### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = KCNJ13) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "KCNJ13" "potassium inwardly-rectifying channel, subfamily J, member 13" "2" "q37" "unknown" "NG_016742.1" "UD_132085297898" "" "http://www.LOVD.nl/KCNJ13" "" "1" "6259" "3769" "603208" "1" "1" "1" "1" "This database is one of the \"Eye disease\" gene variant databases." "" "g" "http://databases.lovd.nl/shared/refseq/KCNJ13_NM_002242.4_codingDNA.html" "1" "" "This database is one of the \"Eye disease\" gene variant databases." "-1" "" "-1" "00001" "2012-07-16 00:00:00" "00006" "2015-03-14 18:30:49" "00000" "2025-11-01 13:22:20" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00010382" "KCNJ13" "transcript variant 1" "003" "NM_002242.4" "" "NP_002233.2" "" "" "" "-137" "3472" "1083" "233641275" "233630512" "" "0000-00-00 00:00:00" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 6 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "01601" "SVD" "vitreoretinal degeneration, snwoflake type (SVD)" "AD" "193230" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03573" "LCA16" "Leber congenital amaurosis, type 16 (LCA-16)" "AR" "614186" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04210" "LCA" "Leber congenital amaurosis (LCA)" "" "" "" "" "" "00006" "2015-02-27 18:57:11" "" "" "04211" "RPar" "retinitis pigmentosa, autosomal recessive (RPar)" "" "" "" "" "" "00006" "2015-02-27 18:58:57" "" "" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04226" "-" "dystrophy, vitreoretinal, with early-onset cataract" "" "" "" "" "" "00006" "2015-03-14 20:52:38" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "KCNJ13" "01601" "KCNJ13" "03573" ## Individuals ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00034370" "" "" "" "13" "" "00006" "{PMID:Hejtmancik 2008:18179896}" "multi-generation family, 13 affecteds" "" "" "United States" "" "0" "" "" "European, white" "" "00034371" "" "" "" "2" "" "00006" "{PMID:Sergouniotis 2011:21763485}" "5-generation family, 2 affected males, unaffacted heterozygous carrier parents" "M" "yes" "" "" "0" "" "" "Middle East" "" "00034372" "" "" "" "1" "" "00006" "{PMID:Sergouniotis 2011:21763485}" "3-generation family, affected male, unaffected heterozygous carrier parents" "M" "no" "United Kingdom (Great Britain)" "" "0" "" "" "European, white" "" "00034373" "" "" "" "1" "" "00006" "{PMID:Sergouniotis 2011:21763485}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00034374" "" "" "" "2" "" "00006" "{PMID:Sergouniotis 2011:21763485}" "1 consanguineous case" "" "" "Turkey" "" "0" "" "" "" "" "00034375" "" "" "" "1" "" "00006" "{PMID:Sergouniotis 2011:21763485}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "Asia, south" "" "00034376" "" "" "" "2" "" "00006" "{PMID:Khan 2015:25475713}" "2-generation family, 2 affecteds (2F), unaffected heterozygous carrier parents" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "" "00034377" "" "" "" "1" "" "00006" "{PMID:Khan 2015:25475713}" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "" "00332228" "" "" "" "1" "" "00000" "{PMID:Bryant 2018:29343940}" "" "" "" "United States" "" "0" "" "" "" "JB23" "00333471" "" "" "" "1" "" "00000" "{PMID:Soens 2017:28714225}" "possible duplicate" "" "" "" "" "0" "" "" "" "1302" "00363573" "" "" "" "1" "" "00000" "{PMID:Patel 2016:26355662}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "08DG-00236" "00386718" "" "" "" "1" "" "00000" "{PMID:Zampaglione 2020:32037395}" "" "?" "" "" "" "0" "" "" "" "OGI2852_004437" "00390026" "" "" "" "1" "" "00000" "{PMID:Ruberto 2020:32507954}" "" "?" "" "Italy" "" "0" "" "" "" "5" "00390947" "" "" "" "1" "" "00000" "{PMID:Maggi_2021:33546218}" "" "F" "" "Switzerland" "" "0" "" "" "" "" "00391350" "" "" "" "1" "" "00000" "{PMID:Méjécase 2020:3278337" "" "?" "" "United Arab Emirates" "" "0" "" "" "" "6" "00407691" "" "" "" "1" "" "00000" "{PMID:Pattnaik 2015:25921210}" "" "M" "" "Jordan" "" "0" "" "" "" "II:2" "00407692" "" "" "" "1" "" "00000" "{PMID:Perez-Roustit 2016:27203561}" "" "M" "" "Jordan" "" "0" "" "" "" "II:2" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 17 "{{individualid}}" "{{diseaseid}}" "00034370" "01601" "00034371" "04210" "00034372" "04210" "00034373" "04210" "00034374" "04211" "00034375" "04211" "00034376" "04226" "00034377" "04226" "00332228" "04214" "00333471" "04214" "00363573" "04214" "00386718" "04214" "00390026" "04214" "00390947" "04214" "00391350" "04214" "00407691" "04214" "00407692" "04214" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 01601, 03573, 04210, 04211, 04214, 04226 ## Count = 17 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "0000027766" "01601" "00034370" "00006" "Familial, autosomal dominant" "" "see paper; affecteds 12-85y, fibrillar degeneration vitreous humor, early-onset cataract, minute crystalline deposits neurosensory retina, retinal detachment" "" "" "" "" "" "" "" "" "" "0000027767" "04210" "00034371" "00006" "Familial, autosomal recessive" "" "see paper; nystagmus, poor night vision, difficulty reading print, bilateral cataract" "" "" "" "" "" "" "" "" "" "0000027768" "04210" "00034372" "00006" "Isolated (sporadic)" "33y" "see paper; strabismus, nystagmus, poor vision, bilateral cataract, ..." "" "" "" "" "" "" "" "" "" "0000027769" "04210" "00034373" "00006" "Unknown" "" "arly onset retinal dystrophy, heavily pigmented fundi" "" "" "" "" "" "" "" "" "" "0000027770" "04211" "00034374" "00006" "Familial, autosomal recessive" "" "adult onset RP, night blind, field of vision\r\nreduced to <10 degrees" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "0000027772" "04211" "00034375" "00006" "Familial, autosomal recessive" "" "adult onset RP" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "0000027773" "04226" "00034376" "00006" "Isolated (sporadic)" "12y" "nystagmus since birth, decreased\r\nvision, total white cataract (right eye); left eye posterior cortical lenticular opacities, unusual retina fundus dystrophic appearance notable for fibrosis over optic disc, clumped pigmentation" "" "" "" "" "" "" "" "" "" "0000027774" "04226" "00034377" "00006" "Isolated (sporadic)" "33y" "early-childhood-onset retinal dystrophy, early-adult-onset cataract, decreased vision, ..." "" "" "" "" "" "" "" "" "" "0000250415" "04214" "00332228" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "0000251656" "04214" "00333471" "00000" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "Leber congenital amaurosis" "0000258923" "04214" "00363573" "00000" "Familial" "" "non-syndromic" "" "" "" "" "" "" "" "" "retinitis pigmentosa, cone-rod dystrophy" "0000280518" "04214" "00386718" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "" "retinal disease" "0000283566" "04214" "00390026" "00000" "Unknown" "11m" "optic disk hypoplasia, surrounded by a depigmented halo, macular hyperpigmentation, hypopigmented peripheral retina with dark pigmented spots, highly altered fundus" "" "" "" "" "" "" "" "Retinal dystrophy" "" "0000284435" "04214" "00390947" "00000" "Familial, autosomal recessive" "21y-25y" "" "" "" "" "" "" "" "" "" "Stargardt’s disease (STGD)" "0000284790" "04214" "00391350" "00000" "Unknown" "" "" "" "" "" "" "" "" "" "Leber congenital amaurosis 16 (614186)" "Leber congenital amaurosis 16 (614186)" "0000299838" "04214" "00407691" "00000" "Familial, autosomal recessive" "" "best corrected visual acuity right, left eye: 20/200, 20/400; fundus examination: retinal pigment epithelium mottling in the macula of both eyes, as well as arteriolar attenuation 10y: best corrected visual acuity right, left eye: 3/60, counting fingers; retinal examination: arteriolar abnormalities, pigmentation of the retina in the macular region, and bilateral retinal pigment epithelium anomalies; optical coherence tomography: retina appeared intact with clearly visible high contrast bands representing the internal limiting membrane, nerve fiber layer, inner plexiform layer, and the outer plexiform layer; thin, high contrast single layer corresponding to the retinal pigment epithelium was also present; spectral domain OCT - only one band was visualized (degeneration of the outer retina), clearly visible areas of hypertrophy in the choroidal structure, small sub-retinal pigment epithelium focal deposits" "2y" "8y" "" "mutation alters the Kir7.1 channel current" "" "" "" "Leber congenital amaurosis" "Stargardt disease or retinitis pigmentosa or cone-rod dystrophy or Leber congenital amaurosis" "0000299839" "04214" "00407692" "00000" "Familial, autosomal recessive" "31y" "nystagmus since childhood, best corrected visual acuity right, left eye: 20/400, 20/200, cataracts extracted in both eyes; clumpy pigment deposits, mostly in macular area, causing an uneven line of retinal pigment epithelium on spectral domain optical coherence tomography; increased retinal thickness in retinal parts devoid of pigment deposits around the optic disk and in periphery; hyperreflective formations either in the inner nuclear layer or in the outer nuclear layer" "" "" "" "mutation alters the Kir7.1 channel current" "" "" "" "Leber congenital amaurosis" "Stargardt disease or retinitis pigmentosa or cone-rod dystrophy or Leber congenital amaurosis" ## Screenings ## Do not remove or alter this header ## ## Count = 17 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000034439" "00034370" "1" "00006" "00006" "2015-03-14 18:56:41" "" "" "SEQ" "DNA" "" "" "0000034440" "00034371" "1" "00006" "00006" "2015-03-14 19:07:02" "" "" "SEQ" "DNA" "" "" "0000034441" "00034372" "1" "00006" "00006" "2015-03-14 19:14:02" "" "" "SEQ" "DNA" "" "" "0000034442" "00034373" "1" "00006" "00006" "2015-03-14 19:26:35" "" "" "SEQ" "DNA" "" "" "0000034443" "00034374" "1" "00006" "00006" "2015-03-14 19:31:34" "" "" "SEQ" "DNA" "" "" "0000034444" "00034375" "1" "00006" "00006" "2015-03-14 20:27:38" "" "" "SEQ" "DNA" "" "" "0000034445" "00034376" "1" "00006" "00006" "2015-03-14 20:56:17" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000034446" "00034377" "1" "00006" "00006" "2015-03-14 21:00:11" "" "" "SEQ" "DNA" "" "" "0000333448" "00332228" "1" "00000" "00006" "2021-02-15 18:54:26" "" "" "SEQ-NG" "DNA" "" "WES" "0000334696" "00333471" "1" "00000" "00006" "2021-02-25 16:04:58" "" "" "SEQ" "DNA" "" "" "0000364801" "00363573" "1" "00000" "00006" "2021-04-29 16:11:05" "" "" "SEQ-NG" "DNA" "" "gene panel" "0000387946" "00386718" "1" "00000" "03840" "2021-10-26 11:33:19" "" "" "SEQ-NG-I;SEQ" "DNA" "blood" "" "0000391267" "00390026" "1" "00000" "03840" "2021-11-08 12:01:50" "" "" "SEQ-NG" "DNA" "" "targeted sequencing with 1 of 4 panels of OFTALMOgenics probes" "0000392188" "00390947" "1" "00000" "00008" "2021-11-11 21:56:08" "" "" "SEQ" "DNA" "" "" "0000392592" "00391350" "1" "00000" "03840" "2021-11-15 18:02:17" "" "" "SEQ-NG" "DNA" "" "retrospective case note review, targeted gene panel testing" "0000408943" "00407691" "1" "00000" "03840" "2022-04-07 19:16:16" "" "" "SEQ" "DNA" "blood" "" "0000408944" "00407692" "1" "00000" "03840" "2022-04-07 19:59:47" "" "" "SEQ" "DNA" "blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 16 "{{screeningid}}" "{{geneid}}" "0000034439" "KCNJ13" "0000034440" "KCNJ13" "0000034441" "KCNJ13" "0000034442" "KCNJ13" "0000034443" "KCNJ13" "0000034444" "KCNJ13" "0000034445" "KCNJ13" "0000034446" "KCNJ13" "0000334696" "KCNJ13" "0000364801" "KCNJ13" "0000387946" "KCNJ13" "0000391267" "KCNJ13" "0000392188" "KCNJ13" "0000392592" "KCNJ13" "0000408943" "KCNJ13" "0000408944" "KCNJ13" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 95 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000061452" "1" "90" "2" "233633500" "233633500" "subst" "4.10317E-6" "00006" "KCNJ13_000002" "g.233633500G>A" "" "{PMID:Hejtmancik 2008:18179896}, {OMIM:603208:0001}" "" "" "mapped by linkage analysis, candidate gene sequencing; not in 420 control chromosomes" "Germline" "yes" "rs121918542" "0" "" "" "g.232768790G>A" "" "pathogenic" "" "0000061453" "3" "90" "2" "233633488" "233633488" "subst" "0" "00006" "KCNJ13_000003" "g.233633488G>A" "" "{PMID:Sergouniotis 2011:21763485}, {OMIM:603208:0002}" "" "" "homozygosity mapping" "Germline" "yes" "" "0" "" "" "g.232768778G>A" "" "pathogenic" "" "0000061454" "3" "90" "2" "233633262" "233633262" "subst" "0" "00006" "KCNJ13_000004" "g.233633262A>G" "" "{PMID:Sergouniotis 2011:21763485}, {OMIM:603208:0003}" "" "" "not in 382 control chromomes" "Germline" "yes" "rs143607153" "0" "" "" "g.232768552A>G" "" "pathogenic" "" "0000061455" "0" "70" "2" "233635723" "233635723" "subst" "0" "00006" "KCNJ13_000005" "g.233635723T>C" "1/335 cases" "{PMID:Sergouniotis 2011:21763485}" "" "" "not in 382 control chromosomes; in heterozygous state not disease associated" "Unknown" "" "" "0" "" "" "g.232771013T>C" "" "likely pathogenic" "" "0000061456" "0" "70" "2" "233633499" "233633499" "subst" "0.000283363" "00006" "KCNJ13_000006" "g.233633499C>T" "2/335 cases" "{PMID:Sergouniotis 2011:21763485}" "" "" "not in 380 control chromosomes; in heterozygous state not associated with phenotype" "Unknown" "" "" "0" "" "" "g.232768789C>T" "" "likely pathogenic" "" "0000061457" "0" "70" "2" "233633157" "233633157" "subst" "0.000370102" "00006" "KCNJ13_000007" "g.233633157T>G" "1/335 cases" "{PMID:Sergouniotis 2011:21763485}" "" "" "not in 380 control chromosomes; in heterozygous state not associated with phe" "Unknown" "" "" "0" "" "" "g.232768447T>G" "" "likely pathogenic" "" "0000061458" "0" "10" "2" "233633460" "233633460" "subst" "0.349993" "00006" "KCNJ13_000008" "g.233633460G>A" "" "{PMID:Sergouniotis 2011:21763485}" "" "" "" "Unknown" "" "rs180125" "0" "" "" "g.232768750G>A" "" "benign" "" "0000061459" "0" "10" "2" "233633460" "233633460" "subst" "0.349993" "00006" "KCNJ13_000008" "g.233633460G>A" "321/1052 chromosomes" "{PMID:Sergouniotis 2011:21763485}" "" "" "212/670 recessive retianl disease, 109/382 control chromosomes" "Unknown" "" "rs1801251" "0" "" "" "g.232768750G>A" "" "benign" "" "0000061460" "3" "70" "2" "233635714" "233635714" "subst" "0" "00006" "KCNJ13_000009" "g.233635714A>G" "" "{PMID:Khan 2015:25475713}" "" "" "" "Germline" "yes" "" "0" "" "" "g.232771004A>G" "" "likely pathogenic" "" "0000061461" "3" "90" "2" "233635714" "233635714" "subst" "0" "00006" "KCNJ13_000009" "g.233635714A>G" "" "{PMID:Khan 2015:25475713}" "" "" "" "Germline" "yes" "" "0" "" "" "g.232771004A>G" "" "pathogenic" "" "0000245938" "0" "10" "2" "233632887" "233632887" "subst" "6.10128E-5" "02330" "GIGYF2_000005" "g.233632887A>G" "" "" "" "KCNJ13(NM_002242.4):c.*14T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232768177A>G" "" "benign" "" "0000247890" "0" "10" "2" "233708806" "233708806" "subst" "0.648984" "02325" "GIGYF2_000013" "g.233708806A>G" "" "" "" "GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_001103147.2):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.4):c.2940A>G (p.Q980=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232844096A>G" "" "benign" "" "0000249868" "0" "10" "2" "233708806" "233708806" "subst" "0.648984" "02329" "GIGYF2_000013" "g.233708806A>G" "" "" "" "GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_001103147.2):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.4):c.2940A>G (p.Q980=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232844096A>G" "" "benign" "" "0000253092" "0" "10" "2" "233708806" "233708806" "subst" "0.648984" "01943" "GIGYF2_000013" "g.233708806A>G" "" "" "" "GIGYF2(NM_001103147.1):c.3003A>G (p.Q1001=), GIGYF2(NM_001103147.2):c.3003A>G (p.Q1001=), GIGYF2(NM_015575.4):c.2940A>G (p.Q980=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232844096A>G" "" "benign" "" "0000253661" "0" "10" "2" "233712244" "233712244" "subst" "0" "01943" "GIGYF2_000023" "g.233712244A>C" "" "" "" "GIGYF2(NM_015575.3):c.3647A>C (p.Q1216P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847534A>C" "" "benign" "" "0000253761" "0" "10" "2" "233599904" "233599904" "subst" "0.349985" "01943" "GIGYF2_000001" "g.233599904A>C" "" "" "" "GIGYF2(NM_001103147.1):c.-4A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232735194A>C" "" "benign" "" "0000254199" "0" "30" "2" "233712227" "233712227" "subst" "0" "01943" "GIGYF2_000021" "g.233712227A>G" "" "" "" "GIGYF2(NM_001103147.1):c.3693A>G (p.P1231=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847517A>G" "" "likely benign" "" "0000254893" "0" "30" "2" "233712235" "233712235" "subst" "0" "01943" "GIGYF2_000022" "g.233712235A>C" "" "" "" "GIGYF2(NM_015575.3):c.3638A>C (p.Q1213P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847525A>C" "" "likely benign" "" "0000254894" "0" "30" "2" "233712274" "233712274" "subst" "0" "01943" "GIGYF2_000025" "g.233712274A>C" "" "" "" "GIGYF2(NM_001103147.1):c.3740A>C (p.Q1247P)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847564A>C" "" "likely benign" "" "0000278357" "0" "50" "2" "233633295" "233633295" "subst" "0.000264191" "02330" "GIGYF2_000006" "g.233633295C>T" "" "" "" "KCNJ13(NM_002242.4):c.689G>A (p.S230N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232768585C>T" "" "VUS" "" "0000281035" "0" "10" "2" "233712049" "233712049" "subst" "0.641625" "02325" "GIGYF2_000015" "g.233712049G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_015575.4):c.3461-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847339G>A" "" "benign" "" "0000281036" "0" "10" "2" "233712248" "233712248" "subst" "0" "02325" "GIGYF2_000024" "g.233712248G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_001103147.2):c.3714G>A (p.P1238=), GIGYF2(NM_015575.4):c.3651G>A (p.P1217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847538G>A" "" "benign" "" "0000281037" "0" "10" "2" "233712296" "233712296" "subst" "0.649909" "02325" "GIGYF2_000026" "g.233712296G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_015575.4):c.3684+15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847586G>A" "" "benign" "" "0000283361" "0" "30" "2" "233659553" "233659553" "subst" "0.0543887" "02329" "GIGYF2_000009" "g.233659553C>A" "" "" "" "GIGYF2(NM_001103147.2):c.1441C>A (p.P481T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232794843C>A" "" "likely benign" "" "0000283362" "0" "10" "2" "233712049" "233712049" "subst" "0.641625" "02329" "GIGYF2_000015" "g.233712049G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_015575.4):c.3461-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847339G>A" "" "benign" "" "0000283363" "0" "10" "2" "233712248" "233712248" "subst" "0" "02329" "GIGYF2_000024" "g.233712248G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_001103147.2):c.3714G>A (p.P1238=), GIGYF2(NM_015575.4):c.3651G>A (p.P1217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847538G>A" "" "benign" "" "0000283364" "0" "10" "2" "233712296" "233712296" "subst" "0.649909" "02329" "GIGYF2_000026" "g.233712296G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_015575.4):c.3684+15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847586G>A" "" "benign" "" "0000283365" "0" "30" "2" "233712223" "233712243" "del" "0" "02329" "GIGYF2_000016" "g.233712223_233712243del" "" "" "" "GIGYF2(NM_001103147.2):c.3689_3709delTGCCACAGCAGCAGCAGCAGC (p.L1230_Q1236del), GIGYF2(NM_015575.4):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847513_232847533del" "" "likely benign" "" "0000283368" "0" "30" "2" "233655513" "233655513" "subst" "0.000162467" "02329" "GIGYF2_000007" "g.233655513C>T" "" "" "" "GIGYF2(NM_001103147.2):c.884C>T (p.S295F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232790803C>T" "" "likely benign" "" "0000288321" "0" "30" "2" "233612385" "233612385" "subst" "8.13008E-6" "01943" "GIGYF2_000002" "g.233612385G>A" "" "" "" "GIGYF2(NM_001103147.1):c.102G>A (p.P34=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232747675G>A" "" "likely benign" "" "0000288322" "0" "30" "2" "233656112" "233656112" "subst" "0" "01943" "GIGYF2_000008" "g.233656112G>A" "" "" "" "GIGYF2(NM_001103147.1):c.1301G>A (p.R434Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232791402G>A" "" "likely benign" "" "0000288323" "0" "30" "2" "233671277" "233671277" "subst" "0.00491813" "01943" "GIGYF2_000010" "g.233671277G>T" "" "" "" "GIGYF2(NM_001103147.1):c.1779G>T (p.A593=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232806567G>T" "" "likely benign" "" "0000288325" "0" "30" "2" "233704627" "233704627" "subst" "0.00296142" "01943" "GIGYF2_000012" "g.233704627G>T" "" "" "" "GIGYF2(NM_015575.3):c.2835G>T (p.S945=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232839917G>T" "" "likely benign" "" "0000288326" "0" "50" "2" "233709083" "233709083" "subst" "0.000934101" "01943" "GIGYF2_000014" "g.233709083C>G" "" "" "" "GIGYF2(NM_001103146.3):c.3104C>G (p.S1035C), GIGYF2(NM_015575.3):c.3104C>G (p.S1035C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232844373C>G" "" "VUS" "" "0000288327" "0" "30" "2" "233621004" "233621004" "subst" "0" "01943" "GIGYF2_000003" "g.233621004G>C" "" "" "" "GIGYF2(NM_015575.3):c.339G>C (p.V113=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232756294G>C" "" "likely benign" "" "0000288328" "0" "10" "2" "233712049" "233712049" "subst" "0.641625" "01943" "GIGYF2_000015" "g.233712049G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3524-9G>A, GIGYF2(NM_015575.4):c.3461-9G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847339G>A" "" "benign" "" "0000288329" "0" "50" "2" "233621014" "233621014" "subst" "5.36682E-5" "01943" "GIGYF2_000004" "g.233621014C>T" "" "" "" "GIGYF2(NM_015575.3):c.349C>T (p.P117S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232756304C>T" "" "VUS" "" "0000288331" "0" "10" "2" "233712248" "233712248" "subst" "0" "01943" "GIGYF2_000024" "g.233712248G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3714G>A (p.P1238=), GIGYF2(NM_001103147.2):c.3714G>A (p.P1238=), GIGYF2(NM_015575.4):c.3651G>A (p.P1217=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847538G>A" "" "benign" "" "0000288332" "0" "10" "2" "233712296" "233712296" "subst" "0.649909" "01943" "GIGYF2_000026" "g.233712296G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3747+15G>A, GIGYF2(NM_015575.4):c.3684+15G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847586G>A" "" "benign" "" "0000288334" "0" "50" "2" "233712226" "233712227" "ins" "0" "01943" "GIGYF2_000020" "g.233712226_233712227insGCA" "" "" "" "GIGYF2(NM_001103147.1):c.3693_3695delACAinsGCAACA (p.Q1237dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232847516_232847517insGCA" "" "VUS" "" "0000288335" "0" "30" "2" "233715061" "233715061" "subst" "0.000682228" "01943" "GIGYF2_000027" "g.233715061G>A" "" "" "" "GIGYF2(NM_001103147.1):c.3837G>A (p.V1279=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232850351G>A" "" "likely benign" "" "0000290062" "0" "50" "2" "233633157" "233633157" "subst" "0.000370102" "01943" "KCNJ13_000007" "g.233633157T>G" "" "" "" "KCNJ13(NM_002242.4):c.827A>C (p.E276A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.232768447T>G" "" "VUS" "" "0000515113" "0" "30" "2" "233612356" "233612356" "subst" "0.000455166" "01943" "GIGYF2_000028" "g.233612356A>G" "" "" "" "GIGYF2(NM_015575.3):c.73A>G (p.T25A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232747646A>G" "" "likely benign" "" "0000515114" "0" "30" "2" "233612450" "233612450" "subst" "0.000256243" "01943" "GIGYF2_000029" "g.233612450A>G" "" "" "" "GIGYF2(NM_015575.3):c.167A>G (p.N56S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232747740A>G" "" "likely benign" "" "0000515115" "0" "30" "2" "233633295" "233633295" "subst" "0.000264191" "01943" "GIGYF2_000006" "g.233633295C>T" "" "" "" "KCNJ13(NM_002242.4):c.689G>A (p.S230N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232768585C>T" "" "likely benign" "" "0000515116" "0" "70" "2" "233633500" "233633500" "subst" "4.10317E-6" "02330" "KCNJ13_000002" "g.233633500G>A" "" "" "" "KCNJ13(NM_002242.4):c.484C>T (p.R162W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232768790G>A" "" "likely pathogenic" "" "0000515117" "0" "30" "2" "233655834" "233655834" "subst" "0.000524608" "01943" "GIGYF2_000030" "g.233655834T>A" "" "" "" "GIGYF2(NM_001103146.1):c.1047T>A (p.(Asp349Glu)), GIGYF2(NM_015575.3):c.1047T>A (p.D349E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232791124T>A" "" "likely benign" "" "0000515118" "0" "30" "2" "233656136" "233656136" "subst" "9.3778E-5" "01943" "GIGYF2_000031" "g.233656136A>G" "" "" "" "GIGYF2(NM_015575.3):c.1262A>G (p.K421R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232791426A>G" "" "likely benign" "" "0000515119" "0" "30" "2" "233659545" "233659545" "subst" "0.000394296" "01943" "GIGYF2_000032" "g.233659545A>C" "" "" "" "GIGYF2(NM_015575.3):c.1370A>C (p.N457T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232794835A>C" "" "likely benign" "" "0000515120" "0" "10" "2" "233660846" "233660846" "subst" "0.0698595" "01943" "GIGYF2_000033" "g.233660846G>A" "" "" "" "GIGYF2(NM_001103147.1):c.1617G>A (p.E539=), GIGYF2(NM_015575.4):c.1554G>A (p.E518=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232796136G>A" "" "benign" "" "0000515121" "0" "30" "2" "233660846" "233660846" "subst" "0.0698595" "02329" "GIGYF2_000033" "g.233660846G>A" "" "" "" "GIGYF2(NM_001103147.1):c.1617G>A (p.E539=), GIGYF2(NM_015575.4):c.1554G>A (p.E518=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232796136G>A" "" "likely benign" "" "0000515122" "0" "50" "2" "233660866" "233660866" "subst" "1.62565E-5" "01943" "GIGYF2_000034" "g.233660866C>T" "" "" "" "GIGYF2(NM_015575.3):c.1574C>T (p.S525L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232796156C>T" "" "VUS" "" "0000515123" "0" "30" "2" "233676068" "233676068" "subst" "1.21931E-5" "01943" "GIGYF2_000035" "g.233676068G>A" "" "" "" "GIGYF2(NM_015575.3):c.2006+7G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232811358G>A" "" "likely benign" "" "0000515124" "0" "50" "2" "233697779" "233697781" "dup" "0" "01943" "GIGYF2_000036" "g.233697779_233697781dup" "" "" "" "GIGYF2(NM_001103147.1):c.2805_2807dupGCA (p.Q938dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232833069_232833071dup" "" "VUS" "" "0000515126" "0" "30" "2" "233704674" "233704674" "subst" "0.000585171" "01943" "GIGYF2_000037" "g.233704674G>A" "" "" "" "GIGYF2(NM_015575.3):c.2882G>A (p.R961Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232839964G>A" "" "likely benign" "" "0000515127" "0" "30" "2" "233708793" "233708793" "subst" "0" "01943" "GIGYF2_000038" "g.233708793A>G" "" "" "" "GIGYF2(NM_015575.3):c.2927A>G (p.Q976R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232844083A>G" "" "likely benign" "" "0000515128" "0" "50" "2" "233712109" "233712109" "subst" "0.00159988" "01943" "GIGYF2_000039" "g.233712109A>G" "" "" "" "GIGYF2(NM_015575.3):c.3512A>G (p.H1171R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847399A>G" "" "VUS" "" "0000515129" "0" "10" "2" "233712223" "233712243" "del" "0" "02325" "GIGYF2_000016" "g.233712223_233712243del" "" "" "" "GIGYF2(NM_001103147.2):c.3689_3709delTGCCACAGCAGCAGCAGCAGC (p.L1230_Q1236del), GIGYF2(NM_015575.4):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1...)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847513_232847533del" "" "benign" "" "0000515130" "0" "10" "2" "233712226" "233712227" "ins" "0" "01943" "GIGYF2_000040" "g.233712226_233712227insGC" "" "" "" "GIGYF2(NM_015575.3):c.3629_3630insGC (p.Q1211Hfs*25), GIGYF2(NM_015575.4):c.3629_3630insGC (p.Q1211Hfs*25)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847516_232847517insGC" "" "benign" "" "0000515131" "0" "30" "2" "233712226" "233712227" "ins" "0" "02329" "GIGYF2_000040" "g.233712226_233712227insGC" "" "" "" "GIGYF2(NM_015575.3):c.3629_3630insGC (p.Q1211Hfs*25), GIGYF2(NM_015575.4):c.3629_3630insGC (p.Q1211Hfs*25)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847516_232847517insGC" "" "likely benign" "" "0000515132" "0" "30" "2" "233712227" "233712228" "ins" "0" "02329" "GIGYF2_000041" "g.233712227_233712228insG" "" "" "" "GIGYF2(NM_001103147.2):c.3693_3694insG (p.Q1232Afs*46)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847517_232847518insG" "" "likely benign" "" "0000515133" "0" "30" "2" "233712227" "233712229" "del" "0" "01943" "GIGYF2_000042" "g.233712227_233712229del" "" "" "" "GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_001103147.2):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.4):c.3630_3632delACA..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847517_232847519del" "" "likely benign" "" "0000515134" "0" "10" "2" "233712227" "233712229" "del" "0" "02325" "GIGYF2_000042" "g.233712227_233712229del" "" "" "" "GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_001103147.2):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.4):c.3630_3632delACA..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847517_232847519del" "" "benign" "" "0000515135" "0" "50" "2" "233712244" "233712246" "dup" "0" "01943" "GIGYF2_000043" "g.233712244_233712246dup" "" "" "" "GIGYF2(NM_015575.3):c.3647_3649dupAGC (p.Q1216dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847534_232847536dup" "" "VUS" "" "0000515136" "0" "50" "2" "233712260" "233712271" "del" "0" "01943" "GIGYF2_000044" "g.233712260_233712271del" "" "" "" "GIGYF2(NM_015575.3):c.3663_3674delGCCACAGCAGCC (p.P1222_P1225del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847550_232847561del" "" "VUS" "" "0000515138" "0" "30" "2" "233721516" "233721516" "subst" "0.000272271" "01943" "GIGYF2_000046" "g.233721516T>C" "" "" "" "GIGYF2(NM_015575.3):c.3846T>C (p.N1282=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232856806T>C" "" "likely benign" "" "0000515139" "0" "10" "2" "233721525" "233721525" "subst" "0.0171254" "02329" "GIGYF2_000047" "g.233721525G>A" "" "" "" "GIGYF2(NM_001103147.2):c.3918G>A (p.S1306=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232856815G>A" "" "benign" "" "0000607821" "0" "30" "2" "233675960" "233675960" "subst" "9.34815E-5" "01943" "GIGYF2_000048" "g.233675960A>G" "" "" "" "GIGYF2(NM_015575.3):c.1905A>G (p.Q635=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232811250A>G" "" "likely benign" "" "0000607822" "0" "50" "2" "233712178" "233712178" "subst" "0.00010966" "01943" "GIGYF2_000050" "g.233712178G>A" "" "" "" "GIGYF2(NM_015575.3):c.3581G>A (p.R1194H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232847468G>A" "" "VUS" "" "0000620987" "0" "50" "2" "233708971" "233708971" "del" "9.58488E-6" "01943" "GIGYF2_000049" "g.233708971del" "" "" "" "GIGYF2(NM_015575.3):c.3099+6delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232844261del" "" "VUS" "" "0000654590" "0" "30" "2" "233704576" "233704576" "subst" "0.000511762" "01943" "GIGYF2_000051" "g.233704576G>C" "" "" "" "GIGYF2(NM_015575.3):c.2784G>C (p.T928=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.232839866G>C" "" "likely benign" "" "0000688699" "0" "50" "2" "233655484" "233655484" "subst" "2.03075E-5" "02325" "GIGYF2_000052" "g.233655484T>A" "" "" "" "GIGYF2(NM_001103146.3):c.789T>A (p.D263E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000718623" "0" "50" "2" "233656162" "233656162" "subst" "0" "01943" "GIGYF2_000053" "g.233656162T>C" "" "" "" "GIGYF2(NM_015575.3):c.1282+6T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000731023" "1" "70" "2" "233635615" "233635615" "subst" "0" "00000" "KCNJ13_000010" "g.233635615G>A" "" "{PMID:Bryant 2018:29343940}" "" "" "" "Germline" "" "rs863224884" "0" "" "" "g.232770905G>A" "" "likely pathogenic (recessive)" "" "0000732676" "3" "70" "2" "233635615" "233635615" "subst" "0" "00000" "KCNJ13_000010" "g.233635615G>A" "" "{PMID:Soens 2017:28714225}" "" "NM_001172417.1:c.218C>T" "r.(del-exon) effect on splicing predicted from mini-gene splicing assay" "Germline" "" "" "0" "" "" "g.232770905G>A" "" "likely pathogenic" "" "0000765743" "0" "70" "2" "233635714" "233635714" "subst" "0" "00000" "KCNJ13_000009" "g.233635714A>G" "" "{PMID:Patel 2016:26355662}" "" "" "" "Germline" "" "" "0" "" "" "g.232771004A>G" "" "likely pathogenic" "" "0000800481" "0" "50" "2" "233620985" "233620985" "subst" "0" "01943" "GIGYF2_000054" "g.233620985G>A" "" "" "" "GIGYF2(NM_015575.3):c.320G>A (p.R107Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800482" "0" "50" "2" "233635939" "233635939" "subst" "0" "01943" "GIGYF2_000055" "g.233635939C>G" "" "" "" "KCNJ13(NM_002242.4):c.134G>C (p.W45S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000800483" "0" "30" "2" "233674471" "233674471" "subst" "0.000256006" "01943" "GIGYF2_000056" "g.233674471C>T" "" "" "" "GIGYF2(NM_015575.3):c.1848C>T (p.L616=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000800484" "0" "30" "2" "233712242" "233712242" "subst" "0" "01943" "GIGYF2_000057" "g.233712242G>A" "" "" "" "GIGYF2(NM_015575.3):c.3645G>A (p.Q1215=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000816104" "3" "70" "2" "233635615" "233635615" "subst" "0" "00000" "KCNJ13_000010" "g.233635615G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "KCNJ13 c.458C>T, p.Thr153Ile" "homozygous" "Unknown" "?" "" "0" "" "" "g.232770905G>A" "" "likely pathogenic" "" "0000816426" "0" "70" "2" "233635615" "233635615" "subst" "0" "00000" "KCNJ13_000010" "g.233635615G>A" "" "{PMID:Zampaglione 2020:32037395}" "" "c.458C>T, p.Thr153Ile" "heterozygous" "Unknown" "?" "" "0" "" "" "g.232770905G>A" "" "likely pathogenic" "" "0000820999" "21" "50" "2" "233633499" "233633499" "subst" "0.000283363" "00000" "KCNJ13_000006" "g.233633499C>T" "" "{PMID:Ruberto 2020:32507954}" "" "KCNJ13 gene:c.[485G?>?A]; [?=], p.[Arg162Gln]; [?=]" "" "Germline" "?" "" "0" "" "" "g.232768789C>T" "" "VUS" "" "0000822386" "1" "70" "2" "233633500" "233633500" "subst" "4.10317E-6" "00000" "KCNJ13_000002" "g.233633500G>A" "" "{PMID:Maggi_2021:33546218}" "" "c.484C>T" "" "Germline" "yes" "" "0" "" "" "" "" "likely pathogenic" "" "0000822935" "3" "70" "2" "233635642" "233635642" "subst" "8.14133E-6" "00000" "GIGYF2_000058" "g.233635642A>G" "" "{PMID:Méjécase 2020:32783370}" "" "KCNJ13 c.431T>C p.(Leu144Pro)" "homozygous" "Unknown" "?" "" "0" "" "" "g.232770932A>G" "" "likely pathogenic" "" "0000845965" "0" "70" "2" "233635915" "233635915" "subst" "0" "00000" "KCNJ13_000001" "g.233635915C>T" "" "{PMID:Pattnaik 2015:25921210}" "" "KCNJ13 c.158G>A, p.(Trp53*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.232771205C>T" "" "likely pathogenic" "" "0000845966" "3" "70" "2" "233633329" "233633329" "subst" "0" "00000" "GIGYF2_000059" "g.233633329G>A" "" "{PMID:Perez-Roustit 2016:27203561}" "" "KCNJ13 c.655C>T, p.(Gln219*)" "homozygous" "Germline" "yes" "" "0" "" "" "g.232768619G>A" "" "likely pathogenic" "" "0000858410" "0" "30" "2" "233635758" "233635758" "subst" "1.21966E-5" "01943" "GIGYF2_000060" "g.233635758A>G" "" "" "" "KCNJ13(NM_002242.4):c.315T>C (p.S105=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000858411" "0" "30" "2" "233677092" "233677092" "subst" "0" "01943" "GIGYF2_000061" "g.233677092C>T" "" "" "" "GIGYF2(NM_015575.3):c.2007-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000947797" "0" "50" "2" "233709083" "233709083" "subst" "0.000934101" "02325" "GIGYF2_000014" "g.233709083C>G" "" "" "" "GIGYF2(NM_001103146.3):c.3104C>G (p.S1035C), GIGYF2(NM_015575.3):c.3104C>G (p.S1035C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000961968" "0" "30" "2" "233712227" "233712229" "del" "0" "02329" "GIGYF2_000042" "g.233712227_233712229del" "" "" "" "GIGYF2(NM_001103147.1):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_001103147.2):c.3693_3695delACA (p.Q1237del), GIGYF2(NM_015575.4):c.3630_3632delACA..." "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992661" "0" "30" "2" "233655834" "233655834" "subst" "0.000524608" "01804" "GIGYF2_000030" "g.233655834T>A" "" "" "" "GIGYF2(NM_001103146.1):c.1047T>A (p.(Asp349Glu)), GIGYF2(NM_015575.3):c.1047T>A (p.D349E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000992662" "0" "30" "2" "233697592" "233697592" "subst" "0.000164291" "01804" "GIGYF2_000062" "g.233697592G>A" "" "" "" "GIGYF2(NM_001103146.1):c.2555G>A (p.(Arg852Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001051139" "0" "50" "2" "233620918" "233620927" "del" "0" "01804" "GIGYF2_000063" "g.233620918_233620927del" "" "" "" "GIGYF2(NM_001103146.3):c.268-15_268-6del" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001051140" "0" "50" "2" "233633353" "233633353" "subst" "0" "01804" "GIGYF2_000064" "g.233633353C>T" "" "" "" "KCNJ13(NM_002242.4):c.631G>A (p.(Glu211Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes KCNJ13 ## Count = 95 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000061452" "00010382" "90" "484" "0" "484" "0" "c.484C>T" "r.(?)" "p.(Arg162Trp)" "3" "0000061453" "00010382" "90" "496" "0" "496" "0" "c.496C>T" "r.(?)" "p.(Arg166*)" "2" "0000061454" "00010382" "90" "722" "0" "722" "0" "c.722T>C" "r.(?)" "p.(Leu241Pro)" "3" "0000061455" "00010382" "70" "350" "0" "350" "0" "c.350A>G" "r.(?)" "p.(Gln117Arg)" "2" "0000061456" "00010382" "70" "485" "0" "485" "0" "c.485G>A" "r.(?)" "p.(Arg162Gln)" "3" "0000061457" "00010382" "70" "827" "0" "827" "0" "c.827A>C" "r.(?)" "p.(Glu276Ala)" "3" "0000061458" "00010382" "10" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Thr175Ile)" "3" "0000061459" "00010382" "10" "524" "0" "524" "0" "c.524C>T" "r.(?)" "p.(Thr175Ile)" "3" "0000061460" "00010382" "90" "359" "0" "359" "0" "c.359T>C" "r.(?)" "p.(Ile120Thr)" "2" "0000061461" "00010382" "90" "359" "0" "359" "0" "c.359T>C" "r.(?)" "p.(Ile120Thr)" "2" "0000245938" "00010382" "10" "1097" "0" "1097" "0" "c.*14T>C" "r.(=)" "p.(=)" "" "0000247890" "00010382" "10" "-67668" "0" "-67668" "0" "c.-67668T>C" "r.(?)" "p.(=)" "" "0000249868" "00010382" "10" "-67668" "0" "-67668" "0" "c.-67668T>C" "r.(?)" "p.(=)" "" "0000253092" "00010382" "10" "-67668" "0" "-67668" "0" "c.-67668T>C" "r.(?)" "p.(=)" "" "0000253661" "00010382" "10" "-71106" "0" "-71106" "0" "c.-71106T>G" "r.(?)" "p.(=)" "" "0000253761" "00010382" "10" "34080" "0" "34080" "0" "c.*32997T>G" "r.(=)" "p.(=)" "" "0000254199" "00010382" "30" "-71089" "0" "-71089" "0" "c.-71089T>C" "r.(?)" "p.(=)" "" "0000254893" "00010382" "30" "-71097" "0" "-71097" "0" "c.-71097T>G" "r.(?)" "p.(=)" "" "0000254894" "00010382" "30" "-71136" "0" "-71136" "0" "c.-71136T>G" "r.(?)" "p.(=)" "" "0000278357" "00010382" "50" "689" "0" "689" "0" "c.689G>A" "r.(?)" "p.(Ser230Asn)" "" "0000281035" "00010382" "10" "-70911" "0" "-70911" "0" "c.-70911C>T" "r.(?)" "p.(=)" "" "0000281036" "00010382" "10" "-71110" "0" "-71110" "0" "c.-71110C>T" "r.(?)" "p.(=)" "" "0000281037" "00010382" "10" "-71158" "0" "-71158" "0" "c.-71158C>T" "r.(?)" "p.(=)" "" "0000283361" "00010382" "30" "-18415" "0" "-18415" "0" "c.-18415G>T" "r.(?)" "p.(=)" "" "0000283362" "00010382" "10" "-70911" "0" "-70911" "0" "c.-70911C>T" "r.(?)" "p.(=)" "" "0000283363" "00010382" "10" "-71110" "0" "-71110" "0" "c.-71110C>T" "r.(?)" "p.(=)" "" "0000283364" "00010382" "10" "-71158" "0" "-71158" "0" "c.-71158C>T" "r.(?)" "p.(=)" "" "0000283365" "00010382" "30" "-71092" "0" "-71072" "0" "c.-71092_-71072del" "r.(?)" "p.(=)" "" "0000283368" "00010382" "30" "-14375" "0" "-14375" "0" "c.-14375G>A" "r.(?)" "p.(=)" "" "0000288321" "00010382" "30" "21599" "0" "21599" "0" "c.*20516C>T" "r.(=)" "p.(=)" "" "0000288322" "00010382" "30" "-14974" "0" "-14974" "0" "c.-14974C>T" "r.(?)" "p.(=)" "" "0000288323" "00010382" "30" "-30139" "0" "-30139" "0" "c.-30139C>A" "r.(?)" "p.(=)" "" "0000288325" "00010382" "30" "-63489" "0" "-63489" "0" "c.-63489C>A" "r.(?)" "p.(=)" "" "0000288326" "00010382" "50" "-67945" "0" "-67945" "0" "c.-67945G>C" "r.(?)" "p.(=)" "" "0000288327" "00010382" "30" "12980" "0" "12980" "0" "c.*11897C>G" "r.(=)" "p.(=)" "" "0000288328" "00010382" "10" "-70911" "0" "-70911" "0" "c.-70911C>T" "r.(?)" "p.(=)" "" "0000288329" "00010382" "50" "12970" "0" "12970" "0" "c.*11887G>A" "r.(=)" "p.(=)" "" "0000288331" "00010382" "10" "-71110" "0" "-71110" "0" "c.-71110C>T" "r.(?)" "p.(=)" "" "0000288332" "00010382" "10" "-71158" "0" "-71158" "0" "c.-71158C>T" "r.(?)" "p.(=)" "" "0000288334" "00010382" "50" "-71089" "0" "-71088" "0" "c.-71089_-71088insTGC" "r.(?)" "p.(=)" "" "0000288335" "00010382" "30" "-73923" "0" "-73923" "0" "c.-73923C>T" "r.(?)" "p.(=)" "" "0000290062" "00010382" "50" "827" "0" "827" "0" "c.827A>C" "r.(?)" "p.(Glu276Ala)" "" "0000515113" "00010382" "30" "21628" "0" "21628" "0" "c.*20545T>C" "r.(=)" "p.(=)" "" "0000515114" "00010382" "30" "21534" "0" "21534" "0" "c.*20451T>C" "r.(=)" "p.(=)" "" "0000515115" "00010382" "30" "689" "0" "689" "0" "c.689G>A" "r.(?)" "p.(Ser230Asn)" "" "0000515116" "00010382" "70" "484" "0" "484" "0" "c.484C>T" "r.(?)" "p.(Arg162Trp)" "" "0000515117" "00010382" "30" "-14696" "0" "-14696" "0" "c.-14696A>T" "r.(?)" "p.(=)" "" "0000515118" "00010382" "30" "-14998" "0" "-14998" "0" "c.-14998T>C" "r.(?)" "p.(=)" "" "0000515119" "00010382" "30" "-18407" "0" "-18407" "0" "c.-18407T>G" "r.(?)" "p.(=)" "" "0000515120" "00010382" "10" "-19708" "0" "-19708" "0" "c.-19708C>T" "r.(?)" "p.(=)" "" "0000515121" "00010382" "30" "-19708" "0" "-19708" "0" "c.-19708C>T" "r.(?)" "p.(=)" "" "0000515122" "00010382" "50" "-19728" "0" "-19728" "0" "c.-19728G>A" "r.(?)" "p.(=)" "" "0000515123" "00010382" "30" "-34930" "0" "-34930" "0" "c.-34930C>T" "r.(?)" "p.(=)" "" "0000515124" "00010382" "50" "-56628" "0" "-56626" "0" "c.-56628_-56626dup" "r.(?)" "p.(=)" "" "0000515126" "00010382" "30" "-63536" "0" "-63536" "0" "c.-63536C>T" "r.(?)" "p.(=)" "" "0000515127" "00010382" "30" "-67655" "0" "-67655" "0" "c.-67655T>C" "r.(?)" "p.(=)" "" "0000515128" "00010382" "50" "-70971" "0" "-70971" "0" "c.-70971T>C" "r.(?)" "p.(=)" "" "0000515129" "00010382" "10" "-71092" "0" "-71072" "0" "c.-71092_-71072del" "r.(?)" "p.(=)" "" "0000515130" "00010382" "10" "-71088" "0" "-71087" "0" "c.-71088_-71087insCG" "r.(?)" "p.(=)" "" "0000515131" "00010382" "30" "-71088" "0" "-71087" "0" "c.-71088_-71087insCG" "r.(?)" "p.(=)" "" "0000515132" "00010382" "30" "-71090" "0" "-71089" "0" "c.-71090_-71089insC" "r.(?)" "p.(=)" "" "0000515133" "00010382" "30" "-71091" "0" "-71089" "0" "c.-71091_-71089del" "r.(?)" "p.(=)" "" "0000515134" "00010382" "10" "-71091" "0" "-71089" "0" "c.-71091_-71089del" "r.(?)" "p.(=)" "" "0000515135" "00010382" "50" "-71092" "0" "-71090" "0" "c.-71092_-71090dup" "r.(?)" "p.(=)" "" "0000515136" "00010382" "50" "-71113" "0" "-71102" "0" "c.-71113_-71102del" "r.(?)" "p.(=)" "" "0000515138" "00010382" "30" "-80378" "0" "-80378" "0" "c.-80378A>G" "r.(?)" "p.(=)" "" "0000515139" "00010382" "10" "-80387" "0" "-80387" "0" "c.-80387C>T" "r.(?)" "p.(=)" "" "0000607821" "00010382" "30" "-34822" "0" "-34822" "0" "c.-34822T>C" "r.(?)" "p.(=)" "" "0000607822" "00010382" "50" "-71040" "0" "-71040" "0" "c.-71040C>T" "r.(?)" "p.(=)" "" "0000620987" "00010382" "50" "-67833" "0" "-67833" "0" "c.-67833del" "r.(?)" "p.(=)" "" "0000654590" "00010382" "30" "-63438" "0" "-63438" "0" "c.-63438C>G" "r.(?)" "p.(=)" "" "0000688699" "00010382" "50" "-14346" "0" "-14346" "0" "c.-14346A>T" "r.(?)" "p.(=)" "" "0000718623" "00010382" "50" "-15024" "0" "-15024" "0" "c.-15024A>G" "r.(?)" "p.(=)" "" "0000731023" "00010382" "70" "458" "0" "458" "0" "c.458C>T" "r.(?)" "p.(Thr153Ile)" "" "0000732676" "00010382" "70" "458" "0" "458" "0" "c.458C>T" "r.(?)" "p.(Thr153Ile)" "" "0000765743" "00010382" "70" "359" "0" "359" "0" "c.359T>C" "r.(?)" "p.(Ile120Thr)" "" "0000800481" "00010382" "50" "12999" "0" "12999" "0" "c.*11916C>T" "r.(=)" "p.(=)" "" "0000800482" "00010382" "50" "134" "0" "134" "0" "c.134G>C" "r.(?)" "p.(Trp45Ser)" "" "0000800483" "00010382" "30" "-33333" "0" "-33333" "0" "c.-33333G>A" "r.(?)" "p.(=)" "" "0000800484" "00010382" "30" "-71104" "0" "-71104" "0" "c.-71104C>T" "r.(?)" "p.(=)" "" "0000816104" "00010382" "70" "458" "0" "458" "0" "c.458C>T" "r.(?)" "p.(Thr153Ile)" "" "0000816426" "00010382" "70" "458" "0" "458" "0" "c.458C>T" "r.(?)" "p.(Thr153Ile)" "" "0000820999" "00010382" "50" "485" "0" "485" "0" "c.485G>A" "r.(?)" "p.(Arg162Gln)" "" "0000822386" "00010382" "70" "484" "0" "484" "0" "c.484C>T" "r.(?)" "p.(Arg162Trp)" "3" "0000822935" "00010382" "70" "431" "0" "431" "0" "c.431T>C" "r.(?)" "p.(Leu144Pro)" "" "0000845965" "00010382" "70" "158" "0" "158" "0" "c.158G>A" "r.(?)" "p.(Trp53*)" "" "0000845966" "00010382" "70" "655" "0" "655" "0" "c.655C>T" "r.(?)" "p.(Gln219*)" "" "0000858410" "00010382" "30" "315" "0" "315" "0" "c.315T>C" "r.(?)" "p.(Ser105=)" "" "0000858411" "00010382" "30" "-35954" "0" "-35954" "0" "c.-35954G>A" "r.(?)" "p.(=)" "" "0000947797" "00010382" "50" "-67945" "0" "-67945" "0" "c.-67945G>C" "r.(?)" "p.(=)" "" "0000961968" "00010382" "30" "-71091" "0" "-71089" "0" "c.-71091_-71089del" "r.(?)" "p.(=)" "" "0000992661" "00010382" "30" "-14696" "0" "-14696" "0" "c.-14696A>T" "r.(?)" "p.(=)" "" "0000992662" "00010382" "30" "-56454" "0" "-56454" "0" "c.-56454C>T" "r.(?)" "p.(=)" "" "0001051139" "00010382" "50" "13067" "0" "13076" "0" "c.*11984_*11993del" "r.(=)" "p.(=)" "" "0001051140" "00010382" "50" "631" "0" "631" "0" "c.631G>A" "r.(?)" "p.(Glu211Lys)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 19 "{{screeningid}}" "{{variantid}}" "0000034439" "0000061452" "0000034440" "0000061453" "0000034441" "0000061454" "0000034442" "0000061455" "0000034442" "0000061458" "0000034443" "0000061456" "0000034444" "0000061457" "0000034445" "0000061460" "0000034446" "0000061461" "0000333448" "0000731023" "0000334696" "0000732676" "0000364801" "0000765743" "0000387946" "0000816104" "0000387946" "0000816426" "0000391267" "0000820999" "0000392188" "0000822386" "0000392592" "0000822935" "0000408943" "0000845965" "0000408944" "0000845966"