### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = KCNC3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "KCNC3" "potassium voltage-gated channel, Shaw-related subfamily, member 3" "19" "q13.33" "unknown" "NG_008134.2" "UD_132119016873" "" "http://www.LOVD.nl/KCNC3" "" "1" "6235" "3748" "176264" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/KCNC3_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2015-12-01 07:47:58" "00006" "2026-03-06 17:26:39" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00010342" "KCNC3" "potassium voltage-gated channel, Shaw-related subfamily, member 3" "001" "NM_004977.2" "" "NP_004968.2" "" "" "" "-295" "2881" "2274" "50832634" "50818765" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 5 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "01186" "SPAX1" "ataxia, spastic, type 1, autosomal dominant (SPAX-1)" "AD" "108600" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02537" "SCA13" "ataxia, spinocerebellar, type 13 (SCA-13)" "AD" "605259" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05356" "ataxia" "ataxia" "" "" "" "" "" "00006" "2017-12-21 19:14:03" "" "" "05521" "seizures" "seizures" "" "" "" "" "" "00006" "2018-11-18 17:02:13" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "KCNC3" "02537" ## Individuals ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00054870" "" "" "" "1" "" "01479" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "M" "" "" "" "0" "" "" "" "Pat9" "00303005" "" "" "" "1" "" "00006" "{PMID:Helbig 2016:26795593}" "" "" "" "United States" "" "0" "" "" "" "Pat50" "00408672" "" "" "" "1" "" "00006" "{PMID:Thomas 2022:34085946}" "no family history" "" "no" "France" "" "0" "" "" "" "Pat18" "00428258" "" "" "" "1" "" "01164" "" "" "F" "no" "Germany" "" "0" "" "" "" "210537" "00434059" "" "" "" "1" "" "03544" "" "" "" "" "" "" "" "" "" "" "" "00467998" "" "" "" "1" "" "00006" "{PMID:Schnekenberg 2015:25981959}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" "" "0" "" "" "" "Pat1" "00469005" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00473350" "" "" "" "1" "" "00006" "{PMID:Molaei 2025:41315541}" "analysis 2009 neuromuscular disorder individuals; patient, family history" "M" "yes" "Iran" "" "0" "" "" "" "Fam206052Pat613" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 8 "{{individualid}}" "{{diseaseid}}" "00054870" "01186" "00303005" "05521" "00408672" "00198" "00428258" "02537" "00434059" "00198" "00467998" "05356" "00469005" "00198" "00473350" "05356" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 01186, 02537, 05356, 05521 ## Count = 8 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000041534" "01186" "00054870" "01479" "Familial, autosomal dominant" "" "ataxia and pyramidal signs lower limbs" "01y" "" "" "" "" "" "" "" "SCA13" "cerebellar ataxia" "" "0000230088" "05521" "00303005" "00006" "Isolated (sporadic)" "" "Unclassified epilepsy; age onset childhood" "" "" "" "" "" "" "" "" "" "seizures" "" "0000300790" "00198" "00408672" "00006" "Maternal, mitochondrial" "" "" "11y" "" "" "" "" "" "" "" "NARP" "cerebellar ataxia" "" "0000319163" "02537" "00428258" "01164" "Familial" "03y" "Motor delay, Delayed speech and language development, Cerebellar hypoplasia, Ankle pain, Ataxia, Broad-based gait" "" "" "" "" "" "" "" "" "" "" "" "0000324438" "00198" "00434059" "03544" "Isolated (sporadic)" "" "intellectual disability, developmental delay, microcephaly, growth restriction" "" "" "" "" "" "" "" "" "" "" "" "0000353150" "05356" "00467998" "00006" "Isolated (sporadic)" "12y" "see paper; ..., birth at term, weight 2860g; no previous miscarriages;ataxia; no clinical regression; mild intellectual disability; MRI brain normal" "" "" "" "" "" "" "" "" "SCA13" "ataxia" "" "0000354158" "00198" "00469005" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the nervous system" "" "0000358145" "05356" "00473350" "00006" "Familial, autosomal dominant" "34y" "Multiple affected individuals, ataxia, speech impairment, unbalanced gait, tremor and cerebellar atrophy" "" "" "" "" "" "" "" "" "" "hereditary ataxia" "" ## Screenings ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000054822" "00054870" "1" "01479" "01479" "2015-11-30 16:05:29" "" "" "SEQ-NG" "DNA" "" "" "0000304130" "00303005" "1" "00006" "00006" "2020-06-05 14:08:27" "" "" "SEQ-NG" "DNA" "" "WES" "0000409934" "00408672" "1" "00006" "00006" "2022-04-25 19:53:26" "" "" "SEQ-NG" "DNA" "" "" "0000429669" "00428258" "1" "01164" "01164" "2022-12-27 17:45:44" "" "" "SEQ-NG-I" "DNA" "" "" "0000435523" "00434059" "1" "03544" "03544" "2023-03-18 14:36:49" "" "" "SEQ-NG-I" "DNA" "" "" "0000469664" "00467998" "1" "00006" "00006" "2025-11-05 18:57:45" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470673" "00469005" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000475019" "00473350" "1" "00006" "00006" "2026-03-06 17:24:40" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 3 "{{screeningid}}" "{{geneid}}" "0000054822" "KCNC3" "0000304130" "KCNC3" "0000429669" "KCNC3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 121 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000084838" "21" "70" "19" "50826942" "50826942" "subst" "0" "01479" "KCNC3_000001" "g.50826942C>T" "" "{PMID:van de Warrenburg 2016:27165006}, {DOI:van de Warrenburg 2016: 10.1038/ejhg.2016.42}" "" "" "" "Germline" "" "" "0" "" "" "g.50323685C>T" "" "likely pathogenic" "" "0000247584" "0" "10" "19" "50812948" "50812948" "subst" "0.00276947" "02330" "MYH14_000076" "g.50812948A>T" "" "" "" "MYH14(NM_001145809.2):c.6012A>T (p.L2004=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50309691A>T" "" "benign" "" "0000252818" "0" "50" "19" "50823632" "50823632" "subst" "0.0157711" "02326" "KCNC3_000004" "g.50823632A>G" "" "" "" "KCNC3(NM_004977.3):c.2171-26T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50320375A>G" "" "VUS" "" "0000278266" "0" "30" "19" "50832152" "50832152" "subst" "0.97561" "02330" "KCNC3_000023" "g.50832152T>C" "" "" "" "KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328895T>C" "" "likely benign" "" "0000280418" "0" "10" "19" "50812342" "50812342" "subst" "0.00784583" "02330" "MYH14_000074" "g.50812342C>T" "" "" "" "MYH14(NM_001145809.2):c.5868C>T (p.A1956=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50309085C>T" "" "benign" "" "0000281708" "0" "90" "19" "50826942" "50826942" "subst" "0" "02325" "KCNC3_000001" "g.50826942C>T" "" "" "" "KCNC3(NM_004977.3):c.1268G>A (p.R423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323685C>T" "" "pathogenic" "" "0000281709" "0" "10" "19" "50832152" "50832152" "subst" "0.97561" "02325" "KCNC3_000023" "g.50832152T>C" "" "" "" "KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328895T>C" "" "benign" "" "0000281710" "0" "30" "19" "50832025" "50832025" "subst" "0.00119603" "02325" "KCNC3_000022" "g.50832025C>G" "" "" "" "KCNC3(NM_004977.2):c.315G>C (p.T105=), KCNC3(NM_004977.3):c.315G>C (p.T105=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328768C>G" "" "likely benign" "" "0000285474" "0" "10" "19" "50832217" "50832217" "subst" "0.0322581" "02326" "KCNC3_000025" "g.50832217C>A" "" "" "" "KCNC3(NM_004977.3):c.123G>T (p.Q41H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328960C>A" "" "benign" "" "0000285475" "0" "90" "19" "50826942" "50826942" "subst" "0" "02326" "KCNC3_000001" "g.50826942C>T" "" "" "" "KCNC3(NM_004977.3):c.1268G>A (p.R423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323685C>T" "" "pathogenic" "" "0000285476" "0" "10" "19" "50826806" "50826806" "subst" "0.00142946" "02326" "KCNC3_000016" "g.50826806G>A" "" "" "" "KCNC3(NM_004977.3):c.1404C>T (p.Y468=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323549G>A" "" "benign" "" "0000285477" "0" "50" "19" "50826781" "50826781" "subst" "0.000219286" "02326" "KCNC3_000015" "g.50826781C>T" "" "" "" "KCNC3(NM_004977.3):c.1429G>A (p.D477N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323524C>T" "" "VUS" "" "0000285478" "0" "50" "19" "50826607" "50826607" "subst" "0" "02326" "KCNC3_000014" "g.50826607C>T" "" "" "" "KCNC3(NM_004977.3):c.1603G>A (p.V535M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323350C>T" "" "VUS" "" "0000285479" "0" "30" "19" "50832178" "50832178" "subst" "0" "02326" "KCNC3_000024" "g.50832178G>A" "" "" "" "KCNC3(NM_004977.3):c.162C>T (p.G54=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328921G>A" "" "likely benign" "" "0000285480" "0" "10" "19" "50826569" "50826569" "subst" "0.022823" "02326" "KCNC3_000013" "g.50826569C>T" "" "" "" "KCNC3(NM_004977.2):c.1641G>A (p.S547=), KCNC3(NM_004977.3):c.1641G>A (p.S547=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323312C>T" "" "benign" "" "0000285481" "0" "50" "19" "50826439" "50826439" "subst" "0.00258617" "02326" "KCNC3_000011" "g.50826439T>C" "" "" "" "KCNC3(NM_004977.2):c.1771A>G (p.S591G), KCNC3(NM_004977.3):c.1771A>G (p.S591G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323182T>C" "" "VUS" "" "0000285482" "0" "50" "19" "50826334" "50826334" "subst" "1.52195E-5" "02326" "KCNC3_000010" "g.50826334C>A" "" "" "" "KCNC3(NM_004977.3):c.1876G>T (p.G626W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323077C>A" "" "VUS" "" "0000285483" "0" "30" "19" "50826326" "50826326" "subst" "0.000161698" "02326" "KCNC3_000009" "g.50826326C>T" "" "" "" "KCNC3(NM_004977.2):c.1884G>A (p.A628=), KCNC3(NM_004977.3):c.1884G>A (p.A628=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323069C>T" "" "likely benign" "" "0000285484" "0" "10" "19" "50832152" "50832152" "subst" "0.97561" "02326" "KCNC3_000023" "g.50832152T>C" "" "" "" "KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328895T>C" "" "benign" "" "0000285485" "0" "50" "19" "50826283" "50826283" "subst" "0.000205468" "02326" "KCNC3_000008" "g.50826283C>T" "" "" "" "KCNC3(NM_004977.3):c.1927G>A (p.G643S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323026C>T" "" "VUS" "" "0000285486" "0" "10" "19" "50826281" "50826281" "subst" "0.00937441" "02326" "KCNC3_000007" "g.50826281G>A" "" "" "" "KCNC3(NM_004977.2):c.1929C>T (p.G643=), KCNC3(NM_004977.3):c.1929C>T (p.G643=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323024G>A" "" "benign" "" "0000285487" "0" "50" "19" "50826210" "50826210" "subst" "0.00794499" "02326" "KCNC3_000006" "g.50826210G>C" "" "" "" "KCNC3(NM_004977.3):c.1978+22C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50322953G>C" "" "VUS" "" "0000285488" "0" "10" "19" "50823836" "50823836" "subst" "0.00916165" "02326" "KCNC3_000005" "g.50823836G>A" "" "" "" "KCNC3(NM_004977.2):c.2170+14C>T, KCNC3(NM_004977.3):c.2170+14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50320579G>A" "" "benign" "" "0000285489" "0" "50" "19" "50823541" "50823541" "subst" "0" "02326" "KCNC3_000003" "g.50823541C>T" "" "" "" "KCNC3(NM_004977.2):c.2236G>A (p.D746N), KCNC3(NM_004977.3):c.2236G>A (p.D746N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50320284C>T" "" "VUS" "" "0000285490" "0" "50" "19" "50823521" "50823521" "subst" "0" "02326" "KCNC3_000002" "g.50823521C>T" "" "" "" "KCNC3(NM_004977.3):c.2256G>A (p.A752=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50320264C>T" "" "VUS" "" "0000285491" "0" "10" "19" "50818020" "50818020" "subst" "0.00750987" "02326" "MYH14_000152" "g.50818020T>A" "" "" "" "KCNC3(NR_110912.2):n.547A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50314763T>A" "" "benign" "" "0000285492" "0" "30" "19" "50831761" "50831761" "subst" "0.000400502" "02326" "KCNC3_000020" "g.50831761G>C" "" "" "" "KCNC3(NM_004977.3):c.579C>G (p.R193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328504G>C" "" "likely benign" "" "0000285493" "0" "50" "19" "50831761" "50831761" "subst" "8.25777E-6" "02326" "KCNC3_000021" "g.50831761G>A" "" "" "" "KCNC3(NM_004977.3):c.579C>T (p.R193=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328504G>A" "" "VUS" "" "0000285494" "0" "10" "19" "50827360" "50827360" "subst" "0.00472169" "02326" "KCNC3_000018" "g.50827360G>C" "" "" "" "KCNC3(NM_004977.3):c.871-21C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50324103G>C" "" "benign" "" "0000285495" "0" "30" "19" "50827226" "50827226" "subst" "0.00100088" "02326" "KCNC3_000017" "g.50827226C>T" "" "" "" "KCNC3(NM_004977.2):c.984G>A (p.P328=), KCNC3(NM_004977.3):c.984G>A (p.P328=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323969C>T" "" "likely benign" "" "0000290028" "0" "30" "19" "50826569" "50826569" "subst" "0.022823" "01943" "KCNC3_000013" "g.50826569C>T" "" "" "" "KCNC3(NM_004977.2):c.1641G>A (p.S547=), KCNC3(NM_004977.3):c.1641G>A (p.S547=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323312C>T" "" "likely benign" "" "0000290029" "0" "30" "19" "50826326" "50826326" "subst" "0.000161698" "01943" "KCNC3_000009" "g.50826326C>T" "" "" "" "KCNC3(NM_004977.2):c.1884G>A (p.A628=), KCNC3(NM_004977.3):c.1884G>A (p.A628=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323069C>T" "" "likely benign" "" "0000290030" "0" "30" "19" "50832152" "50832152" "subst" "0.97561" "01943" "KCNC3_000023" "g.50832152T>C" "" "" "" "KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328895T>C" "" "likely benign" "" "0000290031" "0" "10" "19" "50826281" "50826281" "subst" "0.00937441" "01943" "KCNC3_000007" "g.50826281G>A" "" "" "" "KCNC3(NM_004977.2):c.1929C>T (p.G643=), KCNC3(NM_004977.3):c.1929C>T (p.G643=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323024G>A" "" "benign" "" "0000290032" "0" "30" "19" "50823836" "50823836" "subst" "0.00916165" "01943" "KCNC3_000005" "g.50823836G>A" "" "" "" "KCNC3(NM_004977.2):c.2170+14C>T, KCNC3(NM_004977.3):c.2170+14C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50320579G>A" "" "likely benign" "" "0000290033" "0" "30" "19" "50832025" "50832025" "subst" "0.00119603" "01943" "KCNC3_000022" "g.50832025C>G" "" "" "" "KCNC3(NM_004977.2):c.315G>C (p.T105=), KCNC3(NM_004977.3):c.315G>C (p.T105=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328768C>G" "" "likely benign" "" "0000290034" "0" "10" "19" "50831691" "50831691" "subst" "0.000539395" "01943" "KCNC3_000019" "g.50831691C>T" "" "" "" "KCNC3(NM_004977.2):c.649G>A (p.A217T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50328434C>T" "" "benign" "" "0000290035" "0" "10" "19" "50827226" "50827226" "subst" "0.00100088" "01943" "KCNC3_000017" "g.50827226C>T" "" "" "" "KCNC3(NM_004977.2):c.984G>A (p.P328=), KCNC3(NM_004977.3):c.984G>A (p.P328=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323969C>T" "" "benign" "" "0000292471" "0" "50" "19" "50812362" "50812362" "subst" "1.62467E-5" "01943" "MYH14_000075" "g.50812362G>A" "" "" "" "MYH14(NM_001145809.1):c.5888G>A (p.R1963H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50309105G>A" "" "VUS" "" "0000326744" "0" "50" "19" "50826514" "50826514" "subst" "8.53111E-6" "01804" "KCNC3_000012" "g.50826514G>A" "" "" "" "KCNC3(NM_004977.2):c.1696C>T (p.(Pro566Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323257G>A" "" "VUS" "" "0000342878" "0" "90" "19" "50826942" "50826942" "subst" "0" "02327" "KCNC3_000001" "g.50826942C>T" "" "" "" "KCNC3(NM_004977.3):c.1268G>A (p.R423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323685C>T" "" "pathogenic" "" "0000342884" "0" "50" "19" "50826924" "50826924" "subst" "1.2196E-5" "02327" "KCNC3_000029" "g.50826924C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323667C>T" "" "VUS" "" "0000348050" "0" "90" "19" "50826868" "50826868" "subst" "0" "02327" "KCNC3_000028" "g.50826868A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323611A>G" "" "pathogenic" "" "0000348509" "0" "50" "19" "50826504" "50826504" "subst" "6.12868E-5" "02327" "KCNC3_000026" "g.50826504G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323247G>A" "" "VUS" "" "0000350582" "0" "50" "19" "50826601" "50826601" "subst" "0" "02327" "KCNC3_000027" "g.50826601C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50323344C>T" "" "VUS" "" "0000350757" "0" "30" "19" "50810419" "50810419" "subst" "0" "02327" "MYH14_000090" "g.50810419G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.50307162G>T" "" "likely benign" "" "0000568161" "0" "50" "19" "50812332" "50812332" "subst" "2.03196E-5" "01943" "MYH14_000141" "g.50812332G>A" "" "" "" "MYH14(NM_001145809.1):c.5858G>A (p.R1953Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309075G>A" "" "VUS" "" "0000568162" "0" "50" "19" "50812994" "50812994" "subst" "0" "02330" "MYH14_000142" "g.50812994G>A" "" "" "" "MYH14(NM_001145809.2):c.6058G>A (p.G2020R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309737G>A" "" "VUS" "" "0000568163" "0" "30" "19" "50813024" "50813025" "ins" "0" "01943" "MYH14_000143" "g.50813024_50813025insGCCC" "" "" "" "MYH14(NM_001077186.1):c.5989_5990insGCCC (p.(Ser1997CysfsTer18)), MYH14(NM_001145809.1):c.6088_6089insGCCC (p.S2030Cfs*18)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309767_50309768insGCCC" "" "likely benign" "" "0000568166" "0" "30" "19" "50813029" "50813029" "subst" "0" "01943" "MYH14_000146" "g.50813029A>C" "" "" "" "MYH14(NM_001145809.1):c.6093A>C (p.P2031=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309772A>C" "" "likely benign" "" "0000568167" "0" "30" "19" "50813032" "50813032" "subst" "0" "01943" "MYH14_000147" "g.50813032A>C" "" "" "" "MYH14(NM_001145809.1):c.6096A>C (p.P2032=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309775A>C" "" "likely benign" "" "0000568168" "0" "30" "19" "50813032" "50813033" "del" "0" "01943" "MYH14_000148" "g.50813032_50813033del" "" "" "" "MYH14(NM_001077186.1):c.5997_5998del (p.(Ala2000ProfsTer13)), MYH14(NM_001145809.1):c.6096_6097delAG (p.A2033Pfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309775_50309776del" "" "likely benign" "" "0000568169" "0" "30" "19" "50813032" "50813033" "del" "0" "01804" "MYH14_000148" "g.50813032_50813033del" "" "" "" "MYH14(NM_001077186.1):c.5997_5998del (p.(Ala2000ProfsTer13)), MYH14(NM_001145809.1):c.6096_6097delAG (p.A2033Pfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309775_50309776del" "" "likely benign" "" "0000568170" "0" "30" "19" "50813033" "50813033" "subst" "0" "01943" "MYH14_000149" "g.50813033G>C" "" "" "" "MYH14(NM_001145809.1):c.6097G>C (p.A2033P, p.(Ala2033Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309776G>C" "" "likely benign" "" "0000568171" "0" "30" "19" "50813033" "50813033" "subst" "0" "01804" "MYH14_000149" "g.50813033G>C" "" "" "" "MYH14(NM_001145809.1):c.6097G>C (p.A2033P, p.(Ala2033Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309776G>C" "" "likely benign" "" "0000568172" "0" "30" "19" "50813037" "50813037" "subst" "0" "01943" "MYH14_000150" "g.50813037A>C" "" "" "" "MYH14(NM_001145809.1):c.6101A>C (p.H2034P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309780A>C" "" "likely benign" "" "0000568174" "0" "30" "19" "50813043" "50813047" "del" "0" "01943" "MYH14_000151" "g.50813043_50813047del" "" "" "" "MYH14(NM_001077186.1):c.6008_6012del (p.(Gln2003delinsProLeuProCysProGlnMetHis)), MYH14(NM_001145809.1):c.6107_6111delAGTGA (p.Q2036Pfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309786_50309790del" "" "likely benign" "" "0000568175" "0" "30" "19" "50813043" "50813047" "del" "0" "01804" "MYH14_000151" "g.50813043_50813047del" "" "" "" "MYH14(NM_001077186.1):c.6008_6012del (p.(Gln2003delinsProLeuProCysProGlnMetHis)), MYH14(NM_001145809.1):c.6107_6111delAGTGA (p.Q2036Pfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309786_50309790del" "" "likely benign" "" "0000568176" "0" "30" "19" "50823541" "50823541" "subst" "0" "01943" "KCNC3_000003" "g.50823541C>T" "" "" "" "KCNC3(NM_004977.2):c.2236G>A (p.D746N), KCNC3(NM_004977.3):c.2236G>A (p.D746N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50320284C>T" "" "likely benign" "" "0000568177" "0" "30" "19" "50823927" "50823927" "subst" "0.000630671" "01943" "KCNC3_000030" "g.50823927C>T" "" "" "" "KCNC3(NM_004977.2):c.2093G>A (p.R698H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50320670C>T" "" "likely benign" "" "0000568178" "0" "30" "19" "50824007" "50824007" "subst" "9.79688E-5" "01943" "KCNC3_000031" "g.50824007C>T" "" "" "" "KCNC3(NM_004977.2):c.2013G>A (p.A671=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50320750C>T" "" "likely benign" "" "0000568179" "0" "50" "19" "50824008" "50824008" "subst" "8.164E-5" "01943" "KCNC3_000032" "g.50824008G>A" "" "" "" "KCNC3(NM_004977.2):c.2012C>T (p.A671V), KCNC3(NM_004977.3):c.2012C>T (p.(Ala671Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50320751G>A" "" "VUS" "" "0000568182" "0" "50" "19" "50826805" "50826805" "subst" "1.21832E-5" "02325" "KCNC3_000033" "g.50826805C>T" "" "" "" "KCNC3(NM_004977.3):c.1405G>A (p.A469T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323548C>T" "" "VUS" "" "0000568183" "0" "90" "19" "50826942" "50826942" "subst" "0" "02329" "KCNC3_000001" "g.50826942C>T" "" "" "" "KCNC3(NM_004977.3):c.1268G>A (p.R423H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323685C>T" "" "pathogenic" "" "0000568184" "0" "90" "19" "50826951" "50826951" "subst" "0" "01943" "KCNC3_000034" "g.50826951C>T" "" "" "" "KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323694C>T" "" "pathogenic" "" "0000568185" "0" "90" "19" "50826951" "50826951" "subst" "0" "02325" "KCNC3_000034" "g.50826951C>T" "" "" "" "KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323694C>T" "" "pathogenic" "" "0000568186" "0" "50" "19" "50826951" "50826951" "subst" "0" "02326" "KCNC3_000034" "g.50826951C>T" "" "" "" "KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323694C>T" "" "VUS" "" "0000568187" "0" "90" "19" "50826951" "50826951" "subst" "0" "02329" "KCNC3_000034" "g.50826951C>T" "" "" "" "KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323694C>T" "" "pathogenic" "" "0000568188" "0" "30" "19" "50827178" "50827178" "subst" "3.2491E-5" "01943" "KCNC3_000035" "g.50827178C>T" "" "" "" "KCNC3(NM_004977.2):c.1032G>A (p.T344=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323921C>T" "" "likely benign" "" "0000568189" "0" "30" "19" "50827208" "50827208" "subst" "2.43912E-5" "01943" "KCNC3_000036" "g.50827208C>T" "" "" "" "KCNC3(NM_004977.2):c.1002G>A (p.P334=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323951C>T" "" "likely benign" "" "0000568190" "0" "50" "19" "50831705" "50831713" "dup" "0" "01943" "KCNC3_000037" "g.50831705_50831713dup" "" "" "" "KCNC3(NM_004977.2):c.642_650dupCAACGCCGC (p.N215_A217dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50328448_50328456dup" "" "VUS" "" "0000617825" "0" "30" "19" "50813024" "50813025" "ins" "0" "01804" "MYH14_000165" "g.50813024_50813025insGC" "" "" "" "MYH14(NM_001077186.1):c.5989_5990insGC (p.(Ser1997CysfsTer40))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309767_50309768insGC" "" "likely benign" "" "0000617826" "0" "30" "19" "50813024" "50813025" "ins" "0" "01804" "MYH14_000143" "g.50813024_50813025insGCCC" "" "" "" "MYH14(NM_001077186.1):c.5989_5990insGCCC (p.(Ser1997CysfsTer18)), MYH14(NM_001145809.1):c.6088_6089insGCCC (p.S2030Cfs*18)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309767_50309768insGCCC" "" "likely benign" "" "0000624064" "0" "30" "19" "50813024" "50813024" "subst" "5.1218E-6" "01943" "MYH14_000164" "g.50813024T>A" "" "" "" "MYH14(NM_001145809.1):c.6088T>A (p.S2030T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50309767T>A" "" "likely benign" "" "0000624065" "0" "30" "19" "50823959" "50823959" "subst" "8.13478E-6" "01943" "KCNC3_000038" "g.50823959C>A" "" "" "" "KCNC3(NM_004977.2):c.2061G>T (p.P687=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50320702C>A" "" "likely benign" "" "0000624066" "0" "30" "19" "50826439" "50826439" "subst" "0.00258617" "01943" "KCNC3_000011" "g.50826439T>C" "" "" "" "KCNC3(NM_004977.2):c.1771A>G (p.S591G), KCNC3(NM_004977.3):c.1771A>G (p.S591G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323182T>C" "" "likely benign" "" "0000624067" "0" "50" "19" "50832287" "50832308" "dup" "0" "02330" "KCNC3_000039" "g.50832287_50832308dup" "" "" "" "KCNC3(NM_004977.2):c.34_55dupGGGCGCCAGGGGGCCAGCAAGC (p.Q19Rfs*89)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50329030_50329051dup" "" "VUS" "" "0000658644" "0" "50" "19" "50826491" "50826491" "subst" "0.000304982" "01943" "KCNC3_000040" "g.50826491G>C" "" "" "" "KCNC3(NM_004977.2):c.1719C>G (p.N573K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323234G>C" "" "VUS" "" "0000658645" "0" "30" "19" "50827178" "50827178" "subst" "0" "02325" "KCNC3_000041" "g.50827178C>A" "" "" "" "KCNC3(NM_004977.3):c.1032G>T (p.T344=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.50323921C>A" "" "likely benign" "" "0000667528" "0" "90" "19" "50826942" "50826942" "subst" "0" "00006" "KCNC3_000001" "g.50826942C>T" "" "{PMID:Helbig 2016:26795593}" "" "" "" "De novo" "" "" "0" "" "" "g.50323685C>T" "" "pathogenic (dominant)" "ACMG" "0000681491" "0" "30" "19" "50826917" "50826917" "subst" "2.43896E-5" "01943" "KCNC3_000042" "g.50826917G>A" "" "" "" "KCNC3(NM_004977.2):c.1293C>T (p.F431=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000681492" "0" "30" "19" "50832213" "50832213" "subst" "0" "01943" "KCNC3_000043" "g.50832213G>A" "" "" "" "KCNC3(NM_004977.2):c.127C>T (p.P43S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727496" "0" "30" "19" "50812927" "50812927" "subst" "0.000272263" "02330" "MYH14_000242" "g.50812927G>A" "" "" "" "MYH14(NM_001145809.2):c.5991G>A (p.T1997=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000727497" "0" "50" "19" "50832287" "50832308" "dup" "0" "02329" "KCNC3_000039" "g.50832287_50832308dup" "" "" "" "KCNC3(NM_004977.3):c.34_55dupGGGCGCCAGGGGGCCAGCAAGC (p.Q19Rfs*89)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000808999" "0" "30" "19" "50813023" "50813023" "subst" "0" "02330" "MYH14_000253" "g.50813023G>T" "" "" "" "MYH14(NM_001145809.2):c.6087G>T (p.G2029=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809000" "0" "30" "19" "50826229" "50826229" "subst" "0.000898195" "01943" "KCNC3_000044" "g.50826229C>T" "" "" "" "KCNC3(NM_004977.2):c.1978+3G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809001" "0" "30" "19" "50826443" "50826443" "subst" "0.000130805" "01943" "KCNC3_000045" "g.50826443G>A" "" "" "" "KCNC3(NM_004977.2):c.1767C>T (p.H589=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809002" "0" "50" "19" "50827126" "50827126" "subst" "4.06062E-6" "01943" "KCNC3_000046" "g.50827126C>T" "" "" "" "KCNC3(NM_004977.2):c.1084G>A (p.E362K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809003" "0" "30" "19" "50832316" "50832316" "subst" "0" "01943" "KCNC3_000047" "g.50832316C>A" "" "" "" "KCNC3(NM_004977.2):c.24G>T (p.S8=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000847188" "0" "50" "19" "50823541" "50823541" "subst" "0" "00006" "KCNC3_000003" "g.50823541C>T" "" "{PMID:Thomas 2022:34085946}" "" "" "" "De novo" "" "" "0" "" "" "g.50320284C>T" "" "VUS" "" "0000855675" "0" "50" "19" "50823906" "50823906" "subst" "4.07193E-6" "02325" "KCNC3_000048" "g.50823906C>T" "" "" "" "KCNC3(NM_004977.3):c.2114G>A (p.R705Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000866244" "0" "30" "19" "50826995" "50826995" "subst" "0.000865861" "01943" "KCNC3_000049" "g.50826995G>A" "" "" "" "KCNC3(NM_004977.2):c.1215C>T (p.A405=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000866245" "0" "50" "19" "50827057" "50827057" "subst" "8.1244E-6" "02327" "KCNC3_000050" "g.50827057C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895098" "0" "30" "19" "50812324" "50812324" "subst" "5.28395E-5" "02330" "MYH14_000270" "g.50812324G>A" "" "" "" "MYH14(NM_001145809.2):c.5850G>A (p.E1950=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895099" "0" "50" "19" "50813025" "50813025" "subst" "0" "02327" "MYH14_000271" "g.50813025C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895100" "0" "50" "19" "50826336" "50826337" "del" "0" "02326" "KCNC3_000051" "g.50826336_50826337del" "" "" "" "KCNC3(NM_004977.3):c.1873_1874delAG (p.R625Gfs*30)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000909265" "11" "90" "19" "50826942" "50826942" "subst" "0" "01164" "KCNC3_000001" "g.50826942C>T" "" "PMID: 25356970, 23734863, 22289912, 19953606, 26795593, 21479265, 28216058, 28467418, 25756792, 33624863" "" "" "ACMG: PS3, PS4, PP3_MOD, PM2_SUP; variant inherited from unaffected father, father has this variant with a VAF of 22%" "Germline" "?" "" "0" "" "" "g.50323685C>T" "" "pathogenic (dominant)" "ACMG" "0000921535" "21" "70" "19" "50826987" "50826987" "subst" "0" "03544" "KCNC3_000052" "g.50826987T>C" "" "" "" "" "inheried from an unaffected mother, suggested incomplete penetrance and variable expressivity" "Germline" "" "rs2037067131" "0" "" "" "g.50323730T>C" "" "likely pathogenic (!)" "ACMG" "0000926933" "0" "50" "19" "50826702" "50826702" "subst" "0" "02327" "KCNC3_000053" "g.50826702G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000927821" "0" "70" "19" "50826607" "50826607" "subst" "0" "03779" "KCNC3_000014" "g.50826607C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000931093" "0" "50" "19" "50812931" "50812931" "subst" "0" "02330" "MYH14_000280" "g.50812931C>T" "" "" "" "MYH14(NM_001145809.2):c.5995C>T (p.R1999C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983610" "0" "50" "19" "50823488" "50823488" "dup" "0" "01804" "KCNC3_000054" "g.50823488dup" "" "" "" "KCNC3(NM_004977.3):c.*20dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000983611" "0" "30" "19" "50824008" "50824008" "subst" "8.164E-5" "01804" "KCNC3_000032" "g.50824008G>A" "" "" "" "KCNC3(NM_004977.2):c.2012C>T (p.A671V), KCNC3(NM_004977.3):c.2012C>T (p.(Ala671Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000983612" "0" "30" "19" "50826333" "50826333" "subst" "3.03265E-5" "01804" "KCNC3_000055" "g.50826333C>A" "" "" "" "KCNC3(NM_004977.3):c.1877G>T (p.(Gly626Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005033" "0" "30" "19" "50819329" "50819329" "subst" "5.124E-5" "01804" "KCNC3_000056" "g.50819329G>A" "" "" "" "KCNC3(NM_004977.2):c.*43C>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005034" "0" "30" "19" "50823858" "50823858" "subst" "0" "01804" "KCNC3_000057" "g.50823858A>T" "" "" "" "KCNC3(NM_004977.2):c.2162T>A (p.(Ile721Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001005035" "0" "50" "19" "50826335" "50826335" "subst" "2.27721E-5" "01804" "KCNC3_000058" "g.50826335C>G" "" "" "" "KCNC3(NM_004977.2):c.1875G>C (p.(Arg625Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005036" "0" "70" "19" "50826621" "50826621" "subst" "0" "01804" "KCNC3_000059" "g.50826621G>A" "" "" "" "KCNC3(NM_004977.2):c.1589C>T (p.(Thr530Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001005037" "0" "50" "19" "50831561" "50831561" "subst" "0" "01804" "KCNC3_000060" "g.50831561C>T" "" "" "" "KCNC3(NM_004977.2):c.779G>A (p.(Gly260Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001005038" "0" "30" "19" "50831721" "50831721" "subst" "0" "01804" "KCNC3_000061" "g.50831721G>C" "" "" "" "KCNC3(NM_004977.2):c.619C>G (p.(Pro207Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001015823" "0" "50" "19" "50810385" "50810385" "subst" "0" "02327" "MYH14_000294" "g.50810385C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043123" "0" "50" "19" "50812350" "50812350" "subst" "8.93764E-5" "01804" "MYH14_000216" "g.50812350G>A" "" "" "" "MYH14(NM_001145809.2):c.5876G>A (p.(Arg1959Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001043124" "0" "30" "19" "50824029" "50824029" "subst" "8.58236E-5" "01804" "KCNC3_000062" "g.50824029T>C" "" "" "" "KCNC3(NM_004977.3):c.1991A>G (p.(Asn664Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043125" "0" "30" "19" "50826335" "50826335" "subst" "0.00010627" "01804" "KCNC3_000063" "g.50826335C>A" "" "" "" "KCNC3(NM_004977.3):c.1875G>T (p.(Arg625Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001043126" "0" "30" "19" "50831649" "50831649" "subst" "0" "01804" "KCNC3_000064" "g.50831649C>T" "" "" "" "KCNC3(NM_004977.3):c.691G>A (p.(Gly231Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001056761" "0" "50" "19" "50823927" "50823927" "subst" "5.2895E-5" "01804" "KCNC3_000065" "g.50823927C>A" "" "" "" "KCNC3(NM_004977.3):c.2093G>T (p.(Arg698Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001057709" "0" "90" "19" "50826927" "50826927" "subst" "0" "00006" "KCNC3_000066" "g.50826927G>A" "" "{PMID:Schnekenberg 2015:25981959}" "" "" "" "De novo" "" "" "0" "" "" "g.50323670G>A" "" "pathogenic (dominant)" "" "0001058795" "0" "90" "19" "50826601" "50826601" "subst" "0" "00006" "KCNC3_000067" "g.50826601C>G" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.50323344C>G" "" "pathogenic" "" "0001067252" "0" "30" "19" "50831554" "50831562" "dup" "0" "02325" "KCNC3_000068" "g.50831554_50831562dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001067253" "0" "50" "19" "50831649" "50831649" "subst" "0" "02325" "KCNC3_000064" "g.50831649C>T" "" "" "" "KCNC3(NM_004977.3):c.691G>A (p.(Gly231Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001069417" "0" "90" "19" "50826942" "50826942" "subst" "" "00006" "KCNC3_000001" "g.50826942C>T" "" "{PMID:Molaei 2025:41315541}" "" "" "ACMG PP1, PS3, PS2, PM2, PP3" "Germline" "" "" "0" "" "" "g.50323685C>T" "SCV006074999.1" "pathogenic" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes KCNC3 ## Count = 121 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000084838" "00010342" "70" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "2" "0000247584" "00010342" "10" "8698" "0" "8698" "0" "c.*6424T>A" "r.(=)" "p.(=)" "" "0000252818" "00010342" "50" "2171" "-26" "2171" "-26" "c.2171-26T>C" "r.(=)" "p.(=)" "" "0000278266" "00010342" "30" "188" "0" "188" "0" "c.188A>G" "r.(?)" "p.(Asp63Gly)" "" "0000280418" "00010342" "10" "9304" "0" "9304" "0" "c.*7030G>A" "r.(=)" "p.(=)" "" "0000281708" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "" "0000281709" "00010342" "10" "188" "0" "188" "0" "c.188A>G" "r.(?)" "p.(Asp63Gly)" "" "0000281710" "00010342" "30" "315" "0" "315" "0" "c.315G>C" "r.(?)" "p.(Thr105=)" "" "0000285474" "00010342" "10" "123" "0" "123" "0" "c.123G>T" "r.(?)" "p.(Gln41His)" "" "0000285475" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "" "0000285476" "00010342" "10" "1404" "0" "1404" "0" "c.1404C>T" "r.(?)" "p.(Tyr468=)" "" "0000285477" "00010342" "50" "1429" "0" "1429" "0" "c.1429G>A" "r.(?)" "p.(Asp477Asn)" "" "0000285478" "00010342" "50" "1603" "0" "1603" "0" "c.1603G>A" "r.(?)" "p.(Val535Met)" "" "0000285479" "00010342" "30" "162" "0" "162" "0" "c.162C>T" "r.(?)" "p.(Gly54=)" "" "0000285480" "00010342" "10" "1641" "0" "1641" "0" "c.1641G>A" "r.(?)" "p.(Ser547=)" "" "0000285481" "00010342" "50" "1771" "0" "1771" "0" "c.1771A>G" "r.(?)" "p.(Ser591Gly)" "" "0000285482" "00010342" "50" "1876" "0" "1876" "0" "c.1876G>T" "r.(?)" "p.(Gly626Trp)" "" "0000285483" "00010342" "30" "1884" "0" "1884" "0" "c.1884G>A" "r.(?)" "p.(Ala628=)" "" "0000285484" "00010342" "10" "188" "0" "188" "0" "c.188A>G" "r.(?)" "p.(Asp63Gly)" "" "0000285485" "00010342" "50" "1927" "0" "1927" "0" "c.1927G>A" "r.(?)" "p.(Gly643Ser)" "" "0000285486" "00010342" "10" "1929" "0" "1929" "0" "c.1929C>T" "r.(?)" "p.(Gly643=)" "" "0000285487" "00010342" "50" "1978" "22" "1978" "22" "c.1978+22C>G" "r.(=)" "p.(=)" "" "0000285488" "00010342" "10" "2170" "14" "2170" "14" "c.2170+14C>T" "r.(=)" "p.(=)" "" "0000285489" "00010342" "50" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Asp746Asn)" "" "0000285490" "00010342" "50" "2256" "0" "2256" "0" "c.2256G>A" "r.(?)" "p.(Ala752=)" "" "0000285491" "00010342" "10" "3626" "0" "3626" "0" "c.*1352A>T" "r.(=)" "p.(=)" "" "0000285492" "00010342" "30" "579" "0" "579" "0" "c.579C>G" "r.(?)" "p.(Arg193=)" "" "0000285493" "00010342" "50" "579" "0" "579" "0" "c.579C>T" "r.(?)" "p.(Arg193=)" "" "0000285494" "00010342" "10" "871" "-21" "871" "-21" "c.871-21C>G" "r.(=)" "p.(=)" "" "0000285495" "00010342" "30" "984" "0" "984" "0" "c.984G>A" "r.(?)" "p.(Pro328=)" "" "0000290028" "00010342" "30" "1641" "0" "1641" "0" "c.1641G>A" "r.(?)" "p.(Ser547=)" "" "0000290029" "00010342" "30" "1884" "0" "1884" "0" "c.1884G>A" "r.(?)" "p.(Ala628=)" "" "0000290030" "00010342" "30" "188" "0" "188" "0" "c.188A>G" "r.(?)" "p.(Asp63Gly)" "" "0000290031" "00010342" "10" "1929" "0" "1929" "0" "c.1929C>T" "r.(?)" "p.(Gly643=)" "" "0000290032" "00010342" "30" "2170" "14" "2170" "14" "c.2170+14C>T" "r.(=)" "p.(=)" "" "0000290033" "00010342" "30" "315" "0" "315" "0" "c.315G>C" "r.(?)" "p.(Thr105=)" "" "0000290034" "00010342" "10" "649" "0" "649" "0" "c.649G>A" "r.(?)" "p.(Ala217Thr)" "" "0000290035" "00010342" "10" "984" "0" "984" "0" "c.984G>A" "r.(?)" "p.(Pro328=)" "" "0000292471" "00010342" "50" "9284" "0" "9284" "0" "c.*7010C>T" "r.(=)" "p.(=)" "" "0000326744" "00010342" "50" "1696" "0" "1696" "0" "c.1696C>T" "r.(?)" "p.(Pro566Ser)" "" "0000342878" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "" "0000342884" "00010342" "50" "1286" "0" "1286" "0" "c.1286G>A" "r.(?)" "p.(Arg429Gln)" "" "0000348050" "00010342" "90" "1342" "0" "1342" "0" "c.1342T>C" "r.(?)" "p.(Phe448Leu)" "" "0000348509" "00010342" "50" "1706" "0" "1706" "0" "c.1706C>T" "r.(?)" "p.(Pro569Leu)" "" "0000350582" "00010342" "50" "1609" "0" "1609" "0" "c.1609G>A" "r.(?)" "p.(Val537Ile)" "" "0000350757" "00010342" "30" "11227" "0" "11227" "0" "c.*8953C>A" "r.(=)" "p.(=)" "" "0000568161" "00010342" "50" "9314" "0" "9314" "0" "c.*7040C>T" "r.(=)" "p.(=)" "" "0000568162" "00010342" "50" "8652" "0" "8652" "0" "c.*6378C>T" "r.(=)" "p.(=)" "" "0000568163" "00010342" "30" "8621" "0" "8622" "0" "c.*6347_*6348insGGGC" "r.(=)" "p.(=)" "" "0000568166" "00010342" "30" "8617" "0" "8617" "0" "c.*6343T>G" "r.(=)" "p.(=)" "" "0000568167" "00010342" "30" "8614" "0" "8614" "0" "c.*6340T>G" "r.(=)" "p.(=)" "" "0000568168" "00010342" "30" "8613" "0" "8614" "0" "c.*6339_*6340del" "r.(=)" "p.(=)" "" "0000568169" "00010342" "30" "8613" "0" "8614" "0" "c.*6339_*6340del" "r.(=)" "p.(=)" "" "0000568170" "00010342" "30" "8613" "0" "8613" "0" "c.*6339C>G" "r.(=)" "p.(=)" "" "0000568171" "00010342" "30" "8613" "0" "8613" "0" "c.*6339C>G" "r.(=)" "p.(=)" "" "0000568172" "00010342" "30" "8609" "0" "8609" "0" "c.*6335T>G" "r.(=)" "p.(=)" "" "0000568174" "00010342" "30" "8599" "0" "8603" "0" "c.*6325_*6329del" "r.(=)" "p.(=)" "" "0000568175" "00010342" "30" "8599" "0" "8603" "0" "c.*6325_*6329del" "r.(=)" "p.(=)" "" "0000568176" "00010342" "30" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Asp746Asn)" "" "0000568177" "00010342" "30" "2093" "0" "2093" "0" "c.2093G>A" "r.(?)" "p.(Arg698His)" "" "0000568178" "00010342" "30" "2013" "0" "2013" "0" "c.2013G>A" "r.(?)" "p.(Ala671=)" "" "0000568179" "00010342" "50" "2012" "0" "2012" "0" "c.2012C>T" "r.(?)" "p.(Ala671Val)" "" "0000568182" "00010342" "50" "1405" "0" "1405" "0" "c.1405G>A" "r.(?)" "p.(Ala469Thr)" "" "0000568183" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "" "0000568184" "00010342" "90" "1259" "0" "1259" "0" "c.1259G>A" "r.(?)" "p.(Arg420His)" "" "0000568185" "00010342" "90" "1259" "0" "1259" "0" "c.1259G>A" "r.(?)" "p.(Arg420His)" "" "0000568186" "00010342" "50" "1259" "0" "1259" "0" "c.1259G>A" "r.(?)" "p.(Arg420His)" "" "0000568187" "00010342" "90" "1259" "0" "1259" "0" "c.1259G>A" "r.(?)" "p.(Arg420His)" "" "0000568188" "00010342" "30" "1032" "0" "1032" "0" "c.1032G>A" "r.(?)" "p.(Thr344=)" "" "0000568189" "00010342" "30" "1002" "0" "1002" "0" "c.1002G>A" "r.(?)" "p.(Pro334=)" "" "0000568190" "00010342" "50" "642" "0" "650" "0" "c.642_650dup" "r.(?)" "p.(Asn215_Ala217dup)" "" "0000617825" "00010342" "30" "8621" "0" "8622" "0" "c.*6347_*6348insGC" "r.(=)" "p.(=)" "" "0000617826" "00010342" "30" "8621" "0" "8622" "0" "c.*6347_*6348insGGGC" "r.(=)" "p.(=)" "" "0000624064" "00010342" "30" "8622" "0" "8622" "0" "c.*6348A>T" "r.(=)" "p.(=)" "" "0000624065" "00010342" "30" "2061" "0" "2061" "0" "c.2061G>T" "r.(?)" "p.(Pro687=)" "" "0000624066" "00010342" "30" "1771" "0" "1771" "0" "c.1771A>G" "r.(?)" "p.(Ser591Gly)" "" "0000624067" "00010342" "50" "34" "0" "55" "0" "c.34_55dup" "r.(?)" "p.(Gln19ArgfsTer89)" "" "0000658644" "00010342" "50" "1719" "0" "1719" "0" "c.1719C>G" "r.(?)" "p.(Asn573Lys)" "" "0000658645" "00010342" "30" "1032" "0" "1032" "0" "c.1032G>T" "r.(?)" "p.(Thr344=)" "" "0000667528" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "" "0000681491" "00010342" "30" "1293" "0" "1293" "0" "c.1293C>T" "r.(?)" "p.(Phe431=)" "" "0000681492" "00010342" "30" "127" "0" "127" "0" "c.127C>T" "r.(?)" "p.(Pro43Ser)" "" "0000727496" "00010342" "30" "8719" "0" "8719" "0" "c.*6445C>T" "r.(=)" "p.(=)" "" "0000727497" "00010342" "50" "34" "0" "55" "0" "c.34_55dup" "r.(?)" "p.(Gln19ArgfsTer89)" "" "0000808999" "00010342" "30" "8623" "0" "8623" "0" "c.*6349C>A" "r.(=)" "p.(=)" "" "0000809000" "00010342" "30" "1978" "3" "1978" "3" "c.1978+3G>A" "r.spl?" "p.?" "" "0000809001" "00010342" "30" "1767" "0" "1767" "0" "c.1767C>T" "r.(?)" "p.(His589=)" "" "0000809002" "00010342" "50" "1084" "0" "1084" "0" "c.1084G>A" "r.(?)" "p.(Glu362Lys)" "" "0000809003" "00010342" "30" "24" "0" "24" "0" "c.24G>T" "r.(?)" "p.(Ser8=)" "" "0000847188" "00010342" "50" "2236" "0" "2236" "0" "c.2236G>A" "r.(?)" "p.(Asp746Asn)" "" "0000855675" "00010342" "50" "2114" "0" "2114" "0" "c.2114G>A" "r.(?)" "p.(Arg705Gln)" "" "0000866244" "00010342" "30" "1215" "0" "1215" "0" "c.1215C>T" "r.(?)" "p.(Ala405=)" "" "0000866245" "00010342" "50" "1153" "0" "1153" "0" "c.1153G>A" "r.(?)" "p.(Asp385Asn)" "" "0000895098" "00010342" "30" "9322" "0" "9322" "0" "c.*7048C>T" "r.(=)" "p.(=)" "" "0000895099" "00010342" "50" "8621" "0" "8621" "0" "c.*6347G>T" "r.(=)" "p.(=)" "" "0000895100" "00010342" "50" "1873" "0" "1874" "0" "c.1873_1874del" "r.(?)" "p.(Arg625Glyfs*30)" "" "0000909265" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.spl?" "p.(Arg423His)" "" "0000921535" "00010342" "70" "1223" "0" "1223" "0" "c.1223A>G" "r.(?)" "p.(Asp408Gly)" "" "0000926933" "00010342" "50" "1508" "0" "1508" "0" "c.1508C>A" "r.(?)" "p.(Thr503Asn)" "" "0000927821" "00010342" "70" "1603" "0" "1603" "0" "c.1603G>A" "r.(?)" "p.(Val535Met)" "" "0000931093" "00010342" "50" "8715" "0" "8715" "0" "c.*6441G>A" "r.(=)" "p.(=)" "" "0000983610" "00010342" "50" "2294" "0" "2294" "0" "c.*20dup" "r.(?)" "p.(=)" "" "0000983611" "00010342" "30" "2012" "0" "2012" "0" "c.2012C>T" "r.(?)" "p.(Ala671Val)" "" "0000983612" "00010342" "30" "1877" "0" "1877" "0" "c.1877G>T" "r.(?)" "p.(Gly626Val)" "" "0001005033" "00010342" "30" "2317" "0" "2317" "0" "c.*43C>T" "r.(=)" "p.(=)" "" "0001005034" "00010342" "30" "2162" "0" "2162" "0" "c.2162T>A" "r.(?)" "p.(Ile721Asn)" "" "0001005035" "00010342" "50" "1875" "0" "1875" "0" "c.1875G>C" "r.(?)" "p.(Arg625Ser)" "" "0001005036" "00010342" "70" "1589" "0" "1589" "0" "c.1589C>T" "r.(?)" "p.(Thr530Ile)" "" "0001005037" "00010342" "50" "779" "0" "779" "0" "c.779G>A" "r.(?)" "p.(Gly260Asp)" "" "0001005038" "00010342" "30" "619" "0" "619" "0" "c.619C>G" "r.(?)" "p.(Pro207Ala)" "" "0001015823" "00010342" "50" "11261" "0" "11261" "0" "c.*8987G>A" "r.(=)" "p.(=)" "" "0001043123" "00010342" "50" "9296" "0" "9296" "0" "c.*7022C>T" "r.(=)" "p.(=)" "" "0001043124" "00010342" "30" "1991" "0" "1991" "0" "c.1991A>G" "r.(?)" "p.(Asn664Ser)" "" "0001043125" "00010342" "30" "1875" "0" "1875" "0" "c.1875G>T" "r.(?)" "p.(Arg625Ser)" "" "0001043126" "00010342" "30" "691" "0" "691" "0" "c.691G>A" "r.(?)" "p.(Gly231Ser)" "" "0001056761" "00010342" "50" "2093" "0" "2093" "0" "c.2093G>T" "r.(?)" "p.(Arg698Leu)" "" "0001057709" "00010342" "90" "1283" "0" "1283" "0" "c.1283C>T" "r.(?)" "p.(Thr428Ile)" "" "0001058795" "00010342" "90" "1609" "0" "1609" "0" "c.1609G>C" "r.(?)" "p.(Val537Leu)" "" "0001067252" "00010342" "30" "790" "0" "798" "0" "c.790_798dup" "r.(?)" "p.(Ala264_Gly266dup)" "" "0001067253" "00010342" "50" "691" "0" "691" "0" "c.691G>A" "r.(?)" "p.(Gly231Ser)" "" "0001069417" "00010342" "90" "1268" "0" "1268" "0" "c.1268G>A" "r.(?)" "p.(Arg423His)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 8 "{{screeningid}}" "{{variantid}}" "0000054822" "0000084838" "0000304130" "0000667528" "0000409934" "0000847188" "0000429669" "0000909265" "0000435523" "0000921535" "0000469664" "0001057709" "0000470673" "0001058795" "0000475019" "0001069417"