### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = INPPL1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "INPPL1" "inositol polyphosphate phosphatase-like 1" "11" "q23" "unknown" "NG_023253.2" "UD_132084565292" "" "https://www.LOVD.nl/INPPL1" "" "1" "6080" "3636" "600829" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "" "" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-09-29 15:47:22" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00010059" "INPPL1" "inositol polyphosphate phosphatase-like 1" "001" "NM_001567.3" "" "NP_001558.3" "" "" "" "-147" "4571" "3777" "71935882" "71950191" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 3 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00180" "RRS" "Robinow syndrome, autosomal recessive (RRS)" "AD" "" "" "" "" "00115" "2013-08-28 18:26:52" "00006" "2021-12-10 21:51:32" "00618" "FTHS" "Frank-ter Haar syndrome (FTHS)" "AR" "249420" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-09-29 16:13:42" "01149" "OPSMD" "opsismodysplasia (OPSMD)" "AR" "258480" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-09-29 15:46:56" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "INPPL1" "01149" ## Individuals ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00311872" "" "" "" "1" "" "00006" "{PMID:White 2018:29276006}" "patient" "F" "yes" "" "" "0" "" "" "" "BAB8759/BH9282_1" "00359405" "" "" "" "1" "" "03149" "{PMID:Silveira 2021:34529350}, {DOI:Silveira 2021:10.1002/ajmg.c.31937}" "" "M" "yes" "Brazil" "" "0" "" "" "" "Pat42" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 3 "{{individualid}}" "{{diseaseid}}" "00311872" "00180" "00311872" "00618" "00359405" "01149" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00180, 00618, 01149 ## Count = 2 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000237120" "00180" "00311872" "00006" "Familial, autosomal dominant" "00y00m12d" "12d-prominent forehead, flat occiput, micrognathia, prominent eyes, hypertelorism, downslanting palpebral fissures, flat nasal bridge, nuchal edema, congenital pes equinovarus, congenital atrioventricular septal defect, recurrent respiratory infections; deceased" "" "" "" "" "" "" "" "OPSMD" "Robinow syndrome" "0000237124" "00618" "00311872" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" ## Screenings ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000313044" "00311872" "1" "00006" "00006" "2020-09-29 16:10:21" "" "" "SEQ" "DNA" "" "" "0000360647" "00359405" "1" "03149" "03149" "2021-03-20 18:11:54" "" "" "SEQ-NG-I" "DNA" "" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 2 "{{screeningid}}" "{{geneid}}" "0000313044" "INPPL1" "0000313044" "SH3PXD2B" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 59 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000322412" "0" "50" "11" "71932697" "71932697" "subst" "0.000182725" "01804" "FOLR2_000001" "g.71932697C>T" "" "" "" "FOLR2(NM_000803.4):c.659C>T (p.(Ala220Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.72221653C>T" "" "VUS" "" "0000545655" "0" "30" "11" "71932628" "71932628" "subst" "0" "01804" "FOLR2_000002" "g.71932628G>C" "" "" "" "FOLR2(NM_000803.4):c.590G>C (p.(Ser197Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72221584G>C" "" "likely benign" "" "0000545656" "0" "10" "11" "71936228" "71936255" "del" "0" "02330" "FOLR2_000003" "g.71936228_71936255del" "" "" "" "INPPL1(NM_001567.4):c.182+18_182+45delTCCTTGCGGGCTGGCGTGGACCGGGAGC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72225184_72225211del" "" "benign" "" "0000545657" "0" "50" "11" "71939530" "71939530" "subst" "2.90934E-5" "01804" "INPPL1_000001" "g.71939530C>T" "" "" "" "INPPL1(NM_001567.3):c.385C>T (p.(Arg129Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72228486C>T" "" "VUS" "" "0000545659" "0" "10" "11" "71939905" "71939905" "subst" "0.0180872" "02330" "INPPL1_000003" "g.71939905C>G" "" "" "" "INPPL1(NM_001567.4):c.518+14C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72228861C>G" "" "benign" "" "0000545661" "0" "30" "11" "71940803" "71940803" "subst" "9.7688E-5" "01804" "INPPL1_000005" "g.71940803T>C" "" "" "" "INPPL1(NM_001567.3):c.843+7T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72229759T>C" "" "likely benign" "" "0000545663" "0" "30" "11" "71941033" "71941033" "subst" "0.00923638" "01804" "INPPL1_000007" "g.71941033G>C" "" "" "" "INPPL1(NM_001567.3):c.909G>C (p.(Lys303Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72229989G>C" "" "likely benign" "" "0000545664" "0" "10" "11" "71941212" "71941212" "subst" "0.242649" "02330" "INPPL1_000008" "g.71941212A>G" "" "" "" "INPPL1(NM_001567.4):c.987A>G (p.S329=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72230168A>G" "" "benign" "" "0000545665" "0" "10" "11" "71942104" "71942104" "subst" "0.0242267" "02330" "INPPL1_000009" "g.71942104C>T" "" "" "" "INPPL1(NM_001567.4):c.1368C>T (p.D456=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72231060C>T" "" "benign" "" "0000545666" "0" "10" "11" "71943960" "71943960" "subst" "0.0241882" "02330" "INPPL1_000010" "g.71943960C>A" "" "" "" "INPPL1(NM_001567.4):c.1893C>A (p.L631=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72232916C>A" "" "benign" "" "0000545667" "0" "10" "11" "71943961" "71943961" "subst" "0.024188" "02330" "INPPL1_000011" "g.71943961C>A" "" "" "" "INPPL1(NM_001567.3):c.1894C>A (p.(Leu632Ile)), INPPL1(NM_001567.4):c.1894C>A (p.L632I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72232917C>A" "" "benign" "" "0000545668" "0" "30" "11" "71943961" "71943961" "subst" "0.024188" "01804" "INPPL1_000011" "g.71943961C>A" "" "" "" "INPPL1(NM_001567.3):c.1894C>A (p.(Leu632Ile)), INPPL1(NM_001567.4):c.1894C>A (p.L632I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72232917C>A" "" "likely benign" "" "0000545669" "0" "10" "11" "71945332" "71945332" "subst" "0.0964128" "02330" "INPPL1_000012" "g.71945332A>G" "" "" "" "INPPL1(NM_001567.4):c.2220A>G (p.S740=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72234288A>G" "" "benign" "" "0000545670" "0" "30" "11" "71945564" "71945564" "subst" "0" "01804" "INPPL1_000013" "g.71945564A>C" "" "" "" "INPPL1(NM_001567.3):c.2327-7A>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72234520A>C" "" "likely benign" "" "0000545672" "0" "10" "11" "71946333" "71946333" "subst" "0.0920049" "02330" "INPPL1_000015" "g.71946333T>C" "" "" "" "INPPL1(NM_001567.4):c.2504-7T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72235289T>C" "" "benign" "" "0000545673" "0" "10" "11" "71948536" "71948536" "subst" "0.0959434" "02330" "INPPL1_000016" "g.71948536C>G" "" "" "" "INPPL1(NM_001567.4):c.3248C>G (p.A1083G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72237492C>G" "" "benign" "" "0000545674" "0" "30" "11" "71948605" "71948605" "subst" "0" "01804" "INPPL1_000017" "g.71948605C>A" "" "" "" "INPPL1(NM_001567.3):c.3317C>A (p.(Ala1106Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72237561C>A" "" "likely benign" "" "0000545675" "0" "30" "11" "71949184" "71949184" "subst" "0.000258611" "01943" "INPPL1_000018" "g.71949184G>C" "" "" "" "INPPL1(NM_001567.3):c.3651G>C (p.L1217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72238140G>C" "" "likely benign" "" "0000613691" "0" "30" "11" "71941297" "71941297" "subst" "0.000233524" "01804" "INPPL1_000020" "g.71941297A>G" "" "" "" "INPPL1(NM_001567.3):c.1072A>G (p.T358A, p.(Thr358Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72230253A>G" "" "likely benign" "" "0000622719" "0" "30" "11" "71939397" "71939397" "subst" "2.44294E-5" "01943" "INPPL1_000019" "g.71939397G>A" "" "" "" "INPPL1(NM_001567.3):c.252G>A (p.S84=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72228353G>A" "" "likely benign" "" "0000622720" "0" "30" "11" "71943654" "71943654" "subst" "0.00124114" "02330" "INPPL1_000021" "g.71943654G>A" "" "" "" "INPPL1(NM_001567.4):c.1713-16G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.72232610G>A" "" "likely benign" "" "0000679330" "0" "30" "11" "71941833" "71941833" "subst" "1.63671E-5" "01804" "INPPL1_000022" "g.71941833C>T" "" "" "" "INPPL1(NM_001567.3):c.1198-7C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691187" "0" "30" "11" "71942028" "71942028" "subst" "0.000114578" "02330" "INPPL1_000023" "g.71942028C>T" "" "" "" "INPPL1(NM_001567.4):c.1301-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691188" "0" "30" "11" "71942662" "71942662" "subst" "2.84481E-5" "02330" "INPPL1_000024" "g.71942662A>G" "" "" "" "INPPL1(NM_001567.4):c.1615+3A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691189" "0" "50" "11" "71944734" "71944734" "subst" "0" "01943" "INPPL1_000025" "g.71944734C>T" "" "" "" "INPPL1(NM_001567.3):c.2158C>T (p.P720S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000694770" "3" "90" "11" "71943304" "71943304" "subst" "6.34341E-5" "00006" "INPPL1_000026" "g.71943304G>A" "" "{PMID:White 2018:29276006}" "" "" "" "Germline" "" "" "0" "" "" "g.72232260G>A" "" "pathogenic (recessive)" "" "0000723704" "0" "30" "11" "71952332" "71952332" "subst" "1.39302E-5" "01943" "INPPL1_000027" "g.71952332C>T" "" "" "" "PHOX2A(NM_005169.3):c.219G>A (p.V73=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000760707" "3" "90" "11" "71936122" "71936149" "del" "0" "03149" "INPPL1_000028" "g.71936122_71936149del" "" "{PMID:Silveira 2021:34529350}, {DOI:Silveira 2021:10.1002/ajmg.c.31937}" "" "" "ACMG PP4, PVS1, PM2, PP5" "Germline" "" "" "0" "" "" "g.72225078_72225105del" "" "pathogenic (recessive)" "" "0000805385" "0" "50" "11" "71941297" "71941297" "subst" "0.000233524" "01943" "INPPL1_000020" "g.71941297A>G" "" "" "" "INPPL1(NM_001567.3):c.1072A>G (p.T358A, p.(Thr358Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805386" "0" "50" "11" "71946469" "71946469" "subst" "0.000110318" "01804" "INPPL1_000029" "g.71946469G>A" "" "" "" "INPPL1(NM_001567.3):c.2633G>A (p.(Arg878His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000805387" "0" "30" "11" "71948779" "71948779" "subst" "0.00119682" "01804" "INPPL1_000030" "g.71948779G>A" "" "" "" "INPPL1(NM_001567.3):c.3491G>A (p.(Arg1164Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000805388" "0" "30" "11" "71949118" "71949118" "subst" "0.00112479" "01943" "INPPL1_000031" "g.71949118G>T" "" "" "" "INPPL1(NM_001567.3):c.3585G>T (p.G1195=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000805389" "0" "30" "11" "71952305" "71952305" "subst" "0" "01943" "INPPL1_000032" "g.71952305G>A" "" "" "" "PHOX2A(NM_005169.3):c.246C>T (p.S82=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000862693" "0" "30" "11" "71940703" "71940703" "subst" "6.50042E-5" "01804" "INPPL1_000033" "g.71940703C>G" "" "" "" "INPPL1(NM_001567.3):c.754-4C>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000890166" "0" "30" "11" "71941254" "71941254" "subst" "0.000463708" "02330" "INPPL1_000034" "g.71941254G>A" "" "" "" "INPPL1(NM_001567.4):c.1029G>A (p.L343=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000890167" "0" "50" "11" "71943698" "71943698" "subst" "8.12526E-6" "01804" "INPPL1_000035" "g.71943698C>T" "" "" "" "INPPL1(NM_001567.3):c.1741C>T (p.(Arg581Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890168" "0" "50" "11" "71945658" "71945658" "subst" "0.000117887" "01804" "INPPL1_000036" "g.71945658C>T" "" "" "" "INPPL1(NM_001567.3):c.2414C>T (p.(Thr805Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000890169" "0" "30" "11" "71948206" "71948206" "subst" "2.90599E-5" "01804" "INPPL1_000037" "g.71948206C>T" "" "" "" "INPPL1(NM_001567.3):c.2918C>T (p.(Ala973Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000890170" "0" "30" "11" "71948802" "71948802" "subst" "0.00139315" "01804" "INPPL1_000038" "g.71948802C>T" "" "" "" "INPPL1(NM_001567.3):c.3514C>T (p.(Arg1172Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000925498" "0" "30" "11" "71943374" "71943374" "subst" "0.00146992" "01804" "INPPL1_000039" "g.71943374C>T" "" "" "" "INPPL1(NM_001567.3):c.1706C>T (p.(Thr569Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949795" "0" "30" "11" "71940252" "71940252" "subst" "0.000557862" "01804" "INPPL1_000040" "g.71940252A>G" "" "" "" "INPPL1(NM_001567.3):c.637A>G (p.(Thr213Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949796" "0" "50" "11" "71948839" "71948841" "del" "0" "01804" "INPPL1_000041" "g.71948839_71948841del" "" "" "" "INPPL1(NM_001567.3):c.3547_3549del (p.(Glu1183del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000966569" "0" "90" "11" "71946996" "71946996" "subst" "8.46353E-6" "02325" "INPPL1_000042" "g.71946996C>T" "" "" "" "INPPL1(NM_001567.4):c.2845C>T (p.R949*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000966570" "0" "50" "11" "71951178" "71951193" "del" "0" "01804" "INPPL1_000043" "g.71951178_71951193del" "" "" "" "PHOX2A(NM_005169.3):c.455_470del (p.(Ala152GlyfsTer49))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979868" "0" "50" "11" "71940241" "71940241" "subst" "0.000130861" "01804" "INPPL1_000044" "g.71940241G>A" "" "" "" "INPPL1(NM_001567.4):c.626G>A (p.(Arg209His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979869" "0" "50" "11" "71940602" "71940602" "subst" "0" "01804" "INPPL1_000045" "g.71940602G>A" "" "" "" "INPPL1(NM_001567.4):c.753G>A (p.(Gln251=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000979870" "0" "30" "11" "71942173" "71942173" "subst" "0.000299416" "01804" "INPPL1_000046" "g.71942173C>T" "" "" "" "INPPL1(NM_001567.4):c.1437C>T (p.(Arg479=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000979871" "0" "30" "11" "71943665" "71943665" "subst" "8.13531E-6" "01804" "INPPL1_000047" "g.71943665C>T" "" "" "" "INPPL1(NM_001567.3):c.1713-5C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000999452" "0" "50" "11" "71939413" "71939413" "subst" "3.66632E-5" "01804" "INPPL1_000048" "g.71939413C>T" "" "" "" "INPPL1(NM_001567.3):c.268C>T (p.(Arg90Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038757" "0" "50" "11" "71941312" "71941312" "subst" "4.17509E-6" "01804" "INPPL1_000049" "g.71941312C>T" "" "" "" "INPPL1(NM_001567.4):c.1087C>T (p.(Arg363Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038758" "0" "50" "11" "71941511" "71941511" "subst" "1.63047E-5" "01804" "INPPL1_000050" "g.71941511G>A" "" "" "" "INPPL1(NM_001567.4):c.1196G>A (p.(Arg399Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038759" "0" "30" "11" "71942239" "71942239" "subst" "0" "01804" "INPPL1_000051" "g.71942239G>A" "" "" "" "INPPL1(NM_001567.4):c.1497+6G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038760" "0" "50" "11" "71943759" "71943759" "subst" "0" "01804" "INPPL1_000052" "g.71943759A>G" "" "" "" "INPPL1(NM_001567.4):c.1802A>G (p.(His601Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001038761" "0" "30" "11" "71946182" "71946182" "subst" "0" "01804" "INPPL1_000053" "g.71946182T>G" "" "" "" "INPPL1(NM_001567.4):c.2438T>G (p.(Ile813Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001038762" "0" "50" "11" "71948526" "71948526" "subst" "1.65589E-5" "01804" "INPPL1_000054" "g.71948526C>T" "" "" "" "INPPL1(NM_001567.4):c.3238C>T (p.(Arg1080Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053990" "0" "50" "11" "71941028" "71941028" "subst" "3.65738E-5" "01804" "INPPL1_000055" "g.71941028C>T" "" "" "" "INPPL1(NM_001567.4):c.904C>T (p.(Arg302Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053991" "0" "50" "11" "71941485" "71941485" "subst" "0" "01804" "INPPL1_000056" "g.71941485C>T" "" "" "" "INPPL1(NM_001567.4):c.1170C>T (p.(Arg390=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053992" "0" "50" "11" "71944753" "71944753" "subst" "0" "01804" "INPPL1_000057" "g.71944753A>G" "" "" "" "INPPL1(NM_001567.4):c.2177A>G (p.(Glu726Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001053993" "0" "50" "11" "71948794" "71948794" "subst" "0.000217343" "01804" "INPPL1_000058" "g.71948794C>A" "" "" "" "INPPL1(NM_001567.4):c.3506C>A (p.(Pro1169His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes INPPL1 ## Count = 59 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000322412" "00010059" "50" "-3332" "0" "-3332" "0" "c.-3332C>T" "r.(?)" "p.(=)" "" "0000545655" "00010059" "30" "-3401" "0" "-3401" "0" "c.-3401G>C" "r.(?)" "p.(=)" "" "0000545656" "00010059" "10" "182" "18" "182" "45" "c.182+18_182+45del" "r.(=)" "p.(=)" "" "0000545657" "00010059" "50" "385" "0" "385" "0" "c.385C>T" "r.(?)" "p.(Arg129Trp)" "" "0000545659" "00010059" "10" "518" "14" "518" "14" "c.518+14C>G" "r.(=)" "p.(=)" "" "0000545661" "00010059" "30" "843" "7" "843" "7" "c.843+7T>C" "r.(=)" "p.(=)" "" "0000545663" "00010059" "30" "909" "0" "909" "0" "c.909G>C" "r.(?)" "p.(Lys303Asn)" "" "0000545664" "00010059" "10" "987" "0" "987" "0" "c.987A>G" "r.(?)" "p.(Ser329=)" "" "0000545665" "00010059" "10" "1368" "0" "1368" "0" "c.1368C>T" "r.(?)" "p.(Asp456=)" "" "0000545666" "00010059" "10" "1893" "0" "1893" "0" "c.1893C>A" "r.(?)" "p.(Leu631=)" "" "0000545667" "00010059" "10" "1894" "0" "1894" "0" "c.1894C>A" "r.(?)" "p.(Leu632Ile)" "" "0000545668" "00010059" "30" "1894" "0" "1894" "0" "c.1894C>A" "r.(?)" "p.(Leu632Ile)" "" "0000545669" "00010059" "10" "2220" "0" "2220" "0" "c.2220A>G" "r.(?)" "p.(Ser740=)" "" "0000545670" "00010059" "30" "2327" "-7" "2327" "-7" "c.2327-7A>C" "r.(=)" "p.(=)" "" "0000545672" "00010059" "10" "2504" "-7" "2504" "-7" "c.2504-7T>C" "r.(=)" "p.(=)" "" "0000545673" "00010059" "10" "3248" "0" "3248" "0" "c.3248C>G" "r.(?)" "p.(Ala1083Gly)" "" "0000545674" "00010059" "30" "3317" "0" "3317" "0" "c.3317C>A" "r.(?)" "p.(Ala1106Asp)" "" "0000545675" "00010059" "30" "3651" "0" "3651" "0" "c.3651G>C" "r.(?)" "p.(Leu1217=)" "" "0000613691" "00010059" "30" "1072" "0" "1072" "0" "c.1072A>G" "r.(?)" "p.(Thr358Ala)" "" "0000622719" "00010059" "30" "252" "0" "252" "0" "c.252G>A" "r.(?)" "p.(Ser84=)" "" "0000622720" "00010059" "30" "1713" "-16" "1713" "-16" "c.1713-16G>A" "r.(=)" "p.(=)" "" "0000679330" "00010059" "30" "1198" "-7" "1198" "-7" "c.1198-7C>T" "r.(=)" "p.(=)" "" "0000691187" "00010059" "30" "1301" "-9" "1301" "-9" "c.1301-9C>T" "r.(=)" "p.(=)" "" "0000691188" "00010059" "30" "1615" "3" "1615" "3" "c.1615+3A>G" "r.spl?" "p.?" "" "0000691189" "00010059" "50" "2158" "0" "2158" "0" "c.2158C>T" "r.(?)" "p.(Pro720Ser)" "" "0000694770" "00010059" "90" "1636" "0" "1636" "0" "c.1636G>A" "r.(?)" "p.(Val546Ile)" "" "0000723704" "00010059" "30" "6712" "0" "6712" "0" "c.*2935C>T" "r.(=)" "p.(=)" "" "0000760707" "00010059" "90" "94" "0" "121" "0" "c.94_121del" "r.(?)" "p.(Glu32Metfs*77)" "1" "0000805385" "00010059" "50" "1072" "0" "1072" "0" "c.1072A>G" "r.(?)" "p.(Thr358Ala)" "" "0000805386" "00010059" "50" "2633" "0" "2633" "0" "c.2633G>A" "r.(?)" "p.(Arg878His)" "" "0000805387" "00010059" "30" "3491" "0" "3491" "0" "c.3491G>A" "r.(?)" "p.(Arg1164Gln)" "" "0000805388" "00010059" "30" "3585" "0" "3585" "0" "c.3585G>T" "r.(?)" "p.(Gly1195=)" "" "0000805389" "00010059" "30" "6685" "0" "6685" "0" "c.*2908G>A" "r.(=)" "p.(=)" "" "0000862693" "00010059" "30" "754" "-4" "754" "-4" "c.754-4C>G" "r.spl?" "p.?" "" "0000890166" "00010059" "30" "1029" "0" "1029" "0" "c.1029G>A" "r.(?)" "p.(Leu343=)" "" "0000890167" "00010059" "50" "1741" "0" "1741" "0" "c.1741C>T" "r.(?)" "p.(Arg581Trp)" "" "0000890168" "00010059" "50" "2414" "0" "2414" "0" "c.2414C>T" "r.(?)" "p.(Thr805Met)" "" "0000890169" "00010059" "30" "2918" "0" "2918" "0" "c.2918C>T" "r.(?)" "p.(Ala973Val)" "" "0000890170" "00010059" "30" "3514" "0" "3514" "0" "c.3514C>T" "r.(?)" "p.(Arg1172Cys)" "" "0000925498" "00010059" "30" "1706" "0" "1706" "0" "c.1706C>T" "r.(?)" "p.(Thr569Met)" "" "0000949795" "00010059" "30" "637" "0" "637" "0" "c.637A>G" "r.(?)" "p.(Thr213Ala)" "" "0000949796" "00010059" "50" "3551" "0" "3552" "1" "c.3551_3552+1del" "r.spl?" "p.?" "" "0000966569" "00010059" "90" "2845" "0" "2845" "0" "c.2845C>T" "r.(?)" "p.(Arg949*)" "" "0000966570" "00010059" "50" "5558" "0" "5573" "0" "c.*1781_*1796del" "r.(=)" "p.(=)" "" "0000979868" "00010059" "50" "626" "0" "626" "0" "c.626G>A" "r.(?)" "p.(Arg209His)" "" "0000979869" "00010059" "50" "753" "0" "753" "0" "c.753G>A" "r.(?)" "p.(=)" "" "0000979870" "00010059" "30" "1437" "0" "1437" "0" "c.1437C>T" "r.(?)" "p.(=)" "" "0000979871" "00010059" "30" "1713" "-5" "1713" "-5" "c.1713-5C>T" "r.spl?" "p.?" "" "0000999452" "00010059" "50" "268" "0" "268" "0" "c.268C>T" "r.(?)" "p.(Arg90Cys)" "" "0001038757" "00010059" "50" "1087" "0" "1087" "0" "c.1087C>T" "r.(?)" "p.(Arg363Cys)" "" "0001038758" "00010059" "50" "1196" "0" "1196" "0" "c.1196G>A" "r.(?)" "p.(Arg399Gln)" "" "0001038759" "00010059" "30" "1497" "6" "1497" "6" "c.1497+6G>A" "r.(=)" "p.(=)" "" "0001038760" "00010059" "50" "1802" "0" "1802" "0" "c.1802A>G" "r.(?)" "p.(His601Arg)" "" "0001038761" "00010059" "30" "2438" "0" "2438" "0" "c.2438T>G" "r.(?)" "p.(Ile813Ser)" "" "0001038762" "00010059" "50" "3238" "0" "3238" "0" "c.3238C>T" "r.(?)" "p.(Arg1080Cys)" "" "0001053990" "00010059" "50" "904" "0" "904" "0" "c.904C>T" "r.(?)" "p.(Arg302Cys)" "" "0001053991" "00010059" "50" "1170" "0" "1170" "0" "c.1170C>T" "r.(?)" "p.(=)" "" "0001053992" "00010059" "50" "2177" "0" "2177" "0" "c.2177A>G" "r.(?)" "p.(Glu726Gly)" "" "0001053993" "00010059" "50" "3506" "0" "3506" "0" "c.3506C>A" "r.(?)" "p.(Pro1169His)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 2 "{{screeningid}}" "{{variantid}}" "0000313044" "0000694770" "0000360647" "0000760707"