### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = IRF2BPL) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "IRF2BPL" "interferon regulatory factor 2 binding protein-like" "14" "q24.3" "unknown" "NC_000014.8" "UD_136019450919" "" "https://www.LOVD.nl/IRF2BPL" "" "1" "14282" "64207" "611720" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was performed by Johan den Dunnen, supported by Global Variome." "" "g" "https://databases.lovd.nl/shared/refseq/IRF2BPL_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2020-07-06 11:08:17" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00010135" "IRF2BPL" "interferon regulatory factor 2 binding protein-like" "001" "NM_024496.3" "" "NP_078772.1" "" "" "" "-907" "3250" "2391" "77495042" "77490886" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01424" "VMD" "dystrophy, macular, vitelliform (VMD)" "" "" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2020-07-06 09:48:47" "04225" "-" "neurodegeneration" "" "" "" "" "" "00006" "2015-03-13 20:14:29" "" "" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "05220" "SIHIWES" "Sifrim-Hitz-Weiss syndrome (SIHIWES)" "AD" "617159" "" "global developmental delay, mild to moderate intellectual disability, brain anomalies, congenital heart defects, dysmorphic features, frequent macrocephaly" "" "00006" "2017-02-08 20:54:40" "00006" "2025-01-28 08:32:39" "05611" "NDD" "neurodevelopmental disorder (NDD)" "" "" "" "" "" "00006" "2019-06-19 12:27:20" "00006" "2024-12-13 11:12:21" "05778" "NEDAMSS" "neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures (NEDAMSS)" "AD" "618088" "" "" "" "00006" "2020-07-05 09:16:03" "" "" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "IRF2BPL" "05778" ## Individuals ## Do not remove or alter this header ## ## Count = 39 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00226110" "" "" "" "1" "" "01469" "{PMID:Ginevrino 2020:31583567}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "no" "Italy" "" "0" "" "" "" "patient" "00234322" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00288194" "" "" "" "1" "" "00006" "{PMID:Lee 2019:31607746}" "" "" "" "United States" "" "0" "" "" "" "Pat4" "00288198" "" "" "" "1" "" "00006" "{PMID:Lee 2019:31607746}" "" "" "" "United States" "" "0" "" "" "" "Pat8" "00288199" "" "" "" "1" "" "00006" "{PMID:Lee 2019:31607746}" "" "" "" "United States" "" "0" "" "" "" "Pat9" "00305909" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "United States" "" "0" "" "" "" "Pat1" "00305910" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}" "2-generation family, 1 affected, unaffected parents" "F" "no" "Netherlands" "15y" "0" "" "" "" "Pat2" "00305911" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat3" "00305912" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}" "2-generation family, 1 affected, unaffected parents" "F" "" "" "" "0" "" "" "" "Pat4" "00305913" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}, {PMID:Schuermans 2022:35606766}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "Belgium" "" "0" "" "" "" "Pat5;Pat3" "00305914" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat6" "00305915" "" "" "" "1" "" "00006" "{PMID:Marcogliese 2018:30057031}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "Pat7" "00305918" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat1" "00305919" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "Pat2" "00305920" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat3" "00305921" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "Pat4" "00305922" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat5" "00305923" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat6" "00305924" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "Pat7" "00305925" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat8" "00305926" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "" "" "" "0" "" "" "" "Pat9" "00305927" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "Pat10" "00305928" "" "" "" "1" "" "00006" "{PMID:Mau-Them 2019:30166628}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "" "" "" "0" "" "" "" "Pat11" "00305963" "" "" "" "1" "" "00006" "{PMID:Skorvanek 2019:30733140}" "2-generation family, 1 affected, unaffected non-carrier parents" "F" "" "Slovakia (Slovak Republic)" "" "0" "" "" "" "patient" "00305964" "" "" "" "1" "" "00006" "{PMID:Shelkowitz 2019:31432588}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "United States" "" "0" "" "" "" "patient" "00305965" "" "" "" "2" "" "00006" "{PMID:Ganos 2020:31621620}, {PMID:Ganos 2014:24359844}" "2-generation family, affected, mother and son" "F;M" "" "Germany" "" "0" "" "" "" "family" "00305966" "" "" "" "1" "" "00006" "{PMID:Spagnoli 2020:31729144}" "2-generation family, 1 affected, unaffected parents" "M" "" "Italy" "" "0" "" "" "" "patient" "00305967" "" "" "" "1" "" "00006" "{PMID:Prilop 2020:32291157}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Germany" "54y" "0" "" "" "" "patient" "00305980" "" "" "" "1" "" "00006" "{PMID:Johannesen 2020:32427350}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "Denmark" "" "0" "" "" "" "Pat11" "00306768" "" "" "" "1" "" "00006" "contact me for details" "2-generation family, unaffected healthy non-carrier parents" "M" "no" "Germany" "" "0" "yes" "yes" "" "private email" "00325397" "" "" "" "1" "" "00006" "{PMID:Hong 2020:33333793}" "" "F" "" "Taiwan" "" "0" "" "" "" "Pat10" "00363896" "" "" "" "1" "" "01164" "" "" "M" "?" "Bosnia and Herzegovina" "" "0" "" "" "" "179137" "00414015" "" "" "" "1" "" "01164" "" "" "M" "?" "Cameroon" "" "0" "" "" "" "202095" "00419667" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "207216" "00433667" "" "" "" "1" "" "03544" "" "" "" "" "" "" "" "" "" "" "" "00438705" "" "" "" "1" "" "00006" "{PMID:Hamdan 2017:29100083}" "WGS analysis 197 individuals with unexplained DEE (unaffected parents)" "" "" "Canada" "" "0" "" "pharmaco-resistant seizures" "" "HSJ0757" "00464704" "" "" "" "1" "" "00006" "contact me for more details" "" "F" "" "Poland" "" "0" "" "" "" "private email" "00465308" "" "" "" "1" "" "03544" "" "" "M" "-" "- (not applicable)" "" "" "" "" "white" "" "00465312" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 40 "{{individualid}}" "{{diseaseid}}" "00226110" "04225" "00234322" "00198" "00288194" "00198" "00288198" "00198" "00288199" "00198" "00305909" "05611" "00305910" "05611" "00305911" "05611" "00305912" "01424" "00305912" "05611" "00305913" "05611" "00305914" "05611" "00305915" "05611" "00305918" "05611" "00305919" "05611" "00305920" "05611" "00305921" "05611" "00305922" "05611" "00305923" "05611" "00305924" "05611" "00305925" "05611" "00305926" "05611" "00305927" "05611" "00305928" "05611" "00305963" "05611" "00305964" "05611" "00305965" "00198" "00305966" "05611" "00305967" "05611" "00305980" "04270" "00306768" "05611" "00325397" "00198" "00363896" "05220" "00414015" "05778" "00419667" "05778" "00433667" "05778" "00438705" "06906" "00464704" "05611" "00465308" "05611" "00465312" "05611" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01424, 04225, 04270, 05220, 05611, 05778, 06906 ## Count = 39 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000171217" "04225" "00226110" "01469" "Isolated (sporadic)" "10y" "neuronal ceroid lipofuscinosis, progressive tetraparesis, cognitive and motor decline; until 2.5y normal developmental milestones; 2.5y-language; 3.5y-motor regression, frequent falls, loss of manual skills and language abilities;10y-moderate intellectual disability, severe hypopostural spastic-dystonic tetraparesis associated with ballistic-choreic movements, severe dysarthria, drooling, reduced visual acuity both eyes, optic disks normal, electroretinogram normal; no epileptic seizures, awake EEG examination normal background activity with multifocal spike-and-wave complexes on posterior regions bilaterally and marked photoparoxysmal response, during sleep irregular pseudoperiodic polyspike-and-wave complexes; occasional myoclonic jerks limbs; MRI brain 8y/10-unremarkable; electron microscopy skin biopsy enlarged lysosomes containing storage material, including curved tubular aggregates" "" "" "" "" "" "" "" "" "" "NEDAMSS" "neuronal ceroid lipofuscinosis" "" "0000174741" "00198" "00234322" "01807" "Unknown" "" "Parkinsonism (HP:0001300); Dystonia (HP:0001332); Spastic tetraparesis (HP:0001285); Dysarthria (HP:0001260); Loss of speech (HP:0002371)" "" "" "" "" "" "" "" "" "" "" "" "" "0000221931" "00198" "00288194" "00006" "Isolated (sporadic)" "20y" "facial diplegia, nystagmus, flexion contracture, hypertonia, limitation of joint mobility, gastroparesis, dysphagia, cognitive impairment, dysarthria, absent speech, ataxia, spasticity, tetraplegia, inability to walk, myoclonus, slurred speech, cerebral palsy, cerebral atrophy, brainstem morphology" "" "" "" "" "" "" "" "" "" "" "" "" "0000221935" "00198" "00288198" "00006" "Isolated (sporadic)" "8y" "nystagmus, muscular hypotonia, choreoathetosis, hemiparesis, areflexia, muscle weakness, absent speech, failure to thrive, growth delay, dysphagia, developmental regression, aspiration, myopathy, short stature, decreased body weight, cerebral palsy" "" "" "" "" "" "" "" "" "" "" "" "" "0000221936" "00198" "00288199" "00006" "Isolated (sporadic)" "3y" "narrow face, long face, low anterior hairline, facial hypotonia, micrognathia, long eyelashes, myopia, hyperactivity, single transverse palmar crease, hypertrichosis, generalized hypotonia, muscle weakness, polyphagia, overfolding of the superior helices, short finger, overbite, long palm, moderate global developmental delay, blue nevus" "" "" "" "" "" "" "" "" "" "" "" "" "0000231756" "05611" "00305909" "00006" "Isolated (sporadic)" "7y" "no dysmorphisms; speech delay, 15m-first words; 2.5-3y-onset motor regression; meeting milestones for expressive language until 2 years, regression between 4-5 years; 2y-met gross motor skill milestones, 5.5y-wheelchair bound; 3y-met fine milestones, 6.5y-no intentional movements; 4y-mild-mod oropharyngeal dysphagia without aspiration, 6y-silent aspiration and tube feeds; G-tube fed, lost toilet training; ataxia, dystonia, choreoathetosis; bilateral ophthalmoplegia, lower>upper facial nerve palsy, limited up and down gaze; 5.5y-normal deep tendon reflexes; axial hypotonia, 5.5y-walk with significant support, 6.5y-bedridden with no head control; 5.5y-exam suggestive of dysmetria, excessive drooling without evidence of myopathic facies, waxing/waning spasticity; 6y-no intellectual disabilit, 6y-PPVT-4, average range, 4y-Vineland II low average - composite score 71, 4y-DAS GCA 83; 6y-clinical suspicion seizures; EEG 5y-abnormal, diffuse slowing, frequent multifocal interictal spikes and slow wave discharges from L occipital and R temporal lobes; MRI brain 5y-normal" "" "" "" "" "" "" "" "" "" "" "" "" "0000231757" "05611" "00305910" "00006" "Unknown" "15y" "15y-deceased; no dysmorphisms; 5-6y-onset motor regression; speech meeting milestones initially, 7y-dysarthria, 12y-loss of speech; met early gross motor skills milestones, 4m-rolled over, 5m-sit,, 10m-walk, always toe walked; 5y-developing spasticity, 5y-loss of gross motor skills, 9y-wheelchair-bound; 5y-loss of fine motor skills; 10y-dysphagia; 10y-G-tube fed; dystonia present, no ataxia; 11y-dysconjugate gaze; sustained clonus; axial hypotonia, progressive with loss of head control; Babinski present bilaterally; no intellectual disability, cognition appeared intact throughout; epilepsy, no clear clinical seizures but ‘staring spells’ that resolved with Lamictal; EEG 9y/13y-mild background slowing; EEG 9y/1y-normal; MRI brain 8y-‘Bulky’ corpus callosum, mild cerebellar volume loss, large left middle cranial fossa arachnoid cyst, 10y-marked cord thinning on spine" "" "" "" "" "" "" "" "" "" "" "" "" "0000231758" "05611" "00305911" "00006" "Isolated (sporadic)" "20y" "no dysmorphisms; 5-6y-onset motor regression; 10y-lack of speech; 5y-stumbling and difficulty with ambulation, 10y-unable to walk unsupported; 7y-loss of skills started, 13y-severe contractures with inability to use hands; 8y-drooling, 10y-feeding problems and progressive dysphagia; 13y-G-tube dependent, 10y-lost continence; 6y-ataxic gait; 7y-nystagmus, 11y-dysconjugate gaze; 7y-increased deep tendon reflexes; dysarthria, spasticity, cerebellar signs (dysmetria, slow heel to shin, broad stance), 7y-positive Romberg and Babinksi; 20y-Vineland 3rd edition with significant delays across domains; epilepsy, 10y-myoclonus; EEG 13y-normal; MRI brain 7y-normal, 13y-diffuse cerebral atrophy, 20y-severe cerebral volume loss" "" "" "" "" "" "" "" "" "" "" "" "" "0000231759" "05611" "00305912" "00006" "Unknown" "16y" "no dysmorphisms; motor regression present (age onset unknown); 12y-single words; unsteady gait, clumsy, 12y-mostly wheelchair-bound; 12y-loss of fine motor skills; excessive drooling; 12y-lost continence; 15y-lower extremity dystonia; bilateral ptosis, macular degeneration; 12y-poor balance; Bracken Basics Concepts III Receptive and School Readiness Composite, Conner’s Parent Rating Scale, 6y-Child Behavior Checklist intellectual functioning at approximately 1-3 year level; 13y-epilepsy, spells that consist of falling that last about 1 min; EEG 6.5y-no electrographic or electroclinical sz, but photic stim produced photoconvulsive response, 13y-moderately abnormal - recorded photo myoclonic sz during intermittent photic stim, generalized interictal epileptiform features, sleep architecture was additionally somewhat disrupted with high-voltage rhythmic delta; MRI brain 6y-normal, 13y-normal, 15y-thin corpus callosum but overall within normal limits, MRI brain 13y-spine normal, 15y-spine normal" "" "" "" "" "" "" "" "" "" "NDD;VMD2" "" "" "0000231760" "05611" "00305913" "00006" "Isolated (sporadic)" "43y" "kyphoscoliosis with gibbus, ogival palate; 5-10y-onset motor regressio, 15y-severe motor problems; 11m-first words, 5y-speech skills at level of 2.5y, expressive language problems, dysarthria; 28y-wheelchair-bound; 35y-dysphagia with aspiration and esophageal reflux; completely dependent, wheelchair bound; ataxia, choreoathetosis, generalized dystonia; divergent strabismus, mild proptosis; hyperreflexia; axial hypotonia; intellectual disability (first years); 13.5m-febrile seizures, photosensitive epilepsy, myoclonic epilepsy; EEG 10y-abnormal, 13y-diffuse slowing, bilateral generalized bursts of spikes and waves and polyspikes; MRI brain 34y-atrophy (cerebral, cerebellar, brainstem, corpus callosum); muscle biopsy normal" "" "" "" "" "" "" "" "" "" "" "" "" "0000231761" "05611" "00305914" "00006" "Isolated (sporadic)" "11y" "no dysmorphisms; no motor regression; essentially non-verbal; 17-23m-walk, had motor delays, but no frank regression, 11y-fully ambulatory with no assistive devices, normal stance and gait, tandem and reciprocal; 11y-impaired skills - working on grasping pen and writing; normal oromotor skills; 9.5y-not fully toilet trained; no movement abnormalities; esotropia left eye; normal deep tendon reflexes; axial hypotonia, normal strength; 14m-seizures diagnosed, myoclonic and atonic seizures, absence seizures; EEG 6y-abnormal with generalized spike and wave; MRI brain 11y-probable Rathke’s cyst, otherwise normal" "" "" "" "" "" "" "" "" "" "" "" "" "0000231762" "05611" "00305915" "00006" "Isolated (sporadic)" "2y6m" "round face, epicanthal folds, mild telecanthus, almond-shaped eyes, slightly upturned nares; no frank motor regression, 6m-some slowing of developmental gains, with onset of spasms; 2y2m-20 single words, mostly repeats what others say, uses signs to communicate; 2y2m-walking easily up and down stairs, starting to run; 2y2m-fine motor skills improving, uses palmar grasp when drawing; normal oromotor skills; no movement abnormalities; no ocular findings; normal deep tendon reflexes; axial hypotonia; 2y3m-neurocognitive testing 9%ile over all cognitive function 4%ile expressive and receptive language 9-25%ile fine and gross motor; 6m-infantile spasms; EEG 6m/2.5y-abnormal, focal epileptiform discharges, background mild slowing; MRI brain 6m-normal, 2y2m-normal" "" "" "" "" "" "" "" "" "" "" "" "" "0000231766" "05611" "00305918" "00006" "Isolated (sporadic)" "10y5m" "see paper; ..., facial dysmorphism; axial hypotonia; 9m-sit; 12m-walk; speech delay; 2.5y-regression onset; dystonia; ataxia; choreathetosis,vertical occulomotor paralysis, horizontal nystagmus, upper limb tremor; 8.5y-seizures; EEG points and diffuse waves predominating; atrophy; no periventricular anomalies; EMG-motor and sensory neuropathy; muscle biopsy T2 fibers atrophy" "" "" "" "" "" "" "" "" "" "" "" "" "0000231767" "05611" "00305919" "00006" "Isolated (sporadic)" "27y" "see paper; ..., no facial dysmorphism; 12m-walk; speech delay; 22y-lost ambulation; 5-6y-regression onset; no dystonia; no ataxia; pyramidal syndrome; 13y-tonic-clonic seizures; EEG multifocal polyspikes and waves; no atrophy; no periventricular anomalies" "" "" "" "" "" "" "" "" "" "" "" "" "0000231768" "05611" "00305920" "00006" "Isolated (sporadic)" "23y" "see paper; ..., facial dysmorphism; axial hypotonia; 8m-sit; 15m-walk; speech delay; still walking; 17y-regression onset; dystonia; ataxia; pyramidal syndrome, cerebellar dysarthria, slow dysmetric eye saccades; 7m-spasm, myoclonus seizures, 17y-myoclony seizures; EEG spikes and waves; no atrophy; no periventricular anomalies; muscle biopsy normal" "" "" "" "" "" "" "" "" "" "" "" "" "0000231769" "05611" "00305921" "00006" "Isolated (sporadic)" "48y" "see paper; ..., no facial dysmorphism; 9m-walk; 10y-regression onset; ataxia; cerebellar dysmetry; 26y-seizures, 35y-myoclonus seizures; EEG spikes and polyspikes; atrophy; periventricular anomalies; EMG normal; muscle biopsy COX-negative fibers" "" "" "" "" "" "" "" "" "" "" "" "" "0000231770" "05611" "00305922" "00006" "Isolated (sporadic)" "8y" "see paper; ..., facial dysmorphism; axial hypotonia; 6m-sit; 12m-walk; speech delay; 4y-lost ambulation; 2.5y-regression onset; no dystonia; ataxia; pyramidal syndrome, nonverbal, visual tracks, intermittent smiles, dysphagia; no seizure; EEG frequent intermittent polymorphic theta slowing; no atrophy; no periventricular anomalies; EMG normal; muscle biopsy few ragged red fibers, nemalin rods" "" "" "" "" "" "" "" "" "" "" "" "" "0000231771" "05611" "00305923" "00006" "Isolated (sporadic)" "20y" "see paper; ..., no facial dysmorphism; no axial hypotonia; no speech delay; 10y-lost ambulation; 7y-regression onset; dystonia; ataxia; spastic tetraparesis, dysarthria, nystagmus, ophthalmoplegia, dysphagia, myoclonic jerk; no seizure; EEG normal; atrophy" "" "" "" "" "" "" "" "" "" "" "" "" "0000231772" "05611" "00305924" "00006" "Isolated (sporadic)" "10y5m" "see paper; ..., facial dysmorphism; axial hypotonia; not sitting; never walked; speech delay; first months regression onset; no dystonia; ataxia; quadriplegic hypotonic–ataxic tetraparesis, intermittent nystagmus; 2.5m-tonic-clonic seizures; EEG multifocal cerebral hyperexcitability with intermittent delta waves and sharp slow waves, hypsarrhythmia; atrophy; no periventricular anomalies" "" "" "" "" "" "" "" "" "" "" "" "" "0000231773" "05611" "00305925" "00006" "Isolated (sporadic)" "3y" "see paper; ..., no facial dysmorphism; axial hypotonia; 9m-sit; 19m-walk; no speech delay; 3y-regression onset; dystonia; ataxia; ankle spasticity, dysarthria, dysphagia; no seizure; EEG normal" "" "" "" "" "" "" "" "" "" "" "" "" "0000231774" "05611" "00305926" "00006" "Isolated (sporadic)" "5y" "see paper; ..., facial dysmorphism; axial hypotonia; 18m-walk; speech delay; 1y-regression onset; no dystonia; no ataxia; autism; 5y-seizures; EEG frequent centrotemporoparietal spikes alternating left and right, aggravated by sleep; atrophy; periventricular anomalies" "" "" "" "" "" "" "" "" "" "" "" "" "0000231775" "05611" "00305927" "00006" "Isolated (sporadic)" "3y7m" "see paper; ..., facial dysmorphism; axial hypotonia; 11m-sit; 17m-walk; speech delay; no regression; no dystonia; no ataxia; dysphagia; no seizure; no atrophy; no periventricular anomalies" "" "" "" "" "" "" "" "" "" "" "" "" "0000231776" "05611" "00305928" "00006" "Isolated (sporadic)" "2y2m" "see paper; ..., facial dysmorphism; axial hypotonia; not sitting; never walked; speech delay; 6m-regression onset; no dystonia; no ataxia; total spasticity; 6m-West syndrome; EEG at seizures onset, hypsarrhythmia, 1y-diffuse discharge in the left hemisphere, 2.2y-diffuse discharges; atrophy; no periventricular anomalies" "" "" "" "" "" "" "" "" "" "" "" "" "0000231811" "05611" "00305963" "00006" "Isolated (sporadic)" "36y" "see paper; ...,childhood normal motor milestones, 3y-started speaking, mental development slightly delayed, first 3y academic performance sufficient, 11y-progressive mental retardation, 10y-generalized photosensitive and myoclonic epilepsy; 36y-seizures (well controlled with medicati), severe mental retardation, cerebellar syndrome, dysarthria, markedly reduced ocular saccades in both planes associated with insuppressible head movements, generalized choreodystonia, increased tendon reflexes, positive Babinski sign bilaterally; EEG shows irregular theta activity, frequent sharp theta waves, complexes of sharp and slow waves over the left hemisphere with incomplete synchronization" "" "" "" "" "" "" "" "" "" "NEDAMSS" "neurodevelopmental delay" "" "0000231812" "05611" "00305964" "00006" "Isolated (sporadic)" "10y" "see paper; large for gestational age, neo-natal profound hypotonia, dysphagia, feeding intolerance, developmentally little progress since infancy, 4-5m-regression in motor, cognitive, and social–emotional skills, worsening head control, decreased alertness,loss of reciprocal smiling; 10y-poor head control, cannot roll or sit, no speech; early infancy seizures, focal seizures, infantile spasms, tonic-myoclonic seizures seizure refractory to therapy, cardiac issues, gastrointestinal issues, ocular issues; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "NEDAMSS" "neurodevelopmental delay" "" "0000231813" "00198" "00305965" "00006" "Familial, autosomal dominant" "" "see paper; ..., leg-onset generalized dystonia, severe anarthria/aphonia, slow saccades, epilepsy including photic myoclonus; MRI brain mother mild supratentorial and cerebellar brain atrophy, neurophysiology showed axonal and demyelinating neuropathy peroneal and sural nerves" "" "" "" "" "" "" "" "" "" "NEDAMSS" "dystonia" "" "0000231814" "05611" "00305966" "00006" "Unknown" "31y" "see paper; ..., uneventful pregnancy and delivery; infancy developmental delay; 4y-febrile seizure, 16y-afebrile seizure provoked by light stimulation, 17y-myoclonic and myoclonic-tonic seizures involving both upper limbs, sometimes followed by loss of awareness and falling to floor, affected by episodes of instability with frequent falls and myoclonus of non-epileptic origin; EEG paroxysmal abnormalities (sharp-and-slow waves, polyspike-and slow waves) either diffuse or over frontal/temporal regions, increasing during photic stimulation (at low-medium-high frequencies) and upon eye closure, on normal background; speech impairment, hypotonia, increased deep tendon reflexes, cerebellar signs (instability, lack of motor coordination, tremor, ataxia); moderate intellectual disability, psychiatric profile characterized by severe inhibition, anxiety and panic attacks, depression, obsessive–compulsive traits, aggressive bouts" "" "" "" "" "" "" "" "" "" "NEDAMSS" "neurodevelopmental delay" "" "0000231815" "05611" "00305967" "00006" "Isolated (sporadic)" "54y" "see paper; ...; 54y-deceased; normal early developmental milestones.; 6y-bilateral keratoconus requiring corneal transplantation in early adulthood; at school handwriting slow and clumsy; 19y-started walking on toes, mild speech impairment, grasping difficulties, developed progressive gait problems, needed walking aids, 42y-wheelchair-bound; increased eye blinking, repetitive oromandibular grimacing; developed progressively increased muscle tone extremities, unable to speak a few years into the disease; no seizures" "" "" "" "" "" "" "" "" "" "NEDAMSS" "neurodevelopmental delay" "" "0000231826" "04270" "00305980" "00006" "Isolated (sporadic)" "32y" "" "" "" "" "" "" "" "" "" "" "" "multifocal epilepsy" "" "0000232599" "05611" "00306768" "00006" "Isolated (sporadic)" "01y10m" "epilepsy, regression (5m-West Syndrome); seizures stopped after 6w treatment, now able to walk, drink, eat, speaks 3 words, understands 20-30 words, recently developed tics/immature movements vanishing after 2w, slight squint" "" "" "" "" "" "" "" "" "" "NEDAMSS" "neurodevelopmental delay" "" "0000243884" "00198" "00325397" "00006" "Isolated (sporadic)" "" "11y-onset seizures; general seizures" "" "" "12y" "" "" "" "" "" "" "" "developmental epileptic encephalopathy, regressive encephalopathy" "" "0000259234" "05220" "00363896" "01164" "Unknown" "" "Malposition of fingers, foot deformity, exophthalmos, neck oedema, ventriculomegaly, hypogenitalism, undescended testis, cardiac: ASD, VSD, cardiac arrhythmia, heart structurally normal, supraventricular tachycardia, maturation delay according to EEG, cMRI with ventriculomegaly and septa in the ventricles, dysphagia" "" "" "" "" "" "" "" "" "" "" "01mo" "" "0000305929" "05778" "00414015" "01164" "Isolated (sporadic)" "03y" "Tall stature, Delayed speech and language development, Gait imbalance, Postural instability, Tip-toe gait" "" "" "" "" "" "" "" "" "" "" "" "" "0000310948" "05778" "00419667" "01164" "Isolated (sporadic)" "09y" "Neurodevelopmental abnormality, Microcephaly, Cerebral palsy, Seizure, Abnormality of movement, Delayed eruption of permanent teeth" "" "" "" "" "" "" "" "" "" "" "" "" "0000324090" "05778" "00433667" "03544" "Isolated (sporadic)" "" "atypical autism, gait abnormality" "" "" "" "" "" "" "" "" "" "" "" "" "0000328608" "06906" "00438705" "00006" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "developmental and epileptic encephalopathy" "" "0000350687" "05611" "00464704" "00006" "Unknown" "14y" "14y-losing ability to talk, unable to walk without support, tonic-clonic seizures (under control)" "" "" "" "" "" "" "" "" "" "NEDAMSS" "neurodevelopmental disorder" "" "0000350861" "05611" "00465308" "03544" "Isolated (sporadic)" "" "HP:0000164, HP:0001256, HP:0001382, HP:0002474, HP:0032894" "" "" "" "" "" "" "" "" "" "NEDAMSS" "complex neurodevelopmental disorder" "" "0000350865" "05611" "00465312" "03544" "Isolated (sporadic)" "" "HP:0000098, HP:0000708, HP:0000750, HP:0002474, HP:0001249, HP:0002342, HP:0007018" "" "" "" "" "" "" "" "" "" "NEDAMSS" "complex neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 39 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000227181" "00226110" "1" "01469" "01469" "2019-02-26 17:47:21" "" "" "SEQ-NG" "DNA" "" "" "0000235422" "00234322" "1" "01807" "01807" "2019-05-07 14:50:34" "" "" "SEQ" "DNA" "" "" "0000289363" "00288194" "1" "00006" "00006" "2020-02-16 14:03:09" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "fibroblast, blood" "WES" "0000289367" "00288198" "1" "00006" "00006" "2020-02-16 14:03:09" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "blood, fibroblast, muscle" "WES" "0000289368" "00288199" "1" "00006" "00006" "2020-02-16 14:03:09" "" "" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "fibroblast" "WES" "0000307039" "00305909" "1" "00006" "00006" "2020-07-05 16:07:27" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307040" "00305910" "1" "00006" "00006" "2020-07-05 16:07:27" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307041" "00305911" "1" "00006" "00006" "2020-07-05 16:07:27" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307042" "00305912" "1" "00006" "00006" "2020-07-05 16:07:27" "00006" "2020-07-06 09:46:49" "SEQ;SEQ-NG" "DNA" "" "" "0000307043" "00305913" "1" "00006" "00006" "2020-07-05 16:07:27" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307044" "00305914" "1" "00006" "00006" "2020-07-05 16:07:27" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307045" "00305915" "1" "00006" "00006" "2020-07-05 16:07:27" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307049" "00305918" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307050" "00305919" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307051" "00305920" "1" "00006" "00006" "2020-07-05 16:30:04" "00006" "2020-07-05 17:09:50" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000307052" "00305921" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307053" "00305922" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307054" "00305923" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307055" "00305924" "1" "00006" "00006" "2020-07-05 16:30:04" "00006" "2020-07-05 17:10:46" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000307056" "00305925" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307057" "00305926" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307058" "00305927" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307059" "00305928" "1" "00006" "00006" "2020-07-05 16:30:04" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000307093" "00305963" "1" "00006" "00006" "2020-07-06 12:21:39" "" "" "SEQ" "DNA" "" "WES" "0000307094" "00305964" "1" "00006" "00006" "2020-07-06 13:09:41" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000307095" "00305965" "1" "00006" "00006" "2020-07-06 13:21:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000307096" "00305966" "1" "00006" "00006" "2020-07-06 13:48:12" "" "" "SEQ" "DNA" "" "WES" "0000307097" "00305967" "1" "00006" "00006" "2020-07-06 13:56:28" "" "" "SEQ;SEQ-NG" "DNA" "" "WES trio" "0000307110" "00305980" "1" "00006" "00006" "2020-07-06 16:08:38" "" "" "SEQ;SEQ-NG" "DNA" "" "candidate gene panel" "0000307908" "00306768" "1" "00006" "00006" "2020-07-20 10:30:35" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000326608" "00325397" "1" "00006" "00006" "2021-01-02 12:18:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000365124" "00363896" "1" "01164" "01164" "2021-05-03 13:55:49" "" "" "SEQ-NG-I" "DNA" "" "" "0000415298" "00414015" "1" "01164" "01164" "2022-07-26 17:22:52" "" "" "SEQ-NG-I" "DNA" "" "" "0000420971" "00419667" "1" "01164" "01164" "2022-10-20 16:35:41" "" "" "SEQ-NG-I" "DNA" "" "" "0000435125" "00433667" "1" "03544" "03544" "2023-03-12 20:43:44" "" "" "SEQ-NG-I" "DNA" "" "" "0000440187" "00438705" "1" "00006" "00006" "2023-10-21 19:20:17" "00006" "2023-10-21 22:17:41" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000466351" "00464704" "1" "00006" "00006" "2025-04-11 09:59:07" "" "" "SEQ" "DNA" "" "" "0000466956" "00465308" "1" "03544" "03544" "2025-05-10 05:52:32" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" "0000466960" "00465312" "1" "03544" "03544" "2025-05-10 18:15:03" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 33 "{{screeningid}}" "{{geneid}}" "0000289363" "IRF2BPL" "0000289367" "IRF2BPL" "0000289368" "IRF2BPL" "0000307039" "IRF2BPL" "0000307040" "IRF2BPL" "0000307041" "IRF2BPL" "0000307042" "BEST1" "0000307042" "IRF2BPL" "0000307043" "IRF2BPL" "0000307044" "IRF2BPL" "0000307045" "IRF2BPL" "0000307049" "IRF2BPL" "0000307050" "IRF2BPL" "0000307051" "IRF2BPL" "0000307052" "IRF2BPL" "0000307053" "IRF2BPL" "0000307054" "IRF2BPL" "0000307055" "IRF2BPL" "0000307056" "IRF2BPL" "0000307057" "IRF2BPL" "0000307058" "IRF2BPL" "0000307059" "IRF2BPL" "0000307093" "IRF2BPL" "0000307094" "IRF2BPL" "0000307095" "IRF2BPL" "0000307096" "IRF2BPL" "0000307097" "IRF2BPL" "0000307110" "IRF2BPL" "0000326608" "IRF2BPL" "0000365124" "CHD4" "0000365124" "IRF2BPL" "0000415298" "IRF2BPL" "0000420971" "IRF2BPL" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 128 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000323771" "0" "70" "14" "77492357" "77492357" "dup" "0" "01804" "IRF2BPL_000001" "g.77492357dup" "" "" "" "IRF2BPL(NM_024496.3):c.1784dupG (p.(Pro596SerfsTer19))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77026014dup" "" "likely pathogenic" "" "0000323772" "0" "50" "14" "77493791" "77493793" "del" "0" "01804" "IRF2BPL_000002" "g.77493791_77493793del" "" "" "" "IRF2BPL(NM_024496.3):c.369_371del (p.(Gln126del)), IRF2BPL(NM_024496.4):c.372_374delGCA (p.Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77027448_77027450del" "" "VUS" "" "0000323775" "0" "50" "14" "77493788" "77493793" "del" "0" "01804" "IRF2BPL_000004" "g.77493788_77493793del" "" "" "" "IRF2BPL(NM_024496.3):c.366_371del (p.(Gln126_Gln127del)), IRF2BPL(NM_024496.4):c.369_374delGCAGCA (p.Q126_Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77027445_77027450del" "" "VUS" "" "0000323776" "0" "50" "14" "77493787" "77493788" "ins" "0" "01804" "IRF2BPL_000005" "g.77493787_77493788insTTG" "" "" "" "IRF2BPL(NM_024496.3):c.350_351insACA (p.(Gln117dup)), IRF2BPL(NM_024496.4):c.350_351insACA (p.Q127dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.77027444_77027445insTTG" "" "VUS" "" "0000461225" "0" "70" "14" "77493640" "77493646" "del" "0" "01469" "IRF2BPL_000006" "g.77493640_77493646del" "" "{PMID:Ginevrino 2020:31583567}" "" "490_496delGCGGTGG" "" "De novo" "" "" "0" "" "" "g.77027297_77027303del" "" "likely pathogenic (dominant)" "" "0000478176" "0" "70" "14" "77493537" "77493555" "del" "0" "01807" "IRF2BPL_000007" "g.77493537_77493555del" "" "" "" "581_599delGGGGCCCAAACGGCTTCCC" "" "Unknown" "" "" "0" "" "" "g.77027194_77027212del" "" "likely pathogenic" "" "0000553128" "0" "30" "14" "77491933" "77491933" "subst" "0.00112538" "02326" "IRF2BPL_000008" "g.77491933T>A" "" "" "" "IRF2BPL(NM_024496.4):c.2203A>T (p.S735C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77025590T>A" "" "likely benign" "" "0000553129" "0" "30" "14" "77492105" "77492105" "subst" "0.000991944" "02326" "IRF2BPL_000009" "g.77492105C>T" "" "" "" "IRF2BPL(NM_024496.4):c.2031G>A (p.G677=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77025762C>T" "" "likely benign" "" "0000553130" "0" "70" "14" "77492650" "77492650" "subst" "0" "01943" "IRF2BPL_000010" "g.77492650G>A" "" "" "" "IRF2BPL(NM_024496.4):c.1486C>T (p.P496S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77026307G>A" "" "likely pathogenic" "" "0000553131" "0" "30" "14" "77493412" "77493412" "subst" "0.00101551" "02326" "IRF2BPL_000011" "g.77493412G>A" "" "" "" "IRF2BPL(NM_024496.4):c.724C>T (p.P242S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027069G>A" "" "likely benign" "" "0000553132" "0" "30" "14" "77493500" "77493500" "subst" "0.000706291" "02326" "IRF2BPL_000012" "g.77493500G>A" "" "" "" "IRF2BPL(NM_024496.4):c.636C>T (p.N212=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027157G>A" "" "likely benign" "" "0000553133" "0" "30" "14" "77493646" "77493647" "ins" "0" "02326" "IRF2BPL_000013" "g.77493646_77493647insGGC" "" "" "" "IRF2BPL(NM_024496.4):c.491_492insCGC (p.A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027303_77027304insGGC" "" "likely benign" "" "0000553134" "0" "10" "14" "77493647" "77493647" "subst" "0" "01943" "IRF2BPL_000014" "g.77493647A>G" "" "" "" "IRF2BPL(NM_024496.4):c.480_489delCGCCGCCGCTinsCGCCGCCGCC (p.A160_A163=), IRF2BPL(NM_024496.4):c.486_489delCGCTinsCGCC (p.A162_A163=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027304A>G" "" "benign" "" "0000553135" "0" "10" "14" "77493674" "77493676" "del" "0" "01943" "IRF2BPL_000015" "g.77493674_77493676del" "" "" "" "IRF2BPL(NM_024496.4):c.486_488delCGC (p.A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027331_77027333del" "" "benign" "" "0000553137" "0" "10" "14" "77493788" "77493793" "del" "0" "02326" "IRF2BPL_000004" "g.77493788_77493793del" "" "" "" "IRF2BPL(NM_024496.3):c.366_371del (p.(Gln126_Gln127del)), IRF2BPL(NM_024496.4):c.369_374delGCAGCA (p.Q126_Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027445_77027450del" "" "benign" "" "0000553139" "0" "30" "14" "77493794" "77493799" "del" "0" "01804" "IRF2BPL_000017" "g.77493794_77493799del" "" "" "" "IRF2BPL(NM_024496.3):c.342_347del (p.(Gln117_Gln118del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027451_77027456del" "" "likely benign" "" "0000553140" "0" "30" "14" "77493839" "77493839" "subst" "9.03451E-5" "02326" "IRF2BPL_000018" "g.77493839G>A" "" "" "" "IRF2BPL(NM_024496.4):c.297C>T (p.A99=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027496G>A" "" "likely benign" "" "0000553141" "0" "30" "14" "77494130" "77494130" "subst" "0.000838045" "02326" "IRF2BPL_000019" "g.77494130C>G" "" "" "" "IRF2BPL(NM_024496.4):c.6G>C (p.S2=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027787C>G" "" "likely benign" "" "0000615106" "0" "30" "14" "77493749" "77493749" "subst" "0.000601803" "02326" "IRF2BPL_000020" "g.77493749G>A" "" "" "" "IRF2BPL(NM_024496.4):c.387C>T (p.N129=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027406G>A" "" "likely benign" "" "0000615107" "0" "30" "14" "77493790" "77493800" "del" "0" "02326" "IRF2BPL_000021" "g.77493790_77493800del" "" "" "" "IRF2BPL(NM_024496.4):c.336_346delGCAGCAACAGC (p.Q113Afs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027447_77027457del" "" "likely benign" "" "0000615108" "0" "30" "14" "77493809" "77493809" "subst" "0" "02326" "IRF2BPL_000022" "g.77493809C>T" "" "" "" "IRF2BPL(NM_024496.4):c.327G>A (p.Q109=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027466C>T" "" "likely benign" "" "0000623173" "0" "10" "14" "77493842" "77493923" "del" "0" "02325" "IRF2BPL_000023" "g.77493842_77493923del" "" "" "" "IRF2BPL(NM_024496.4):c.224_305del (p.P75Rfs*50)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027499_77027580del" "" "benign" "" "0000645292" "0" "90" "14" "77493574" "77493574" "subst" "0" "00006" "IRF2BPL_000025" "g.77493574G>A" "" "{PMID:Lee 2019:31607746}" "" "" "" "De novo" "" "" "0" "" "" "g.77027231G>A" "{CV:000837716.1}" "pathogenic (dominant)" "" "0000645296" "0" "70" "14" "77493617" "77493617" "subst" "0" "00006" "IRF2BPL_000026" "g.77493617G>C" "" "{PMID:Lee 2019:31607746}" "" "" "" "De novo" "" "" "0" "" "" "g.77027274G>C" "{CV:000837715.1}" "likely pathogenic (dominant)" "" "0000645297" "0" "70" "14" "77492015" "77492015" "del" "0" "00006" "IRF2BPL_000024" "g.77492015del" "" "{PMID:Lee 2019:31607746}" "" "" "" "De novo" "" "" "0" "" "" "g.77025672del" "{CV:000837717.1}" "likely pathogenic (dominant)" "" "0000657495" "0" "30" "14" "77493668" "77493676" "dup" "0" "02325" "IRF2BPL_000027" "g.77493668_77493676dup" "" "" "" "IRF2BPL(NM_024496.4):c.480_488dupCGCCGCCGC (p.A162_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027325_77027333dup" "" "likely benign" "" "0000657496" "0" "10" "14" "77493674" "77493676" "del" "0" "02325" "IRF2BPL_000015" "g.77493674_77493676del" "" "" "" "IRF2BPL(NM_024496.4):c.486_488delCGC (p.A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.77027331_77027333del" "" "benign" "" "0000673578" "1" "90" "14" "77493622" "77493622" "subst" "0" "00006" "IRF2BPL_000034" "g.77493622C>A" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "De novo" "" "" "0" "" "" "g.77027279C>A" "" "pathogenic (dominant)" "" "0000673579" "0" "90" "14" "77493574" "77493574" "subst" "0" "00006" "IRF2BPL_000025" "g.77493574G>A" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77027231G>A" "" "pathogenic (dominant)" "" "0000673580" "0" "90" "14" "77493574" "77493574" "subst" "0" "00006" "IRF2BPL_000025" "g.77493574G>A" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "De novo" "" "" "0" "" "" "g.77027231G>A" "" "pathogenic (dominant)" "" "0000673581" "0" "90" "14" "77493757" "77493757" "subst" "0" "00006" "IRF2BPL_000036" "g.77493757G>A" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77027414G>A" "" "pathogenic (dominant)" "" "0000673582" "0" "90" "14" "77493760" "77493760" "subst" "0" "00006" "IRF2BPL_000028" "g.77493760G>A" "" "{PMID:Marcogliese 2018:30057031}, {PMID:Schuermans 2022:35606766}" "" "" "" "De novo" "" "" "0" "" "" "g.77027417G>A" "" "pathogenic (dominant)" "" "0000673583" "0" "90" "14" "77493021" "77493021" "subst" "0" "00006" "IRF2BPL_000033" "g.77493021G>C" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "De novo" "" "" "0" "" "" "g.77026678G>C" "" "pathogenic (dominant)" "" "0000673584" "0" "90" "14" "77492882" "77492882" "subst" "0" "00006" "IRF2BPL_000032" "g.77492882C>G" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "De novo" "" "" "0" "" "" "g.77026539C>G" "" "pathogenic (dominant)" "" "0000673588" "0" "90" "14" "77493617" "77493617" "subst" "0" "00006" "IRF2BPL_000026" "g.77493617G>C" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77027274G>C" "" "pathogenic (dominant)" "" "0000673589" "0" "90" "14" "77493775" "77493775" "subst" "0" "00006" "IRF2BPL_000037" "g.77493775G>A" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77027432G>A" "" "pathogenic (dominant)" "" "0000673590" "0" "90" "14" "77493760" "77493760" "subst" "0" "00006" "IRF2BPL_000028" "g.77493760G>A" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77027417G>A" "" "pathogenic (dominant)" "" "0000673591" "0" "90" "14" "77493640" "77493640" "subst" "0" "00006" "IRF2BPL_000035" "g.77493640C>A" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77027297C>A" "" "pathogenic (dominant)" "" "0000673592" "0" "90" "14" "77493617" "77493617" "subst" "0" "00006" "IRF2BPL_000026" "g.77493617G>C" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77027274G>C" "" "pathogenic (dominant)" "" "0000673593" "0" "90" "14" "77493574" "77493574" "subst" "0" "00006" "IRF2BPL_000025" "g.77493574G>A" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77027231G>A" "" "pathogenic (dominant)" "" "0000673594" "0" "90" "14" "77493174" "77493174" "del" "0" "00006" "IRF2BPL_000029" "g.77493174del" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77026831del" "" "pathogenic (dominant)" "" "0000673595" "0" "90" "14" "77492014" "77492014" "del" "0" "00006" "IRF2BPL_000024" "g.77492014del" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77025671del" "" "pathogenic (dominant)" "" "0000673596" "0" "90" "14" "77492000" "77492001" "del" "0" "00006" "IRF2BPL_000031" "g.77492000_77492001del" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77025657_77025658del" "" "pathogenic (dominant)" "" "0000673597" "0" "90" "14" "0" "0" "" "0" "00006" "IRF2BPL_000000" "g.?" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (dominant)" "" "0000673598" "0" "90" "14" "77491984" "77491984" "del" "0" "00006" "IRF2BPL_000030" "g.77491984del" "" "{PMID:Mau-Them 2019:30166628}" "" "" "" "De novo" "" "" "0" "" "" "g.77025641del" "" "pathogenic (dominant)" "" "0000673635" "1" "50" "14" "77493552" "77493552" "subst" "8.5563E-6" "00006" "IRF2BPL_000038" "g.77493552C>A" "" "{PMID:Marcogliese 2018:30057031}" "" "" "" "De novo" "" "" "0" "" "" "g.77027209C>A" "" "VUS" "" "0000673658" "0" "90" "14" "77493763" "77493763" "subst" "0" "00006" "IRF2BPL_000039" "g.77493763G>A" "" "{PMID:Skorvanek 2019:30733140}" "" "" "" "De novo" "" "" "0" "" "" "g.77027420G>A" "" "pathogenic (dominant)" "" "0000673659" "0" "90" "14" "77491984" "77491984" "del" "0" "00006" "IRF2BPL_000030" "g.77491984del" "" "{PMID:Shelkowitz 2019:31432588}" "" "2152delT" "" "De novo" "" "" "0" "" "" "g.77025641del" "" "pathogenic (dominant)" "" "0000673660" "21" "90" "14" "77493781" "77493781" "subst" "0" "00006" "IRF2BPL_000040" "g.77493781G>A" "" "{PMID:Ganos 2020:31621620}" "" "" "" "Germline" "" "" "0" "" "" "g.77027438G>A" "" "pathogenic (dominant)" "" "0000673661" "0" "70" "14" "77493769" "77493769" "subst" "0" "00006" "IRF2BPL_000041" "g.77493769G>A" "" "{PMID:Spagnoli 2020:31729144}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77027426G>A" "" "likely pathogenic (dominant)" "" "0000673662" "0" "90" "14" "77493537" "77493555" "del" "0" "00006" "IRF2BPL_000007" "g.77493537_77493555del" "" "{PMID:Prilop 2020:32291157}" "" "" "" "De novo" "" "" "0" "" "" "g.77027194_77027212del" "" "pathogenic (dominant)" "" "0000673675" "0" "90" "14" "77491998" "77491998" "del" "0" "00006" "IRF2BPL_000042" "g.77491998del" "" "{PMID:Johannesen 2020:32427350}" "" "2138delT" "ACMG PVS1, PS1, PM2, PM6" "De novo" "" "" "0" "" "" "g.77025655del" "" "pathogenic (dominant)" "ACMG" "0000674731" "0" "90" "14" "77493374" "77493374" "dup" "0" "00006" "IRF2BPL_000043" "g.77493374dup" "" "contact me for details" "" "762dupC" "" "De novo" "" "" "0" "" "" "g.77027031dup" "" "pathogenic (dominant)" "" "0000691715" "0" "30" "14" "77493646" "77493647" "ins" "0" "02325" "IRF2BPL_000047" "g.77493646_77493647insGGCGGC" "" "" "" "IRF2BPL(NM_024496.4):c.491_492insCGCCGC (p.(Ala163_Ala164dup)), IRF2BPL(NM_024496.4):c.491_492insCGCCGC (p.A163_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691716" "0" "30" "14" "77493647" "77493647" "subst" "0" "02326" "IRF2BPL_000014" "g.77493647A>G" "" "" "" "IRF2BPL(NM_024496.4):c.480_489delCGCCGCCGCTinsCGCCGCCGCC (p.A160_A163=), IRF2BPL(NM_024496.4):c.486_489delCGCTinsCGCC (p.A162_A163=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691717" "0" "10" "14" "77493668" "77493676" "del" "0" "02325" "IRF2BPL_000045" "g.77493668_77493676del" "" "" "" "IRF2BPL(NM_024496.4):c.480_488del (p.(Ala162_Ala164del)), IRF2BPL(NM_024496.4):c.480_488delCGCCGCCGC (p.A162_A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000691718" "0" "30" "14" "77493674" "77493676" "del" "0" "02326" "IRF2BPL_000015" "g.77493674_77493676del" "" "" "" "IRF2BPL(NM_024496.4):c.486_488delCGC (p.A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691719" "0" "30" "14" "77493761" "77493763" "del" "0" "02325" "IRF2BPL_000048" "g.77493761_77493763del" "" "" "" "IRF2BPL(NM_024496.4):c.378_380delACA (p.Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000691720" "0" "10" "14" "77493791" "77493793" "del" "0" "02325" "IRF2BPL_000002" "g.77493791_77493793del" "" "" "" "IRF2BPL(NM_024496.3):c.369_371del (p.(Gln126del)), IRF2BPL(NM_024496.4):c.372_374delGCA (p.Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000691721" "0" "30" "14" "77493825" "77493830" "del" "0" "02325" "IRF2BPL_000049" "g.77493825_77493830del" "" "" "" "IRF2BPL(NM_024496.4):c.321_326del (p.(Gln126_Gln127del)), IRF2BPL(NM_024496.4):c.321_326delACAGCA (p.Q126_Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000710193" "0" "90" "14" "77493574" "77493574" "subst" "0" "00006" "IRF2BPL_000025" "g.77493574G>A" "" "{PMID:Hong 2020:33333793}" "" "" "" "De novo" "" "" "0" "" "" "g.77027231G>A" "" "pathogenic (dominant)" "" "0000724882" "0" "30" "14" "77492190" "77492190" "subst" "5.42372E-5" "02325" "IRF2BPL_000050" "g.77492190G>A" "" "" "" "IRF2BPL(NM_024496.4):c.1946C>T (p.T649I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724883" "0" "30" "14" "77493407" "77493407" "subst" "0" "02326" "IRF2BPL_000051" "g.77493407C>A" "" "" "" "IRF2BPL(NM_024496.4):c.729G>T (p.G243=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724884" "0" "30" "14" "77493646" "77493647" "ins" "0" "02325" "IRF2BPL_000013" "g.77493646_77493647insGGC" "" "" "" "IRF2BPL(NM_024496.4):c.491_492insCGC (p.A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724885" "0" "50" "14" "77493647" "77493661" "del" "0" "02325" "IRF2BPL_000052" "g.77493647_77493661del" "" "" "" "IRF2BPL(NM_024496.4):c.477_491delCGCCGCCGCCGCTGC (p.A160_A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000724886" "0" "90" "14" "77493760" "77493760" "subst" "0" "02327" "IRF2BPL_000028" "g.77493760G>A" "" "" "" "IRF2BPL(NM_024496.4):c.376C>T (p.Q126*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000724887" "0" "10" "14" "77493790" "77493800" "del" "0" "02325" "IRF2BPL_000021" "g.77493790_77493800del" "" "" "" "IRF2BPL(NM_024496.4):c.336_346delGCAGCAACAGC (p.Q113Afs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000724888" "0" "30" "14" "77493791" "77493791" "subst" "0" "02326" "IRF2BPL_000053" "g.77493791C>T" "" "" "" "IRF2BPL(NM_024496.4):c.342_345delACAGinsACAA (p.Q114_Q115=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000724889" "0" "30" "14" "77493791" "77493793" "del" "0" "02326" "IRF2BPL_000002" "g.77493791_77493793del" "" "" "" "IRF2BPL(NM_024496.3):c.369_371del (p.(Gln126del)), IRF2BPL(NM_024496.4):c.372_374delGCA (p.Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000766082" "0" "90" "14" "77493144" "77493144" "dup" "0" "01164" "IRF2BPL_000054" "g.77493144dup" "" "" "" "" "ACMG: PVS1, PS2_MOD, PM2_SUP; variant confirmed de novo after segregation analysis; additional comp-het for C2CD3 c.275C>G p.(Thr92Arg) + c.4744T>C p.(Ser1582Pro), both VUS" "De novo" "?" "" "0" "" "" "g.77026801dup" "" "pathogenic (dominant)" "ACMG" "0000806508" "0" "30" "14" "77491933" "77491933" "subst" "0.00112538" "01943" "IRF2BPL_000008" "g.77491933T>A" "" "" "" "IRF2BPL(NM_024496.4):c.2203A>T (p.S735C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806509" "0" "90" "14" "77492289" "77492289" "del" "0" "02325" "IRF2BPL_000055" "g.77492289del" "" "" "" "IRF2BPL(NM_024496.4):c.1852delC (p.Q618Rfs*62)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000806510" "0" "30" "14" "77492586" "77492586" "subst" "0.000678887" "01943" "IRF2BPL_000056" "g.77492586G>A" "" "" "" "IRF2BPL(NM_024496.4):c.1550C>T (p.A517V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806511" "0" "30" "14" "77493140" "77493140" "subst" "8.79272E-5" "02326" "IRF2BPL_000057" "g.77493140G>A" "" "" "" "IRF2BPL(NM_024496.4):c.996C>T (p.P332=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806512" "0" "30" "14" "77493367" "77493367" "subst" "8.65937E-5" "02326" "IRF2BPL_000058" "g.77493367G>A" "" "" "" "IRF2BPL(NM_024496.4):c.769C>T (p.L257=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806513" "0" "50" "14" "77493483" "77493485" "del" "0" "01943" "IRF2BPL_000059" "g.77493483_77493485del" "" "" "" "IRF2BPL(NM_024496.4):c.657_659delTTC (p.S220del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000806514" "0" "30" "14" "77493671" "77493676" "dup" "0" "01943" "IRF2BPL_000060" "g.77493671_77493676dup" "" "" "" "IRF2BPL(NM_024496.4):c.477_482dupCGCCGC (p.A163_A164dup), IRF2BPL(NM_024496.4):c.483_488dupCGCCGC (p.A163_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806515" "0" "30" "14" "77493671" "77493676" "dup" "0" "02326" "IRF2BPL_000060" "g.77493671_77493676dup" "" "" "" "IRF2BPL(NM_024496.4):c.477_482dupCGCCGC (p.A163_A164dup), IRF2BPL(NM_024496.4):c.483_488dupCGCCGC (p.A163_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806516" "0" "30" "14" "77493749" "77493749" "subst" "0.000601803" "01943" "IRF2BPL_000020" "g.77493749G>A" "" "" "" "IRF2BPL(NM_024496.4):c.387C>T (p.N129=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806517" "0" "90" "14" "77493760" "77493760" "subst" "0" "02329" "IRF2BPL_000028" "g.77493760G>A" "" "" "" "IRF2BPL(NM_024496.4):c.376C>T (p.Q126*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000806518" "0" "30" "14" "77493788" "77493788" "subst" "0" "02326" "IRF2BPL_000061" "g.77493788C>T" "" "" "" "IRF2BPL(NM_024496.4):c.342_348delACAGCAGinsACAGCAA (p.Q114_Q116=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000806519" "0" "30" "14" "77493869" "77493869" "subst" "0" "01943" "IRF2BPL_000062" "g.77493869C>T" "" "" "" "IRF2BPL(NM_024496.4):c.267G>A (p.A89=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853894" "0" "90" "14" "77492443" "77492443" "subst" "0" "02327" "IRF2BPL_000063" "g.77492443G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000853895" "0" "50" "14" "77493192" "77493193" "ins" "0" "02325" "IRF2BPL_000065" "g.77493192_77493193insCGGTCG" "" "" "" "IRF2BPL(NM_024496.4):c.948_949insGCGACC (p.T316_S317insAT)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853896" "0" "50" "14" "77493574" "77493574" "subst" "0" "02325" "IRF2BPL_000066" "g.77493574G>C" "" "" "" "IRF2BPL(NM_024496.4):c.562C>G (p.R188G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000853897" "0" "30" "14" "77493646" "77493647" "ins" "0" "01943" "IRF2BPL_000013" "g.77493646_77493647insGGC" "" "" "" "IRF2BPL(NM_024496.4):c.491_492insCGC (p.A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000853898" "0" "30" "14" "77493668" "77493676" "del" "0" "01943" "IRF2BPL_000045" "g.77493668_77493676del" "" "" "" "IRF2BPL(NM_024496.4):c.480_488del (p.(Ala162_Ala164del)), IRF2BPL(NM_024496.4):c.480_488delCGCCGCCGC (p.A162_A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863690" "0" "30" "14" "77493189" "77493189" "subst" "0.000200837" "01943" "IRF2BPL_000064" "g.77493189G>A" "" "" "" "IRF2BPL(NM_024496.4):c.947C>T (p.T316I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863691" "0" "30" "14" "77493500" "77493500" "subst" "0.000706291" "01943" "IRF2BPL_000012" "g.77493500G>A" "" "" "" "IRF2BPL(NM_024496.4):c.636C>T (p.N212=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863692" "0" "30" "14" "77493671" "77493676" "dup" "0" "02325" "IRF2BPL_000060" "g.77493671_77493676dup" "" "" "" "IRF2BPL(NM_024496.4):c.477_482dupCGCCGC (p.A163_A164dup), IRF2BPL(NM_024496.4):c.483_488dupCGCCGC (p.A163_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863693" "0" "30" "14" "77493787" "77493788" "ins" "0" "01943" "IRF2BPL_000005" "g.77493787_77493788insTTG" "" "" "" "IRF2BPL(NM_024496.3):c.350_351insACA (p.(Gln117dup)), IRF2BPL(NM_024496.4):c.350_351insACA (p.Q127dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000863694" "0" "50" "14" "77493866" "77493874" "del" "0" "01943" "IRF2BPL_000067" "g.77493866_77493874del" "" "" "" "IRF2BPL(NM_024496.4):c.270_278delGGCGGCGGC (p.A100_A102del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000873063" "0" "70" "14" "77493646" "77493689" "del" "0" "01164" "IRF2BPL_000068" "g.77493646_77493689del" "" "" "" "" "ACMG: PVS1, PM2_SUP" "Germline" "?" "" "0" "" "" "g.77027303_77027346del" "" "likely pathogenic (dominant)" "ACMG" "0000881382" "0" "70" "14" "77493919" "77493958" "del" "0" "01164" "IRF2BPL_000069" "g.77493919_77493958del" "" "" "" "" "ACMG: PVS1, PM2_SUP" "Germline" "?" "" "0" "" "" "g.77027576_77027615del" "" "likely pathogenic (dominant)" "ACMG" "0000891903" "0" "50" "14" "77491801" "77491801" "subst" "0" "02325" "IRF2BPL_000070" "g.77491801C>T" "" "" "" "IRF2BPL(NM_024496.4):c.2335G>A (p.E779K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000891904" "0" "30" "14" "77493674" "77493676" "dup" "0" "02325" "IRF2BPL_000071" "g.77493674_77493676dup" "" "" "" "IRF2BPL(NM_024496.4):c.486_488dup (p.(Ala164dup)), IRF2BPL(NM_024496.4):c.486_488dupCGC (p.A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000891905" "0" "50" "14" "77493785" "77493814" "del" "0" "02325" "IRF2BPL_000072" "g.77493785_77493814del" "" "" "" "IRF2BPL(NM_024496.4):c.342_371del (p.(Gln118_Gln127del)), IRF2BPL(NM_024496.4):c.342_371delACAGCAGCAGCAGCAGCAGCAGCAGCAGCA (p.Q118_Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000921063" "0" "90" "14" "77493629" "77493629" "del" "0" "03544" "IRF2BPL_000073" "g.77493629del" "" "" "" "" "" "De novo" "-" "" "0" "" "" "g.77027286del" "" "pathogenic (dominant)" "ACMG" "0000930339" "0" "70" "14" "77492338" "77492338" "dup" "0" "02327" "IRF2BPL_000074" "g.77492338dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000930340" "0" "70" "14" "77493827" "77493858" "del" "0" "02325" "IRF2BPL_000075" "g.77493827_77493858del" "" "" "" "IRF2BPL(NM_024496.4):c.283_314delGCGGCGGCCGCCGCCGCCGCCGCGCAACAGCA (p.A95Tfs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000936478" "0" "50" "14" "77493647" "77493649" "del" "0" "00006" "IRF2BPL_000076" "g.77493647_77493649del" "" "{PMID:Hamdan 2017:29100083}" "" "NM_024496:c.489_491del (163_164del)" "" "De novo" "" "" "0" "" "" "g.77027304_77027306del" "" "VUS" "" "0000950294" "0" "90" "14" "77493774" "77493775" "ins" "0" "02325" "IRF2BPL_000077" "g.77493774_77493775insACT" "" "" "" "IRF2BPL(NM_024496.4):c.363_364insTAG (p.Q122*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000967568" "0" "50" "14" "77493112" "77493112" "subst" "0" "02325" "IRF2BPL_000080" "g.77493112G>A" "" "" "" "IRF2BPL(NM_024496.4):c.1024C>T (p.R342C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000967570" "0" "50" "14" "77493669" "77493680" "dup" "0" "02325" "IRF2BPL_000081" "g.77493669_77493680dup" "" "" "" "IRF2BPL(NM_024496.4):c.459_470dupTGCCGCCGCCGC (p.A161_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000967579" "0" "10" "14" "77493791" "77493793" "dup" "0" "02329" "IRF2BPL_000083" "g.77493791_77493793dup" "" "" "" "IRF2BPL(NM_024496.4):c.372_374dupGCA (p.Q127dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000981015" "0" "30" "14" "77493646" "77493647" "ins" "0" "01804" "IRF2BPL_000047" "g.77493646_77493647insGGCGGC" "" "" "" "IRF2BPL(NM_024496.4):c.491_492insCGCCGC (p.(Ala163_Ala164dup)), IRF2BPL(NM_024496.4):c.491_492insCGCCGC (p.A163_A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981016" "0" "10" "14" "77493668" "77493676" "del" "0" "01804" "IRF2BPL_000045" "g.77493668_77493676del" "" "" "" "IRF2BPL(NM_024496.4):c.480_488del (p.(Ala162_Ala164del)), IRF2BPL(NM_024496.4):c.480_488delCGCCGCCGC (p.A162_A164del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000981017" "0" "30" "14" "77493674" "77493676" "dup" "0" "01804" "IRF2BPL_000071" "g.77493674_77493676dup" "" "" "" "IRF2BPL(NM_024496.4):c.486_488dup (p.(Ala164dup)), IRF2BPL(NM_024496.4):c.486_488dupCGC (p.A164dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000981018" "0" "50" "14" "77493785" "77493814" "del" "0" "01804" "IRF2BPL_000072" "g.77493785_77493814del" "" "" "" "IRF2BPL(NM_024496.4):c.342_371del (p.(Gln118_Gln127del)), IRF2BPL(NM_024496.4):c.342_371delACAGCAGCAGCAGCAGCAGCAGCAGCAGCA (p.Q118_Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000981019" "0" "10" "14" "77493825" "77493830" "del" "0" "01804" "IRF2BPL_000049" "g.77493825_77493830del" "" "" "" "IRF2BPL(NM_024496.4):c.321_326del (p.(Gln126_Gln127del)), IRF2BPL(NM_024496.4):c.321_326delACAGCA (p.Q126_Q127del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000981020" "0" "30" "14" "77493857" "77493859" "del" "0" "01804" "IRF2BPL_000084" "g.77493857_77493859del" "" "" "" "IRF2BPL(NM_024496.4):c.282_284del (p.(Ala102del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001156" "0" "30" "14" "77492059" "77492059" "subst" "1.89505E-5" "01804" "IRF2BPL_000085" "g.77492059C>T" "" "" "" "IRF2BPL(NM_024496.3):c.2077G>A (p.(Gly693Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001157" "0" "50" "14" "77492175" "77492175" "subst" "1.25462E-5" "01804" "IRF2BPL_000086" "g.77492175C>T" "" "" "" "IRF2BPL(NM_024496.3):c.1961G>A (p.(Arg654Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001158" "0" "50" "14" "77492742" "77492742" "subst" "0" "01804" "IRF2BPL_000087" "g.77492742T>A" "" "" "" "IRF2BPL(NM_024496.3):c.1394A>T (p.(Lys465Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001159" "0" "30" "14" "77492844" "77492844" "subst" "1.62975E-5" "01804" "IRF2BPL_000088" "g.77492844T>A" "" "" "" "IRF2BPL(NM_024496.3):c.1292A>T (p.(Tyr431Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001160" "0" "50" "14" "77493486" "77493486" "subst" "4.59893E-5" "01804" "IRF2BPL_000089" "g.77493486T>C" "" "" "" "IRF2BPL(NM_024496.3):c.650A>G (p.(Asn217Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001161" "0" "30" "14" "77493840" "77493840" "subst" "0" "01804" "IRF2BPL_000090" "g.77493840G>A" "" "" "" "IRF2BPL(NM_024496.3):c.296C>T (p.(Ala99Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001001162" "0" "50" "14" "77493856" "77493856" "subst" "5.82004E-5" "02325" "IRF2BPL_000091" "g.77493856C>T" "" "" "" "IRF2BPL(NM_024496.4):c.280G>A (p.A94T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001001163" "0" "30" "14" "77493864" "77493875" "del" "0" "01804" "IRF2BPL_000092" "g.77493864_77493875del" "" "" "" "IRF2BPL(NM_024496.3):c.261_272delAGCGGCGGCGGC (p.(Ala88_Ala91del)), IRF2BPL(NM_024496.4):c.261_272delAGCGGCGGCGGC (p.A99_A102del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015177" "0" "90" "14" "77493656" "77493687" "del" "0" "02327" "IRF2BPL_000093" "g.77493656_77493687del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0001026405" "0" "50" "14" "77493864" "77493875" "del" "0" "02325" "IRF2BPL_000092" "g.77493864_77493875del" "" "" "" "IRF2BPL(NM_024496.3):c.261_272delAGCGGCGGCGGC (p.(Ala88_Ala91del)), IRF2BPL(NM_024496.4):c.261_272delAGCGGCGGCGGC (p.A99_A102del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001030313" "0" "90" "14" "77493765" "77493766" "ins" "0" "00006" "IRF2BPL_000094" "g.77493765_77493766insACT" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.77027422_77027423insACT" "" "pathogenic (dominant)" "" "0001040116" "0" "50" "14" "77493873" "77493875" "del" "0" "01804" "IRF2BPL_000097" "g.77493873_77493875del" "" "" "" "IRF2BPL(NM_024496.4):c.261_263del (p.(Ala102del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001044603" "0" "70" "14" "77493227" "77493227" "del" "0" "03544" "IRF2BPL_000096" "g.77493227del" "" "" "" "" "not detected in unaffected mother and sister" "Germline" "-" "" "0" "" "" "g.77026884del" "" "likely pathogenic" "ACMG" "0001044608" "0" "70" "14" "77492956" "77492956" "del" "0" "03544" "IRF2BPL_000095" "g.77492956del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.77026613del" "{CV:4526891}" "likely pathogenic" "ACMG" "0001054911" "0" "50" "14" "77491920" "77491920" "subst" "0" "01804" "IRF2BPL_000098" "g.77491920C>G" "" "" "" "IRF2BPL(NM_024496.4):c.2216G>C (p.(Cys739Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001054912" "0" "50" "14" "77493955" "77493955" "subst" "9.03971E-6" "01804" "IRF2BPL_000099" "g.77493955G>A" "" "" "" "IRF2BPL(NM_024496.4):c.181C>T (p.(His61Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001066102" "0" "50" "14" "77493647" "77493652" "del" "0" "02325" "IRF2BPL_000100" "g.77493647_77493652del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes IRF2BPL ## Count = 128 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000323771" "00010135" "70" "1784" "0" "1784" "0" "c.1784dup" "r.(?)" "p.(Pro596SerfsTer19)" "" "0000323772" "00010135" "50" "372" "0" "374" "0" "c.372_374del" "r.(?)" "p.(Gln127del)" "" "0000323775" "00010135" "50" "369" "0" "374" "0" "c.369_374del" "r.(?)" "p.(Gln126_Gln127del)" "" "0000323776" "00010135" "50" "350" "0" "351" "0" "c.350_351insACA" "r.(?)" "p.(Gln127dup)" "" "0000461225" "00010135" "70" "490" "0" "496" "0" "c.490_496del" "r.(?)" "p.(Ala164Asnfs*13)" "" "0000478176" "00010135" "70" "581" "0" "599" "0" "c.581_599del" "r.(?)" "p.(Gly194Alafs*12)" "" "0000553128" "00010135" "30" "2203" "0" "2203" "0" "c.2203A>T" "r.(?)" "p.(Ser735Cys)" "" "0000553129" "00010135" "30" "2031" "0" "2031" "0" "c.2031G>A" "r.(?)" "p.(Gly677=)" "" "0000553130" "00010135" "70" "1486" "0" "1486" "0" "c.1486C>T" "r.(?)" "p.(Pro496Ser)" "" "0000553131" "00010135" "30" "724" "0" "724" "0" "c.724C>T" "r.(?)" "p.(Pro242Ser)" "" "0000553132" "00010135" "30" "636" "0" "636" "0" "c.636C>T" "r.(?)" "p.(Asn212=)" "" "0000553133" "00010135" "30" "491" "0" "492" "0" "c.491_492insCGC" "r.(?)" "p.(Ala164dup)" "" "0000553134" "00010135" "10" "489" "0" "489" "0" "c.489T>C" "r.(?)" "p.(Ala163=)" "" "0000553135" "00010135" "10" "486" "0" "488" "0" "c.486_488del" "r.(?)" "p.(Ala164del)" "" "0000553137" "00010135" "10" "369" "0" "374" "0" "c.369_374del" "r.(?)" "p.(Gln126_Gln127del)" "" "0000553139" "00010135" "30" "342" "0" "347" "0" "c.342_347del" "r.(?)" "p.(Gln126_Gln127del)" "" "0000553140" "00010135" "30" "297" "0" "297" "0" "c.297C>T" "r.(?)" "p.(Ala99=)" "" "0000553141" "00010135" "30" "6" "0" "6" "0" "c.6G>C" "r.(?)" "p.(Ser2=)" "" "0000615106" "00010135" "30" "387" "0" "387" "0" "c.387C>T" "r.(?)" "p.(Asn129=)" "" "0000615107" "00010135" "30" "336" "0" "346" "0" "c.336_346del" "r.(?)" "p.(Gln113AlafsTer16)" "" "0000615108" "00010135" "30" "327" "0" "327" "0" "c.327G>A" "r.(?)" "p.(Gln109=)" "" "0000623173" "00010135" "10" "224" "0" "305" "0" "c.224_305del" "r.(?)" "p.(Pro75ArgfsTer50)" "" "0000645292" "00010135" "90" "562" "0" "562" "0" "c.562C>T" "r.562c>u" "p.(Arg188*)" "" "0000645296" "00010135" "70" "519" "0" "519" "0" "c.519C>G" "r.519c>g" "p.(Tyr173*)" "" "0000645297" "00010135" "70" "2122" "0" "2122" "0" "c.2122del" "r.2122del" "p.(Ala708Profs*59)" "" "0000657495" "00010135" "30" "480" "0" "488" "0" "c.480_488dup" "r.(?)" "p.(Ala162_Ala164dup)" "" "0000657496" "00010135" "10" "486" "0" "488" "0" "c.486_488del" "r.(?)" "p.(Ala164del)" "" "0000673578" "00010135" "90" "514" "0" "514" "0" "c.514G>T" "r.(?)" "p.(Glu172∗)" "" "0000673579" "00010135" "90" "562" "0" "562" "0" "c.562C>T" "r.(?)" "p.(Arg188∗)" "" "0000673580" "00010135" "90" "562" "0" "562" "0" "c.562C>T" "r.(?)" "p.(Arg188∗)" "" "0000673581" "00010135" "90" "379" "0" "379" "0" "c.379C>T" "r.(?)" "p.(Gln127∗)" "" "0000673582" "00010135" "90" "376" "0" "376" "0" "c.376C>T" "r.(?)" "p.(Gln126∗)" "" "0000673583" "00010135" "90" "1115" "0" "1115" "0" "c.1115C>G" "r.(?)" "p.(Pro372Arg)" "" "0000673584" "00010135" "90" "1254" "0" "1254" "0" "c.1254G>C" "r.(?)" "p.(Lys418Asn)" "" "0000673588" "00010135" "90" "519" "0" "519" "0" "c.519C>G" "r.(?)" "p.(Tyr173*)" "" "0000673589" "00010135" "90" "361" "0" "361" "0" "c.361C>T" "r.(?)" "p.(Gln121*)" "" "0000673590" "00010135" "90" "376" "0" "376" "0" "c.376C>T" "r.376c>u" "p.Gln126*" "" "0000673591" "00010135" "90" "496" "0" "496" "0" "c.496G>T" "r.(?)" "p.(Glu166*)" "" "0000673592" "00010135" "90" "519" "0" "519" "0" "c.519C>G" "r.(?)" "p.(Tyr173*)" "" "0000673593" "00010135" "90" "562" "0" "562" "0" "c.562C>T" "r.(?)" "p.(Arg188*)" "" "0000673594" "00010135" "90" "962" "0" "962" "0" "c.962del" "r.962del" "p.Ala321Glufs*24" "" "0000673595" "00010135" "90" "2122" "0" "2122" "0" "c.2122del" "r.(?)" "p.(Ala708Profs*59)" "" "0000673596" "00010135" "90" "2135" "0" "2136" "0" "c.2135_2136del" "r.(?)" "p.(Leu713Serfs*56)" "" "0000673597" "00010135" "90" "0" "0" "0" "0" "c.?" "r.(?)" "p.(Cys714Alafs*49)" "" "0000673598" "00010135" "90" "2152" "0" "2152" "0" "c.2152del" "r.(?)" "p.(Cys718Alafs*48)" "" "0000673635" "00010135" "50" "584" "0" "584" "0" "c.584G>T" "r.(?)" "p.(Gly195Val)" "" "0000673658" "00010135" "90" "373" "0" "373" "0" "c.373C>T" "r.(?)" "p.(Gln125*)" "" "0000673659" "00010135" "90" "2152" "0" "2152" "0" "c.2152del" "r.(?)" "p.(Cys718Alafs*49)" "" "0000673660" "00010135" "90" "355" "0" "355" "0" "c.355C>T" "r.(?)" "p.(Gln119*)" "" "0000673661" "00010135" "70" "367" "0" "367" "0" "c.367C>T" "r.(?)" "p.(Gln123*)" "" "0000673662" "00010135" "90" "581" "0" "599" "0" "c.581_599del" "r.(?)" "p.(Gly194Alafs*12)" "" "0000673675" "00010135" "90" "2138" "0" "2138" "0" "c.2138del" "r.(?)" "p.(Leu713Profs*54)" "" "0000674731" "00010135" "90" "762" "0" "762" "0" "c.762dup" "r.(?)" "p.(Asn255Glnfs*9)" "" "0000691715" "00010135" "30" "491" "0" "492" "0" "c.491_492insCGCCGC" "r.(?)" "p.(Ala163_Ala164dup)" "" "0000691716" "00010135" "30" "489" "0" "489" "0" "c.489T>C" "r.(?)" "p.(Ala163=)" "" "0000691717" "00010135" "10" "480" "0" "488" "0" "c.480_488del" "r.(?)" "p.(Ala162_Ala164del)" "" "0000691718" "00010135" "30" "486" "0" "488" "0" "c.486_488del" "r.(?)" "p.(Ala164del)" "" "0000691719" "00010135" "30" "378" "0" "380" "0" "c.378_380del" "r.(?)" "p.(Gln127del)" "" "0000691720" "00010135" "10" "372" "0" "374" "0" "c.372_374del" "r.(?)" "p.(Gln127del)" "" "0000691721" "00010135" "30" "321" "0" "326" "0" "c.321_326del" "r.(?)" "p.(Gln126_Gln127del)" "" "0000710193" "00010135" "90" "562" "0" "562" "0" "c.562C>T" "r.(?)" "p.(Arg188*)" "" "0000724882" "00010135" "30" "1946" "0" "1946" "0" "c.1946C>T" "r.(?)" "p.(Thr649Ile)" "" "0000724883" "00010135" "30" "729" "0" "729" "0" "c.729G>T" "r.(?)" "p.(Gly243=)" "" "0000724884" "00010135" "30" "491" "0" "492" "0" "c.491_492insCGC" "r.(?)" "p.(Ala164dup)" "" "0000724885" "00010135" "50" "477" "0" "491" "0" "c.477_491del" "r.(?)" "p.(Ala160_Ala164del)" "" "0000724886" "00010135" "90" "376" "0" "376" "0" "c.376C>T" "r.(?)" "p.(Gln126*)" "" "0000724887" "00010135" "10" "336" "0" "346" "0" "c.336_346del" "r.(?)" "p.(Gln113AlafsTer16)" "" "0000724888" "00010135" "30" "345" "0" "345" "0" "c.345G>A" "r.(?)" "p.(Gln115=)" "" "0000724889" "00010135" "30" "372" "0" "374" "0" "c.372_374del" "r.(?)" "p.(Gln127del)" "" "0000766082" "00010135" "90" "993" "0" "993" "0" "c.993dup" "r.(?)" "p.(Pro332Alafs*91)" "" "0000806508" "00010135" "30" "2203" "0" "2203" "0" "c.2203A>T" "r.(?)" "p.(Ser735Cys)" "" "0000806509" "00010135" "90" "1852" "0" "1852" "0" "c.1852del" "r.(?)" "p.(Gln618Argfs*62)" "" "0000806510" "00010135" "30" "1550" "0" "1550" "0" "c.1550C>T" "r.(?)" "p.(Ala517Val)" "" "0000806511" "00010135" "30" "996" "0" "996" "0" "c.996C>T" "r.(?)" "p.(Pro332=)" "" "0000806512" "00010135" "30" "769" "0" "769" "0" "c.769C>T" "r.(?)" "p.(Leu257=)" "" "0000806513" "00010135" "50" "657" "0" "659" "0" "c.657_659del" "r.(?)" "p.(Ser220del)" "" "0000806514" "00010135" "30" "483" "0" "488" "0" "c.483_488dup" "r.(?)" "p.(Ala163_Ala164dup)" "" "0000806515" "00010135" "30" "483" "0" "488" "0" "c.483_488dup" "r.(?)" "p.(Ala163_Ala164dup)" "" "0000806516" "00010135" "30" "387" "0" "387" "0" "c.387C>T" "r.(?)" "p.(Asn129=)" "" "0000806517" "00010135" "90" "376" "0" "376" "0" "c.376C>T" "r.(?)" "p.(Gln126*)" "" "0000806518" "00010135" "30" "348" "0" "348" "0" "c.348G>A" "r.(?)" "p.(Gln116=)" "" "0000806519" "00010135" "30" "267" "0" "267" "0" "c.267G>A" "r.(?)" "p.(Ala89=)" "" "0000853894" "00010135" "90" "1693" "0" "1693" "0" "c.1693C>T" "r.(?)" "p.(Gln565*)" "" "0000853895" "00010135" "50" "948" "0" "949" "0" "c.948_949insGCGACC" "r.(?)" "p.(Thr316_Ser317insAlaThr)" "" "0000853896" "00010135" "50" "562" "0" "562" "0" "c.562C>G" "r.(?)" "p.(Arg188Gly)" "" "0000853897" "00010135" "30" "491" "0" "492" "0" "c.491_492insCGC" "r.(?)" "p.(Ala164dup)" "" "0000853898" "00010135" "30" "480" "0" "488" "0" "c.480_488del" "r.(?)" "p.(Ala162_Ala164del)" "" "0000863690" "00010135" "30" "947" "0" "947" "0" "c.947C>T" "r.(?)" "p.(Thr316Ile)" "" "0000863691" "00010135" "30" "636" "0" "636" "0" "c.636C>T" "r.(?)" "p.(Asn212=)" "" "0000863692" "00010135" "30" "483" "0" "488" "0" "c.483_488dup" "r.(?)" "p.(Ala163_Ala164dup)" "" "0000863693" "00010135" "30" "350" "0" "351" "0" "c.350_351insACA" "r.(?)" "p.(Gln127dup)" "" "0000863694" "00010135" "50" "270" "0" "278" "0" "c.270_278del" "r.(?)" "p.(Ala100_Ala102del)" "" "0000873063" "00010135" "70" "450" "0" "493" "0" "c.450_493del" "r.(?)" "p.(Leu151Glyfs*98)" "1" "0000881382" "00010135" "70" "178" "0" "217" "0" "c.178_217del" "r.(?)" "p.(Ala60Argfs*79)" "" "0000891903" "00010135" "50" "2335" "0" "2335" "0" "c.2335G>A" "r.(?)" "p.(Glu779Lys)" "" "0000891904" "00010135" "30" "486" "0" "488" "0" "c.486_488dup" "r.(?)" "p.(Ala164dup)" "" "0000891905" "00010135" "50" "342" "0" "371" "0" "c.342_371del" "r.(?)" "p.(Gln118_Gln127del)" "" "0000921063" "00010135" "90" "508" "0" "508" "0" "c.508del" "r.(?)" "p.(Arg170Alafs*9)" "" "0000930339" "00010135" "70" "1802" "0" "1802" "0" "c.1802dup" "r.(?)" "p.(Pro602Thrfs*13)" "" "0000930340" "00010135" "70" "283" "0" "314" "0" "c.283_314del" "r.(?)" "p.(Ala95Thrfs*27)" "" "0000936478" "00010135" "50" "489" "0" "491" "0" "c.489_491del" "r.(?)" "p.(Ala164del)" "" "0000950294" "00010135" "90" "363" "0" "364" "0" "c.363_364insTAG" "r.(?)" "p.(Gln122*)" "" "0000967568" "00010135" "50" "1024" "0" "1024" "0" "c.1024C>T" "r.(?)" "p.(Arg342Cys)" "" "0000967570" "00010135" "50" "459" "0" "470" "0" "c.459_470dup" "r.(?)" "p.(Ala161_Ala164dup)" "" "0000967579" "00010135" "10" "372" "0" "374" "0" "c.372_374dup" "r.(?)" "p.(Gln127dup)" "" "0000981015" "00010135" "30" "491" "0" "492" "0" "c.491_492insCGCCGC" "r.(?)" "p.(Ala163_Ala164dup)" "" "0000981016" "00010135" "10" "480" "0" "488" "0" "c.480_488del" "r.(?)" "p.(Ala162_Ala164del)" "" "0000981017" "00010135" "30" "486" "0" "488" "0" "c.486_488dup" "r.(?)" "p.(Ala164dup)" "" "0000981018" "00010135" "50" "342" "0" "371" "0" "c.342_371del" "r.(?)" "p.(Gln118_Gln127del)" "" "0000981019" "00010135" "10" "321" "0" "326" "0" "c.321_326del" "r.(?)" "p.(Gln126_Gln127del)" "" "0000981020" "00010135" "30" "282" "0" "284" "0" "c.282_284del" "r.(?)" "p.(Ala102del)" "" "0001001156" "00010135" "30" "2077" "0" "2077" "0" "c.2077G>A" "r.(?)" "p.(Gly693Ser)" "" "0001001157" "00010135" "50" "1961" "0" "1961" "0" "c.1961G>A" "r.(?)" "p.(Arg654Gln)" "" "0001001158" "00010135" "50" "1394" "0" "1394" "0" "c.1394A>T" "r.(?)" "p.(Lys465Met)" "" "0001001159" "00010135" "30" "1292" "0" "1292" "0" "c.1292A>T" "r.(?)" "p.(Tyr431Phe)" "" "0001001160" "00010135" "50" "650" "0" "650" "0" "c.650A>G" "r.(?)" "p.(Asn217Ser)" "" "0001001161" "00010135" "30" "296" "0" "296" "0" "c.296C>T" "r.(?)" "p.(Ala99Val)" "" "0001001162" "00010135" "50" "280" "0" "280" "0" "c.280G>A" "r.(?)" "p.(Ala94Thr)" "" "0001001163" "00010135" "30" "261" "0" "272" "0" "c.261_272del" "r.(?)" "p.(Ala99_Ala102del)" "" "0001015177" "00010135" "90" "452" "0" "483" "0" "c.452_483del" "r.(?)" "p.(Leu151Argfs*102)" "" "0001026405" "00010135" "50" "261" "0" "272" "0" "c.261_272del" "r.(?)" "p.(Ala99_Ala102del)" "" "0001030313" "00010135" "90" "372" "0" "373" "0" "c.372_373insTAG" "r.(372_373insTAG)" "p.(Gln125Ter)" "" "0001040116" "00010135" "50" "261" "0" "263" "0" "c.261_263del" "r.(?)" "p.(Ala102del)" "" "0001044603" "00010135" "70" "911" "0" "911" "0" "c.911del" "r.(911del)" "p.(Gly304Valfs*41)" "1" "0001044608" "00010135" "70" "1181" "0" "1181" "0" "c.1181del" "r.(1181del)" "p.(Lys394Argfs*24)" "1" "0001054911" "00010135" "50" "2216" "0" "2216" "0" "c.2216G>C" "r.(?)" "p.(Cys739Ser)" "" "0001054912" "00010135" "50" "181" "0" "181" "0" "c.181C>T" "r.(?)" "p.(His61Tyr)" "" "0001066102" "00010135" "50" "486" "0" "491" "0" "c.486_491del" "r.(?)" "p.(Ala163_Ala164del)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 40 "{{screeningid}}" "{{variantid}}" "0000227181" "0000461225" "0000235422" "0000478176" "0000289363" "0000645292" "0000289367" "0000645296" "0000289368" "0000645297" "0000307039" "0000673578" "0000307039" "0000673635" "0000307040" "0000673579" "0000307041" "0000673580" "0000307042" "0000673581" "0000307043" "0000673582" "0000307044" "0000673583" "0000307045" "0000673584" "0000307049" "0000673588" "0000307050" "0000673589" "0000307051" "0000673590" "0000307052" "0000673591" "0000307053" "0000673592" "0000307054" "0000673593" "0000307055" "0000673594" "0000307056" "0000673595" "0000307057" "0000673596" "0000307058" "0000673597" "0000307059" "0000673598" "0000307093" "0000673658" "0000307094" "0000673659" "0000307095" "0000673660" "0000307096" "0000673661" "0000307097" "0000673662" "0000307110" "0000673675" "0000307908" "0000674731" "0000326608" "0000710193" "0000365124" "0000766082" "0000415298" "0000873063" "0000420971" "0000881382" "0000435125" "0000921063" "0000440187" "0000936478" "0000466351" "0001030313" "0000466956" "0001044603" "0000466960" "0001044608"