### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = GSN) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "GSN" "gelsolin" "9" "q33" "unknown" "NG_012872.2" "UD_132118626774" "{PMID:Levy et al. 1990:2175344}, {PMID:Maury et al. 1990:2176164}, {PMID:Hiltunen et al. 1991:1652889}" "https://www.LOVD.nl/GSN" "" "1" "4620" "2934" "137350" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement nÂș 200754 - the GEN2PHEN project.\r\n\r\nThis database was initially part of the Finnish Disease Resource (FinDis; Polvi et al: Hum Mutat. 2013:34:1458-66). We gratefully acknowledge the support of Juha Muilu acting as curator until 2015." "" "g" "http://databases.lovd.nl/shared/refseq/GSN_codingDNA.html" "1" "" "" "-1" "" "-1" "00008" "2012-08-30 00:00:00" "00006" "2019-07-21 20:31:00" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000283" "GSN" "transcript variant 1" "008" "NM_000177.4" "" "NP_000168.1" "" "" "" "-61" "2588" "2349" "124062079" "124095120" "00008" "2012-08-30 17:19:51" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00044" "FAF" "amyloidosis, Finnish type (type V) (FAF)" "AD" "105120" "" "" "" "00008" "2012-08-30 17:21:32" "00006" "2021-12-10 21:51:32" "00114" "GA1" "glutaricaciduria, type 1 (GA-1)" "AR" "231670" "" "autosomal recessive" "" "00008" "2013-03-06 12:48:45" "00006" "2021-12-10 21:51:32" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "GSN" "00044" ## Individuals ## Do not remove or alter this header ## ## Count = 26 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00001000" "" "" "" "1" "" "00065" "" "" "" "" "" "" "0" "" "" "" "" "00019991" "" "" "" "1" "" "00006" "{PMID:Sethi 2013:22938848}" "" "F" "?" "United States" "" "0" "" "" "white" "" "00019992" "" "" "" "1" "" "00006" "{PMID:de la Chapelle 1992:1338910}" "family" "" "" "Denmark" "" "0" "" "" "" "" "00019993" "" "" "" "8" "" "00006" "{PMID:Maury 1990:2176164}, {DOI:Maury 1990:10.1016/0014-5793(90)80510-P}" "3-generation family, 7 affecteds, 1 unaffected carrier" "-" "" "Finland" "" "0" "" "" "" "" "00019994" "" "" "" "5" "" "00006" "{PMID:Maury 1990:2176164}, {DOI:Maury 1990:10.1016/0014-5793(90)80510-P}" "5 unrelated patients" "-" "" "Finland" "" "0" "" "" "" "" "00019995" "" "" "" "5" "" "00006" "{PMID:Levy 1990:2175344}, {DOI:Levy 1990:10.1084/jem.172.6.1865}" "5 unrelated patients" "-" "" "Finland" "" "0" "" "" "" "" "00019996" "" "" "" "22" "" "00006" "{PMID:Hiltunen 1991:1652889}" "6-generation family, 22 affecteds (13F, 9M)" "-" "" "Finland" "" "0" "" "" "" "" "00019997" "" "" "" "8" "" "00006" "{PMID:Hiltunen 1991:1652889}" "4-generation family, 8 affecteds (4F, 4M)" "-" "" "Finland" "" "0" "" "" "" "" "00019998" "" "" "" "15" "" "00006" "{PMID:Hiltunen 1991:1652889}" "4-generation family, 15 affecteds (9F, 6M)" "-" "" "Finland" "" "0" "" "" "" "" "00019999" "" "" "" "17" "" "00006" "{PMID:de la Chapelle 1992:1322359}, {DOI:de la Chapelle 1992:10.1016/0888-7543(92)90182-R}" "6 families, 17 affecteds" "-" "" "Finland" "" "0" "" "" "" "" "00020000" "" "" "" "4" "" "00006" "{PMID:de la Chapelle 1992:1322359}, {DOI:de la Chapelle 1992:10.1016/0888-7543(92)90182-R}" "4-generation family, 4 affecteds (2F, 2M)" "-" "" "United States" "" "0" "" "" "Scotland;Ireland" "" "00020001" "" "" "" "3" "" "00006" "{PMID:Maury 1992:1322360}" "2-generation family, 5 affecteds, 3 heterozygous (2F, M)" "-" "" "Finland" "" "0" "" "" "" "" "00020002" "" "" "" "2" "" "00006" "{PMID:Maury 1992:1322360}" "2-generation family, 5 affecteds, 2 homozygous females" "F" "" "Finland" "" "0" "" "" "" "" "00020003" "" "" "" "22" "" "00006" "{PMID:Gorevic 1991:1658654}" "2-generation family, father and daugther" "-" "" "United States" "" "0" "" "" "Ireland" "" "00020004" "" "" "" "22" "" "00006" "{PMID:Taira 2012:22622774}" "4-generation family, 2 affecteds" "-" "" "Japan" "" "0" "" "" "" "" "00020005" "" "" "" "1" "" "00006" "{PMID:Taira 2012:22622774}" "3-generation family, 1 affected" "-" "" "Japan" "" "0" "" "" "" "" "00020006" "" "" "" "4" "" "00006" "{PMID:Taira 2012:22622774}" "5-generation family, 4 affecteds" "-" "" "Japan" "" "0" "" "" "" "" "00020007" "" "" "" "17" "" "00006" "{PMID:Taira 2012:22622774}" "4-generation family, 17 affecteds" "-" "" "Japan" "" "0" "" "" "" "" "00020008" "" "" "" "3" "" "00006" "{PMID:Taira 2012:22622774}" "4-generation family, 3 affected" "-" "" "Japan" "" "0" "" "" "" "" "00020009" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Rodriguez 2014:24801599}" "" "-" "" "Mexico" "" "0" "" "" "" "" "00020010" "" "" "" "1" "" "00006" "{PMID:de la Chapelle 1992:1338910}, {DOI:de la Chapelle 1992:10.1038/ng1092-157}" "" "-" "" "Netherlands" "" "0" "" "" "" "" "00020011" "" "" "" "1" "" "00006" "{PMID:de la Chapelle 1992:1338910}, {DOI:de la Chapelle 1992:10.1038/ng1092-157}" "" "-" "" "Czech Republic" "" "0" "" "" "" "" "00020012" "" "" "" "2" "" "00006" "{PMID:Solari 2011:22068858}, {DOI:Solari 2011:10.1590/S0004-27492011000400012}" "2-generation family, 2 affected brothers" "-" "" "Brazil" "" "0" "" "" "" "" "00020013" "" "" "" "4" "" "00006" "{PMID:Chastan 2006:16258946}, {DOI:Chastan 2006:10.1002/mus.20448}" "4-generation family, 4 affecteds (2F, 2M)" "-" "" "France" "" "0" "" "" "" "" "00020014" "" "" "" "6" "" "00006" "{PMID:Stewart 2000:10729296}, {DOI:Stewart 2000:10.1136/bjo.84.4.390}" "4-generation family, 6 affecteds (2F, 4M)" "-" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00414433" "" "" "" "1" "" "00000" "{PMID:Sun 2018:30076350}" "" "F" "" "China" "" "0" "" "" "" "WHP100" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 26 "{{individualid}}" "{{diseaseid}}" "00001000" "00114" "00019991" "00044" "00019992" "00044" "00019993" "00044" "00019994" "00044" "00019995" "00044" "00019996" "00044" "00019997" "00044" "00019998" "00044" "00019999" "00044" "00020000" "00044" "00020001" "00044" "00020002" "00044" "00020003" "00044" "00020004" "00044" "00020005" "00044" "00020006" "00044" "00020007" "00044" "00020008" "00044" "00020009" "00044" "00020010" "00044" "00020011" "00044" "00020012" "00044" "00020013" "00044" "00020014" "00044" "00414433" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00044, 00114, 00198 ## Count = 25 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Biochem_param}}" "{{Phenotype/enzyme_act}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000017750" "00044" "00019991" "00006" "Isolated (sporadic)" "75y" "see paper; chronic kidney disease, anemia; medical history significant for hypertension, rheumatoid arthritis, gout" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017751" "00044" "00019992" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017752" "00044" "00019993" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017753" "00044" "00019994" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017754" "00044" "00019995" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017755" "00044" "00019996" "00006" "Familial, autosomal dominant" "" "familial amyloidosis of Finnish type (FAF)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017756" "00044" "00019997" "00006" "Familial, autosomal dominant" "" "familial amyloidosis of Finnish type (FAF)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017757" "00044" "00019998" "00006" "Familial, autosomal dominant" "" "familial amyloidosis of Finnish type (FAF)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017758" "00044" "00019999" "00006" "Familial, autosomal dominant" "" "familial amyloidosis of Finnish type (FAF)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017759" "00044" "00020000" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017760" "00044" "00020001" "00006" "Familial, autosomal dominant" "" "see paper; familial amyloidosis of Finnish type (FAF)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017761" "00044" "00020002" "00006" "Familial, autosomal dominant" "" "see paper; early onset and severe familial amyloidosis of Finnish type (FAF)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017762" "00044" "00020003" "00006" "Familial, autosomal dominant" "" "see paper; father lattice corneal dystrophy, bilateral facial-nerve palsies, amyloid in corneal tissue; daugther lattice corneal dystrophy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017763" "00044" "00020004" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017764" "00044" "00020005" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017765" "00044" "00020006" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017766" "00044" "00020007" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017767" "00044" "00020008" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017768" "00044" "00020009" "00006" "Isolated (sporadic)" "" "see paper, Finnish type corneal amyloidosis" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017769" "00044" "00020010" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017770" "00044" "00020011" "00006" "Familial, autosomal dominant" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017771" "00044" "00020012" "00006" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017772" "00044" "00020013" "00006" "Familial, autosomal dominant" "" "see paper, familial amyloidosis of Finnish type (FAF), severe cardiac conduction alterations" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000017773" "00044" "00020014" "00006" "Familial, autosomal dominant" "" "see paper, late onset lattice corneal dystrophy" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000306268" "00198" "00414433" "00000" "Unknown" "12y" "Finnish type Amyloidosis;Alport Syndrome;Vesicoureteral Reflux 8" "" "" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 26 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000019985" "00019991" "1" "00006" "00006" "2014-09-29 22:52:48" "" "" "SEQ" "DNA;protein" "" "" "0000019986" "00019992" "1" "00006" "00006" "2014-09-29 23:12:16" "" "" "SEQ" "DNA" "" "" "0000019987" "00019993" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019988" "00019994" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019989" "00001000" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "MS" "protein" "" "" "0000019990" "00019995" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019991" "00019996" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019992" "00019997" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019993" "00019998" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019994" "00019999" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019995" "00020000" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019996" "00020001" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019997" "00020002" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019998" "00020003" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000019999" "00020004" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020000" "00020005" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020001" "00020006" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020002" "00020007" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020003" "00020008" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020004" "00020009" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020005" "00020010" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020006" "00020011" "1" "00006" "00006" "2014-10-01 11:25:54" "" "" "SEQ" "DNA" "" "" "0000020007" "00020012" "1" "00006" "00006" "2014-10-01 11:48:50" "" "" "SEQ" "DNA" "" "" "0000020008" "00020013" "1" "00006" "00006" "2014-10-01 11:48:50" "" "" "SEQ" "DNA" "" "" "0000020009" "00020014" "1" "00006" "00006" "2014-10-01 11:48:50" "" "" "SEQ;SSCA" "DNA" "" "" "0000415713" "00414433" "1" "00000" "03840" "2022-07-28 13:16:36" "" "" "SEQ-NG-I" "DNA" "blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 26 "{{screeningid}}" "{{geneid}}" "0000019985" "GSN" "0000019986" "GSN" "0000019987" "GSN" "0000019988" "GSN" "0000019989" "GSN" "0000019990" "GSN" "0000019991" "GSN" "0000019992" "GSN" "0000019993" "GSN" "0000019994" "GSN" "0000019995" "GSN" "0000019996" "GSN" "0000019997" "GSN" "0000019998" "GSN" "0000019999" "GSN" "0000020000" "GSN" "0000020001" "GSN" "0000020002" "GSN" "0000020003" "GSN" "0000020004" "GSN" "0000020005" "GSN" "0000020006" "GSN" "0000020007" "GSN" "0000020008" "GSN" "0000020009" "GSN" "0000415713" "GSN" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 154 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000016821" "3" "99" "9" "124073097" "124073097" "subst" "4.06147E-6" "00015" "GSN_000001" "g.124073097G>A" "" "{PMID:Levy 1990:2175344}, {PMID:Maury 1990:2176164}, {PMID:Hiltunen 1991:1652889}, {PMID:Paunio 1992:1315718}, {PMID:de la Chapelle 1992a:1322359}, {PMID:1992b:1338910}, {PMID:Taira 2012:22622774}, {PMID:Gonzalez-Rodriguez 2014:24801599}" "" "654G>A, D187N" "Finnish major mutation: >28 Finnish FAF families and FAF patients (all homo). Also 2 American FAF families, 1 Dutch FAF family and 5 Japanese FAF families (all hom), and 1 Mexican patient with FAF (het)." "SUMMARY record" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000016822" "3" "99" "9" "124073097" "124073097" "subst" "0" "00015" "GSN_000002" "g.124073097G>T" "" "{PMID:de la Chapelle et al. 1992:1338910}, {PMID:Solari et al. 2011:22068858}, {PMID:Chastan et al. 2006:16258946}" "" "654G>T, D187Y" "1 Danish, 1 Czech, 1 Brazilian and 1 French FAF family (all hom)" "SUMMARY record" "yes" "rs121909715" "0" "" "" "g.121310819G>T" "" "pathogenic" "" "0000040505" "0" "90" "9" "124073037" "124073037" "subst" "2.84282E-5" "00006" "GSN_000003" "g.124073037G>A" "" "{PMID:Sethi 2013:22938848}, {DOI:Sethi 2013:10.1053/j.ajkd.2012.07.016}" "" "" "GSN peptides identified in fibrillary deposits using LC-MS/MS" "Unknown" "?" "" "0" "" "" "g.121310759G>A" "" "pathogenic" "" "0000040506" "1" "90" "9" "124073097" "124073097" "subst" "0" "00006" "GSN_000002" "g.124073097G>T" "" "{PMID:de la Chapelle 1992:01338910}, {DOI:de la Chapelle 1992:10.1038/ng1092-157}, {OMIM137350:0002}" "" "G654T (Asp187Tyr)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>T" "" "pathogenic" "" "0000040508" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Maury 1990:02176164}, {DOI:Maury 1990:10.1016/0014-5793(90)80510-P}" "" "654G>A (Asp187Asn)" "not in 90 control chromosomes" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040509" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Maury 1990:02176164}, {DOI:Maury 1990:10.1016/0014-5793(90)80510-P}" "" "654G>A (Asp187Asn)" "not in 90 control chromosomes; {PMID:Maury 1990:02176550} shows Asp214Asn change using protein sequencing" "Unknown" "?" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040510" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Maury 1990:02176550}" "" "654G>A (Asp187Asn)" "Asp214Asn change detected using protein sequencing" "Unknown" "?" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040511" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Levy 1990:02175344}, {DOI:Levy 1990:10.1084/jem.172.6.1865}" "" "654G>A (Asp187Asn)" "not in 26 control chromosomes" "Unknown" "?" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040512" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Hiltunen 1991:01652889}, {PMID:Paunio 1992:01315718}, {DOI:Paunio 1992:10.1016/0888-7543(92)90235-K}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040513" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Hiltunen 1991:01652889}, {PMID:Paunio 1992:01315718}, {DOI:Paunio 1992:10.1016/0888-7543(92)90235-K}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040514" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Hiltunen 1991:01652889}, {PMID:Paunio 1992:01315718}, {DOI:Paunio 1992:10.1016/0888-7543(92)90235-K}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040515" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:de la Chapelle 1992:01322359}, {DOI:de la Chapelle 1992:10.1016/0888-7543(92)90182-R}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040516" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:de la Chapelle 1992:01322359}, {DOI:de la Chapelle 1992:10.1016/0888-7543(92)90182-R}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040517" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Maury 1992:01322360}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040518" "3" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Maury 1992:01322360}" "" "654G>A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040519" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Gorevic 1991:01658654}" "" "654G>A" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040520" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Taira 2012:22622774}" "" "654G>A (Asp187Asn)" "performed extensive haplotype analysis" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040521" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Taira 2012:22622774}" "" "654G>A (Asp187Asn)" "performed extensive haplotype analysis" "Unknown" "?" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040522" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Taira 2012:22622774}" "" "654G>A (Asp187Asn)" "performed extensive haplotype analysis" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040523" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Taira 2012:22622774}" "" "654G>A (Asp187Asn)" "performed extensive haplotype analysis" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040524" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Taira 2012:22622774}" "" "654G>A (Asp187Asn)" "performed extensive haplotype analysis" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040525" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Gonzalez-Rodriguez 2014:24801599}" "" "654G>A (Asp187Asn)" "" "Unknown" "?" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040526" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:de la Chapelle 1992:01338910}, {DOI:de la Chapelle 1992:10.1038/ng1092-157}" "" "G654A (Asp187Asn)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000040527" "1" "90" "9" "124073097" "124073097" "subst" "0" "00006" "GSN_000002" "g.124073097G>T" "" "{PMID:de la Chapelle 1992:01338910}, {DOI:de la Chapelle 1992:10.1038/ng1092-157}, {OMIM137350:0002}" "" "G654T (Asp187Tyr)" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>T" "" "pathogenic" "" "0000040528" "1" "90" "9" "124073097" "124073097" "subst" "0" "00006" "GSN_000002" "g.124073097G>T" "" "{PMID:Solari 2011:22068858}, {DOI:Solari 2011:10.1590/S0004-27492011000400012}" "" "G654T" "" "Unknown" "yes" "rs121909715" "0" "" "" "g.121310819G>T" "" "pathogenic" "" "0000040529" "1" "90" "9" "124073097" "124073097" "subst" "0" "00006" "GSN_000002" "g.124073097G>T" "" "{PMID:Chastan 2006:16258946}, {DOI:Chastan 2006:10.1002/mus.20448}" "" "654G>T" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>T" "" "pathogenic" "" "0000040530" "1" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "00006" "GSN_000001" "g.124073097G>A" "" "{PMID:Stewart 2000:10729296}, {DOI:Stewart 2000:10.1136/bjo.84.4.390}" "" "" "" "Germline" "yes" "rs121909715" "0" "" "" "g.121310819G>A" "" "pathogenic" "" "0000281196" "0" "50" "9" "124062405" "124062405" "subst" "3.25643E-5" "02325" "GSN_000005" "g.124062405G>T" "" "" "" "GSN(NM_000177.4):c.144+122G>T (p.(=)), GSN(NM_001127663.2):c.100-1836G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121300127G>T" "" "VUS" "" "0000281197" "0" "50" "9" "124086837" "124086837" "subst" "0" "02325" "GSN_000013" "g.124086837G>T" "" "" "" "GSN(NM_000177.5):c.1484G>T (p.G495V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121324559G>T" "" "VUS" "" "0000288881" "0" "30" "9" "124083642" "124083642" "subst" "0.00287573" "01943" "GSN_000011" "g.124083642C>T" "" "" "" "GSN(NM_000177.4):c.1441C>T (p.(Arg481Cys)), GSN(NM_000177.5):c.1441C>T (p.R481C), GSN(NM_001353053.1):c.1288C>T (p.R430C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121321364C>T" "" "likely benign" "" "0000332778" "0" "30" "9" "124048472" "124048472" "subst" "0.0170938" "01804" "GSN_000017" "g.124048472C>T" "" "" "" "GSN(NM_001127662.1):c.-9-15769C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121286194C>T" "" "likely benign" "" "0000332779" "0" "50" "9" "124062326" "124062332" "dup" "0" "01804" "GSN_000004" "g.124062326_124062332dup" "" "" "" "GSN(NM_000177.4):c.144+42_144+43insATTGTAA (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121300048_121300054dup" "" "VUS" "" "0000332780" "0" "50" "9" "124062405" "124062405" "subst" "3.25643E-5" "01804" "GSN_000005" "g.124062405G>T" "" "" "" "GSN(NM_000177.4):c.144+122G>T (p.(=)), GSN(NM_001127663.2):c.100-1836G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121300127G>T" "" "VUS" "" "0000332782" "0" "30" "9" "124073142" "124073142" "subst" "0.00204519" "01804" "GSN_000007" "g.124073142T>C" "" "" "" "GSN(NM_000177.4):c.666+19T>C (p.(=)), GSN(NM_000177.5):c.666+19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121310864T>C" "" "likely benign" "" "0000332783" "0" "10" "9" "124074641" "124074641" "subst" "0.00302961" "01804" "GSN_000008" "g.124074641A>G" "" "" "" "GSN(NM_000177.4):c.691A>G (p.(Asn231Asp)), GSN(NM_000177.5):c.691A>G (p.N231D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121312363A>G" "" "benign" "" "0000332784" "0" "30" "9" "124079515" "124079515" "subst" "0.00167304" "01804" "GSN_000009" "g.124079515G>T" "" "" "" "GSN(NM_000177.4):c.1039+19G>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121317237G>T" "" "likely benign" "" "0000332785" "0" "30" "9" "124083593" "124083593" "subst" "0.00193721" "01804" "GSN_000010" "g.124083593A>G" "" "" "" "GSN(NM_000177.4):c.1392A>G (p.(Thr464=)), GSN(NM_000177.5):c.1392A>G (p.T464=), GSN(NM_001127663.1):c.1347A>G (p.T449=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121321315A>G" "" "likely benign" "" "0000332787" "0" "30" "9" "124083663" "124083663" "subst" "8.12407E-6" "01804" "GSN_000012" "g.124083663C>A" "" "" "" "GSN(NM_000177.4):c.1462C>A (p.(Gln488Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121321385C>A" "" "likely benign" "" "0000332788" "0" "30" "9" "124088908" "124088908" "subst" "0.028341" "01804" "GSN_000014" "g.124088908C>G" "" "" "" "GSN(NM_000177.4):c.1688C>G (p.(Thr563Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121326630C>G" "" "likely benign" "" "0000346141" "0" "50" "9" "124088805" "124088805" "subst" "0" "02327" "GSN_000015" "g.124088805G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.121326527G>A" "" "VUS" "" "0000536195" "0" "50" "9" "124044748" "124044748" "subst" "0" "01943" "GSN_000016" "g.124044748C>T" "" "" "" "GSN(NM_001127663.1):c.19C>T (p.R7C), GSN(NM_001127663.2):c.19C>T (p.R7C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121282470C>T" "" "VUS" "" "0000536196" "0" "30" "9" "124062202" "124062202" "subst" "0.000252813" "01804" "GSN_000018" "g.124062202G>C" "" "" "" "GSN(NM_000177.4):c.63G>C (p.(Leu21=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121299924G>C" "" "likely benign" "" "0000536197" "0" "30" "9" "124062250" "124062250" "subst" "2.15703E-5" "01943" "GSN_000019" "g.124062250G>A" "" "" "" "GSN(NM_000177.4):c.111G>A (p.A37=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121299972G>A" "" "likely benign" "" "0000536199" "0" "30" "9" "124064452" "124064452" "subst" "0.000962428" "01804" "GSN_000021" "g.124064452C>T" "" "" "" "GSN(NM_000177.4):c.349+7C>T (p.(=)), GSN(NM_000177.5):c.349+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121302174C>T" "" "likely benign" "" "0000536200" "0" "50" "9" "124065314" "124065314" "subst" "3.25418E-5" "01804" "GSN_000022" "g.124065314G>A" "" "" "" "GSN(NM_000177.4):c.475G>A (p.(Gly159Ser)), GSN(NM_001353053.1):c.322G>A (p.G108S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121303036G>A" "" "VUS" "" "0000536201" "0" "30" "9" "124072992" "124072992" "subst" "0.00500361" "01804" "GSN_000023" "g.124072992G>A" "" "" "" "GSN(NM_000177.4):c.535G>A (p.(Val179Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121310714G>A" "" "likely benign" "" "0000536202" "0" "50" "9" "124073124" "124073124" "subst" "5.28352E-5" "01943" "GSN_000024" "g.124073124G>A" "" "" "" "GSN(NM_001127663.1):c.621+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121310846G>A" "" "VUS" "" "0000536203" "0" "30" "9" "124074700" "124074700" "subst" "0.000629677" "01943" "GSN_000025" "g.124074700C>T" "" "" "" "GSN(NM_000177.4):c.750C>T (p.(Asn250=)), GSN(NM_000177.5):c.750C>T (p.N250=), GSN(NM_001353053.1):c.597C>T (p.N199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121312422C>T" "" "likely benign" "" "0000536204" "0" "30" "9" "124079396" "124079396" "subst" "0.000377717" "01804" "GSN_000026" "g.124079396C>T" "" "" "" "GSN(NM_000177.4):c.939C>T (p.(Ser313=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121317118C>T" "" "likely benign" "" "0000536205" "0" "30" "9" "124080744" "124080744" "subst" "8.93379E-5" "01804" "GSN_000027" "g.124080744C>A" "" "" "" "GSN(NM_000177.4):c.1100C>A (p.(Thr367Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121318466C>A" "" "likely benign" "" "0000536206" "0" "30" "9" "124080976" "124080976" "subst" "0.000828635" "01943" "GSN_000028" "g.124080976C>T" "" "" "" "GSN(NM_001127663.1):c.1117C>T (p.L373=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121318698C>T" "" "likely benign" "" "0000536207" "0" "30" "9" "124083579" "124083579" "subst" "0.00105207" "01943" "GSN_000029" "g.124083579G>A" "" "" "" "GSN(NM_000177.4):c.1378G>A (p.(Val460Met)), GSN(NM_000177.5):c.1378G>A (p.V460M), GSN(NM_001127663.1):c.1333G>A (p.V445M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121321301G>A" "" "likely benign" "" "0000536208" "0" "30" "9" "124083579" "124083579" "subst" "0.00105207" "01804" "GSN_000029" "g.124083579G>A" "" "" "" "GSN(NM_000177.4):c.1378G>A (p.(Val460Met)), GSN(NM_000177.5):c.1378G>A (p.V460M), GSN(NM_001127663.1):c.1333G>A (p.V445M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121321301G>A" "" "likely benign" "" "0000536209" "0" "10" "9" "124083593" "124083593" "subst" "0.00193721" "01943" "GSN_000010" "g.124083593A>G" "" "" "" "GSN(NM_000177.4):c.1392A>G (p.(Thr464=)), GSN(NM_000177.5):c.1392A>G (p.T464=), GSN(NM_001127663.1):c.1347A>G (p.T449=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121321315A>G" "" "benign" "" "0000536210" "0" "30" "9" "124083642" "124083642" "subst" "0.00287573" "01804" "GSN_000011" "g.124083642C>T" "" "" "" "GSN(NM_000177.4):c.1441C>T (p.(Arg481Cys)), GSN(NM_000177.5):c.1441C>T (p.R481C), GSN(NM_001353053.1):c.1288C>T (p.R430C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121321364C>T" "" "likely benign" "" "0000536211" "0" "50" "9" "124088790" "124088790" "subst" "4.08467E-5" "01804" "GSN_000030" "g.124088790A>G" "" "" "" "GSN(NM_000177.4):c.1570A>G (p.(Ser524Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121326512A>G" "" "VUS" "" "0000536212" "0" "50" "9" "124088794" "124088794" "subst" "0.000183711" "01943" "GSN_000031" "g.124088794G>A" "" "" "" "GSN(NM_000177.5):c.1574G>A (p.R525H), GSN(NM_001127663.1):c.1529G>A (p.R510H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121326516G>A" "" "VUS" "" "0000536213" "0" "30" "9" "124089668" "124089668" "subst" "0" "01943" "GSN_000032" "g.124089668C>T" "" "" "" "GSN(NM_001127663.1):c.1778C>T (p.T593I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121327390C>T" "" "likely benign" "" "0000536214" "0" "50" "9" "124089725" "124089725" "subst" "0.000536546" "01943" "GSN_000033" "g.124089725C>G" "" "" "" "GSN(NM_001127663.1):c.1835C>G (p.A612G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121327447C>G" "" "VUS" "" "0000536215" "0" "50" "9" "124089771" "124089771" "subst" "0.000116783" "01804" "GSN_000034" "g.124089771G>A" "" "" "" "GSN(NM_000177.4):c.1915+11G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121327493G>A" "" "VUS" "" "0000536216" "0" "50" "9" "124091280" "124091280" "subst" "8.13623E-5" "01943" "GSN_000035" "g.124091280T>C" "" "" "" "GSN(NM_001127663.1):c.1982T>C (p.I661T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121329002T>C" "" "VUS" "" "0000536217" "0" "30" "9" "124091518" "124091518" "subst" "4.06164E-5" "01804" "GSN_000036" "g.124091518C>T" "" "" "" "GSN(NM_000177.4):c.2043C>T (p.(Ile681=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121329240C>T" "" "likely benign" "" "0000611840" "0" "30" "9" "124065235" "124065235" "subst" "0.0013046" "01943" "GSN_000037" "g.124065235C>T" "" "" "" "GSN(NM_000177.4):c.396C>T (p.(Thr132=)), GSN(NM_000177.5):c.396C>T (p.T132=), GSN(NM_001127663.1):c.351C>T (p.T117=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121302957C>T" "" "likely benign" "" "0000611841" "0" "30" "9" "124065263" "124065263" "subst" "0.000284481" "01943" "GSN_000038" "g.124065263C>T" "" "" "" "GSN(NM_001353053.1):c.271C>T (p.R91W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121302985C>T" "" "likely benign" "" "0000611842" "0" "30" "9" "124065295" "124065295" "subst" "2.84527E-5" "01943" "GSN_000006" "g.124065295C>T" "" "" "" "GSN(NM_001127663.1):c.411C>T (p.F137=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121303017C>T" "" "likely benign" "" "0000611843" "0" "50" "9" "124073041" "124073041" "subst" "0.000203064" "01943" "GSN_000039" "g.124073041G>A" "" "" "" "GSN(NM_001127663.1):c.539G>A (p.R180Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121310763G>A" "" "VUS" "" "0000611844" "0" "50" "9" "124074650" "124074650" "subst" "6.49762E-5" "01943" "GSN_000040" "g.124074650C>T" "" "" "" "GSN(NM_000177.4):c.700C>T (p.(Arg234Trp)), GSN(NM_001353053.1):c.547C>T (p.R183W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121312372C>T" "" "VUS" "" "0000611845" "0" "30" "9" "124089770" "124089770" "subst" "1.9496E-5" "01943" "GSN_000042" "g.124089770G>A" "" "" "" "GSN(NM_001127663.1):c.1870+10G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121327492G>A" "" "likely benign" "" "0000622159" "0" "30" "9" "124088928" "124088928" "subst" "0.000355755" "01943" "GSN_000041" "g.124088928G>A" "" "" "" "GSN(NM_000177.4):c.1708G>A (p.(Ala570Thr)), GSN(NM_001353053.1):c.1555G>A (p.A519T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121326650G>A" "" "likely benign" "" "0000656213" "0" "30" "9" "124065314" "124065314" "subst" "3.25418E-5" "01943" "GSN_000022" "g.124065314G>A" "" "" "" "GSN(NM_000177.4):c.475G>A (p.(Gly159Ser)), GSN(NM_001353053.1):c.322G>A (p.G108S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121303036G>A" "" "likely benign" "" "0000656214" "0" "50" "9" "124094809" "124094809" "subst" "0" "02325" "GSN_000043" "g.124094809G>A" "" "" "" "GSN(NM_001353053.1):c.2124G>A (p.W708*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.121332531G>A" "" "VUS" "" "0000690393" "0" "30" "9" "124091188" "124091188" "subst" "0.000401018" "01943" "GSN_000044" "g.124091188G>A" "" "" "" "GSN(NM_001353053.1):c.1782G>A (p.L594=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000690394" "0" "50" "9" "124094750" "124094750" "subst" "3.65848E-5" "01943" "GSN_000045" "g.124094750C>T" "" "" "" "GSN(NM_001353053.1):c.2065C>T (p.R689W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722246" "0" "50" "9" "124044749" "124044749" "subst" "0" "01943" "GSN_000046" "g.124044749G>A" "" "" "" "GSN(NM_001127663.1):c.20G>A (p.R7H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722247" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "02325" "GSN_000001" "g.124073097G>A" "" "" "" "GSN(NM_000177.5):c.640G>A (p.D214N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000722248" "0" "50" "9" "124088814" "124088814" "subst" "1.63044E-5" "02325" "GSN_000047" "g.124088814C>A" "" "" "" "GSN(NM_000177.5):c.1594C>A (p.P532T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722249" "0" "30" "9" "124089661" "124089661" "subst" "0.00150566" "02326" "GSN_000048" "g.124089661G>A" "" "" "" "GSN(NM_001353053.1):c.1663G>A (p.V555M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803857" "0" "30" "9" "124048450" "124048450" "subst" "8.11083E-6" "01943" "GSN_000050" "g.124048450A>G" "" "" "" "GSN(NM_001258029.1):c.29A>G (p.N10S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803858" "0" "30" "9" "124062258" "124062258" "subst" "5.48509E-5" "02326" "GSN_000051" "g.124062258C>T" "" "" "" "GSN(NM_000177.5):c.119C>T (p.P40L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803859" "0" "30" "9" "124064452" "124064452" "subst" "0.000962428" "02326" "GSN_000021" "g.124064452C>T" "" "" "" "GSN(NM_000177.4):c.349+7C>T (p.(=)), GSN(NM_000177.5):c.349+7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803860" "0" "30" "9" "124074700" "124074700" "subst" "0.000629677" "02326" "GSN_000025" "g.124074700C>T" "" "" "" "GSN(NM_000177.4):c.750C>T (p.(Asn250=)), GSN(NM_000177.5):c.750C>T (p.N250=), GSN(NM_001353053.1):c.597C>T (p.N199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000803861" "0" "50" "9" "124083558" "124083558" "subst" "4.47016E-5" "01943" "GSN_000052" "g.124083558G>A" "" "" "" "GSN(NM_001353053.1):c.1204G>A (p.E402K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000803862" "0" "30" "9" "124086904" "124086904" "subst" "0" "01943" "GSN_000053" "g.124086904G>A" "" "" "" "GSN(NM_001353053.1):c.1398G>A (p.L466=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852088" "0" "30" "9" "124062241" "124062241" "subst" "0.000173638" "02326" "GSN_000054" "g.124062241G>T" "" "" "" "GSN(NM_000177.5):c.102G>T (p.A34=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852089" "0" "10" "9" "124074641" "124074641" "subst" "0.00302961" "02326" "GSN_000008" "g.124074641A>G" "" "" "" "GSN(NM_000177.4):c.691A>G (p.(Asn231Asp)), GSN(NM_000177.5):c.691A>G (p.N231D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000852090" "0" "30" "9" "124083579" "124083579" "subst" "0.00105207" "02326" "GSN_000029" "g.124083579G>A" "" "" "" "GSN(NM_000177.4):c.1378G>A (p.(Val460Met)), GSN(NM_000177.5):c.1378G>A (p.V460M), GSN(NM_001127663.1):c.1333G>A (p.V445M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000852091" "0" "30" "9" "124088858" "124088858" "subst" "0.000236771" "01943" "GSN_000063" "g.124088858C>T" "" "" "" "GSN(NM_001353053.1):c.1485C>T (p.I495=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861374" "0" "30" "9" "124064278" "124064278" "subst" "0.00646175" "01804" "GSN_000055" "g.124064278A>G" "" "" "" "GSN(NM_000177.4):c.182A>G (p.(Lys61Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861375" "0" "30" "9" "124065235" "124065235" "subst" "0.0013046" "01804" "GSN_000037" "g.124065235C>T" "" "" "" "GSN(NM_000177.4):c.396C>T (p.(Thr132=)), GSN(NM_000177.5):c.396C>T (p.T132=), GSN(NM_001127663.1):c.351C>T (p.T117=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861376" "0" "90" "9" "124073097" "124073097" "subst" "4.06147E-6" "02326" "GSN_000001" "g.124073097G>A" "" "" "" "GSN(NM_000177.5):c.640G>A (p.D214N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000861377" "0" "50" "9" "124074677" "124074677" "subst" "4.06121E-6" "01943" "GSN_000056" "g.124074677G>C" "" "" "" "GSN(NM_001353053.1):c.574G>C (p.V192L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861378" "0" "30" "9" "124074700" "124074700" "subst" "0.000629677" "01804" "GSN_000025" "g.124074700C>T" "" "" "" "GSN(NM_000177.4):c.750C>T (p.(Asn250=)), GSN(NM_000177.5):c.750C>T (p.N250=), GSN(NM_001353053.1):c.597C>T (p.N199=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861379" "0" "30" "9" "124074713" "124074713" "subst" "0" "01804" "GSN_000057" "g.124074713C>A" "" "" "" "GSN(NM_000177.4):c.763C>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861380" "0" "30" "9" "124076208" "124076208" "subst" "0.000960662" "01804" "GSN_000058" "g.124076208A>G" "" "" "" "GSN(NM_000177.4):c.817-4A>G (p.?), GSN(NM_000177.5):c.817-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861381" "0" "30" "9" "124076229" "124076229" "subst" "1.62801E-5" "01804" "GSN_000059" "g.124076229G>A" "" "" "" "GSN(NM_000177.4):c.834G>A (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861382" "0" "50" "9" "124080963" "124080963" "subst" "1.21885E-5" "01943" "GSN_000060" "g.124080963C>T" "" "" "" "GSN(NM_001353053.1):c.996C>T (p.G332=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861383" "0" "30" "9" "124081116" "124081116" "subst" "8.14233E-6" "01943" "GSN_000061" "g.124081116C>T" "" "" "" "GSN(NM_001353053.1):c.1149C>T (p.A383=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861384" "0" "10" "9" "124083593" "124083593" "subst" "0.00193721" "02326" "GSN_000010" "g.124083593A>G" "" "" "" "GSN(NM_000177.4):c.1392A>G (p.(Thr464=)), GSN(NM_000177.5):c.1392A>G (p.T464=), GSN(NM_001127663.1):c.1347A>G (p.T449=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000861385" "0" "50" "9" "124086918" "124086918" "subst" "0" "01804" "GSN_000062" "g.124086918T>G" "" "" "" "GSN(NM_000177.4):c.1565T>G (p.(Val522Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861386" "0" "30" "9" "124089692" "124089692" "subst" "0.0346111" "01804" "GSN_000064" "g.124089692C>T" "" "" "" "GSN(NM_000177.4):c.1847delinsT (p.(Thr616Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000861387" "0" "30" "9" "124091256" "124091256" "subst" "0.00093572" "01804" "GSN_000065" "g.124091256G>T" "" "" "" "GSN(NM_000177.4):c.2003G>T (p.(Arg668Leu)), GSN(NM_000177.5):c.2003G>T (p.R668L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000873580" "0" "70" "9" "124065283" "124065283" "subst" "8.1281E-6" "00000" "GSN_000066" "g.124065283G>T" "200" "{PMID:Sun 2018:30076350}" "" "GSN(NM_000177.4):c.444G>T(p.E148D); COL4A4(NM_000092.4):c.930+1G>A; TNXB(NM_019105.6):c.8201_8202insC(p.E2735Terfs*1)" "" "Germline/De novo (untested)" "?" "" "0" "" "" "g.121303005G>T" "" "likely pathogenic" "" "0000888592" "0" "30" "9" "124044794" "124044794" "subst" "0" "02326" "GSN_000067" "g.124044794C>T" "" "" "" "GSN(NM_001127663.2):c.65C>T (p.P22L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888593" "0" "50" "9" "124048464" "124048464" "subst" "0.000170504" "02325" "GSN_000068" "g.124048464G>T" "" "" "" "GSN(NM_001353053.1):c.-10+4624G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888594" "0" "70" "9" "124062150" "124062177" "del" "0" "02325" "GSN_000069" "g.124062150_124062177del" "" "" "" "GSN(NM_000177.5):c.11_38delACCGCCCCGCGCCCGCGCTGCTTTGCGC (p.H4Rfs*86)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000888595" "0" "30" "9" "124065219" "124065219" "subst" "0.00152491" "02326" "GSN_000070" "g.124065219C>T" "" "" "" "GSN(NM_000177.4):c.380C>T (p.(Ala127Val)), GSN(NM_000177.5):c.380C>T (p.A127V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888596" "0" "30" "9" "124065235" "124065235" "subst" "0.0013046" "02326" "GSN_000037" "g.124065235C>T" "" "" "" "GSN(NM_000177.4):c.396C>T (p.(Thr132=)), GSN(NM_000177.5):c.396C>T (p.T132=), GSN(NM_001127663.1):c.351C>T (p.T117=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888597" "0" "30" "9" "124074650" "124074650" "subst" "6.49762E-5" "01804" "GSN_000040" "g.124074650C>T" "" "" "" "GSN(NM_000177.4):c.700C>T (p.(Arg234Trp)), GSN(NM_001353053.1):c.547C>T (p.R183W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888598" "0" "50" "9" "124074714" "124074714" "subst" "1.21895E-5" "02325" "GSN_000071" "g.124074714G>A" "" "" "" "GSN(NM_000177.5):c.764G>A (p.R255Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888599" "0" "30" "9" "124081065" "124081065" "subst" "0.000243978" "01804" "GSN_000072" "g.124081065G>A" "" "" "" "GSN(NM_000177.4):c.1251G>A (p.(Val417=)), GSN(NM_000177.5):c.1251G>A (p.V417=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888600" "0" "30" "9" "124081086" "124081086" "subst" "3.25283E-5" "02326" "GSN_000073" "g.124081086C>T" "" "" "" "GSN(NM_000177.5):c.1272C>T (p.A424=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888601" "0" "30" "9" "124083642" "124083642" "subst" "0.00287573" "02326" "GSN_000011" "g.124083642C>T" "" "" "" "GSN(NM_000177.4):c.1441C>T (p.(Arg481Cys)), GSN(NM_000177.5):c.1441C>T (p.R481C), GSN(NM_001353053.1):c.1288C>T (p.R430C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888602" "0" "30" "9" "124088928" "124088928" "subst" "0.000355755" "01804" "GSN_000041" "g.124088928G>A" "" "" "" "GSN(NM_000177.4):c.1708G>A (p.(Ala570Thr)), GSN(NM_001353053.1):c.1555G>A (p.A519T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888603" "0" "50" "9" "124088952" "124088952" "subst" "0" "02326" "GSN_000074" "g.124088952G>T" "" "" "" "GSN(NM_000177.5):c.1732G>T (p.A578S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888604" "0" "50" "9" "124089638" "124089638" "subst" "8.12585E-6" "02326" "GSN_000075" "g.124089638C>T" "" "" "" "GSN(NM_000177.5):c.1793C>T (p.T598I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000888605" "0" "30" "9" "124089775" "124089775" "subst" "1.99317E-5" "02326" "GSN_000076" "g.124089775G>C" "" "" "" "GSN(NM_000177.5):c.1915+15G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913069" "0" "30" "9" "124044748" "124044748" "subst" "0" "02326" "GSN_000016" "g.124044748C>T" "" "" "" "GSN(NM_001127663.1):c.19C>T (p.R7C), GSN(NM_001127663.2):c.19C>T (p.R7C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913070" "0" "30" "9" "124062220" "124062220" "subst" "0.000113199" "01804" "GSN_000077" "g.124062220G>A" "" "" "" "GSN(NM_000177.4):c.81G>A (p.(Ala27=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913071" "0" "50" "9" "124064408" "124064408" "del" "0" "02325" "GSN_000078" "g.124064408del" "" "" "" "GSN(NM_000177.5):c.312delG (p.N105Tfs*35)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913072" "0" "50" "9" "124076251" "124076251" "subst" "0" "02325" "GSN_000079" "g.124076251G>A" "" "" "" "GSN(NM_000177.5):c.856G>A (p.D286N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000913073" "0" "30" "9" "124083615" "124083615" "subst" "4.06134E-6" "02326" "GSN_000080" "g.124083615G>A" "" "" "" "GSN(NM_000177.5):c.1414G>A (p.D472N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913074" "0" "30" "9" "124091559" "124091559" "subst" "0.000641713" "02326" "GSN_000081" "g.124091559C>T" "" "" "" "GSN(NM_000177.4):c.2084C>T (p.(Thr695Met)), GSN(NM_000177.5):c.2084C>T (p.T695M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913075" "0" "30" "9" "124093745" "124093745" "subst" "0.000107807" "02326" "GSN_000082" "g.124093745G>A" "" "" "" "GSN(NM_000177.5):c.2179+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924955" "0" "50" "9" "124062215" "124062215" "subst" "0" "02325" "GSN_000083" "g.124062215C>T" "" "" "" "GSN(NM_000177.5):c.76C>T (p.R26C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924956" "0" "30" "9" "124062240" "124062240" "subst" "0" "01804" "GSN_000084" "g.124062240C>T" "" "" "" "GSN(NM_000177.4):c.101C>T (p.(Ala34Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000924957" "0" "30" "9" "124091304" "124091304" "subst" "7.75339E-5" "02326" "GSN_000085" "g.124091304G>T" "" "" "" "GSN(NM_000177.5):c.2040+11G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929523" "0" "30" "9" "124064435" "124064435" "subst" "0.00041453" "01804" "GSN_000086" "g.124064435C>T" "" "" "" "GSN(NM_000177.4):c.339C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929524" "0" "30" "9" "124073142" "124073142" "subst" "0.00204519" "02326" "GSN_000007" "g.124073142T>C" "" "" "" "GSN(NM_000177.4):c.666+19T>C (p.(=)), GSN(NM_000177.5):c.666+19T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929525" "0" "30" "9" "124081050" "124081050" "subst" "4.06762E-6" "01804" "GSN_000087" "g.124081050C>T" "" "" "" "GSN(NM_000177.4):c.1236C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949176" "0" "50" "9" "124072969" "124072969" "subst" "0" "02325" "GSN_000088" "g.124072969G>T" "" "" "" "GSN(NM_000177.5):c.512G>T (p.G171V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000949177" "0" "30" "9" "124076208" "124076208" "subst" "0.000960662" "02326" "GSN_000058" "g.124076208A>G" "" "" "" "GSN(NM_000177.4):c.817-4A>G (p.?), GSN(NM_000177.5):c.817-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949178" "0" "30" "9" "124089678" "124089678" "subst" "0.000921957" "02326" "GSN_000089" "g.124089678C>T" "" "" "" "GSN(NM_000177.4):c.1833C>T (p.(Ser611=)), GSN(NM_000177.5):c.1833C>T (p.S611=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949179" "0" "10" "9" "124091256" "124091256" "subst" "0.00093572" "02326" "GSN_000065" "g.124091256G>T" "" "" "" "GSN(NM_000177.4):c.2003G>T (p.(Arg668Leu)), GSN(NM_000177.5):c.2003G>T (p.R668L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000965158" "0" "10" "9" "124064324" "124064324" "subst" "0.00120194" "02326" "GSN_000090" "g.124064324C>G" "" "" "" "GSN(NM_000177.5):c.228C>G (p.F76L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000965159" "0" "30" "9" "124065219" "124065219" "subst" "0.00152491" "01804" "GSN_000070" "g.124065219C>T" "" "" "" "GSN(NM_000177.4):c.380C>T (p.(Ala127Val)), GSN(NM_000177.5):c.380C>T (p.A127V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000965160" "0" "30" "9" "124073123" "124073123" "subst" "2.03168E-5" "02326" "GSN_000091" "g.124073123C>T" "" "" "" "GSN(NM_000177.5):c.666C>T (p.N222=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000965161" "0" "30" "9" "124081065" "124081065" "subst" "0.000243978" "02326" "GSN_000072" "g.124081065G>A" "" "" "" "GSN(NM_000177.4):c.1251G>A (p.(Val417=)), GSN(NM_000177.5):c.1251G>A (p.V417=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000978378" "0" "50" "9" "124062146" "124062146" "subst" "0" "02326" "GSN_000092" "g.124062146C>T" "" "" "" "GSN(NM_000177.5):c.7C>T (p.P3S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978379" "0" "50" "9" "124079444" "124079446" "del" "0" "02325" "GSN_000093" "g.124079444_124079446del" "" "" "" "GSN(NM_000177.5):c.987_989delGGA (p.E329del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978380" "0" "30" "9" "124091559" "124091559" "subst" "0.000641713" "01804" "GSN_000081" "g.124091559C>T" "" "" "" "GSN(NM_000177.4):c.2084C>T (p.(Thr695Met)), GSN(NM_000177.5):c.2084C>T (p.T695M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000997474" "0" "50" "9" "124044734" "124044734" "subst" "0" "01804" "GSN_000094" "g.124044734A>G" "" "" "" "GSN(NM_000177.4):c.-17406A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997475" "0" "50" "9" "124088794" "124088794" "subst" "0.000183711" "02325" "GSN_000031" "g.124088794G>A" "" "" "" "GSN(NM_000177.5):c.1574G>A (p.R525H), GSN(NM_001127663.1):c.1529G>A (p.R510H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014493" "0" "30" "9" "124062345" "124062345" "dup" "0" "02325" "GSN_000095" "g.124062345dup" "" "" "" "GSN(NM_000177.5):c.144+62dupA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001014494" "0" "50" "9" "124088812" "124088812" "subst" "0" "02325" "GSN_000096" "g.124088812A>G" "" "" "" "GSN(NM_000177.5):c.1592A>G (p.E531G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025580" "0" "50" "9" "124064269" "124064269" "subst" "0" "01804" "GSN_000097" "g.124064269A>C" "" "" "" "GSN(NM_000177.4):c.173A>C (p.(Glu58Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025581" "0" "30" "9" "124065264" "124065264" "subst" "2.43849E-5" "01804" "GSN_000098" "g.124065264G>A" "" "" "" "GSN(NM_000177.4):c.425G>A (p.(Arg142Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037165" "0" "30" "9" "124081162" "124081162" "subst" "0.000159909" "02325" "GSN_000099" "g.124081162C>T" "" "" "" "GSN(NM_000177.5):c.1344+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037166" "0" "30" "9" "124089678" "124089678" "subst" "0.000921957" "01804" "GSN_000089" "g.124089678C>T" "" "" "" "GSN(NM_000177.4):c.1833C>T (p.(Ser611=)), GSN(NM_000177.5):c.1833C>T (p.S611=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001037167" "0" "50" "9" "124091220" "124091220" "subst" "0" "01804" "GSN_000100" "g.124091220G>T" "" "" "" "GSN(NM_000177.4):c.1967G>T (p.(Arg656Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046175" "0" "30" "9" "124094767" "124094767" "subst" "6.90748E-5" "01804" "GSN_000101" "g.124094767C>T" "" "" "" "GSN(NM_000177.4):c.2235C>T (p.(Thr745=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053334" "0" "50" "9" "124062172" "124062192" "dup" "0" "01804" "GSN_000102" "g.124062172_124062192dup" "" "" "" "GSN(NM_000177.5):c.33_53dup (p.(Ala17_Leu23dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053335" "0" "30" "9" "124079332" "124079332" "subst" "1.2249E-5" "01804" "GSN_000103" "g.124079332A>G" "" "" "" "GSN(NM_000177.4):c.907-32A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053336" "0" "30" "9" "124081126" "124081126" "subst" "3.25852E-5" "01804" "GSN_000104" "g.124081126G>A" "" "" "" "GSN(NM_198252.3):c.1159G>A (p.(Gly387Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001053337" "0" "30" "9" "124094731" "124094731" "subst" "4.06805E-6" "01804" "GSN_000105" "g.124094731G>C" "" "" "" "GSN(NM_000177.4):c.2199G>C (p.(Thr733=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes GSN ## Count = 154 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000016821" "00000283" "99" "640" "0" "640" "0" "c.640G>A" "r.(640g>a)" "p.(Asp214Asn)" "4" "0000016822" "00000283" "99" "640" "0" "640" "0" "c.640G>T" "r.(640g>u)" "p.(Asp214Tyr)" "4" "0000040505" "00000283" "90" "580" "0" "580" "0" "c.580G>A" "r.(?)" "p.(Gly194Arg)" "4" "0000040506" "00000283" "90" "640" "0" "640" "0" "c.640G>T" "r.(?)" "p.(Asp214Tyr)" "4" "0000040508" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040509" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040510" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.Asp214Asn" "4" "0000040511" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040512" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040513" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.640g>a" "p.Asp214Asn" "4" "0000040514" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040515" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040516" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040517" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040518" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040519" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040520" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040521" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040522" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040523" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040524" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040525" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040526" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000040527" "00000283" "90" "640" "0" "640" "0" "c.640G>T" "r.(?)" "p.(Asp214Tyr)" "4" "0000040528" "00000283" "90" "640" "0" "640" "0" "c.640G>T" "r.(?)" "p.(Asp214Tyr)" "4" "0000040529" "00000283" "90" "640" "0" "640" "0" "c.640G>T" "r.(?)" "p.(Asp214Tyr)" "4" "0000040530" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "4" "0000281196" "00000283" "50" "144" "122" "144" "122" "c.144+122G>T" "r.(=)" "p.(=)" "" "0000281197" "00000283" "50" "1484" "0" "1484" "0" "c.1484G>T" "r.(?)" "p.(Gly495Val)" "" "0000288881" "00000283" "30" "1441" "0" "1441" "0" "c.1441C>T" "r.(?)" "p.(Arg481Cys)" "" "0000332778" "00000283" "30" "-13668" "0" "-13668" "0" "c.-13668C>T" "r.(?)" "p.(=)" "" "0000332779" "00000283" "50" "144" "43" "144" "49" "c.144+43_144+49dup" "r.(=)" "p.(=)" "" "0000332780" "00000283" "50" "144" "122" "144" "122" "c.144+122G>T" "r.(=)" "p.(=)" "" "0000332782" "00000283" "30" "666" "19" "666" "19" "c.666+19T>C" "r.(=)" "p.(=)" "" "0000332783" "00000283" "10" "691" "0" "691" "0" "c.691A>G" "r.(?)" "p.(Asn231Asp)" "" "0000332784" "00000283" "30" "1039" "19" "1039" "19" "c.1039+19G>T" "r.(=)" "p.(=)" "" "0000332785" "00000283" "30" "1392" "0" "1392" "0" "c.1392A>G" "r.(?)" "p.(Thr464=)" "" "0000332787" "00000283" "30" "1462" "0" "1462" "0" "c.1462C>A" "r.(?)" "p.(Gln488Lys)" "" "0000332788" "00000283" "30" "1688" "0" "1688" "0" "c.1688C>G" "r.(?)" "p.(Thr563Ser)" "" "0000346141" "00000283" "50" "1585" "0" "1585" "0" "c.1585G>A" "r.(?)" "p.(Gly529Ser)" "" "0000536195" "00000283" "50" "-17392" "0" "-17392" "0" "c.-17392C>T" "r.(?)" "p.(=)" "" "0000536196" "00000283" "30" "63" "0" "63" "0" "c.63G>C" "r.(?)" "p.(Leu21=)" "" "0000536197" "00000283" "30" "111" "0" "111" "0" "c.111G>A" "r.(?)" "p.(Ala37=)" "" "0000536199" "00000283" "30" "349" "7" "349" "7" "c.349+7C>T" "r.(=)" "p.(=)" "" "0000536200" "00000283" "50" "475" "0" "475" "0" "c.475G>A" "r.(?)" "p.(Gly159Ser)" "" "0000536201" "00000283" "30" "535" "0" "535" "0" "c.535G>A" "r.(?)" "p.(Val179Met)" "" "0000536202" "00000283" "50" "666" "1" "666" "1" "c.666+1G>A" "r.spl?" "p.?" "" "0000536203" "00000283" "30" "750" "0" "750" "0" "c.750C>T" "r.(?)" "p.(Asn250=)" "" "0000536204" "00000283" "30" "939" "0" "939" "0" "c.939C>T" "r.(?)" "p.(Ser313=)" "" "0000536205" "00000283" "30" "1100" "0" "1100" "0" "c.1100C>A" "r.(?)" "p.(Thr367Asn)" "" "0000536206" "00000283" "30" "1162" "0" "1162" "0" "c.1162C>T" "r.(?)" "p.(Leu388=)" "" "0000536207" "00000283" "30" "1378" "0" "1378" "0" "c.1378G>A" "r.(?)" "p.(Val460Met)" "" "0000536208" "00000283" "30" "1378" "0" "1378" "0" "c.1378G>A" "r.(?)" "p.(Val460Met)" "" "0000536209" "00000283" "10" "1392" "0" "1392" "0" "c.1392A>G" "r.(?)" "p.(Thr464=)" "" "0000536210" "00000283" "30" "1441" "0" "1441" "0" "c.1441C>T" "r.(?)" "p.(Arg481Cys)" "" "0000536211" "00000283" "50" "1570" "0" "1570" "0" "c.1570A>G" "r.(?)" "p.(Ser524Gly)" "" "0000536212" "00000283" "50" "1574" "0" "1574" "0" "c.1574G>A" "r.(?)" "p.(Arg525His)" "" "0000536213" "00000283" "30" "1823" "0" "1823" "0" "c.1823C>T" "r.(?)" "p.(Thr608Ile)" "" "0000536214" "00000283" "50" "1880" "0" "1880" "0" "c.1880C>G" "r.(?)" "p.(Ala627Gly)" "" "0000536215" "00000283" "50" "1915" "11" "1915" "11" "c.1915+11G>A" "r.(=)" "p.(=)" "" "0000536216" "00000283" "50" "2027" "0" "2027" "0" "c.2027T>C" "r.(?)" "p.(Ile676Thr)" "" "0000536217" "00000283" "30" "2043" "0" "2043" "0" "c.2043C>T" "r.(?)" "p.(Ile681=)" "" "0000611840" "00000283" "30" "396" "0" "396" "0" "c.396C>T" "r.(?)" "p.(Thr132=)" "" "0000611841" "00000283" "30" "424" "0" "424" "0" "c.424C>T" "r.(?)" "p.(Arg142Trp)" "" "0000611842" "00000283" "30" "456" "0" "456" "0" "c.456C>T" "r.(?)" "p.(Phe152=)" "" "0000611843" "00000283" "50" "584" "0" "584" "0" "c.584G>A" "r.(?)" "p.(Arg195Gln)" "" "0000611844" "00000283" "50" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Trp)" "" "0000611845" "00000283" "30" "1915" "10" "1915" "10" "c.1915+10G>A" "r.(=)" "p.(=)" "" "0000622159" "00000283" "30" "1708" "0" "1708" "0" "c.1708G>A" "r.(?)" "p.(Ala570Thr)" "" "0000656213" "00000283" "30" "475" "0" "475" "0" "c.475G>A" "r.(?)" "p.(Gly159Ser)" "" "0000656214" "00000283" "50" "2277" "0" "2277" "0" "c.2277G>A" "r.(?)" "p.(Trp759Ter)" "" "0000690393" "00000283" "30" "1935" "0" "1935" "0" "c.1935G>A" "r.(?)" "p.(Leu645=)" "" "0000690394" "00000283" "50" "2218" "0" "2218" "0" "c.2218C>T" "r.(?)" "p.(Arg740Trp)" "" "0000722246" "00000283" "50" "-17391" "0" "-17391" "0" "c.-17391G>A" "r.(?)" "p.(=)" "" "0000722247" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "" "0000722248" "00000283" "50" "1594" "0" "1594" "0" "c.1594C>A" "r.(?)" "p.(Pro532Thr)" "" "0000722249" "00000283" "30" "1816" "0" "1816" "0" "c.1816G>A" "r.(?)" "p.(Val606Met)" "" "0000803857" "00000283" "30" "-13690" "0" "-13690" "0" "c.-13690A>G" "r.(?)" "p.(=)" "" "0000803858" "00000283" "30" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Pro40Leu)" "" "0000803859" "00000283" "30" "349" "7" "349" "7" "c.349+7C>T" "r.(=)" "p.(=)" "" "0000803860" "00000283" "30" "750" "0" "750" "0" "c.750C>T" "r.(?)" "p.(Asn250=)" "" "0000803861" "00000283" "50" "1357" "0" "1357" "0" "c.1357G>A" "r.(?)" "p.(Glu453Lys)" "" "0000803862" "00000283" "30" "1551" "0" "1551" "0" "c.1551G>A" "r.(?)" "p.(Leu517=)" "" "0000852088" "00000283" "30" "102" "0" "102" "0" "c.102G>T" "r.(?)" "p.(Ala34=)" "" "0000852089" "00000283" "10" "691" "0" "691" "0" "c.691A>G" "r.(?)" "p.(Asn231Asp)" "" "0000852090" "00000283" "30" "1378" "0" "1378" "0" "c.1378G>A" "r.(?)" "p.(Val460Met)" "" "0000852091" "00000283" "30" "1638" "0" "1638" "0" "c.1638C>T" "r.(?)" "p.(Ile546=)" "" "0000861374" "00000283" "30" "182" "0" "182" "0" "c.182A>G" "r.(?)" "p.(Lys61Arg)" "" "0000861375" "00000283" "30" "396" "0" "396" "0" "c.396C>T" "r.(?)" "p.(Thr132=)" "" "0000861376" "00000283" "90" "640" "0" "640" "0" "c.640G>A" "r.(?)" "p.(Asp214Asn)" "" "0000861377" "00000283" "50" "727" "0" "727" "0" "c.727G>C" "r.(?)" "p.(Val243Leu)" "" "0000861378" "00000283" "30" "750" "0" "750" "0" "c.750C>T" "r.(?)" "p.(Asn250=)" "" "0000861379" "00000283" "30" "763" "0" "763" "0" "c.763C>A" "r.(?)" "p.(Arg255=)" "" "0000861380" "00000283" "30" "817" "-4" "817" "-4" "c.817-4A>G" "r.spl?" "p.?" "" "0000861381" "00000283" "30" "834" "0" "834" "0" "c.834G>A" "r.(?)" "p.(Pro278=)" "" "0000861382" "00000283" "50" "1149" "0" "1149" "0" "c.1149C>T" "r.(?)" "p.(Gly383=)" "" "0000861383" "00000283" "30" "1302" "0" "1302" "0" "c.1302C>T" "r.(?)" "p.(Ala434=)" "" "0000861384" "00000283" "10" "1392" "0" "1392" "0" "c.1392A>G" "r.(?)" "p.(Thr464=)" "" "0000861385" "00000283" "50" "1565" "0" "1565" "0" "c.1565T>G" "r.(?)" "p.(Val522Gly)" "" "0000861386" "00000283" "30" "1847" "0" "1847" "0" "c.1847C>T" "r.(?)" "p.(Thr616Met)" "" "0000861387" "00000283" "30" "2003" "0" "2003" "0" "c.2003G>T" "r.(?)" "p.(Arg668Leu)" "" "0000873580" "00000283" "70" "444" "0" "444" "0" "c.444G>T" "r.(?)" "p.(Glu148Asp)" "" "0000888592" "00000283" "30" "-17346" "0" "-17346" "0" "c.-17346C>T" "r.(?)" "p.(=)" "" "0000888593" "00000283" "50" "-13676" "0" "-13676" "0" "c.-13676G>T" "r.(?)" "p.(=)" "" "0000888594" "00000283" "70" "11" "0" "38" "0" "c.11_38del" "r.(?)" "p.(His4Argfs*86)" "" "0000888595" "00000283" "30" "380" "0" "380" "0" "c.380C>T" "r.(?)" "p.(Ala127Val)" "" "0000888596" "00000283" "30" "396" "0" "396" "0" "c.396C>T" "r.(?)" "p.(Thr132=)" "" "0000888597" "00000283" "30" "700" "0" "700" "0" "c.700C>T" "r.(?)" "p.(Arg234Trp)" "" "0000888598" "00000283" "50" "764" "0" "764" "0" "c.764G>A" "r.(?)" "p.(Arg255Gln)" "" "0000888599" "00000283" "30" "1251" "0" "1251" "0" "c.1251G>A" "r.(?)" "p.(Val417=)" "" "0000888600" "00000283" "30" "1272" "0" "1272" "0" "c.1272C>T" "r.(?)" "p.(Ala424=)" "" "0000888601" "00000283" "30" "1441" "0" "1441" "0" "c.1441C>T" "r.(?)" "p.(Arg481Cys)" "" "0000888602" "00000283" "30" "1708" "0" "1708" "0" "c.1708G>A" "r.(?)" "p.(Ala570Thr)" "" "0000888603" "00000283" "50" "1732" "0" "1732" "0" "c.1732G>T" "r.(?)" "p.(Ala578Ser)" "" "0000888604" "00000283" "50" "1793" "0" "1793" "0" "c.1793C>T" "r.(?)" "p.(Thr598Ile)" "" "0000888605" "00000283" "30" "1915" "15" "1915" "15" "c.1915+15G>C" "r.(=)" "p.(=)" "" "0000913069" "00000283" "30" "-17392" "0" "-17392" "0" "c.-17392C>T" "r.(?)" "p.(=)" "" "0000913070" "00000283" "30" "81" "0" "81" "0" "c.81G>A" "r.(?)" "p.(Ala27=)" "" "0000913071" "00000283" "50" "312" "0" "312" "0" "c.312del" "r.(?)" "p.(Asn105Thrfs*35)" "" "0000913072" "00000283" "50" "856" "0" "856" "0" "c.856G>A" "r.(?)" "p.(Asp286Asn)" "" "0000913073" "00000283" "30" "1414" "0" "1414" "0" "c.1414G>A" "r.(?)" "p.(Asp472Asn)" "" "0000913074" "00000283" "30" "2084" "0" "2084" "0" "c.2084C>T" "r.(?)" "p.(Thr695Met)" "" "0000913075" "00000283" "30" "2179" "19" "2179" "19" "c.2179+19G>A" "r.(=)" "p.(=)" "" "0000924955" "00000283" "50" "76" "0" "76" "0" "c.76C>T" "r.(?)" "p.(Arg26Cys)" "" "0000924956" "00000283" "30" "101" "0" "101" "0" "c.101C>T" "r.(?)" "p.(Ala34Val)" "" "0000924957" "00000283" "30" "2040" "11" "2040" "11" "c.2040+11G>T" "r.(=)" "p.(=)" "" "0000929523" "00000283" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(=)" "" "0000929524" "00000283" "30" "666" "19" "666" "19" "c.666+19T>C" "r.(=)" "p.(=)" "" "0000929525" "00000283" "30" "1236" "0" "1236" "0" "c.1236C>T" "r.(?)" "p.(=)" "" "0000949176" "00000283" "50" "512" "0" "512" "0" "c.512G>T" "r.(?)" "p.(Gly171Val)" "" "0000949177" "00000283" "30" "817" "-4" "817" "-4" "c.817-4A>G" "r.spl?" "p.?" "" "0000949178" "00000283" "30" "1833" "0" "1833" "0" "c.1833C>T" "r.(?)" "p.(=)" "" "0000949179" "00000283" "10" "2003" "0" "2003" "0" "c.2003G>T" "r.(?)" "p.(Arg668Leu)" "" "0000965158" "00000283" "10" "228" "0" "228" "0" "c.228C>G" "r.(?)" "p.(Phe76Leu)" "" "0000965159" "00000283" "30" "380" "0" "380" "0" "c.380C>T" "r.(?)" "p.(Ala127Val)" "" "0000965160" "00000283" "30" "666" "0" "666" "0" "c.666C>T" "r.(?)" "p.(=)" "" "0000965161" "00000283" "30" "1251" "0" "1251" "0" "c.1251G>A" "r.(?)" "p.(Val417=)" "" "0000978378" "00000283" "50" "7" "0" "7" "0" "c.7C>T" "r.(?)" "p.(Pro3Ser)" "" "0000978379" "00000283" "50" "987" "0" "989" "0" "c.987_989del" "r.(?)" "p.(Glu329del)" "" "0000978380" "00000283" "30" "2084" "0" "2084" "0" "c.2084C>T" "r.(?)" "p.(Thr695Met)" "" "0000997474" "00000283" "50" "-17406" "0" "-17406" "0" "c.-17406A>G" "r.(?)" "p.(=)" "" "0000997475" "00000283" "50" "1574" "0" "1574" "0" "c.1574G>A" "r.(?)" "p.(Arg525His)" "" "0001014493" "00000283" "30" "144" "62" "144" "62" "c.144+62dup" "r.(=)" "p.(=)" "" "0001014494" "00000283" "50" "1592" "0" "1592" "0" "c.1592A>G" "r.(?)" "p.(Glu531Gly)" "" "0001025580" "00000283" "50" "173" "0" "173" "0" "c.173A>C" "r.(?)" "p.(Glu58Ala)" "" "0001025581" "00000283" "30" "425" "0" "425" "0" "c.425G>A" "r.(?)" "p.(Arg142Gln)" "" "0001037165" "00000283" "30" "1344" "4" "1344" "4" "c.1344+4C>T" "r.spl?" "p.?" "" "0001037166" "00000283" "30" "1833" "0" "1833" "0" "c.1833C>T" "r.(?)" "p.(=)" "" "0001037167" "00000283" "50" "1967" "0" "1967" "0" "c.1967G>T" "r.(?)" "p.(Arg656Leu)" "" "0001046175" "00000283" "30" "2235" "0" "2235" "0" "c.2235C>T" "r.(?)" "p.(=)" "" "0001053334" "00000283" "50" "33" "0" "53" "0" "c.33_53dup" "r.(?)" "p.(Ala17_Leu23dup)" "" "0001053335" "00000283" "30" "907" "-32" "907" "-32" "c.907-32A>G" "r.(=)" "p.(=)" "" "0001053336" "00000283" "30" "1312" "0" "1312" "0" "c.1312G>A" "r.(?)" "p.(Gly438Ser)" "" "0001053337" "00000283" "30" "2199" "0" "2199" "0" "c.2199G>C" "r.(?)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 26 "{{screeningid}}" "{{variantid}}" "0000019985" "0000040505" "0000019986" "0000040506" "0000019987" "0000040508" "0000019988" "0000040509" "0000019989" "0000040510" "0000019990" "0000040511" "0000019991" "0000040512" "0000019992" "0000040513" "0000019993" "0000040514" "0000019994" "0000040515" "0000019995" "0000040516" "0000019996" "0000040517" "0000019997" "0000040518" "0000019998" "0000040519" "0000019999" "0000040520" "0000020000" "0000040521" "0000020001" "0000040522" "0000020002" "0000040523" "0000020003" "0000040524" "0000020004" "0000040525" "0000020005" "0000040526" "0000020006" "0000040527" "0000020007" "0000040528" "0000020008" "0000040529" "0000020009" "0000040530" "0000415713" "0000873580"