0" "c.651T>A" "r.(?)" "p.(Arg217=)" "" "0000570047" "00024158" "10" "-50906" "0" "-50906" "0" "c.-50906C>A" "r.(?)" "p.(=)" "" "0000570047" "00025229" "10" "-12445" "0" "-12445" "0" "c.-12445C>A" "r.(?)" "p.(=)" "" "0000570047" "00024010" "10" "715" "0" "715" "0" "c.715C>A" "r.(?)" "p.(Pro239Thr)" "" "0000570048" "00024158" "30" "-38451" "0" "-38451" "0" "c.-38451G>A" "r.(?)" "p.(=)" "" "0000570048" "00025229" "30" "11" "0" "11" "0" "c.11G>A" "r.(?)" "p.(Arg4His)" "" "0000570048" "00024010" "30" "780" "12390" "780" "12390" "c.*42+12390G>A" "r.(=)" "p.(=)" "" "0000570049" "00024158" "30" "-38304" "0" "-38304" "0" "c.-38304C>G" "r.(?)" "p.(=)" "" "0000570049" "00025229" "30" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0000570049" "00024010" "30" "780" "12537" "780" "12537" "c.*42+12537C>G" "r.(=)" "p.(=)" "" "0000570051" "00024158" "30" "-37978" "0" "-37978" "0" "c.-37978A>G" "r.(?)" "p.(=)" "" "0000570051" "00025229" "30" "484" "0" "484" "0" "c.484A>G" "r.(?)" "p.(Met162Val)" "" "0000570051" "00024010" "30" "780" "12863" "780" "12863" "c.*42+12863A>G" "r.(=)" "p.(=)" "" "0000570052" "00024158" "30" "-37978" "0" "-37978" "0" "c.-37978A>G" "r.(?)" "p.(=)" "" "0000570052" "00025229" "30" "484" "0" "484" "0" "c.484A>G" "r.(?)" "p.(Met162Val)" "" "0000570052" "00024010" "30" "780" "12863" "780" "12863" "c.*42+12863A>G" "r.(=)" "p.(=)" "" "0000570053" "00024158" "10" "-37962" "0" "-37962" "0" "c.-37962A>G" "r.(?)" "p.(=)" "" "0000570053" "00025229" "10" "500" "0" "500" "0" "c.500A>G" "r.(?)" "p.(Asp167Gly)" "" "0000570053" "00024010" "10" "780" "12879" "780" "12879" "c.*42+12879A>G" "r.(=)" "p.(=)" "" "0000570054" "00024158" "50" "-37924" "0" "-37924" "0" "c.-37924C>T" "r.(?)" "p.(=)" "" "0000570054" "00025229" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Gln180Ter)" "" "0000570054" "00024010" "50" "780" "12917" "780" "12917" "c.*42+12917C>T" "r.(=)" "p.(=)" "" "0000570055" "00024158" "50" "-37884" "0" "-37884" "0" "c.-37884G>A" "r.(?)" "p.(=)" "" "0000570055" "00025229" "50" "578" "0" "578" "0" "c.578G>A" "r.(?)" "p.(Gly193Glu)" "" "0000570055" "00024010" "50" "780" "12957" "780" "12957" "c.*42+12957G>A" "r.(=)" "p.(=)" "" "0000570056" "00024158" "30" "-37835" "0" "-37835" "0" "c.-37835G>A" "r.(?)" "p.(=)" "" "0000570056" "00025229" "30" "627" "0" "627" "0" "c.627G>A" "r.(?)" "p.(Lys209=)" "" "0000570056" "00024010" "30" "780" "13006" "780" "13006" "c.*42+13006G>A" "r.(=)" "p.(=)" "" "0000570057" "00024158" "30" "-37688" "0" "-37688" "0" "c.-37688C>T" "r.(?)" "p.(=)" "" "0000570057" "00025229" "30" "774" "0" "774" "0" "c.774C>T" "r.(?)" "p.(Val258=)" "" "0000570057" "00024010" "30" "780" "13153" "780" "13153" "c.*42+13153C>T" "r.(=)" "p.(=)" "" "0000570058" "00024158" "50" "-37641" "0" "-37641" "0" "c.-37641C>T" "r.(?)" "p.(=)" "" "0000570058" "00025229" "50" "821" "0" "821" "0" "c.821C>T" "r.(?)" "p.(Pro274Leu)" "" "0000570058" "00024010" "50" "780" "13200" "780" "13200" "c.*42+13200C>T" "r.(=)" "p.(=)" "" "0000570059" "00024158" "30" "-37574" "0" "-37574" "0" "c.-37574G>A" "r.(?)" "p.(=)" "" "0000570059" "00025229" "30" "888" "0" "888" "0" "c.888G>A" "r.(?)" "p.(Thr296=)" "" "0000570059" "00024010" "30" "780" "13267" "780" "13267" "c.*42+13267G>A" "r.(=)" "p.(=)" "" "0000570060" "00024158" "30" "-37523" "0" "-37523" "0" "c.-37523C>G" "r.(?)" "p.(=)" "" "0000570060" "00025229" "30" "939" "0" "939" "0" "c.939C>G" "r.(?)" "p.(Ser313Arg)" "" "0000570060" "00024010" "30" "780" "13318" "780" "13318" "c.*42+13318C>G" "r.(=)" "p.(=)" "" "0000570062" "00024158" "10" "-37335" "0" "-37335" "0" "c.-37335C>T" "r.(?)" "p.(=)" "" "0000570062" "00025229" "10" "1127" "0" "1127" "0" "c.1127C>T" "r.(?)" "p.(Pro376Leu)" "" "0000570062" "00024010" "10" "780" "13506" "780" "13506" "c.*42+13506C>T" "r.(=)" "p.(=)" "" "0000570063" "00024158" "30" "-37335" "0" "-37335" "0" "c.-37335C>T" "r.(?)" "p.(=)" "" "0000570063" "00025229" "30" "1127" "0" "1127" "0" "c.1127C>T" "r.(?)" "p.(Pro376Leu)" "" "0000570063" "00024010" "30" "780" "13506" "780" "13506" "c.*42+13506C>T" "r.(=)" "p.(=)" "" "0000570064" "00024158" "10" "-37335" "0" "-37335" "0" "c.-37335C>T" "r.(?)" "p.(=)" "" "0000570064" "00025229" "10" "1127" "0" "1127" "0" "c.1127C>T" "r.(?)" "p.(Pro376Leu)" "" "0000570064" "00024010" "10" "780" "13506" "780" "13506" "c.*42+13506C>T" "r.(=)" "p.(=)" "" "0000570065" "00024158" "30" "-37333" "0" "-37333" "0" "c.-37333G>C" "r.(?)" "p.(=)" "" "0000570065" "00025229" "30" "1129" "0" "1129" "0" "c.1129G>C" "r.(?)" "p.(Gly377Arg)" "" "0000570065" "00024010" "30" "780" "13508" "780" "13508" "c.*42+13508G>C" "r.(=)" "p.(=)" "" "0000570067" "00024158" "10" "-37274" "0" "-37266" "0" "c.-37274_-37266dup" "r.(?)" "p.(=)" "" "0000570067" "00025229" "10" "1188" "0" "1196" "0" "c.1188_1196dup" "r.(?)" "p.(Ala398_Ala400dup)" "" "0000570067" "00024010" "10" "780" "13567" "780" "13575" "c.*42+13567_*42+13575dup" "r.(=)" "p.(=)" "" "0000570068" "00024158" "10" "-37274" "0" "-37266" "0" "c.-37274_-37266dup" "r.(?)" "p.(=)" "" "0000570068" "00025229" "10" "1188" "0" "1196" "0" "c.1188_1196dup" "r.(?)" "p.(Ala398_Ala400dup)" "" "0000570068" "00024010" "10" "780" "13567" "780" "13575" "c.*42+13567_*42+13575dup" "r.(=)" "p.(=)" "" "0000570069" "00024158" "30" "-37261" "0" "-37261" "0" "c.-37261G>A" "r.(?)" "p.(=)" "" "0000570069" "00025229" "30" "1201" "0" "1201" "0" "c.1201G>A" "r.(?)" "p.(Asp401Asn)" "" "0000570069" "00024010" "30" "780" "13580" "780" "13580" "c.*42+13580G>A" "r.(=)" "p.(=)" "" "0000570071" "00024158" "30" "-37163" "0" "-37163" "0" "c.-37163A>G" "r.(?)" "p.(=)" "" "0000570071" "00025229" "30" "1299" "0" "1299" "0" "c.1299A>G" "r.(?)" "p.(Ala433=)" "" "0000570071" "00024010" "30" "780" "13678" "780" "13678" "c.*42+13678A>G" "r.(=)" "p.(=)" "" "0000570072" "00024158" "30" "-37155" "0" "-37155" "0" "c.-37155C>A" "r.(?)" "p.(=)" "" "0000570072" "00025229" "30" "1307" "0" "1307" "0" "c.1307C>A" "r.(?)" "p.(Ala436Asp)" "" "0000570072" "00024010" "30" "780" "13686" "780" "13686" "c.*42+13686C>A" "r.(=)" "p.(=)" "" "0000570073" "00024158" "30" "-37155" "0" "-37155" "0" "c.-37155C>A" "r.(?)" "p.(=)" "" "0000570073" "00025229" "30" "1307" "0" "1307" "0" "c.1307C>A" "r.(?)" "p.(Ala436Asp)" "" "0000570073" "00024010" "30" "780" "13686" "780" "13686" "c.*42+13686C>A" "r.(=)" "p.(=)" "" "0000570075" "00024158" "30" "-37127" "0" "-37127" "0" "c.-37127G>A" "r.(?)" "p.(=)" "" "0000570075" "00025229" "30" "1335" "0" "1335" "0" "c.1335G>A" "r.(?)" "p.(Ala445=)" "" "0000570075" "00024010" "30" "780" "13714" "780" "13714" "c.*42+13714G>A" "r.(=)" "p.(=)" "" "0000570076" "00024158" "30" "-37119" "0" "-37119" "0" "c.-37119A>C" "r.(?)" "p.(=)" "" "0000570076" "00025229" "30" "1343" "0" "1343" "0" "c.1343A>C" "r.(?)" "p.(Asp448Ala)" "" "0000570076" "00024010" "30" "780" "13722" "780" "13722" "c.*42+13722A>C" "r.(=)" "p.(=)" "" "0000570077" "00024158" "30" "-37086" "0" "-37086" "0" "c.-37086C>G" "r.(?)" "p.(=)" "" "0000570077" "00025229" "30" "1376" "0" "1376" "0" "c.1376C>G" "r.(?)" "p.(Pro459Arg)" "" "0000570077" "00024010" "30" "780" "13755" "780" "13755" "c.*42+13755C>G" "r.(=)" "p.(=)" "" "0000570080" "00024158" "30" "-37000" "0" "-37000" "0" "c.-37000G>A" "r.(?)" "p.(=)" "" "0000570080" "00025229" "30" "1462" "0" "1462" "0" "c.1462G>A" "r.(?)" "p.(Ala488Thr)" "" "0000570080" "00024010" "30" "780" "13841" "780" "13841" "c.*42+13841G>A" "r.(=)" "p.(=)" "" "0000570081" "00024158" "10" "-36938" "0" "-36938" "0" "c.-36938C>T" "r.(?)" "p.(=)" "" "0000570081" "00025229" "10" "1524" "0" "1524" "0" "c.1524C>T" "r.(?)" "p.(Ala508=)" "" "0000570081" "00024010" "10" "780" "13903" "780" "13903" "c.*42+13903C>T" "r.(=)" "p.(=)" "" "0000570082" "00024158" "30" "-36938" "0" "-36938" "0" "c.-36938C>T" "r.(?)" "p.(=)" "" "0000570082" "00025229" "30" "1524" "0" "1524" "0" "c.1524C>T" "r.(?)" "p.(Ala508=)" "" "0000570082" "00024010" "30" "780" "13903" "780" "13903" "c.*42+13903C>T" "r.(=)" "p.(=)" "" "0000570083" "00024158" "50" "-36914" "0" "-36914" "0" "c.-36914A>T" "r.(?)" "p.(=)" "" "0000570083" "00025229" "50" "1548" "0" "1548" "0" "c.1548A>T" "r.(?)" "p.(Ala516=)" "" "0000570083" "00024010" "50" "780" "13927" "780" "13927" "c.*42+13927A>T" "r.(=)" "p.(=)" "" "0000570084" "00024158" "50" "-36909" "0" "-36909" "0" "c.-36909C>T" "r.(?)" "p.(=)" "" "0000570084" "00025229" "50" "1553" "0" "1553" "0" "c.1553C>T" "r.(?)" "p.(Pro518Leu)" "" "0000570084" "00024010" "50" "780" "13932" "780" "13932" "c.*42+13932C>T" "r.(=)" "p.(=)" "" "0000570085" "00024158" "30" "-36891" "0" "-36891" "0" "c.-36891G>A" "r.(?)" "p.(=)" "" "0000570085" "00025229" "30" "1571" "0" "1571" "0" "c.1571G>A" "r.(?)" "p.(Arg524His)" "" "0000570085" "00024010" "30" "780" "13950" "780" "13950" "c.*42+13950G>A" "r.(=)" "p.(=)" "" "0000570086" "00024158" "50" "-36872" "0" "-36872" "0" "c.-36872C>T" "r.(?)" "p.(=)" "" "0000570086" "00025229" "50" "1590" "0" "1590" "0" "c.1590C>T" "r.(?)" "p.(Pro530=)" "" "0000570086" "00024010" "50" "780" "13969" "780" "13969" "c.*42+13969C>T" "r.(=)" "p.(=)" "" "0000570087" "00024158" "50" "-36814" "0" "-36814" "0" "c.-36814G>A" "r.(?)" "p.(=)" "" "0000570087" "00025229" "50" "1648" "0" "1648" "0" "c.1648G>A" "r.(?)" "p.(Ala550Thr)" "" "0000570087" "00024010" "50" "780" "14027" "780" "14027" "c.*42+14027G>A" "r.(=)" "p.(=)" "" "0000570088" "00024158" "10" "-36664" "0" "-36664" "0" "c.-36664C>G" "r.(?)" "p.(=)" "" "0000570088" "00025229" "10" "1798" "0" "1798" "0" "c.1798C>G" "r.(?)" "p.(Arg600Gly)" "" "0000570088" "00024010" "10" "780" "14177" "780" "14177" "c.*42+14177C>G" "r.(=)" "p.(=)" "" "0000570089" "00024158" "30" "-36664" "0" "-36664" "0" "c.-36664C>G" "r.(?)" "p.(=)" "" "0000570089" "00025229" "30" "1798" "0" "1798" "0" "c.1798C>G" "r.(?)" "p.(Arg600Gly)" "" "0000570089" "00024010" "30" "780" "14177" "780" "14177" "c.*42+14177C>G" "r.(=)" "p.(=)" "" "0000570090" "00024158" "50" "-36539" "0" "-36539" "0" "c.-36539G>C" "r.(?)" "p.(=)" "" "0000570090" "00025229" "50" "1923" "0" "1923" "0" "c.1923G>C" "r.(?)" "p.(Leu641=)" "" "0000570090" "00024010" "50" "780" "14302" "780" "14302" "c.*42+14302G>C" "r.(=)" "p.(=)" "" "0000570092" "00024158" "30" "-36523" "0" "-36523" "0" "c.-36523C>G" "r.(?)" "p.(=)" "" "0000570092" "00025229" "30" "1939" "0" "1939" "0" "c.1939C>G" "r.(?)" "p.(Gln647Glu)" "" "0000570092" "00024010" "30" "780" "14318" "780" "14318" "c.*42+14318C>G" "r.(=)" "p.(=)" "" "0000570093" "00024158" "10" "-3" "0" "-1" "0" "c.-3_-1del" "r.(?)" "p.(=)" "" "0000570093" "00025229" "10" "2069" "-3888" "2069" "-3886" "c.2069-3888_2069-3886del" "r.(=)" "p.(=)" "" "0000570093" "00024010" "10" "781" "-3888" "781" "-3886" "c.*43-3888_*43-3886del" "r.(=)" "p.(=)" "" "0000570094" "00024158" "10" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000570094" "00025229" "10" "2069" "-3877" "2069" "-3877" "c.2069-3877C>T" "r.(=)" "p.(=)" "" "0000570094" "00024010" "10" "781" "-3877" "781" "-3877" "c.*43-3877C>T" "r.(=)" "p.(=)" "" "0000570095" "00024158" "30" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000570095" "00025229" "30" "2069" "-3877" "2069" "-3877" "c.2069-3877C>T" "r.(=)" "p.(=)" "" "0000570095" "00024010" "30" "781" "-3877" "781" "-3877" "c.*43-3877C>T" "r.(=)" "p.(=)" "" "0000570096" "00024158" "10" "108" "0" "108" "0" "c.108C>T" "r.(?)" "p.(Val36=)" "" "0000570096" "00025229" "10" "2069" "-3778" "2069" "-3778" "c.2069-3778C>T" "r.(=)" "p.(=)" "" "0000570096" "00024010" "10" "781" "-3778" "781" "-3778" "c.*43-3778C>T" "r.(=)" "p.(=)" "" "0000570097" "00024158" "50" "177" "0" "177" "0" "c.177G>C" "r.(?)" "p.(Gln59His)" "" "0000570097" "00025229" "50" "2106" "0" "2106" "0" "c.2106G>C" "r.(?)" "p.(Gln702His)" "" "0000570097" "00024010" "50" "818" "0" "818" "0" "c.*80G>C" "r.(=)" "p.(=)" "" "0000570098" "00024158" "10" "306" "0" "306" "0" "c.306G>A" "r.(?)" "p.(Ala102=)" "" "0000570098" "00025229" "10" "2235" "0" "2235" "0" "c.2235G>A" "r.(?)" "p.(Ala745=)" "" "0000570098" "00024010" "10" "950" "0" "950" "0" "c.*212G>A" "r.(=)" "p.(=)" "" "0000570099" "00024158" "50" "317" "0" "317" "0" "c.317T>C" "r.(?)" "p.(Ile106Thr)" "" "0000570099" "00025229" "50" "2246" "0" "2246" "0" "c.2246T>C" "r.(?)" "p.(Ile749Thr)" "" "0000570099" "00024010" "50" "961" "0" "961" "0" "c.*223T>C" "r.(=)" "p.(=)" "" "0000570100" "00024158" "30" "357" "0" "357" "0" "c.357G>A" "r.(?)" "p.(Leu119=)" "" "0000570100" "00025229" "30" "2286" "0" "2286" "0" "c.2286G>A" "r.(?)" "p.(Leu762=)" "" "0000570100" "00024010" "30" "1001" "0" "1001" "0" "c.*263G>A" "r.(=)" "p.(=)" "" "0000570101" "00024158" "30" "357" "0" "357" "0" "c.357G>A" "r.(?)" "p.(Leu119=)" "" "0000570101" "00025229" "30" "2286" "0" "2286" "0" "c.2286G>A" "r.(?)" "p.(Leu762=)" "" "0000570101" "00024010" "30" "1001" "0" "1001" "0" "c.*263G>A" "r.(=)" "p.(=)" "" "0000570102" "00024158" "10" "366" "0" "366" "0" "c.366C>T" "r.(?)" "p.(Pro122=)" "" "0000570102" "00025229" "10" "2295" "0" "2295" "0" "c.2295C>T" "r.(?)" "p.(Pro765=)" "" "0000570102" "00024010" "10" "1010" "0" "1010" "0" "c.*272C>T" "r.(=)" "p.(=)" "" "0000570103" "00024158" "30" "366" "0" "366" "0" "c.366C>T" "r.(?)" "p.(Pro122=)" "" "0000570103" "00025229" "30" "2295" "0" "2295" "0" "c.2295C>T" "r.(?)" "p.(Pro765=)" "" "0000570103" "00024010" "30" "1010" "0" "1010" "0" "c.*272C>T" "r.(=)" "p.(=)" "" "0000570104" "00024158" "10" "384" "0" "384" "0" "c.384G>A" "r.(?)" "p.(Val128=)" "" "0000570104" "00025229" "10" "2313" "0" "2313" "0" "c.2313G>A" "r.(?)" "p.(Val771=)" "" "0000570104" "00024010" "10" "1028" "0" "1028" "0" "c.*290G>A" "r.(=)" "p.(=)" "" "0000570105" "00024158" "30" "384" "0" "384" "0" "c.384G>A" "r.(?)" "p.(Val128=)" "" "0000570105" "00025229" "30" "2313" "0" "2313" "0" "c.2313G>A" "r.(?)" "p.(Val771=)" "" "0000570105" "00024010" "30" "1028" "0" "1028" "0" "c.*290G>A" "r.(=)" "p.(=)" "" "0000570106" "00024158" "10" "393" "0" "393" "0" "c.393C>T" "r.(?)" "p.(Ile131=)" "" "0000570106" "00025229" "10" "2322" "0" "2322" "0" "c.2322C>T" "r.(?)" "p.(Ile774=)" "" "0000570106" "00024010" "10" "1037" "0" "1037" "0" "c.*299C>T" "r.(=)" "p.(=)" "" "0000570107" "00024158" "30" "432" "0" "432" "0" "c.432C>T" "r.(?)" "p.(Pro144=)" "" "0000570107" "00025229" "30" "2361" "0" "2361" "0" "c.2361C>T" "r.(?)" "p.(Pro787=)" "" "0000570107" "00024010" "30" "1076" "0" "1076" "0" "c.*338C>T" "r.(=)" "p.(=)" "" "0000570108" "00024158" "10" "433" "-18" "433" "-18" "c.433-18T>C" "r.(=)" "p.(=)" "" "0000570108" "00025229" "10" "2362" "-18" "2362" "-18" "c.2362-18T>C" "r.(=)" "p.(=)" "" "0000570108" "00024010" "10" "1077" "-18" "1077" "-18" "c.*339-18T>C" "r.(=)" "p.(=)" "" "0000570109" "00024158" "10" "555" "0" "555" "0" "c.555C>T" "r.(?)" "p.(Ile185=)" "" "0000570109" "00025229" "10" "2484" "0" "2484" "0" "c.2484C>T" "r.(?)" "p.(Ile828=)" "" "0000570109" "00024010" "10" "1199" "0" "1199" "0" "c.*461C>T" "r.(=)" "p.(=)" "" "0000570111" "00024158" "50" "717" "0" "717" "0" "c.717C>T" "r.(?)" "p.(Asn239=)" "" "0000570111" "00025229" "50" "2646" "0" "2646" "0" "c.2646C>T" "r.(?)" "p.(Asn882=)" "" "0000570111" "00024010" "50" "1361" "0" "1361" "0" "c.*623C>T" "r.(=)" "p.(=)" "" "0000570112" "00024158" "90" "772" "0" "772" "0" "c.772C>T" "r.(?)" "p.(Arg258Trp)" "" "0000570112" "00025229" "90" "2701" "0" "2701" "0" "c.2701C>T" "r.(?)" "p.(Arg901Trp)" "" "0000570112" "00024010" "90" "1416" "0" "1416" "0" "c.*678C>T" "r.(=)" "p.(=)" "" "0000570113" "00024158" "50" "773" "0" "773" "0" "c.773G>A" "r.(?)" "p.(Arg258Gln)" "" "0000570113" "00025229" "50" "2702" "0" "2702" "0" "c.2702G>A" "r.(?)" "p.(Arg901Gln)" "" "0000570113" "00024010" "50" "1417" "0" "1417" "0" "c.*679G>A" "r.(=)" "p.(=)" "" "0000570114" "00024158" "50" "793" "0" "793" "0" "c.793C>T" "r.(?)" "p.(Arg265Cys)" "" "0000570114" "00025229" "50" "2722" "0" "2722" "0" "c.2722C>T" "r.(?)" "p.(Arg908Cys)" "" "0000570114" "00024010" "50" "1437" "0" "1437" "0" "c.*699C>T" "r.(=)" "p.(=)" "" "0000570115" "00024158" "50" "839" "5" "839" "5" "c.839+5G>C" "r.spl?" "p.?" "" "0000570115" "00025229" "50" "2768" "5" "2768" "5" "c.2768+5G>C" "r.spl?" "p.?" "" "0000570115" "00024010" "50" "1483" "5" "1483" "5" "c.*745+5G>C" "r.spl?" "p.?" "" "0000570116" "00024158" "50" "976" "0" "976" "0" "c.976C>T" "r.(?)" "p.(Pro326Ser)" "" "0000570116" "00025229" "50" "2905" "0" "2905" "0" "c.2905C>T" "r.(?)" "p.(Pro969Ser)" "" "0000570116" "00024010" "50" "1620" "0" "1620" "0" "c.*882C>T" "r.(=)" "p.(=)" "" "0000570117" "00024158" "30" "978" "0" "978" "0" "c.978C>T" "r.(?)" "p.(Pro326=)" "" "0000570117" "00025229" "30" "2907" "0" "2907" "0" "c.2907C>T" "r.(?)" "p.(Pro969=)" "" "0000570117" "00024010" "30" "1622" "0" "1622" "0" "c.*884C>T" "r.(=)" "p.(=)" "" "0000570118" "00024158" "50" "1014" "0" "1014" "0" "c.1014G>T" "r.(?)" "p.(Lys338Asn)" "" "0000570118" "00025229" "50" "2943" "0" "2943" "0" "c.2943G>T" "r.(?)" "p.(Lys981Asn)" "" "0000570118" "00024010" "50" "1658" "0" "1658" "0" "c.*920G>T" "r.(=)" "p.(=)" "" "0000570119" "00024158" "30" "1026" "0" "1026" "0" "c.1026A>G" "r.(?)" "p.(Arg342=)" "" "0000570119" "00025229" "30" "2955" "0" "2955" "0" "c.2955A>G" "r.(?)" "p.(Arg985=)" "" "0000570119" "00024010" "30" "1670" "0" "1670" "0" "c.*932A>G" "r.(=)" "p.(=)" "" "0000570120" "00024158" "10" "1113" "0" "1113" "0" "c.1113C>T" "r.(?)" "p.(Asn371=)" "" "0000570120" "00025229" "10" "3042" "0" "3042" "0" "c.3042C>T" "r.(?)" "p.(Asn1014=)" "" "0000570120" "00024010" "10" "1757" "0" "1757" "0" "c.*1019C>T" "r.(=)" "p.(=)" "" "0000570121" "00024158" "30" "1179" "0" "1179" "0" "c.1179G>T" "r.(?)" "p.(Leu393=)" "" "0000570121" "00025229" "30" "3108" "0" "3108" "0" "c.3108G>T" "r.(?)" "p.(Leu1036=)" "" "0000570121" "00024010" "30" "1823" "0" "1823" "0" "c.*1085G>T" "r.(=)" "p.(=)" "" "0000618220" "00024158" "30" "-51475" "0" "-51475" "0" "c.-51475A>G" "r.(?)" "p.(=)" "" "0000618220" "00025229" "30" "-13014" "0" "-13014" "0" "c.-13014A>G" "r.(?)" "p.(=)" "" "0000618220" "00024010" "30" "146" "0" "146" "0" "c.146A>G" "r.(?)" "p.(Asn49Ser)" "" "0000618221" "00024158" "30" "-51416" "0" "-51416" "0" "c.-51416C>A" "r.(?)" "p.(=)" "" "0000618221" "00025229" "30" "-12955" "0" "-12955" "0" "c.-12955C>A" "r.(?)" "p.(=)" "" "0000618221" "00024010" "30" "205" "0" "205" "0" "c.205C>A" "r.(?)" "p.(His69Asn)" "" "0000618222" "00024158" "30" "-51223" "0" "-51223" "0" "c.-51223C>T" "r.(?)" "p.(=)" "" "0000618222" "00025229" "30" "-12762" "0" "-12762" "0" "c.-12762C>T" "r.(?)" "p.(=)" "" "0000618222" "00024010" "30" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Pro133Leu)" "" "0000618223" "00024158" "10" "-51084" "0" "-51084" "0" "c.-51084G>A" "r.(?)" "p.(=)" "" "0000618223" "00025229" "10" "-12623" "0" "-12623" "0" "c.-12623G>A" "r.(?)" "p.(=)" "" "0000618223" "00024010" "10" "537" "0" "537" "0" "c.537G>A" "r.(?)" "p.(Pro179=)" "" "0000618224" "00024158" "10" "-50906" "0" "-50906" "0" "c.-50906C>A" "r.(?)" "p.(=)" "" "0000618224" "00025229" "10" "-12445" "0" "-12445" "0" "c.-12445C>A" "r.(?)" "p.(=)" "" "0000618224" "00024010" "10" "715" "0" "715" "0" "c.715C>A" "r.(?)" "p.(Pro239Thr)" "" "0000618225" "00024158" "30" "-38379" "0" "-38379" "0" "c.-38379A>G" "r.(?)" "p.(=)" "" "0000618225" "00025229" "30" "83" "0" "83" "0" "c.83A>G" "r.(?)" "p.(Gln28Arg)" "" "0000618225" "00024010" "30" "780" "12462" "780" "12462" "c.*42+12462A>G" "r.(=)" "p.(=)" "" "0000618226" "00024158" "30" "-37835" "0" "-37835" "0" "c.-37835G>A" "r.(?)" "p.(=)" "" "0000618226" "00025229" "30" "627" "0" "627" "0" "c.627G>A" "r.(?)" "p.(Lys209=)" "" "0000618226" "00024010" "30" "780" "13006" "780" "13006" "c.*42+13006G>A" "r.(=)" "p.(=)" "" "0000618227" "00024158" "50" "-37504" "0" "-37502" "0" "c.-37504_-37502del" "r.(?)" "p.(=)" "" "0000618227" "00025229" "50" "958" "0" "960" "0" "c.958_960del" "r.(?)" "p.(Asp320del)" "" "0000618227" "00024010" "50" "780" "13337" "780" "13339" "c.*42+13337_*42+13339del" "r.(=)" "p.(=)" "" "0000618228" "00024158" "30" "-37222" "0" "-37222" "0" "c.-37222G>A" "r.(?)" "p.(=)" "" "0000618228" "00025229" "30" "1240" "0" "1240" "0" "c.1240G>A" "r.(?)" "p.(Gly414Arg)" "" "0000618228" "00024010" "30" "780" "13619" "780" "13619" "c.*42+13619G>A" "r.(=)" "p.(=)" "" "0000618229" "00024158" "50" "-37163" "0" "-37128" "0" "c.-37163_-37128del" "r.(?)" "p.(=)" "" "0000618229" "00025229" "50" "1299" "0" "1334" "0" "c.1299_1334del" "r.(?)" "p.(Ala436_Pro447del)" "" "0000618229" "00024010" "50" "780" "13678" "780" "13713" "c.*42+13678_*42+13713del" "r.(=)" "p.(=)" "" "0000618230" "00024158" "50" "-37065" "0" "-37064" "0" "c.-37065_-37064insC" "r.(?)" "p.(=)" "" "0000618230" "00025229" "50" "1397" "0" "1398" "0" "c.1397_1398insC" "r.(?)" "p.(Ala467CysfsTer6)" "" "0000618230" "00024010" "50" "780" "13776" "780" "13777" "c.*42+13776_*42+13777insC" "r.(=)" "p.(=)" "" "0000618231" "00024158" "50" "-36924" "0" "-36924" "0" "c.-36924C>T" "r.(?)" "p.(=)" "" "0000618231" "00025229" "50" "1538" "0" "1538" "0" "c.1538C>T" "r.(?)" "p.(Ala513Val)" "" "0000618231" "00024010" "50" "780" "13917" "780" "13917" "c.*42+13917C>T" "r.(=)" "p.(=)" "" "0000618232" "00024158" "30" "-36437" "0" "-36437" "0" "c.-36437C>G" "r.(?)" "p.(=)" "" "0000618232" "00025229" "30" "2025" "0" "2025" "0" "c.2025C>G" "r.(?)" "p.(Asp675Glu)" "" "0000618232" "00024010" "30" "780" "14404" "780" "14404" "c.*42+14404C>G" "r.(=)" "p.(=)" "" "0000618233" "00024158" "30" "-36225" "0" "-36225" "0" "c.-36225A>T" "r.(?)" "p.(=)" "" "0000618233" "00025229" "30" "2068" "169" "2068" "169" "c.2068+169A>T" "r.(=)" "p.(=)" "" "0000618233" "00024010" "30" "780" "14616" "780" "14616" "c.*42+14616A>T" "r.(=)" "p.(=)" "" "0000618234" "00024158" "30" "-36214" "0" "-36214" "0" "c.-36214A>T" "r.(?)" "p.(=)" "" "0000618234" "00025229" "30" "2068" "180" "2068" "180" "c.2068+180A>T" "r.(=)" "p.(=)" "" "0000618234" "00024010" "30" "780" "14627" "780" "14627" "c.*42+14627A>T" "r.(=)" "p.(=)" "" "0000618235" "00024158" "10" "90" "0" "90" "0" "c.90G>A" "r.(?)" "p.(Leu30=)" "" "0000618235" "00025229" "10" "2069" "-3796" "2069" "-3796" "c.2069-3796G>A" "r.(=)" "p.(=)" "" "0000618235" "00024010" "10" "781" "-3796" "781" "-3796" "c.*43-3796G>A" "r.(=)" "p.(=)" "" "0000618236" "00024158" "70" "139" "0" "139" "0" "c.139G>C" "r.(?)" "p.(Gly47Arg)" "" "0000618236" "00025229" "70" "2069" "-3747" "2069" "-3747" "c.2069-3747G>C" "r.(=)" "p.(=)" "" "0000618236" "00024010" "70" "781" "-3747" "781" "-3747" "c.*43-3747G>C" "r.(=)" "p.(=)" "" "0000618237" "00024158" "30" "219" "0" "219" "0" "c.219C>T" "r.(?)" "p.(Gly73=)" "" "0000618237" "00025229" "30" "2148" "0" "2148" "0" "c.2148C>T" "r.(?)" "p.(Gly716=)" "" "0000618237" "00024010" "30" "860" "0" "860" "0" "c.*122C>T" "r.(=)" "p.(=)" "" "0000618238" "00024158" "10" "243" "0" "243" "0" "c.243G>A" "r.(?)" "p.(Arg81=)" "" "0000618238" "00025229" "10" "2172" "0" "2172" "0" "c.2172G>A" "r.(?)" "p.(Arg724=)" "" "0000618238" "00024010" "10" "884" "0" "884" "0" "c.*146G>A" "r.(=)" "p.(=)" "" "0000618239" "00024158" "30" "279" "0" "279" "0" "c.279G>A" "r.(?)" "p.(Gln93=)" "" "0000618239" "00025229" "30" "2208" "0" "2208" "0" "c.2208G>A" "r.(?)" "p.(Gln736=)" "" "0000618239" "00024010" "30" "923" "0" "923" "0" "c.*185G>A" "r.(=)" "p.(=)" "" "0000618240" "00024158" "30" "555" "0" "555" "0" "c.555C>T" "r.(?)" "p.(Ile185=)" "" "0000618240" "00025229" "30" "2484" "0" "2484" "0" "c.2484C>T" "r.(?)" "p.(Ile828=)" "" "0000618240" "00024010" "30" "1199" "0" "1199" "0" "c.*461C>T" "r.(=)" "p.(=)" "" "0000618241" "00024158" "70" "750" "0" "750" "0" "c.750C>G" "r.(?)" "p.(Ser250Arg)" "" "0000618241" "00025229" "70" "2679" "0" "2679" "0" "c.2679C>G" "r.(?)" "p.(Ser893Arg)" "" "0000618241" "00024010" "70" "1394" "0" "1394" "0" "c.*656C>G" "r.(=)" "p.(=)" "" "0000618242" "00024158" "30" "1113" "0" "1113" "0" "c.1113C>T" "r.(?)" "p.(Asn371=)" "" "0000618242" "00025229" "30" "3042" "0" "3042" "0" "c.3042C>T" "r.(?)" "p.(Asn1014=)" "" "0000618242" "00024010" "30" "1757" "0" "1757" "0" "c.*1019C>T" "r.(=)" "p.(=)" "" "0000624175" "00024158" "30" "-51045" "0" "-51045" "0" "c.-51045G>A" "r.(?)" "p.(=)" "" "0000624175" "00025229" "30" "-12584" "0" "-12584" "0" "c.-12584G>A" "r.(?)" "p.(=)" "" "0000624175" "00024010" "30" "576" "0" "576" "0" "c.576G>A" "r.(?)" "p.(Glu192=)" "" "0000624176" "00024158" "50" "-37924" "0" "-37924" "0" "c.-37924C>T" "r.(?)" "p.(=)" "" "0000624176" "00025229" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Gln180Ter)" "" "0000624176" "00024010" "50" "780" "12917" "780" "12917" "c.*42+12917C>T" "r.(=)" "p.(=)" "" "0000624177" "00024158" "90" "-37715" "0" "-37715" "0" "c.-37715C>A" "r.(?)" "p.(=)" "" "0000624177" "00025229" "90" "747" "0" "747" "0" "c.747C>A" "r.(?)" "p.(Val249=)" "" "0000624177" "00024010" "90" "780" "13126" "780" "13126" "c.*42+13126C>A" "r.(=)" "p.(=)" "" "0000624178" "00024158" "30" "-37549" "0" "-37549" "0" "c.-37549T>C" "r.(?)" "p.(=)" "" "0000624178" "00025229" "30" "913" "0" "913" "0" "c.913T>C" "r.(?)" "p.(Ser305Pro)" "" "0000624178" "00024010" "30" "780" "13292" "780" "13292" "c.*42+13292T>C" "r.(=)" "p.(=)" "" "0000624180" "00024158" "30" "1036" "0" "1036" "0" "c.1036C>T" "r.(?)" "p.(Leu346=)" "" "0000624180" "00025229" "30" "2965" "0" "2965" "0" "c.2965C>T" "r.(?)" "p.(Leu989=)" "" "0000624180" "00024010" "30" "1680" "0" "1680" "0" "c.*942C>T" "r.(=)" "p.(=)" "" "0000650816" "00024158" "10" "433" "-18" "433" "-18" "c.433-18T>C" "r.(=)" "p.(=)" "" "0000650816" "00025229" "10" "2362" "-18" "2362" "-18" "c.2362-18T>C" "r.(=)" "p.(=)" "" "0000650816" "00024010" "10" "1077" "-18" "1077" "-18" "c.*339-18T>C" "r.(=)" "p.(=)" "" "0000658783" "00024158" "30" "-51327" "0" "-51327" "0" "c.-51327C>T" "r.(?)" "p.(=)" "" "0000658783" "00025229" "30" "-12866" "0" "-12866" "0" "c.-12866C>T" "r.(?)" "p.(=)" "" "0000658783" "00024010" "30" "294" "0" "294" "0" "c.294C>T" "r.(?)" "p.(Pro98=)" "" "0000658784" "00024158" "30" "-37182" "0" "-37182" "0" "c.-37182C>A" "r.(?)" "p.(=)" "" "0000658784" "00025229" "30" "1280" "0" "1280" "0" "c.1280C>A" "r.(?)" "p.(Ala427Asp)" "" "0000658784" "00024010" "30" "780" "13659" "780" "13659" "c.*42+13659C>A" "r.(=)" "p.(=)" "" "0000658785" "00024158" "30" "-37091" "0" "-37091" "0" "c.-37091G>C" "r.(?)" "p.(=)" "" "0000658785" "00025229" "30" "1371" "0" "1371" "0" "c.1371G>C" "r.(?)" "p.(Ala457=)" "" "0000658785" "00024010" "30" "780" "13750" "780" "13750" "c.*42+13750G>C" "r.(=)" "p.(=)" "" "0000658786" "00024158" "30" "531" "-13" "531" "-10" "c.531-13_531-10del" "r.(=)" "p.(=)" "" "0000658786" "00025229" "30" "2460" "-13" "2460" "-10" "c.2460-13_2460-10del" "r.(=)" "p.(=)" "" "0000658786" "00024010" "30" "1175" "-13" "1175" "-10" "c.*437-13_*437-10del" "r.(=)" "p.(=)" "" "0000658787" "00024158" "30" "891" "0" "891" "0" "c.891C>A" "r.(?)" "p.(Leu297=)" "" "0000658787" "00025229" "30" "2820" "0" "2820" "0" "c.2820C>A" "r.(?)" "p.(Leu940=)" "" "0000658787" "00024010" "30" "1535" "0" "1535" "0" "c.*797C>A" "r.(=)" "p.(=)" "" "0000658788" "00024158" "90" "1107" "0" "1108" "0" "c.1107_1108del" "r.(?)" "p.(Asn371HisfsTer10)" "" "0000658788" "00025229" "90" "3036" "0" "3037" "0" "c.3036_3037del" "r.(?)" "p.(Asn1014HisfsTer10)" "" "0000658788" "00024010" "90" "1751" "0" "1752" "0" "c.*1013_*1014del" "r.(=)" "p.(=)" "" "0000669683" "00024158" "10" "433" "-18" "433" "-18" "c.433-18T>C" "r.(=)" "p.(=)" "" "0000669683" "00025229" "10" "2362" "-18" "2362" "-18" "c.2362-18T>C" "r.(=)" "p.(=)" "" "0000669683" "00024010" "10" "1077" "-18" "1077" "-18" "c.*339-18T>C" "r.(=)" "p.(=)" "" "0000675197" "00025229" "70" "1773" "0" "1773" "0" "c.1773G>A" "r.(?)" "p.(Trp591*)" "" "0000681656" "00024158" "30" "-38266" "0" "-38266" "0" "c.-38266G>A" "r.(?)" "p.(=)" "" "0000681656" "00025229" "30" "196" "0" "196" "0" "c.196G>A" "r.(?)" "p.(Glu66Lys)" "" "0000681656" "00024010" "30" "780" "12575" "780" "12575" "c.*42+12575G>A" "r.(=)" "p.(=)" "" "0000681657" "00024158" "50" "-37695" "0" "-37695" "0" "c.-37695C>T" "r.(?)" "p.(=)" "" "0000681657" "00025229" "50" "767" "0" "767" "0" "c.767C>T" "r.(?)" "p.(Ala256Val)" "" "0000681657" "00024010" "50" "780" "13146" "780" "13146" "c.*42+13146C>T" "r.(=)" "p.(=)" "" "0000681659" "00024158" "50" "-37139" "0" "-37139" "0" "c.-37139C>T" "r.(?)" "p.(=)" "" "0000681659" "00025229" "50" "1323" "0" "1323" "0" "c.1323C>T" "r.(?)" "p.(Pro441=)" "" "0000681659" "00024010" "50" "780" "13702" "780" "13702" "c.*42+13702C>T" "r.(=)" "p.(=)" "" "0000681660" "00024158" "30" "-37086" "0" "-37086" "0" "c.-37086C>G" "r.(?)" "p.(=)" "" "0000681660" "00025229" "30" "1376" "0" "1376" "0" "c.1376C>G" "r.(?)" "p.(Pro459Arg)" "" "0000681660" "00024010" "30" "780" "13755" "780" "13755" "c.*42+13755C>G" "r.(=)" "p.(=)" "" "0000681661" "00024158" "30" "-37000" "0" "-37000" "0" "c.-37000G>A" "r.(?)" "p.(=)" "" "0000681661" "00025229" "30" "1462" "0" "1462" "0" "c.1462G>A" "r.(?)" "p.(Ala488Thr)" "" "0000681661" "00024010" "30" "780" "13841" "780" "13841" "c.*42+13841G>A" "r.(=)" "p.(=)" "" "0000681662" "00024158" "30" "-36776" "0" "-36776" "0" "c.-36776C>T" "r.(?)" "p.(=)" "" "0000681662" "00025229" "30" "1686" "0" "1686" "0" "c.1686C>T" "r.(?)" "p.(Arg562=)" "" "0000681662" "00024010" "30" "780" "14065" "780" "14065" "c.*42+14065C>T" "r.(=)" "p.(=)" "" "0000681663" "00024158" "30" "-36509" "0" "-36509" "0" "c.-36509A>T" "r.(?)" "p.(=)" "" "0000681663" "00025229" "30" "1953" "0" "1953" "0" "c.1953A>T" "r.(?)" "p.(Glu651Asp)" "" "0000681663" "00024010" "30" "780" "14332" "780" "14332" "c.*42+14332A>T" "r.(=)" "p.(=)" "" "0000681664" "00024158" "30" "-28749" "0" "-28749" "0" "c.-28749del" "r.(?)" "p.(=)" "" "0000681664" "00025229" "30" "2068" "7645" "2068" "7645" "c.2068+7645del" "r.(=)" "p.(=)" "" "0000681664" "00024010" "30" "780" "22092" "780" "22092" "c.*42+22092del" "r.(=)" "p.(=)" "" "0000681665" "00024158" "10" "433" "-18" "433" "-18" "c.433-18T>C" "r.(=)" "p.(=)" "" "0000681665" "00025229" "10" "2362" "-18" "2362" "-18" "c.2362-18T>C" "r.(=)" "p.(=)" "" "0000681665" "00024010" "10" "1077" "-18" "1077" "-18" "c.*339-18T>C" "r.(=)" "p.(=)" "" "0000681666" "00024158" "50" "478" "0" "478" "0" "c.478C>T" "r.(?)" "p.(Arg160Cys)" "" "0000681666" "00025229" "50" "2407" "0" "2407" "0" "c.2407C>T" "r.(?)" "p.(Arg803Cys)" "" "0000681666" "00024010" "50" "1122" "0" "1122" "0" "c.*384C>T" "r.(=)" "p.(=)" "" "0000681667" "00024158" "50" "794" "0" "794" "0" "c.794G>A" "r.(?)" "p.(Arg265His)" "" "0000681667" "00025229" "50" "2723" "0" "2723" "0" "c.2723G>A" "r.(?)" "p.(Arg908His)" "" "0000681667" "00024010" "50" "1438" "0" "1438" "0" "c.*700G>A" "r.(=)" "p.(=)" "" "0000682766" "00025229" "70" "2631" "0" "2631" "0" "c.2631G>A" "r.(?)" "p.(Trp877*)" "" "0000693007" "00024158" "50" "-51381" "0" "-51381" "0" "c.-51381del" "r.(?)" "p.(=)" "" "0000693007" "00025229" "50" "-12920" "0" "-12920" "0" "c.-12920del" "r.(?)" "p.(=)" "" "0000693007" "00024010" "50" "240" "0" "240" "0" "c.240del" "r.(?)" "p.(Glu81AsnfsTer21)" "" "0000693008" "00024158" "30" "-51084" "0" "-51084" "0" "c.-51084G>A" "r.(?)" "p.(=)" "" "0000693008" "00025229" "30" "-12623" "0" "-12623" "0" "c.-12623G>A" "r.(?)" "p.(=)" "" "0000693008" "00024010" "30" "537" "0" "537" "0" "c.537G>A" "r.(?)" "p.(Pro179=)" "" "0000693009" "00024158" "50" "-37785" "0" "-37785" "0" "c.-37785T>C" "r.(?)" "p.(=)" "" "0000693009" "00025229" "50" "677" "0" "677" "0" "c.677T>C" "r.(?)" "p.(Phe226Ser)" "" "0000693009" "00024010" "50" "780" "13056" "780" "13056" "c.*42+13056T>C" "r.(=)" "p.(=)" "" "0000693010" "00024158" "50" "-36454" "0" "-36454" "0" "c.-36454G>A" "r.(?)" "p.(=)" "" "0000693010" "00025229" "50" "2008" "0" "2008" "0" "c.2008G>A" "r.(?)" "p.(Asp670Asn)" "" "0000693010" "00024010" "50" "780" "14387" "780" "14387" "c.*42+14387G>A" "r.(=)" "p.(=)" "" "0000693011" "00024158" "30" "68" "0" "68" "0" "c.68A>G" "r.(?)" "p.(Asn23Ser)" "" "0000693011" "00025229" "30" "2069" "-3818" "2069" "-3818" "c.2069-3818A>G" "r.(=)" "p.(=)" "" "0000693011" "00024010" "30" "781" "-3818" "781" "-3818" "c.*43-3818A>G" "r.(=)" "p.(=)" "" "0000693012" "00024158" "50" "257" "970" "257" "972" "c.257+970_257+972del" "r.(=)" "p.(=)" "" "0000693012" "00025229" "50" "2186" "970" "2186" "972" "c.2186+970_2186+972del" "r.(=)" "p.(=)" "" "0000693012" "00024010" "50" "898" "970" "898" "972" "c.*160+970_*160+972del" "r.(=)" "p.(=)" "" "0000727761" "00024158" "30" "-51485" "0" "-51485" "0" "c.-51485G>C" "r.(?)" "p.(=)" "" "0000727761" "00025229" "30" "-13024" "0" "-13024" "0" "c.-13024G>C" "r.(?)" "p.(=)" "" "0000727761" "00024010" "30" "136" "0" "136" "0" "c.136G>C" "r.(?)" "p.(Ala46Pro)" "" "0000727762" "00024158" "50" "-51291" "0" "-51268" "0" "c.-51291_-51268dup" "r.(?)" "p.(=)" "" "0000727762" "00025229" "50" "-12830" "0" "-12807" "0" "c.-12830_-12807dup" "r.(?)" "p.(=)" "" "0000727762" "00024010" "50" "330" "0" "353" "0" "c.330_353dup" "r.(?)" "p.(Thr111_Glu118dup)" "" "0000727763" "00024158" "10" "-51225" "0" "-51225" "0" "c.-51225C>A" "r.(?)" "p.(=)" "" "0000727763" "00025229" "10" "-12764" "0" "-12764" "0" "c.-12764C>A" "r.(?)" "p.(=)" "" "0000727763" "00024010" "10" "396" "0" "396" "0" "c.396C>A" "r.(?)" "p.(Ala132=)" "" "0000727764" "00024158" "30" "-51107" "0" "-51107" "0" "c.-51107G>A" "r.(?)" "p.(=)" "" "0000727764" "00025229" "30" "-12646" "0" "-12646" "0" "c.-12646G>A" "r.(?)" "p.(=)" "" "0000727764" "00024010" "30" "514" "0" "514" "0" "c.514G>A" "r.(?)" "p.(Asp172Asn)" "" "0000727765" "00024158" "50" "-51013" "0" "-51013" "0" "c.-51013A>T" "r.(?)" "p.(=)" "" "0000727765" "00025229" "50" "-12552" "0" "-12552" "0" "c.-12552A>T" "r.(?)" "p.(=)" "" "0000727765" "00024010" "50" "608" "0" "608" "0" "c.608A>T" "r.(?)" "p.(Asp203Val)" "" "0000727766" "00024158" "30" "-38455" "0" "-38455" "0" "c.-38455G>A" "r.(?)" "p.(=)" "" "0000727766" "00025229" "30" "7" "0" "7" "0" "c.7G>A" "r.(?)" "p.(Val3Met)" "" "0000727766" "00024010" "30" "780" "12386" "780" "12386" "c.*42+12386G>A" "r.(=)" "p.(=)" "" "0000727767" "00024158" "50" "-38308" "0" "-38308" "0" "c.-38308G>A" "r.(?)" "p.(=)" "" "0000727767" "00025229" "50" "154" "0" "154" "0" "c.154G>A" "r.(?)" "p.(Glu52Lys)" "" "0000727767" "00024010" "50" "780" "12533" "780" "12533" "c.*42+12533G>A" "r.(=)" "p.(=)" "" "0000727768" "00024158" "50" "-38002" "0" "-38002" "0" "c.-38002T>C" "r.(?)" "p.(=)" "" "0000727768" "00025229" "50" "460" "0" "460" "0" "c.460T>C" "r.(?)" "p.(Tyr154His)" "" "0000727768" "00024010" "50" "780" "12839" "780" "12839" "c.*42+12839T>C" "r.(=)" "p.(=)" "" "0000727769" "00024158" "50" "-37924" "0" "-37924" "0" "c.-37924C>T" "r.(?)" "p.(=)" "" "0000727769" "00025229" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Gln180Ter)" "" "0000727769" "00024010" "50" "780" "12917" "780" "12917" "c.*42+12917C>T" "r.(=)" "p.(=)" "" "0000727770" "00024158" "30" "-37834" "0" "-37834" "0" "c.-37834G>C" "r.(?)" "p.(=)" "" "0000727770" "00025229" "30" "628" "0" "628" "0" "c.628G>C" "r.(?)" "p.(Ala210Pro)" "" "0000727770" "00024010" "30" "780" "13007" "780" "13007" "c.*42+13007G>C" "r.(=)" "p.(=)" "" "0000727771" "00024158" "30" "-37684" "0" "-37684" "0" "c.-37684G>T" "r.(?)" "p.(=)" "" "0000727771" "00025229" "30" "778" "0" "778" "0" "c.778G>T" "r.(?)" "p.(Ala260Ser)" "" "0000727771" "00024010" "30" "780" "13157" "780" "13157" "c.*42+13157G>T" "r.(=)" "p.(=)" "" "0000727772" "00024158" "50" "-37666" "0" "-37666" "0" "c.-37666C>T" "r.(?)" "p.(=)" "" "0000727772" "00025229" "50" "796" "0" "796" "0" "c.796C>T" "r.(?)" "p.(Leu266Phe)" "" "0000727772" "00024010" "50" "780" "13175" "780" "13175" "c.*42+13175C>T" "r.(=)" "p.(=)" "" "0000727773" "00024158" "50" "-37504" "0" "-37502" "0" "c.-37504_-37502del" "r.(?)" "p.(=)" "" "0000727773" "00025229" "50" "958" "0" "960" "0" "c.958_960del" "r.(?)" "p.(Asp320del)" "" "0000727773" "00024010" "50" "780" "13337" "780" "13339" "c.*42+13337_*42+13339del" "r.(=)" "p.(=)" "" "0000727774" "00024158" "30" "-37461" "0" "-37461" "0" "c.-37461G>A" "r.(?)" "p.(=)" "" "0000727774" "00025229" "30" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Gly334Asp)" "" "0000727774" "00024010" "30" "780" "13380" "780" "13380" "c.*42+13380G>A" "r.(=)" "p.(=)" "" "0000727775" "00024158" "30" "-37241" "0" "-37241" "0" "c.-37241C>G" "r.(?)" "p.(=)" "" "0000727775" "00025229" "30" "1221" "0" "1221" "0" "c.1221C>G" "r.(?)" "p.(Thr407=)" "" "0000727775" "00024010" "30" "780" "13600" "780" "13600" "c.*42+13600C>G" "r.(=)" "p.(=)" "" "0000727776" "00024158" "30" "-37192" "0" "-37192" "0" "c.-37192G>C" "r.(?)" "p.(=)" "" "0000727776" "00025229" "30" "1270" "0" "1270" "0" "c.1270G>C" "r.(?)" "p.(Ala424Pro)" "" "0000727776" "00024010" "30" "780" "13649" "780" "13649" "c.*42+13649G>C" "r.(=)" "p.(=)" "" "0000727777" "00024158" "30" "-37182" "0" "-37182" "0" "c.-37182C>A" "r.(?)" "p.(=)" "" "0000727777" "00025229" "30" "1280" "0" "1280" "0" "c.1280C>A" "r.(?)" "p.(Ala427Asp)" "" "0000727777" "00024010" "30" "780" "13659" "780" "13659" "c.*42+13659C>A" "r.(=)" "p.(=)" "" "0000727778" "00024158" "30" "-37153" "0" "-37153" "0" "c.-37153G>T" "r.(?)" "p.(=)" "" "0000727778" "00025229" "30" "1309" "0" "1309" "0" "c.1309G>T" "r.(?)" "p.(Ala437Ser)" "" "0000727778" "00024010" "30" "780" "13688" "780" "13688" "c.*42+13688G>T" "r.(=)" "p.(=)" "" "0000727779" "00024158" "30" "-37132" "0" "-37132" "0" "c.-37132G>A" "r.(?)" "p.(=)" "" "0000727779" "00025229" "30" "1330" "0" "1330" "0" "c.1330G>A" "r.(?)" "p.(Gly444Arg)" "" "0000727779" "00024010" "30" "780" "13709" "780" "13709" "c.*42+13709G>A" "r.(=)" "p.(=)" "" "0000727780" "00024158" "30" "-37127" "0" "-37127" "0" "c.-37127G>A" "r.(?)" "p.(=)" "" "0000727780" "00025229" "30" "1335" "0" "1335" "0" "c.1335G>A" "r.(?)" "p.(Ala445=)" "" "0000727780" "00024010" "30" "780" "13714" "780" "13714" "c.*42+13714G>A" "r.(=)" "p.(=)" "" "0000727781" "00024158" "30" "-37119" "0" "-37119" "0" "c.-37119A>C" "r.(?)" "p.(=)" "" "0000727781" "00025229" "30" "1343" "0" "1343" "0" "c.1343A>C" "r.(?)" "p.(Asp448Ala)" "" "0000727781" "00024010" "30" "780" "13722" "780" "13722" "c.*42+13722A>C" "r.(=)" "p.(=)" "" "0000727782" "00024158" "10" "-37068" "0" "-37067" "0" "c.-37068_-37067insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(?)" "p.(=)" "" "0000727782" "00025229" "10" "1394" "0" "1395" "0" "c.1394_1395insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(?)" "p.(Asp466_Ala467insSerGlyAlaAlaArgAspAlaProAlaAspProAsp)" "" "0000727782" "00024010" "10" "780" "13773" "780" "13774" "c.*42+13773_*42+13774insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(=)" "p.(=)" "" "0000727783" "00024158" "30" "-37034" "0" "-37034" "0" "c.-37034C>G" "r.(?)" "p.(=)" "" "0000727783" "00025229" "30" "1428" "0" "1428" "0" "c.1428C>G" "r.(?)" "p.(Ala476=)" "" "0000727783" "00024010" "30" "780" "13807" "780" "13807" "c.*42+13807C>G" "r.(=)" "p.(=)" "" "0000727784" "00024158" "30" "-37033" "0" "-37033" "0" "c.-37033C>T" "r.(?)" "p.(=)" "" "0000727784" "00025229" "30" "1429" "0" "1429" "0" "c.1429C>T" "r.(?)" "p.(Pro477Ser)" "" "0000727784" "00024010" "30" "780" "13808" "780" "13808" "c.*42+13808C>T" "r.(=)" "p.(=)" "" "0000727785" "00024158" "30" "-37022" "0" "-37022" "0" "c.-37022T>A" "r.(?)" "p.(=)" "" "0000727785" "00025229" "30" "1440" "0" "1440" "0" "c.1440T>A" "r.(?)" "p.(Ala480=)" "" "0000727785" "00024010" "30" "780" "13819" "780" "13819" "c.*42+13819T>A" "r.(=)" "p.(=)" "" "0000727786" "00024158" "30" "-37007" "0" "-37007" "0" "c.-37007C>A" "r.(?)" "p.(=)" "" "0000727786" "00025229" "30" "1455" "0" "1455" "0" "c.1455C>A" "r.(?)" "p.(Ala485=)" "" "0000727786" "00024010" "30" "780" "13834" "780" "13834" "c.*42+13834C>A" "r.(=)" "p.(=)" "" "0000727787" "00024158" "50" "-37000" "0" "-36932" "0" "c.-37000_-36932del" "r.(?)" "p.(=)" "" "0000727787" "00025229" "50" "1462" "0" "1530" "0" "c.1462_1530del" "r.(?)" "p.(Ala488_Val510del)" "" "0000727787" "00024010" "50" "780" "13841" "780" "13909" "c.*42+13841_*42+13909del" "r.(=)" "p.(=)" "" "0000727788" "00024158" "30" "-36708" "0" "-36708" "0" "c.-36708C>A" "r.(?)" "p.(=)" "" "0000727788" "00025229" "30" "1754" "0" "1754" "0" "c.1754C>A" "r.(?)" "p.(Thr585Asn)" "" "0000727788" "00024010" "30" "780" "14133" "780" "14133" "c.*42+14133C>A" "r.(=)" "p.(=)" "" "0000727789" "00024158" "30" "-36539" "0" "-36539" "0" "c.-36539G>C" "r.(?)" "p.(=)" "" "0000727789" "00025229" "30" "1923" "0" "1923" "0" "c.1923G>C" "r.(?)" "p.(Leu641=)" "" "0000727789" "00024010" "30" "780" "14302" "780" "14302" "c.*42+14302G>C" "r.(=)" "p.(=)" "" "0000727790" "00024158" "10" "-34" "0" "-5" "0" "c.-34_-5del" "r.(?)" "p.(=)" "" "0000727790" "00025229" "10" "2069" "-3919" "2069" "-3890" "c.2069-3919_2069-3890del" "r.(=)" "p.(=)" "" "0000727790" "00024010" "10" "781" "-3919" "781" "-3890" "c.*43-3919_*43-3890del" "r.(=)" "p.(=)" "" "0000727791" "00024158" "30" "-34" "0" "-2" "0" "c.-34_-2del" "r.(?)" "p.(=)" "" "0000727791" "00025229" "30" "2069" "-3919" "2069" "-3887" "c.2069-3919_2069-3887del" "r.(=)" "p.(=)" "" "0000727791" "00024010" "30" "781" "-3919" "781" "-3887" "c.*43-3919_*43-3887del" "r.(=)" "p.(=)" "" "0000727792" "00024158" "30" "-6" "0" "-1" "0" "c.-6_-1del" "r.(?)" "p.(=)" "" "0000727792" "00025229" "30" "2069" "-3891" "2069" "-3886" "c.2069-3891_2069-3886del" "r.(=)" "p.(=)" "" "0000727792" "00024010" "30" "781" "-3891" "781" "-3886" "c.*43-3891_*43-3886del" "r.(=)" "p.(=)" "" "0000727793" "00024158" "30" "15" "0" "15" "0" "c.15G>A" "r.(?)" "p.(Gly5=)" "" "0000727793" "00025229" "30" "2069" "-3871" "2069" "-3871" "c.2069-3871G>A" "r.(=)" "p.(=)" "" "0000727793" "00024010" "30" "781" "-3871" "781" "-3871" "c.*43-3871G>A" "r.(=)" "p.(=)" "" "0000727794" "00024158" "30" "257" "970" "257" "972" "c.257+970_257+972del" "r.(=)" "p.(=)" "" "0000727794" "00025229" "30" "2186" "970" "2186" "972" "c.2186+970_2186+972del" "r.(=)" "p.(=)" "" "0000727794" "00024010" "30" "898" "970" "898" "972" "c.*160+970_*160+972del" "r.(=)" "p.(=)" "" "0000727795" "00024158" "50" "312" "3" "312" "3" "c.312+3A>G" "r.spl?" "p.?" "" "0000727795" "00025229" "50" "2241" "3" "2241" "3" "c.2241+3A>G" "r.spl?" "p.?" "" "0000727795" "00024010" "50" "956" "3" "956" "3" "c.*218+3A>G" "r.spl?" "p.?" "" "0000727796" "00024158" "30" "312" "17" "312" "17" "c.312+17T>C" "r.(=)" "p.(=)" "" "0000727796" "00025229" "30" "2241" "17" "2241" "17" "c.2241+17T>C" "r.(=)" "p.(=)" "" "0000727796" "00024010" "30" "956" "17" "956" "17" "c.*218+17T>C" "r.(=)" "p.(=)" "" "0000727797" "00024158" "30" "432" "15" "432" "15" "c.432+15G>A" "r.(=)" "p.(=)" "" "0000727797" "00025229" "30" "2361" "15" "2361" "15" "c.2361+15G>A" "r.(=)" "p.(=)" "" "0000727797" "00024010" "30" "1076" "15" "1076" "15" "c.*338+15G>A" "r.(=)" "p.(=)" "" "0000727798" "00024158" "50" "490" "0" "490" "0" "c.490G>A" "r.(?)" "p.(Glu164Lys)" "" "0000727798" "00025229" "50" "2419" "0" "2419" "0" "c.2419G>A" "r.(?)" "p.(Glu807Lys)" "" "0000727798" "00024010" "50" "1134" "0" "1134" "0" "c.*396G>A" "r.(=)" "p.(=)" "" "0000727799" "00024158" "70" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Arg165Cys)" "" "0000727799" "00025229" "70" "2422" "0" "2422" "0" "c.2422C>T" "r.(?)" "p.(Arg808Cys)" "" "0000727799" "00024010" "70" "1137" "0" "1137" "0" "c.*399C>T" "r.(=)" "p.(=)" "" "0000727800" "00024158" "30" "531" "-13" "531" "-10" "c.531-13_531-10del" "r.(=)" "p.(=)" "" "0000727800" "00025229" "30" "2460" "-13" "2460" "-10" "c.2460-13_2460-10del" "r.(=)" "p.(=)" "" "0000727800" "00024010" "30" "1175" "-13" "1175" "-10" "c.*437-13_*437-10del" "r.(=)" "p.(=)" "" "0000727801" "00024158" "50" "659" "0" "659" "0" "c.659A>C" "r.(?)" "p.(His220Pro)" "" "0000727801" "00025229" "50" "2588" "0" "2588" "0" "c.2588A>C" "r.(?)" "p.(His863Pro)" "" "0000727801" "00024010" "50" "1303" "0" "1303" "0" "c.*565A>C" "r.(=)" "p.(=)" "" "0000727802" "00024158" "30" "936" "0" "936" "0" "c.936T>C" "r.(?)" "p.(Phe312=)" "" "0000727802" "00025229" "30" "2865" "0" "2865" "0" "c.2865T>C" "r.(?)" "p.(Phe955=)" "" "0000727802" "00024010" "30" "1580" "0" "1580" "0" "c.*842T>C" "r.(=)" "p.(=)" "" "0000727803" "00024158" "30" "936" "0" "936" "0" "c.936T>C" "r.(?)" "p.(Phe312=)" "" "0000727803" "00025229" "30" "2865" "0" "2865" "0" "c.2865T>C" "r.(?)" "p.(Phe955=)" "" "0000727803" "00024010" "30" "1580" "0" "1580" "0" "c.*842T>C" "r.(=)" "p.(=)" "" "0000727804" "00024158" "50" "976" "0" "976" "0" "c.976C>T" "r.(?)" "p.(Pro326Ser)" "" "0000727804" "00025229" "50" "2905" "0" "2905" "0" "c.2905C>T" "r.(?)" "p.(Pro969Ser)" "" "0000727804" "00024010" "50" "1620" "0" "1620" "0" "c.*882C>T" "r.(=)" "p.(=)" "" "0000727805" "00024158" "50" "1066" "0" "1066" "0" "c.1066C>T" "r.(?)" "p.(Arg356Cys)" "" "0000727805" "00025229" "50" "2995" "0" "2995" "0" "c.2995C>T" "r.(?)" "p.(Arg999Cys)" "" "0000727805" "00024010" "50" "1710" "0" "1710" "0" "c.*972C>T" "r.(=)" "p.(=)" "" "0000727806" "00024158" "70" "1096" "0" "1096" "0" "c.1096G>A" "r.(?)" "p.(Ala366Thr)" "" "0000727806" "00025229" "70" "3025" "0" "3025" "0" "c.3025G>A" "r.(?)" "p.(Ala1009Thr)" "" "0000727806" "00024010" "70" "1740" "0" "1740" "0" "c.*1002G>A" "r.(=)" "p.(=)" "" "0000729962" "00024158" "90" "476" "0" "476" "0" "c.476T>C" "r.(?)" "p.(Val159Ala)" "" "0000729962" "00025229" "90" "2405" "0" "2405" "0" "c.2405T>C" "r.(?)" "p.(Val802Ala)" "" "0000729962" "00024010" "90" "1120" "0" "1120" "0" "c.*382T>C" "r.(=)" "p.(=)" "" "0000759623" "00024158" "90" "518" "0" "521" "0" "c.518_521del" "r.(?)" "p.(Asp173Valfs*11)" "" "0000760708" "00025229" "90" "2361" "1" "2361" "1" "c.2361+1G>C" "r.spl" "p.?" "5" "0000760709" "00025229" "70" "2339" "0" "2340" "0" "c.2339_2340insA" "r.(?)" "p.(Pro781Alafs*2)" "" "0000763243" "00024158" "70" "476" "0" "476" "0" "c.476T>C" "r.(?)" "p.(Val159Ala)" "" "0000763243" "00025229" "70" "2405" "0" "2405" "0" "c.2405T>C" "r.(?)" "p.(Val802Ala)" "" "0000763243" "00024010" "70" "1120" "0" "1120" "0" "c.*382T>C" "r.(=)" "p.(=)" "" "0000809288" "00024158" "30" "-51483" "0" "-51483" "0" "c.-51483C>A" "r.(?)" "p.(=)" "" "0000809288" "00025229" "30" "-13022" "0" "-13022" "0" "c.-13022C>A" "r.(?)" "p.(=)" "" "0000809288" "00024010" "30" "138" "0" "138" "0" "c.138C>A" "r.(?)" "p.(Ala46=)" "" "0000809289" "00024158" "50" "-51223" "0" "-51223" "0" "c.-51223C>T" "r.(?)" "p.(=)" "" "0000809289" "00025229" "50" "-12762" "0" "-12762" "0" "c.-12762C>T" "r.(?)" "p.(=)" "" "0000809289" "00024010" "50" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Pro133Leu)" "" "0000809290" "00024158" "10" "-51180" "0" "-51180" "0" "c.-51180G>A" "r.(?)" "p.(=)" "" "0000809290" "00025229" "10" "-12719" "0" "-12719" "0" "c.-12719G>A" "r.(?)" "p.(=)" "" "0000809290" "00024010" "10" "441" "0" "441" "0" "c.441G>A" "r.(?)" "p.(Pro147=)" "" "0000809291" "00024158" "30" "-50901" "0" "-50901" "0" "c.-50901C>A" "r.(?)" "p.(=)" "" "0000809291" "00025229" "30" "-12440" "0" "-12440" "0" "c.-12440C>A" "r.(?)" "p.(=)" "" "0000809291" "00024010" "30" "720" "0" "720" "0" "c.720C>A" "r.(?)" "p.(Ile240=)" "" "0000809292" "00024158" "30" "-38266" "0" "-38266" "0" "c.-38266G>A" "r.(?)" "p.(=)" "" "0000809292" "00025229" "30" "196" "0" "196" "0" "c.196G>A" "r.(?)" "p.(Glu66Lys)" "" "0000809292" "00024010" "30" "780" "12575" "780" "12575" "c.*42+12575G>A" "r.(=)" "p.(=)" "" "0000809293" "00024158" "10" "-37937" "0" "-37937" "0" "c.-37937T>C" "r.(?)" "p.(=)" "" "0000809293" "00025229" "10" "525" "0" "525" "0" "c.525T>C" "r.(?)" "p.(Ser175=)" "" "0000809293" "00024010" "10" "780" "12904" "780" "12904" "c.*42+12904T>C" "r.(=)" "p.(=)" "" "0000809294" "00024158" "90" "-37732" "0" "-37732" "0" "c.-37732C>T" "r.(?)" "p.(=)" "" "0000809294" "00025229" "90" "730" "0" "730" "0" "c.730C>T" "r.(?)" "p.(Arg244*)" "" "0000809294" "00024010" "90" "780" "13109" "780" "13109" "c.*42+13109C>T" "r.(=)" "p.(=)" "" "0000809295" "00024158" "30" "-37565" "0" "-37565" "0" "c.-37565C>A" "r.(?)" "p.(=)" "" "0000809295" "00025229" "30" "897" "0" "897" "0" "c.897C>A" "r.(?)" "p.(Ser299Arg)" "" "0000809295" "00024010" "30" "780" "13276" "780" "13276" "c.*42+13276C>A" "r.(=)" "p.(=)" "" "0000809296" "00024158" "30" "-37442" "0" "-37442" "0" "c.-37442C>T" "r.(?)" "p.(=)" "" "0000809296" "00025229" "30" "1020" "0" "1020" "0" "c.1020C>T" "r.(?)" "p.(Ser340=)" "" "0000809296" "00024010" "30" "780" "13399" "780" "13399" "c.*42+13399C>T" "r.(=)" "p.(=)" "" "0000809297" "00024158" "30" "-37398" "0" "-37398" "0" "c.-37398A>G" "r.(?)" "p.(=)" "" "0000809297" "00025229" "30" "1064" "0" "1064" "0" "c.1064A>G" "r.(?)" "p.(Glu355Gly)" "" "0000809297" "00024010" "30" "780" "13443" "780" "13443" "c.*42+13443A>G" "r.(=)" "p.(=)" "" "0000809298" "00024158" "30" "-37195" "0" "-37195" "0" "c.-37195G>C" "r.(?)" "p.(=)" "" "0000809298" "00025229" "30" "1267" "0" "1267" "0" "c.1267G>C" "r.(?)" "p.(Gly423Arg)" "" "0000809298" "00024010" "30" "780" "13646" "780" "13646" "c.*42+13646G>C" "r.(=)" "p.(=)" "" "0000809299" "00024158" "30" "-6" "0" "-1" "0" "c.-6_-1dup" "r.(?)" "p.(=)" "" "0000809299" "00025229" "30" "2069" "-3891" "2069" "-3886" "c.2069-3891_2069-3886dup" "r.(=)" "p.(=)" "" "0000809299" "00024010" "30" "781" "-3891" "781" "-3886" "c.*43-3891_*43-3886dup" "r.(=)" "p.(=)" "" "0000809300" "00024158" "10" "87" "0" "87" "0" "c.87G>A" "r.(?)" "p.(Gln29=)" "" "0000809300" "00025229" "10" "2069" "-3799" "2069" "-3799" "c.2069-3799G>A" "r.(=)" "p.(=)" "" "0000809300" "00024010" "10" "781" "-3799" "781" "-3799" "c.*43-3799G>A" "r.(=)" "p.(=)" "" "0000809301" "00024158" "30" "90" "0" "90" "0" "c.90G>A" "r.(?)" "p.(Leu30=)" "" "0000809301" "00025229" "30" "2069" "-3796" "2069" "-3796" "c.2069-3796G>A" "r.(=)" "p.(=)" "" "0000809301" "00024010" "30" "781" "-3796" "781" "-3796" "c.*43-3796G>A" "r.(=)" "p.(=)" "" "0000809302" "00024158" "10" "130" "0" "130" "0" "c.130C>T" "r.(?)" "p.(Leu44=)" "" "0000809302" "00025229" "10" "2069" "-3756" "2069" "-3756" "c.2069-3756C>T" "r.(=)" "p.(=)" "" "0000809302" "00024010" "10" "781" "-3756" "781" "-3756" "c.*43-3756C>T" "r.(=)" "p.(=)" "" "0000809303" "00024158" "30" "213" "-5" "213" "-5" "c.213-5A>G" "r.spl?" "p.?" "" "0000809303" "00025229" "30" "2142" "-5" "2142" "-5" "c.2142-5A>G" "r.spl?" "p.?" "" "0000809303" "00024010" "30" "854" "-5" "854" "-5" "c.*116-5A>G" "r.spl?" "p.?" "" "0000809304" "00024158" "90" "494" "0" "494" "0" "c.494G>A" "r.(?)" "p.(Arg165His)" "" "0000809304" "00025229" "90" "2423" "0" "2423" "0" "c.2423G>A" "r.(?)" "p.(Arg808His)" "" "0000809304" "00024010" "90" "1138" "0" "1138" "0" "c.*400G>A" "r.(=)" "p.(=)" "" "0000809305" "00024158" "30" "530" "10" "530" "10" "c.530+10C>T" "r.(=)" "p.(=)" "" "0000809305" "00025229" "30" "2459" "10" "2459" "10" "c.2459+10C>T" "r.(=)" "p.(=)" "" "0000809305" "00024010" "30" "1174" "10" "1174" "10" "c.*436+10C>T" "r.(=)" "p.(=)" "" "0000809306" "00024158" "10" "531" "-19" "531" "-19" "c.531-19G>A" "r.(=)" "p.(=)" "" "0000809306" "00025229" "10" "2460" "-19" "2460" "-19" "c.2460-19G>A" "r.(=)" "p.(=)" "" "0000809306" "00024010" "10" "1175" "-19" "1175" "-19" "c.*437-19G>A" "r.(=)" "p.(=)" "" "0000809307" "00024158" "90" "602" "0" "602" "0" "c.602G>A" "r.(?)" "p.(Arg201His)" "" "0000809307" "00025229" "90" "2531" "0" "2531" "0" "c.2531G>A" "r.(?)" "p.(Arg844His)" "" "0000809307" "00024010" "90" "1246" "0" "1246" "0" "c.*508G>A" "r.(=)" "p.(=)" "" "0000809308" "00024158" "70" "682" "0" "682" "0" "c.682C>T" "r.(?)" "p.(Arg228Cys)" "" "0000809308" "00025229" "70" "2611" "0" "2611" "0" "c.2611C>T" "r.(?)" "p.(Arg871Cys)" "" "0000809308" "00024010" "70" "1326" "0" "1326" "0" "c.*588C>T" "r.(=)" "p.(=)" "" "0000809309" "00024158" "70" "728" "0" "728" "0" "c.728C>T" "r.(?)" "p.(Ala243Val)" "" "0000809309" "00025229" "70" "2657" "0" "2657" "0" "c.2657C>T" "r.(?)" "p.(Ala886Val)" "" "0000809309" "00024010" "70" "1372" "0" "1372" "0" "c.*634C>T" "r.(=)" "p.(=)" "" "0000809310" "00024158" "30" "840" "-4" "840" "-4" "c.840-4G>A" "r.spl?" "p.?" "" "0000809310" "00025229" "30" "2769" "-4" "2769" "-4" "c.2769-4G>A" "r.spl?" "p.?" "" "0000809310" "00024010" "30" "1484" "-4" "1484" "-4" "c.*746-4G>A" "r.spl?" "p.?" "" "0000809311" "00024158" "10" "951" "0" "951" "0" "c.951C>T" "r.(?)" "p.(Arg317=)" "" "0000809311" "00025229" "10" "2880" "0" "2880" "0" "c.2880C>T" "r.(?)" "p.(Arg960=)" "" "0000809311" "00024010" "10" "1595" "0" "1595" "0" "c.*857C>T" "r.(=)" "p.(=)" "" "0000809312" "00024158" "10" "1038" "8" "1038" "8" "c.1038+8G>C" "r.(=)" "p.(=)" "" "0000809312" "00025229" "10" "2967" "8" "2967" "8" "c.2967+8G>C" "r.(=)" "p.(=)" "" "0000809312" "00024010" "10" "1682" "8" "1682" "8" "c.*944+8G>C" "r.(=)" "p.(=)" "" "0000842558" "00024158" "90" "139" "0" "139" "0" "c.139G>T" "r.(?)" "p.(Gly47Cys)" "" "0000842559" "00024158" "90" "108" "0" "108" "0" "c.108C>A" "r.(?)" "p.(Val36=)" "" "0000842560" "00024158" "10" "1113" "0" "1113" "0" "c.1113C>T" "r.(?)" "p.(Asn371=)" "" "0000842561" "00024158" "10" "1113" "0" "1113" "0" "c.1113C>T" "r.(?)" "p.(Asn371=)" "" "0000855881" "00024158" "50" "-51493" "0" "-51493" "0" "c.-51493G>A" "r.(?)" "p.(=)" "" "0000855881" "00025229" "50" "-13032" "0" "-13032" "0" "c.-13032G>A" "r.(?)" "p.(=)" "" "0000855881" "00024010" "50" "128" "0" "128" "0" "c.128G>A" "r.(?)" "p.(Arg43His)" "" "0000855882" "00024158" "50" "-51137" "0" "-51137" "0" "c.-51137C>A" "r.(?)" "p.(=)" "" "0000855882" "00025229" "50" "-12676" "0" "-12676" "0" "c.-12676C>A" "r.(?)" "p.(=)" "" "0000855882" "00024010" "50" "484" "0" "484" "0" "c.484C>A" "r.(?)" "p.(Arg162Ser)" "" "0000855883" "00024158" "50" "-38308" "0" "-38308" "0" "c.-38308G>A" "r.(?)" "p.(=)" "" "0000855883" "00025229" "50" "154" "0" "154" "0" "c.154G>A" "r.(?)" "p.(Glu52Lys)" "" "0000855883" "00024010" "50" "780" "12533" "780" "12533" "c.*42+12533G>A" "r.(=)" "p.(=)" "" "0000855884" "00024158" "30" "-38002" "0" "-38002" "0" "c.-38002T>C" "r.(?)" "p.(=)" "" "0000855884" "00025229" "30" "460" "0" "460" "0" "c.460T>C" "r.(?)" "p.(Tyr154His)" "" "0000855884" "00024010" "30" "780" "12839" "780" "12839" "c.*42+12839T>C" "r.(=)" "p.(=)" "" "0000855885" "00024158" "30" "-37801" "0" "-37801" "0" "c.-37801G>A" "r.(?)" "p.(=)" "" "0000855885" "00025229" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Glu221Lys)" "" "0000855885" "00024010" "30" "780" "13040" "780" "13040" "c.*42+13040G>A" "r.(=)" "p.(=)" "" "0000855886" "00024158" "30" "-37476" "0" "-37476" "0" "c.-37476C>G" "r.(?)" "p.(=)" "" "0000855886" "00025229" "30" "986" "0" "986" "0" "c.986C>G" "r.(?)" "p.(Pro329Arg)" "" "0000855886" "00024010" "30" "780" "13365" "780" "13365" "c.*42+13365C>G" "r.(=)" "p.(=)" "" "0000855887" "00024158" "30" "-37298" "0" "-37298" "0" "c.-37298G>A" "r.(?)" "p.(=)" "" "0000855887" "00025229" "30" "1164" "0" "1164" "0" "c.1164G>A" "r.(?)" "p.(Ala388=)" "" "0000855887" "00024010" "30" "780" "13543" "780" "13543" "c.*42+13543G>A" "r.(=)" "p.(=)" "" "0000855888" "00024158" "10" "-37229" "0" "-37203" "0" "c.-37229_-37203del" "r.(?)" "p.(=)" "" "0000855888" "00025229" "10" "1233" "0" "1259" "0" "c.1233_1259del" "r.(?)" "p.(Thr415_Gly423del)" "" "0000855888" "00024010" "10" "780" "13612" "780" "13638" "c.*42+13612_*42+13638del" "r.(=)" "p.(=)" "" "0000855889" "00024158" "30" "-37068" "0" "-37067" "0" "c.-37068_-37067insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(?)" "p.(=)" "" "0000855889" "00025229" "30" "1394" "0" "1395" "0" "c.1394_1395insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(?)" "p.(Asp466_Ala467insSerGlyAlaAlaArgAspAlaProAlaAspProAsp)" "" "0000855889" "00024010" "30" "780" "13773" "780" "13774" "c.*42+13773_*42+13774insCGACTCCGGGGCGGCCCGTGACGCCCCAGCCGATCC" "r.(=)" "p.(=)" "" "0000855890" "00024158" "30" "-3" "0" "-1" "0" "c.-3_-1dup" "r.(?)" "p.(=)" "" "0000855890" "00025229" "30" "2069" "-3888" "2069" "-3886" "c.2069-3888_2069-3886dup" "r.(=)" "p.(=)" "" "0000855890" "00024010" "30" "781" "-3888" "781" "-3886" "c.*43-3888_*43-3886dup" "r.(=)" "p.(=)" "" "0000855891" "00024158" "10" "576" "0" "576" "0" "c.576G>T" "r.(?)" "p.(Pro192=)" "" "0000855891" "00025229" "10" "2505" "0" "2505" "0" "c.2505G>T" "r.(?)" "p.(Pro835=)" "" "0000855891" "00024010" "10" "1220" "0" "1220" "0" "c.*482G>T" "r.(=)" "p.(=)" "" "0000855892" "00024158" "30" "576" "0" "576" "0" "c.576G>T" "r.(?)" "p.(Pro192=)" "" "0000855892" "00025229" "30" "2505" "0" "2505" "0" "c.2505G>T" "r.(?)" "p.(Pro835=)" "" "0000855892" "00024010" "30" "1220" "0" "1220" "0" "c.*482G>T" "r.(=)" "p.(=)" "" "0000866535" "00024158" "30" "-51246" "0" "-51246" "0" "c.-51246C>G" "r.(?)" "p.(=)" "" "0000866535" "00025229" "30" "-12785" "0" "-12785" "0" "c.-12785C>G" "r.(?)" "p.(=)" "" "0000866535" "00024010" "30" "375" "0" "375" "0" "c.375C>G" "r.(?)" "p.(Phe125Leu)" "" "0000866536" "00024158" "30" "-51180" "0" "-51180" "0" "c.-51180G>A" "r.(?)" "p.(=)" "" "0000866536" "00025229" "30" "-12719" "0" "-12719" "0" "c.-12719G>A" "r.(?)" "p.(=)" "" "0000866536" "00024010" "30" "441" "0" "441" "0" "c.441G>A" "r.(?)" "p.(Pro147=)" "" "0000866537" "00024158" "30" "-51107" "0" "-51107" "0" "c.-51107G>A" "r.(?)" "p.(=)" "" "0000866537" "00025229" "30" "-12646" "0" "-12646" "0" "c.-12646G>A" "r.(?)" "p.(=)" "" "0000866537" "00024010" "30" "514" "0" "514" "0" "c.514G>A" "r.(?)" "p.(Asp172Asn)" "" "0000866538" "00024158" "30" "-51090" "0" "-51090" "0" "c.-51090C>A" "r.(?)" "p.(=)" "" "0000866538" "00025229" "30" "-12629" "0" "-12629" "0" "c.-12629C>A" "r.(?)" "p.(=)" "" "0000866538" "00024010" "30" "531" "0" "531" "0" "c.531C>A" "r.(?)" "p.(Arg177=)" "" "0000866539" "00024158" "30" "-37834" "0" "-37834" "0" "c.-37834G>T" "r.(?)" "p.(=)" "" "0000866539" "00025229" "30" "628" "0" "628" "0" "c.628G>T" "r.(?)" "p.(Ala210Ser)" "" "0000866539" "00024010" "30" "780" "13007" "780" "13007" "c.*42+13007G>T" "r.(=)" "p.(=)" "" "0000866540" "00024158" "50" "-37646" "0" "-37646" "0" "c.-37646G>A" "r.(?)" "p.(=)" "" "0000866540" "00025229" "50" "816" "0" "816" "0" "c.816G>A" "r.(?)" "p.(Ala272=)" "" "0000866540" "00024010" "50" "780" "13195" "780" "13195" "c.*42+13195G>A" "r.(=)" "p.(=)" "" "0000866541" "00024158" "50" "-37641" "0" "-37641" "0" "c.-37641C>T" "r.(?)" "p.(=)" "" "0000866541" "00025229" "50" "821" "0" "821" "0" "c.821C>T" "r.(?)" "p.(Pro274Leu)" "" "0000866541" "00024010" "50" "780" "13200" "780" "13200" "c.*42+13200C>T" "r.(=)" "p.(=)" "" "0000866542" "00024158" "50" "-37549" "0" "-37549" "0" "c.-37549T>C" "r.(?)" "p.(=)" "" "0000866542" "00025229" "50" "913" "0" "913" "0" "c.913T>C" "r.(?)" "p.(Ser305Pro)" "" "0000866542" "00024010" "50" "780" "13292" "780" "13292" "c.*42+13292T>C" "r.(=)" "p.(=)" "" "0000866543" "00024158" "30" "-37461" "0" "-37461" "0" "c.-37461G>A" "r.(?)" "p.(=)" "" "0000866543" "00025229" "30" "1001" "0" "1001" "0" "c.1001G>A" "r.(?)" "p.(Gly334Asp)" "" "0000866543" "00024010" "30" "780" "13380" "780" "13380" "c.*42+13380G>A" "r.(=)" "p.(=)" "" "0000866544" "00024158" "30" "-37178" "0" "-37178" "0" "c.-37178T>G" "r.(?)" "p.(=)" "" "0000866544" "00025229" "30" "1284" "0" "1284" "0" "c.1284T>G" "r.(?)" "p.(Asp428Glu)" "" "0000866544" "00024010" "30" "780" "13663" "780" "13663" "c.*42+13663T>G" "r.(=)" "p.(=)" "" "0000866545" "00024158" "50" "-36782" "0" "-36782" "0" "c.-36782C>A" "r.(?)" "p.(=)" "" "0000866545" "00025229" "50" "1680" "0" "1680" "0" "c.1680C>A" "r.(?)" "p.(Gly560=)" "" "0000866545" "00024010" "50" "780" "14059" "780" "14059" "c.*42+14059C>A" "r.(=)" "p.(=)" "" "0000866546" "00024158" "30" "-36665" "0" "-36665" "0" "c.-36665C>T" "r.(?)" "p.(=)" "" "0000866546" "00025229" "30" "1797" "0" "1797" "0" "c.1797C>T" "r.(?)" "p.(Arg599=)" "" "0000866546" "00024010" "30" "780" "14176" "780" "14176" "c.*42+14176C>T" "r.(=)" "p.(=)" "" "0000866547" "00024158" "50" "97" "0" "97" "0" "c.97G>A" "r.(?)" "p.(Asp33Asn)" "" "0000866547" "00025229" "50" "2069" "-3789" "2069" "-3789" "c.2069-3789G>A" "r.(=)" "p.(=)" "" "0000866547" "00024010" "50" "781" "-3789" "781" "-3789" "c.*43-3789G>A" "r.(=)" "p.(=)" "" "0000866548" "00024158" "90" "691" "0" "691" "0" "c.691C>T" "r.(?)" "p.(Arg231Cys)" "" "0000866548" "00025229" "90" "2620" "0" "2620" "0" "c.2620C>T" "r.(?)" "p.(Arg874Cys)" "" "0000866548" "00024010" "90" "1335" "0" "1335" "0" "c.*597C>T" "r.(=)" "p.(=)" "" "0000866549" "00024158" "50" "719" "0" "719" "0" "c.719A>G" "r.(?)" "p.(Asp240Gly)" "" "0000866549" "00025229" "50" "2648" "0" "2648" "0" "c.2648A>G" "r.(?)" "p.(Asp883Gly)" "" "0000866549" "00024010" "50" "1363" "0" "1363" "0" "c.*625A>G" "r.(=)" "p.(=)" "" "0000867674" "00024158" "70" "388" "0" "388" "0" "c.388T>C" "r.(?)" "p.(Tyr130His)" "" "0000881240" "00024158" "99" "493" "0" "493" "0" "c.493C>T" "r.(?)" "p.(Arg165Cys)" "" "0000881282" "00024158" "70" "364" "0" "364" "0" "c.364C>G" "r.(?)" "p.(Pro122Ala)" "" "0000881282" "00025229" "70" "2293" "0" "2293" "0" "c.2293C>G" "r.(?)" "p.(Pro765Ala)" "" "0000881282" "00024010" "70" "1008" "0" "1008" "0" "c.*270C>G" "r.(=)" "p.(=)" "" "0000895383" "00024158" "50" "-37472" "0" "-37472" "0" "c.-37472C>A" "r.(?)" "p.(=)" "" "0000895383" "00025229" "50" "990" "0" "990" "0" "c.990C>A" "r.(?)" "p.(Ile330=)" "" "0000895383" "00024010" "50" "780" "13369" "780" "13369" "c.*42+13369C>A" "r.(=)" "p.(=)" "" "0000895384" "00024158" "30" "-37163" "0" "-37128" "0" "c.-37163_-37128del" "r.(?)" "p.(=)" "" "0000895384" "00025229" "30" "1299" "0" "1334" "0" "c.1299_1334del" "r.(?)" "p.(Ala436_Pro447del)" "" "0000895384" "00024010" "30" "780" "13678" "780" "13713" "c.*42+13678_*42+13713del" "r.(=)" "p.(=)" "" "0000895385" "00024158" "30" "-37086" "0" "-37086" "0" "c.-37086C>G" "r.(?)" "p.(=)" "" "0000895385" "00025229" "30" "1376" "0" "1376" "0" "c.1376C>G" "r.(?)" "p.(Pro459Arg)" "" "0000895385" "00024010" "30" "780" "13755" "780" "13755" "c.*42+13755C>G" "r.(=)" "p.(=)" "" "0000895386" "00024158" "30" "-37007" "0" "-37007" "0" "c.-37007C>A" "r.(?)" "p.(=)" "" "0000895386" "00025229" "30" "1455" "0" "1455" "0" "c.1455C>A" "r.(?)" "p.(Ala485=)" "" "0000895386" "00024010" "30" "780" "13834" "780" "13834" "c.*42+13834C>A" "r.(=)" "p.(=)" "" "0000895387" "00024158" "30" "-36195" "0" "-36195" "0" "c.-36195G>C" "r.(?)" "p.(=)" "" "0000895387" "00025229" "30" "2068" "199" "2068" "199" "c.2068+199G>C" "r.(=)" "p.(=)" "" "0000895387" "00024010" "30" "780" "14646" "780" "14646" "c.*42+14646G>C" "r.(=)" "p.(=)" "" "0000895388" "00024158" "30" "312" "17" "312" "17" "c.312+17T>C" "r.(=)" "p.(=)" "" "0000895388" "00025229" "30" "2241" "17" "2241" "17" "c.2241+17T>C" "r.(=)" "p.(=)" "" "0000895388" "00024010" "30" "956" "17" "956" "17" "c.*218+17T>C" "r.(=)" "p.(=)" "" "0000895389" "00024158" "70" "760" "0" "760" "0" "c.760A>T" "r.(?)" "p.(Asn254Tyr)" "" "0000895389" "00025229" "70" "2689" "0" "2689" "0" "c.2689A>T" "r.(?)" "p.(Asn897Tyr)" "" "0000895389" "00024010" "70" "1404" "0" "1404" "0" "c.*666A>T" "r.(=)" "p.(=)" "" "0000895390" "00024158" "50" "1138" "0" "1138" "0" "c.1138C>T" "r.(?)" "p.(Arg380Cys)" "" "0000895390" "00025229" "50" "3067" "0" "3067" "0" "c.3067C>T" "r.(?)" "p.(Arg1023Cys)" "" "0000895390" "00024010" "50" "1782" "0" "1782" "0" "c.*1044C>T" "r.(=)" "p.(=)" "" "0000902941" "00024158" "70" "136" "0" "138" "0" "c.136_138dup" "r.(?)" "p.(Leu46dup)" "" "0000902969" "00024158" "90" "136" "0" "138" "0" "c.136_138dup" "r.(?)" "p.(Leu46dup)" "" "0000915409" "00024158" "30" "-38266" "0" "-38266" "0" "c.-38266G>A" "r.(?)" "p.(=)" "" "0000915409" "00025229" "30" "196" "0" "196" "0" "c.196G>A" "r.(?)" "p.(Glu66Lys)" "" "0000915409" "00024010" "30" "780" "12575" "780" "12575" "c.*42+12575G>A" "r.(=)" "p.(=)" "" "0000915410" "00024158" "30" "96" "0" "96" "0" "c.96G>A" "r.(?)" "p.(Lys32=)" "" "0000915410" "00025229" "30" "2069" "-3790" "2069" "-3790" "c.2069-3790G>A" "r.(=)" "p.(=)" "" "0000915410" "00024010" "30" "781" "-3790" "781" "-3790" "c.*43-3790G>A" "r.(=)" "p.(=)" "" "0000915411" "00024158" "10" "432" "0" "432" "0" "c.432C>T" "r.(?)" "p.(Pro144=)" "" "0000915411" "00025229" "10" "2361" "0" "2361" "0" "c.2361C>T" "r.(?)" "p.(Pro787=)" "" "0000915411" "00024010" "10" "1076" "0" "1076" "0" "c.*338C>T" "r.(=)" "p.(=)" "" "0000915412" "00024158" "30" "1161" "0" "1161" "0" "c.1161C>T" "r.(?)" "p.(His387=)" "" "0000915412" "00025229" "30" "3090" "0" "3090" "0" "c.3090C>T" "r.(?)" "p.(His1030=)" "" "0000915412" "00024010" "30" "1805" "0" "1805" "0" "c.*1067C>T" "r.(=)" "p.(=)" "" "0000927026" "00024158" "30" "-51588" "0" "-51588" "0" "c.-51588C>T" "r.(?)" "p.(=)" "" "0000927026" "00025229" "30" "-13127" "0" "-13127" "0" "c.-13127C>T" "r.(?)" "p.(=)" "" "0000927026" "00024010" "30" "33" "0" "33" "0" "c.33C>T" "r.(?)" "p.(Arg11=)" "" "0000927027" "00024158" "30" "-51223" "0" "-51223" "0" "c.-51223C>T" "r.(?)" "p.(=)" "" "0000927027" "00025229" "30" "-12762" "0" "-12762" "0" "c.-12762C>T" "r.(?)" "p.(=)" "" "0000927027" "00024010" "30" "398" "0" "398" "0" "c.398C>T" "r.(?)" "p.(Pro133Leu)" "" "0000927028" "00024158" "30" "-51092" "0" "-51092" "0" "c.-51092C>T" "r.(?)" "p.(=)" "" "0000927028" "00025229" "30" "-12631" "0" "-12631" "0" "c.-12631C>T" "r.(?)" "p.(=)" "" "0000927028" "00024010" "30" "529" "0" "529" "0" "c.529C>T" "r.(?)" "p.(Arg177Cys)" "" "0000927029" "00024158" "10" "-50906" "0" "-50906" "0" "c.-50906C>A" "r.(?)" "p.(=)" "" "0000927029" "00025229" "10" "-12445" "0" "-12445" "0" "c.-12445C>A" "r.(?)" "p.(=)" "" "0000927029" "00024010" "10" "715" "0" "715" "0" "c.715C>A" "r.(?)" "p.(Pro239Thr)" "" "0000927030" "00024158" "30" "-37262" "0" "-37262" "0" "c.-37262C>A" "r.(?)" "p.(=)" "" "0000927030" "00025229" "30" "1200" "0" "1200" "0" "c.1200C>A" "r.(?)" "p.(Ala400=)" "" "0000927030" "00024010" "30" "780" "13579" "780" "13579" "c.*42+13579C>A" "r.(=)" "p.(=)" "" "0000927031" "00024158" "30" "-36665" "0" "-36665" "0" "c.-36665C>T" "r.(?)" "p.(=)" "" "0000927031" "00025229" "30" "1797" "0" "1797" "0" "c.1797C>T" "r.(?)" "p.(Arg599=)" "" "0000927031" "00024010" "30" "780" "14176" "780" "14176" "c.*42+14176C>T" "r.(=)" "p.(=)" "" "0000927032" "00024158" "30" "201" "0" "201" "0" "c.201G>A" "r.(?)" "p.(Gly67=)" "" "0000927032" "00025229" "30" "2130" "0" "2130" "0" "c.2130G>A" "r.(?)" "p.(Gly710=)" "" "0000927032" "00024010" "30" "842" "0" "842" "0" "c.*104G>A" "r.(=)" "p.(=)" "" "0000927033" "00024158" "30" "1131" "0" "1131" "0" "c.1131C>T" "r.(?)" "p.(Asn377=)" "" "0000927033" "00025229" "30" "3060" "0" "3060" "0" "c.3060C>T" "r.(?)" "p.(Asn1020=)" "" "0000927033" "00024010" "30" "1775" "0" "1775" "0" "c.*1037C>T" "r.(=)" "p.(=)" "" "0000931189" "00024158" "50" "-37910" "0" "-37910" "0" "c.-37910T>C" "r.(?)" "p.(=)" "" "0000931189" "00025229" "50" "552" "0" "552" "0" "c.552T>C" "r.(?)" "p.(=)" "" "0000931189" "00024010" "50" "780" "12931" "780" "12931" "c.*42+12931T>C" "r.(=)" "p.(=)" "" "0000931190" "00024158" "30" "432" "10" "432" "10" "c.432+10A>T" "r.(=)" "p.(=)" "" "0000931190" "00025229" "30" "2361" "10" "2361" "10" "c.2361+10A>T" "r.(=)" "p.(=)" "" "0000931190" "00024010" "30" "1076" "10" "1076" "10" "c.*338+10A>T" "r.(=)" "p.(=)" "" "0000951452" "00024158" "50" "-51362" "0" "-51362" "0" "c.-51362G>A" "r.(?)" "p.(=)" "" "0000951452" "00025229" "50" "-12901" "0" "-12901" "0" "c.-12901G>A" "r.(?)" "p.(=)" "" "0000951452" "00024010" "50" "259" "0" "259" "0" "c.259G>A" "r.(?)" "p.(Glu87Lys)" "" "0000951453" "00024158" "30" "-50901" "0" "-50901" "0" "c.-50901C>A" "r.(?)" "p.(=)" "" "0000951453" "00025229" "30" "-12440" "0" "-12440" "0" "c.-12440C>A" "r.(?)" "p.(=)" "" "0000951453" "00024010" "30" "720" "0" "720" "0" "c.720C>A" "r.(?)" "p.(Ile240=)" "" "0000951454" "00024158" "30" "-37608" "0" "-37608" "0" "c.-37608C>T" "r.(?)" "p.(=)" "" "0000951454" "00025229" "30" "854" "0" "854" "0" "c.854C>T" "r.(?)" "p.(Ser285Phe)" "" "0000951454" "00024010" "30" "780" "13233" "780" "13233" "c.*42+13233C>T" "r.(=)" "p.(=)" "" "0000951455" "00024158" "30" "-9" "0" "-1" "0" "c.-9_-1dup" "r.(?)" "p.(=)" "" "0000951455" "00025229" "30" "2069" "-3894" "2069" "-3886" "c.2069-3894_2069-3886dup" "r.(=)" "p.(=)" "" "0000951455" "00024010" "30" "781" "-3894" "781" "-3886" "c.*43-3894_*43-3886dup" "r.(=)" "p.(=)" "" "0000951456" "00024158" "30" "432" "17" "432" "17" "c.432+17C>A" "r.(=)" "p.(=)" "" "0000951456" "00025229" "30" "2361" "17" "2361" "17" "c.2361+17C>A" "r.(=)" "p.(=)" "" "0000951456" "00024010" "30" "1076" "17" "1076" "17" "c.*338+17C>A" "r.(=)" "p.(=)" "" "0000951457" "00024158" "50" "793" "0" "793" "0" "c.793C>T" "r.(?)" "p.(Arg265Cys)" "" "0000951457" "00025229" "50" "2722" "0" "2722" "0" "c.2722C>T" "r.(?)" "p.(Arg908Cys)" "" "0000951457" "00024010" "50" "1437" "0" "1437" "0" "c.*699C>T" "r.(=)" "p.(=)" "" "0000951458" "00024158" "30" "1179" "0" "1179" "0" "c.1179G>T" "r.(?)" "p.(Leu393=)" "" "0000951458" "00025229" "30" "3108" "0" "3108" "0" "c.3108G>T" "r.(?)" "p.(Leu1036=)" "" "0000951458" "00024010" "30" "1823" "0" "1823" "0" "c.*1085G>T" "r.(=)" "p.(=)" "" "0000970200" "00024158" "30" "-36938" "0" "-36938" "0" "c.-36938C>T" "r.(?)" "p.(=)" "" "0000970200" "00025229" "30" "1524" "0" "1524" "0" "c.1524C>T" "r.(?)" "p.(Ala508=)" "" "0000970200" "00024010" "30" "780" "13903" "780" "13903" "c.*42+13903C>T" "r.(=)" "p.(=)" "" "0000970202" "00024158" "30" "212" "10" "212" "10" "c.212+10A>T" "r.(=)" "p.(=)" "" "0000970202" "00025229" "30" "2141" "10" "2141" "10" "c.2141+10A>T" "r.(=)" "p.(=)" "" "0000970202" "00024010" "30" "853" "10" "853" "10" "c.*115+10A>T" "r.(=)" "p.(=)" "" "0000983859" "00024158" "50" "-51203" "0" "-51203" "0" "c.-51203G>C" "r.(?)" "p.(=)" "" "0000983859" "00025229" "50" "-12742" "0" "-12742" "0" "c.-12742G>C" "r.(?)" "p.(=)" "" "0000983859" "00024010" "50" "418" "0" "418" "0" "c.418G>C" "r.(?)" "p.(Glu140Gln)" "" "0000983860" "00024158" "50" "-38466" "0" "-38466" "0" "c.-38466G>A" "r.(?)" "p.(=)" "" "0000983860" "00025229" "50" "-5" "0" "-5" "0" "c.-5G>A" "r.(?)" "p.(=)" "" "0000983860" "00024010" "50" "780" "12375" "780" "12375" "c.*42+12375G>A" "r.(=)" "p.(=)" "" "0000983861" "00024158" "50" "-37953" "0" "-37953" "0" "c.-37953C>T" "r.(?)" "p.(=)" "" "0000983861" "00025229" "50" "509" "0" "509" "0" "c.509C>T" "r.(?)" "p.(Ala170Val)" "" "0000983861" "00024010" "50" "780" "12888" "780" "12888" "c.*42+12888C>T" "r.(=)" "p.(=)" "" "0000983862" "00024158" "30" "-37815" "0" "-37815" "0" "c.-37815A>G" "r.(?)" "p.(=)" "" "0000983862" "00025229" "30" "647" "0" "647" "0" "c.647A>G" "r.(?)" "p.(Tyr216Cys)" "" "0000983862" "00024010" "30" "780" "13026" "780" "13026" "c.*42+13026A>G" "r.(=)" "p.(=)" "" "0000983863" "00024158" "30" "-37805" "0" "-37805" "0" "c.-37805C>T" "r.(?)" "p.(=)" "" "0000983863" "00025229" "30" "657" "0" "657" "0" "c.657C>T" "r.(?)" "p.(=)" "" "0000983863" "00024010" "30" "780" "13036" "780" "13036" "c.*42+13036C>T" "r.(=)" "p.(=)" "" "0000983864" "00024158" "50" "-36678" "0" "-36678" "0" "c.-36678G>A" "r.(?)" "p.(=)" "" "0000983864" "00025229" "50" "1784" "0" "1784" "0" "c.1784G>A" "r.(?)" "p.(Arg595Gln)" "" "0000983864" "00024010" "50" "780" "14163" "780" "14163" "c.*42+14163G>A" "r.(=)" "p.(=)" "" "0000983865" "00024158" "30" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000983865" "00025229" "30" "2069" "-3877" "2069" "-3877" "c.2069-3877C>T" "r.(=)" "p.(=)" "" "0000983865" "00024010" "30" "781" "-3877" "781" "-3877" "c.*43-3877C>T" "r.(=)" "p.(=)" "" "0000983866" "00024158" "30" "738" "0" "738" "0" "c.738C>T" "r.(?)" "p.(=)" "" "0000983866" "00025229" "30" "2667" "0" "2667" "0" "c.2667C>T" "r.(?)" "p.(=)" "" "0000983866" "00024010" "30" "1382" "0" "1382" "0" "c.*644C>T" "r.(=)" "p.(=)" "" "0001005486" "00024158" "50" "-51263" "0" "-51263" "0" "c.-51263G>A" "r.(?)" "p.(=)" "" "0001005486" "00025229" "50" "-12802" "0" "-12802" "0" "c.-12802G>A" "r.(?)" "p.(=)" "" "0001005486" "00024010" "50" "358" "0" "358" "0" "c.358G>A" "r.(?)" "p.(Glu120Lys)" "" "0001005487" "00024158" "50" "-51033" "0" "-51033" "0" "c.-51033del" "r.(?)" "p.(=)" "" "0001005487" "00025229" "50" "-12572" "0" "-12572" "0" "c.-12572del" "r.(?)" "p.(=)" "" "0001005487" "00024010" "50" "588" "0" "588" "0" "c.588del" "r.(?)" "p.(Glu197Argfs*70)" "" "0001005488" "00024158" "30" "-51028" "0" "-51028" "0" "c.-51028A>G" "r.(?)" "p.(=)" "" "0001005488" "00025229" "30" "-12567" "0" "-12567" "0" "c.-12567A>G" "r.(?)" "p.(=)" "" "0001005488" "00024010" "30" "593" "0" "593" "0" "c.593A>G" "r.(?)" "p.(Asp198Gly)" "" "0001005489" "00024158" "30" "-38028" "0" "-38028" "0" "c.-38028G>A" "r.(?)" "p.(=)" "" "0001005489" "00025229" "30" "434" "0" "434" "0" "c.434G>A" "r.(?)" "p.(Ser145Asn)" "" "0001005489" "00024010" "30" "780" "12813" "780" "12813" "c.*42+12813G>A" "r.(=)" "p.(=)" "" "0001005490" "00024158" "50" "-37530" "0" "-37530" "0" "c.-37530T>C" "r.(?)" "p.(=)" "" "0001005490" "00025229" "50" "932" "0" "932" "0" "c.932T>C" "r.(?)" "p.(Ile311Thr)" "" "0001005490" "00024010" "50" "780" "13311" "780" "13311" "c.*42+13311T>C" "r.(=)" "p.(=)" "" "0001005491" "00024158" "30" "-36814" "0" "-36814" "0" "c.-36814G>A" "r.(?)" "p.(=)" "" "0001005491" "00025229" "30" "1648" "0" "1648" "0" "c.1648G>A" "r.(?)" "p.(Ala550Thr)" "" "0001005491" "00024010" "30" "780" "14027" "780" "14027" "c.*42+14027G>A" "r.(=)" "p.(=)" "" "0001005492" "00024158" "30" "-6" "0" "-1" "0" "c.-6_-1del" "r.(?)" "p.(=)" "" "0001005492" "00025229" "30" "2069" "-3891" "2069" "-3886" "c.2069-3891_2069-3886del" "r.(=)" "p.(=)" "" "0001005492" "00024010" "30" "781" "-3891" "781" "-3886" "c.*43-3891_*43-3886del" "r.(=)" "p.(=)" "" "0001005493" "00024158" "30" "30" "0" "30" "0" "c.30G>C" "r.(?)" "p.(Glu10Asp)" "" "0001005493" "00025229" "30" "2069" "-3856" "2069" "-3856" "c.2069-3856G>C" "r.(=)" "p.(=)" "" "0001005493" "00024010" "30" "781" "-3856" "781" "-3856" "c.*43-3856G>C" "r.(=)" "p.(=)" "" "0001005494" "00024158" "50" "138" "0" "138" "0" "c.138G>A" "r.(?)" "p.(=)" "" "0001005494" "00025229" "50" "2069" "-3748" "2069" "-3748" "c.2069-3748G>A" "r.(=)" "p.(=)" "" "0001005494" "00024010" "50" "781" "-3748" "781" "-3748" "c.*43-3748G>A" "r.(=)" "p.(=)" "" "0001005495" "00024158" "30" "530" "11" "530" "11" "c.530+11G>A" "r.(=)" "p.(=)" "" "0001005495" "00025229" "30" "2459" "11" "2459" "11" "c.2459+11G>A" "r.(=)" "p.(=)" "" "0001005495" "00024010" "30" "1174" "11" "1174" "11" "c.*436+11G>A" "r.(=)" "p.(=)" "" "0001005496" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "" "0001005496" "00025229" "90" "2494" "0" "2497" "0" "c.2494_2497del" "r.(?)" "p.(Asp832Metfs*14)" "" "0001005496" "00024010" "90" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0001005497" "00024158" "70" "682" "0" "682" "0" "c.682C>T" "r.(?)" "p.(Arg228Cys)" "" "0001005497" "00025229" "70" "2611" "0" "2611" "0" "c.2611C>T" "r.(?)" "p.(Arg871Cys)" "" "0001005497" "00024010" "70" "1326" "0" "1326" "0" "c.*588C>T" "r.(=)" "p.(=)" "" "0001005498" "00024158" "50" "695" "0" "695" "0" "c.695G>A" "r.(?)" "p.(Arg232His)" "" "0001005498" "00025229" "50" "2624" "0" "2624" "0" "c.2624G>A" "r.(?)" "p.(Arg875His)" "" "0001005498" "00024010" "50" "1339" "0" "1339" "0" "c.*601G>A" "r.(=)" "p.(=)" "" "0001005499" "00024158" "70" "1121" "0" "1121" "0" "c.1121G>A" "r.(?)" "p.(Arg374His)" "" "0001005499" "00025229" "70" "3050" "0" "3050" "0" "c.3050G>A" "r.(?)" "p.(Arg1017His)" "" "0001005499" "00024010" "70" "1765" "0" "1765" "0" "c.*1027G>A" "r.(=)" "p.(=)" "" "0001015874" "00024158" "30" "-38304" "0" "-38304" "0" "c.-38304C>G" "r.(?)" "p.(=)" "" "0001015874" "00025229" "30" "158" "0" "158" "0" "c.158C>G" "r.(?)" "p.(Pro53Arg)" "" "0001015874" "00024010" "30" "780" "12537" "780" "12537" "c.*42+12537C>G" "r.(=)" "p.(=)" "" "0001015875" "00024158" "50" "-37924" "0" "-37924" "0" "c.-37924C>T" "r.(?)" "p.(=)" "" "0001015875" "00025229" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Gln180Ter)" "" "0001015875" "00024010" "50" "780" "12917" "780" "12917" "c.*42+12917C>T" "r.(=)" "p.(=)" "" "0001015876" "00024158" "50" "-36873" "0" "-36873" "0" "c.-36873C>G" "r.(?)" "p.(=)" "" "0001015876" "00025229" "50" "1589" "0" "1589" "0" "c.1589C>G" "r.(?)" "p.(Pro530Arg)" "" "0001015876" "00024010" "50" "780" "13968" "780" "13968" "c.*42+13968C>G" "r.(=)" "p.(=)" "" "0001015877" "00024158" "90" "565" "0" "568" "0" "c.565_568del" "r.(?)" "p.(Asp189Metfs*14)" "" "0001015877" "00025229" "90" "2494" "0" "2497" "0" "c.2494_2497del" "r.(?)" "p.(Asp832Metfs*14)" "" "0001015877" "00024010" "90" "1209" "0" "1212" "0" "c.*471_*474del" "r.(=)" "p.(=)" "" "0001017457" "00024158" "70" "-36915" "0" "-36915" "0" "c.-36915C>T" "r.(?)" "p.(=)" "" "0001017457" "00025229" "70" "1547" "0" "1547" "0" "c.1547C>T" "r.(?)" "p.(Ala516Val)" "" "0001017457" "00024010" "70" "780" "13926" "780" "13926" "c.*42+13926C>T" "r.(?)" "p.(=)" "" "0001027329" "00024158" "30" "-51239" "0" "-51239" "0" "c.-51239G>A" "r.(?)" "p.(=)" "" "0001027329" "00025229" "30" "-12778" "0" "-12778" "0" "c.-12778G>A" "r.(?)" "p.(=)" "" "0001027329" "00024010" "30" "382" "0" "382" "0" "c.382G>A" "r.(?)" "p.(Glu128Lys)" "" "0001027330" "00024158" "70" "305" "0" "305" "0" "c.305C>T" "r.(?)" "p.(Ala102Val)" "" "0001027330" "00025229" "70" "2234" "0" "2234" "0" "c.2234C>T" "r.(?)" "p.(Ala745Val)" "" "0001027330" "00024010" "70" "949" "0" "949" "0" "c.*211C>T" "r.(=)" "p.(=)" "" "0001030941" "00024158" "50" "1165" "0" "1165" "0" "c.1165C>T" "r.(?)" "p.(Arg389Cys)" "" "0001043438" "00024158" "50" "-51199" "0" "-51199" "0" "c.-51199del" "r.(?)" "p.(=)" "" "0001043438" "00025229" "50" "-12738" "0" "-12738" "0" "c.-12738del" "r.(?)" "p.(=)" "" "0001043438" "00024010" "50" "422" "0" "422" "0" "c.422del" "r.(?)" "p.(Pro141Leufs*126)" "" "0001043439" "00024158" "30" "-51105" "0" "-51105" "0" "c.-51105C>G" "r.(?)" "p.(=)" "" "0001043439" "00025229" "30" "-12644" "0" "-12644" "0" "c.-12644C>G" "r.(?)" "p.(=)" "" "0001043439" "00024010" "30" "516" "0" "516" "0" "c.516C>G" "r.(?)" "p.(Asp172Glu)" "" "0001043440" "00024158" "30" "-38251" "0" "-38251" "0" "c.-38251C>A" "r.(?)" "p.(=)" "" "0001043440" "00025229" "30" "211" "0" "211" "0" "c.211C>A" "r.(?)" "p.(Pro71Thr)" "" "0001043440" "00024010" "30" "780" "12590" "780" "12590" "c.*42+12590C>A" "r.(=)" "p.(=)" "" "0001043441" "00024158" "50" "-37924" "0" "-37924" "0" "c.-37924C>T" "r.(?)" "p.(=)" "" "0001043441" "00025229" "50" "538" "0" "538" "0" "c.538C>T" "r.(?)" "p.(Gln180Ter)" "" "0001043441" "00024010" "50" "780" "12917" "780" "12917" "c.*42+12917C>T" "r.(=)" "p.(=)" "" "0001043442" "00024158" "50" "-37906" "0" "-37906" "0" "c.-37906C>G" "r.(?)" "p.(=)" "" "0001043442" "00025229" "50" "556" "0" "556" "0" "c.556C>G" "r.(?)" "p.(Pro186Ala)" "" "0001043442" "00024010" "50" "780" "12935" "780" "12935" "c.*42+12935C>G" "r.(=)" "p.(=)" "" "0001043443" "00024158" "50" "-37784" "0" "-37784" "0" "c.-37784T>G" "r.(?)" "p.(=)" "" "0001043443" "00025229" "50" "678" "0" "678" "0" "c.678T>G" "r.(?)" "p.(Phe226Leu)" "" "0001043443" "00024010" "50" "780" "13057" "780" "13057" "c.*42+13057T>G" "r.(=)" "p.(=)" "" "0001043444" "00024158" "30" "-37565" "0" "-37565" "0" "c.-37565C>A" "r.(?)" "p.(=)" "" "0001043444" "00025229" "30" "897" "0" "897" "0" "c.897C>A" "r.(?)" "p.(Ser299Arg)" "" "0001043444" "00024010" "30" "780" "13276" "780" "13276" "c.*42+13276C>A" "r.(=)" "p.(=)" "" "0001043445" "00024158" "50" "-37332" "0" "-37332" "0" "c.-37332G>T" "r.(?)" "p.(=)" "" "0001043445" "00025229" "50" "1130" "0" "1130" "0" "c.1130G>T" "r.(?)" "p.(Gly377Val)" "" "0001043445" "00024010" "50" "780" "13509" "780" "13509" "c.*42+13509G>T" "r.(=)" "p.(=)" "" "0001043446" "00024158" "50" "-36999" "0" "-36999" "0" "c.-36999C>T" "r.(?)" "p.(=)" "" "0001043446" "00025229" "50" "1463" "0" "1463" "0" "c.1463C>T" "r.(?)" "p.(Ala488Val)" "" "0001043446" "00024010" "50" "780" "13842" "780" "13842" "c.*42+13842C>T" "r.(=)" "p.(=)" "" "0001043447" "00024158" "30" "-36864" "0" "-36864" "0" "c.-36864C>G" "r.(?)" "p.(=)" "" "0001043447" "00025229" "30" "1598" "0" "1598" "0" "c.1598C>G" "r.(?)" "p.(Pro533Arg)" "" "0001043447" "00024010" "30" "780" "13977" "780" "13977" "c.*42+13977C>G" "r.(=)" "p.(=)" "" "0001043448" "00024158" "50" "-36454" "0" "-36454" "0" "c.-36454G>A" "r.(?)" "p.(=)" "" "0001043448" "00025229" "50" "2008" "0" "2008" "0" "c.2008G>A" "r.(?)" "p.(Asp670Asn)" "" "0001043448" "00024010" "50" "780" "14387" "780" "14387" "c.*42+14387G>A" "r.(=)" "p.(=)" "" "0001043449" "00024158" "50" "121" "0" "121" "0" "c.121C>A" "r.(?)" "p.(His41Asn)" "" "0001043449" "00025229" "50" "2069" "-3765" "2069" "-3765" "c.2069-3765C>A" "r.(=)" "p.(=)" "" "0001043449" "00024010" "50" "781" "-3765" "781" "-3765" "c.*43-3765C>A" "r.(=)" "p.(=)" "" "0001043450" "00024158" "30" "258" "-8" "258" "-8" "c.258-8C>T" "r.(=)" "p.(=)" "" "0001043450" "00025229" "30" "2187" "-8" "2187" "-8" "c.2187-8C>T" "r.(=)" "p.(=)" "" "0001043450" "00024010" "30" "899" "-5" "899" "-5" "c.*161-5C>T" "r.spl?" "p.?" "" "0001043451" "00024158" "30" "839" "4" "839" "4" "c.839+4T>G" "r.spl?" "p.?" "" "0001043451" "00025229" "30" "2768" "4" "2768" "4" "c.2768+4T>G" "r.spl?" "p.?" "" "0001043451" "00024010" "30" "1483" "4" "1483" "4" "c.*745+4T>G" "r.spl?" "p.?" "" "0001043452" "00024158" "30" "978" "0" "978" "0" "c.978C>T" "r.(?)" "p.(Pro326=)" "" "0001043452" "00025229" "30" "2907" "0" "2907" "0" "c.2907C>T" "r.(?)" "p.(Pro969=)" "" "0001043452" "00024010" "30" "1622" "0" "1622" "0" "c.*884C>T" "r.(=)" "p.(=)" "" "0001049026" "00024158" "90" "533" "0" "533" "0" "c.533T>C" "r.(?)" "p.(Phe178Ser)" "" "0001049440" "00024158" "90" "601" "0" "601" "0" "c.601C>T" "r.(?)" "p.(Arg201Cys)" "" "0001056934" "00024158" "50" "-51598" "0" "-51598" "0" "c.-51598A>T" "r.(?)" "p.(=)" "" "0001056934" "00025229" "50" "-13137" "0" "-13137" "0" "c.-13137A>T" "r.(?)" "p.(=)" "" "0001056934" "00024010" "50" "23" "0" "23" "0" "c.23A>T" "r.(?)" "p.(Gln8Leu)" "" "0001056935" "00024158" "30" "-38416" "0" "-38416" "0" "c.-38416C>T" "r.(?)" "p.(=)" "" "0001056935" "00025229" "30" "46" "0" "46" "0" "c.46C>T" "r.(?)" "p.(Arg16Cys)" "" "0001056935" "00024010" "30" "780" "12425" "780" "12425" "c.*42+12425C>T" "r.(=)" "p.(=)" "" "0001056936" "00024158" "30" "-38344" "0" "-38344" "0" "c.-38344G>A" "r.(?)" "p.(=)" "" "0001056936" "00025229" "30" "118" "0" "118" "0" "c.118G>A" "r.(?)" "p.(Gly40Ser)" "" "0001056936" "00024010" "30" "780" "12497" "780" "12497" "c.*42+12497G>A" "r.(=)" "p.(=)" "" "0001056937" "00024158" "50" "-37708" "0" "-37708" "0" "c.-37708A>C" "r.(?)" "p.(=)" "" "0001056937" "00025229" "50" "754" "0" "754" "0" "c.754A>C" "r.(?)" "p.(Ser252Arg)" "" "0001056937" "00024010" "50" "780" "13133" "780" "13133" "c.*42+13133A>C" "r.(=)" "p.(=)" "" "0001056938" "00024158" "50" "-36409" "0" "-36409" "0" "c.-36409C>T" "r.(?)" "p.(=)" "" "0001056938" "00025229" "50" "2053" "0" "2053" "0" "c.2053C>T" "r.(?)" "p.(Arg685Cys)" "" "0001056938" "00024010" "50" "780" "14432" "780" "14432" "c.*42+14432C>T" "r.(=)" "p.(=)" "" "0001056939" "00024158" "50" "257" "970" "257" "972" "c.257+970_257+972del" "r.(=)" "p.(=)" "" "0001056939" "00025229" "50" "2186" "970" "2186" "972" "c.2186+970_2186+972del" "r.(=)" "p.(=)" "" "0001056939" "00024010" "50" "898" "970" "898" "972" "c.*160+970_*160+972del" "r.(=)" "p.(=)" "" "0001056940" "00024158" "30" "258" "-607" "258" "-607" "c.258-607C>T" "r.(=)" "p.(=)" "" "0001056940" "00025229" "30" "2187" "-607" "2187" "-607" "c.2187-607C>T" "r.(=)" "p.(=)" "" "0001056940" "00024010" "30" "899" "-604" "899" "-604" "c.*161-604C>T" "r.(=)" "p.(=)" "" "0001056941" "00024158" "30" "432" "10" "432" "10" "c.432+10A>T" "r.(=)" "p.(=)" "" "0001056941" "00025229" "30" "2361" "10" "2361" "10" "c.2361+10A>T" "r.(=)" "p.(=)" "" "0001056941" "00024010" "30" "1076" "10" "1076" "10" "c.*338+10A>T" "r.(=)" "p.(=)" "" "0001058739" "00024158" "90" "1" "0" "10" "0" "c.1_10del" "r.(?)" "p.(Met1?)" "" "0001059642" "00024158" "70" "3" "0" "3" "0" "c.3G>T" "r.(?)" "p.(Met1?)" "" "0001067354" "00024158" "50" "-38415" "0" "-38415" "0" "c.-38415G>A" "r.(?)" "p.(=)" "" "0001067354" "00025229" "50" "47" "0" "47" "0" "c.47G>A" "r.(?)" "p.(Arg16His)" "" "0001067354" "00024010" "50" "780" "12426" "780" "12426" "c.*42+12426G>A" "r.(=)" "p.(=)" "" "0001067355" "00024158" "50" "-37745" "0" "-37745" "0" "c.-37745C>T" "r.(?)" "p.(=)" "" "0001067355" "00025229" "50" "717" "0" "717" "0" "c.717C>T" "r.(?)" "p.(=)" "" "0001067355" "00024010" "50" "780" "13096" "780" "13096" "c.*42+13096C>T" "r.(=)" "p.(=)" "" "0001067356" "00024158" "50" "-36848" "0" "-36848" "0" "c.-36848C>T" "r.(?)" "p.(=)" "" "0001067356" "00025229" "50" "1614" "0" "1614" "0" "c.1614C>T" "r.(?)" "p.(=)" "" "0001067356" "00024010" "50" "780" "13993" "780" "13993" "c.*42+13993C>T" "r.(=)" "p.(=)" "" "0001067357" "00024158" "50" "24" "0" "24" "0" "c.24G>C" "r.(?)" "p.(Lys8Asn)" "" "0001067357" "00025229" "50" "2069" "-3862" "2069" "-3862" "c.2069-3862G>C" "r.(=)" "p.(=)" "" "0001067357" "00024010" "50" "781" "-3862" "781" "-3862" "c.*43-3862G>C" "r.(=)" "p.(=)" "" "0001067358" "00024158" "90" "184" "0" "184" "0" "c.184dup" "r.(?)" "p.(Ile62Asnfs*5)" "" "0001067358" "00025229" "90" "2113" "0" "2113" "0" "c.2113dup" "r.(?)" "p.(Ile705Asnfs*5)" "" "0001067358" "00024010" "90" "825" "0" "825" "0" "c.*87dup" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 111 "{{screeningid}}" "{{variantid}}" "0000029672" "0000053052" "0000029673" "0000053053" "0000029674" "0000053054" "0000079744" "0000128520" "0000081427" "0000130563" "0000081429" "0000130565" "0000081430" "0000130566" "0000081839" "0000132519" "0000081840" "0000132520" "0000081841" "0000132521" "0000081842" "0000132522" "0000081843" "0000132523" "0000081845" "0000132525" "0000081849" "0000132530" "0000081852" "0000132536" "0000081853" "0000132551" "0000081948" "0000134722" "0000081950" "0000134724" "0000081951" "0000134725" "0000081952" "0000134726" "0000081953" "0000134727" "0000081954" "0000134728" "0000087347" "0000140517" "0000087348" "0000140518" "0000087349" "0000140520" "0000087350" "0000140521" "0000087351" "0000140522" "0000087352" "0000140523" "0000087353" "0000140524" "0000087354" "0000140526" "0000087355" "0000140527" "0000087356" "0000140528" "0000087357" "0000140529" "0000087358" "0000140530" "0000087359" "0000140531" "0000087360" "0000140532" "0000087361" "0000140533" "0000087362" "0000140534" "0000087364" "0000140536" "0000088397" "0000146068" "0000088399" "0000146072" "0000089179" "0000147092" "0000089287" "0000147215" "0000092424" "0000150749" "0000100647" "0000162953" "0000100658" "0000162966" "0000100661" "0000162969" "0000100663" "0000162971" "0000101063" "0000163509" "0000101068" "0000163512" "0000101069" "0000163513" "0000101071" "0000163514" "0000104412" "0000169138" "0000105361" "0000170755" "0000105362" "0000170756" "0000105363" "0000170757" "0000105365" "0000170759" "0000106391" "0000171996" "0000108015" "0000173840" "0000108016" "0000173841" "0000108017" "0000173842" "0000108185" "0000174065" "0000108186" "0000174066" "0000108187" "0000174067" "0000111880" "0000179037" "0000118425" "0000194530" "0000122324" "0000211215" "0000132751" "0000221933" "0000132752" "0000221934" "0000132753" "0000221935" "0000132754" "0000221936" "0000132755" "0000221937" "0000132756" "0000221938" "0000132757" "0000221939" "0000132758" "0000221940" "0000132759" "0000221941" "0000132760" "0000221942" "0000132761" "0000221943" "0000132762" "0000221944" "0000132764" "0000221946" "0000132769" "0000221950" "0000132771" "0000221952" "0000132771" "0000221953" "0000132774" "0000221956" "0000132782" "0000221966" "0000132864" "0000222050" "0000132908" "0000222090" "0000144547" "0000235017" "0000145298" "0000236397" "0000145299" "0000236398" "0000145300" "0000236399" "0000230666" "0000472241" "0000230667" "0000472242" "0000230668" "0000472243" "0000236552" "0000480550" "0000236553" "0000480551" "0000294127" "0000650816" "0000305995" "0000669683" "0000308283" "0000675197" "0000308402" "0000682766" "0000332680" "0000729962" "0000359981" "0000759623" "0000360648" "0000760708" "0000360649" "0000760709" "0000362869" "0000763243" "0000420881" "0000881240" "0000420923" "0000881282" "0000459431" "0001017457" "0000468932" "0001049026" "0000470617" "0001058739" "0000471494" "0001059642"