### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ###
## Filter: (gene_public = GRN)
# charset = UTF-8
## Genes ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}"
"GRN" "granulin" "17" "q21.32" "unknown" "NG_007886.1" "UD_132084561871" "" "https://www.LOVD.nl/GRN" "" "1" "4601" "2896" "138945" "1" "1" "1" "1" "Alias CLN11.\r\nAn NCL gene variant database.\r\nEstablishment of this database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project." "" "g" "http://databases.lovd.nl/shared/refseq/GRN_codingDNA.html" "1" "" "
An NCL gene variant database\r\n
" "-1" "" "-1" "00001" "2010-04-29 00:00:00" "00006" "2017-04-03 14:08:37" "00000" "2026-01-20 18:57:21"
## Transcripts ## Do not remove or alter this header ##
## Count = 1
"{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00008964" "GRN" "granulin" "001" "NM_002087.2" "" "NP_002078.1" "" "" "" "-219" "2086" "1782" "42422491" "42430470" "" "0000-00-00 00:00:00" "" ""
## Diseases ## Do not remove or alter this header ##
## Count = 18
"{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}"
"00025" "FTDALS" "dementia, frontotemporal, and/or amyotrophic lateral sclerosis (FTDALS)" "AD" "105550" "" "" "" "00001" "2012-08-03 15:09:30" "00006" "2021-12-10 21:51:32"
"00096" "FTD" "dementia, frontotemporal (FTD)" "AD" "600274" "" "" "" "00008" "2012-12-10 14:01:50" "00006" "2021-12-10 21:51:32"
"00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12"
"00204" "AD" "Alzheimer disease (AD)" "AD" "104300" "" "" "" "00006" "2013-09-24 20:52:38" "00006" "2021-12-10 21:51:32"
"00218" "IBMPFD1" "myopathy, inclusion body, with early-onset Paget disease and frontotemporal dementia, type 1" "AD" "167320" "" "" "" "00008" "2013-10-02 11:35:03" "00006" "2023-11-03 18:38:39"
"00414" "PD" "Parkinson disease, susceptibility to" "AD;AR;Mu" "168600" "" "" "" "00006" "2014-06-15 21:26:13" "00006" "2023-10-27 16:16:06"
"00639" "cancer, lung" "cancer, lung (adenocarcinoma)" "" "211980" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"01294" "DLB" "dementia, Lewy body" "AD" "127750" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"01749" "HDLS" "leukoencephalopathy, diffuse hereditary, with spheroid (HDLS)" "AD" "221820" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"02665" "FTLDTDP;PPA" "degeneration, frontotemporal lobar, with TDP43 inclusions (FTLD-TDP, aphasia, primary progressive (PPA))" "AD" "607485" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"03601" "CIAT" "cognitive impairment, ataxia, cerebellar (CIAT)" "AD" "614306" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2019-10-25 11:02:39"
"03710" "CLN11" "lipofuscinosis, ceroid, neuronal, type 11 (CLN-11)" "AR" "614706" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32"
"04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26"
"04255" "ALS" "sclerosis, lateral, amyotrophic (ALS)" "" "" "" "" "" "00015" "2015-05-08 11:45:27" "00006" "2015-12-08 23:53:05"
"04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59"
"05106" "MPD" "myopathy, distal (MPD)" "" "" "" "" "" "00006" "2015-12-08 01:43:19" "" ""
"05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" ""
"05258" "CLN" "lipofuscinosis, ceroid, neuronal (CLN)" "" "" "" "" "" "00006" "2017-04-03 15:00:30" "00006" "2017-04-04 08:43:07"
## Genes_To_Diseases ## Do not remove or alter this header ##
## Count = 2
"{{geneid}}" "{{diseaseid}}"
"GRN" "02665"
"GRN" "03710"
## Individuals ## Do not remove or alter this header ##
## Count = 279
"{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}"
"00057197" "" "" "" "1" "" "01225" "" "" "" "" "Norway" "" "0" "" "" "" ""
"00057198" "" "" "" "1" "" "01225" "" "" "" "" "Norway" "" "0" "" "" "" ""
"00104698" "" "" "" "2" "" "00006" "{PMID:Smith 2012:22608501}, {DOI:Smith 2012:10.1016/j.ajhg.2012.04.021}" "3-generation family, affected brother/sister, unaffected heterozygous carrier parents/relatives" "F;M" "" "Australia" "" "0" "" "" "Italy (Lombardy)" "22608501-Fam"
"00104699" "" "" "" "1" "" "00006" "{PMID:Smith 2012:22608501}, {DOI:Smith 2012:10.1016/j.ajhg.2012.04.021}" "" "" "" "" "" "0" "" "" "" "22608501-Pat"
"00148807" "" "" "" "3" "" "02360" "{PMID:Rogaeva EA 2001:11524469} {PMID:Amtul Z 2002:11895378} {PMID:Tang-Wai D 2002:12053127}" "The proband also carries the PSEN1 insR352 mutation\"\"" "" "" "" "74y06m" "0" "" "" "" ""
"00148992" "" "" "" "2" "" "02360" "" "Also segregates the MAPT IVS10+29G>A mutation\"\"" "" "" "Australia" "59y06m" "0" "" "" "" ""
"00149091" "" "" "" "12" "" "02360" "" "" "" "" "Netherlands" "70y" "0" "" "" "white" ""
"00149092" "" "" "" "11" "" "02360" "" "" "" "" "Belgium" "64y07m" "0" "" "" "white" ""
"00149093" "" "" "" "11" "" "02360" "" "" "" "" "Belgium" "71y02m" "0" "" "" "white" ""
"00149094" "" "" "" "7" "" "02360" "" "" "" "" "Belgium" "71y" "0" "" "" "white" ""
"00149095" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "68y" "0" "" "" "white" ""
"00149096" "" "" "" "2" "" "02360" "" "" "" "" "Belgium" "71y" "0" "" "" "white" ""
"00149097" "" "" "" "3" "" "02360" "" "" "" "" "Belgium" "67y09m" "0" "" "" "white" ""
"00149098" "" "" "" "2" "" "02360" "" "" "" "" "Belgium" "71y06m" "0" "" "" "white" ""
"00149099" "" "" "" "2" "" "02360" "" "" "" "" "Belgium" "65y" "0" "" "" "white" ""
"00149100" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "" "0" "" "" "white" ""
"00149101" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "" "0" "" "" "white" ""
"00149102" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "" "0" "" "" "white" ""
"00149103" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149104" "" "" "" "17" "" "02360" "" "" "" "" "Canada" "64y" "0" "" "" "white" ""
"00149105" "" "" "" "6" "" "02360" "" "" "" "" "Canada" "63y" "0" "" "" "white" ""
"00149106" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "66y" "0" "" "" "white" ""
"00149107" "" "" "" "9" "" "02360" "" "" "" "" "Canada" "" "0" "" "" "white" ""
"00149108" "" "" "" "3" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149109" "" "" "" "7" "" "02360" "" "" "" "" "Canada" "71y" "0" "" "" "white" ""
"00149110" "" "" "" "10" "" "02360" "" "" "" "" "Canada" "66y06m" "0" "" "" "white" ""
"00149111" "" "" "" "4" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "68y10m" "0" "" "" "white" ""
"00149141" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149142" "" "" "" "1" "" "02360" "" "Parents died at 66 and 70 years without signs of dementia" "" "" "United States" "56y" "0" "" "" "white" ""
"00149143" "" "" "" "2" "" "02360" "" "" "" "" "United States" "65y06m" "0" "" "" "white" ""
"00149144" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149145" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149146" "" "" "" "1" "" "02360" "" "" "" "" "Sweden" "" "0" "" "" "white" ""
"00149147" "" "" "" "1" "" "02360" "" "" "" "" "United States" "63y" "0" "" "" "white" ""
"00149148" "" "" "" "1" "" "02360" "" "" "" "" "United States" "76y" "0" "" "" "white" ""
"00149149" "" "" "" "1" "" "02360" "" "" "" "" "United States" "87y" "0" "" "" "white" ""
"00149150" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149151" "" "" "" "1" "" "02360" "" "" "" "" "United States" "66y" "0" "" "" "white" ""
"00149152" "" "" "" "1" "" "02360" "" "" "" "" "United States" "68y" "0" "" "" "white" ""
"00149153" "" "" "" "2" "" "02360" "" "" "" "" "Canada" "60y" "0" "" "" "white" ""
"00149154" "" "" "" "1" "" "02360" "" "One parent died at 56 y from unrelated illness" "" "" "United States" "61y" "0" "" "" "white" ""
"00149155" "" "" "" "1" "" "02360" "" "" "" "" "United States" "72y" "0" "" "" "white" ""
"00149156" "" "" "" "1" "" "02360" "" "" "" "" "United States" "53y" "0" "" "" "white" ""
"00149157" "" "" "" "1" "" "02360" "" "" "" "" "United States" "61y" "0" "" "" "white" ""
"00149158" "" "" "" "1" "" "02360" "" "" "" "" "United States" "65y" "0" "" "" "white" ""
"00149159" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149160" "" "" "" "1" "" "02360" "" "" "" "" "United States" "68y" "0" "" "" "white" ""
"00149161" "" "" "" "1" "" "02360" "" "" "" "" "United States" "65y" "0" "" "" "white" ""
"00149162" "" "" "" "3" "" "02360" "" "" "" "" "United States" "72y" "0" "" "" "white" ""
"00149163" "" "" "" "1" "" "02360" "" "" "" "" "United States" "54y" "0" "" "" "white" ""
"00149164" "" "" "" "1" "" "02360" "" "" "" "" "United States" "56y" "0" "" "" "white" ""
"00149165" "" "" "" "1" "" "02360" "" "" "" "" "United States" "75y" "0" "" "" "white" ""
"00149166" "" "" "" "2" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149167" "" "" "" "1" "" "02360" "" "" "" "" "United States" "59y" "0" "" "" "white" ""
"00149168" "" "" "" "1" "" "02360" "" "" "" "" "United States" "60y" "0" "" "" "white" ""
"00149169" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149170" "" "" "" "1" "" "02360" "" "" "" "" "United States" "61y" "0" "" "" "white" ""
"00149171" "" "" "" "1" "" "02360" "" "" "" "" "United States" "56y" "0" "" "" "white" ""
"00149172" "" "" "" "1" "" "02360" "" "" "" "" "United States" "72y" "0" "" "" "white" ""
"00149180" "" "" "" "26" "" "02360" "" "" "" "" "United States" "70y02m" "0" "" "" "white (Central European Ancestry)" ""
"00149181" "" "" "" "1" "" "02360" "" "" "" "" "United States" "76y" "0" "" "" "" ""
"00149182" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "" ""
"00149183" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "" ""
"00149188" "" "" "" "2" "" "02360" "" "" "" "" "Canada" "61y" "0" "" "" "Asian (Chinese Ancestry)" ""
"00149189" "" "" "" "1" "" "02360" "" "The patient also carries the MAPT Ala239Thr mutation\"\"" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149190" "" "" "" "6" "" "02360" "" "" "" "" "Italy" "66y06m" "0" "" "" "white" ""
"00149191" "" "" "" "5" "" "02360" "" "" "" "" "Italy" "73y04m" "0" "" "" "white" ""
"00149200" "" "" "" "10" "" "02360" "" "" "" "" "Netherlands" "70y09m" "0" "" "" "white" ""
"00149201" "" "" "" "1" "" "02360" "" "" "" "" "Netherlands" "" "0" "" "" "white" ""
"00149202" "" "" "" "3" "" "02360" "" "" "" "" "" "71y04m" "0" "" "" "" ""
"00149203" "" "" "" "1" "" "02360" "" "" "" "" "United States" "54y" "0" "" "" "white" ""
"00149208" "" "" "" "1" "" "02360" "" "" "" "" "Germany" "" "0" "" "" "white" ""
"00149209" "" "" "" "1" "" "02360" "" "" "" "" "" "63y" "0" "" "" "" ""
"00149210" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149211" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149212" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149213" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149214" "" "" "" "1" "" "02360" "" "" "" "" "Sweden" "" "0" "" "" "white" ""
"00149215" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149216" "" "" "" "2" "" "02360" "" "" "" "" "France" "63y" "0" "" "" "white" ""
"00149217" "" "" "" "1" "" "02360" "" "" "" "" "France" "49y" "0" "" "" "white" ""
"00149218" "" "" "" "1" "" "02360" "" "" "" "" "France" "61y" "0" "" "" "white" ""
"00149219" "" "" "" "1" "" "02360" "" "" "" "" "France" "58y" "0" "" "" "white" ""
"00149220" "" "" "" "2" "" "02360" "" "" "" "" "France" "74y" "0" "" "" "white" ""
"00149221" "" "" "" "1" "" "02360" "" "" "" "" "France" "78y" "0" "" "" "white" ""
"00149222" "" "" "" "1" "" "02360" "" "" "" "" "France" "85y" "0" "" "" "white" ""
"00149223" "" "" "" "3" "" "02360" "" "" "" "" "France" "60y06m" "0" "" "" "white" ""
"00149224" "" "" "" "1" "" "02360" "" "" "" "" "France" "68y" "0" "" "" "white" ""
"00149225" "" "" "" "9" "" "02360" "" "" "" "" "United States" "65y04m" "0" "" "" "white" ""
"00149226" "" "" "" "4" "" "02360" "" "" "" "" "United States" "68y07m" "0" "" "" "white" ""
"00149227" "" "" "" "1" "" "02360" "" "" "" "" "Spain" "74y" "0" "" "" "white" ""
"00149230" "" "" "" "2" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white (Chinese Ancestry)" ""
"00149236" "" "" "" "9" "" "02360" "" "Mutation absent in one family branch also segregating autosomal dominant frontotempral dementia (From Calabria, Italy)" "" "" "Italy" "70y" "0" "" "" "white" ""
"00149242" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149243" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149244" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149245" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149246" "" "" "" "2" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149247" "" "" "" "2" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149248" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149258" "" "" "" "1" "" "02360" "" "" "" "" "" "61y" "0" "" "" "" ""
"00149259" "" "" "" "1" "" "02360" "" "" "" "" "United States" "64y" "0" "" "" "" ""
"00149260" "" "" "" "1" "" "02360" "" "" "" "" "United States" "55y" "0" "" "" "" ""
"00149261" "" "" "" "1" "" "02360" "" "" "" "" "United States" "53y" "0" "" "" "" ""
"00149262" "" "" "" "2" "" "02360" "" "" "" "" "United States" "58y" "0" "" "" "" ""
"00149263" "" "" "" "1" "" "02360" "" "" "" "" "United States" "55y" "0" "" "" "" ""
"00149264" "" "" "" "1" "" "02360" "" "" "" "" "United States" "56y" "0" "" "" "" ""
"00149265" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "" ""
"00149266" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00149267" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "60y" "0" "" "" "" ""
"00149268" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" ""
"00149269" "" "" "" "1" "" "02360" "" "" "" "" "United States" "65y" "0" "" "" "" ""
"00149270" "" "" "" "1" "" "02360" "" "" "" "" "United States" "64y" "0" "" "" "" ""
"00149271" "" "" "" "1" "" "02360" "" "" "" "" "United States" "67y" "0" "" "" "" ""
"00149272" "" "" "" "1" "" "02360" "" "" "" "" "United States" "68y" "0" "" "" "" ""
"00149273" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "" ""
"00149274" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "" ""
"00149275" "" "" "" "1" "" "02360" "" "" "" "" "United States" "70y" "0" "" "" "" ""
"00149276" "" "" "" "1" "" "02360" "" "" "" "" "United States" "66y" "0" "" "" "" ""
"00149277" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "" ""
"00149278" "" "" "" "1" "" "02360" "" "" "" "" "United States" "69y" "0" "" "" "" ""
"00149279" "" "" "" "1" "" "02360" "" "" "" "" "Canada" "74y" "0" "" "" "" ""
"00149310" "" "" "" "59" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149311" "" "" "" "65" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149312" "" "" "" "59" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149313" "" "" "" "56" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149314" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "76y" "0" "" "" "white" ""
"00149315" "" "" "" "1" "" "02360" "" "Patient presented with Parkinson disease. Neuropathologic diagnosis revealed FTLDU and Lewy body features." "" "" "Belgium" "61y" "0" "" "" "white" ""
"00149316" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "" "0" "" "" "white" ""
"00149321" "" "" "" "1" "" "02360" "" "" "" "" "" "65y" "0" "" "" "white" ""
"00149322" "" "" "" "1" "" "02360" "" "" "" "" "" "78y" "0" "" "" "white" ""
"00149323" "" "" "" "4" "" "02360" "" "Basque Country" "" "" "Spain" "66y" "0" "" "" "white" ""
"00149324" "" "" "" "4" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149325" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149326" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "64y" "0" "" "" "white" ""
"00149327" "" "" "" "2" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149328" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149329" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "59y" "0" "" "" "white" ""
"00149330" "" "" "" "2" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149331" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149332" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149333" "" "" "" "1" "" "02360" "" "" "" "" "" "51y" "0" "" "" "white" ""
"00149334" "" "" "" "2" "" "02360" "" "Mutation observed in proband and relative with schizophrenia" "" "" "" "55y" "0" "" "" "" ""
"00149335" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149336" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149337" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149338" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149339" "" "" "" "2" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149340" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149341" "" "" "" "2" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149342" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149343" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149344" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149345" "" "" "" "2" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149346" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149347" "" "" "" "1" "" "02360" "" "" "" "" "France" "" "0" "" "" "white" ""
"00149348" "" "" "" "7" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149349" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149350" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "African American" ""
"00149351" "" "" "" "1" "" "02360" "" "" "" "" "" "62y" "0" "" "" "" ""
"00149352" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149361" "" "" "" "10" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "65y" "0" "" "" "white" ""
"00149362" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149363" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149364" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149365" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149366" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149367" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149368" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149369" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149370" "" "" "" "1" "" "02360" "" "" "" "" "Bangladesh" "" "0" "" "" "Asian" ""
"00149371" "" "" "" "1" "" "02360" "" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "white" ""
"00149374" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149375" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149376" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149377" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149383" "" "" "" "4" "" "02360" "" "" "" "" "Portugal" "58y" "0" "" "" "white" ""
"00149384" "" "" "" "1" "" "02360" "" "Mutation present in 2 affected sibling but absent from 1 affected sibling" "" "" "Portugal" "" "0" "" "" "white" ""
"00149386" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "85y" "0" "" "" "white" ""
"00149387" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "89y" "0" "" "" "white" ""
"00149388" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "78y" "0" "" "" "white" ""
"00149389" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "82y" "0" "" "" "white" ""
"00149390" "" "" "" "1" "" "02360" "" "" "" "" "Belgium" "" "0" "" "" "white" ""
"00149392" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149394" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149395" "" "" "" "1" "" "02360" "" "Unaffected 44 year old individual of a dementia family" "" "" "" "" "0" "" "" "" ""
"00149398" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149400" "" "" "" "1" "" "02360" "" "" "" "" "Portugal" "" "0" "" "" "white" ""
"00149402" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149403" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149404" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149405" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149406" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149417" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149418" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149437" "" "" "" "2" "" "02360" "" "" "" "" "France" "71y10m" "0" "" "" "white" ""
"00149439" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white (Belgian)" ""
"00149440" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149443" "" "" "" "10" "" "02360" "" "" "" "" "Sweden" "58y02m" "0" "" "" "white" ""
"00149447" "" "" "" "4" "" "02360" "" "" "" "" "Spain" "71y10m" "0" "" "" "white" ""
"00149450" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149451" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149452" "" "" "" "2" "" "02360" "" "" "" "" "Italy" "80y" "0" "" "" "white" ""
"00149453" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149454" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149455" "" "" "" "3" "" "02360" "" "" "" "" "Italy" "69y" "0" "" "" "white" ""
"00149456" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149457" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149458" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149459" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149460" "" "" "" "3" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149461" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149462" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149463" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149464" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149465" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149466" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149467" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149468" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149469" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149470" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149471" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149472" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149473" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149474" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149475" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149476" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149477" "" "" "" "3" "" "02360" "" "" "" "" "Italy" "72y" "0" "" "" "white" ""
"00149478" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149538" "" "" "" "1" "" "02360" "" "" "" "" "United States" "75y" "0" "" "" "white" ""
"00149539" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149540" "" "" "" "1" "" "02360" "" "" "" "" "United States" "86y" "0" "" "" "white" ""
"00149541" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149542" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149543" "" "" "" "1" "" "02360" "" "" "" "" "United States" "" "0" "" "" "white" ""
"00149544" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149545" "" "" "" "2" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149546" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149547" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149550" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149554" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149555" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149596" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149597" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149598" "" "" "" "1" "" "02360" "" "Basque Country" "" "" "Spain" "" "0" "" "" "white" ""
"00149600" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149601" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149606" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149607" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149608" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149609" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149610" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149611" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149612" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149613" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149614" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149615" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149616" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149617" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149618" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149619" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149632" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "" "0" "" "" "white" ""
"00149633" "" "" "" "1" "" "02360" "" "" "" "" "Italy" "66y" "0" "" "" "white" ""
"00149639" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149656" "" "" "" "1" "" "02360" "" "" "" "" "" "" "0" "" "" "white" ""
"00149661" "" "" "" "8" "" "02360" "" "" "" "" "" "" "0" "" "" "" ""
"00149715" "" "" "" "5" "" "02360" "" "" "" "" "Italy" "73y" "0" "" "" "white" ""
"00320003" "" "" "" "1" "" "01164" "" "" "F" "?" "Germany" "" "0" "" "" "" "171471"
"00324290" "" "" "" "1" "" "03951" "" "" "F" "no" "Italy" "" "" "yes" "" "white" "SLA-266"
"00324470" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" ""
"00328826" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" ""
"00362028" "" "" "" "1" "" "00006" "{PMID:Courage 2021:33798445}, {DOI:Courage 2021:10.1016/j.ajhg.2021.03.013}" "" "" "" "" "" "0" "" "" "" "PME54"
"00376336" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" ""
"00383485" "" "" "" "1" "" "00000" "{PMID:Dozieres-Puyravel 2020:31489614}" "" "?" "" "France" "" "0" "" "" "" "11"
"00393990" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" ""
"00393991" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" ""
"00393992" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" ""
"00393993" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" ""
"00393994" "" "" "" "1" "" "00000" "{PMID:Fuster-Garcia-2019:31725169}" "" "" "" "" "" "0" "" "" "Spanish" ""
## Individuals_To_Diseases ## Do not remove or alter this header ##
## Count = 292
"{{individualid}}" "{{diseaseid}}"
"00057197" "00414"
"00057198" "00414"
"00104698" "05258"
"00104699" "05258"
"00148807" "00096"
"00148992" "00096"
"00149091" "00096"
"00149092" "00096"
"00149093" "00096"
"00149094" "00096"
"00149095" "00096"
"00149096" "00096"
"00149097" "00096"
"00149098" "00096"
"00149099" "00096"
"00149100" "00096"
"00149101" "00096"
"00149102" "00096"
"00149103" "00096"
"00149104" "00096"
"00149105" "00096"
"00149106" "00096"
"00149107" "00096"
"00149108" "00096"
"00149108" "00198"
"00149109" "00096"
"00149110" "00096"
"00149111" "00096"
"00149111" "00198"
"00149141" "00198"
"00149142" "00096"
"00149143" "00096"
"00149143" "00204"
"00149144" "00096"
"00149145" "00198"
"00149146" "00096"
"00149147" "00096"
"00149148" "00096"
"00149148" "00204"
"00149149" "00096"
"00149150" "00198"
"00149151" "00096"
"00149152" "00096"
"00149153" "00096"
"00149154" "00198"
"00149155" "00096"
"00149156" "00096"
"00149157" "00096"
"00149158" "00096"
"00149159" "00198"
"00149160" "00096"
"00149161" "00096"
"00149162" "00198"
"00149163" "00096"
"00149164" "00096"
"00149165" "00198"
"00149166" "00198"
"00149167" "00096"
"00149168" "00096"
"00149169" "00198"
"00149170" "00096"
"00149171" "00096"
"00149172" "00096"
"00149180" "00096"
"00149181" "00096"
"00149182" "00096"
"00149183" "00096"
"00149188" "00198"
"00149188" "01294"
"00149189" "00096"
"00149190" "00096"
"00149191" "00198"
"00149191" "05106"
"00149200" "00096"
"00149201" "00096"
"00149202" "00096"
"00149203" "00096"
"00149208" "04255"
"00149209" "00025"
"00149210" "00096"
"00149211" "00096"
"00149212" "00096"
"00149213" "00096"
"00149214" "04255"
"00149215" "00096"
"00149216" "00096"
"00149217" "00096"
"00149218" "00096"
"00149219" "00096"
"00149220" "00096"
"00149221" "00096"
"00149222" "00096"
"00149223" "00096"
"00149224" "00096"
"00149225" "00096"
"00149226" "00096"
"00149227" "00096"
"00149230" "00096"
"00149236" "00096"
"00149242" "00096"
"00149243" "00096"
"00149244" "00096"
"00149245" "00096"
"00149246" "00096"
"00149247" "00096"
"00149248" "00096"
"00149258" "00198"
"00149259" "00096"
"00149260" "00204"
"00149261" "00096"
"00149262" "00096"
"00149263" "00198"
"00149264" "00096"
"00149265" "00096"
"00149266" "00096"
"00149267" "00096"
"00149268" "00096"
"00149269" "00096"
"00149270" "00096"
"00149271" "00204"
"00149272" "00204"
"00149273" "00096"
"00149274" "00198"
"00149275" "00096"
"00149278" "00096"
"00149279" "00096"
"00149310" "00096"
"00149311" "00198"
"00149312" "00096"
"00149313" "00096"
"00149314" "00204"
"00149315" "00096"
"00149316" "00204"
"00149321" "00025"
"00149322" "00096"
"00149323" "00198"
"00149323" "02665"
"00149324" "00198"
"00149324" "00218"
"00149325" "00198"
"00149325" "01749"
"00149326" "00198"
"00149327" "00198"
"00149327" "05126"
"00149328" "00096"
"00149329" "00025"
"00149330" "00198"
"00149331" "00198"
"00149332" "00096"
"00149333" "00096"
"00149334" "00096"
"00149334" "00198"
"00149335" "00096"
"00149336" "00096"
"00149337" "00198"
"00149338" "00096"
"00149339" "00096"
"00149340" "00096"
"00149341" "00096"
"00149342" "00096"
"00149343" "00198"
"00149344" "00096"
"00149345" "00096"
"00149346" "00096"
"00149347" "00198"
"00149348" "00096"
"00149349" "00096"
"00149350" "00096"
"00149351" "00198"
"00149352" "00096"
"00149361" "00096"
"00149362" "00096"
"00149363" "00096"
"00149364" "00096"
"00149365" "00096"
"00149366" "00096"
"00149367" "00096"
"00149368" "00096"
"00149369" "00096"
"00149370" "00198"
"00149371" "00198"
"00149374" "00096"
"00149375" "00096"
"00149376" "00198"
"00149377" "00198"
"00149383" "00198"
"00149384" "00096"
"00149386" "00204"
"00149387" "00204"
"00149388" "00204"
"00149389" "00204"
"00149390" "00204"
"00149392" "00096"
"00149394" "00096"
"00149398" "00204"
"00149400" "00096"
"00149402" "00025"
"00149403" "00096"
"00149404" "00096"
"00149405" "00096"
"00149406" "00096"
"00149417" "00096"
"00149417" "00639"
"00149418" "00096"
"00149437" "00096"
"00149437" "00414"
"00149439" "00414"
"00149440" "00414"
"00149443" "00096"
"00149447" "00096"
"00149450" "00096"
"00149451" "00096"
"00149452" "00198"
"00149453" "00025"
"00149454" "00096"
"00149455" "00096"
"00149455" "00204"
"00149455" "03601"
"00149456" "00096"
"00149457" "00096"
"00149458" "00198"
"00149459" "00096"
"00149460" "00096"
"00149461" "01294"
"00149462" "00096"
"00149463" "00198"
"00149464" "00096"
"00149465" "00025"
"00149466" "00096"
"00149467" "00096"
"00149468" "00198"
"00149469" "00096"
"00149470" "00096"
"00149471" "00198"
"00149472" "00096"
"00149473" "00198"
"00149474" "00096"
"00149475" "00096"
"00149476" "00096"
"00149477" "00198"
"00149478" "00096"
"00149538" "00198"
"00149539" "00096"
"00149540" "00198"
"00149541" "00198"
"00149542" "00198"
"00149543" "00204"
"00149544" "00096"
"00149545" "00096"
"00149546" "04255"
"00149547" "04255"
"00149550" "00204"
"00149554" "00096"
"00149555" "00096"
"00149596" "00198"
"00149597" "00198"
"00149598" "00096"
"00149600" "00096"
"00149601" "02665"
"00149606" "02665"
"00149607" "00096"
"00149608" "02665"
"00149609" "00096"
"00149610" "00198"
"00149611" "00096"
"00149612" "00096"
"00149613" "02665"
"00149614" "02665"
"00149615" "00096"
"00149616" "00096"
"00149617" "00096"
"00149618" "00096"
"00149619" "00096"
"00149632" "00096"
"00149633" "00096"
"00149639" "00198"
"00149656" "00096"
"00149661" "00096"
"00149661" "00204"
"00149715" "00096"
"00320003" "00096"
"00324290" "04255"
"00324470" "00198"
"00328826" "00198"
"00362028" "04270"
"00376336" "00198"
"00383485" "05258"
"00393990" "04214"
"00393991" "04214"
"00393992" "04214"
"00393993" "04214"
"00393994" "04214"
## Phenotypes ## Do not remove or alter this header ##
## Note: Only showing Phenotype columns active for Diseases 00025, 00096, 00198, 00204, 00218, 00414, 00639, 01294, 01749, 02665, 03601, 03710, 04214, 04255, 04270, 05106, 05126, 05258
## Count = 276
"{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Cancer/Sub_type}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}"
"0000043877" "00414" "00057197" "01225" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000043878" "00414" "00057198" "01225" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000082613" "05258" "00104698" "00006" "Familial, autosomal recessive" "" "see paper; ..., NCL, retinopathy" "" "" "" "" "" "" "" "" "" "NCL" ""
"0000082614" "05258" "00104699" "00006" "Unknown" "" "more likely FTLD-TDP; 46y-limb dystonia, spasticity, gait disturbance, apraxia, dementia; died around 48–49y" "" "" "" "" "" "" "" "" "" "adult NCL" ""
"0000121225" "00104" "00148807" "02360" "Familial, autosomal dominant" "60y04m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121410" "00104" "00148992" "02360" "Familial, autosomal dominant" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121509" "00104" "00149091" "02360" "Familial, autosomal dominant" "64y11m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121510" "00104" "00149092" "02360" "Familial, autosomal dominant" "60y04m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121511" "00104" "00149093" "02360" "Familial, autosomal dominant" "65y08m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121512" "00104" "00149094" "02360" "Familial, autosomal dominant" "67y10m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121513" "00104" "00149095" "02360" "Familial, autosomal dominant" "65y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121514" "00104" "00149096" "02360" "Familial, autosomal dominant" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121515" "00104" "00149097" "02360" "Familial, autosomal dominant" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121516" "00104" "00149098" "02360" "Familial, autosomal dominant" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121517" "00104" "00149099" "02360" "Familial, autosomal dominant" "52y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121518" "00104" "00149100" "02360" "Familial" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121519" "00104" "00149101" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121520" "00104" "00149102" "02360" "Familial" "67y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121521" "00104" "00149103" "02360" "Unknown" "50y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121522" "00104" "00149104" "02360" "Familial, autosomal dominant" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121523" "00104" "00149105" "02360" "Familial, autosomal dominant" "68y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121524" "00104" "00149106" "02360" "Familial, autosomal dominant" "60y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121525" "00104" "00149107" "02360" "Familial, autosomal dominant" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121526" "00104" "00149108" "02360" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121527" "00104" "00149109" "02360" "Familial, autosomal dominant" "65y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121528" "00104" "00149110" "02360" "Familial, autosomal dominant" "60y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121529" "00104" "00149111" "02360" "Familial, autosomal dominant" "61y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121559" "00100" "00149141" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121560" "00104" "00149142" "02360" "Isolated (sporadic)" "48y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121561" "00104" "00149143" "02360" "Familial" "62y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121562" "00104" "00149144" "02360" "Familial" "65y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121563" "00100" "00149145" "02360" "Familial" "83y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121564" "00104" "00149146" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121565" "00104" "00149147" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121566" "00104" "00149148" "02360" "Familial" "69y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121567" "00104" "00149149" "02360" "Familial" "80y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121568" "00100" "00149150" "02360" "Familial" "61y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121569" "00104" "00149151" "02360" "Unknown" "51y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121570" "00104" "00149152" "02360" "Familial" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121571" "00104" "00149153" "02360" "Familial" "57y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121572" "00100" "00149154" "02360" "Isolated (sporadic)" "56y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121573" "00104" "00149155" "02360" "Familial" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121574" "00104" "00149156" "02360" "Unknown" "51y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121575" "00104" "00149157" "02360" "Familial" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121576" "00104" "00149158" "02360" "Familial" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121577" "00125" "00149159" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121578" "00104" "00149160" "02360" "Familial" "60y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121579" "00104" "00149161" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121580" "00100" "00149162" "02360" "Familial" "62y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121581" "00104" "00149163" "02360" "Familial" "49y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121582" "00104" "00149164" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121583" "00100" "00149165" "02360" "Familial" "66y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121584" "00100" "00149166" "02360" "Familial" "63y06m" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121585" "00104" "00149167" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121586" "00104" "00149168" "02360" "Familial" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121587" "00125" "00149169" "02360" "Familial" "48y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121588" "00104" "00149170" "02360" "Familial" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121589" "00104" "00149171" "02360" "Familial" "53y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121590" "00104" "00149172" "02360" "Familial" "69y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121598" "00104" "00149180" "02360" "Familial, autosomal dominant" "63y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121599" "00104" "00149181" "02360" "Familial" "51y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121600" "00104" "00149182" "02360" "Unknown" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121601" "00104" "00149183" "02360" "Familial" "45y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121606" "00105" "00149188" "02360" "Familial" "59y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121607" "00104" "00149189" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121608" "00104" "00149190" "02360" "Familial, autosomal dominant" "59y10m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121609" "00106" "00149191" "02360" "Familial, autosomal dominant" "66y05m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121618" "00104" "00149200" "02360" "Familial, autosomal dominant" "61y02m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121619" "00104" "00149201" "02360" "Familial" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121620" "00104" "00149202" "02360" "Familial, autosomal dominant" "66y04m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121621" "00104" "00149203" "02360" "Familial, autosomal dominant" "47y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121626" "00124" "00149208" "02360" "Isolated (sporadic)" "67y" "" "" "" "" "" "" "" "" "" "MFDGA" "" ""
"0000121627" "00098" "00149209" "02360" "Familial" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121628" "00104" "00149210" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121629" "00104" "00149211" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121630" "00104" "00149212" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121631" "00104" "00149213" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121632" "00124" "00149214" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "MFDGA" "" ""
"0000121633" "00104" "00149215" "02360" "Isolated (sporadic)" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121634" "00104" "00149216" "02360" "Familial, autosomal dominant" "54y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121635" "00104" "00149217" "02360" "Familial, autosomal dominant" "45y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121636" "00104" "00149218" "02360" "Isolated (sporadic)" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121637" "00104" "00149219" "02360" "Isolated (sporadic)" "53y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121638" "00104" "00149220" "02360" "Familial, autosomal dominant" "67y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121639" "00104" "00149221" "02360" "Familial, autosomal dominant" "72y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121640" "00104" "00149222" "02360" "Isolated (sporadic)" "74y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121641" "00104" "00149223" "02360" "Familial, autosomal dominant" "56y07m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121642" "00104" "00149224" "02360" "Isolated (sporadic)" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121643" "00104" "00149225" "02360" "Familial, autosomal dominant" "55y07m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121644" "00104" "00149226" "02360" "Familial, autosomal dominant" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121645" "00104" "00149227" "02360" "Familial, autosomal dominant" "67y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121648" "00104" "00149230" "02360" "Familial, autosomal dominant" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121654" "00104" "00149236" "02360" "Familial, autosomal dominant" "63y05m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121660" "00104" "00149242" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121661" "00104" "00149243" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121662" "00104" "00149244" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121663" "00104" "00149245" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121664" "00104" "00149246" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121665" "00104" "00149247" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121666" "00104" "00149248" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121676" "00100" "00149258" "02360" "Familial" "53y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121677" "00104" "00149259" "02360" "Familial" "60y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121678" "00095" "00149260" "02360" "Familial" "44y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121679" "00104" "00149261" "02360" "Familial" "45y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121680" "00104" "00149262" "02360" "Familial" "48y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121681" "00100" "00149263" "02360" "Isolated (sporadic)" "48y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121682" "00104" "00149264" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121683" "00104" "00149265" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121684" "00104" "00149266" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121685" "00104" "00149267" "02360" "Familial" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121686" "00104" "00149268" "02360" "Familial" "69y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121687" "00104" "00149269" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121688" "00104" "00149270" "02360" "Familial" "59y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121689" "00095" "00149271" "02360" "Familial" "60y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121690" "00095" "00149272" "02360" "Familial" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121691" "00104" "00149273" "02360" "Familial" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121692" "00125" "00149274" "02360" "Familial" "66y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121693" "00104" "00149275" "02360" "Familial" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121694" "00104" "00149278" "02360" "Familial" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121695" "00104" "00149279" "02360" "Familial" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121726" "00104" "00149310" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121727" "00132" "00149311" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "Progressive Nonfluent Aphasia" ""
"0000121728" "00104" "00149312" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121729" "00104" "00149313" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121730" "00095" "00149314" "02360" "Unknown" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121731" "00104" "00149315" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121732" "00095" "00149316" "02360" "Unknown" "72y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121737" "00098" "00149321" "02360" "Familial" "63y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121738" "00104" "00149322" "02360" "Isolated (sporadic)" "70y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121739" "00107" "00149323" "02360" "Familial, autosomal dominant" "57y04m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121740" "00108" "00149324" "02360" "Familial, autosomal dominant" "66y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121741" "00109" "00149325" "02360" "Familial, autosomal dominant" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121742" "00110" "00149326" "02360" "Familial, autosomal dominant" "60y" "" "" "" "" "" "" "" "" "" "" "Motor neuron disease; Corticobasal Syndrome" ""
"0000121743" "00111" "00149327" "02360" "Familial, autosomal dominant" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121744" "00104" "00149328" "02360" "Familial" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121745" "00098" "00149329" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121746" "00112" "00149330" "02360" "Familial, autosomal dominant" "61y" "" "" "" "" "" "" "" "" "" "" "Myoclonus-ataxia; Corticobasal Syndrome" ""
"0000121747" "00100" "00149331" "02360" "Familial, autosomal dominant" "63y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121748" "00104" "00149332" "02360" "Familial" "57y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121749" "00104" "00149333" "02360" "Familial" "44y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121750" "00104" "00149334" "02360" "Familial, autosomal dominant" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121751" "00104" "00149335" "02360" "Familial, autosomal dominant" "51y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121752" "00104" "00149336" "02360" "Familial, autosomal dominant" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121753" "00100" "00149337" "02360" "Familial, autosomal dominant" "69y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121754" "00104" "00149338" "02360" "Familial, autosomal dominant" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121755" "00104" "00149339" "02360" "Familial, autosomal dominant" "69y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121756" "00104" "00149340" "02360" "Familial, autosomal dominant" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121757" "00104" "00149341" "02360" "Familial, autosomal dominant" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121758" "00104" "00149342" "02360" "Familial, autosomal dominant" "69y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121759" "00100" "00149343" "02360" "Familial, autosomal dominant" "60y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121760" "00104" "00149344" "02360" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121761" "00104" "00149345" "02360" "Familial, autosomal dominant" "62y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121762" "00104" "00149346" "02360" "Familial, autosomal dominant" "57y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121763" "00100" "00149347" "02360" "Familial, autosomal dominant" "52y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121764" "00104" "00149348" "02360" "Familial, autosomal dominant" "57y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121765" "00104" "00149349" "02360" "Familial, autosomal dominant" "53y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121766" "00104" "00149350" "02360" "Isolated (sporadic)" "73y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121767" "00125" "00149351" "02360" "Familial, autosomal dominant" "45y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121768" "00104" "00149352" "02360" "Familial" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121777" "00104" "00149361" "02360" "Familial, autosomal dominant" "57y10m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121778" "00104" "00149362" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121779" "00104" "00149363" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121780" "00104" "00149364" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121781" "00104" "00149365" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121782" "00104" "00149366" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121783" "00104" "00149367" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121784" "00104" "00149368" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121785" "00104" "00149369" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121786" "00125" "00149370" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121787" "00132" "00149371" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "Progressive Nonfluent Aphasia" ""
"0000121790" "00104" "00149374" "02360" "Familial" "55y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121791" "00104" "00149375" "02360" "Isolated (sporadic)" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121792" "00132" "00149376" "02360" "Familial" "53y" "" "" "" "" "" "" "" "" "" "" "Progressive Nonfluent Aphasia" ""
"0000121793" "00132" "00149377" "02360" "Familial" "53y" "" "" "" "" "" "" "" "" "" "" "Progressive Nonfluent Aphasia" ""
"0000121799" "00125" "00149383" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121800" "00104" "00149384" "02360" "Familial" "37y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121802" "00095" "00149386" "02360" "Familial" "81y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121803" "00095" "00149387" "02360" "Isolated (sporadic)" "80y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121804" "00095" "00149388" "02360" "Isolated (sporadic)" "74y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121805" "00095" "00149389" "02360" "Familial" "73y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121806" "00095" "00149390" "02360" "Familial" "70y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121808" "00104" "00149392" "02360" "Unknown" "54y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121810" "00104" "00149394" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121813" "00095" "00149398" "02360" "Unknown" "76y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121815" "00104" "00149400" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121817" "00098" "00149402" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121818" "00104" "00149403" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121819" "00104" "00149404" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121820" "00104" "00149405" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121821" "00104" "00149406" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121832" "00104" "00149417" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121833" "00104" "00149418" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121852" "00104" "00149437" "02360" "Familial, autosomal dominant" "72y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121854" "00113" "00149439" "02360" "Isolated (sporadic)" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121855" "00113" "00149440" "02360" "Isolated (sporadic)" "70y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121858" "00104" "00149443" "02360" "Familial, autosomal dominant" "54y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121862" "00104" "00149447" "02360" "Familial, autosomal dominant" "60y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121865" "00104" "00149450" "02360" "Familial" "47y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121866" "00104" "00149451" "02360" "Familial" "59y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121867" "00100" "00149452" "02360" "Familial" "62y06m" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive; Vascular Dementia" ""
"0000121868" "00098" "00149453" "02360" "Familial" "63y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121869" "00104" "00149454" "02360" "Familial" "60y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121870" "00104" "00149455" "02360" "Familial, autosomal dominant" "59y04m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121871" "00104" "00149456" "02360" "Familial" "63y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121872" "00104" "00149457" "02360" "Familial" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121873" "00125" "00149458" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121874" "00104" "00149459" "02360" "Familial" "54y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121875" "00104" "00149460" "02360" "Familial, autosomal dominant" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121876" "00105" "00149461" "02360" "Familial" "71y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121877" "00104" "00149462" "02360" "Familial" "69y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121878" "00125" "00149463" "02360" "Familial" "43y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121879" "00104" "00149464" "02360" "Unknown" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121880" "00098" "00149465" "02360" "Familial" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121881" "00104" "00149466" "02360" "Familial" "66y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121882" "00104" "00149467" "02360" "Familial" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121883" "00125" "00149468" "02360" "Isolated (sporadic)" "64y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121884" "00104" "00149469" "02360" "Unknown" "63y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121885" "00104" "00149470" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121886" "00125" "00149471" "02360" "Familial" "69y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000121887" "00104" "00149472" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121888" "00100" "00149473" "02360" "Unknown" "46y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121889" "00104" "00149474" "02360" "Familial" "54y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121890" "00104" "00149475" "02360" "Familial" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121891" "00104" "00149476" "02360" "Familial" "45y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121892" "00100" "00149477" "02360" "Familial, autosomal dominant" "63y" "Dementia" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121893" "00104" "00149478" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121953" "00100" "00149538" "02360" "Isolated (sporadic)" "65y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121954" "00104" "00149539" "02360" "Familial" "50y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121955" "00100" "00149540" "02360" "Isolated (sporadic)" "79y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121956" "00100" "00149541" "02360" "Familial" "76y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121957" "00100" "00149542" "02360" "Isolated (sporadic)" "55y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000121958" "00095" "00149543" "02360" "Isolated (sporadic)" "63y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121959" "00104" "00149544" "02360" "Isolated (sporadic)" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121960" "00104" "00149545" "02360" "Familial" "54y06m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121961" "00124" "00149546" "02360" "Isolated (sporadic)" "68y" "" "" "" "" "" "" "" "" "" "MFDGA" "" ""
"0000121962" "00124" "00149547" "02360" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "MFDGA" "" ""
"0000121965" "00095" "00149550" "02360" "Unknown" "77y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121969" "00104" "00149554" "02360" "Familial, autosomal dominant" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000121970" "00104" "00149555" "02360" "Familial, autosomal dominant" "64y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122011" "00125" "00149596" "02360" "Familial" "61y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000122012" "00125" "00149597" "02360" "Familial, autosomal dominant" "62y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000122013" "00104" "00149598" "02360" "Familial, autosomal dominant" "42y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122015" "00104" "00149600" "02360" "Unknown" "52y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122016" "00107" "00149601" "02360" "Familial" "73y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122021" "00107" "00149606" "02360" "Unknown" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122022" "00104" "00149607" "02360" "Familial" "59y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122023" "00107" "00149608" "02360" "Familial" "58y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122024" "00104" "00149609" "02360" "Familial" "59y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122025" "00125" "00149610" "02360" "Familial" "60y" "" "" "" "" "" "" "" "" "" "" "Corticobasal Syndrome" ""
"0000122026" "00104" "00149611" "02360" "Familial" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122027" "00104" "00149612" "02360" "Familial" "62y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122028" "00107" "00149613" "02360" "Familial" "59y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122029" "00107" "00149614" "02360" "Unknown" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122030" "00104" "00149615" "02360" "Familial" "45y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122031" "00104" "00149616" "02360" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122032" "00104" "00149617" "02360" "Familial" "65y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122033" "00104" "00149618" "02360" "Unknown" "56y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122034" "00104" "00149619" "02360" "Unknown" "68y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122046" "00104" "00149632" "02360" "Familial" "63y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122047" "00104" "00149633" "02360" "Isolated (sporadic)" "61y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122053" "00100" "00149639" "02360" "Familial" "59y" "" "" "" "" "" "" "" "" "" "" "Aphasia, primary progressive" ""
"0000122070" "00104" "00149656" "02360" "Familial, autosomal dominant" "50y" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122075" "00095" "00149661" "02360" "Familial" "68y02m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000122129" "00104" "00149715" "02360" "Familial, autosomal dominant" "63y05m" "" "" "" "" "" "" "" "" "" "" "" ""
"0000242047" "00096" "00320003" "01164" "Unknown" "" "Dementia" "" "" "" "" "" "" "" "" "" "65" ""
"0000242859" "04255" "00324290" "03951" "Isolated (sporadic)" "65y" "gait ataxia; Hypertonia; Brisk reflexes; Dysarthria; Fasciculations;" "64y" "66y" "gait ataxia; Dysarthria" "" "" "" "" "" "ALS" "ALS" ""
"0000243012" "00198" "00324470" "01807" "Unknown" "" "Frontotemporal dementia (HP:0002145)" "" "" "" "" "" "" "" "" "" "" ""
"0000247034" "00198" "00328826" "01807" "Unknown" "" "Apathy (HP:0000741); Frontotemporal dementia (HP:0002145); Aphasia (HP:0002381)" "" "" "" "" "" "" "" "" "" "" ""
"0000257442" "04270" "00362028" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "progressive myoclonus epilepsy" ""
"0000271544" "00198" "00376336" "01807" "Unknown" "" "Dementia (HP:0000726); Frontal lobe dementia (HP:0000727); Personality changes (HP:0000751); Frontotemporal dementia (HP:0002145); Aphasia (HP:0002381); Language impairment (HP:0002463); Neuronal loss in central nervous system (HP:0002529)" "" "" "" "" "" "" "" "" "" "" ""
"0000277270" "05258" "00383485" "00000" "Familial, autosomal recessive" "" "VEP results: atypical" "" "12y6m" "" "" "" "" "" "" "" "lipofuscinosis, ceroid, neuronal, type 11 (CLN-11)" ""
"0000287196" "04214" "00393990" "00000" "Familial, autosomal recessive" "" "uncharacterized late onset dementia onset at 60 years old" "60y" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000287197" "04214" "00393991" "00000" "Familial, autosomal recessive" "" "uncharacterized late onset dementia onset at 70 years old" "40y" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000287198" "04214" "00393992" "00000" "Familial, autosomal recessive" "" "uncharacterized late onset dementia onset at 73 years old" "73y" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000287199" "04214" "00393993" "00000" "Familial, autosomal recessive" "" "uncharacterized late onset dementia reported as severe AD, onset at 74 yo" "30y" "" "" "" "" "" "" "" "" "Usher syndrome" ""
"0000287200" "04214" "00393994" "00000" "Familial, autosomal recessive" "" "Severity, moderate ; onset, adulthood; evolution" "" "" "" "" "" "" "" "" "" "Usher syndrome" ""
## Screenings ## Do not remove or alter this header ##
## Count = 279
"{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}"
"0000057158" "00057197" "1" "01225" "01225" "2016-01-14 14:07:27" "" "" "SEQ-NG" "DNA" "" ""
"0000057159" "00057198" "1" "01225" "01225" "2016-01-14 14:07:27" "" "" "SEQ-NG" "DNA" "" ""
"0000105170" "00104698" "1" "00006" "00006" "2017-05-19 16:46:57" "" "" "SEQ;SEQ-NG" "DNA" "" ""
"0000105171" "00104699" "1" "00006" "00006" "2017-05-19 16:53:10" "" "" "SEQ" "DNA" "" ""
"0000149663" "00148807" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149848" "00148992" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149947" "00149091" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149948" "00149092" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149949" "00149093" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149950" "00149094" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149951" "00149095" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149952" "00149096" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149953" "00149097" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149954" "00149098" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149955" "00149099" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149956" "00149100" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149957" "00149101" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149958" "00149102" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149959" "00149103" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149960" "00149104" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149961" "00149105" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149962" "00149106" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149963" "00149107" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149964" "00149108" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149965" "00149109" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149966" "00149110" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149967" "00149111" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149997" "00149141" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149998" "00149142" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000149999" "00149143" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150000" "00149144" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150001" "00149145" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150002" "00149146" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150003" "00149147" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150004" "00149148" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150005" "00149149" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150006" "00149150" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150007" "00149151" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150008" "00149152" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150009" "00149153" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150010" "00149154" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150011" "00149155" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150012" "00149156" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150013" "00149157" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150014" "00149158" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150015" "00149159" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150016" "00149160" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150017" "00149161" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150018" "00149162" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150019" "00149163" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150020" "00149164" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150021" "00149165" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150022" "00149166" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150023" "00149167" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150024" "00149168" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150025" "00149169" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150026" "00149170" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150027" "00149171" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150028" "00149172" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150036" "00149180" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150037" "00149181" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150038" "00149182" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150039" "00149183" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150044" "00149188" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150045" "00149189" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150046" "00149190" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150047" "00149191" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150056" "00149200" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150057" "00149201" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150058" "00149202" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150059" "00149203" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150064" "00149208" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150065" "00149209" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150066" "00149210" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150067" "00149211" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150068" "00149212" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150069" "00149213" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150070" "00149214" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150071" "00149215" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150072" "00149216" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150073" "00149217" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150074" "00149218" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150075" "00149219" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150076" "00149220" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150077" "00149221" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150078" "00149222" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150079" "00149223" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150080" "00149224" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150081" "00149225" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150082" "00149226" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150083" "00149227" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150086" "00149230" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150092" "00149236" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150098" "00149242" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150099" "00149243" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150100" "00149244" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150101" "00149245" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150102" "00149246" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150103" "00149247" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150104" "00149248" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150114" "00149258" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150115" "00149259" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150116" "00149260" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150117" "00149261" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150118" "00149262" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150119" "00149263" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150120" "00149264" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150121" "00149265" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150122" "00149266" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150123" "00149267" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150124" "00149268" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150125" "00149269" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150126" "00149270" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150127" "00149271" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150128" "00149272" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150129" "00149273" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150130" "00149274" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150131" "00149275" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150132" "00149276" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150133" "00149277" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150134" "00149278" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150135" "00149279" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150166" "00149310" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150167" "00149311" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150168" "00149312" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150169" "00149313" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150170" "00149314" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150171" "00149315" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150172" "00149316" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150177" "00149321" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150178" "00149322" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150179" "00149323" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150180" "00149324" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150181" "00149325" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150182" "00149326" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150183" "00149327" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150184" "00149328" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150185" "00149329" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150186" "00149330" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150187" "00149331" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150188" "00149332" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150189" "00149333" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150190" "00149334" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150191" "00149335" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150192" "00149336" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150193" "00149337" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150194" "00149338" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150195" "00149339" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150196" "00149340" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150197" "00149341" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150198" "00149342" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150199" "00149343" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150200" "00149344" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150201" "00149345" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150202" "00149346" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150203" "00149347" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150204" "00149348" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150205" "00149349" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150206" "00149350" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150207" "00149351" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150208" "00149352" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150217" "00149361" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150218" "00149362" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150219" "00149363" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150220" "00149364" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150221" "00149365" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150222" "00149366" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150223" "00149367" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150224" "00149368" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150225" "00149369" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150226" "00149370" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150227" "00149371" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150230" "00149374" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150231" "00149375" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150232" "00149376" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150233" "00149377" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150239" "00149383" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150240" "00149384" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150242" "00149386" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150243" "00149387" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150244" "00149388" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150245" "00149389" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150246" "00149390" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150248" "00149392" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150250" "00149394" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150251" "00149395" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150254" "00149398" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150256" "00149400" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150258" "00149402" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150259" "00149403" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150260" "00149404" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150261" "00149405" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150262" "00149406" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150273" "00149417" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150274" "00149418" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150293" "00149437" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150295" "00149439" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150296" "00149440" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150299" "00149443" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150303" "00149447" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150306" "00149450" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150307" "00149451" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150308" "00149452" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150309" "00149453" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150310" "00149454" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150311" "00149455" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150312" "00149456" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150313" "00149457" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150314" "00149458" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150315" "00149459" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150316" "00149460" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150317" "00149461" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150318" "00149462" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150319" "00149463" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150320" "00149464" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150321" "00149465" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150322" "00149466" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150323" "00149467" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150324" "00149468" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150325" "00149469" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150326" "00149470" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150327" "00149471" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150328" "00149472" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150329" "00149473" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150330" "00149474" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150331" "00149475" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150332" "00149476" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150333" "00149477" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150334" "00149478" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150394" "00149538" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150395" "00149539" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150396" "00149540" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150397" "00149541" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150398" "00149542" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150399" "00149543" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150400" "00149544" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150401" "00149545" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150402" "00149546" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150403" "00149547" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150406" "00149550" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150410" "00149554" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150411" "00149555" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150452" "00149596" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150453" "00149597" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150454" "00149598" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150456" "00149600" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150457" "00149601" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150462" "00149606" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150463" "00149607" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150464" "00149608" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150465" "00149609" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150466" "00149610" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150467" "00149611" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150468" "00149612" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150469" "00149613" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150470" "00149614" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150471" "00149615" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150472" "00149616" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150473" "00149617" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150474" "00149618" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150475" "00149619" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150488" "00149632" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150489" "00149633" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150495" "00149639" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150512" "00149656" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150517" "00149661" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000150571" "00149715" "1" "02360" "00008" "2013-03-04 17:13:03" "" "" "?" "DNA" "" ""
"0000321185" "00320003" "1" "01164" "01164" "2020-11-17 15:50:40" "" "" "SEQ-NG-I" "DNA" "" ""
"0000325480" "00324290" "1" "03951" "03951" "2020-12-04 16:36:15" "" "" "SEQ" "DNA" "peripheral blood" ""
"0000325660" "00324470" "1" "01807" "01807" "2020-12-14 13:35:16" "" "" "SEQ" "DNA" "" ""
"0000330042" "00328826" "1" "01807" "01807" "2021-02-01 09:52:01" "" "" "SEQ" "DNA" "" ""
"0000363256" "00362028" "1" "00006" "00006" "2021-04-14 11:32:13" "" "" "SEQ-NG" "DNA" "" "WES"
"0000377532" "00376336" "1" "01807" "01807" "2021-06-21 13:40:41" "" "" "SEQ" "DNA" "" ""
"0000384710" "00383485" "1" "00000" "03840" "2021-09-29 11:58:04" "" "" "?" "?" "" ""
"0000395238" "00393990" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES"
"0000395239" "00393991" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES"
"0000395240" "00393992" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES"
"0000395241" "00393993" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES"
"0000395242" "00393994" "1" "00000" "00008" "2021-11-30 07:46:38" "" "" "SEQ-NG" "DNA" "blood" "WES"
## Screenings_To_Genes ## Do not remove or alter this header ##
## Count = 275
"{{screeningid}}" "{{geneid}}"
"0000057158" "GRN"
"0000057159" "GRN"
"0000105170" "GRN"
"0000105171" "GRN"
"0000149663" "GRN"
"0000149848" "GRN"
"0000149947" "GRN"
"0000149948" "GRN"
"0000149949" "GRN"
"0000149950" "GRN"
"0000149951" "GRN"
"0000149952" "GRN"
"0000149953" "GRN"
"0000149954" "GRN"
"0000149955" "GRN"
"0000149956" "GRN"
"0000149957" "GRN"
"0000149958" "GRN"
"0000149959" "GRN"
"0000149960" "GRN"
"0000149961" "GRN"
"0000149962" "GRN"
"0000149963" "GRN"
"0000149964" "GRN"
"0000149965" "GRN"
"0000149966" "GRN"
"0000149967" "GRN"
"0000149997" "GRN"
"0000149998" "GRN"
"0000149999" "GRN"
"0000150000" "GRN"
"0000150001" "GRN"
"0000150002" "GRN"
"0000150003" "GRN"
"0000150004" "GRN"
"0000150005" "GRN"
"0000150006" "GRN"
"0000150007" "GRN"
"0000150008" "GRN"
"0000150009" "GRN"
"0000150010" "GRN"
"0000150011" "GRN"
"0000150012" "GRN"
"0000150013" "GRN"
"0000150014" "GRN"
"0000150015" "GRN"
"0000150016" "GRN"
"0000150017" "GRN"
"0000150018" "GRN"
"0000150019" "GRN"
"0000150020" "GRN"
"0000150021" "GRN"
"0000150022" "GRN"
"0000150023" "GRN"
"0000150024" "GRN"
"0000150025" "GRN"
"0000150026" "GRN"
"0000150027" "GRN"
"0000150028" "GRN"
"0000150036" "GRN"
"0000150037" "GRN"
"0000150038" "GRN"
"0000150039" "GRN"
"0000150044" "GRN"
"0000150045" "GRN"
"0000150046" "GRN"
"0000150047" "GRN"
"0000150056" "GRN"
"0000150057" "GRN"
"0000150058" "GRN"
"0000150059" "GRN"
"0000150064" "GRN"
"0000150065" "GRN"
"0000150066" "GRN"
"0000150067" "GRN"
"0000150068" "GRN"
"0000150069" "GRN"
"0000150070" "GRN"
"0000150071" "GRN"
"0000150072" "GRN"
"0000150073" "GRN"
"0000150074" "GRN"
"0000150075" "GRN"
"0000150076" "GRN"
"0000150077" "GRN"
"0000150078" "GRN"
"0000150079" "GRN"
"0000150080" "GRN"
"0000150081" "GRN"
"0000150082" "GRN"
"0000150083" "GRN"
"0000150086" "GRN"
"0000150092" "GRN"
"0000150098" "GRN"
"0000150099" "GRN"
"0000150100" "GRN"
"0000150101" "GRN"
"0000150102" "GRN"
"0000150103" "GRN"
"0000150104" "GRN"
"0000150114" "GRN"
"0000150115" "GRN"
"0000150116" "GRN"
"0000150117" "GRN"
"0000150118" "GRN"
"0000150119" "GRN"
"0000150120" "GRN"
"0000150121" "GRN"
"0000150122" "GRN"
"0000150123" "GRN"
"0000150124" "GRN"
"0000150125" "GRN"
"0000150126" "GRN"
"0000150127" "GRN"
"0000150128" "GRN"
"0000150129" "GRN"
"0000150130" "GRN"
"0000150131" "GRN"
"0000150132" "GRN"
"0000150133" "GRN"
"0000150134" "GRN"
"0000150135" "GRN"
"0000150166" "GRN"
"0000150167" "GRN"
"0000150168" "GRN"
"0000150169" "GRN"
"0000150170" "GRN"
"0000150171" "GRN"
"0000150172" "GRN"
"0000150177" "GRN"
"0000150178" "GRN"
"0000150179" "GRN"
"0000150180" "GRN"
"0000150181" "GRN"
"0000150182" "GRN"
"0000150183" "GRN"
"0000150184" "GRN"
"0000150185" "GRN"
"0000150186" "GRN"
"0000150187" "GRN"
"0000150188" "GRN"
"0000150189" "GRN"
"0000150190" "GRN"
"0000150191" "GRN"
"0000150192" "GRN"
"0000150193" "GRN"
"0000150194" "GRN"
"0000150195" "GRN"
"0000150196" "GRN"
"0000150197" "GRN"
"0000150198" "GRN"
"0000150199" "GRN"
"0000150200" "GRN"
"0000150201" "GRN"
"0000150202" "GRN"
"0000150203" "GRN"
"0000150204" "GRN"
"0000150205" "GRN"
"0000150206" "GRN"
"0000150207" "GRN"
"0000150208" "GRN"
"0000150217" "GRN"
"0000150218" "GRN"
"0000150219" "GRN"
"0000150220" "GRN"
"0000150221" "GRN"
"0000150222" "GRN"
"0000150223" "GRN"
"0000150224" "GRN"
"0000150225" "GRN"
"0000150226" "GRN"
"0000150227" "GRN"
"0000150230" "GRN"
"0000150231" "GRN"
"0000150232" "GRN"
"0000150233" "GRN"
"0000150239" "GRN"
"0000150240" "GRN"
"0000150242" "GRN"
"0000150243" "GRN"
"0000150244" "GRN"
"0000150245" "GRN"
"0000150246" "GRN"
"0000150248" "GRN"
"0000150250" "GRN"
"0000150251" "GRN"
"0000150254" "GRN"
"0000150256" "GRN"
"0000150258" "GRN"
"0000150259" "GRN"
"0000150260" "GRN"
"0000150261" "GRN"
"0000150262" "GRN"
"0000150273" "GRN"
"0000150274" "GRN"
"0000150293" "GRN"
"0000150295" "GRN"
"0000150296" "GRN"
"0000150299" "GRN"
"0000150303" "GRN"
"0000150306" "GRN"
"0000150307" "GRN"
"0000150308" "GRN"
"0000150309" "GRN"
"0000150310" "GRN"
"0000150311" "GRN"
"0000150312" "GRN"
"0000150313" "GRN"
"0000150314" "GRN"
"0000150315" "GRN"
"0000150316" "GRN"
"0000150317" "GRN"
"0000150318" "GRN"
"0000150319" "GRN"
"0000150320" "GRN"
"0000150321" "GRN"
"0000150322" "GRN"
"0000150323" "GRN"
"0000150324" "GRN"
"0000150325" "GRN"
"0000150326" "GRN"
"0000150327" "GRN"
"0000150328" "GRN"
"0000150329" "GRN"
"0000150330" "GRN"
"0000150331" "GRN"
"0000150332" "GRN"
"0000150333" "GRN"
"0000150334" "GRN"
"0000150394" "GRN"
"0000150395" "GRN"
"0000150396" "GRN"
"0000150397" "GRN"
"0000150398" "GRN"
"0000150399" "GRN"
"0000150400" "GRN"
"0000150401" "GRN"
"0000150402" "GRN"
"0000150403" "GRN"
"0000150406" "GRN"
"0000150410" "GRN"
"0000150411" "GRN"
"0000150452" "GRN"
"0000150453" "GRN"
"0000150454" "GRN"
"0000150456" "GRN"
"0000150457" "GRN"
"0000150462" "GRN"
"0000150463" "GRN"
"0000150464" "GRN"
"0000150465" "GRN"
"0000150466" "GRN"
"0000150467" "GRN"
"0000150468" "GRN"
"0000150469" "GRN"
"0000150470" "GRN"
"0000150471" "GRN"
"0000150472" "GRN"
"0000150473" "GRN"
"0000150474" "GRN"
"0000150475" "GRN"
"0000150488" "GRN"
"0000150489" "GRN"
"0000150495" "GRN"
"0000150512" "GRN"
"0000150517" "GRN"
"0000150571" "GRN"
"0000321185" "GRN"
"0000325480" "GRN"
"0000384710" "GRN"
"0000395238" "GRN"
"0000395239" "GRN"
"0000395240" "GRN"
"0000395241" "GRN"
"0000395242" "GRN"
## Variants_On_Genome ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Count = 465
"{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}"
"0000087446" "0" "50" "17" "42428094" "42428094" "subst" "4.4682E-5" "01225" "GRN_000002" "g.42428094C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.44350726C>T" "" "VUS" ""
"0000087447" "0" "50" "17" "42430088" "42430088" "subst" "0" "01225" "GRN_000001" "g.42430088G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.44352720G>T" "" "VUS" ""
"0000170442" "3" "70" "17" "42428509" "42428512" "del" "0" "00006" "GRN_000003" "g.42428509_42428512del" "" "{PMID:Smith 2012:22608501}, {DOI:Smith 2012:10.1016/j.ajhg.2012.04.021}" "" "" "" "Germline" "yes" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "likely pathogenic" ""
"0000170443" "1" "90" "17" "42429772" "42429772" "subst" "4.06507E-6" "00006" "GRN_000004" "g.42429772C>T" "" "{PMID:Smith 2012:22608501}, {DOI:Smith 2012:10.1016/j.ajhg.2012.04.021}" "" "" "no variants 2nd chromosome" "Germline" "?" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243381" "0" "99" "17" "42427619" "42427619" "subst" "0" "02360" "GRN_000085" "g.42427619C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750077" "0" "" "" "g.44350251C>T" "" "pathogenic" ""
"0000243382" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243383" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243384" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243385" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243386" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243387" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243388" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243389" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "yes" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243390" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "no" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243391" "0" "99" "17" "42422707" "42422707" "subst" "0" "02360" "GRN_000060" "g.42422707G>C" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "no" "rs63750313" "0" "" "" "g.44345339G>C" "" "pathogenic" ""
"0000243392" "0" "99" "17" "42426535" "42426535" "subst" "0" "02360" "GRN_000064" "g.42426535G>A" "" "" "" "" "Point mutation in translation initiation codon predicting failed translation" "Unknown" "no" "rs63750331" "0" "" "" "g.44349167G>A" "" "pathogenic" ""
"0000243393" "0" "99" "17" "42427626" "42427627" "del" "4.06055E-6" "02360" "GRN_000086" "g.42427626_42427627del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750405" "0" "" "" "g.44350258_44350259del" "" "pathogenic" ""
"0000243394" "0" "99" "17" "42427626" "42427627" "del" "4.06055E-6" "02360" "GRN_000086" "g.42427626_42427627del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750405" "0" "" "" "g.44350258_44350259del" "" "pathogenic" ""
"0000243395" "0" "99" "17" "42428531" "42428532" "ins" "0" "02360" "GRN_000107" "g.42428531_42428532insCTGA" "" "" "" "" "Tetranucleotide insertion in intron 8 splice donor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750976" "0" "" "" "g.44351163_44351164insCTGA" "" "pathogenic" ""
"0000243396" "0" "99" "17" "42426534" "42426534" "subst" "8.12922E-6" "02360" "GRN_000063" "g.42426534T>C" "" "" "" "" "Point mutation in translation initiation codon resulting in reduced mRNA levels" "Unknown" "no" "rs63751006" "0" "" "" "g.44349166T>C" "" "pathogenic" ""
"0000243397" "0" "99" "17" "42426534" "42426534" "subst" "8.12922E-6" "02360" "GRN_000063" "g.42426534T>C" "" "" "" "" "Point mutation in translation initiation codon resulting in reduced mRNA levels" "Unknown" "no" "rs63751006" "0" "" "" "g.44349166T>C" "" "pathogenic" ""
"0000243398" "0" "99" "17" "42426619" "42426622" "dup" "0" "02360" "GRN_000070" "g.42426619_42426622dup" "" "" "" "" "Tetranucleotide insertion in coding region causing frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751057" "0" "" "" "g.44349251_44349254dup" "" "pathogenic" ""
"0000243399" "0" "99" "17" "42426619" "42426622" "dup" "0" "02360" "GRN_000070" "g.42426619_42426622dup" "" "" "" "" "Tetranucleotide insertion in coding region causing frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751057" "0" "" "" "g.44349251_44349254dup" "" "pathogenic" ""
"0000243400" "0" "99" "17" "42426619" "42426622" "dup" "0" "02360" "GRN_000070" "g.42426619_42426622dup" "" "" "" "" "Tetranucleotide insertion in coding region causing frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751057" "0" "" "" "g.44349251_44349254dup" "" "pathogenic" ""
"0000243401" "0" "99" "17" "42426619" "42426622" "dup" "0" "02360" "GRN_000070" "g.42426619_42426622dup" "" "" "" "" "Tetranucleotide insertion in coding region causing frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751057" "0" "" "" "g.44349251_44349254dup" "" "pathogenic" ""
"0000243402" "0" "99" "17" "42426619" "42426622" "dup" "0" "02360" "GRN_000070" "g.42426619_42426622dup" "" "" "" "" "Tetranucleotide insertion in coding region causing frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751057" "0" "" "" "g.44349251_44349254dup" "" "pathogenic" ""
"0000243403" "0" "99" "17" "42426619" "42426622" "dup" "0" "02360" "GRN_000070" "g.42426619_42426622dup" "" "" "" "" "Tetranucleotide insertion in coding region causing frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751057" "0" "" "" "g.44349251_44349254dup" "" "pathogenic" ""
"0000243404" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "yes" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243405" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "yes" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243406" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243407" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243408" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243409" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243410" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243411" "0" "99" "17" "42427634" "42427637" "del" "0" "02360" "GRN_000088" "g.42427634_42427637del" "" "" "" "" "This is the same mutation as GRN g.1098_1101delTAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63749801" "0" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000243412" "0" "99" "17" "42428829" "42428829" "subst" "0" "02360" "GRN_000116" "g.42428829G>A" "" "" "" "" "Point mutation in intron 9 splice donor site predicted to cause exon 9 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750707" "0" "" "" "g.44351461G>A" "" "pathogenic" ""
"0000243413" "0" "99" "17" "42429129" "42429129" "del" "4.0812E-6" "02360" "GRN_000126" "g.42429129del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750805" "0" "" "" "g.44351761del" "" "pathogenic" ""
"0000243414" "0" "99" "17" "42429141" "42429141" "subst" "0" "02360" "GRN_000127" "g.42429141G>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751213" "0" "" "" "g.44351773G>A" "" "pathogenic" ""
"0000243415" "0" "99" "17" "42429141" "42429141" "subst" "0" "02360" "GRN_000127" "g.42429141G>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751213" "0" "" "" "g.44351773G>A" "" "pathogenic" ""
"0000243416" "0" "99" "17" "42429141" "42429141" "subst" "0" "02360" "GRN_000127" "g.42429141G>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751213" "0" "" "" "g.44351773G>A" "" "pathogenic" ""
"0000243417" "0" "99" "17" "42429455" "42429455" "subst" "0" "02360" "GRN_000133" "g.42429455C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751180" "0" "" "" "g.44352087C>T" "" "pathogenic" ""
"0000243418" "0" "99" "17" "42429455" "42429455" "subst" "0" "02360" "GRN_000133" "g.42429455C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751180" "0" "" "" "g.44352087C>T" "" "pathogenic" ""
"0000243419" "0" "99" "17" "42429455" "42429455" "subst" "0" "02360" "GRN_000133" "g.42429455C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751180" "0" "" "" "g.44352087C>T" "" "pathogenic" ""
"0000243420" "0" "99" "17" "42429455" "42429455" "subst" "0" "02360" "GRN_000133" "g.42429455C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751180" "0" "" "" "g.44352087C>T" "" "pathogenic" ""
"0000243421" "0" "99" "17" "42429455" "42429455" "subst" "0" "02360" "GRN_000133" "g.42429455C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751180" "0" "" "" "g.44352087C>T" "" "pathogenic" ""
"0000243422" "0" "99" "17" "42429605" "42429605" "subst" "0" "02360" "GRN_000137" "g.42429605C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749908" "0" "" "" "g.44352237C>T" "" "pathogenic" ""
"0000243423" "0" "99" "17" "42429605" "42429605" "subst" "0" "02360" "GRN_000137" "g.42429605C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749908" "0" "" "" "g.44352237C>T" "" "pathogenic" ""
"0000243427" "0" "99" "17" "42426558" "42426558" "subst" "0" "02360" "GRN_000067" "g.42426558C>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "rs63751243" "0" "" "" "g.44349190C>A" "" "pathogenic" ""
"0000243428" "0" "99" "17" "42426558" "42426558" "subst" "0" "02360" "GRN_000067" "g.42426558C>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "rs63751243" "0" "" "" "g.44349190C>A" "" "pathogenic" ""
"0000243429" "0" "99" "17" "42426558" "42426558" "subst" "0" "02360" "GRN_000067" "g.42426558C>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "rs63751243" "0" "" "" "g.44349190C>A" "" "pathogenic" ""
"0000243430" "0" "99" "17" "42426558" "42426558" "subst" "0" "02360" "GRN_000067" "g.42426558C>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "yes" "rs63751243" "0" "" "" "g.44349190C>A" "" "pathogenic" ""
"0000243431" "0" "99" "17" "42426558" "42426558" "subst" "0" "02360" "GRN_000067" "g.42426558C>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "rs63751243" "0" "" "" "g.44349190C>A" "" "pathogenic" ""
"0000243432" "0" "99" "17" "42426595" "42426596" "ins" "0" "02360" "GRN_000069" "g.42426595_42426596insC" "" "" "" "" "Single nucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750981" "0" "" "" "g.44349227_44349228insC" "" "pathogenic" ""
"0000243433" "0" "99" "17" "42426595" "42426596" "ins" "0" "02360" "GRN_000069" "g.42426595_42426596insC" "" "" "" "" "Single nucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750981" "0" "" "" "g.44349227_44349228insC" "" "pathogenic" ""
"0000243434" "0" "99" "17" "42426634" "42426634" "del" "0" "02360" "GRN_000072" "g.42426634del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751073" "0" "" "" "g.44349266del" "" "pathogenic" ""
"0000243435" "0" "99" "17" "42426634" "42426634" "del" "0" "02360" "GRN_000072" "g.42426634del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751073" "0" "" "" "g.44349266del" "" "pathogenic" ""
"0000243436" "0" "99" "17" "42426634" "42426634" "del" "0" "02360" "GRN_000072" "g.42426634del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751073" "0" "" "" "g.44349266del" "" "pathogenic" ""
"0000243437" "0" "99" "17" "42426671" "42426671" "subst" "0" "02360" "GRN_000074" "g.42426671G>A" "" "" "" "" "Point mutation in intron 2 splice donor site predicted to cause exon 2 skipping, deletion of Kozak sequence and failed translation initiation" "Unknown" "no" "rs63749844" "0" "" "" "g.44349303G>A" "" "pathogenic" ""
"0000243438" "0" "99" "17" "42426671" "42426671" "subst" "0" "02360" "GRN_000074" "g.42426671G>A" "" "" "" "" "Point mutation in intron 2 splice donor site predicted to cause exon 2 skipping, deletion of Kozak sequence and failed translation initiation" "Unknown" "no" "rs63749844" "0" "" "" "g.44349303G>A" "" "pathogenic" ""
"0000243439" "0" "99" "17" "42426809" "42426809" "del" "0" "02360" "GRN_000075" "g.42426809del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751092" "0" "" "" "g.44349441del" "" "pathogenic" ""
"0000243440" "0" "99" "17" "42426809" "42426809" "del" "0" "02360" "GRN_000075" "g.42426809del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751092" "0" "" "" "g.44349441del" "" "pathogenic" ""
"0000243441" "0" "99" "17" "42426809" "42426809" "del" "0" "02360" "GRN_000075" "g.42426809del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751092" "0" "" "" "g.44349441del" "" "pathogenic" ""
"0000243442" "0" "99" "17" "42426809" "42426809" "del" "0" "02360" "GRN_000075" "g.42426809del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751092" "0" "" "" "g.44349441del" "" "pathogenic" ""
"0000243443" "0" "99" "17" "42426889" "42426890" "del" "0" "02360" "GRN_000076" "g.42426889_42426890del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750373" "0" "" "" "g.44349521_44349522del" "" "pathogenic" ""
"0000243444" "0" "99" "17" "42426889" "42426890" "del" "0" "02360" "GRN_000076" "g.42426889_42426890del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750373" "0" "" "" "g.44349521_44349522del" "" "pathogenic" ""
"0000243445" "0" "99" "17" "42427809" "42427809" "subst" "0" "02360" "GRN_000090" "g.42427809G>A" "" "" "" "" "Point mutation in intron 5 splice acceptor site predicted to cause exon 6 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750536" "0" "" "" "g.44350441G>A" "" "pathogenic" ""
"0000243446" "0" "99" "17" "42427809" "42427809" "subst" "0" "02360" "GRN_000090" "g.42427809G>A" "" "" "" "" "Point mutation in intron 5 splice acceptor site predicted to cause exon 6 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750536" "0" "" "" "g.44350441G>A" "" "pathogenic" ""
"0000243447" "0" "99" "17" "42428135" "42428136" "del" "0" "02360" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751085" "0" "" "" "g.44350767_44350768del" "" "pathogenic" ""
"0000243448" "0" "99" "17" "42428135" "42428136" "del" "0" "02360" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751085" "0" "" "" "g.44350767_44350768del" "" "pathogenic" ""
"0000243449" "0" "99" "17" "42428135" "42428136" "del" "0" "02360" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751085" "0" "" "" "g.44350767_44350768del" "" "pathogenic" ""
"0000243450" "0" "99" "17" "42428135" "42428136" "del" "0" "02360" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751085" "0" "" "" "g.44350767_44350768del" "" "pathogenic" ""
"0000243451" "0" "99" "17" "42428135" "42428136" "del" "0" "02360" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751085" "0" "" "" "g.44350767_44350768del" "" "pathogenic" ""
"0000243452" "0" "99" "17" "42428135" "42428136" "del" "0" "02360" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751085" "0" "" "" "g.44350767_44350768del" "" "pathogenic" ""
"0000243453" "0" "99" "17" "42428169" "42428169" "subst" "4.07628E-6" "02360" "GRN_000100" "g.42428169G>C" "" "" "" "" "Point mutation in intron 7 splice donor site predicted to cause exon 7 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749817" "0" "" "" "g.44350801G>C" "" "pathogenic" ""
"0000243454" "0" "99" "17" "42428455" "42428456" "del" "0" "02360" "GRN_000105" "g.42428455_42428456del" "" "" "" "" "Dinucleotide deletion in coding region creating a premature termination codon, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751035" "0" "" "" "g.44351087_44351088del" "" "pathogenic" ""
"0000243455" "0" "99" "17" "42428455" "42428456" "del" "0" "02360" "GRN_000105" "g.42428455_42428456del" "" "" "" "" "Dinucleotide deletion in coding region creating a premature termination codon, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751035" "0" "" "" "g.44351087_44351088del" "" "pathogenic" ""
"0000243456" "0" "99" "17" "42428730" "42428730" "subst" "0" "02360" "GRN_000108" "g.42428730G>C" "" "" "" "" "Point mutation in intron 8 splice acceptor site predicted to cause exon 9 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751296" "0" "" "" "g.44351362G>C" "" "pathogenic" ""
"0000243457" "0" "99" "17" "42428730" "42428730" "subst" "0" "02360" "GRN_000108" "g.42428730G>C" "" "" "" "" "Point mutation in intron 8 splice acceptor site predicted to cause exon 9 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751296" "0" "" "" "g.44351362G>C" "" "pathogenic" ""
"0000243458" "0" "99" "17" "42428805" "42428806" "ins" "0" "02360" "GRN_000114" "g.42428805_42428806insTG" "" "" "" "" "Dinucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751239" "0" "" "" "g.44351437_44351438insTG" "" "pathogenic" ""
"0000243459" "0" "99" "17" "42428806" "42428806" "subst" "0" "02360" "GRN_000115" "g.42428806G>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751177" "0" "" "" "g.44351438G>A" "" "pathogenic" ""
"0000243460" "0" "99" "17" "42428806" "42428806" "subst" "0" "02360" "GRN_000115" "g.42428806G>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751177" "0" "" "" "g.44351438G>A" "" "pathogenic" ""
"0000243461" "0" "99" "17" "42428806" "42428806" "subst" "0" "02360" "GRN_000115" "g.42428806G>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751177" "0" "" "" "g.44351438G>A" "" "pathogenic" ""
"0000243462" "0" "99" "17" "42428982" "42428982" "del" "0" "02360" "GRN_000118" "g.42428982del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750873" "0" "" "" "g.44351614del" "" "pathogenic" ""
"0000243463" "0" "99" "17" "42429598" "42429598" "dup" "0" "02360" "GRN_000136" "g.42429598dup" "" "" "" "" "Single nucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749951" "0" "" "" "g.44352230dup" "" "pathogenic" ""
"0000243464" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243465" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243466" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243467" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243468" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243469" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243470" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243471" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243472" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243473" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243474" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243475" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243476" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243477" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243478" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243479" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243480" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243481" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243482" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243483" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243484" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243485" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243486" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243487" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243488" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243489" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243490" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243491" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243492" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243493" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243494" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243495" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243496" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243497" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243498" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243499" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243500" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243501" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243502" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243503" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243504" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243505" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243506" "0" "99" "17" "42429772" "42429772" "subst" "4.06507E-6" "02360" "GRN_000004" "g.42429772C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751294" "0" "" "" "g.44352404C>T" "" "pathogenic" ""
"0000243509" "0" "99" "17" "42428169" "42428169" "subst" "8.15255E-6" "02360" "GRN_000101" "g.42428169G>A" "" "" "" "" "Point mutation in intron 7 splice donor site predicted to cause exon 7 skipping, frameshift and premature translation termination, and demonstrated to result in transcript degradation" "Unknown" "yes" "rs63749817" "0" "" "" "g.44350801G>A" "" "pathogenic" ""
"0000243510" "0" "99" "17" "42428169" "42428169" "subst" "8.15255E-6" "02360" "GRN_000101" "g.42428169G>A" "" "" "" "" "Point mutation in intron 7 splice donor site predicted to cause exon 7 skipping, frameshift and premature translation termination, and demonstrated to result in transcript degradation" "Unknown" "no" "rs63749817" "0" "" "" "g.44350801G>A" "" "pathogenic" ""
"0000243511" "0" "99" "17" "42428169" "42428169" "subst" "8.15255E-6" "02360" "GRN_000101" "g.42428169G>A" "" "" "" "" "Point mutation in intron 7 splice donor site predicted to cause exon 7 skipping, frameshift and premature translation termination, and demonstrated to result in transcript degradation" "Unknown" "no" "rs63749817" "0" "" "" "g.44350801G>A" "" "pathogenic" ""
"0000243512" "0" "99" "17" "42429694" "42429886" "del" "0" "02360" "GRN_000139" "g.42429694_42429886del" "" "" "" "" "Deletion of 193 bp starting 15 bp upstream of exon 12 and extending 177 bp into exon 12, destroying the intron 11 splice acceptor site and predicted to result in in-frame exon 12 skipping" "Unknown" "no" "" "0" "" "" "g.44352326_44352518del" "" "pathogenic" ""
"0000243513" "0" "99" "17" "42429694" "42429886" "del" "0" "02360" "GRN_000139" "g.42429694_42429886del" "" "" "" "" "Deletion of 193 bp starting 15 bp upstream of exon 12 and extending 177 bp into exon 12, destroying the intron 11 splice acceptor site and predicted to result in in-frame exon 12 skipping" "Unknown" "no" "" "0" "" "" "g.44352326_44352518del" "" "pathogenic" ""
"0000243514" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243515" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243516" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243517" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243518" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243519" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243520" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243521" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243522" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243523" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243524" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243525" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243526" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243527" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243528" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243529" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243530" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243531" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243532" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243533" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243534" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243535" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243536" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243537" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243538" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243539" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243540" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243541" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243542" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243543" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243544" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243545" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243546" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243547" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243548" "0" "99" "17" "42428509" "42428512" "del" "0" "02360" "GRN_000003" "g.42428509_42428512del" "" "" "" "" "Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749877" "0" "" "" "g.44351141_44351144del" "" "pathogenic" ""
"0000243553" "0" "99" "17" "42426898" "42426898" "del" "0" "02360" "GRN_000077" "g.42426898del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63751193" "0" "" "" "g.44349530del" "" "pathogenic" ""
"0000243554" "0" "11" "17" "42427049" "42427049" "subst" "8.1275E-5" "02360" "GRN_000080" "g.42427049G>A" "" "" "" "" "Observed in 2 FTD patients and 1 unaffected individual. /r/Silent point mutation in coding region" "Unknown" "no" "rs63751088" "0" "" "" "g.44349681G>A" "" "benign" ""
"0000243555" "0" "11" "17" "42427892" "42427892" "subst" "0.000991274" "02360" "GRN_000094" "g.42427892C>T" "" "" "" "" "Observed in 2 FTD patients and 1 ALS patient, absent in 409 control individuals, not segregating in 1 FTD family. Identified in eight African control individual of the T" "" "benign" ""
"0000243556" "0" "11" "17" "42427892" "42427892" "subst" "0.000991274" "02360" "GRN_000094" "g.42427892C>T" "" "" "" "" "Observed in 2 FTD patients and 1 ALS patient, absent in 409 control individuals, not segregating in 1 FTD family. Identified in eight African control individual of the T" "" "benign" ""
"0000243557" "0" "11" "17" "42427892" "42427892" "subst" "0.000991274" "02360" "GRN_000094" "g.42427892C>T" "" "" "" "" "Observed in 2 FTD patients and 1 ALS patient, absent in 409 control individuals, not segregating in 1 FTD family. Identified in eight African control individual of the T" "" "benign" ""
"0000243558" "0" "55" "17" "42428158" "42428158" "subst" "8.14405E-6" "02360" "GRN_000099" "g.42428158C>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "rs63750455" "0" "" "" "g.44350790C>A" "" "VUS" ""
"0000243559" "0" "99" "17" "42429434" "42429435" "del" "0" "02360" "GRN_000130" "g.42429434_42429435del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750419" "0" "" "" "g.44352066_44352067del" "" "pathogenic" ""
"0000243560" "0" "55" "17" "42429918" "42429918" "subst" "0" "02360" "GRN_000146" "g.42429918G>C" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "rs63751060" "0" "" "" "g.44352550G>C" "" "VUS" ""
"0000243561" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243562" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243563" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243564" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243565" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243566" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243567" "0" "99" "17" "42428403" "42428403" "subst" "0" "02360" "GRN_000103" "g.42428403A>G" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750548" "0" "" "" "g.44351035A>G" "" "pathogenic" ""
"0000243571" "0" "11" "17" "42427605" "42427605" "subst" "0.00109643" "02360" "GRN_000083" "g.42427605C>A" "" "" "" "" "Observed in 2 patients possiby sharing a GRN haplotype; absent in 590 control individuals. Identified in two Asian control individual of the Human Genome Dive. /r/Point mutation in coding region predicting an amino acid substitution\"\"" "Unknown" "no" "rs63750043" "0" "" "" "g.44350237C>A" "" "benign" ""
"0000243572" "0" "11" "17" "42427605" "42427605" "subst" "0.00109643" "02360" "GRN_000083" "g.42427605C>A" "" "" "" "" "Observed in 2 patients possiby sharing a GRN haplotype; absent in 590 control individuals. Identified in two Asian control individual of the Human Genome Dive. /r/Point mutation in coding region predicting an amino acid substitution\"\"" "Unknown" "no" "rs63750043" "0" "" "" "g.44350237C>A" "" "benign" ""
"0000243573" "0" "55" "17" "42429160" "42429160" "subst" "1.63503E-5" "02360" "GRN_000128" "g.42429160A>C" "" "" "" "" "Absent in 409 control individuals. /r/Silent point mutation in coding region" "Unknown" "no" "rs63750448" "0" "" "" "g.44351792A>C" "" "VUS" ""
"0000243574" "0" "99" "17" "42422705" "42422705" "subst" "0" "02360" "GRN_000059" "g.42422705A>T" "" "" "" "" "Point mutation in intron 1 splice donor site causing intron 1 retention resulting in nuclear mRNA degradation" "Unknown" "no" "rs63751020" "0" "" "" "g.44345337A>T" "" "pathogenic" ""
"0000243575" "0" "99" "17" "42427607" "42427607" "del" "0" "02360" "GRN_000084" "g.42427607del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749940" "0" "" "" "g.44350239del" "" "pathogenic" ""
"0000243576" "0" "99" "17" "42427630" "42427633" "del" "0" "02360" "GRN_000087" "g.42427630_42427633del" "" "" "" "" "This is the same mutation as GRN g.1102_1105delCAGT on different allelic background of SNP rs25646. /r/Tetranucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay\"\"" "Unknown" "no" "rs63750768" "0" "" "" "g.44350262_44350265del" "" "pathogenic" ""
"0000243577" "0" "99" "17" "42427815" "42427821" "del" "0" "02360" "GRN_000091" "g.42427815_42427821del" "" "" "" "" "Heptanucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750247" "0" "" "" "g.44350447_44350453del" "" "pathogenic" ""
"0000243578" "0" "99" "17" "42428926" "42428926" "subst" "0" "02360" "GRN_000117" "g.42428926C>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750926" "0" "" "" "g.44351558C>A" "" "pathogenic" ""
"0000243579" "0" "99" "17" "42428926" "42428926" "subst" "0" "02360" "GRN_000117" "g.42428926C>A" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750926" "0" "" "" "g.44351558C>A" "" "pathogenic" ""
"0000243580" "0" "99" "17" "42429079" "42429080" "del" "0" "02360" "GRN_000124" "g.42429079_42429080del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63749988" "0" "" "" "g.44351711_44351712del" "" "pathogenic" ""
"0000243581" "0" "99" "17" "42429404" "42429404" "subst" "0" "02360" "GRN_000129" "g.42429404C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63750118" "0" "" "" "g.44352036C>T" "" "pathogenic" ""
"0000243582" "0" "99" "17" "42429404" "42429404" "subst" "0" "02360" "GRN_000129" "g.42429404C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750118" "0" "" "" "g.44352036C>T" "" "pathogenic" ""
"0000243583" "0" "99" "17" "42429434" "42429435" "dup" "0" "02360" "GRN_000131" "g.42429434_42429435dup" "" "" "" "" "Dinucleotide insertion in coding region causing frameshift and premature translation termination predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750351" "0" "" "" "g.44352066_44352067dup" "" "pathogenic" ""
"0000243584" "0" "99" "17" "42429434" "42429435" "dup" "0" "02360" "GRN_000131" "g.42429434_42429435dup" "" "" "" "" "Dinucleotide insertion in coding region causing frameshift and premature translation termination predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750351" "0" "" "" "g.44352066_44352067dup" "" "pathogenic" ""
"0000243585" "0" "99" "17" "42428804" "42428804" "del" "0" "02360" "GRN_000113" "g.42428804del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750366" "0" "" "" "g.44351436del" "" "pathogenic" ""
"0000243590" "0" "99" "17" "42429128" "42429128" "dup" "0" "02360" "GRN_000125" "g.42429128dup" "" "" "" "" "Single nucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "rs63749905" "0" "" "" "g.44351760dup" "" "pathogenic" ""
"0000243594" "0" "99" "17" "42427098" "42427098" "subst" "4.07448E-6" "02360" "GRN_000081" "g.42427098C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750411" "0" "" "" "g.44349730C>T" "" "pathogenic" ""
"0000243595" "0" "99" "17" "42427098" "42427098" "subst" "4.07448E-6" "02360" "GRN_000081" "g.42427098C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750411" "0" "" "" "g.44349730C>T" "" "pathogenic" ""
"0000243596" "0" "99" "17" "42427098" "42427098" "subst" "4.07448E-6" "02360" "GRN_000081" "g.42427098C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63750411" "0" "" "" "g.44349730C>T" "" "pathogenic" ""
"0000243597" "0" "99" "17" "42428993" "42428993" "subst" "0" "02360" "GRN_000119" "g.42428993C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751406" "0" "" "" "g.44351625C>T" "" "pathogenic" ""
"0000243598" "0" "99" "17" "42428993" "42428993" "subst" "0" "02360" "GRN_000119" "g.42428993C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "rs63751406" "0" "" "" "g.44351625C>T" "" "pathogenic" ""
"0000243654" "0" "99" "17" "42429446" "42429446" "subst" "0" "02360" "GRN_000132" "g.42429446C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352078C>T" "" "pathogenic" ""
"0000243655" "0" "99" "17" "42429446" "42429446" "subst" "0" "02360" "GRN_000132" "g.42429446C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352078C>T" "" "pathogenic" ""
"0000243656" "0" "99" "17" "42429446" "42429446" "subst" "0" "02360" "GRN_000132" "g.42429446C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352078C>T" "" "pathogenic" ""
"0000243657" "0" "99" "17" "42429446" "42429446" "subst" "0" "02360" "GRN_000132" "g.42429446C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352078C>T" "" "pathogenic" ""
"0000243658" "0" "55" "17" "42429898" "42429898" "subst" "1.21988E-5" "02360" "GRN_000145" "g.42429898C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in C-truncated protein" "Unknown" "no" "" "0" "" "" "g.44352530C>T" "" "VUS" ""
"0000243659" "0" "55" "17" "42426545" "42426545" "subst" "0" "02360" "GRN_000065" "g.42426545G>C" "" "" "" "" "Observed in 1 familial FTD-MND patient, no segregation. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44349177G>C" "" "VUS" ""
"0000243660" "0" "55" "17" "42427877" "42427877" "subst" "2.84338E-5" "02360" "GRN_000093" "g.42427877G>A" "" "" "" "" "Observed in 1 FTD patient and 2 asymptomatic relatives. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44350509G>A" "" "VUS" ""
"0000243661" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243662" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243663" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243664" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243665" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243666" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243667" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243668" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243669" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243670" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243671" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243672" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243673" "0" "99" "17" "42428404" "42428404" "subst" "0" "02360" "GRN_000104" "g.42428404G>A" "" "" "" "" "Point mutation in intron 7 splice acceptor site predicted to cause exon 8 skipping, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351036G>A" "" "pathogenic" ""
"0000243674" "0" "99" "17" "42429054" "42429054" "del" "0" "02360" "GRN_000122" "g.42429054del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351686del" "" "pathogenic" ""
"0000243675" "0" "99" "17" "42426533" "42426533" "subst" "0" "02360" "GRN_000062" "g.42426533A>G" "" "" "" "" "Point mutation in translation initiation codon predicted to result in reduced mRNA levels" "Unknown" "no" "" "0" "" "" "g.44349165A>G" "" "pathogenic" ""
"0000243676" "0" "55" "17" "42426551" "42426551" "subst" "0" "02360" "GRN_000066" "g.42426551T>C" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44349183T>C" "" "VUS" ""
"0000243677" "0" "99" "17" "42427596" "42427596" "del" "0" "02360" "GRN_000082" "g.42427596del" "" "" "" "" "Single nucleotide deletion in intron 4 splice acceptor site predicting exon 5 skipping, frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44350228del" "" "pathogenic" ""
"0000243678" "0" "99" "17" "42427596" "42427596" "del" "0" "02360" "GRN_000082" "g.42427596del" "" "" "" "" "Single nucleotide deletion in intron 4 splice acceptor site predicting exon 5 skipping, frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44350228del" "" "pathogenic" ""
"0000243679" "0" "99" "17" "42429789" "42429793" "del" "0" "02360" "GRN_000141" "g.42429789_42429793del" "" "" "" "" "Pentanucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352421_44352425del" "" "pathogenic" ""
"0000243680" "0" "99" "17" "42429789" "42429793" "del" "0" "02360" "GRN_000141" "g.42429789_42429793del" "" "" "" "" "Pentanucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352421_44352425del" "" "pathogenic" ""
"0000243681" "0" "99" "17" "42429789" "42429793" "del" "0" "02360" "GRN_000141" "g.42429789_42429793del" "" "" "" "" "Pentanucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352421_44352425del" "" "pathogenic" ""
"0000243682" "0" "99" "17" "42429789" "42429793" "del" "0" "02360" "GRN_000141" "g.42429789_42429793del" "" "" "" "" "Pentanucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352421_44352425del" "" "pathogenic" ""
"0000243683" "0" "11" "17" "42429501" "42429501" "subst" "0.000593453" "02360" "GRN_000134" "g.42429501G>A" "" "" "" "" "Observed in 1 non-familial FTLD patient. Observed in two African control individuals of the Human Genome Diversity Panel. Nonpathogenic A" "" "benign" ""
"0000243684" "0" "55" "17" "42427661" "42427661" "subst" "0.000178664" "02360" "GRN_000089" "g.42427661T>C" "" "" "" "" "Observed in 1 FTD, 1 PPA and 1 AD patient, absent from 907 control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44350293T>C" "" "VUS" ""
"0000243685" "0" "55" "17" "42427661" "42427661" "subst" "0.000178664" "02360" "GRN_000089" "g.42427661T>C" "" "" "" "" "Observed in 1 FTD, 1 PPA and 1 AD patient, absent from 907 control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44350293T>C" "" "VUS" ""
"0000243686" "0" "55" "17" "42427661" "42427661" "subst" "0.000178664" "02360" "GRN_000089" "g.42427661T>C" "" "" "" "" "Observed in 1 FTD, 1 PPA and 1 AD patient, absent from 907 control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44350293T>C" "" "VUS" ""
"0000243691" "0" "99" "17" "42428793" "42428793" "subst" "0" "02360" "GRN_000110" "g.42428793C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon predicted to result in C-truncated protein" "Unknown" "no" "" "0" "" "" "g.44351425C>T" "" "pathogenic" ""
"0000243692" "0" "99" "17" "42428063" "42428063" "dup" "0" "02360" "GRN_000097" "g.42428063dup" "" "" "" "" "Single nucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44350695dup" "" "pathogenic" ""
"0000243693" "0" "55" "17" "42427943" "42427943" "subst" "0" "02360" "GRN_000096" "g.42427943C>T" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44350575C>T" "" "VUS" ""
"0000243694" "0" "55" "17" "42429610" "42429610" "subst" "4.10176E-6" "02360" "GRN_000138" "g.42429610G>T" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352242G>T" "" "VUS" ""
"0000243698" "0" "99" "17" "42428798" "42428799" "ins" "0" "02360" "GRN_000111" "g.42428798_42428799insTG" "" "" "" "" "Dinucleotide insertion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351430_44351431insTG" "" "pathogenic" ""
"0000243699" "0" "55" "17" "42426631" "42426631" "subst" "7.72955E-5" "02360" "GRN_000071" "g.42426631C>A" "" "" "" "" "Observed in 1 AD patient and 1 PD patient, absent from 459 control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44349263C>A" "" "VUS" ""
"0000243700" "0" "55" "17" "42426631" "42426631" "subst" "7.72955E-5" "02360" "GRN_000071" "g.42426631C>A" "" "" "" "" "Observed in 1 AD patient and 1 PD patient, absent from 459 control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44349263C>A" "" "VUS" ""
"0000243701" "0" "55" "17" "42429555" "42429555" "subst" "8.15029E-6" "02360" "GRN_000135" "g.42429555C>T" "" "" "" "" "Observed in 1 AD patient, absent from 459 control individuals . /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352187C>T" "" "VUS" ""
"0000243702" "0" "55" "17" "42429835" "42429835" "subst" "4.87424E-5" "02360" "GRN_000142" "g.42429835G>A" "" "" "" "" "Observed in 1 AD patient and 1 PD patient, absent from 459 control individuals . /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352467G>A" "" "VUS" ""
"0000243703" "0" "55" "17" "42429835" "42429835" "subst" "4.87424E-5" "02360" "GRN_000142" "g.42429835G>A" "" "" "" "" "Observed in 1 AD patient and 1 PD patient, absent from 459 control individuals . /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352467G>A" "" "VUS" ""
"0000243704" "0" "55" "17" "42430074" "42430074" "subst" "0" "02360" "GRN_000148" "g.42430074C>T" "" "" "" "" "Observed in 1 AD patient, absent from 459 control individuals . /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352706C>T" "" "VUS" ""
"0000243705" "0" "55" "17" "42429934" "42429934" "subst" "4.07701E-6" "02360" "GRN_000147" "g.42429934C>T" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352566C>T" "" "VUS" ""
"0000243708" "0" "55" "17" "42426635" "42426635" "subst" "1.62758E-5" "02360" "GRN_000073" "g.42426635G>A" "" "" "" "" "Observed in 1 AD patient, absent in 226 controls. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44349267G>A" "" "VUS" ""
"0000243710" "0" "11" "17" "42426574" "42426574" "subst" "0.00120669" "02360" "GRN_000068" "g.42426574G>A" "" "" "" "" "Observed in 1 FTD patient and 15 African control individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"" "Unknown" "no" "" "0" "" "" "g.44349206G>A" "" "benign" ""
"0000243711" "0" "55" "17" "42427849" "42427849" "subst" "1.21851E-5" "02360" "GRN_000092" "g.42427849G>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44350481G>A" "" "VUS" ""
"0000243712" "0" "99" "17" "42426921" "42426921" "subst" "0" "02360" "GRN_000079" "g.42426921C>T" "" "" "" "" "Point mutation in intron 3 splice donor site causing cryptic splicing, frameshift and premature translation termination, resulting in nonsense-mediated mRNA decay\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "no" "" "0" "" "" "" "" "pathogenic" ""
"0000243713" "0" "99" "17" "42426910" "42426910" "del" "0" "02360" "GRN_000078" "g.42426910del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44349542del" "" "pathogenic" ""
"0000243714" "0" "99" "17" "42428802" "42428802" "dup" "0" "02360" "GRN_000112" "g.42428802dup" "" "" "" "" "Single nucleotide insertion in coding region causing frameshift and premature translation termination resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351434dup" "" "pathogenic" ""
"0000243715" "0" "99" "17" "42429056" "42429056" "subst" "0" "02360" "GRN_000123" "g.42429056C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon resulting in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351688C>T" "" "pathogenic" ""
"0000243716" "0" "99" "17" "42429715" "42429716" "del" "0" "02360" "GRN_000140" "g.42429715_42429716del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44352347_44352348del" "" "pathogenic" ""
"0000243732" "0" "99" "17" "42426438" "42430022" "del" "0" "02360" "GRN_000061" "g.42426438_42430022del" "" "" "" "" "Genomic deletion of 3585 bp ranging from 88 bp upstream of exon 2 to 7 bp upstream of exon 13" "Unknown" "yes" "" "0" "" "" "g.44349070_44352654del" "" "pathogenic" ""
"0000243736" "0" "99" "17" "42429857" "42429857" "subst" "5.28047E-5" "02360" "GRN_000144" "g.42429857G>A" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "no" "" "0" "" "" "g.44352489G>A" "" "pathogenic" ""
"0000243740" "0" "55" "17" "42428402" "42428402" "subst" "0" "02360" "GRN_000102" "g.42428402C>G" "" "" "" "" "Observed in 1 FTD patient. /r/Point mutation in intron 7 splice acceptor site probably leading to exon 8 skipping, a frameshift and a premature termination codon, potentially resulting in degradation by nonsense-mediated RNA decay" "Unknown" "no" "" "0" "" "" "g.44351034C>G" "" "VUS" ""
"0000243741" "0" "99" "17" "42429005" "42429005" "subst" "0" "02360" "GRN_000121" "g.42429005C>T" "" "" "" "" "Point mutation in coding region creating a premature termination codon, predicted to result in nonsense-mediated mRNA decay" "Unknown" "yes" "" "0" "" "" "g.44351637C>T" "" "pathogenic" ""
"0000243742" "0" "99" "17" "42428998" "42428998" "del" "0" "02360" "GRN_000120" "g.42428998del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44351630del" "" "pathogenic" ""
"0000243874" "0" "55" "17" "42430118" "42430118" "subst" "1.64029E-5" "02360" "GRN_000149" "g.42430118G>A" "" "" "" "" "Observed in 1 PPA patient. /r/Silent point mutation in coding region" "Unknown" "no" "" "0" "" "" "g.44352750G>A" "" "VUS" ""
"0000243875" "0" "99" "17" "42427939" "42427940" "del" "0" "02360" "GRN_000095" "g.42427939_42427940del" "" "" "" "" "Dinucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in nonsense-mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44350571_44350572del" "" "pathogenic" ""
"0000243876" "0" "99" "17" "42428471" "42428471" "subst" "0" "02360" "GRN_000106" "g.42428471A>T" "" "" "" "" "Point mutation in coding region predicting a premature termination codon" "Unknown" "no" "" "0" "" "" "g.44351103A>T" "" "pathogenic" ""
"0000243877" "0" "11" "17" "42429849" "42429849" "subst" "2.03089E-5" "02360" "GRN_000143" "g.42429849C>T" "" "" "" "" "Observed in 1 ALS patient and 1 Caucasian individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"" "Unknown" "no" "" "0" "" "" "g.44352481C>T" "" "benign" ""
"0000243943" "0" "99" "17" "42428777" "42428777" "subst" "0" "02360" "GRN_000109" "g.42428777T>G" "" "" "" "" "Point mutation, predicting a premature termination codon" "Unknown" "no" "" "0" "" "" "g.44351409T>G" "" "pathogenic" ""
"0000243949" "0" "55" "17" "42426809" "42426809" "del" "0" "02360" "GRN_000075" "g.42426809del" "" "" "" "" "Single nucleotide deletion in coding region causing frameshift and premature translation termination, predicted to result in non-sense mediated mRNA decay" "Unknown" "no" "" "0" "" "" "g.44349441del" "" "VUS" ""
"0000243988" "0" "15" "17" "39782113" "39782113" "subst" "0" "02360" "GRN_000005" "g.39782113C>T" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750723" "0" "" "" "g.41625861C>T" "" "benign" ""
"0000243989" "0" "15" "17" "39782157" "39782157" "subst" "0" "02360" "GRN_000006" "g.39782157C>T" "" "" "" "" "Observed in multiple control individuals. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750742" "0" "" "" "" "" "benign" ""
"0000243990" "0" "55" "17" "39782445" "39782445" "subst" "0" "02360" "GRN_000012" "g.39782445G>A" "" "" "" "" "Silent point mutation in coding region" "Unknown" "" "rs63751166" "0" "" "" "g.41626193G>A" "" "VUS" ""
"0000243991" "0" "55" "17" "39782609" "39782609" "subst" "0" "02360" "GRN_000014" "g.39782609T>C" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750441" "0" "" "" "" "" "VUS" ""
"0000243992" "0" "15" "17" "39783156" "39783156" "subst" "0" "02360" "GRN_000020" "g.39783156T>C" "" "" "" "" "Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs25646" "0" "" "" "" "" "benign" ""
"0000243993" "0" "55" "17" "39783694" "39783694" "subst" "0" "02360" "GRN_000030" "g.39783694C>T" "" "" "" "" "Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750744" "0" "" "" "" "" "VUS" ""
"0000243994" "0" "55" "17" "39784282" "39784282" "subst" "0" "02360" "GRN_000036" "g.39784282G>C" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750565" "0" "" "" "" "" "VUS" ""
"0000243995" "0" "15" "17" "39784324" "39784324" "subst" "0" "02360" "GRN_000037" "g.39784324G>A" "" "" "" "" "Observed in 2 FTD patients, 1 ALS patient and 4 unaffected individuals. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750142" "0" "" "" "" "" "benign" ""
"0000243996" "0" "15" "17" "39784480" "39784480" "subst" "0" "02360" "GRN_000038" "g.39784480G>A" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750541" "0" "" "" "g.41628228G>A" "" "benign" ""
"0000243997" "0" "15" "17" "39784982" "39784982" "subst" "0" "02360" "GRN_000044" "g.39784982G>A" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63751100" "0" "" "" "" "" "benign" ""
"0000243998" "0" "15" "17" "39785026" "39785026" "subst" "0" "02360" "GRN_000046" "g.39785026C>T" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750412" "0" "" "" "" "" "benign" ""
"0000243999" "0" "55" "17" "39785243" "39785243" "subst" "0" "02360" "GRN_000050" "g.39785243C>T" "" "" "" "" "Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63751470" "0" "" "" "" "" "VUS" ""
"0000244000" "0" "15" "17" "39785365" "39785365" "subst" "0" "02360" "GRN_000054" "g.39785365G>C" "" "" "" "" "Observed in four African control individuals of the Human Genome Diversity Panel. Corresponds to SNP T" "" "" "" "" "Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750920" "0" "" "" "g.41628718G>T" "" "benign" ""
"0000244004" "0" "55" "17" "39785070" "39785070" "subst" "0" "02360" "GRN_000047" "g.39785070C>T" "" "" "" "" "Observed in 2 FTD patients and 1 ALS patient. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750775" "0" "" "" "" "" "VUS" ""
"0000244005" "0" "15" "17" "39783193" "39783193" "subst" "0" "02360" "GRN_000023" "g.39783193G>A" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63749853" "0" "" "" "" "" "benign" ""
"0000244006" "0" "15" "17" "39785102" "39785102" "subst" "0" "02360" "GRN_000048" "g.39785102C>T" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750537" "0" "" "" "g.41628850C>T" "" "benign" ""
"0000244007" "0" "15" "17" "39785576" "39785576" "subst" "0" "02360" "GRN_000056" "g.39785576C>T" "" "" "" "" "Observed in control individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750116" "0" "" "" "" "" "benign" ""
"0000244008" "0" "55" "17" "39782160" "39782160" "subst" "0" "02360" "GRN_000007" "g.39782160C>T" "" "" "" "" "Observed in 1 FTD patient, absent in 646 control individuals. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63751074" "0" "" "" "" "" "VUS" ""
"0000244009" "0" "15" "17" "39785605" "39785605" "subst" "0" "02360" "GRN_000058" "g.39785605C>T" "" "" "" "" "Observed in 1 FTD patient, absent in 646 control individuals. Observed in 1 Caucasian individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63751248" "0" "" "" "" "" "benign" ""
"0000244010" "0" "55" "17" "39783965" "39783965" "subst" "0" "02360" "GRN_000031" "g.39783965C>T" "" "" "" "" "Observed in 1 FTD patient, absent in 646 control individuals. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750344" "0" "" "" "g.41627713C>T" "" "VUS" ""
"0000244011" "0" "55" "17" "39783995" "39783995" "subst" "0" "02360" "GRN_000032" "g.39783995G>A" "" "" "" "" "Observed in 1 FTD patient, absent in 646 control individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63751000" "0" "" "" "" "" "VUS" ""
"0000244012" "0" "55" "17" "39785023" "39785023" "subst" "0" "02360" "GRN_000045" "g.39785023C>T" "" "" "" "" "Observed in 2 FTD patients, absent in 646 control individuals. Affected cousin of 1 patient also carried the mutation. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750130" "0" "" "" "g.41628771C>T" "" "VUS" ""
"0000244013" "0" "55" "17" "39785306" "39785306" "subst" "0" "02360" "GRN_000052" "g.39785306C>T" "" "" "" "" "Observed in 1 FTD patient, absent in 646 control individuals. /r/Silent point mutation in coding region" "Unknown" "" "rs63750576" "0" "" "" "g.41629054C>T" "" "VUS" ""
"0000244014" "0" "15" "17" "39782613" "39782613" "subst" "0" "02360" "GRN_000015" "g.39782613G>A" "" "" "" "" "Observed in 1 unaffected individual. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750202" "0" "" "" "" "" "benign" ""
"0000244015" "0" "15" "17" "39783346" "39783346" "subst" "0" "02360" "GRN_000024" "g.39783346G>A" "" "" "" "" "Observed in 1 unaffected individual. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750163" "0" "" "" "g.41627094G>A" "" "benign" ""
"0000244016" "0" "15" "17" "39783621" "39783621" "subst" "0" "02360" "GRN_000027" "g.39783621G>A" "" "" "" "" "Observed in 1 unaffected individual. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750787" "0" "" "" "" "" "benign" ""
"0000244017" "0" "15" "17" "39783644" "39783644" "subst" "0" "02360" "GRN_000028" "g.39783644A>T" "" "" "" "" "Observed in 1 unaffected individual. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750683" "0" "" "" "" "" "benign" ""
"0000244018" "0" "15" "17" "39784003" "39784003" "subst" "0" "02360" "GRN_000033" "g.39784003C>A" "" "" "" "" "Observed in 1 AD patient and 1 unaffected individual. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "rs63750435" "0" "" "" "g.41627751C>A" "" "benign" ""
"0000244019" "0" "15" "17" "39784026" "39784026" "subst" "0" "02360" "GRN_000035" "g.39784026G>A" "" "" "" "" "Observed in 1 ALS patient and 1 unaffected individual. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750229" "0" "" "" "" "" "benign" ""
"0000244020" "0" "15" "17" "39784506" "39784506" "subst" "0" "02360" "GRN_000039" "g.39784506G>A" "" "" "" "" "Observed in 1 unaffected individual. /r/Silent point mutation in coding region" "Unknown" "" "rs63750785" "0" "" "" "g.41628254G>A" "" "benign" ""
"0000244021" "0" "15" "17" "39785138" "39785138" "subst" "0" "02360" "GRN_000049" "g.39785138C>T" "" "" "" "" "Observed in 1 unaffected individual. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750007" "0" "" "" "" "" "benign" ""
"0000244022" "0" "15" "17" "39785246" "39785246" "subst" "0" "02360" "GRN_000051" "g.39785246C>T" "" "" "" "" "Observed in 1 unaffected individual. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63751104" "0" "" "" "" "" "benign" ""
"0000244023" "0" "15" "17" "39785558" "39785558" "subst" "0" "02360" "GRN_000055" "g.39785558G>A" "" "" "" "" "Observed in 2 unaffected individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750754" "0" "" "" "" "" "benign" ""
"0000244024" "0" "55" "17" "39782339" "39782339" "subst" "0" "02360" "GRN_000008" "g.39782339T>C" "" "" "" "" "Observed in 1 non-familial FTD patient, absent in 160 control individuals. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "rs63750481" "0" "" "" "" "" "VUS" ""
"0000244029" "0" "55" "17" "39782625" "39782625" "subst" "0" "02360" "GRN_000017" "g.39782625G>A" "" "" "" "" "Observed in 1 ALS patient, absent in 308 controls. /r/Point mutation in coding region predicting an amino acid substitution" "Unknown" "" "" "0" "" "" "g.41626373G>A" "" "VUS" ""
"0000244030" "0" "55" "17" "39783143" "39783143" "subst" "0" "02360" "GRN_000019" "g.39783143T>C" "" "" "" "" "Observed in 1 ALS patient, absent in 308 controls. /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000244031" "0" "55" "17" "39783186" "39783186" "subst" "0" "02360" "GRN_000022" "g.39783186G>A" "" "" "" "" "Observed in 1 ALS patient, absent in 308 controls. /r/Silent point mutation in coding region\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "VUS" ""
"0000244055" "0" "15" "17" "39782344" "39782344" "subst" "0" "02360" "GRN_000009" "g.39782344A>T" "" "" "" "" "Observed in 1 Asian individual of the Human Genome Diversity Panel. /r/Point mutation in coding region predicting an amino acid substitution\"\"" "Unknown" "" "" "0" "" "" "g.41626092A>T" "" "benign" ""
"0000244056" "0" "15" "17" "39782386" "39782386" "subst" "0" "02360" "GRN_000010" "g.39782386G>A" "" "" "" "" "Observed in 1 Asian individual of the Human Genome Diversity Panel. /r/Point mutation in coding region predicting an amino acid substitution\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244057" "0" "15" "17" "39783127" "39783129" "del" "0" "02360" "GRN_000018" "g.39783127_39783129delAAC" "" "" "" "" "Observed in 1 Asian individual of the Human Genome Diversity Panel. /r/Trinucleotide deletion in coding region predicting a deletion of one amino acid\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244058" "0" "15" "17" "39783648" "39783648" "subst" "0" "02360" "GRN_000029" "g.39783648G>C" "" "" "" "" "Observed in 1 unaffected asian (China). /r/Point mutation in coding region predicting an amino acid substitution\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244059" "0" "15" "17" "39784636" "39784636" "subst" "0" "02360" "GRN_000040" "g.39784636G>A" "" "" "" "" "Observed in 2 African individuals of the Human Genome Diversity Panel. /r/Point mutation in coding region predicting an amino acid substitution\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244060" "0" "15" "17" "39784922" "39784922" "subst" "0" "02360" "GRN_000041" "g.39784922C>T" "" "" "" "" "Observed in 1 Asian individual of the Human Genome Diversity Panel. /r/Point mutation in coding region predicting an amino acid substitution\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244061" "0" "15" "17" "39785601" "39785601" "subst" "0" "02360" "GRN_000057" "g.39785601G>A" "" "" "" "" "Observed in 1 African individual of the Human Genome Diversity Panel. /r/Point mutation in coding region predicting an amino acid substitution\"\"" "Unknown" "" "" "0" "" "" "g.41629349G>A" "" "benign" ""
"0000244062" "0" "15" "17" "39782409" "39782409" "subst" "0" "02360" "GRN_000011" "g.39782409C>T" "" "" "" "" "Observed in 3 African individuals of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244063" "0" "15" "17" "39782563" "39782563" "subst" "0" "02360" "GRN_000013" "g.39782563C>T" "" "" "" "" "Observed in 1 Asian individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244064" "0" "15" "17" "39782620" "39782620" "subst" "0" "02360" "GRN_000016" "g.39782620C>T" "" "" "" "" "Observed in 1 African individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"" "Unknown" "" "" "0" "" "" "g.41626368C>T" "" "benign" ""
"0000244065" "0" "15" "17" "39783174" "39783174" "subst" "0" "02360" "GRN_000021" "g.39783174G>A" "" "" "" "" "Observed in 2 African individuals of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244066" "0" "15" "17" "39783380" "39783380" "subst" "0" "02360" "GRN_000025" "g.39783380C>G" "" "" "" "" "Observed in 5 African individuals of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244067" "0" "15" "17" "39783419" "39783419" "subst" "0" "02360" "GRN_000026" "g.39783419G>A" "" "" "" "" "Observed in 2 African individuals of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"" "Unknown" "" "" "0" "" "" "g.41627167G>A" "" "benign" ""
"0000244068" "0" "15" "17" "39784008" "39784008" "subst" "0" "02360" "GRN_000034" "g.39784008C>T" "" "" "" "" "Observed in 1 Asian individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244069" "0" "15" "17" "39784956" "39784956" "subst" "0" "02360" "GRN_000042" "g.39784956G>A" "" "" "" "" "Observed in 2 African individuals of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000244070" "0" "15" "17" "39785336" "39785336" "subst" "0" "02360" "GRN_000053" "g.39785336C>T" "" "" "" "" "Observed in 1 Caucasian individual of the Human Genome Diversity Panel. /r/Silent point mutation in coding region\"\"\r\nVariant Error [EREF/EUNCERTAIN]: This genomic variant does not match the reference sequence; the transcript variant also has an error. Please fix this entry and then remove this message." "Unknown" "" "" "0" "" "" "" "" "benign" ""
"0000250482" "0" "30" "17" "42427792" "42427792" "subst" "0" "02329" "GRN_000161" "g.42427792A>G" "" "" "" "GRN(NM_002087.4):c.463-18A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350424A>G" "" "likely benign" ""
"0000254884" "0" "30" "17" "42426916" "42426916" "subst" "0" "01943" "GRN_000155" "g.42426916A>G" "" "" "" "GRN(NM_002087.2):c.261A>G (p.P87=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349548A>G" "" "likely benign" ""
"0000277515" "0" "10" "17" "42426926" "42426926" "subst" "0.00515539" "02330" "GRN_000156" "g.42426926G>A" "" "" "" "GRN(NM_002087.2):c.264+7G>A (p.?), GRN(NM_002087.4):c.264+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349558G>A" "" "benign" ""
"0000281190" "0" "10" "17" "42427630" "42427630" "subst" "0.0507" "02325" "GRN_000020" "g.42427630T>C" "" "" "" "GRN(NM_002087.2):c.384T>C (p.D128=), GRN(NM_002087.4):c.384T>C (p.(Asp128=), p.D128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350262T>C" "" "benign" ""
"0000283391" "0" "10" "17" "42429500" "42429500" "subst" "0.00563784" "02329" "GRN_000046" "g.42429500C>T" "" "" "" "GRN(NM_002087.2):c.1297C>T (p.R433W), GRN(NM_002087.4):c.1297C>T (p.R433W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352132C>T" "" "benign" ""
"0000283392" "0" "30" "17" "42429720" "42429720" "subst" "1.22333E-5" "02329" "GRN_000051" "g.42429720C>T" "" "" "" "GRN(NM_002087.4):c.1425C>T (p.C475=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352352C>T" "" "likely benign" ""
"0000283393" "0" "30" "17" "42429839" "42429839" "subst" "0.00214047" "02329" "GRN_000054" "g.42429839G>C" "" "" "" "GRN(NM_002087.2):c.1544G>C (p.G515A), GRN(NM_002087.4):c.1544G>C (p.(Gly515Ala), p.G515A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352471G>C" "" "likely benign" ""
"0000283394" "0" "50" "17" "42429918" "42429918" "subst" "0" "02329" "GRN_000146" "g.42429918G>C" "" "" "" "GRN(NM_002087.4):c.1623G>C (p.W541C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352550G>C" "" "VUS" ""
"0000283395" "0" "70" "17" "42426555" "42426555" "subst" "0" "02329" "GRN_000151" "g.42426555T>A" "" "" "" "GRN(NM_002087.4):c.23T>A (p.V8E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349187T>A" "" "likely pathogenic" ""
"0000283396" "0" "90" "17" "42426898" "42426898" "del" "0" "02329" "GRN_000154" "g.42426898del" "" "" "" "GRN(NM_002087.2):c.243delC (p.S82Vfs*174), GRN(NM_002087.4):c.243delC (p.S82Vfs*174)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349530del" "" "pathogenic" ""
"0000283397" "0" "30" "17" "42426926" "42426926" "subst" "0.00515539" "02329" "GRN_000156" "g.42426926G>A" "" "" "" "GRN(NM_002087.2):c.264+7G>A (p.?), GRN(NM_002087.4):c.264+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349558G>A" "" "likely benign" ""
"0000283398" "0" "30" "17" "42427131" "42427131" "subst" "3.28845E-5" "02329" "GRN_000158" "g.42427131G>T" "" "" "" "GRN(NM_002087.4):c.349+12G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349763G>T" "" "likely benign" ""
"0000283399" "0" "10" "17" "42427630" "42427630" "subst" "0.0507" "02329" "GRN_000020" "g.42427630T>C" "" "" "" "GRN(NM_002087.2):c.384T>C (p.D128=), GRN(NM_002087.4):c.384T>C (p.(Asp128=), p.D128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350262T>C" "" "benign" ""
"0000283400" "0" "50" "17" "42427661" "42427661" "subst" "0.000178664" "02329" "GRN_000089" "g.42427661T>C" "" "" "" "GRN(NM_002087.4):c.415T>C (p.(Cys139Arg), p.C139R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350293T>C" "" "VUS" ""
"0000283401" "0" "30" "17" "42428393" "42428393" "subst" "2.8578E-5" "02329" "GRN_000163" "g.42428393G>C" "" "" "" "GRN(NM_002087.2):c.709-12G>C, GRN(NM_002087.4):c.709-12G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351025G>C" "" "likely benign" ""
"0000283402" "0" "90" "17" "42428456" "42428456" "del" "0" "02329" "GRN_000164" "g.42428456del" "" "" "" "GRN(NM_002087.4):c.760delG (p.D254Tfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351088del" "" "pathogenic" ""
"0000283403" "0" "50" "17" "42428788" "42428788" "subst" "5.28043E-5" "02329" "GRN_000165" "g.42428788G>A" "" "" "" "GRN(NM_002087.4):c.893G>A (p.R298H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351420G>A" "" "VUS" ""
"0000285059" "0" "30" "17" "42429025" "42429025" "subst" "8.12394E-6" "02326" "GRN_000167" "g.42429025G>A" "" "" "" "GRN(NM_002087.2):c.1041G>A (p.K347=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351657G>A" "" "likely benign" ""
"0000285060" "0" "50" "17" "42427099" "42427099" "subst" "8.96444E-5" "02326" "GRN_000017" "g.42427099G>A" "" "" "" "GRN(NM_002087.2):c.329G>A (p.R110Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349731G>A" "" "VUS" ""
"0000285061" "0" "10" "17" "42427630" "42427630" "subst" "0.0507" "02326" "GRN_000020" "g.42427630T>C" "" "" "" "GRN(NM_002087.2):c.384T>C (p.D128=), GRN(NM_002087.4):c.384T>C (p.(Asp128=), p.D128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350262T>C" "" "benign" ""
"0000285062" "0" "30" "17" "42428393" "42428393" "subst" "2.8578E-5" "02326" "GRN_000163" "g.42428393G>C" "" "" "" "GRN(NM_002087.2):c.709-12G>C, GRN(NM_002087.4):c.709-12G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351025G>C" "" "likely benign" ""
"0000288843" "0" "90" "17" "42429144" "42429144" "dup" "0" "01943" "GRN_000168" "g.42429144dup" "" "" "" "GRN(NM_002087.2):c.1160dupG (p.C388Lfs*26)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351776dup" "" "pathogenic" ""
"0000288844" "0" "50" "17" "42429407" "42429407" "subst" "4.07412E-6" "01943" "GRN_000169" "g.42429407C>T" "" "" "" "GRN(NM_002087.2):c.1204C>T (p.H402Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352039C>T" "" "VUS" ""
"0000288845" "0" "10" "17" "42429430" "42429430" "subst" "0.000911065" "01943" "GRN_000042" "g.42429430G>A" "" "" "" "GRN(NM_002087.2):c.1227G>A (p.T409=), GRN(NM_002087.4):c.1227G>A (p.T409=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352062G>A" "" "benign" ""
"0000288846" "0" "90" "17" "42429434" "42429435" "del" "0" "01943" "GRN_000130" "g.42429434_42429435del" "" "" "" "GRN(NM_002087.2):c.1231_1232delGT (p.V411Sfs*2)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352066_44352067del" "" "pathogenic" ""
"0000288847" "0" "30" "17" "42429444" "42429444" "subst" "2.43893E-5" "01943" "GRN_000043" "g.42429444G>T" "" "" "" "GRN(NM_002087.2):c.1241G>T (p.G414V), GRN(NM_002087.4):c.1241G>T (p.G414V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352076G>T" "" "likely benign" ""
"0000288848" "0" "30" "17" "42429456" "42429456" "subst" "0.000251963" "01943" "GRN_000044" "g.42429456G>A" "" "" "" "GRN(NM_002087.2):c.1253G>A (p.R418Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352088G>A" "" "likely benign" ""
"0000288849" "0" "30" "17" "42426660" "42426660" "subst" "6.10719E-5" "01943" "GRN_000152" "g.42426660G>A" "" "" "" "GRN(NM_002087.2):c.128G>A (p.R43H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349292G>A" "" "likely benign" ""
"0000288850" "0" "30" "17" "42429501" "42429501" "subst" "0.000593453" "01943" "GRN_000134" "g.42429501G>A" "" "" "" "GRN(NM_002087.2):c.1298G>A (p.R433Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352133G>A" "" "likely benign" ""
"0000288851" "0" "30" "17" "42429544" "42429544" "subst" "0.000126174" "01943" "GRN_000047" "g.42429544C>T" "" "" "" "GRN(NM_002087.2):c.1341C>T (p.H447=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352176C>T" "" "likely benign" ""
"0000288852" "0" "50" "17" "42429763" "42429763" "subst" "0" "01943" "GRN_000170" "g.42429763G>A" "" "" "" "GRN(NM_002087.2):c.1468G>A (p.V490M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352395G>A" "" "VUS" ""
"0000288853" "0" "10" "17" "42429839" "42429839" "subst" "0.00214047" "01943" "GRN_000054" "g.42429839G>C" "" "" "" "GRN(NM_002087.2):c.1544G>C (p.G515A), GRN(NM_002087.4):c.1544G>C (p.(Gly515Ala), p.G515A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352471G>C" "" "benign" ""
"0000288854" "0" "30" "17" "42430032" "42430032" "subst" "0.000181227" "01943" "GRN_000055" "g.42430032G>A" "" "" "" "GRN(NM_002087.2):c.1648G>A (p.V550I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352664G>A" "" "likely benign" ""
"0000288855" "0" "50" "17" "42426551" "42426551" "subst" "0" "01943" "GRN_000066" "g.42426551T>C" "" "" "" "GRN(NM_002087.2):c.19T>C (p.W7R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349183T>C" "" "VUS" ""
"0000288856" "0" "50" "17" "42426551" "42426551" "subst" "0" "01943" "GRN_000150" "g.42426551T>G" "" "" "" "GRN(NM_002087.2):c.19T>G (p.W7G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349183T>G" "" "VUS" ""
"0000288857" "0" "30" "17" "42426868" "42426868" "subst" "4.06329E-6" "01943" "GRN_000153" "g.42426868C>T" "" "" "" "GRN(NM_002087.2):c.213C>T (p.H71=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349500C>T" "" "likely benign" ""
"0000288858" "0" "90" "17" "42426898" "42426898" "del" "0" "01943" "GRN_000077" "g.42426898del" "" "" "" "GRN(NM_002087.2):c.243delC (p.S82Vfs*174), GRN(NM_002087.4):c.243delC (p.S82Vfs*174)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349530del" "" "pathogenic" ""
"0000288859" "0" "10" "17" "42426940" "42426940" "subst" "0.159375" "01943" "GRN_000157" "g.42426940G>A" "" "" "" "GRN(NM_002087.2):c.264+21G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349572G>A" "" "benign" ""
"0000288860" "0" "30" "17" "42426926" "42426926" "subst" "0.00515539" "01943" "GRN_000156" "g.42426926G>A" "" "" "" "GRN(NM_002087.2):c.264+7G>A (p.?), GRN(NM_002087.4):c.264+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349558G>A" "" "likely benign" ""
"0000288862" "0" "50" "17" "42427605" "42427605" "subst" "0.00109643" "01943" "GRN_000083" "g.42427605C>A" "" "" "" "GRN(NM_002087.2):c.359C>A (p.S120Y), GRN(NM_002087.4):c.359C>A (p.S120Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350237C>A" "" "VUS" ""
"0000288863" "0" "90" "17" "42427619" "42427619" "subst" "0" "01943" "GRN_000085" "g.42427619C>T" "" "" "" "GRN(NM_002087.2):c.373C>T (p.Q125*), GRN(NM_002087.4):c.373C>T (p.Q125*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350251C>T" "" "pathogenic" ""
"0000288864" "0" "10" "17" "42427630" "42427630" "subst" "0.0507" "01943" "GRN_000020" "g.42427630T>C" "" "" "" "GRN(NM_002087.2):c.384T>C (p.D128=), GRN(NM_002087.4):c.384T>C (p.(Asp128=), p.D128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350262T>C" "" "benign" ""
"0000288865" "0" "10" "17" "42426574" "42426574" "subst" "0.00120669" "01943" "GRN_000068" "g.42426574G>A" "" "" "" "GRN(NM_002087.2):c.42G>A (p.L14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349206G>A" "" "benign" ""
"0000288866" "0" "10" "17" "42427732" "42427732" "subst" "0.280707" "01943" "GRN_000160" "g.42427732G>A" "" "" "" "GRN(NM_002087.2):c.462+24G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350364G>A" "" "benign" ""
"0000288867" "0" "10" "17" "42426587" "42426587" "subst" "0.00336901" "01943" "GRN_000005" "g.42426587C>T" "" "" "" "GRN(NM_002087.2):c.55C>T (p.R19W, p.(Arg19Trp)), GRN(NM_002087.4):c.55C>T (p.R19W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349219C>T" "" "benign" ""
"0000288868" "0" "30" "17" "42428165" "42428165" "subst" "0.000138492" "01943" "GRN_000162" "g.42428165C>A" "" "" "" "GRN(NM_002087.2):c.705C>A (p.P235=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350797C>A" "" "likely benign" ""
"0000288869" "0" "90" "17" "42428169" "42428169" "subst" "8.15255E-6" "01943" "GRN_000101" "g.42428169G>A" "" "" "" "GRN(NM_002087.2):c.708+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44350801G>A" "" "pathogenic" ""
"0000288870" "0" "30" "17" "42428833" "42428833" "subst" "0" "01943" "GRN_000166" "g.42428833C>A" "" "" "" "GRN(NM_002087.2):c.933+5C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351465C>A" "" "likely benign" ""
"0000288871" "0" "10" "17" "42428954" "42428954" "subst" "0.000857041" "01943" "GRN_000038" "g.42428954G>A" "" "" "" "GRN(NM_002087.2):c.970G>A (p.A324T), GRN(NM_002087.4):c.970G>A (p.A324T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44351586G>A" "" "benign" ""
"0000325433" "0" "30" "17" "42426926" "42426926" "subst" "0.00515539" "01804" "GRN_000156" "g.42426926G>A" "" "" "" "GRN(NM_002087.2):c.264+7G>A (p.?), GRN(NM_002087.4):c.264+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44349558G>A" "" "likely benign" ""
"0000325435" "0" "30" "17" "42429839" "42429839" "subst" "0.00214047" "01804" "GRN_000054" "g.42429839G>C" "" "" "" "GRN(NM_002087.2):c.1544G>C (p.G515A), GRN(NM_002087.4):c.1544G>C (p.(Gly515Ala), p.G515A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.44352471G>C" "" "likely benign" ""
"0000561900" "0" "50" "17" "42426554" "42426554" "subst" "2.43784E-5" "02330" "FAM171A2_000001" "g.42426554G>A" "" "" "" "GRN(NM_002087.2):c.22G>A (p.V8M), GRN(NM_002087.4):c.22G>A (p.V8M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349186G>A" "" "VUS" ""
"0000561901" "0" "30" "17" "42426631" "42426631" "subst" "0.00224971" "01943" "GRN_000006" "g.42426631C>T" "" "" "" "GRN(NM_002087.2):c.99C>T (p.D33=), GRN(NM_002087.4):c.99C>T (p.D33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349263C>T" "" "likely benign" ""
"0000561902" "0" "30" "17" "42426631" "42426631" "subst" "0.00224971" "02326" "GRN_000006" "g.42426631C>T" "" "" "" "GRN(NM_002087.2):c.99C>T (p.D33=), GRN(NM_002087.4):c.99C>T (p.D33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349263C>T" "" "likely benign" ""
"0000561903" "0" "10" "17" "42426631" "42426631" "subst" "0.00224971" "02329" "GRN_000006" "g.42426631C>T" "" "" "" "GRN(NM_002087.2):c.99C>T (p.D33=), GRN(NM_002087.4):c.99C>T (p.D33=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349263C>T" "" "benign" ""
"0000561904" "0" "30" "17" "42426791" "42426791" "subst" "2.03034E-5" "01943" "FAM171A2_000002" "g.42426791T>C" "" "" "" "GRN(NM_002087.2):c.139-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349423T>C" "" "likely benign" ""
"0000561905" "0" "30" "17" "42426828" "42426828" "subst" "0" "01943" "FAM171A2_000003" "g.42426828G>A" "" "" "" "GRN(NM_002087.2):c.173G>A (p.G58D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349460G>A" "" "likely benign" ""
"0000561906" "0" "30" "17" "42426883" "42426883" "subst" "0.000235713" "01943" "GRN_000011" "g.42426883C>T" "" "" "" "GRN(NM_002087.2):c.228C>T (p.T76=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349515C>T" "" "likely benign" ""
"0000561907" "0" "30" "17" "42427049" "42427049" "subst" "8.1275E-5" "02329" "GRN_000080" "g.42427049G>A" "" "" "" "GRN(NM_002087.2):c.279G>A (p.G93=), GRN(NM_002087.4):c.279G>A (p.G93=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349681G>A" "" "likely benign" ""
"0000561908" "0" "10" "17" "42427546" "42427549" "dup" "0" "01943" "FAM171A2_000004" "g.42427546_42427549dup" "" "" "" "GRN(NM_002087.2):c.350-50_350-47dupGTCA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44350178_44350181dup" "" "benign" ""
"0000561909" "0" "30" "17" "42427632" "42427632" "subst" "0" "02329" "FAM171A2_000005" "g.42427632G>A" "" "" "" "GRN(NM_002087.4):c.386G>A (p.S129N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44350264G>A" "" "likely benign" ""
"0000561910" "0" "90" "17" "42427634" "42427637" "del" "0" "02329" "GRN_000088" "g.42427634_42427637del" "" "" "" "GRN(NM_002087.4):c.388_391delCAGT (p.Q130Sfs*125)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44350266_44350269del" "" "pathogenic" ""
"0000561911" "0" "30" "17" "42427639" "42427639" "subst" "0.000150242" "02329" "FAM171A2_000006" "g.42427639C>G" "" "" "" "GRN(NM_002087.4):c.393C>G (p.F131L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44350271C>G" "" "likely benign" ""
"0000561912" "0" "50" "17" "42427865" "42427865" "subst" "0" "02329" "FAM171A2_000007" "g.42427865T>C" "" "" "" "GRN(NM_002087.4):c.518T>C (p.L173P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44350497T>C" "" "VUS" ""
"0000561913" "0" "30" "17" "42428419" "42428419" "subst" "5.29182E-5" "02329" "FAM171A2_000008" "g.42428419C>T" "" "" "" "GRN(NM_002087.4):c.723C>T (p.S241=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351051C>T" "" "likely benign" ""
"0000561914" "0" "50" "17" "42428420" "42428420" "subst" "0" "01943" "FAM171A2_000009" "g.42428420G>C" "" "" "" "GRN(NM_002087.2):c.724G>C (p.D242H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351052G>C" "" "VUS" ""
"0000561915" "0" "10" "17" "42428538" "42428538" "subst" "0.0455805" "02330" "FAM171A2_000010" "g.42428538G>A" "" "" "" "GRN(NM_002087.2):c.835+7G>A, GRN(NM_002087.4):c.835+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351170G>A" "" "benign" ""
"0000561916" "0" "10" "17" "42428538" "42428538" "subst" "0.0455805" "01943" "FAM171A2_000010" "g.42428538G>A" "" "" "" "GRN(NM_002087.2):c.835+7G>A, GRN(NM_002087.4):c.835+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351170G>A" "" "benign" ""
"0000561917" "0" "10" "17" "42428538" "42428538" "subst" "0.0455805" "02329" "FAM171A2_000010" "g.42428538G>A" "" "" "" "GRN(NM_002087.2):c.835+7G>A, GRN(NM_002087.4):c.835+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351170G>A" "" "benign" ""
"0000561918" "0" "30" "17" "42428797" "42428797" "subst" "1.62537E-5" "01943" "FAM171A2_000011" "g.42428797C>T" "" "" "" "GRN(NM_002087.2):c.902C>T (p.S301L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351429C>T" "" "likely benign" ""
"0000561919" "0" "30" "17" "42428798" "42428798" "subst" "0.000576982" "02326" "GRN_000037" "g.42428798G>A" "" "" "" "GRN(NM_002087.2):c.903G>A (p.S301=), GRN(NM_002087.4):c.903G>A (p.(Ser301=), p.S301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351430G>A" "" "likely benign" ""
"0000561920" "0" "30" "17" "42428798" "42428798" "subst" "0.000576982" "02329" "GRN_000037" "g.42428798G>A" "" "" "" "GRN(NM_002087.2):c.903G>A (p.S301=), GRN(NM_002087.4):c.903G>A (p.(Ser301=), p.S301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351430G>A" "" "likely benign" ""
"0000561921" "0" "50" "17" "42428835" "42428835" "subst" "0" "02326" "FAM171A2_000012" "g.42428835A>T" "" "" "" "GRN(NM_002087.2):c.933+7A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351467A>T" "" "VUS" ""
"0000561922" "0" "50" "17" "42428843" "42428843" "subst" "0" "02326" "FAM171A2_000013" "g.42428843C>G" "" "" "" "GRN(NM_002087.2):c.933+15C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351475C>G" "" "VUS" ""
"0000561923" "0" "90" "17" "42428929" "42428930" "del" "0" "01943" "FAM171A2_000014" "g.42428929_42428930del" "" "" "" "GRN(NM_002087.2):c.945_946delTG (p.C315*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351561_44351562del" "" "pathogenic" ""
"0000561924" "0" "30" "17" "42428954" "42428954" "subst" "0.000857041" "02325" "GRN_000038" "g.42428954G>A" "" "" "" "GRN(NM_002087.2):c.970G>A (p.A324T), GRN(NM_002087.4):c.970G>A (p.A324T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44351586G>A" "" "likely benign" ""
"0000561925" "0" "30" "17" "42429424" "42429424" "subst" "8.13511E-6" "02329" "FAM171A2_000015" "g.42429424C>A" "" "" "" "GRN(NM_002087.4):c.1221C>A (p.G407=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352056C>A" "" "likely benign" ""
"0000561926" "0" "30" "17" "42429444" "42429444" "subst" "2.43893E-5" "02329" "GRN_000043" "g.42429444G>T" "" "" "" "GRN(NM_002087.2):c.1241G>T (p.G414V), GRN(NM_002087.4):c.1241G>T (p.G414V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352076G>T" "" "likely benign" ""
"0000561927" "0" "90" "17" "42429455" "42429455" "subst" "0" "02329" "GRN_000133" "g.42429455C>T" "" "" "" "GRN(NM_002087.4):c.1252C>T (p.R418*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352087C>T" "" "pathogenic" ""
"0000561928" "0" "10" "17" "42429500" "42429500" "subst" "0.00563784" "02326" "GRN_000046" "g.42429500C>T" "" "" "" "GRN(NM_002087.2):c.1297C>T (p.R433W), GRN(NM_002087.4):c.1297C>T (p.R433W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352132C>T" "" "benign" ""
"0000561929" "0" "30" "17" "42429780" "42429780" "subst" "0.00012192" "01943" "GRN_000052" "g.42429780C>T" "" "" "" "GRN(NM_002087.2):c.1485C>T (p.C495=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352412C>T" "" "likely benign" ""
"0000561930" "0" "50" "17" "42429857" "42429857" "subst" "5.28047E-5" "02326" "GRN_000144" "g.42429857G>A" "" "" "" "GRN(NM_002087.2):c.1562G>A (p.C521Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352489G>A" "" "VUS" ""
"0000616621" "0" "90" "17" "42427619" "42427619" "subst" "0" "02329" "GRN_000085" "g.42427619C>T" "" "" "" "GRN(NM_002087.2):c.373C>T (p.Q125*), GRN(NM_002087.4):c.373C>T (p.Q125*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44350251C>T" "" "pathogenic" ""
"0000616622" "0" "30" "17" "42429469" "42429469" "subst" "1.21896E-5" "01943" "FAM171A2_000016" "g.42429469C>T" "" "" "" "GRN(NM_002087.2):c.1266C>T (p.I422=), GRN(NM_002087.4):c.1266C>T (p.(Ile422=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352101C>T" "" "likely benign" ""
"0000616623" "0" "30" "17" "42429727" "42429727" "subst" "0" "01943" "FAM171A2_000017" "g.42429727C>G" "" "" "" "GRN(NM_002087.2):c.1432C>G (p.R478G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352359C>G" "" "likely benign" ""
"0000616624" "0" "50" "17" "42429748" "42429748" "subst" "0" "01943" "FAM171A2_000018" "g.42429748G>A" "" "" "" "GRN(NM_002087.2):c.1453G>A (p.G485S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44352380G>A" "" "VUS" ""
"0000623693" "0" "30" "17" "42426554" "42426554" "subst" "2.43784E-5" "02326" "FAM171A2_000001" "g.42426554G>A" "" "" "" "GRN(NM_002087.2):c.22G>A (p.V8M), GRN(NM_002087.4):c.22G>A (p.V8M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349186G>A" "" "likely benign" ""
"0000658152" "0" "30" "17" "42427037" "42427037" "subst" "0.000581003" "02326" "GRN_000013" "g.42427037C>T" "" "" "" "GRN(NM_002087.2):c.267C>T (p.A89=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.44349669C>T" "" "likely benign" ""
"0000680899" "0" "30" "17" "42427049" "42427049" "subst" "8.1275E-5" "01943" "GRN_000080" "g.42427049G>A" "" "" "" "GRN(NM_002087.2):c.279G>A (p.G93=), GRN(NM_002087.4):c.279G>A (p.G93=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000692373" "0" "30" "17" "42427860" "42427860" "subst" "8.53055E-5" "01943" "FAM171A2_000019" "g.42427860C>T" "" "" "" "GRN(NM_002087.2):c.513C>T (p.C171=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000692374" "0" "90" "17" "42429772" "42429772" "subst" "4.06507E-6" "01943" "GRN_000004" "g.42429772C>T" "" "" "" "GRN(NM_002087.2):c.1477C>T (p.R493*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000703990" "0" "70" "17" "42426921" "42426921" "subst" "0" "01164" "GRN_000171" "g.42426921T>C" "" "" "" "" "ACMG: PVS1, PM2 (predicted in-frame exon 3 skipping, exon 3 contains functional \"granulin\" domain)" "Germline" "?" "" "" "" "" "" "" "likely pathogenic (dominant)" "ACMG"
"0000708490" "0" "90" "17" "42427054" "42427054" "dup" "0" "03951" "GRN_000172" "g.42427054dup" "" "" "" "284dupG" "" "Germline/De novo (untested)" "-" "" "0" "" "" "g.44349686dup" "" "pathogenic (dominant)" "ACMG"
"0000708796" "0" "90" "17" "42426557" "42426557" "del" "0" "01807" "GRN_000173" "g.42426557del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.44349189del" "" "pathogenic" ""
"0000714467" "0" "90" "17" "42428135" "42428136" "del" "0" "01807" "GRN_000098" "g.42428135_42428136del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000726445" "0" "30" "17" "42426587" "42426587" "subst" "0.00336901" "02329" "GRN_000005" "g.42426587C>T" "" "" "" "GRN(NM_002087.2):c.55C>T (p.R19W, p.(Arg19Trp)), GRN(NM_002087.4):c.55C>T (p.R19W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000726446" "0" "50" "17" "42426884" "42426884" "subst" "8.94113E-5" "01943" "FAM171A2_000020" "g.42426884G>A" "" "" "" "GRN(NM_002087.2):c.229G>A (p.V77I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000726447" "0" "50" "17" "42427605" "42427605" "subst" "0.00109643" "02325" "GRN_000083" "g.42427605C>A" "" "" "" "GRN(NM_002087.2):c.359C>A (p.S120Y), GRN(NM_002087.4):c.359C>A (p.S120Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000726448" "0" "50" "17" "42427877" "42427877" "subst" "0" "01943" "FAM171A2_000021" "g.42427877G>T" "" "" "" "GRN(NM_002087.2):c.530G>T (p.R177L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000726449" "0" "30" "17" "42428798" "42428798" "subst" "0.000576982" "01943" "GRN_000037" "g.42428798G>A" "" "" "" "GRN(NM_002087.2):c.903G>A (p.S301=), GRN(NM_002087.4):c.903G>A (p.(Ser301=), p.S301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000726450" "0" "50" "17" "42429500" "42429500" "subst" "0.00563784" "01943" "GRN_000046" "g.42429500C>T" "" "" "" "GRN(NM_002087.2):c.1297C>T (p.R433W), GRN(NM_002087.4):c.1297C>T (p.R433W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000726451" "0" "50" "17" "42429576" "42429576" "subst" "4.4942E-5" "02325" "GRN_000048" "g.42429576C>T" "" "" "" "GRN(NM_002087.4):c.1373C>T (p.P458L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000763831" "1" "50" "17" "42428728" "42428728" "subst" "1.2184E-5" "00006" "GRN_000174" "g.42428728C>T" "" "{PMID:Courage 2021:33798445}, {DOI:Courage 2021:10.1016/j.ajhg.2021.03.013}" "" "836-3C>T" "ACMG PM2, BP4" "Germline/De novo (untested)" "" "" "0" "" "" "g.44351360C>T" "" "VUS" "ACMG"
"0000789905" "0" "90" "17" "42426610" "42426610" "subst" "0" "01807" "GRN_000175" "g.42426610C>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000808037" "0" "30" "17" "42426791" "42426791" "subst" "2.03034E-5" "02326" "FAM171A2_000002" "g.42426791T>C" "" "" "" "GRN(NM_002087.2):c.139-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000808038" "0" "30" "17" "42429375" "42429375" "subst" "8.21659E-6" "01943" "FAM171A2_000022" "g.42429375C>T" "" "" "" "GRN(NM_002087.2):c.1180-8C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000808039" "0" "90" "17" "42429455" "42429455" "subst" "0" "02327" "GRN_000133" "g.42429455C>T" "" "" "" "GRN(NM_002087.4):c.1252C>T (p.R418*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000808040" "0" "90" "17" "42429463" "42429463" "del" "0" "01943" "FAM171A2_000023" "g.42429463del" "" "" "" "GRN(NM_002087.2):c.1260delC (p.S420Rfs*71)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" ""
"0000811475" "3" "70" "17" "42426533" "42426533" "subst" "4.06474E-6" "00000" "GRN_000176" "g.42426533A>T" "" "{PMID:Dozieres-Puyravel 2020:31489614}" "" "c.1A>T, Not known" "Homozygous" "Germline" "?" "" "0" "" "" "g.44349165A>T" "" "likely pathogenic" "ACMG"
"0000826495" "0" "90" "17" "42429708" "42429708" "subst" "0" "00000" "GRN_000177" "g.42429708G>T" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.1414-1 G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000826496" "3" "90" "17" "42429708" "42429708" "subst" "0" "00000" "GRN_000177" "g.42429708G>T" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.1414-1 G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000826497" "0" "90" "17" "42429708" "42429708" "subst" "0" "00000" "GRN_000177" "g.42429708G>T" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.1414-1 G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000826498" "3" "90" "17" "42429708" "42429708" "subst" "0" "00000" "GRN_000177" "g.42429708G>T" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.1414-1 G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000826499" "0" "90" "17" "42429708" "42429708" "subst" "0" "00000" "GRN_000177" "g.42429708G>T" "" "{PMID:Fuster-Garcia-2019:31725169}" "" "c.1414-1 G>T" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" ""
"0000854944" "0" "50" "17" "42426845" "42426845" "subst" "0" "01943" "FAM171A2_000024" "g.42426845G>A" "" "" "" "GRN(NM_002087.2):c.190G>A (p.D64N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000854945" "0" "50" "17" "42428094" "42428094" "subst" "4.4682E-5" "01943" "GRN_000002" "g.42428094C>T" "" "" "" "GRN(NM_002087.2):c.634C>T (p.R212W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000854946" "0" "30" "17" "42429540" "42429540" "subst" "1.22074E-5" "01943" "FAM171A2_000026" "g.42429540A>T" "" "" "" "GRN(NM_002087.2):c.1337A>T (p.Q446L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000865308" "0" "30" "17" "42427893" "42427893" "subst" "0.00086941" "02329" "GRN_000026" "g.42427893G>A" "" "" "" "GRN(NM_002087.2):c.546G>A (p.T182=), GRN(NM_002087.4):c.546G>A (p.T182=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000865309" "0" "30" "17" "42428176" "42428176" "subst" "0.000138713" "01943" "FAM171A2_000025" "g.42428176A>T" "" "" "" "GRN(NM_002087.2):c.708+8A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000865310" "0" "30" "17" "42429430" "42429430" "subst" "0.000911065" "02329" "GRN_000042" "g.42429430G>A" "" "" "" "GRN(NM_002087.2):c.1227G>A (p.T409=), GRN(NM_002087.4):c.1227G>A (p.T409=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000893957" "0" "30" "17" "42427892" "42427892" "subst" "0.000991274" "02326" "GRN_000094" "g.42427892C>T" "" "" "" "GRN(NM_002087.2):c.545C>T (p.T182M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000893958" "0" "30" "17" "42429456" "42429456" "subst" "0.000251963" "02326" "GRN_000044" "g.42429456G>A" "" "" "" "GRN(NM_002087.2):c.1253G>A (p.R418Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000893959" "0" "50" "17" "42429557" "42429577" "del" "0" "02325" "FAM171A2_000027" "g.42429557_42429577del" "" "" "" "GRN(NM_002087.4):c.1354_1374delGTGGGGCAGACCTGCTGCCCG (p.V452_P458del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000903132" "0" "70" "17" "42422701" "42422701" "subst" "0" "03779" "GRN_000178" "g.42422701A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" ""
"0000914864" "0" "30" "17" "42428728" "42428728" "subst" "1.2184E-5" "02325" "GRN_000174" "g.42428728C>T" "" "" "" "GRN(NM_002087.4):c.836-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000914865" "0" "30" "17" "42429544" "42429544" "subst" "0.000126174" "02326" "GRN_000047" "g.42429544C>T" "" "" "" "GRN(NM_002087.2):c.1341C>T (p.H447=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000950929" "0" "50" "17" "42426540" "42426540" "subst" "0" "02325" "FAM171A2_000028" "g.42426540C>A" "" "" "" "GRN(NM_002087.4):c.8C>A (p.T3N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000982540" "0" "50" "17" "42427661" "42427661" "subst" "0.000178664" "01804" "GRN_000089" "g.42427661T>C" "" "" "" "GRN(NM_002087.4):c.415T>C (p.(Cys139Arg), p.C139R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0000982541" "0" "10" "17" "42428538" "42428538" "subst" "0.0455805" "01804" "FAM171A2_000010" "g.42428538G>A" "" "" "" "GRN(NM_002087.2):c.835+7G>A, GRN(NM_002087.4):c.835+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0000982542" "0" "30" "17" "42428833" "42428833" "subst" "8.13855E-6" "01804" "FAM171A2_000029" "g.42428833C>G" "" "" "" "GRN(NM_002087.4):c.933+5C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0000982543" "0" "50" "17" "42430144" "42430144" "del" "0" "01804" "FAM171A2_000030" "g.42430144del" "" "" "" "GRN(NM_002087.4):c.1760del (p.(Pro587Glnfs*3))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001003313" "0" "30" "17" "42426587" "42426587" "subst" "0.00336901" "01804" "GRN_000005" "g.42426587C>T" "" "" "" "GRN(NM_002087.2):c.55C>T (p.R19W, p.(Arg19Trp)), GRN(NM_002087.4):c.55C>T (p.R19W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001003314" "0" "50" "17" "42429602" "42429602" "subst" "0" "01804" "FAM171A2_000031" "g.42429602T>C" "" "" "" "GRN(NM_002087.2):c.1399T>C (p.(Cys467Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001015559" "0" "30" "17" "42427046" "42427046" "subst" "8.12836E-5" "02325" "FAM171A2_000032" "g.42427046C>T" "" "" "" "GRN(NM_002087.4):c.276C>T (p.C92=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001026948" "0" "30" "17" "42427893" "42427893" "subst" "0.00086941" "01943" "GRN_000026" "g.42427893G>A" "" "" "" "GRN(NM_002087.2):c.546G>A (p.T182=), GRN(NM_002087.4):c.546G>A (p.T182=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001041907" "0" "10" "17" "42427630" "42427630" "subst" "0.0507" "01804" "GRN_000020" "g.42427630T>C" "" "" "" "GRN(NM_002087.2):c.384T>C (p.D128=), GRN(NM_002087.4):c.384T>C (p.(Asp128=), p.D128=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" ""
"0001041908" "0" "30" "17" "42428844" "42428844" "subst" "0.000146612" "02326" "FAM171A2_000033" "g.42428844G>A" "" "" "" "GRN(NM_002087.2):c.933+16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001041909" "0" "30" "17" "42428954" "42428954" "subst" "0.000857041" "02326" "GRN_000038" "g.42428954G>A" "" "" "" "GRN(NM_002087.2):c.970G>A (p.A324T), GRN(NM_002087.4):c.970G>A (p.A324T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001041910" "0" "30" "17" "42429469" "42429469" "subst" "1.21896E-5" "01804" "FAM171A2_000016" "g.42429469C>T" "" "" "" "GRN(NM_002087.2):c.1266C>T (p.I422=), GRN(NM_002087.4):c.1266C>T (p.(Ile422=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001056043" "0" "30" "17" "42427660" "42427660" "subst" "0.000609083" "01804" "FAM171A2_000034" "g.42427660G>C" "" "" "" "GRN(NM_002087.4):c.414G>C (p.(Thr138=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001066791" "0" "50" "17" "42427661" "42427661" "subst" "0.000178664" "02325" "GRN_000089" "g.42427661T>C" "" "" "" "GRN(NM_002087.4):c.415T>C (p.(Cys139Arg), p.C139R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001066792" "0" "50" "17" "42428086" "42428086" "subst" "0.000467142" "02325" "FAM171A2_000035" "g.42428086C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
"0001066793" "0" "30" "17" "42428798" "42428798" "subst" "0.000576982" "01804" "GRN_000037" "g.42428798G>A" "" "" "" "GRN(NM_002087.2):c.903G>A (p.S301=), GRN(NM_002087.4):c.903G>A (p.(Ser301=), p.S301=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" ""
"0001066794" "0" "50" "17" "42430057" "42430057" "subst" "0" "02325" "FAM171A2_000036" "g.42430057G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" ""
## Variants_On_Transcripts ## Do not remove or alter this header ##
## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene.
## Note: Only showing Variants_On_Transcript columns active for Genes GRN
## Count = 465
"{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}"
"0000087446" "00008964" "50" "634" "0" "634" "0" "c.634C>T" "r.(?)" "p.(Arg212Trp)" "7"
"0000087447" "00008964" "50" "1704" "0" "1704" "0" "c.1704G>T" "r.(?)" "p.(Arg568Ser)" "13"
"0000170442" "00008964" "70" "813" "0" "816" "0" "c.813_816del" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000170443" "00008964" "90" "1477" "0" "1477" "0" "c.1477C>T" "r.(?)" "p.(Arg493*)" "12"
"0000243381" "00008964" "99" "373" "0" "373" "0" "c.(373C>T)" "r.(?)" "p.(Gln125*)" "5"
"0000243382" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243383" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243384" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243385" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243386" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243387" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243388" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243389" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243390" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243391" "00008964" "99" "-8" "5" "-8" "5" "c.-8+5G>C" "r.-8_-7ins3823" "0" "1_2"
"0000243392" "00008964" "99" "3" "0" "3" "0" "c.(3G>A)" "r.(?)" "p.(Met1?)" "2"
"0000243393" "00008964" "99" "380" "0" "381" "0" "c.(380_381del)" "r.(?)" "p.(Pro127Argfs*2)" "5"
"0000243394" "00008964" "99" "380" "0" "381" "0" "c.(380_381del)" "r.(?)" "p.(Pro127Argfs*2)" "5"
"0000243395" "00008964" "99" "835" "0" "835" "1" "c.835_835+1insCTGA" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243396" "00008964" "99" "2" "0" "2" "0" "c.2T>C" "r.(?)" "0" "2"
"0000243397" "00008964" "99" "2" "0" "2" "0" "c.2T>C" "r.(?)" "0" "2"
"0000243398" "00008964" "99" "87" "0" "90" "0" "c.(87_90dup)" "r.(?)" "p.(Cys31Leufs*35)" "2"
"0000243399" "00008964" "99" "87" "0" "90" "0" "c.(87_90dup)" "r.(?)" "p.(Cys31Leufs*35)" "2"
"0000243400" "00008964" "99" "87" "0" "90" "0" "c.(87_90dup)" "r.(?)" "p.(Cys31Leufs*35)" "2"
"0000243401" "00008964" "99" "87" "0" "90" "0" "c.(87_90dup)" "r.(?)" "p.(Cys31Leufs*35)" "2"
"0000243402" "00008964" "99" "87" "0" "90" "0" "c.(87_90dup)" "r.(?)" "p.(Cys31Leufs*35)" "2"
"0000243403" "00008964" "99" "87" "0" "90" "0" "c.(87_90dup)" "r.(?)" "p.(Cys31Leufs*35)" "2"
"0000243404" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243405" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243406" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243407" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243408" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243409" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243410" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243411" "00008964" "99" "388" "0" "391" "0" "c.(388_391del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243412" "00008964" "99" "933" "1" "933" "1" "c.933+1G>A" "r.(836_933del)" "p.(Val279Glyfs*5)" "8i_9i"
"0000243413" "00008964" "99" "1145" "0" "1145" "0" "c.(1145del)" "r.(?)" "p.(Thr382Serfs*30)" "10"
"0000243414" "00008964" "99" "1157" "0" "1157" "0" "c.(1157G>A)" "r.(?)" "p.(Trp386*)" "10"
"0000243415" "00008964" "99" "1157" "0" "1157" "0" "c.(1157G>A)" "r.(?)" "p.(Trp386*)" "10"
"0000243416" "00008964" "99" "1157" "0" "1157" "0" "c.(1157G>A)" "r.(?)" "p.(Trp386*)" "10"
"0000243417" "00008964" "99" "1252" "0" "1252" "0" "c.(1252C>T)" "r.(?)" "p.(Arg418*)" "11"
"0000243418" "00008964" "99" "1252" "0" "1252" "0" "c.(1252C>T)" "r.(?)" "p.(Arg418*)" "11"
"0000243419" "00008964" "99" "1252" "0" "1252" "0" "c.(1252C>T)" "r.(?)" "p.(Arg418*)" "11"
"0000243420" "00008964" "99" "1252" "0" "1252" "0" "c.(1252C>T)" "r.(?)" "p.(Arg418*)" "11"
"0000243421" "00008964" "99" "1252" "0" "1252" "0" "c.(1252C>T)" "r.(?)" "p.(Arg418*)" "11"
"0000243422" "00008964" "99" "1402" "0" "1402" "0" "c.(1402C>T)" "r.(?)" "p.(Gln468*)" "11"
"0000243423" "00008964" "99" "1402" "0" "1402" "0" "c.(1402C>T)" "r.(?)" "p.(Gln468*)" "11"
"0000243427" "00008964" "99" "26" "0" "26" "0" "c.(26C>A)" "r.(?)" "p.(Ala9Asp)" "2"
"0000243428" "00008964" "99" "26" "0" "26" "0" "c.(26C>A)" "r.(?)" "p.(Ala9Asp)" "2"
"0000243429" "00008964" "99" "26" "0" "26" "0" "c.(26C>A)" "r.(?)" "p.(Ala9Asp)" "2"
"0000243430" "00008964" "99" "26" "0" "26" "0" "c.(26C>A)" "r.(?)" "p.(Ala9Asp)" "2"
"0000243431" "00008964" "99" "26" "0" "26" "0" "c.(26C>A)" "r.(?)" "p.(Ala9Asp)" "2"
"0000243432" "00008964" "99" "63" "0" "64" "0" "c.(63_64insC)" "r.(?)" "p.(Asp22Argfs*43)" "2"
"0000243433" "00008964" "99" "63" "0" "64" "0" "c.(63_64insC)" "r.(?)" "p.(Asp22Argfs*43)" "2"
"0000243434" "00008964" "99" "102" "0" "102" "0" "c.(102del)" "r.(?)" "p.(Gly35Glufs*19)" "2"
"0000243435" "00008964" "99" "102" "0" "102" "0" "c.(102del)" "r.(?)" "p.(Gly35Glufs*19)" "2"
"0000243436" "00008964" "99" "102" "0" "102" "0" "c.(102del)" "r.(?)" "p.(Gly35Glufs*19)" "2"
"0000243437" "00008964" "99" "138" "1" "138" "1" "c.138+1G>A" "r.-7_138del" "p.?" "1i_2i"
"0000243438" "00008964" "99" "138" "1" "138" "1" "c.138+1G>A" "r.-7_138del" "p.?" "1i_2i"
"0000243439" "00008964" "99" "154" "0" "154" "0" "c.(154del)" "r.(?)" "p.(Thr52Hisfs*2)" "3"
"0000243440" "00008964" "99" "154" "0" "154" "0" "c.(154del)" "r.(?)" "p.(Thr52Hisfs*2)" "3"
"0000243441" "00008964" "99" "154" "0" "154" "0" "c.(154del)" "r.(?)" "p.(Thr52Hisfs*2)" "3"
"0000243442" "00008964" "99" "154" "0" "154" "0" "c.(154del)" "r.(?)" "p.(Thr52Hisfs*2)" "3"
"0000243443" "00008964" "99" "234" "0" "235" "0" "c.(234_235del)" "r.(?)" "p.(Gly79Aspfs*39)" "3"
"0000243444" "00008964" "99" "234" "0" "235" "0" "c.(234_235del)" "r.(?)" "p.(Gly79Aspfs*39)" "3"
"0000243445" "00008964" "99" "463" "-1" "463" "-1" "c.463-1G>A" "r.(463_598del)" "p.(Ala155Trpfs*56)" "5i_6i"
"0000243446" "00008964" "99" "463" "-1" "463" "-1" "c.463-1G>A" "r.(463_598del)" "p.(Ala155Trpfs*56)" "5i_6i"
"0000243447" "00008964" "99" "675" "0" "676" "0" "c.(675_676del)" "r.(?)" "p.(Ser226Trpfs*28)" "7"
"0000243448" "00008964" "99" "675" "0" "676" "0" "c.(675_676del)" "r.(?)" "p.(Ser226Trpfs*28)" "7"
"0000243449" "00008964" "99" "675" "0" "676" "0" "c.(675_676del)" "r.(?)" "p.(Ser226Trpfs*28)" "7"
"0000243450" "00008964" "99" "675" "0" "676" "0" "c.(675_676del)" "r.(?)" "p.(Ser226Trpfs*28)" "7"
"0000243451" "00008964" "99" "675" "0" "676" "0" "c.(675_676del)" "r.(?)" "p.(Ser226Trpfs*28)" "7"
"0000243452" "00008964" "99" "675" "0" "676" "0" "c.(675_676del)" "r.(?)" "p.(Ser226Trpfs*28)" "7"
"0000243453" "00008964" "99" "708" "1" "708" "1" "c.708+1G>C" "r.(599_708del)" "p.(Val200Glyfs*18)" "6i_7i"
"0000243454" "00008964" "99" "759" "0" "760" "0" "c.(759_760del)" "r.(?)" "p.(Cys253*)" "8"
"0000243455" "00008964" "99" "759" "0" "760" "0" "c.(759_760del)" "r.(?)" "p.(Cys253*)" "8"
"0000243456" "00008964" "99" "836" "-1" "836" "-1" "c.836-1G>C" "r.(836_933del)" "p.(Val279Glyfs*5)" "8i_9i"
"0000243457" "00008964" "99" "836" "-1" "836" "-1" "c.836-1G>C" "r.(836_933del)" "p.(Val279Glyfs*5)" "8i_9i"
"0000243458" "00008964" "99" "910" "0" "911" "0" "c.(910_911insTG)" "r.(?)" "p.(Trp304Leufs*58)" "9"
"0000243459" "00008964" "99" "911" "0" "911" "0" "c.(911G>A)" "r.(?)" "p.(Trp304*)" "9"
"0000243460" "00008964" "99" "911" "0" "911" "0" "c.(911G>A)" "r.(?)" "p.(Trp304*)" "9"
"0000243461" "00008964" "99" "911" "0" "911" "0" "c.(911G>A)" "r.(?)" "p.(Trp304*)" "9"
"0000243462" "00008964" "99" "998" "0" "998" "0" "c.(998del)" "r.(?)" "p.(Gly333Valfs*28)" "10"
"0000243463" "00008964" "99" "1395" "0" "1395" "0" "c.(1395dup)" "r.(?)" "p.(Cys466Leufs*46)" "11"
"0000243464" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243465" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243466" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243467" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243468" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243469" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243470" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243471" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243472" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243473" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243474" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243475" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243476" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243477" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243478" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243479" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243480" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243481" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243482" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243483" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243484" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243485" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243486" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243487" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243488" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243489" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243490" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243491" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243492" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243493" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243494" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243495" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243496" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243497" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243498" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243499" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243500" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243501" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243502" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243503" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243504" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243505" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243506" "00008964" "99" "1477" "0" "1477" "0" "c.(1477C>T)" "r.(?)" "p.(Arg493*)" "12"
"0000243509" "00008964" "99" "708" "1" "708" "1" "c.708+1G>A" "r.(599_708del)" "p.(Val200Glyfs*18)" "6i_7i"
"0000243510" "00008964" "99" "708" "1" "708" "1" "c.708+1G>A" "r.(599_708del)" "p.(Val200Glyfs*18)" "6i_7i"
"0000243511" "00008964" "99" "708" "1" "708" "1" "c.708+1G>A" "r.(599_708del)" "p.(Val200Glyfs*18)" "6i_7i"
"0000243512" "00008964" "99" "1414" "-15" "1591" "0" "c.1414-15_1591del" "r.(1414_1644del)" "p.(Ala472_Gln548del)" "12"
"0000243513" "00008964" "99" "1414" "-15" "1591" "0" "c.1414-15_1591del" "r.(1414_1644del)" "p.(Ala472_Gln548del)" "12"
"0000243514" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243515" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243516" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243517" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243518" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243519" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243520" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243521" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243522" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243523" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243524" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243525" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243526" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243527" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243528" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243529" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243530" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243531" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243532" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243533" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243534" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243535" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243536" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243537" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243538" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243539" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243540" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243541" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243542" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243543" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243544" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243545" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243546" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243547" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243548" "00008964" "99" "813" "0" "816" "0" "c.(813_816del)" "r.(?)" "p.(Thr272Serfs*10)" "8"
"0000243553" "00008964" "99" "243" "0" "243" "0" "c.(243del)" "r.(?)" "p.(Ser82Valfs*174)" "3"
"0000243554" "00008964" "11" "279" "0" "279" "0" "c.(279G>A)" "r.(?)" "p.(=)" "4"
"0000243555" "00008964" "11" "545" "0" "545" "0" "c.(545C>T)" "r.(?)" "p.(Thr182Met)" "6"
"0000243556" "00008964" "11" "545" "0" "545" "0" "c.(545C>T)" "r.(?)" "p.(Thr182Met)" "6"
"0000243557" "00008964" "11" "545" "0" "545" "0" "c.(545C>T)" "r.(?)" "p.(Thr182Met)" "6"
"0000243558" "00008964" "55" "698" "0" "698" "0" "c.(698C>A)" "r.(?)" "p.(Pro233Gln)" "7"
"0000243559" "00008964" "99" "1231" "0" "1232" "0" "c.(1231_1232del)" "r.(?)" "p.(Val411Serfs*2)" "11"
"0000243560" "00008964" "55" "1623" "0" "1623" "0" "c.(1623G>C)" "r.(?)" "p.(Trp541Cys)" "12"
"0000243561" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243562" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243563" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243564" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243565" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243566" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243567" "00008964" "99" "709" "-2" "709" "-2" "c.709-2A>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243571" "00008964" "11" "359" "0" "359" "0" "c.(359C>A)" "r.(?)" "p.(Ser120Tyr)" "5"
"0000243572" "00008964" "11" "359" "0" "359" "0" "c.(359C>A)" "r.(?)" "p.(Ser120Tyr)" "5"
"0000243573" "00008964" "55" "1176" "0" "1176" "0" "c.(1176A>C)" "r.(?)" "p.(=)" "10"
"0000243574" "00008964" "99" "-8" "3" "-8" "3" "c.-8+3A>T" "r.-8_-7ins3823" "0" "1_2"
"0000243575" "00008964" "99" "361" "0" "361" "0" "c.(361del)" "r.(?)" "p.(Val121Trpfs*135)" "5"
"0000243576" "00008964" "99" "384" "0" "387" "0" "c.(384_387del)" "r.(?)" "p.(Gln130Serfs*125)" "5"
"0000243577" "00008964" "99" "468" "0" "474" "0" "c.(468_474del)" "r.(?)" "p.(Cys157Lysfs*97)" "6"
"0000243578" "00008964" "99" "942" "0" "942" "0" "c.(942C>A)" "r.(?)" "p.(Cys314*)" "10"
"0000243579" "00008964" "99" "942" "0" "942" "0" "c.(942C>A)" "r.(?)" "p.(Cys314*)" "10"
"0000243580" "00008964" "99" "1095" "0" "1096" "0" "c.(1095_1096del)" "r.(?)" "p.(Cys366*)" "10"
"0000243581" "00008964" "99" "1201" "0" "1201" "0" "c.(1201C>T)" "r.(?)" "p.(Gln401*)" "11"
"0000243582" "00008964" "99" "1201" "0" "1201" "0" "c.(1201C>T)" "r.(?)" "p.(Gln401*)" "11"
"0000243583" "00008964" "99" "1231" "0" "1232" "0" "c.(1231_1232dup)" "r.(?)" "p.(Ala412*)" "11"
"0000243584" "00008964" "99" "1231" "0" "1232" "0" "c.(1231_1232dup)" "r.(?)" "p.(Ala412*)" "11"
"0000243585" "00008964" "99" "909" "0" "909" "0" "c.(909del)" "r.(?)" "p.(Trp304Glyfs*57)" "9"
"0000243590" "00008964" "99" "1144" "0" "1144" "0" "c.(1144dup)" "r.(?)" "p.(Thr382Asnfs*32)" "10"
"0000243594" "00008964" "99" "328" "0" "328" "0" "c.(328C>T)" "r.(?)" "p.(Arg110*)" "4"
"0000243595" "00008964" "99" "328" "0" "328" "0" "c.(328C>T)" "r.(?)" "p.(Arg110*)" "4"
"0000243596" "00008964" "99" "328" "0" "328" "0" "c.(328C>T)" "r.(?)" "p.(Arg110*)" "4"
"0000243597" "00008964" "99" "1009" "0" "1009" "0" "c.(1009C>T)" "r.(?)" "p.(Gln337*)" "10"
"0000243598" "00008964" "99" "1009" "0" "1009" "0" "c.(1009C>T)" "r.(?)" "p.(Gln337*)" "10"
"0000243654" "00008964" "99" "1243" "0" "1243" "0" "c.(1243C>T)" "r.(?)" "p.(Gln415*)" "11"
"0000243655" "00008964" "99" "1243" "0" "1243" "0" "c.(1243C>T)" "r.(?)" "p.(Gln415*)" "11"
"0000243656" "00008964" "99" "1243" "0" "1243" "0" "c.(1243C>T)" "r.(?)" "p.(Gln415*)" "11"
"0000243657" "00008964" "99" "1243" "0" "1243" "0" "c.(1243C>T)" "r.(?)" "p.(Gln415*)" "11"
"0000243658" "00008964" "55" "1603" "0" "1603" "0" "c.1603C>T" "r.(?)" "p.(Arg535*)" "12"
"0000243659" "00008964" "55" "13" "0" "13" "0" "c.(13G>C)" "r.(?)" "p.(Val5Leu)" "2"
"0000243660" "00008964" "55" "530" "0" "530" "0" "c.(530G>A)" "r.(?)" "p.(Arg177His)" "6"
"0000243661" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243662" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243663" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243664" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243665" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243666" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243667" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243668" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243669" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243670" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243671" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243672" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243673" "00008964" "99" "709" "-1" "709" "-1" "c.709-1G>A" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243674" "00008964" "99" "1070" "0" "1070" "0" "c.(1070del)" "r.(?)" "p.(Pro357Hisfs*4)" "10"
"0000243675" "00008964" "99" "1" "0" "1" "0" "c.(1A>G)" "r.(?)" "0" "2"
"0000243676" "00008964" "55" "19" "0" "19" "0" "c.(19T>C)" "r.(?)" "p.(Trp7Arg)" "2"
"0000243677" "00008964" "99" "350" "0" "350" "0" "c.350del" "r.(350_462del)" "p.(Asn118Phefs*4)" "5"
"0000243678" "00008964" "99" "350" "0" "350" "0" "c.350del" "r.(350_462del)" "p.(Asn118Phefs*4)" "5"
"0000243679" "00008964" "99" "1494" "0" "1498" "0" "c.(1494_1498del)" "r.(?)" "p.(Glu498Aspfs*12)" "12"
"0000243680" "00008964" "99" "1494" "0" "1498" "0" "c.(1494_1498del)" "r.(?)" "p.(Glu498Aspfs*12)" "12"
"0000243681" "00008964" "99" "1494" "0" "1498" "0" "c.(1494_1498del)" "r.(?)" "p.(Glu498Aspfs*12)" "12"
"0000243682" "00008964" "99" "1494" "0" "1498" "0" "c.(1494_1498del)" "r.(?)" "p.(Glu498Aspfs*12)" "12"
"0000243683" "00008964" "11" "1298" "0" "1298" "0" "c.(1298G>A)" "r.(?)" "p.(Arg433Gln)" "11"
"0000243684" "00008964" "55" "415" "0" "415" "0" "c.(415T>C)" "r.(?)" "p.(Cys139Arg)" "5"
"0000243685" "00008964" "55" "415" "0" "415" "0" "c.(415T>C)" "r.(?)" "p.(Cys139Arg)" "5"
"0000243686" "00008964" "55" "415" "0" "415" "0" "c.(415T>C)" "r.(?)" "p.(Cys139Arg)" "5"
"0000243691" "00008964" "99" "898" "0" "898" "0" "c.(898C>T)" "r.(?)" "p.(Gln300*)" "9"
"0000243692" "00008964" "99" "603" "0" "603" "0" "c.(603dup)" "r.(?)" "p.(Ser203Valfs*15)" "7"
"0000243693" "00008964" "55" "596" "0" "596" "0" "c.(596C>T)" "r.(?)" "p.(Ala199Val)" "6"
"0000243694" "00008964" "55" "1407" "0" "1407" "0" "c.(1407G>T)" "r.(?)" "p.(Leu469Phe)" "11"
"0000243698" "00008964" "99" "903" "0" "904" "0" "c.(903_904insTG)" "r.(?)" "p.(Gly302Trpfs*60)" "9"
"0000243699" "00008964" "55" "99" "0" "99" "0" "c.(99C>A)" "r.(?)" "p.(Asp33Glu)" "2"
"0000243700" "00008964" "55" "99" "0" "99" "0" "c.(99C>A)" "r.(?)" "p.(Asp33Glu)" "2"
"0000243701" "00008964" "55" "1352" "0" "1352" "0" "c.(1352C>T)" "r.(?)" "p.(Pro451Leu)" "11"
"0000243702" "00008964" "55" "1540" "0" "1540" "0" "c.(1540G>A)" "r.(?)" "p.(Val514Met)" "12"
"0000243703" "00008964" "55" "1540" "0" "1540" "0" "c.(1540G>A)" "r.(?)" "p.(Val514Met)" "12"
"0000243704" "00008964" "55" "1690" "0" "1690" "0" "c.(1690C>T)" "r.(?)" "p.(Arg564Cys)" "13"
"0000243705" "00008964" "55" "1639" "0" "1639" "0" "c.(1639C>T)" "r.(?)" "p.(Arg547Cys)" "12"
"0000243708" "00008964" "55" "103" "0" "103" "0" "c.103G>A" "r.(?)" "p.(Gly35Arg)" "2"
"0000243710" "00008964" "11" "42" "0" "42" "0" "c.(42G>A)" "r.(?)" "p.(=)" "2"
"0000243711" "00008964" "55" "502" "0" "502" "0" "c.(502G>A)" "r.(?)" "p.(Gly168Ser)" "6"
"0000243712" "00008964" "99" "264" "2" "264" "2" "c.(264+2C>T)" "r.264_265ins34" "0" "3_4"
"0000243713" "00008964" "99" "255" "0" "255" "0" "c.(255del)" "r.(?)" "p.(Phe86Serfs*170)" "3"
"0000243714" "00008964" "99" "907" "0" "907" "0" "c.(907dup)" "r.(?)" "p.(Ala303Glyfs*14)" "9"
"0000243715" "00008964" "99" "1072" "0" "1072" "0" "c.(1072C>T)" "r.(?)" "p.(Gln358*)" "10"
"0000243716" "00008964" "99" "1420" "0" "1421" "0" "c.(1420_1421del)" "r.(?)" "p.(Cys474Leufs*37)" "12"
"0000243732" "00008964" "99" "-7" "-88" "1645" "-7" "c.-7-88_1645-7del" "r.(-7_1644del)" "p.?" "2_12"
"0000243736" "00008964" "99" "1562" "0" "1562" "0" "c.(1562G>A)" "r.(?)" "p.(Cys521Tyr)" "12"
"0000243740" "00008964" "55" "709" "-3" "709" "-3" "c.709-3C>G" "r.(709_835del)" "p.(Ala237Trpfs*4)" "7i_8i"
"0000243741" "00008964" "99" "1021" "0" "1021" "0" "c.(1021C>T)" "r.(?)" "p.(Gln341*)" "10"
"0000243742" "00008964" "99" "1014" "0" "1014" "0" "c.(1014del)" "r.(?)" "p.(His340Thrfs*21)" "10"
"0000243874" "00008964" "55" "1734" "0" "1734" "0" "c.(1734G>A)" "r.(?)" "p.(=)" "13"
"0000243875" "00008964" "99" "592" "0" "593" "0" "c.(592_593del)" "r.(?)" "p.(Arg198Glyfs*19)" "6"
"0000243876" "00008964" "99" "775" "0" "775" "0" "c.(775A>T)" "r.(?)" "p.(Lys259*)" "8"
"0000243877" "00008964" "11" "1554" "0" "1554" "0" "c.(1554C>T)" "r.(?)" "p.(=)" "12"
"0000243943" "00008964" "99" "882" "0" "882" "0" "c.(882T>G)" "r.(?)" "p.(Tyr294*)" "9"
"0000243949" "00008964" "55" "154" "0" "154" "0" "c.154del" "r.(?)" "p.(Thr52Hisfs*2)" "3"
"0000243988" "00008964" "15" "55" "0" "55" "0" "c.(55C>T)" "r.(?)" "p.(Arg19Trp)" "2"
"0000243989" "00008964" "15" "99" "0" "99" "0" "c.(99C>T)" "r.(?)" "p.(=)" "2"
"0000243990" "00008964" "55" "264" "0" "264" "0" "c.(264G>A)" "r.(?)" "p.(=)" "3"
"0000243991" "00008964" "55" "313" "0" "313" "0" "c.(313T>C)" "r.(?)" "p.(Cys105Arg)" "4"
"0000243992" "00008964" "15" "384" "0" "384" "0" "c.(384T>C)" "r.(?)" "p.(=)" "5"
"0000243993" "00008964" "55" "708" "0" "708" "0" "c.(708C>T)" "r.(?)" "p.(=)" "7"
"0000243994" "00008964" "55" "861" "0" "861" "0" "c.(861G>C)" "r.(?)" "p.(Glu287Asp)" "9"
"0000243995" "00008964" "15" "903" "0" "903" "0" "c.(903G>A)" "r.(?)" "p.(=)" "9"
"0000243996" "00008964" "15" "970" "0" "970" "0" "c.(970G>A)" "r.(?)" "p.(Ala324Thr)" "10"
"0000243997" "00008964" "15" "1253" "0" "1253" "0" "c.(1253G>A)" "r.(?)" "p.(Arg418Gln)" "11"
"0000243998" "00008964" "15" "1297" "0" "1297" "0" "c.(1297C>T)" "r.(?)" "p.(Arg433Trp)" "11"
"0000243999" "00008964" "55" "1422" "0" "1422" "0" "c.(1422C>T)" "r.(?)" "p.(=)" "12"
"0000244000" "00008964" "15" "1544" "0" "1544" "0" "c.(1544G>C)" "r.(?)" "p.(Gly515Ala)" "12"
"0000244003" "00008964" "15" "1241" "0" "1241" "0" "c.(1241G>T)" "r.(?)" "p.(Gly414Val)" "11"
"0000244004" "00008964" "55" "1341" "0" "1341" "0" "c.(1341C>T)" "r.(?)" "p.(=)" "11"
"0000244005" "00008964" "15" "421" "0" "421" "0" "c.(421G>A)" "r.(?)" "p.(Val141Ile)" "5"
"0000244006" "00008964" "15" "1373" "0" "1373" "0" "c.(1373C>T)" "r.(?)" "p.(Pro458Leu)" "11"
"0000244007" "00008964" "15" "1666" "0" "1666" "0" "c.(1666C>T)" "r.(?)" "p.(Arg556Cys)" "13"
"0000244008" "00008964" "55" "102" "0" "102" "0" "c.(102C>T)" "r.(?)" "p.(=)" "2"
"0000244009" "00008964" "15" "1695" "0" "1695" "0" "c.(1695C>T)" "r.(?)" "p.(=)" "13"
"0000244010" "00008964" "55" "743" "0" "743" "0" "c.(743C>T)" "r.(?)" "p.(Pro248Leu)" "8"
"0000244011" "00008964" "55" "773" "0" "773" "0" "c.(773G>A)" "r.(?)" "p.(Ser258Asn)" "8"
"0000244012" "00008964" "55" "1294" "0" "1294" "0" "c.(1294C>T)" "r.(?)" "p.(Arg432Cys)" "11"
"0000244013" "00008964" "55" "1485" "0" "1485" "0" "c.(1485C>T)" "r.(?)" "p.(=)" "12"
"0000244014" "00008964" "15" "317" "0" "317" "0" "c.(317G>A)" "r.(?)" "p.(Ser106Asn)" "4"
"0000244015" "00008964" "15" "473" "0" "473" "0" "c.(473G>A)" "r.(?)" "p.(Cys158Tyr)" "6"
"0000244016" "00008964" "15" "635" "0" "635" "0" "c.(635G>A)" "r.(?)" "p.(Arg212Gln)" "7"
"0000244017" "00008964" "15" "658" "0" "658" "0" "c.(658A>T)" "r.(?)" "p.(Thr220Ser)" "7"
"0000244018" "00008964" "15" "781" "0" "781" "0" "c.(781C>A)" "r.(?)" "p.(Leu261Ile)" "8"
"0000244019" "00008964" "15" "804" "0" "804" "0" "c.(804G>A)" "r.(?)" "p.(=)" "8"
"0000244020" "00008964" "15" "996" "0" "996" "0" "c.(996G>A)" "r.(?)" "p.(=)" "10"
"0000244021" "00008964" "15" "1409" "0" "1409" "0" "c.(1409C>T)" "r.(?)" "p.(Pro470Leu)" "11"
"0000244022" "00008964" "15" "1425" "0" "1425" "0" "c.(1425C>T)" "r.(?)" "p.(=)" "12"
"0000244023" "00008964" "15" "1648" "0" "1648" "0" "c.(1648G>A)" "r.(?)" "p.(Val550Ile)" "13"
"0000244024" "00008964" "55" "158" "0" "158" "0" "c.(158T>C)" "r.(?)" "p.(Leu53Pro)" "3"
"0000244029" "00008964" "55" "329" "0" "329" "0" "c.(329G>A)" "r.(?)" "p.(Arg110Gln)" "4"
"0000244030" "00008964" "55" "371" "0" "371" "0" "c.(371T>C)" "r.(?)" "p.(Ile124Thr)" "5"
"0000244031" "00008964" "55" "414" "0" "414" "0" "c.(414G>A)" "r.(?)" "p.(=)" "5"
"0000244055" "00008964" "15" "163" "0" "163" "0" "c.(163A>T)" "r.(?)" "p.(Arg55Trp)" "3"
"0000244056" "00008964" "15" "205" "0" "205" "0" "c.(205G>A)" "r.(?)" "p.(Ala69Thr)" "3"
"0000244057" "00008964" "15" "355" "0" "357" "0" "c.(355_357del)" "r.(?)" "p.(Asn119del)" "5"
"0000244058" "00008964" "15" "662" "0" "662" "0" "c.(662G>C)" "r.(?)" "p.(Cys221Ser)" "7"
"0000244059" "00008964" "15" "1126" "0" "1126" "0" "c.(1126G>A)" "r.(?)" "p.(Asp376Asn)" "10"
"0000244060" "00008964" "15" "1193" "0" "1193" "0" "c.(1193C>T)" "r.(?)" "p.(Ser398Leu)" "11"
"0000244061" "00008964" "15" "1691" "0" "1691" "0" "c.(1691G>A)" "r.(?)" "p.(Arg564His)" "13"
"0000244062" "00008964" "15" "228" "0" "228" "0" "c.(228C>T)" "r.(?)" "p.(=)" "3"
"0000244063" "00008964" "15" "267" "0" "267" "0" "c.(267C>T)" "r.(?)" "p.(=)" "4"
"0000244064" "00008964" "15" "324" "0" "324" "0" "c.(324C>T)" "r.(?)" "p.(=)" "4"
"0000244065" "00008964" "15" "402" "0" "402" "0" "c.(402G>A)" "r.(?)" "p.(=)" "5"
"0000244066" "00008964" "15" "507" "0" "507" "0" "c.(507C>G)" "r.(?)" "p.(=)" "6"
"0000244067" "00008964" "15" "546" "0" "546" "0" "c.(546G>A)" "r.(?)" "p.(=)" "6"
"0000244068" "00008964" "15" "786" "0" "786" "0" "c.(786C>T)" "r.(?)" "p.(=)" "8"
"0000244069" "00008964" "15" "1227" "0" "1227" "0" "c.(1227G>A)" "r.(?)" "p.(=)" "11"
"0000244070" "00008964" "15" "1515" "0" "1515" "0" "c.(1515C>T)" "r.(?)" "p.(=)" "12"
"0000250482" "00008964" "30" "463" "-18" "463" "-18" "c.463-18A>G" "r.(=)" "p.(=)" ""
"0000254884" "00008964" "30" "261" "0" "261" "0" "c.261A>G" "r.(?)" "p.(Pro87=)" ""
"0000277515" "00008964" "10" "264" "7" "264" "7" "c.264+7G>A" "r.(=)" "p.(=)" ""
"0000281190" "00008964" "10" "384" "0" "384" "0" "c.384T>C" "r.(?)" "p.(Asp128=)" ""
"0000283391" "00008964" "10" "1297" "0" "1297" "0" "c.1297C>T" "r.(?)" "p.(Arg433Trp)" ""
"0000283392" "00008964" "30" "1425" "0" "1425" "0" "c.1425C>T" "r.(?)" "p.(Cys475=)" ""
"0000283393" "00008964" "30" "1544" "0" "1544" "0" "c.1544G>C" "r.(?)" "p.(Gly515Ala)" ""
"0000283394" "00008964" "50" "1623" "0" "1623" "0" "c.1623G>C" "r.(?)" "p.(Trp541Cys)" ""
"0000283395" "00008964" "70" "23" "0" "23" "0" "c.23T>A" "r.(?)" "p.(Val8Glu)" ""
"0000283396" "00008964" "90" "243" "0" "243" "0" "c.243del" "r.(?)" "p.(Ser82ValfsTer174)" ""
"0000283397" "00008964" "30" "264" "7" "264" "7" "c.264+7G>A" "r.(=)" "p.(=)" ""
"0000283398" "00008964" "30" "349" "12" "349" "12" "c.349+12G>T" "r.(=)" "p.(=)" ""
"0000283399" "00008964" "10" "384" "0" "384" "0" "c.384T>C" "r.(?)" "p.(Asp128=)" ""
"0000283400" "00008964" "50" "415" "0" "415" "0" "c.415T>C" "r.(?)" "p.(Cys139Arg)" ""
"0000283401" "00008964" "30" "709" "-12" "709" "-12" "c.709-12G>C" "r.(=)" "p.(=)" ""
"0000283402" "00008964" "90" "760" "0" "760" "0" "c.760del" "r.(?)" "p.(Asp254ThrfsTer2)" ""
"0000283403" "00008964" "50" "893" "0" "893" "0" "c.893G>A" "r.(?)" "p.(Arg298His)" ""
"0000285059" "00008964" "30" "1041" "0" "1041" "0" "c.1041G>A" "r.(?)" "p.(Lys347=)" ""
"0000285060" "00008964" "50" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Arg110Gln)" ""
"0000285061" "00008964" "10" "384" "0" "384" "0" "c.384T>C" "r.(?)" "p.(Asp128=)" ""
"0000285062" "00008964" "30" "709" "-12" "709" "-12" "c.709-12G>C" "r.(=)" "p.(=)" ""
"0000288843" "00008964" "90" "1160" "0" "1160" "0" "c.1160dup" "r.(?)" "p.(Cys388LeufsTer26)" ""
"0000288844" "00008964" "50" "1204" "0" "1204" "0" "c.1204C>T" "r.(?)" "p.(His402Tyr)" ""
"0000288845" "00008964" "10" "1227" "0" "1227" "0" "c.1227G>A" "r.(?)" "p.(Thr409=)" ""
"0000288846" "00008964" "90" "1231" "0" "1232" "0" "c.1231_1232del" "r.(?)" "p.(Val411SerfsTer2)" ""
"0000288847" "00008964" "30" "1241" "0" "1241" "0" "c.1241G>T" "r.(?)" "p.(Gly414Val)" ""
"0000288848" "00008964" "30" "1253" "0" "1253" "0" "c.1253G>A" "r.(?)" "p.(Arg418Gln)" ""
"0000288849" "00008964" "30" "128" "0" "128" "0" "c.128G>A" "r.(?)" "p.(Arg43His)" ""
"0000288850" "00008964" "30" "1298" "0" "1298" "0" "c.1298G>A" "r.(?)" "p.(Arg433Gln)" ""
"0000288851" "00008964" "30" "1341" "0" "1341" "0" "c.1341C>T" "r.(?)" "p.(His447=)" ""
"0000288852" "00008964" "50" "1468" "0" "1468" "0" "c.1468G>A" "r.(?)" "p.(Val490Met)" ""
"0000288853" "00008964" "10" "1544" "0" "1544" "0" "c.1544G>C" "r.(?)" "p.(Gly515Ala)" ""
"0000288854" "00008964" "30" "1648" "0" "1648" "0" "c.1648G>A" "r.(?)" "p.(Val550Ile)" ""
"0000288855" "00008964" "50" "19" "0" "19" "0" "c.19T>C" "r.(?)" "p.(Trp7Arg)" ""
"0000288856" "00008964" "50" "19" "0" "19" "0" "c.19T>G" "r.(?)" "p.(Trp7Gly)" ""
"0000288857" "00008964" "30" "213" "0" "213" "0" "c.213C>T" "r.(?)" "p.(His71=)" ""
"0000288858" "00008964" "90" "243" "0" "243" "0" "c.243del" "r.(?)" "p.(Ser82ValfsTer174)" ""
"0000288859" "00008964" "10" "264" "21" "264" "21" "c.264+21G>A" "r.(=)" "p.(=)" ""
"0000288860" "00008964" "30" "264" "7" "264" "7" "c.264+7G>A" "r.(=)" "p.(=)" ""
"0000288862" "00008964" "50" "359" "0" "359" "0" "c.359C>A" "r.(?)" "p.(Ser120Tyr)" ""
"0000288863" "00008964" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Gln125Ter)" ""
"0000288864" "00008964" "10" "384" "0" "384" "0" "c.384T>C" "r.(?)" "p.(Asp128=)" ""
"0000288865" "00008964" "10" "42" "0" "42" "0" "c.42G>A" "r.(?)" "p.(Leu14=)" ""
"0000288866" "00008964" "10" "462" "24" "462" "24" "c.462+24G>A" "r.(=)" "p.(=)" ""
"0000288867" "00008964" "10" "55" "0" "55" "0" "c.55C>T" "r.(?)" "p.(Arg19Trp)" ""
"0000288868" "00008964" "30" "705" "0" "705" "0" "c.705C>A" "r.(?)" "p.(Pro235=)" ""
"0000288869" "00008964" "90" "708" "1" "708" "1" "c.708+1G>A" "r.spl?" "p.?" ""
"0000288870" "00008964" "30" "933" "5" "933" "5" "c.933+5C>A" "r.spl?" "p.?" ""
"0000288871" "00008964" "10" "970" "0" "970" "0" "c.970G>A" "r.(?)" "p.(Ala324Thr)" ""
"0000325433" "00008964" "30" "264" "7" "264" "7" "c.264+7G>A" "r.(=)" "p.(=)" ""
"0000325435" "00008964" "30" "1544" "0" "1544" "0" "c.1544G>C" "r.(?)" "p.(Gly515Ala)" ""
"0000561900" "00008964" "50" "22" "0" "22" "0" "c.22G>A" "r.(?)" "p.(Val8Met)" ""
"0000561901" "00008964" "30" "99" "0" "99" "0" "c.99C>T" "r.(?)" "p.(Asp33=)" ""
"0000561902" "00008964" "30" "99" "0" "99" "0" "c.99C>T" "r.(?)" "p.(Asp33=)" ""
"0000561903" "00008964" "10" "99" "0" "99" "0" "c.99C>T" "r.(?)" "p.(Asp33=)" ""
"0000561904" "00008964" "30" "139" "-3" "139" "-3" "c.139-3T>C" "r.spl?" "p.?" ""
"0000561905" "00008964" "30" "173" "0" "173" "0" "c.173G>A" "r.(?)" "p.(Gly58Asp)" ""
"0000561906" "00008964" "30" "228" "0" "228" "0" "c.228C>T" "r.(?)" "p.(Thr76=)" ""
"0000561907" "00008964" "30" "279" "0" "279" "0" "c.279G>A" "r.(?)" "p.(Gly93=)" ""
"0000561908" "00008964" "10" "350" "-50" "350" "-47" "c.350-50_350-47dup" "r.(=)" "p.(=)" ""
"0000561909" "00008964" "30" "386" "0" "386" "0" "c.386G>A" "r.(?)" "p.(Ser129Asn)" ""
"0000561910" "00008964" "90" "388" "0" "391" "0" "c.388_391del" "r.(?)" "p.(Gln130SerfsTer125)" ""
"0000561911" "00008964" "30" "393" "0" "393" "0" "c.393C>G" "r.(?)" "p.(Phe131Leu)" ""
"0000561912" "00008964" "50" "518" "0" "518" "0" "c.518T>C" "r.(?)" "p.(Leu173Pro)" ""
"0000561913" "00008964" "30" "723" "0" "723" "0" "c.723C>T" "r.(?)" "p.(Ser241=)" ""
"0000561914" "00008964" "50" "724" "0" "724" "0" "c.724G>C" "r.(?)" "p.(Asp242His)" ""
"0000561915" "00008964" "10" "835" "7" "835" "7" "c.835+7G>A" "r.(=)" "p.(=)" ""
"0000561916" "00008964" "10" "835" "7" "835" "7" "c.835+7G>A" "r.(=)" "p.(=)" ""
"0000561917" "00008964" "10" "835" "7" "835" "7" "c.835+7G>A" "r.(=)" "p.(=)" ""
"0000561918" "00008964" "30" "902" "0" "902" "0" "c.902C>T" "r.(?)" "p.(Ser301Leu)" ""
"0000561919" "00008964" "30" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Ser301=)" ""
"0000561920" "00008964" "30" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Ser301=)" ""
"0000561921" "00008964" "50" "933" "7" "933" "7" "c.933+7A>T" "r.(=)" "p.(=)" ""
"0000561922" "00008964" "50" "933" "15" "933" "15" "c.933+15C>G" "r.(=)" "p.(=)" ""
"0000561923" "00008964" "90" "945" "0" "946" "0" "c.945_946del" "r.(?)" "p.(Cys315Ter)" ""
"0000561924" "00008964" "30" "970" "0" "970" "0" "c.970G>A" "r.(?)" "p.(Ala324Thr)" ""
"0000561925" "00008964" "30" "1221" "0" "1221" "0" "c.1221C>A" "r.(?)" "p.(Gly407=)" ""
"0000561926" "00008964" "30" "1241" "0" "1241" "0" "c.1241G>T" "r.(?)" "p.(Gly414Val)" ""
"0000561927" "00008964" "90" "1252" "0" "1252" "0" "c.1252C>T" "r.(?)" "p.(Arg418Ter)" ""
"0000561928" "00008964" "10" "1297" "0" "1297" "0" "c.1297C>T" "r.(?)" "p.(Arg433Trp)" ""
"0000561929" "00008964" "30" "1485" "0" "1485" "0" "c.1485C>T" "r.(?)" "p.(Cys495=)" ""
"0000561930" "00008964" "50" "1562" "0" "1562" "0" "c.1562G>A" "r.(?)" "p.(Cys521Tyr)" ""
"0000616621" "00008964" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Gln125Ter)" ""
"0000616622" "00008964" "30" "1266" "0" "1266" "0" "c.1266C>T" "r.(?)" "p.(Ile422=)" ""
"0000616623" "00008964" "30" "1432" "0" "1432" "0" "c.1432C>G" "r.(?)" "p.(Arg478Gly)" ""
"0000616624" "00008964" "50" "1453" "0" "1453" "0" "c.1453G>A" "r.(?)" "p.(Gly485Ser)" ""
"0000623693" "00008964" "30" "22" "0" "22" "0" "c.22G>A" "r.(?)" "p.(Val8Met)" ""
"0000658152" "00008964" "30" "267" "0" "267" "0" "c.267C>T" "r.(?)" "p.(Ala89=)" ""
"0000680899" "00008964" "30" "279" "0" "279" "0" "c.279G>A" "r.(?)" "p.(Gly93=)" ""
"0000692373" "00008964" "30" "513" "0" "513" "0" "c.513C>T" "r.(?)" "p.(Cys171=)" ""
"0000692374" "00008964" "90" "1477" "0" "1477" "0" "c.1477C>T" "r.(?)" "p.(Arg493Ter)" ""
"0000703990" "00008964" "70" "264" "2" "264" "2" "c.264+2T>C" "r.spl?" "p.?" ""
"0000708490" "00008964" "90" "284" "0" "284" "0" "c.284dup" "r.(?)" "p.(His96Profs*23)" "4"
"0000708796" "00008964" "90" "25" "0" "25" "0" "c.25del" "r.(?)" "p.(Ala9ProfsTer2)" ""
"0000714467" "00008964" "90" "675" "0" "676" "0" "c.675_676del" "r.(?)" "p.(Ser226TrpfsTer28)" ""
"0000726445" "00008964" "30" "55" "0" "55" "0" "c.55C>T" "r.(?)" "p.(Arg19Trp)" ""
"0000726446" "00008964" "50" "229" "0" "229" "0" "c.229G>A" "r.(?)" "p.(Val77Ile)" ""
"0000726447" "00008964" "50" "359" "0" "359" "0" "c.359C>A" "r.(?)" "p.(Ser120Tyr)" ""
"0000726448" "00008964" "50" "530" "0" "530" "0" "c.530G>T" "r.(?)" "p.(Arg177Leu)" ""
"0000726449" "00008964" "30" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Ser301=)" ""
"0000726450" "00008964" "50" "1297" "0" "1297" "0" "c.1297C>T" "r.(?)" "p.(Arg433Trp)" ""
"0000726451" "00008964" "50" "1373" "0" "1373" "0" "c.1373C>T" "r.(?)" "p.(Pro458Leu)" ""
"0000763831" "00008964" "50" "836" "-3" "836" "-3" "c.836-3C>T" "r.spl?" "p.?" ""
"0000789905" "00008964" "90" "78" "0" "78" "0" "c.78C>A" "r.(?)" "p.(Cys26Ter)" ""
"0000808037" "00008964" "30" "139" "-3" "139" "-3" "c.139-3T>C" "r.spl?" "p.?" ""
"0000808038" "00008964" "30" "1180" "-8" "1180" "-8" "c.1180-8C>T" "r.(=)" "p.(=)" ""
"0000808039" "00008964" "90" "1252" "0" "1252" "0" "c.1252C>T" "r.(?)" "p.(Arg418Ter)" ""
"0000808040" "00008964" "90" "1260" "0" "1260" "0" "c.1260del" "r.(?)" "p.(Ser420Argfs*71)" ""
"0000811475" "00008964" "70" "1" "0" "1" "0" "c.1A>T" "r.0?" "p.(Met1?)" ""
"0000826495" "00008964" "90" "1414" "-1" "1414" "-1" "c.1414-1G>T" "r.spl?" "p.?" "11i"
"0000826496" "00008964" "90" "1414" "-1" "1414" "-1" "c.1414-1G>T" "r.spl?" "p.?" "11i"
"0000826497" "00008964" "90" "1414" "-1" "1414" "-1" "c.1414-1G>T" "r.spl?" "p.?" "11i"
"0000826498" "00008964" "90" "1414" "-1" "1414" "-1" "c.1414-1G>T" "r.spl?" "p.?" "11i"
"0000826499" "00008964" "90" "1414" "-1" "1414" "-1" "c.1414-1G>T" "r.spl?" "p.?" "11i"
"0000854944" "00008964" "50" "190" "0" "190" "0" "c.190G>A" "r.(?)" "p.(Asp64Asn)" ""
"0000854945" "00008964" "50" "634" "0" "634" "0" "c.634C>T" "r.(?)" "p.(Arg212Trp)" ""
"0000854946" "00008964" "30" "1337" "0" "1337" "0" "c.1337A>T" "r.(?)" "p.(Gln446Leu)" ""
"0000865308" "00008964" "30" "546" "0" "546" "0" "c.546G>A" "r.(?)" "p.(Thr182=)" ""
"0000865309" "00008964" "30" "708" "8" "708" "8" "c.708+8A>T" "r.(=)" "p.(=)" ""
"0000865310" "00008964" "30" "1227" "0" "1227" "0" "c.1227G>A" "r.(?)" "p.(Thr409=)" ""
"0000893957" "00008964" "30" "545" "0" "545" "0" "c.545C>T" "r.(?)" "p.(Thr182Met)" ""
"0000893958" "00008964" "30" "1253" "0" "1253" "0" "c.1253G>A" "r.(?)" "p.(Arg418Gln)" ""
"0000893959" "00008964" "50" "1354" "0" "1374" "0" "c.1354_1374del" "r.(?)" "p.(Val452_Pro458del)" ""
"0000903132" "00008964" "70" "-9" "0" "-9" "0" "c.-9A>G" "r.(?)" "p.(?)" ""
"0000914864" "00008964" "30" "836" "-3" "836" "-3" "c.836-3C>T" "r.spl?" "p.?" ""
"0000914865" "00008964" "30" "1341" "0" "1341" "0" "c.1341C>T" "r.(?)" "p.(His447=)" ""
"0000950929" "00008964" "50" "8" "0" "8" "0" "c.8C>A" "r.(?)" "p.(Thr3Asn)" ""
"0000982540" "00008964" "50" "415" "0" "415" "0" "c.415T>C" "r.(?)" "p.(Cys139Arg)" ""
"0000982541" "00008964" "10" "835" "7" "835" "7" "c.835+7G>A" "r.(=)" "p.(=)" ""
"0000982542" "00008964" "30" "933" "5" "933" "5" "c.933+5C>G" "r.spl?" "p.?" ""
"0000982543" "00008964" "50" "1760" "0" "1760" "0" "c.1760del" "r.(?)" "p.(Pro587Glnfs*3)" ""
"0001003313" "00008964" "30" "55" "0" "55" "0" "c.55C>T" "r.(?)" "p.(Arg19Trp)" ""
"0001003314" "00008964" "50" "1399" "0" "1399" "0" "c.1399T>C" "r.(?)" "p.(Cys467Arg)" ""
"0001015559" "00008964" "30" "276" "0" "276" "0" "c.276C>T" "r.(?)" "p.(=)" ""
"0001026948" "00008964" "30" "546" "0" "546" "0" "c.546G>A" "r.(?)" "p.(Thr182=)" ""
"0001041907" "00008964" "10" "384" "0" "384" "0" "c.384T>C" "r.(?)" "p.(Asp128=)" ""
"0001041908" "00008964" "30" "933" "16" "933" "16" "c.933+16G>A" "r.(=)" "p.(=)" ""
"0001041909" "00008964" "30" "970" "0" "970" "0" "c.970G>A" "r.(?)" "p.(Ala324Thr)" ""
"0001041910" "00008964" "30" "1266" "0" "1266" "0" "c.1266C>T" "r.(?)" "p.(Ile422=)" ""
"0001056043" "00008964" "30" "414" "0" "414" "0" "c.414G>C" "r.(?)" "p.(=)" ""
"0001066791" "00008964" "50" "415" "0" "415" "0" "c.415T>C" "r.(?)" "p.(Cys139Arg)" ""
"0001066792" "00008964" "50" "626" "0" "626" "0" "c.626C>T" "r.(?)" "p.(Pro209Leu)" ""
"0001066793" "00008964" "30" "903" "0" "903" "0" "c.903G>A" "r.(?)" "p.(Ser301=)" ""
"0001066794" "00008964" "50" "1673" "0" "1673" "0" "c.1673G>A" "r.(?)" "p.(Cys558Tyr)" ""
## Screenings_To_Variants ## Do not remove or alter this header ##
## Count = 279
"{{screeningid}}" "{{variantid}}"
"0000057158" "0000087446"
"0000057159" "0000087447"
"0000105170" "0000170442"
"0000105171" "0000170443"
"0000149663" "0000243437"
"0000149848" "0000243464"
"0000149947" "0000243381"
"0000149948" "0000243382"
"0000149949" "0000243383"
"0000149950" "0000243384"
"0000149951" "0000243385"
"0000149952" "0000243386"
"0000149953" "0000243387"
"0000149954" "0000243388"
"0000149955" "0000243389"
"0000149956" "0000243392"
"0000149957" "0000243393"
"0000149958" "0000243395"
"0000149959" "0000243396"
"0000149960" "0000243398"
"0000149961" "0000243404"
"0000149962" "0000243405"
"0000149963" "0000243412"
"0000149964" "0000243413"
"0000149965" "0000243414"
"0000149966" "0000243417"
"0000149967" "0000243422"
"0000149997" "0000243427"
"0000149998" "0000243428"
"0000149999" "0000243429"
"0000150000" "0000243432"
"0000150001" "0000243434"
"0000150002" "0000243435"
"0000150003" "0000243438"
"0000150004" "0000243439"
"0000150005" "0000243440"
"0000150006" "0000243441"
"0000150007" "0000243443"
"0000150008" "0000243444"
"0000150009" "0000243445"
"0000150010" "0000243447"
"0000150011" "0000243448"
"0000150012" "0000243449"
"0000150013" "0000243453"
"0000150014" "0000243454"
"0000150015" "0000243456"
"0000150016" "0000243458"
"0000150017" "0000243459"
"0000150018" "0000243462"
"0000150019" "0000243418"
"0000150020" "0000243463"
"0000150021" "0000243465"
"0000150022" "0000243466"
"0000150023" "0000243467"
"0000150024" "0000243468"
"0000150025" "0000243469"
"0000150026" "0000243470"
"0000150027" "0000243471"
"0000150028" "0000243472"
"0000150036" "0000243430"
"0000150037" "0000243473"
"0000150038" "0000243474"
"0000150039" "0000243475"
"0000150044" "0000243509"
"0000150045" "0000243512"
"0000150046" "0000243514"
"0000150047" "0000243515"
"0000150056" "0000243553"
"0000150057" "0000243559"
"0000150058" "0000243561"
"0000150059" "0000243476"
"0000150064" "0000243555"
"0000150065" "0000243571"
"0000150066" "0000243556"
"0000150067" "0000243554"
"0000150068" "0000243558"
"0000150069" "0000243560"
"0000150070" "0000243573"
"0000150071" "0000243574"
"0000150072" "0000243575"
"0000150073" "0000243576"
"0000150074" "0000243577"
"0000150075" "0000243510"
"0000150076" "0000243511"
"0000150077" "0000243578"
"0000150078" "0000243580"
"0000150079" "0000243581"
"0000150080" "0000243583"
"0000150081" "0000243562"
"0000150082" "0000243563"
"0000150083" "0000243585"
"0000150086" "0000243564"
"0000150092" "0000243590"
"0000150098" "0000243594"
"0000150099" "0000243450"
"0000150100" "0000243460"
"0000150101" "0000243597"
"0000150102" "0000243419"
"0000150103" "0000243477"
"0000150104" "0000243478"
"0000150114" "0000243565"
"0000150115" "0000243479"
"0000150116" "0000243480"
"0000150117" "0000243481"
"0000150118" "0000243482"
"0000150119" "0000243483"
"0000150120" "0000243484"
"0000150121" "0000243485"
"0000150122" "0000243486"
"0000150123" "0000243487"
"0000150124" "0000243488"
"0000150125" "0000243489"
"0000150126" "0000243490"
"0000150127" "0000243491"
"0000150128" "0000243492"
"0000150129" "0000243493"
"0000150130" "0000243494"
"0000150131" "0000243495"
"0000150132" "0000243496"
"0000150133" "0000243497"
"0000150134" "0000243498"
"0000150135" "0000243499"
"0000150166" "0000243654"
"0000150167" "0000243655"
"0000150168" "0000243656"
"0000150169" "0000243657"
"0000150170" "0000243390"
"0000150171" "0000243391"
"0000150172" "0000243658"
"0000150177" "0000243659"
"0000150178" "0000243660"
"0000150179" "0000243661"
"0000150180" "0000243662"
"0000150181" "0000243663"
"0000150182" "0000243664"
"0000150183" "0000243665"
"0000150184" "0000243666"
"0000150185" "0000243667"
"0000150186" "0000243668"
"0000150187" "0000243669"
"0000150188" "0000243670"
"0000150189" "0000243674"
"0000150190" "0000243675"
"0000150191" "0000243676"
"0000150192" "0000243595"
"0000150193" "0000243677"
"0000150194" "0000243394"
"0000150195" "0000243446"
"0000150196" "0000243455"
"0000150197" "0000243516"
"0000150198" "0000243579"
"0000150199" "0000243582"
"0000150200" "0000243584"
"0000150201" "0000243679"
"0000150202" "0000243680"
"0000150203" "0000243681"
"0000150204" "0000243566"
"0000150205" "0000243567"
"0000150206" "0000243683"
"0000150207" "0000243431"
"0000150208" "0000243684"
"0000150217" "0000243399"
"0000150218" "0000243400"
"0000150219" "0000243401"
"0000150220" "0000243402"
"0000150221" "0000243691"
"0000150222" "0000243406"
"0000150223" "0000243407"
"0000150224" "0000243682"
"0000150225" "0000243692"
"0000150226" "0000243693"
"0000150227" "0000243694"
"0000150230" "0000243517"
"0000150231" "0000243518"
"0000150232" "0000243519"
"0000150233" "0000243520"
"0000150239" "0000243698"
"0000150240" "0000243557"
"0000150242" "0000243699"
"0000150243" "0000243685"
"0000150244" "0000243701"
"0000150245" "0000243702"
"0000150246" "0000243704"
"0000150248" "0000243705"
"0000150250" "0000243457"
"0000150251" "0000243451"
"0000150254" "0000243708"
"0000150256" "0000243710"
"0000150258" "0000243711"
"0000150259" "0000243712"
"0000150260" "0000243713"
"0000150261" "0000243678"
"0000150262" "0000243714"
"0000150273" "0000243715"
"0000150274" "0000243716"
"0000150293" "0000243732"
"0000150295" "0000243700"
"0000150296" "0000243703"
"0000150299" "0000243436"
"0000150303" "0000243736"
"0000150306" "0000243521"
"0000150307" "0000243522"
"0000150308" "0000243523"
"0000150309" "0000243524"
"0000150310" "0000243525"
"0000150311" "0000243526"
"0000150312" "0000243527"
"0000150313" "0000243528"
"0000150314" "0000243529"
"0000150315" "0000243530"
"0000150316" "0000243531"
"0000150317" "0000243532"
"0000150318" "0000243533"
"0000150319" "0000243534"
"0000150320" "0000243535"
"0000150321" "0000243536"
"0000150322" "0000243537"
"0000150323" "0000243538"
"0000150324" "0000243539"
"0000150325" "0000243540"
"0000150326" "0000243541"
"0000150327" "0000243542"
"0000150328" "0000243543"
"0000150329" "0000243544"
"0000150330" "0000243545"
"0000150331" "0000243397"
"0000150332" "0000243740"
"0000150333" "0000243741"
"0000150334" "0000243742"
"0000150394" "0000243408"
"0000150395" "0000243409"
"0000150396" "0000243513"
"0000150397" "0000243686"
"0000150398" "0000243874"
"0000150399" "0000243875"
"0000150400" "0000243420"
"0000150401" "0000243876"
"0000150402" "0000243572"
"0000150403" "0000243877"
"0000150406" "0000243410"
"0000150410" "0000243442"
"0000150411" "0000243415"
"0000150452" "0000243671"
"0000150453" "0000243672"
"0000150454" "0000243673"
"0000150456" "0000243596"
"0000150457" "0000243461"
"0000150462" "0000243598"
"0000150463" "0000243416"
"0000150464" "0000243421"
"0000150465" "0000243423"
"0000150466" "0000243500"
"0000150467" "0000243501"
"0000150468" "0000243502"
"0000150469" "0000243503"
"0000150470" "0000243504"
"0000150471" "0000243505"
"0000150472" "0000243403"
"0000150473" "0000243411"
"0000150474" "0000243452"
"0000150475" "0000243546"
"0000150488" "0000243547"
"0000150489" "0000243548"
"0000150495" "0000243506"
"0000150512" "0000243943"
"0000150517" "0000243949"
"0000150571" "0000243433"
"0000321185" "0000703990"
"0000325480" "0000708490"
"0000325660" "0000708796"
"0000330042" "0000714467"
"0000363256" "0000763831"
"0000377532" "0000789905"
"0000384710" "0000811475"
"0000395238" "0000826495"
"0000395239" "0000826496"
"0000395240" "0000826497"
"0000395241" "0000826498"
"0000395242" "0000826499"