### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = HCN1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "HCN1" "hyperpolarization activated cyclic nucleotide-gated potassium channel 1" "5" "p12" "unknown" "NC_000005.9" "UD_136087414146" "" "http://www.LOVD.nl/HCN1" "" "1" "4845" "348980" "602780" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "http://databases.lovd.nl/shared/refseq/HCN1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2016-06-11 18:39:40" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00009203" "HCN1" "hyperpolarization activated cyclic nucleotide-gated potassium channel 1" "001" "NM_021072.3" "" "NP_066550.2" "" "" "" "-25" "9644" "2673" "45696220" "45255052" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "04113" "EIEE24" "encephalopathy, epileptic, early infantile, type 24 (EIEE-24)" "AD" "615871" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05166" "SUD" "death, sudden, unexplained (SUD)" "" "" "" "" "" "00006" "2016-05-19 16:34:23" "00006" "2018-09-11 12:14:13" "05391" "GEFSP" "epilepsy, generalized, with febrile seizures plus (GEFSP)" "" "" "" "" "" "00006" "2018-02-02 09:53:31" "" "" "06680" "GEFSP10" "Generalized epilepsy with febrile seizures plus, type 10" "AD" "618482" "" "" "" "00006" "2021-12-10 23:20:41" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "HCN1" "04113" "HCN1" "06680" ## Individuals ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00064741" "" "" "" "1" "" "01601" "" "" "F" "" "Denmark" "50y" "0" "" "" "" "" "00116984" "" "" "" "1" "" "02192" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "individual from 567 controls" "" "" "" "" "0" "" "" "" "S_50:0/1:CONTROL" "00358838" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "176346" "00374652" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3202" "00374751" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3270" "00374752" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5488" "00409135" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "195636" "00440404" "" "" "" "1" "" "00006" "{PMID:Nambot 2018:29095811}" "" "" "" "France" "" "0" "" "" "" "PED3646.1" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 8 "{{individualid}}" "{{diseaseid}}" "00064741" "05166" "00116984" "00000" "00358838" "05391" "00374652" "00198" "00374751" "00198" "00374752" "00198" "00409135" "04113" "00440404" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00198, 04113, 05166, 05391, 06680 ## Count = 7 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000053266" "05166" "00064741" "01601" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000254096" "05391" "00358838" "01164" "Unknown" "07y" "(+) Febrile seizure (within the age range of 3 months to 6 years),(+) Infection-related seizure,(+) Seizure precipitated by febrile infection / at age 4y first seizure fever-associated after influenza infection, at age 6y further fever-associated seizure, seizure-free under levetiracetam" "" "" "" "" "" "" "" "" "" "" "" "0000269862" "00198" "00374652" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000269961" "00198" "00374751" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "epilepsy, autism spectrum disorder" "" "0000269962" "00198" "00374752" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "epilepsy" "" "0000301251" "04113" "00409135" "01164" "Unknown" "04y" "Seizure, Neurodevelopmental delay, Intellectual disability" "" "" "" "" "" "" "" "" "" "" "" "0000330314" "00198" "00440404" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "Early infantile epileptic encephalopathy-24 (MIM #615871)" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000064880" "00064741" "1" "01601" "01601" "2016-05-10 13:33:49" "" "" "SEQ-NG-I" "DNA" "" "" "0000117452" "00116984" "1" "02192" "00006" "2017-08-03 15:16:01" "" "" "SEQ-NG" "DNA" "" "" "0000360070" "00358838" "1" "01164" "01164" "2021-03-16 12:08:23" "" "" "SEQ-NG-I" "DNA" "" "" "0000375846" "00374652" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375945" "00374751" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375946" "00374752" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000410399" "00409135" "1" "01164" "01164" "2022-05-03 13:16:06" "" "" "SEQ-NG-I" "DNA" "" "" "0000441889" "00440404" "1" "00006" "00006" "2023-11-02 14:36:08" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 5 "{{screeningid}}" "{{geneid}}" "0000360070" "HCN1" "0000375846" "ALDH5A1" "0000375945" "HCN1" "0000375946" "HCN1" "0000410399" "HCN1" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 76 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000096535" "0" "50" "5" "45262276" "45262276" "subst" "0" "01601" "HCN1_000001" "g.45262276G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.45262174G>C" "" "VUS" "" "0000188297" "0" "50" "5" "45353231" "45353231" "subst" "0" "02192" "HCN1_000002" "g.45353231G>T" "1/567 controls" "{PMID:Bobbili 2018:29358611}, {DOI:Bobbili 2018:10.1038/s41431-017-0034-x}" "" "" "" "Germline" "" "" "0" "" "" "g.45353129G>T" "" "VUS" "" "0000251975" "0" "30" "5" "45262658" "45262658" "subst" "0" "02326" "HCN1_000003" "g.45262658A>T" "" "" "" "HCN1(NM_021072.3):c.2038T>A (p.S680T), HCN1(NM_021072.4):c.2038T>A (p.S680T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45262556A>T" "" "likely benign" "" "0000252104" "0" "30" "5" "45267358" "45267358" "subst" "0.000158468" "02326" "HCN1_000005" "g.45267358A>G" "" "" "" "HCN1(NM_021072.4):c.1619-3T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45267256A>G" "" "likely benign" "" "0000252416" "0" "70" "5" "45645408" "45645408" "subst" "0" "02326" "HCN1_000017" "g.45645408A>C" "" "" "" "HCN1(NM_021072.4):c.728T>G (p.M243R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45645306A>C" "" "likely pathogenic" "" "0000285071" "0" "30" "5" "45396826" "45396826" "subst" "0.00108353" "02326" "HCN1_000013" "g.45396826T>C" "" "" "" "HCN1(NM_021072.4):c.1012-14A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45396724T>C" "" "likely benign" "" "0000285072" "0" "10" "5" "45396499" "45396500" "del" "0" "02326" "HCN1_000009" "g.45396499_45396500del" "" "" "" "HCN1(NM_021072.4):c.1230+104_1230+105delAA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45396397_45396398del" "" "benign" "" "0000285073" "0" "30" "5" "45396500" "45396500" "del" "0" "02326" "HCN1_000010" "g.45396500del" "" "" "" "HCN1(NM_021072.4):c.1230+105delA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45396398del" "" "likely benign" "" "0000285075" "0" "30" "5" "45396575" "45396575" "subst" "0" "02326" "HCN1_000012" "g.45396575G>A" "" "" "" "HCN1(NM_021072.4):c.1230+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45396473G>A" "" "likely benign" "" "0000285076" "0" "30" "5" "45396499" "45396499" "subst" "0" "02326" "HCN1_000011" "g.45396499T>A" "" "" "" "HCN1(NM_021072.4):c.1230+95A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45396397T>A" "" "likely benign" "" "0000285077" "0" "30" "5" "45353355" "45353355" "subst" "0" "02326" "HCN1_000007" "g.45353355G>A" "" "" "" "HCN1(NM_021072.4):c.1231-7C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45353253G>A" "" "likely benign" "" "0000285078" "0" "30" "5" "45303672" "45303672" "subst" "0.00417391" "02326" "HCN1_000006" "g.45303672T>C" "" "" "" "HCN1(NM_021072.4):c.1618+29A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45303570T>C" "" "likely benign" "" "0000285080" "0" "30" "5" "45695690" "45695690" "subst" "0" "02326" "HCN1_000019" "g.45695690G>A" "" "" "" "HCN1(NM_021072.4):c.425+81C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45695588G>A" "" "likely benign" "" "0000285081" "0" "70" "5" "45645622" "45645622" "subst" "0" "02326" "HCN1_000018" "g.45645622T>G" "" "" "" "HCN1(NM_021072.4):c.514A>C (p.T172P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45645520T>G" "" "likely pathogenic" "" "0000285082" "0" "10" "5" "45645120" "45645120" "subst" "0" "02326" "HCN1_000016" "g.45645120T>C" "" "" "" "HCN1(NM_021072.4):c.849+167A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45645018T>C" "" "benign" "" "0000285083" "0" "30" "5" "45462149" "45462149" "subst" "0" "02326" "HCN1_000014" "g.45462149T>G" "" "" "" "HCN1(NM_021072.4):c.850-40A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45462047T>G" "" "likely benign" "" "0000285084" "0" "30" "5" "45462149" "45462149" "subst" "0" "02326" "HCN1_000015" "g.45462149T>C" "" "" "" "HCN1(NM_021072.4):c.850-40A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45462047T>C" "" "likely benign" "" "0000288973" "0" "30" "5" "45262899" "45262899" "subst" "0.00396172" "01943" "HCN1_000004" "g.45262899T>C" "" "" "" "HCN1(NM_021072.3):c.1797A>G (p.S599=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45262797T>C" "" "likely benign" "" "0000343381" "0" "50" "5" "45262288" "45262288" "subst" "0" "02327" "HCN1_000022" "g.45262288C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45262186C>G" "" "VUS" "" "0000346707" "0" "50" "5" "45396704" "45396704" "subst" "0" "02327" "HCN1_000024" "g.45396704T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45396602T>C" "" "VUS" "" "0000347284" "0" "50" "5" "45262616" "45262616" "subst" "0" "02327" "HCN1_000023" "g.45262616G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45262514G>T" "" "VUS" "" "0000349325" "0" "50" "5" "45645619" "45645619" "subst" "8.15674E-6" "02327" "HCN1_000025" "g.45645619T>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.45645517T>G" "" "VUS" "" "0000525785" "0" "30" "5" "45262205" "45262205" "subst" "1.63265E-5" "02326" "HCN1_000026" "g.45262205C>T" "" "" "" "HCN1(NM_021072.4):c.2491G>A (p.G831S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45262103C>T" "" "likely benign" "" "0000525786" "0" "50" "5" "45262687" "45262687" "subst" "4.06273E-5" "01943" "HCN1_000027" "g.45262687G>A" "" "" "" "HCN1(NM_021072.3):c.2009C>T (p.A670V, p.(Ala670Val)), HCN1(NM_021072.4):c.2009C>T (p.A670V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45262585G>A" "" "VUS" "" "0000525788" "0" "30" "5" "45267184" "45267184" "dup" "0" "01804" "HCN1_000029" "g.45267184dup" "" "" "" "HCN1(NM_021072.3):c.1783+7dup (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45267082dup" "" "likely benign" "" "0000525790" "0" "50" "5" "45695903" "45695923" "dup" "0" "01943" "HCN1_000031" "g.45695903_45695923dup" "" "" "" "HCN1(NM_021072.3):c.274_294dupGGCTTCATGCAGAGGCAGTTC (p.G92_F98dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695801_45695821dup" "" "VUS" "" "0000525791" "0" "50" "5" "45695949" "45695949" "subst" "0" "02327" "HCN1_000032" "g.45695949C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695847C>T" "" "VUS" "" "0000525792" "0" "30" "5" "45695956" "45695956" "subst" "0.000121751" "01943" "HCN1_000033" "g.45695956G>T" "" "" "" "HCN1(NM_021072.3):c.240C>A (p.G80=), HCN1(NM_021072.4):c.240C>A (p.G80=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695854G>T" "" "likely benign" "" "0000525793" "0" "30" "5" "45695986" "45695994" "del" "0" "01943" "HCN1_000034" "g.45695986_45695994del" "" "" "" "HCN1(NM_021072.3):c.215_223delGCGGCGGCG (p.G72_G74del), HCN1(NM_021072.4):c.215_223delGCGGCGGCG (p.G72_G74del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695884_45695892del" "" "likely benign" "" "0000525794" "0" "30" "5" "45695986" "45695994" "del" "0" "02326" "HCN1_000034" "g.45695986_45695994del" "" "" "" "HCN1(NM_021072.3):c.215_223delGCGGCGGCG (p.G72_G74del), HCN1(NM_021072.4):c.215_223delGCGGCGGCG (p.G72_G74del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695884_45695892del" "" "likely benign" "" "0000525795" "0" "30" "5" "45695989" "45695994" "del" "0" "01943" "HCN1_000035" "g.45695989_45695994del" "" "" "" "HCN1(NM_021072.3):c.218_223del (p.(Gly73_Gly74del)), HCN1(NM_021072.3):c.218_223delGCGGCG (p.G73_G74del), HCN1(NM_021072.4):c.218_223delGCGGCG (p....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695887_45695892del" "" "likely benign" "" "0000525796" "0" "30" "5" "45695989" "45695994" "del" "0" "01804" "HCN1_000035" "g.45695989_45695994del" "" "" "" "HCN1(NM_021072.3):c.218_223del (p.(Gly73_Gly74del)), HCN1(NM_021072.3):c.218_223delGCGGCG (p.G73_G74del), HCN1(NM_021072.4):c.218_223delGCGGCG (p....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695887_45695892del" "" "likely benign" "" "0000525797" "0" "10" "5" "45695989" "45695994" "del" "0" "02325" "HCN1_000035" "g.45695989_45695994del" "" "" "" "HCN1(NM_021072.3):c.218_223del (p.(Gly73_Gly74del)), HCN1(NM_021072.3):c.218_223delGCGGCG (p.G73_G74del), HCN1(NM_021072.4):c.218_223delGCGGCG (p....)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695887_45695892del" "" "benign" "" "0000525799" "0" "10" "5" "45696002" "45696010" "dup" "0" "02326" "HCN1_000037" "g.45696002_45696010dup" "" "" "" "HCN1(NM_021072.4):c.201_209dupTGGCGGCGG (p.G72_G74dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695900_45695908dup" "" "benign" "" "0000525800" "0" "50" "5" "45696056" "45696056" "subst" "0.00665804" "01943" "HCN1_000038" "g.45696056C>A" "" "" "" "HCN1(NM_021072.3):c.140G>T (p.G47V, p.(Gly47Val)), HCN1(NM_021072.4):c.140G>T (p.G47V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695954C>A" "" "VUS" "" "0000525801" "0" "30" "5" "45696056" "45696056" "subst" "0.00665804" "01804" "HCN1_000038" "g.45696056C>A" "" "" "" "HCN1(NM_021072.3):c.140G>T (p.G47V, p.(Gly47Val)), HCN1(NM_021072.4):c.140G>T (p.G47V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695954C>A" "" "likely benign" "" "0000525802" "0" "30" "5" "45696056" "45696056" "subst" "0.00665804" "02325" "HCN1_000038" "g.45696056C>A" "" "" "" "HCN1(NM_021072.3):c.140G>T (p.G47V, p.(Gly47Val)), HCN1(NM_021072.4):c.140G>T (p.G47V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695954C>A" "" "likely benign" "" "0000525803" "0" "10" "5" "45696056" "45696056" "subst" "0.00665804" "02326" "HCN1_000038" "g.45696056C>A" "" "" "" "HCN1(NM_021072.3):c.140G>T (p.G47V, p.(Gly47Val)), HCN1(NM_021072.4):c.140G>T (p.G47V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695954C>A" "" "benign" "" "0000525804" "0" "30" "5" "45696072" "45696072" "subst" "0.000519003" "01943" "HCN1_000039" "g.45696072G>A" "" "" "" "HCN1(NM_021072.3):c.124C>T (p.P42S), HCN1(NM_021072.4):c.124C>T (p.(Pro42Ser), p.P42S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695970G>A" "" "likely benign" "" "0000525805" "0" "30" "5" "45696072" "45696072" "subst" "0.000519003" "01804" "HCN1_000039" "g.45696072G>A" "" "" "" "HCN1(NM_021072.3):c.124C>T (p.P42S), HCN1(NM_021072.4):c.124C>T (p.(Pro42Ser), p.P42S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695970G>A" "" "likely benign" "" "0000525806" "0" "30" "5" "45696072" "45696072" "subst" "0.000519003" "02325" "HCN1_000039" "g.45696072G>A" "" "" "" "HCN1(NM_021072.3):c.124C>T (p.P42S), HCN1(NM_021072.4):c.124C>T (p.(Pro42Ser), p.P42S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695970G>A" "" "likely benign" "" "0000525807" "0" "30" "5" "45696072" "45696072" "subst" "0.000519003" "02326" "HCN1_000039" "g.45696072G>A" "" "" "" "HCN1(NM_021072.3):c.124C>T (p.P42S), HCN1(NM_021072.4):c.124C>T (p.(Pro42Ser), p.P42S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695970G>A" "" "likely benign" "" "0000609748" "0" "50" "5" "45262636" "45262636" "dup" "0" "02327" "HCN1_000040" "g.45262636dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45262534dup" "" "VUS" "" "0000609751" "0" "30" "5" "45695916" "45695916" "subst" "1.68091E-5" "02326" "HCN1_000044" "g.45695916T>C" "" "" "" "HCN1(NM_021072.4):c.280A>G (p.(Met94Val), p.M94V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695814T>C" "" "likely benign" "" "0000609752" "0" "30" "5" "45695986" "45695994" "del" "0" "02325" "HCN1_000034" "g.45695986_45695994del" "" "" "" "HCN1(NM_021072.3):c.215_223delGCGGCGGCG (p.G72_G74del), HCN1(NM_021072.4):c.215_223delGCGGCGGCG (p.G72_G74del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45695884_45695892del" "" "likely benign" "" "0000621574" "0" "50" "5" "45396677" "45396677" "subst" "0" "02325" "HCN1_000042" "g.45396677C>T" "" "" "" "HCN1(NM_021072.4):c.1147G>A (p.A383T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.45396575C>T" "" "VUS" "" "0000677521" "0" "30" "5" "45695956" "45695956" "subst" "0.000121751" "02326" "HCN1_000033" "g.45695956G>T" "" "" "" "HCN1(NM_021072.3):c.240C>A (p.G80=), HCN1(NM_021072.4):c.240C>A (p.G80=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720448" "0" "50" "5" "45303739" "45303739" "subst" "0" "02329" "HCN1_000041" "g.45303739C>T" "" "" "" "HCN1(NM_021072.4):c.1580G>A (p.S527N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720449" "0" "70" "5" "45396653" "45396653" "subst" "0" "01943" "HCN1_000047" "g.45396653C>T" "" "" "" "HCN1(NM_021072.3):c.1171G>A (p.G391S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000720450" "0" "50" "5" "45645373" "45645373" "subst" "0" "02329" "HCN1_000043" "g.45645373G>A" "" "" "" "HCN1(NM_021072.4):c.763C>T (p.R255C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000759751" "0" "50" "5" "45462051" "45462051" "subst" "0" "01164" "HCN1_000048" "g.45462051C>A" "" "" "" "" "ACMG: class 3 (PM1, PM2_SUP, PP2, PP3)" "Germline" "?" "" "" "" "" "" "" "VUS (!)" "ACMG" "0000787296" "0" "50" "5" "45262379" "45262379" "subst" "0" "00006" "HCN1_000050" "g.45262379C>G" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.45262277C>G" "" "VUS" "" "0000787297" "0" "50" "5" "45262132" "45262132" "subst" "4.06822E-6" "00006" "HCN1_000049" "g.45262132C>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs755932633" "0" "" "" "g.45262030C>A" "" "VUS" "" "0000787561" "0" "50" "5" "45396683" "45396683" "subst" "0" "00000" "HCN1_000051" "g.45396683C>T" "" "0" "" "" "" "Germline" "" "rs750838439" "0" "" "" "g.45396581C>T" "" "VUS" "" "0000802123" "0" "50" "5" "45262658" "45262658" "subst" "0" "01943" "HCN1_000003" "g.45262658A>T" "" "" "" "HCN1(NM_021072.3):c.2038T>A (p.S680T), HCN1(NM_021072.4):c.2038T>A (p.S680T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802124" "0" "50" "5" "45262687" "45262687" "subst" "4.06273E-5" "02325" "HCN1_000027" "g.45262687G>A" "" "" "" "HCN1(NM_021072.3):c.2009C>T (p.A670V, p.(Ala670Val)), HCN1(NM_021072.4):c.2009C>T (p.A670V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000847688" "0" "90" "5" "45396653" "45396653" "subst" "0" "01164" "HCN1_000047" "g.45396653C>T" "" "PMID: 33822003, 30351409, 34310985, 31572294, 30986657" "" "" "ACMG: PS4, PS2_MOD, PM5, PM2_SUP, PP2, PP3" "Germline" "?" "" "" "" "" "" "VCV000635189.4" "pathogenic (dominant)" "ACMG" "0000850926" "0" "30" "5" "45696002" "45696010" "dup" "0" "02325" "HCN1_000037" "g.45696002_45696010dup" "" "" "" "HCN1(NM_021072.4):c.201_209dupTGGCGGCGG (p.G72_G74dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000886883" "0" "50" "5" "45696017" "45696017" "subst" "0" "02325" "HCN1_000052" "g.45696017T>C" "" "" "" "HCN1(NM_021072.4):c.179A>G (p.K60R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000924357" "0" "50" "5" "45695986" "45695994" "dup" "0" "02325" "HCN1_000053" "g.45695986_45695994dup" "" "" "" "HCN1(NM_021072.4):c.215_223dupGCGGCGGCG (p.G72_G74dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929087" "0" "50" "5" "45303761" "45303761" "subst" "0" "02327" "HCN1_000054" "g.45303761C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000939831" "0" "90" "5" "45695782" "45695782" "del" "0" "00006" "HCN1_000055" "g.45695782del" "" "{PMID:Nambot 2018:29095811}" "" "" "" "De novo" "" "" "0" "" "" "g.45695680del" "" "pathogenic (dominant)" "" "0000995073" "0" "50" "5" "45262529" "45262529" "subst" "0" "01804" "HCN1_000056" "g.45262529T>C" "" "" "" "HCN1(NM_021072.3):c.2167A>G (p.(Thr723Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995074" "0" "30" "5" "45262531" "45262531" "subst" "0" "01804" "HCN1_000057" "g.45262531G>A" "" "" "" "HCN1(NM_021072.3):c.2165C>T (p.(Pro722Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995075" "0" "50" "5" "45262545" "45262545" "subst" "0" "01804" "HCN1_000058" "g.45262545G>C" "" "" "" "HCN1(NM_021072.3):c.2151C>G (p.(Phe717Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995076" "0" "30" "5" "45262687" "45262687" "subst" "4.06273E-5" "01804" "HCN1_000027" "g.45262687G>A" "" "" "" "HCN1(NM_021072.3):c.2009C>T (p.A670V, p.(Ala670Val)), HCN1(NM_021072.4):c.2009C>T (p.A670V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995077" "0" "50" "5" "45303800" "45303800" "subst" "0" "01804" "HCN1_000059" "g.45303800C>T" "" "" "" "HCN1(NM_021072.3):c.1519G>A (p.(Ala507Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995078" "0" "50" "5" "45695922" "45695922" "subst" "0" "01804" "HCN1_000060" "g.45695922C>G" "" "" "" "HCN1(NM_021072.3):c.274G>C (p.(Gly92Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995079" "0" "30" "5" "45695990" "45695990" "subst" "0" "01804" "HCN1_000061" "g.45695990C>T" "" "" "" "HCN1(NM_021072.3):c.206G>A (p.(Gly69Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995080" "0" "50" "5" "45695995" "45695997" "del" "0" "01804" "HCN1_000062" "g.45695995_45695997del" "" "" "" "HCN1(NM_021072.3):c.201_203delTGG (p.(Gly68del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995081" "0" "50" "5" "45696036" "45696036" "subst" "3.75672E-5" "01804" "HCN1_000063" "g.45696036C>G" "" "" "" "HCN1(NM_021072.3):c.160G>C (p.(Gly54Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014136" "0" "30" "5" "45695986" "45695994" "dup" "0" "02326" "HCN1_000053" "g.45695986_45695994dup" "" "" "" "HCN1(NM_021072.4):c.215_223dupGCGGCGGCG (p.G72_G74dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035235" "0" "50" "5" "45303799" "45303799" "subst" "0" "01804" "HCN1_000064" "g.45303799G>T" "" "" "" "HCN1(NM_021072.4):c.1520C>A (p.(Ala507Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035236" "0" "30" "5" "45695916" "45695916" "subst" "1.68091E-5" "01804" "HCN1_000044" "g.45695916T>C" "" "" "" "HCN1(NM_021072.4):c.280A>G (p.(Met94Val), p.M94V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001051962" "0" "50" "5" "45267265" "45267265" "subst" "0" "01804" "HCN1_000065" "g.45267265T>C" "" "" "" "HCN1(NM_021072.4):c.1709A>G (p.(Asn570Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001064328" "0" "50" "5" "45645453" "45645453" "subst" "0" "02325" "HCN1_000066" "g.45645453G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes HCN1 ## Count = 76 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000096535" "00009203" "50" "2420" "0" "2420" "0" "c.2420C>G" "r.(?)" "p.(Thr807Ser)" "8" "0000188297" "00009203" "00" "1348" "0" "1348" "0" "c.1348C>A" "r.(?)" "p.(Leu450Ile)" "" "0000251975" "00009203" "30" "2038" "0" "2038" "0" "c.2038T>A" "r.(?)" "p.(Ser680Thr)" "" "0000252104" "00009203" "30" "1619" "-3" "1619" "-3" "c.1619-3T>C" "r.spl?" "p.?" "" "0000252416" "00009203" "70" "728" "0" "728" "0" "c.728T>G" "r.(?)" "p.(Met243Arg)" "" "0000285071" "00009203" "30" "1012" "-14" "1012" "-14" "c.1012-14A>G" "r.(=)" "p.(=)" "" "0000285072" "00009203" "10" "1230" "104" "1230" "105" "c.1230+104_1230+105del" "r.(=)" "p.(=)" "" "0000285073" "00009203" "30" "1230" "105" "1230" "105" "c.1230+105del" "r.(=)" "p.(=)" "" "0000285075" "00009203" "30" "1230" "19" "1230" "19" "c.1230+19C>T" "r.(=)" "p.(=)" "" "0000285076" "00009203" "30" "1230" "95" "1230" "95" "c.1230+95A>T" "r.(=)" "p.(=)" "" "0000285077" "00009203" "30" "1231" "-7" "1231" "-7" "c.1231-7C>T" "r.(=)" "p.(=)" "" "0000285078" "00009203" "30" "1618" "29" "1618" "29" "c.1618+29A>G" "r.(=)" "p.(=)" "" "0000285080" "00009203" "30" "425" "81" "425" "81" "c.425+81C>T" "r.(=)" "p.(=)" "" "0000285081" "00009203" "70" "514" "0" "514" "0" "c.514A>C" "r.(?)" "p.(Thr172Pro)" "" "0000285082" "00009203" "10" "849" "167" "849" "167" "c.849+167A>G" "r.(=)" "p.(=)" "" "0000285083" "00009203" "30" "850" "-40" "850" "-40" "c.850-40A>C" "r.(=)" "p.(=)" "" "0000285084" "00009203" "30" "850" "-40" "850" "-40" "c.850-40A>G" "r.(=)" "p.(=)" "" "0000288973" "00009203" "30" "1797" "0" "1797" "0" "c.1797A>G" "r.(?)" "p.(Ser599=)" "" "0000343381" "00009203" "50" "2408" "0" "2408" "0" "c.2408G>C" "r.(?)" "p.(Arg803Thr)" "" "0000346707" "00009203" "50" "1120" "0" "1120" "0" "c.1120A>G" "r.(?)" "p.(Ile374Val)" "" "0000347284" "00009203" "50" "2080" "0" "2080" "0" "c.2080C>A" "r.(?)" "p.(Leu694Met)" "" "0000349325" "00009203" "50" "517" "0" "517" "0" "c.517A>C" "r.(?)" "p.(Thr173Pro)" "" "0000525785" "00009203" "30" "2491" "0" "2491" "0" "c.2491G>A" "r.(?)" "p.(Gly831Ser)" "" "0000525786" "00009203" "50" "2009" "0" "2009" "0" "c.2009C>T" "r.(?)" "p.(Ala670Val)" "" "0000525788" "00009203" "30" "1783" "7" "1783" "7" "c.1783+7dup" "r.(=)" "p.(=)" "" "0000525790" "00009203" "50" "274" "0" "294" "0" "c.274_294dup" "r.(?)" "p.(Gly92_Phe98dup)" "" "0000525791" "00009203" "50" "247" "0" "247" "0" "c.247G>A" "r.(?)" "p.(Asp83Asn)" "" "0000525792" "00009203" "30" "240" "0" "240" "0" "c.240C>A" "r.(?)" "p.(Gly80=)" "" "0000525793" "00009203" "30" "215" "0" "223" "0" "c.215_223del" "r.(?)" "p.(Gly72_Gly74del)" "" "0000525794" "00009203" "30" "215" "0" "223" "0" "c.215_223del" "r.(?)" "p.(Gly72_Gly74del)" "" "0000525795" "00009203" "30" "218" "0" "223" "0" "c.218_223del" "r.(?)" "p.(Gly73_Gly74del)" "" "0000525796" "00009203" "30" "218" "0" "223" "0" "c.218_223del" "r.(?)" "p.(Gly73_Gly74del)" "" "0000525797" "00009203" "10" "218" "0" "223" "0" "c.218_223del" "r.(?)" "p.(Gly73_Gly74del)" "" "0000525799" "00009203" "10" "201" "0" "209" "0" "c.201_209dup" "r.(?)" "p.(Gly72_Gly74dup)" "" "0000525800" "00009203" "50" "140" "0" "140" "0" "c.140G>T" "r.(?)" "p.(Gly47Val)" "" "0000525801" "00009203" "30" "140" "0" "140" "0" "c.140G>T" "r.(?)" "p.(Gly47Val)" "" "0000525802" "00009203" "30" "140" "0" "140" "0" "c.140G>T" "r.(?)" "p.(Gly47Val)" "" "0000525803" "00009203" "10" "140" "0" "140" "0" "c.140G>T" "r.(?)" "p.(Gly47Val)" "" "0000525804" "00009203" "30" "124" "0" "124" "0" "c.124C>T" "r.(?)" "p.(Pro42Ser)" "" "0000525805" "00009203" "30" "124" "0" "124" "0" "c.124C>T" "r.(?)" "p.(Pro42Ser)" "" "0000525806" "00009203" "30" "124" "0" "124" "0" "c.124C>T" "r.(?)" "p.(Pro42Ser)" "" "0000525807" "00009203" "30" "124" "0" "124" "0" "c.124C>T" "r.(?)" "p.(Pro42Ser)" "" "0000609748" "00009203" "50" "2065" "0" "2065" "0" "c.2065dup" "r.(?)" "p.(Gln689ProfsTer78)" "" "0000609751" "00009203" "30" "280" "0" "280" "0" "c.280A>G" "r.(?)" "p.(Met94Val)" "" "0000609752" "00009203" "30" "215" "0" "223" "0" "c.215_223del" "r.(?)" "p.(Gly72_Gly74del)" "" "0000621574" "00009203" "50" "1147" "0" "1147" "0" "c.1147G>A" "r.(?)" "p.(Ala383Thr)" "" "0000677521" "00009203" "30" "240" "0" "240" "0" "c.240C>A" "r.(?)" "p.(Gly80=)" "" "0000720448" "00009203" "50" "1580" "0" "1580" "0" "c.1580G>A" "r.(?)" "p.(Ser527Asn)" "" "0000720449" "00009203" "70" "1171" "0" "1171" "0" "c.1171G>A" "r.(?)" "p.(Gly391Ser)" "" "0000720450" "00009203" "50" "763" "0" "763" "0" "c.763C>T" "r.(?)" "p.(Arg255Cys)" "" "0000759751" "00009203" "50" "908" "0" "908" "0" "c.908G>T" "r.(?)" "p.(Gly303Val)" "" "0000787296" "00009203" "50" "2317" "0" "2317" "0" "c.2317G>C" "r.(?)" "p.(Ala773Pro)" "8" "0000787297" "00009203" "50" "2564" "0" "2564" "0" "c.2564G>T" "r.(?)" "p.(Gly855Val)" "8" "0000787561" "00009203" "50" "1141" "0" "1141" "0" "c.1141G>A" "r.(?)" "p.(Val381Ile)" "4" "0000802123" "00009203" "50" "2038" "0" "2038" "0" "c.2038T>A" "r.(?)" "p.(Ser680Thr)" "" "0000802124" "00009203" "50" "2009" "0" "2009" "0" "c.2009C>T" "r.(?)" "p.(Ala670Val)" "" "0000847688" "00009203" "90" "1171" "0" "1171" "0" "c.1171G>A" "r.(?)" "p.(Gly391Ser)" "" "0000850926" "00009203" "30" "201" "0" "209" "0" "c.201_209dup" "r.(?)" "p.(Gly72_Gly74dup)" "" "0000886883" "00009203" "50" "179" "0" "179" "0" "c.179A>G" "r.(?)" "p.(Lys60Arg)" "" "0000924357" "00009203" "50" "215" "0" "223" "0" "c.215_223dup" "r.(?)" "p.(Gly72_Gly74dup)" "" "0000929087" "00009203" "50" "1558" "0" "1558" "0" "c.1558G>T" "r.(?)" "p.(Ala520Ser)" "" "0000939831" "00009203" "90" "414" "0" "414" "0" "c.414del" "r.(?)" "p.(Tyr138Ter)" "1" "0000995073" "00009203" "50" "2167" "0" "2167" "0" "c.2167A>G" "r.(?)" "p.(Thr723Ala)" "" "0000995074" "00009203" "30" "2165" "0" "2165" "0" "c.2165C>T" "r.(?)" "p.(Pro722Leu)" "" "0000995075" "00009203" "50" "2151" "0" "2151" "0" "c.2151C>G" "r.(?)" "p.(Phe717Leu)" "" "0000995076" "00009203" "30" "2009" "0" "2009" "0" "c.2009C>T" "r.(?)" "p.(Ala670Val)" "" "0000995077" "00009203" "50" "1519" "0" "1519" "0" "c.1519G>A" "r.(?)" "p.(Ala507Thr)" "" "0000995078" "00009203" "50" "274" "0" "274" "0" "c.274G>C" "r.(?)" "p.(Gly92Arg)" "" "0000995079" "00009203" "30" "206" "0" "206" "0" "c.206G>A" "r.(?)" "p.(Gly69Asp)" "" "0000995080" "00009203" "50" "201" "0" "203" "0" "c.201_203del" "r.(?)" "p.(Gly74del)" "" "0000995081" "00009203" "50" "160" "0" "160" "0" "c.160G>C" "r.(?)" "p.(Gly54Arg)" "" "0001014136" "00009203" "30" "215" "0" "223" "0" "c.215_223dup" "r.(?)" "p.(Gly72_Gly74dup)" "" "0001035235" "00009203" "50" "1520" "0" "1520" "0" "c.1520C>A" "r.(?)" "p.(Ala507Asp)" "" "0001035236" "00009203" "30" "280" "0" "280" "0" "c.280A>G" "r.(?)" "p.(Met94Val)" "" "0001051962" "00009203" "50" "1709" "0" "1709" "0" "c.1709A>G" "r.(?)" "p.(Asn570Ser)" "" "0001064328" "00009203" "50" "683" "0" "683" "0" "c.683C>T" "r.(?)" "p.(Ser228Leu)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 8 "{{screeningid}}" "{{variantid}}" "0000064880" "0000096535" "0000117452" "0000188297" "0000360070" "0000759751" "0000375846" "0000787561" "0000375945" "0000787296" "0000375946" "0000787297" "0000410399" "0000847688" "0000441889" "0000939831"