### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = IFITM5) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "IFITM5" "interferon induced transmembrane protein 5" "11" "p15.5" "unknown" "NG_032892.1" "UD_136020392871" "" "https://www.LOVD.nl/IFITM5" "Osteogenesis Imperfecta & Ehlers-Danlos syndrome variant databases \r\nOsteogenesis Imperfecta Federation Europe (OIFE) " "1" "16644" "387733" "614757" "1" "1" "1" "1" "Establishment of the database was supported by the European Community\'s Seventh Framework Programme (FP7/2007-2013) under grant agreement No 200754 - the GEN2PHEN project.\r\nThis database is supported by Osteogenesis Imperfecta Federation Europe (OIFE)" "" "g" "https://databases.lovd.nl/shared/refseq/IFITM5_codingDNA.html" "1" "" "
Osteogenesis Imperfecta Variant Database\r\n
\r\n\r\n
" "-1" "" "-1" "00001" "2012-08-17 00:00:00" "00085" "2022-04-05 12:56:53" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00009821" "IFITM5" "interferon induced transmembrane protein 5" "001" "NM_001025295.2" "" "NP_001020466.1" "" "" "" "-36" "700" "399" "299526" "298200" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "02998" "OI5" "osteogenesis imperfecta, type V (OI5)" "AD" "610967" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-05-16 09:24:20" "05296" "OI" "osteogenesis imperfecta" "" "" "" "" "" "00006" "2017-06-26 22:59:16" "00006" "2025-09-23 21:54:31" "05517" "skeletal dysplasia" "dysplasia, skeletal" "" "" "" "" "" "00006" "2018-11-16 16:43:21" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "IFITM5" "02998" "IFITM5" "05296" ## Individuals ## Do not remove or alter this header ## ## Count = 80 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00299981" "" "" "" "1" "" "03235" "{PMID:Higuchi 2021:33939306}, {DOI:Higuchi 2021:10.1002/mgg3.1675}" "" "F" "" "Japan" "" "0" "" "" "Japanese" "" "00300424" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "F" "" "China" "" "0" "" "" "" "Fam77" "00300425" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "F" "" "China" "" "0" "" "" "" "Fam78" "00300426" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "F" "" "China" "" "0" "" "" "" "Fam79" "00300427" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "M" "" "China" "" "0" "" "" "" "Fam80" "00300428" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "F" "" "China" "" "0" "" "" "" "Fam81" "00300429" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "F" "" "China" "" "0" "" "" "" "Fam82" "00300430" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "M" "" "China" "" "0" "" "" "" "Fam83" "00300431" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "M" "" "China" "" "0" "" "" "" "Fam84" "00300432" "" "" "" "1" "" "00006" "{PMID:Liu 2017:28725987}" "analysis 101 unrelated OI families" "F" "" "China" "" "0" "" "" "" "Fam85" "00327449" "" "" "" "1" "" "00006" "{PMID:Demir 2021:33470886}" "analysis 43 OI patients" "M" "" "Turkey" "" "0" "" "" "" "B34" "00327450" "" "" "" "1" "" "00006" "{PMID:Demir 2021:33470886}" "analysis 43 OI patients" "M" "" "Turkey" "" "0" "" "" "" "B35" "00331486" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "M" "yes" "" "" "0" "" "" "Arab" "13DG1119" "00331487" "" "" "" "1" "" "00000" "{PMID:Maddirevula 2018:29620724}" "isolated case" "F" "yes" "" "" "0" "" "" "Arab" "10DG2178" "00373113" "" "" "" "1" "" "00085" "{PMID:Semler 2012:22863195}" "" "" "" "" "" "0" "" "" "" "Proband 1" "00373114" "" "" "" "1" "" "00085" "{PMID:Semler 2012:22863195}" "" "" "" "" "" "0" "" "" "" "Proband 2" "00373115" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "This patient was subsequently presented again as Patient 1 by {PMID23804581:Kim et al., 2013} and previously as case 12 by {PMID:Lee et al. 2006:16891817}." "" "" "Korea" "" "0" "" "" "" "Family 1 V:1" "00373116" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "This patient was subsequently presented again as Patient 4 by {PMID23804581:Kim et al., 2013} and previously as case 3 by {PMID:Lee et al. 2006:16891817}." "" "" "Korea" "" "0" "" "" "" "Family 2 III:1" "00373117" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "This patient was subsequently presented again as Patient 3 by {PMID23804581:Kim et al., 2013}." "" "" "Korea" "" "0" "" "" "" "Family 3 III:1" "00373118" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "" "" "" "Korea" "" "0" "" "" "" "Family 4 II:1" "00373119" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "" "" "" "Korea" "" "0" "" "" "" "Family 5 II:1" "00373120" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "" "" "" "Korea" "" "0" "" "" "" "Family 6 II:1" "00373121" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "" "" "" "Korea" "" "0" "" "" "" "Family 7 II:1" "00373122" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "" "" "" "Korea" "" "0" "" "" "" "Family 8 II:1" "00373123" "" "" "" "1" "" "00085" "{PMID:Cho 2012:22863190}" "" "" "" "Korea" "" "0" "" "" "" "Family 9 II:1" "00373124" "" "" "" "1" "" "00085" "{PMID:Balasubramanian 2013:23612438}" "The patients daughter (Patient 2) also harbours the same variant." "" "" "" "" "0" "" "" "Europe" "Patient 1" "00373125" "" "" "" "1" "" "00085" "{PMID:Balasubramanian 2013:23612438}" "" "" "" "" "" "0" "" "" "Europe" "Patient 3" "00373126" "" "" "" "1" "" "00085" "{PMID:Balasubramanian 2013:23612438}" "" "" "" "" "" "0" "" "" "Europe" "Patient 4" "00373127" "" "" "" "1" "" "00085" "{PMID:Grover 2013:23674381}" "This patient is the first described having the recurrent OI type V sequence variant but with a different OI type." "" "" "" "" "0" "" "" "Hispanic" "" "00373128" "" "" "" "1" "" "00085" "{PMID:Takagi 2013:23813632}" "" "" "" "Japan" "" "0" "" "" "" "Patient 1" "00373129" "" "" "" "1" "" "00085" "{PMID:Takagi 2013:23813632}" "" "" "" "Japan" "" "0" "" "" "" "Patient 2" "00373130" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "Patient 9 is related to this patient and also harbours the same variant." "" "" "Japan" "" "0" "" "" "" "Patient 5" "00373131" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 10" "00373132" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 11" "00373133" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 12" "00373134" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 13" "00373135" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 14" "00373136" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 15" "00373137" "" "" "" "1" "" "00085" "{PMID:Kim 2013:23804581}" "" "" "" "Korea" "" "0" "" "" "" "Patient 16" "00373138" "" "" "" "1" "" "00085" "{PMID:Zhang 2013:23977282}" "The probands mother also has OI V." "" "" "China" "" "0" "" "" "Han" "F1-II1" "00373139" "" "" "" "1" "" "00085" "{PMID:Zhang 2013:23977282}" "" "" "" "China" "" "0" "" "" "Han" "F2" "00373140" "" "" "" "1" "" "00085" "{PMID:Zhang 2013:23977282}" "" "" "" "China" "" "0" "" "" "Han" "F3" "00373141" "" "" "" "1" "" "00085" "{PMID:Zhang 2013:23977282}" "" "" "" "China" "" "0" "" "" "Han" "F4" "00373142" "" "" "" "1" "" "03864" "{PMID:Guillén-Navarro 2014:24478195}" "This is Patient 2 as described in the paper" "" "" "Lithuania" "" "0" "" "" "" "" "00373143" "" "" "" "1" "" "00085" "{PMID:Rauch 2014:25086671}" "" "" "" "" "" "0" "" "" "" "" "00373144" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "" "" "" "" "" "0" "" "" "" "" "00373145" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "" "" "" "" "" "0" "" "" "" "" "00373146" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "" "" "" "" "" "0" "" "" "" "" "00373147" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "" "" "" "" "" "0" "" "" "" "" "00373148" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "Presence of mRNA carrying the variant was shown by RT-PCR and sequencing of RNA from bone." "" "" "" "" "0" "" "" "" "" "00373149" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "" "" "" "" "" "0" "" "" "" "" "00373150" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "" "" "" "" "" "0" "" "" "" "" "00373151" "" "" "" "1" "" "00085" "{PMID:Lazarus 2014:24674092}" "The patients son (individual 185.4) also harbours the same variant and has OI type V." "" "" "" "" "0" "" "" "" "" "00373152" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-40" "00373153" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-146" "00373154" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-170" "00373155" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-177" "00373156" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-181" "00373157" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-205" "00373158" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-237" "00373159" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-246" "00373160" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-248" "00373161" "" "" "" "1" "" "03894" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "China" "" "0" "" "" "" "PUMC-373" "00373162" "" "" "" "1" "" "03864" "{PMID:Guillén-Navarro 2014:24478195}" "This is Patient 1 as described in the paper" "" "" "Spain" "" "0" "" "" "" "" "00373163" "" "" "" "1" "" "00085" "{PMID:Hoyer-Kuhn 2014:24293101}" "The OI phenotype is described by the authors as severe." "" "" "" "" "0" "" "" "" "" "00373164" "" "" "" "1" "" "00085" "{PMID:Farber 2014:24519609}" "" "" "" "" "" "0" "" "" "" "" "00373165" "" "" "" "1" "" "00085" "{PMID:He 2017:28319678}" "The pregnancy was terminated at 20 weeks due to poor prognosis." "" "" "China" "" "0" "" "" "" "" "00373166" "" "" "" "1" "" "00085" "{PMID:Chandler 2018:29595812}" "" "" "" "" "" "0" "" "" "" "Case 9" "00373167" "" "" "" "1" "" "00085" "{PMID:Rodriguez Celin 2018:30039845}" "The proband is described as having severe OI." "" "" "Argentina" "" "0" "" "" "" "" "00373168" "" "" "" "1" "" "00085" "{PMID:Lim 2019:30985308}" "The probands mother is mosaic for the sequence variant. A second pregnancy was terminated because of multiple prenatal fractures." "" "" "" "" "0" "" "" "" "" "00373169" "" "" "" "1" "" "00085" "{PMID:Nawawi 2019:29807018}" "" "" "" "Malaysia" "" "0" "" "" "" "OI 26" "00431388" "" "" "" "1" "" "04465" "{PMID:Wu 2020:32383316}" "" "F" "no" "China" ">00y" "" "" "" "" "patient" "00431420" "" "" "" "1" "" "04465" "{PMID:Whyte 2020:33360005}" "" "M" "no" "United States" ">29y" "" "" "" "" "Pat1" "00431421" "" "" "" "1" "" "04465" "{PMID:Whyte 2020:33360005}" "" "F" "?" "United States" "51y" "" "" "" "" "Pat2" "00431427" "" "" "" "1" "" "04465" "{PMID:Deng 2021:33935965}" "" "M" "no" "China" ">14y" "" "" "pamidronate, zoledronate, vitamin A, vitamin D, calcium" "Han" "patient" "00432478" "" "" "" "1" "" "04465" "{PMID:Nadyrshina 2022:35052464}" "" "F" "?" "Russia" ">26y" "" "" "" "" "Pat41" "00432479" "" "" "" "1" "" "04465" "{PMID:Nadyrshina 2022:35052464}" "" "M" "?" "Russia" ">10y" "" "" "" "" "Pat42" "00434127" "" "" "" "1" "" "04465" "{PMID:Nadyrshina 2022:3505246}" "" "F" "?" "Russia" ">27y" "0" "" "" "" "Pat40" "00466825" "" "" "" "1" "" "00006" "{PMID:Tuysuz 2022:34902613}" "" "" "" "Turkey" "" "0" "" "" "" "Pat112" "00469862" "" "" "" "1" "" "00006" "{PMID:Jacob 2025:39706863}" "2-generation family, 1 affected, unaffected non-carrier parents" "" "" "India" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 80 "{{individualid}}" "{{diseaseid}}" "00299981" "05296" "00300424" "05296" "00300425" "05296" "00300426" "05296" "00300427" "05296" "00300428" "05296" "00300429" "05296" "00300430" "05296" "00300431" "05296" "00300432" "05296" "00327449" "05296" "00327450" "05296" "00331486" "05517" "00331487" "05517" "00373113" "05296" "00373114" "05296" "00373115" "05296" "00373116" "05296" "00373117" "05296" "00373118" "05296" "00373119" "05296" "00373120" "05296" "00373121" "05296" "00373122" "05296" "00373123" "05296" "00373124" "05296" "00373125" "05296" "00373126" "05296" "00373127" "05296" "00373128" "05296" "00373129" "05296" "00373130" "05296" "00373131" "05296" "00373132" "05296" "00373133" "05296" "00373134" "05296" "00373135" "05296" "00373136" "05296" "00373137" "05296" "00373138" "05296" "00373139" "05296" "00373140" "05296" "00373141" "05296" "00373142" "05296" "00373143" "00198" "00373144" "05296" "00373145" "05296" "00373146" "05296" "00373147" "05296" "00373148" "05296" "00373149" "05296" "00373150" "05296" "00373151" "05296" "00373152" "05296" "00373153" "05296" "00373154" "05296" "00373155" "05296" "00373156" "05296" "00373157" "05296" "00373158" "05296" "00373159" "05296" "00373160" "05296" "00373161" "05296" "00373162" "05296" "00373163" "05296" "00373164" "05296" "00373165" "05296" "00373166" "05296" "00373167" "05296" "00373168" "05296" "00373169" "05296" "00431388" "02998" "00431420" "02998" "00431421" "02998" "00431427" "02998" "00432478" "02998" "00432479" "02998" "00434127" "02998" "00466825" "05296" "00469862" "05517" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 02998, 05296, 05517 ## Count = 78 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000227302" "05296" "00299981" "03235" "Unknown" "26y" "OI-5; no blue sclera (-HP:0000592); no dentinogenesis imperfecta (-HP:0000703); no deafness (-HP:0000365); no deformities lower extremity; recurrent fractures (HP:0002757); bone fragility (-HP:0002659)" "" "" "" "" "" "" "" "" "OI" "osteogenesis imperfecta" "" "0000227732" "05296" "00300424" "00006" "Familial, autosomal dominant" "3y" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type III" "" "0000227733" "05296" "00300425" "00006" "Familial, autosomal dominant" "3y5m" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type III" "" "0000227734" "05296" "00300426" "00006" "Familial, autosomal dominant" "1y10m" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type III" "" "0000227735" "05296" "00300427" "00006" "Familial, autosomal dominant" "14y" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type III" "" "0000227736" "05296" "00300428" "00006" "Familial, autosomal dominant" "1y10m" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type IV" "" "0000227737" "05296" "00300429" "00006" "Familial, autosomal dominant" "29y" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type IV" "" "0000227738" "05296" "00300430" "00006" "Familial, autosomal dominant" "16y" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type I" "" "0000227739" "05296" "00300431" "00006" "Familial, autosomal dominant" "4y10m" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type I" "" "0000227740" "05296" "00300432" "00006" "Familial, autosomal dominant" "12y" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta type III" "" "0000245738" "05296" "00327449" "00006" "Unknown" "1y" "" "" "" "" "" "" "" "" "" "OI-5" "osteogenesis imperfecta" "" "0000245739" "05296" "00327450" "00006" "Isolated (sporadic)" "3y" "" "" "" "" "" "" "" "" "" "OI-5" "osteogenesis imperfecta" "" "0000249678" "05517" "00331486" "00000" "Familial, autosomal dominant" "" "Recurrent fractures" "" "" "" "" "" "" "" "" "Osteogenesis imperfecta and decreased bone density group" "skeletal dysplasia" "" "0000249679" "05517" "00331487" "00000" "Familial, autosomal dominant" "" "Recurrent fractures, Osteopenia, Scoliosis" "" "" "" "" "" "" "" "" "Osteogenesis imperfecta and decreased bone density group" "skeletal dysplasia" "" "0000268389" "05296" "00373113" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268390" "05296" "00373114" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268391" "05296" "00373115" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268392" "05296" "00373116" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268393" "05296" "00373117" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268394" "05296" "00373118" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268395" "05296" "00373119" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268396" "05296" "00373120" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268397" "05296" "00373121" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268398" "05296" "00373122" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268399" "05296" "00373123" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268400" "05296" "00373124" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268401" "05296" "00373125" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268402" "05296" "00373126" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268403" "05296" "00373127" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III/IV" "" "0000268404" "05296" "00373128" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268405" "05296" "00373129" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268406" "05296" "00373130" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268407" "05296" "00373131" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268408" "05296" "00373132" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268409" "05296" "00373133" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268410" "05296" "00373134" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268411" "05296" "00373135" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268412" "05296" "00373136" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268413" "05296" "00373137" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268414" "05296" "00373138" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268415" "05296" "00373139" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268416" "05296" "00373140" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268417" "05296" "00373141" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268418" "05296" "00373142" "03864" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268419" "00198" "00373143" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000268420" "05296" "00373144" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268421" "05296" "00373145" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268422" "05296" "00373146" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268423" "05296" "00373147" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268424" "05296" "00373148" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268425" "05296" "00373149" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268426" "05296" "00373150" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268427" "05296" "00373151" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268428" "05296" "00373152" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268429" "05296" "00373153" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268430" "05296" "00373154" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268431" "05296" "00373155" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268432" "05296" "00373156" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268433" "05296" "00373157" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268434" "05296" "00373158" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268435" "05296" "00373159" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268436" "05296" "00373160" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268437" "05296" "00373161" "03894" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI V" "" "0000268438" "05296" "00373162" "03864" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III/IV" "" "0000268439" "05296" "00373163" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III" "" "0000268440" "05296" "00373164" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI VI" "" "0000268441" "05296" "00373165" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI" "" "0000268442" "05296" "00373166" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI" "" "0000268443" "05296" "00373167" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI" "" "0000268444" "05296" "00373168" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI VI" "" "0000268445" "05296" "00373169" "00085" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "OI III" "" "0000321981" "02998" "00431388" "04465" "Isolated (sporadic)" "00y" "" "" "" "" "" "" "" "" "" "" "" "" "0000322103" "02998" "00431427" "04465" "Isolated (sporadic)" "14y" "" "" "" "" "" "" "" "" "" "" "" "" "0000323040" "02998" "00432478" "04465" "Isolated (sporadic)" "26y" "" "" "" "" "" "" "" "" "" "" "" "" "0000323041" "02998" "00432479" "04465" "Isolated (sporadic)" "10y" "" "" "" "" "" "" "" "" "" "" "" "" "0000324481" "02998" "00434127" "04465" "Isolated (sporadic)" "27y" "" "" "" "" "" "" "" "" "" "" "" "" "0000352188" "05296" "00466825" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "osteogenesis imperfecta" "" "0000355007" "05517" "00469862" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "OI5" "skeletal dysplasia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 80 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000301097" "00299981" "1" "03235" "00006" "2020-04-22 15:48:57" "" "" "SEQ" "DNA" "" "" "0000301545" "00300424" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301546" "00300425" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301547" "00300426" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301548" "00300427" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301549" "00300428" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301550" "00300429" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301551" "00300430" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301552" "00300431" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000301553" "00300432" "1" "00006" "00006" "2020-05-01 16:46:56" "" "" "SEQ-NG" "DNA" "" "targeted 14-gene panel OI" "0000328661" "00327449" "1" "00006" "00006" "2021-01-21 13:10:01" "" "" "SEQ;SEQ-NG" "DNA" "" "57-gene panel" "0000328662" "00327450" "1" "00006" "00006" "2021-01-21 13:10:01" "" "" "SEQ;SEQ-NG" "DNA" "" "57-gene panel" "0000332705" "00331486" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000332706" "00331487" "1" "00000" "00006" "2021-02-11 15:29:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000374347" "00373113" "1" "00085" "00085" "2012-08-17 13:28:30" "" "" "PCR;SEQ" "DNA" "" "" "0000374348" "00373114" "1" "00085" "00085" "2012-08-17 13:36:51" "" "" "PCR;SEQ" "DNA" "" "" "0000374349" "00373115" "1" "00085" "00085" "2012-08-17 14:03:36" "00085" "2013-07-24 11:06:05" "PCR;SEQ" "DNA" "" "" "0000374350" "00373116" "1" "00085" "00085" "2012-08-17 14:05:51" "00085" "2013-07-24 11:12:14" "PCR;SEQ" "DNA" "" "" "0000374351" "00373117" "1" "00085" "00085" "2012-08-17 14:07:19" "00085" "2013-07-24 11:01:56" "PCR;SEQ" "DNA" "" "" "0000374352" "00373118" "1" "00085" "00085" "2012-08-17 14:08:50" "" "" "PCR;SEQ" "DNA" "" "" "0000374353" "00373119" "1" "00085" "00085" "2012-08-17 14:10:32" "" "" "PCR;SEQ" "DNA" "" "" "0000374354" "00373120" "1" "00085" "00085" "2012-08-17 14:15:34" "" "" "PCR;SEQ" "DNA" "" "" "0000374355" "00373121" "1" "00085" "00085" "2012-08-17 14:16:58" "" "" "PCR;SEQ" "DNA" "" "" "0000374356" "00373122" "1" "00085" "00085" "2012-08-17 14:18:18" "" "" "PCR;SEQ" "DNA" "" "" "0000374357" "00373123" "1" "00085" "00085" "2012-08-17 14:20:13" "" "" "PCR;SEQ" "DNA" "" "" "0000374358" "00373124" "1" "00085" "00085" "2013-04-29 13:14:36" "00085" "2013-04-29 15:53:26" "PCR;SEQ" "DNA" "" "" "0000374359" "00373125" "1" "00085" "00085" "2013-04-29 13:16:02" "00085" "2013-04-29 15:54:10" "PCR;SEQ" "DNA" "" "" "0000374360" "00373126" "1" "00085" "00085" "2013-04-29 13:17:20" "00085" "2013-04-29 15:54:48" "PCR;SEQ" "DNA" "" "" "0000374361" "00373127" "1" "00085" "00085" "2013-05-17 09:07:44" "" "" "PCR;SEQ" "DNA" "" "" "0000374362" "00373128" "1" "00085" "00085" "2013-07-22 15:23:52" "" "" "SEQ" "DNA" "" "" "0000374363" "00373129" "1" "00085" "00085" "2013-07-22 15:25:10" "" "" "SEQ" "DNA" "" "" "0000374364" "00373130" "1" "00085" "00085" "2013-07-24 11:18:30" "00085" "2013-07-24 11:33:39" "SEQ" "DNA" "" "" "0000374365" "00373131" "1" "00085" "00085" "2013-07-24 11:43:41" "" "" "SEQ" "DNA" "" "" "0000374366" "00373132" "1" "00085" "00085" "2013-07-24 11:44:56" "" "" "SEQ" "DNA" "" "" "0000374367" "00373133" "1" "00085" "00085" "2013-07-24 11:46:29" "" "" "SEQ" "DNA" "" "" "0000374368" "00373134" "1" "00085" "00085" "2013-07-24 13:34:30" "" "" "SEQ" "DNA" "" "" "0000374369" "00373135" "1" "00085" "00085" "2013-07-24 13:35:42" "" "" "SEQ" "DNA" "" "" "0000374370" "00373136" "1" "00085" "00085" "2013-07-24 13:36:56" "" "" "SEQ" "DNA" "" "" "0000374371" "00373137" "1" "00085" "00085" "2013-07-24 13:38:16" "" "" "SEQ" "DNA" "" "" "0000374372" "00373138" "1" "00085" "00085" "2013-08-27 11:23:48" "" "" "PCR;SEQ" "DNA" "" "" "0000374373" "00373139" "1" "00085" "00085" "2013-08-27 11:25:24" "" "" "PCR;SEQ" "DNA" "" "" "0000374374" "00373140" "1" "00085" "00085" "2013-08-27 11:26:53" "" "" "PCR;SEQ" "DNA" "" "" "0000374375" "00373141" "1" "00085" "00085" "2013-08-27 11:28:13" "" "" "PCR;SEQ" "DNA" "" "" "0000374376" "00373142" "1" "03864" "03864" "2013-11-06 16:11:55" "00085" "2014-02-03 09:12:49" "SEQ" "DNA" "" "" "0000374377" "00373143" "1" "00085" "00085" "2014-08-05 12:58:26" "00085" "2014-08-05 13:58:47" "PCRm;SEQ" "DNA" "" "" "0000374378" "00373144" "1" "00085" "00085" "2015-12-18 11:48:29" "" "" "PCR;SEQ" "DNA" "" "" "0000374379" "00373145" "1" "00085" "00085" "2015-12-18 11:50:01" "" "" "PCR;SEQ" "DNA" "" "" "0000374380" "00373146" "1" "00085" "00085" "2015-12-18 11:53:04" "" "" "PCR;SEQ" "DNA" "" "" "0000374381" "00373147" "1" "00085" "00085" "2015-12-18 11:54:19" "" "" "PCR;SEQ" "DNA" "" "" "0000374382" "00373148" "1" "00085" "00085" "2015-12-18 11:55:38" "00085" "2015-12-18 12:55:06" "PCR;RT-PCR;SEQ" "DNA;RNA" "" "" "0000374383" "00373149" "1" "00085" "00085" "2015-12-18 11:57:07" "" "" "PCR;SEQ" "DNA" "" "" "0000374384" "00373150" "1" "00085" "00085" "2015-12-18 12:39:37" "" "" "PCR;SEQ" "DNA" "" "" "0000374385" "00373151" "1" "00085" "00085" "2015-12-18 12:45:52" "00085" "2015-12-18 14:59:51" "PCR;SEQ" "DNA" "" "" "0000374386" "00373152" "1" "03894" "03894" "2018-09-25 13:02:04" "" "" "PCR;SEQ" "DNA" "" "" "0000374387" "00373153" "1" "03894" "03894" "2018-09-25 13:03:52" "03894" "2018-09-28 08:40:51" "PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000374388" "00373154" "1" "03894" "03894" "2018-09-25 13:05:38" "" "" "PCR;SEQ" "DNA" "" "" "0000374389" "00373155" "1" "03894" "03894" "2018-09-25 13:06:53" "" "" "PCR;SEQ" "DNA" "" "" "0000374390" "00373156" "1" "03894" "03894" "2018-09-25 13:08:02" "03894" "2018-09-28 08:41:49" "PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000374391" "00373157" "1" "03894" "03894" "2018-09-25 13:08:57" "" "" "PCR;SEQ" "DNA" "" "" "0000374392" "00373158" "1" "03894" "03894" "2018-09-25 13:09:55" "" "" "PCR;SEQ" "DNA" "" "" "0000374393" "00373159" "1" "03894" "03894" "2018-09-25 13:10:52" "" "" "PCR;SEQ" "DNA" "" "" "0000374394" "00373160" "1" "03894" "03894" "2018-09-25 13:11:50" "" "" "PCR;SEQ" "DNA" "" "" "0000374395" "00373161" "1" "03894" "03894" "2018-09-25 13:14:43" "" "" "PCR;SEQ" "DNA" "" "" "0000374396" "00373162" "1" "03864" "03864" "2013-11-06 16:08:27" "00085" "2014-02-03 09:11:43" "SEQ" "DNA" "" "" "0000374397" "00373163" "1" "00085" "00085" "2013-12-11 15:31:58" "00085" "2015-04-14 09:19:49" "PCR;SEQ" "DNA" "" "" "0000374398" "00373164" "1" "00085" "00085" "2014-02-13 11:23:02" "00085" "2014-02-13 11:25:16" "SEQ-NG;SEQ" "DNA" "" "exome" "0000374399" "00373165" "1" "00085" "00085" "2017-03-21 10:19:44" "00085" "2017-03-21 10:20:42" "PCR;SEQ;SEQ-NG" "DNA" "" "WES" "0000374400" "00373166" "1" "00085" "00085" "2018-05-31 09:26:21" "" "" "SEQ-NG;PCR;SEQ" "DNA" "" "custom exome panel" "0000374401" "00373167" "1" "00085" "00085" "2018-07-31 14:26:22" "00085" "2018-07-31 14:26:38" "SEQ-NG;SEQ" "DNA" "" "custom gene panel" "0000374402" "00373168" "1" "00085" "00085" "2019-05-01 11:17:20" "" "" "SEQ-NG" "DNA" "" "custom gene panel" "0000374403" "00373169" "1" "00085" "00085" "2019-08-16 10:51:39" "00085" "2019-08-23 14:49:22" "SEQ" "DNA" "" "" "0000432802" "00431388" "1" "04465" "04465" "2023-02-10 14:31:02" "" "" "SEQ-NG" "DNA" "" "whole-exome next-generation sequencing (NGS)" "0000432835" "00431420" "1" "04465" "04465" "2023-02-13 12:56:50" "" "" "SEQ-NG" "DNA" "Periheral blood leukocytes" "" "0000432836" "00431421" "1" "04465" "04465" "2023-02-13 13:01:44" "" "" "SEQ-NG" "DNA" "Peripheral blood leukocytes" "" "0000432948" "00431427" "1" "04465" "04465" "2023-02-14 09:25:45" "" "" "?" "DNA" "blood" "" "0000433920" "00432478" "1" "04465" "04465" "2023-02-23 10:27:27" "" "" "SEQ-NG" "DNA" "whole venous blood" "" "0000433921" "00432479" "1" "04465" "04465" "2023-02-23 10:29:23" "" "" "SEQ-NG" "DNA" "whole venous blood" "" "0000435594" "00434127" "1" "04465" "04465" "2023-03-20 14:47:39" "" "" "SEQ-NG" "DNA" "whole venous blood" "" "0000468489" "00466825" "1" "00006" "00006" "2025-09-24 08:32:06" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000471530" "00469862" "1" "00006" "00006" "2025-11-20 12:33:13" "" "" "SEQ;SEQ-NG" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 71 "{{screeningid}}" "{{geneid}}" "0000301097" "IFITM5" "0000301545" "IFITM5" "0000301546" "IFITM5" "0000301547" "IFITM5" "0000301548" "IFITM5" "0000301549" "IFITM5" "0000301550" "IFITM5" "0000301551" "IFITM5" "0000301552" "IFITM5" "0000301553" "IFITM5" "0000328661" "IFITM5" "0000328662" "IFITM5" "0000332705" "IFITM5" "0000332706" "IFITM5" "0000374347" "IFITM5" "0000374348" "IFITM5" "0000374349" "IFITM5" "0000374350" "IFITM5" "0000374351" "IFITM5" "0000374352" "IFITM5" "0000374353" "IFITM5" "0000374354" "IFITM5" "0000374355" "IFITM5" "0000374356" "IFITM5" "0000374357" "IFITM5" "0000374358" "IFITM5" "0000374359" "IFITM5" "0000374360" "IFITM5" "0000374361" "IFITM5" "0000374362" "IFITM5" "0000374363" "IFITM5" "0000374364" "IFITM5" "0000374365" "IFITM5" "0000374366" "IFITM5" "0000374367" "IFITM5" "0000374368" "IFITM5" "0000374369" "IFITM5" "0000374370" "IFITM5" "0000374371" "IFITM5" "0000374372" "IFITM5" "0000374373" "IFITM5" "0000374374" "IFITM5" "0000374375" "IFITM5" "0000374376" "IFITM5" "0000374377" "IFITM5" "0000374378" "IFITM5" "0000374379" "IFITM5" "0000374380" "IFITM5" "0000374381" "IFITM5" "0000374382" "IFITM5" "0000374383" "IFITM5" "0000374384" "IFITM5" "0000374385" "IFITM5" "0000374386" "IFITM5" "0000374387" "IFITM5" "0000374388" "IFITM5" "0000374389" "IFITM5" "0000374390" "IFITM5" "0000374391" "IFITM5" "0000374392" "IFITM5" "0000374393" "IFITM5" "0000374394" "IFITM5" "0000374395" "IFITM5" "0000374396" "IFITM5" "0000374397" "IFITM5" "0000374398" "IFITM5" "0000374399" "IFITM5" "0000374400" "IFITM5" "0000374401" "IFITM5" "0000374402" "IFITM5" "0000374403" "IFITM5" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 107 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000281480" "0" "10" "11" "299411" "299411" "subst" "0.449645" "02325" "IFITM5_000007" "g.299411C>G" "" "" "" "IFITM5(NM_001025295.3):c.80G>C (p.G27A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.299411C>G" "" "benign" "" "0000283448" "0" "90" "11" "299504" "299504" "subst" "0" "02329" "IFITM5_000001" "g.299504G>A" "" "" "" "IFITM5(NM_001025295.3):c.-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.299504G>A" "" "pathogenic" "" "0000283449" "0" "10" "11" "299411" "299411" "subst" "0.449645" "02329" "IFITM5_000007" "g.299411C>G" "" "" "" "IFITM5(NM_001025295.3):c.80G>C (p.G27A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.299411C>G" "" "benign" "" "0000543734" "0" "50" "11" "293597" "293598" "dup" "0" "01943" "ATHL1_000002" "g.293597_293598dup" "" "" "" "PGGHG(NM_025092.4):c.1481-1_1481insGA" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.293597_293598dup" "" "VUS" "" "0000543735" "0" "30" "11" "293878" "293878" "subst" "0.000550733" "01804" "ATHL1_000003" "g.293878C>T" "" "" "" "ATHL1(NM_025092.4):c.1663C>T (p.(Arg555Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.293878C>T" "" "likely benign" "" "0000543740" "0" "50" "11" "298680" "298680" "subst" "0" "01804" "IFITM5_000006" "g.298680C>T" "" "" "" "IFITM5(NM_001025295.2):c.220G>A (p.(Ala74Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.298680C>T" "" "VUS" "" "0000543741" "0" "10" "11" "299286" "299286" "subst" "0.0116568" "02329" "IFITM5_000005" "g.299286C>T" "" "" "" "IFITM5(NM_001025295.3):c.186+19G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.299286C>T" "" "benign" "" "0000543742" "0" "90" "11" "299372" "299372" "subst" "0" "02327" "IFITM5_000002" "g.299372G>A" "" "" "" "IFITM5(NM_001025295.3):c.119C>T (p.S40L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.299372G>A" "" "pathogenic" "" "0000543743" "0" "30" "11" "299449" "299449" "subst" "0.000472964" "02329" "IFITM5_000004" "g.299449C>T" "" "" "" "IFITM5(NM_001025295.3):c.42G>A (p.T14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.299449C>T" "" "likely benign" "" "0000663992" "0" "90" "11" "299504" "299504" "subst" "0" "03235" "IFITM5_000001" "g.299504G>A" "" "{PMID:Higuchi 2021:33939306}, {DOI:Higuchi 2021:10.1002/mgg3.1675}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "ACMG" "0000664503" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664504" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664505" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664506" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664507" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664508" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664509" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664510" "1" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000664511" "1" "90" "11" "299372" "299372" "subst" "0" "00006" "IFITM5_000002" "g.299372G>A" "1/101 cases OI" "{PMID:Liu 2017:28725987}" "" "" "" "Germline" "" "" "0" "" "" "g.299372G>A" "" "pathogenic (dominant)" "" "0000712620" "0" "70" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "" "{PMID:Demir 2021:33470886}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.299504G>A" "" "likely pathogenic" "" "0000712621" "0" "70" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "" "{PMID:Demir 2021:33470886}" "" "" "" "De novo" "" "" "0" "" "" "g.299504G>A" "" "likely pathogenic" "" "0000723410" "0" "50" "11" "298710" "298710" "subst" "8.65337E-5" "01943" "IFITM5_000009" "g.298710G>A" "" "" "" "IFITM5(NM_001025295.2):c.190C>T (p.R64*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000723411" "0" "30" "11" "299457" "299457" "subst" "0.000843581" "01804" "IFITM5_000008" "g.299457C>A" "" "" "" "IFITM5(NM_001025295.2):c.34G>T (p.(Ala12Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "" "" "likely benign" "" "0000729987" "0" "90" "11" "299504" "299504" "subst" "0" "00000" "IFITM5_000001" "g.299504G>A" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_001025295.2:c.-14C>T" "" "De novo" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000729988" "0" "90" "11" "299504" "299504" "subst" "0" "00000" "IFITM5_000001" "g.299504G>A" "" "{PMID:Maddirevula 2018:29620724}" "" "NM_001025295.2:c.-14C>T" "" "De novo" "" "" "0" "" "" "g.299504G>A" "" "pathogenic (dominant)" "" "0000785111" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Semler 2012:22863195}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785112" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Semler 2012:22863195}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785113" "11" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785114" "11" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785115" "21" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785116" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785117" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785118" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785119" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785120" "0" "55" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000785121" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Cho 2012:22863190}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785122" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Balasubramanian 2013:23612438}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785123" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Balasubramanian 2013:23612438}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785124" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Balasubramanian 2013:23612438}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785125" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Grover 2013:23674381}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785126" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Takagi 2013:23813632}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785127" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Takagi 2013:23813632}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785128" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785129" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785130" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785131" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785132" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785133" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785134" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785135" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Kim 2013:23804581}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785136" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Zhang 2013:23977282}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785137" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Zhang 2013:23977282}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785138" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Zhang 2013:23977282}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785139" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Zhang 2013:23977282}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785140" "0" "99" "11" "299504" "299504" "subst" "0" "03864" "IFITM5_000001" "g.299504G>A" "" "{PMID:Guillén-Navarro 2014:24478195}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000785141" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Rauch 2014:25086671}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785142" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785143" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785144" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785145" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785146" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785147" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785148" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785149" "0" "99" "11" "299504" "299504" "subst" "0" "00085" "IFITM5_000001" "g.299504G>A" "" "{PMID:Lazarus 2014:24674092}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785150" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785151" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785152" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785153" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785154" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785155" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785156" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785157" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785158" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785159" "0" "95" "11" "299504" "299504" "subst" "0" "03894" "IFITM5_000001" "g.299504G>A" "" "{PMID:Li 2019:30715774}, {DOI:Li 2019:10.1002/humu.23718}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785160" "0" "99" "11" "299372" "299372" "subst" "0" "03864" "IFITM5_000002" "g.299372G>A" "" "{PMID:Guillén-Navarro 2014:24478195}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000785161" "0" "99" "11" "299372" "299372" "subst" "0" "00085" "IFITM5_000002" "g.299372G>A" "" "{PMID:Hoyer-Kuhn 2014:24293101}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785162" "0" "99" "11" "299372" "299372" "subst" "0" "00085" "IFITM5_000002" "g.299372G>A" "" "{PMID:Farber 2014:24519609}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic" "" "0000785163" "0" "99" "11" "299372" "299372" "subst" "0" "00085" "IFITM5_000002" "g.299372G>A" "" "{PMID:He 2017:28319678}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785164" "0" "99" "11" "299372" "299372" "subst" "0" "00085" "IFITM5_000002" "g.299372G>A" "" "{PMID:Chandler 2018:29595812}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785165" "0" "99" "11" "299372" "299372" "subst" "0" "00085" "IFITM5_000002" "g.299372G>A" "" "{PMID:Rodriguez Celin 2018:30039845}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785166" "21" "99" "11" "299372" "299372" "subst" "0" "00085" "IFITM5_000002" "g.299372G>A" "" "{PMID:Lim 2019:30985308}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000785167" "0" "93" "11" "299493" "299493" "dup" "0" "00085" "IFITM5_000003" "g.299493dup" "" "{PMID:Nawawi et al., 2019:29807018}" "" "c.-1_0insC" "There is no evidence that the variant alters RNA splicing, RNA folding, or translation initiation." "Germline" "" "" "0" "" "" "g.299493dup" "" "likely benign" "" "0000889796" "0" "90" "11" "299504" "299504" "subst" "0" "02327" "IFITM5_000001" "g.299504G>A" "" "" "" "IFITM5(NM_001025295.3):c.-14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000913572" "0" "30" "11" "299291" "299291" "subst" "0" "02329" "ATHL1_000004" "g.299291G>A" "" "" "" "IFITM5(NM_001025295.3):c.186+14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000913573" "0" "30" "11" "299436" "299436" "subst" "0" "01804" "ATHL1_000005" "g.299436C>T" "" "" "" "IFITM5(NM_001025295.2):c.55G>A (p.(Gly19Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000918412" "0" "70" "11" "299499" "299499" "subst" "0" "04465" "IFITM5_000010" "g.299499G>T" "" "{PMID:Wu 2020:32383316}" "" "" "" "De novo" "" "" "" "" "" "" "" "likely pathogenic" "" "0000918450" "0" "90" "11" "299504" "299504" "subst" "0" "04465" "IFITM5_000001" "g.299504G>A" "" "{PMID:Whyte 2020:33360005}" "" "" "" "De novo" "" "" "" "" "" "" "" "pathogenic" "" "0000918451" "0" "90" "11" "299504" "299504" "subst" "0" "04465" "IFITM5_000001" "g.299504G>A" "" "{PMID:Whyte 2020:33360005}" "" "" "" "De novo" "" "" "" "" "" "" "" "pathogenic" "" "0000918567" "0" "90" "11" "299504" "299504" "subst" "0" "04465" "IFITM5_000001" "g.299504G>A" "" "{PMID:Deng 2021:33935965}" "" "" "" "De novo" "" "" "" "" "" "" "" "pathogenic" "" "0000919568" "0" "90" "11" "299504" "299504" "subst" "0" "04465" "IFITM5_000001" "g.299504G>A" "" "{PMID:Nadyrshina 2022:3505246}" "" "" "" "De novo" "" "" "" "" "" "" "" "pathogenic" "" "0000919569" "0" "90" "11" "299504" "299504" "subst" "0" "04465" "IFITM5_000001" "g.299504G>A" "" "{PMID:Nadyrshina 2022:3505246}" "" "" "" "De novo" "" "" "" "" "" "" "" "pathogenic" "" "0000920178" "0" "90" "11" "299372" "299372" "subst" "0" "03779" "IFITM5_000002" "g.299372G>A" "" "" "" "" "" "Unknown" "" "rs786201032" "0" "" "" "" "" "pathogenic" "" "0000921618" "0" "90" "11" "299504" "299504" "subst" "0" "04465" "IFITM5_000001" "g.299504G>A" "" "{PMID:Nadyrshina 2022:3505246}" "" "" "" "De novo" "" "" "0" "" "" "g.299504G>A" "" "pathogenic" "" "0000925373" "0" "30" "11" "298622" "298622" "subst" "0.000860136" "02329" "ATHL1_000006" "g.298622G>A" "" "" "" "IFITM5(NM_001025295.3):c.278C>T (p.T93M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925374" "0" "10" "11" "299371" "299371" "subst" "0.00518098" "02329" "ATHL1_000007" "g.299371C>A" "" "" "" "IFITM5(NM_001025295.3):c.120G>T (p.S40=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000929850" "0" "90" "11" "299372" "299372" "subst" "0" "02325" "IFITM5_000002" "g.299372G>A" "" "" "" "IFITM5(NM_001025295.3):c.119C>T (p.S40L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000979542" "0" "50" "11" "299334" "299334" "subst" "6.17867E-5" "01804" "ATHL1_000008" "g.299334C>T" "" "" "" "IFITM5(NM_001025295.3):c.157G>A (p.(Gly53Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979543" "0" "30" "11" "299471" "299471" "subst" "0" "01804" "ATHL1_000009" "g.299471C>T" "" "" "" "IFITM5(NM_001025295.3):c.20G>A (p.(Arg7His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000998984" "0" "50" "11" "298595" "298615" "dup" "0" "01804" "ATHL1_000011" "g.298595_298615dup" "" "" "" "IFITM5(NM_001025295.2):c.287_307dupCGCCACTGCTGCTCCTGGGGC (p.(Pro96_Gly102dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000998985" "0" "50" "11" "299423" "299423" "dup" "0" "01804" "ATHL1_000012" "g.299423dup" "" "" "" "IFITM5(NM_001025295.2):c.70dupC (p.(Leu24fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038421" "0" "50" "11" "298597" "298597" "del" "0" "01804" "ATHL1_000013" "g.298597del" "" "" "" "IFITM5(NM_001025295.3):c.306del (p.(Leu103Trpfs*3))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038422" "0" "50" "11" "299300" "299300" "subst" "0" "01804" "ATHL1_000014" "g.299300C>T" "" "" "" "IFITM5(NM_001025295.3):c.186+5G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001046308" "0" "50" "11" "299399" "299401" "del" "0" "02325" "ATHL1_000015" "g.299399_299401del" "" "" "" "IFITM5(NM_001025295.3):c.93_95delCCC (p.P33del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001048323" "0" "90" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "" "{PMID:Tuysuz 2022:34902613}" "" "" "ACMG PM2, PP3, BP1" "Germline/De novo (untested)" "" "" "0" "" "" "g.299504G>A" "VCV000037143.7" "pathogenic" "" "0001053746" "0" "50" "11" "299391" "299391" "subst" "3.78968E-5" "01804" "ATHL1_000016" "g.299391G>A" "" "" "" "IFITM5(NM_001025295.3):c.100C>T (p.(Arg34*))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001059678" "0" "70" "11" "299504" "299504" "subst" "0" "00006" "IFITM5_000001" "g.299504G>A" "" "{PMID:Jacob 2025:39706863}" "" "" "" "De novo" "" "" "0" "" "" "g.299504G>A" "SCV002054003.1" "likely pathogenic (dominant)" "" "0001065376" "0" "50" "11" "298637" "298637" "subst" "0" "01804" "ATHL1_000017" "g.298637A>G" "" "" "" "IFITM5(NM_001025295.3):c.263T>C (p.(Leu88Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes IFITM5 ## Count = 107 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000281480" "00009821" "10" "80" "0" "80" "0" "c.80G>C" "r.(?)" "p.(Gly27Ala)" "" "0000283448" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(=)" "" "0000283449" "00009821" "10" "80" "0" "80" "0" "c.80G>C" "r.(?)" "p.(Gly27Ala)" "" "0000543734" "00009821" "50" "5305" "0" "5306" "0" "c.*4906_*4907dup" "r.(=)" "p.(=)" "" "0000543735" "00009821" "30" "5022" "0" "5022" "0" "c.*4623G>A" "r.(=)" "p.(=)" "" "0000543740" "00009821" "50" "220" "0" "220" "0" "c.220G>A" "r.(?)" "p.(Ala74Thr)" "" "0000543741" "00009821" "10" "186" "19" "186" "19" "c.186+19G>A" "r.(=)" "p.(=)" "" "0000543742" "00009821" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "" "0000543743" "00009821" "30" "42" "0" "42" "0" "c.42G>A" "r.(?)" "p.(Thr14=)" "" "0000663992" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "" "0000664503" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664504" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664505" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664506" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664507" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664508" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664509" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664510" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000664511" "00009821" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000712620" "00009821" "70" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.?" "" "0000712621" "00009821" "70" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.?" "" "0000723410" "00009821" "50" "190" "0" "190" "0" "c.190C>T" "r.(?)" "p.(Arg64*)" "" "0000723411" "00009821" "30" "34" "0" "34" "0" "c.34G>T" "r.(?)" "p.(Ala12Ser)" "" "0000729987" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(=)" "" "0000729988" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(=)" "" "0000785111" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785112" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785113" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785114" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785115" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785116" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785117" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785118" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785119" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785120" "00009821" "55" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785121" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785122" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785123" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785124" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785125" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785126" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785127" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785128" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785129" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785130" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785131" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785132" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785133" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785134" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785135" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785136" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785137" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785138" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785139" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785140" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785141" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785142" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785143" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785144" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785145" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785146" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785147" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785148" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785149" "00009821" "99" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785150" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785151" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785152" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785153" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785154" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785155" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785156" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785157" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785158" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785159" "00009821" "95" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(Met1ext-5)" "1" "0000785160" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785161" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785162" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785163" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785164" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785165" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785166" "00009821" "99" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "1" "0000785167" "00009821" "93" "-1" "0" "-1" "0" "c.-1dup" "r.(=)" "p.(=)" "1" "0000889796" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(=)" "" "0000913572" "00009821" "30" "186" "14" "186" "14" "c.186+14C>T" "r.(=)" "p.(=)" "" "0000913573" "00009821" "30" "55" "0" "55" "0" "c.55G>A" "r.(?)" "p.(Gly19Ser)" "" "0000918412" "00009821" "70" "-9" "0" "-9" "0" "c.-9C>A" "r.(=)" "p.(=)" "" "0000918450" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(=)" "p.(=)" "" "0000918451" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(=)" "p.(=)" "" "0000918567" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(=)" "p.M1TextM-5" "5′UTR" "0000919568" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(=)" "p.(=)" "" "0000919569" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(=)" "p.(=)" "" "0000920178" "00009821" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "" "0000921618" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.(=)" "" "0000925373" "00009821" "30" "278" "0" "278" "0" "c.278C>T" "r.(?)" "p.(Thr93Met)" "" "0000925374" "00009821" "10" "120" "0" "120" "0" "c.120G>T" "r.(?)" "p.(Ser40=)" "" "0000929850" "00009821" "90" "119" "0" "119" "0" "c.119C>T" "r.(?)" "p.(Ser40Leu)" "" "0000979542" "00009821" "50" "157" "0" "157" "0" "c.157G>A" "r.(?)" "p.(Gly53Ser)" "" "0000979543" "00009821" "30" "20" "0" "20" "0" "c.20G>A" "r.(?)" "p.(Arg7His)" "" "0000998984" "00009821" "50" "287" "0" "307" "0" "c.287_307dup" "r.(?)" "p.(Pro96_Gly102dup)" "" "0000998985" "00009821" "50" "70" "0" "70" "0" "c.70dup" "r.(?)" "p.(Leu24Profs*48)" "" "0001038421" "00009821" "50" "306" "0" "306" "0" "c.306del" "r.(?)" "p.(Leu103Trpfs*3)" "" "0001038422" "00009821" "50" "186" "5" "186" "5" "c.186+5G>A" "r.spl?" "p.?" "" "0001046308" "00009821" "50" "93" "0" "95" "0" "c.93_95del" "r.(?)" "p.(Pro33del)" "" "0001048323" "00009821" "90" "-14" "0" "-14" "0" "c.-14C>T" "r.spl" "p.?" "" "0001053746" "00009821" "50" "100" "0" "100" "0" "c.100C>T" "r.(?)" "p.(Arg34*)" "" "0001059678" "00009821" "70" "-14" "0" "-14" "0" "c.-14C>T" "r.(?)" "p.?" "" "0001065376" "00009821" "50" "263" "0" "263" "0" "c.263T>C" "r.(?)" "p.(Leu88Pro)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 80 "{{screeningid}}" "{{variantid}}" "0000301097" "0000663992" "0000301545" "0000664503" "0000301546" "0000664504" "0000301547" "0000664505" "0000301548" "0000664506" "0000301549" "0000664507" "0000301550" "0000664508" "0000301551" "0000664509" "0000301552" "0000664510" "0000301553" "0000664511" "0000328661" "0000712620" "0000328662" "0000712621" "0000332705" "0000729987" "0000332706" "0000729988" "0000374347" "0000785111" "0000374348" "0000785112" "0000374349" "0000785113" "0000374350" "0000785114" "0000374351" "0000785115" "0000374352" "0000785116" "0000374353" "0000785117" "0000374354" "0000785118" "0000374355" "0000785119" "0000374356" "0000785120" "0000374357" "0000785121" "0000374358" "0000785122" "0000374359" "0000785123" "0000374360" "0000785124" "0000374361" "0000785125" "0000374362" "0000785126" "0000374363" "0000785127" "0000374364" "0000785128" "0000374365" "0000785129" "0000374366" "0000785130" "0000374367" "0000785131" "0000374368" "0000785132" "0000374369" "0000785133" "0000374370" "0000785134" "0000374371" "0000785135" "0000374372" "0000785136" "0000374373" "0000785137" "0000374374" "0000785138" "0000374375" "0000785139" "0000374376" "0000785140" "0000374377" "0000785141" "0000374378" "0000785142" "0000374379" "0000785143" "0000374380" "0000785144" "0000374381" "0000785145" "0000374382" "0000785146" "0000374383" "0000785147" "0000374384" "0000785148" "0000374385" "0000785149" "0000374386" "0000785150" "0000374387" "0000785151" "0000374388" "0000785152" "0000374389" "0000785153" "0000374390" "0000785154" "0000374391" "0000785155" "0000374392" "0000785156" "0000374393" "0000785157" "0000374394" "0000785158" "0000374395" "0000785159" "0000374396" "0000785160" "0000374397" "0000785161" "0000374398" "0000785162" "0000374399" "0000785163" "0000374400" "0000785164" "0000374401" "0000785165" "0000374402" "0000785166" "0000374403" "0000785167" "0000432802" "0000918412" "0000432835" "0000918450" "0000432836" "0000918451" "0000432948" "0000918567" "0000433920" "0000919568" "0000433921" "0000919569" "0000435594" "0000921618" "0000468489" "0001048323" "0000471530" "0001059678"