### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = KCNN3) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "KCNN3" "potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3" "1" "q21.3" "unknown" "NG_016807.2" "UD_132084488147" "" "https://www.LOVD.nl/KCNN3" "" "1" "6292" "3782" "602983" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/KCNN3_codingDNA.html" "1" "" "" "-1" "" "-1" "00000" "2012-09-13 00:00:00" "00006" "2018-09-05 23:11:25" "00000" "2026-01-20 18:57:21" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00001197" "KCNN3" "transcript variant 1" "001" "NM_002249.5" "" "NP_002240.3" "" "" "" "-314" "12710" "2196" "154669938" "154842754" "00000" "2012-09-13 13:18:32" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 8 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00332" "CILD" "dyskinesia, ciliary, primary (CILD)" "" "" "" "" "" "00006" "2014-02-21 12:58:05" "00006" "2015-03-31 17:58:20" "00350" "DFNA1" "deafness, autosomal dominant, type 1" "AD" "124900" "" "" "" "00081" "2014-03-13 13:45:31" "00006" "2021-12-10 21:51:32" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05610" "ZLS" "Zimmermann-Laband syndrome (ZLS)" "" "" "" "" "" "00006" "2019-06-11 17:18:31" "00006" "2021-12-10 21:51:32" "05890" "ZLS3" "Zimmermann-Laband syndrome, type 3 (ZLS3)" "AD" "618658" "" "" "" "00006" "2021-01-12 16:48:31" "00006" "2021-12-10 21:51:32" "06906" "DEE" "encephalopathy, developmental and epileptic" "" "" "" "" "" "00006" "2022-04-07 09:24:23" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "KCNN3" "05610" "KCNN3" "05890" ## Individuals ## Do not remove or alter this header ## ## Count = 14 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00016189" "" "" "" "11" "" "00671" "{PMID:Zhang 2014:24729547}" "4-generation family, 11 affected (5F, 6M)" "F;M" "no" "China" "" "0" "" "" "Chinese" "" "00017598" "" "" "" "2" "" "00006" "{PMID:Casey 2014:24824133}" "4-generation family, 2 affecteds (brothers), unaffected heterozygous carrier parents and 4 relatives" "M" "yes" "Ireland" "" "0" "" "" "Irish Traveller" "" "00240149" "" "" "" "1" "" "00006" "{PMID:Bauer 2019:31155282}" "" "M" "" "Australia" "" "0" "" "" "" "Pat1" "00240150" "" "" "" "1" "" "00006" "{PMID:Bauer 2019:31155282}" "" "F" "" "Spain" "" "0" "" "" "white" "Pat2" "00240151" "" "" "" "1" "" "00006" "{PMID:Bauer 2019:31155282}" "" "F" "" "United States" "" "0" "" "" "" "Pat3" "00240152" "" "" "" "4" "" "00006" "{PMID:Koot 2016:26658685}" "3-generation family, 4 affected (father, daughter, 2 sons)" "F;M" "" "Netherlands" "" "0" "" "" "" "Family" "00326092" "" "" "" "1" "" "03966" "Gripp 2021, submitted" "" "M" "" "" "" "" "" "" "" "#6" "00326093" "" "" "" "1" "" "03966" "Gripp 2021, submitted" "" "F" "" "" "" "" "" "" "" "#7" "00326094" "" "" "" "1" "" "03966" "Gripp 2021, submitted" "" "F" "" "" "" "" "" "" "" "#8" "00380302" "" "" "" "2" "" "00000" "{PMID:Abu-Safieh-2013:23105016}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" "00391862" "" "" "" "1" "" "02494" "" "" "F" "no" "Spain" "" "" "" "" "" "029P" "00443881" "" "" "" "1" "" "00006" "{PMID:Chatron 2020:32282878}" "3-generation family, 1 affected brother, unaffected heterozygous parents/relatives" "F" "yes" "Brazil" "" "0" "" "" "" "FamFPatIV1" "00455442" "" "" "" "1" "" "03544" "" "" "F" "-" "- (not applicable)" "" "" "" "" "white" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 15 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00016189" "00350" "00017598" "00332" "00240149" "05610" "00240150" "05610" "00240151" "05610" "00240152" "00198" "00326092" "00198" "00326093" "00198" "00326094" "00198" "00380302" "04214" "00391862" "05610" "00391862" "05890" "00443881" "06906" "00455442" "00198" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 00332, 00350, 01157, 04214, 05610, 05890, 06906 ## Count = 13 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000015957" "00332" "00017598" "00006" "Isolated (sporadic)" "" "see paper" "" "" "" "" "" "" "" "" "" "" "" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "3w" "" "" "" "" "" "" "" "" "" "0000142766" "00350" "00016189" "00006" "Familial, autosomal dominant" "" "nonsyndromic, bilateral, slowly progressive hearing impairment, starting mildly in high frequencies; age onset late 20s, hearing impairment gradually progressed to all frequencies later, eventually reached severe-to-profound in seventh decade; absent or abnormal otoacoustic emission, no evidence of vestibular dysfunction, no inner ear malformation observed by CT scanning" "" "" "" "" "" "" "" "" "DFNA-65" "hearing impairment" "" "0000180301" "05610" "00240149" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "" "Zimmermann-Laband syndrome" "" "0000180302" "05610" "00240150" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "" "Zimmermann-Laband syndrome" "" "0000180303" "05610" "00240151" "00006" "Isolated (sporadic)" "" "see paper; …" "" "" "" "" "" "" "" "" "" "Zimmermann-Laband syndrome" "" "0000180304" "00198" "00240152" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "Non-cirrhotic portal hypertension, hepatosplenomegaly, liver abnormalities" "" "0000244577" "00198" "00326092" "03966" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "ZLS3" "Zimmermann-Laband syndrome" "" "0000244578" "00198" "00326093" "03966" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "ZLS3" "Zimmermann-Laband syndrome" "" "0000244579" "00198" "00326094" "03966" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "ZLS3" "Zimmermann-Laband syndrome" "" "0000274153" "04214" "00380302" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa (RP)" "" "0000333158" "06906" "00443881" "00006" "Familial, autosomal recessive" "6y11m" "see paper; ..., 7d-myoclonic seizure; tonic seizures, epileptic spasms, focal seizures; EEG at onset suppression-burst pattern; occasional seizure; dystonia and hyperkinetic movements; profound intellectual disability; no pes equinovarus; no omphalocele; no cleft palate; joint contractures; no dysmorphic facial features; MRI brain 4m-normal, 13m-mild cerebral atrophy, 6y-mild cerebral atrophy with ventricular dilation" "" "" "" "" "" "" "" "" "DEE89" "neonatal developmental and epileptic encephalopathy" "" "0000344007" "00198" "00455442" "03544" "Isolated (sporadic)" "" "HP:0000271, HP:0001249" "" "" "" "" "" "" "" "" "ZLS3" "complex neurodevelopmental disorder" "" ## Screenings ## Do not remove or alter this header ## ## Count = 14 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000017581" "00017598" "1" "00006" "00006" "2014-06-20 23:36:11" "" "" "SEQ;SEQ-NG-I" "DNA" "" "" "0000181308" "00016189" "1" "00006" "00006" "2018-09-05 21:23:14" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000241252" "00240149" "1" "00006" "00006" "2019-06-11 17:24:15" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000241253" "00240150" "1" "00006" "00006" "2019-06-11 17:24:15" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000241254" "00240151" "1" "00006" "00006" "2019-06-11 17:24:15" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000241255" "00240152" "1" "00006" "00006" "2019-06-11 17:36:46" "" "" "SEQ" "DNA" "" "" "0000327301" "00326092" "1" "03966" "03966" "2021-01-07 14:03:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000327302" "00326093" "1" "03966" "03966" "2021-01-07 14:41:11" "" "" "SEQ-NG-I" "DNA" "" "" "0000327303" "00326094" "1" "03966" "03966" "2021-01-07 14:45:54" "" "" "SEQ-NG-I" "DNA" "" "" "0000381516" "00380302" "1" "00000" "00008" "2021-08-13 14:56:11" "" "" "SEQ-NG" "DNA" "blood" "autozygome-guided sequencing" "0000393104" "00391862" "1" "02494" "02494" "2021-11-19 12:29:47" "" "" "SEQ-NG" "DNA" "" "WES" "0000445378" "00443881" "1" "00006" "00006" "2023-12-05 10:17:31" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000457056" "00455442" "1" "03544" "03544" "2024-10-09 09:40:15" "" "" "SEQ-NG-I" "DNA" "peripheral blood" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 9 "{{screeningid}}" "{{geneid}}" "0000017581" "CCNO" "0000017581" "CDKN1C" "0000017581" "KCNN3" "0000181308" "TBC1D24" "0000241252" "KCNN3" "0000241253" "KCNN3" "0000241254" "KCNN3" "0000241255" "KCNN3" "0000381516" "KCNN3" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 52 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000003506" "3" "50" "1" "154776412" "154776412" "subst" "0" "00037" "KCNN3_000001" "g.154776412A>G" "" "" "" "" "" "Germline" "" "" "" "" "" "g.154803936A>G" "" "VUS" "" "0000037557" "3" "50" "1" "154842240" "154842242" "del" "0" "00006" "KCNN3_000002" "g.154842240_154842242del" "" "{PMID:Casey 2014:24824133}" "" "" "" "Germline" "yes" "" "0" "" "" "g.154869764_154869766del" "" "VUS" "" "0000404996" "1" "50" "1" "154842347" "154842355" "del" "0" "00006" "KCNN3_000009" "g.154842347_154842355del" "" "{PMID:Zhang 2014:24729547}" "" "86_94del9 (p.29_32del)" "" "Germline" "" "" "0" "" "" "g.154869871_154869879del" "" "VUS" "" "0000487116" "0" "90" "1" "154744593" "154744593" "subst" "0" "00006" "KCNN3_000010" "g.154744593T>A" "" "{PMID:Bauer 2019:31155282}" "" "" "" "De novo" "" "" "0" "" "" "g.154772117T>A" "" "pathogenic (dominant)" "" "0000487117" "0" "90" "1" "154841636" "154841636" "subst" "0" "00006" "KCNN3_000011" "g.154841636T>C" "" "{PMID:Bauer 2019:31155282}" "" "" "" "De novo" "" "" "0" "" "" "g.154869160T>C" "" "pathogenic (dominant)" "" "0000487118" "0" "90" "1" "154744850" "154744850" "subst" "0" "00006" "KCNN3_000012" "g.154744850C>T" "" "{PMID:Bauer 2019:31155282}" "" "" "" "De novo" "" "" "0" "" "" "g.154772374C>T" "" "pathogenic (dominant)" "" "0000487119" "11" "90" "1" "154744551" "154744551" "subst" "0" "00006" "KCNN3_000003" "g.154744551C>G" "" "{PMID:Koot 2016:26658685}" "" "" "variant de novo in father" "Germline" "" "" "0" "" "" "g.154772075C>G" "" "pathogenic (dominant)" "" "0000604843" "0" "30" "1" "154680694" "154680694" "subst" "0" "02327" "KCNN3_000018" "g.154680694G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.154708218G>A" "" "likely benign" "" "0000711020" "0" "70" "1" "154698430" "154698430" "subst" "0" "03966" "KCNN3_000020" "g.154698430C>A" "" "Gripp 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.154725954C>A" "" "likely pathogenic (dominant)" "" "0000711021" "0" "70" "1" "154698479" "154698481" "del" "0" "03966" "KCNN3_000021" "g.154698479_154698481del" "" "Gripp 2021, submitted" "" "" "" "De novo" "" "" "0" "" "" "g.154726003_154726005del" "" "likely pathogenic (dominant)" "" "0000711022" "0" "70" "1" "154841582" "154841582" "subst" "0" "03966" "KCNN3_000019" "g.154841582C>A" "" "Gripp 2021, submitted" "" "" "" "Germline" "" "" "0" "" "" "g.154869106C>A" "" "likely pathogenic (dominant)" "" "0000716874" "0" "50" "1" "154744551" "154744551" "subst" "0" "02329" "KCNN3_000003" "g.154744551C>G" "" "" "" "KCNN3(NM_001204087.1):c.1348G>C (p.V450L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000794977" "3" "50" "1" "154842200" "154842202" "del" "0" "00000" "KCNN3_000002" "g.154842200_154842202del" "" "{PMID:Abu-Safieh-2013:23105016}" "" "c.239_241del" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000798808" "0" "30" "1" "154842240" "154842242" "del" "0" "02325" "KCNN3_000002" "g.154842240_154842242del" "" "" "" "KCNN3(NM_002249.6):c.239_241delAGC (p.Q80del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000823714" "0" "50" "1" "154698403" "154698403" "subst" "0" "02494" "KCNN3_000022" "g.154698403G>A" "" "" "" "" "" "De novo" "" "" "" "" "" "" "" "VUS" "" "0000848319" "0" "30" "1" "154842219" "154842242" "dup" "0" "02325" "KCNN3_000023" "g.154842219_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.218_241dupAGCAGCAGCAGCAGCAGCAGCAGC (p.Q73_Q80dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000910784" "0" "70" "1" "154698430" "154698430" "subst" "0" "02327" "KCNN3_000024" "g.154698430C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000928021" "0" "50" "1" "154680720" "154680720" "subst" "0" "02325" "KCNN3_000025" "g.154680720G>A" "" "" "" "KCNN3(NM_002249.6):c.1928C>T (p.T643I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000928022" "0" "50" "1" "154698441" "154698441" "subst" "0" "02325" "KCNN3_000026" "g.154698441G>A" "" "" "" "KCNN3(NM_002249.6):c.1652C>T (p.A551V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000946987" "0" "30" "1" "154842240" "154842242" "dup" "0" "02325" "KCNN3_000027" "g.154842240_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.239_241dupAGC (p.Q80dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000952366" "3" "50" "1" "154842228" "154842242" "dup" "0" "00006" "KCNN3_000015" "g.154842228_154842242dup" "" "{PMID:Chatron 2020:32282878}" "" "ENST00000271915:c.241_242insAGCAGCAGCAGCAGC" "" "Germline" "" "" "0" "" "" "g.154869752_154869766dup" "" "VUS" "" "0000960535" "0" "50" "1" "154842222" "154842242" "del" "0" "02325" "KCNN3_000028" "g.154842222_154842242del" "" "" "" "KCNN3(NM_002249.6):c.221_241delAGCAGCAGCAGCAGCAGCAGC (p.Q74_Q80del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000960541" "0" "10" "1" "154842237" "154842242" "dup" "0" "02329" "KCNN3_000029" "g.154842237_154842242dup" "" "" "" "KCNN3(NM_001204087.2):c.236_241dupAGCAGC (p.Q79_Q80dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000973350" "0" "50" "1" "154687433" "154687433" "subst" "0" "01804" "KCNN3_000030" "g.154687433T>C" "" "" "" "KCNN3(NM_002249.6):c.1748A>G (p.(Tyr583Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000973351" "0" "50" "1" "154709520" "154709520" "subst" "0" "01804" "KCNN3_000031" "g.154709520C>T" "" "" "" "KCNN3(NM_001204087.2):c.1493G>A (p.(Trp498Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000973352" "0" "50" "1" "154841555" "154841557" "del" "0" "01804" "KCNN3_000032" "g.154841555_154841557del" "" "" "" "KCNN3(NM_002249.6):c.889_891del (p.(Val297del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000973353" "0" "50" "1" "154841987" "154841987" "subst" "0" "01804" "KCNN3_000033" "g.154841987C>T" "" "" "" "KCNN3(NM_002249.6):c.454G>A (p.(Gly152Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000990379" "0" "30" "1" "154680734" "154680734" "subst" "4.10246E-6" "01804" "KCNN3_000034" "g.154680734C>G" "" "" "" "KCNN3(NM_002249.5):c.1914G>C (p.(Met638Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000990380" "0" "50" "1" "154842029" "154842029" "subst" "0" "02325" "KCNN3_000035" "g.154842029C>T" "" "" "" "KCNN3(NM_002249.6):c.412G>A (p.G138S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000990381" "0" "30" "1" "154842121" "154842121" "subst" "4.14418E-6" "01804" "KCNN3_000036" "g.154842121G>A" "" "" "" "KCNN3(NM_002249.5):c.320C>T (p.(Ala107Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000990382" "0" "30" "1" "154842304" "154842304" "subst" "0" "01804" "KCNN3_000037" "g.154842304G>C" "" "" "" "KCNN3(NM_002249.5):c.137C>G (p.(Ala46Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001011496" "0" "70" "1" "154698487" "154698487" "subst" "0" "03544" "KCNN3_000038" "g.154698487C>T" "" "{PMID:Schwarz 2022:34907639}" "" "" "de novo in proband and her affected monozygotic twin" "De novo" "-" "rs2101782564" "0" "" "" "g.154726011C>T" "{CV:1064423}" "pathogenic" "ACMG" "0001031302" "0" "30" "1" "154705526" "154705526" "subst" "8.12255E-6" "01804" "KCNN3_000039" "g.154705526G>A" "" "" "" "KCNN3(NM_002249.6):c.1543C>T (p.(Pro515Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001031303" "0" "50" "1" "154705571" "154705571" "subst" "0" "01804" "KCNN3_000040" "g.154705571G>C" "" "" "" "KCNN3(NM_002249.6):c.1498C>G (p.(Leu500Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001031304" "0" "50" "1" "154832170" "154832170" "subst" "2.84255E-5" "01804" "KCNN3_000041" "g.154832170C>G" "" "" "" "KCNN3(NM_170782.3):c.18+1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001031305" "0" "50" "1" "154841770" "154841770" "subst" "4.06227E-6" "01804" "KCNN3_000042" "g.154841770C>T" "" "" "" "KCNN3(NM_002249.6):c.671G>A (p.(Arg224Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001031306" "0" "50" "1" "154842210" "154842242" "dup" "0" "01804" "KCNN3_000043" "g.154842210_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.209_241dup (p.(Gln70_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001031307" "0" "30" "1" "154842228" "154842242" "dup" "0" "01804" "KCNN3_000015" "g.154842228_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.227_241dup (p.(Gln76_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001031308" "0" "50" "1" "154842341" "154842355" "del" "0" "01804" "KCNN3_000044" "g.154842341_154842355del" "" "" "" "KCNN3(NM_002249.6):c.96_110del (p.(Gln37_Gln41del))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001050280" "0" "30" "1" "154842222" "154842242" "dup" "0" "01804" "KCNN3_000013" "g.154842222_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.221_241dup (p.(Gln74_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001050281" "0" "50" "1" "154842234" "154842242" "dup" "0" "01804" "KCNN3_000017" "g.154842234_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.233_241dup (p.(Gln78_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063158" "0" "50" "1" "154705526" "154705526" "subst" "8.12255E-6" "02325" "KCNN3_000039" "g.154705526G>A" "" "" "" "KCNN3(NM_002249.6):c.1543C>T (p.(Pro515Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063159" "0" "50" "1" "154744577" "154744577" "subst" "0" "02325" "KCNN3_000045" "g.154744577T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063160" "0" "50" "1" "154794575" "154794575" "subst" "1.2184E-5" "02325" "KCNN3_000046" "g.154794575C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063161" "0" "50" "1" "154794654" "154794654" "subst" "4.06118E-6" "02325" "KCNN3_000047" "g.154794654T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063162" "0" "30" "1" "154842210" "154842242" "dup" "0" "02325" "KCNN3_000043" "g.154842210_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.209_241dup (p.(Gln70_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001063163" "0" "50" "1" "154842219" "154842242" "del" "0" "02325" "KCNN3_000048" "g.154842219_154842242del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063164" "0" "30" "1" "154842222" "154842242" "dup" "0" "02325" "KCNN3_000013" "g.154842222_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.221_241dup (p.(Gln74_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001063165" "0" "10" "1" "154842228" "154842242" "dup" "0" "02325" "KCNN3_000015" "g.154842228_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.227_241dup (p.(Gln76_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001063166" "0" "50" "1" "154842231" "154842242" "dup" "0" "02325" "KCNN3_000016" "g.154842231_154842242dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001063167" "0" "10" "1" "154842234" "154842242" "dup" "0" "02325" "KCNN3_000017" "g.154842234_154842242dup" "" "" "" "KCNN3(NM_002249.6):c.233_241dup (p.(Gln78_Gln80dup))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001063168" "0" "10" "1" "154842237" "154842242" "dup" "0" "02325" "KCNN3_000029" "g.154842237_154842242dup" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes KCNN3 ## Count = 52 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000003506" "00001197" "50" "1029" "18153" "1029" "18153" "c.1029+18153T>C" "r.(=)" "p.(=)" "" "0000037557" "00001197" "50" "239" "0" "241" "0" "c.239_241del" "r.(?)" "p.(Gln80del)" "" "0000404996" "00001197" "50" "102" "0" "110" "0" "c.102_110del" "r.(?)" "p.(Gln39_Gln41del)" "" "0000487116" "00001197" "90" "1306" "0" "1306" "0" "c.1306A>T" "r.(?)" "p.(Ser436Cys)" "" "0000487117" "00001197" "90" "805" "0" "805" "0" "c.805A>G" "r.(?)" "p.(Lys269Glu)" "" "0000487118" "00001197" "90" "1049" "0" "1049" "0" "c.1049G>A" "r.(?)" "p.(Gly350Asp)" "" "0000487119" "00001197" "90" "1348" "0" "1348" "0" "c.1348G>C" "r.(?)" "p.(Val450Leu)" "" "0000604843" "00001197" "30" "1954" "0" "1954" "0" "c.1954C>T" "r.(?)" "p.(Leu652=)" "" "0000711020" "00001197" "70" "1663" "0" "1663" "0" "c.1663G>T" "r.(?)" "p.(Val555Phe)" "" "0000711021" "00001197" "70" "1616" "0" "1618" "0" "c.1616_1618del" "r.(?)" "p.(Val539del)" "" "0000711022" "00001197" "70" "859" "0" "859" "0" "c.859G>T" "r.(?)" "p.(Ala287Ser)" "" "0000716874" "00001197" "50" "1348" "0" "1348" "0" "c.1348G>C" "r.(?)" "p.(Val450Leu)" "" "0000794977" "00001197" "50" "239" "0" "241" "0" "c.239_241del" "r.(?)" "p.(Gln80del)" "1" "0000798808" "00001197" "30" "239" "0" "241" "0" "c.239_241del" "r.(?)" "p.(Gln80del)" "" "0000823714" "00001197" "50" "1690" "0" "1690" "0" "c.1690C>T" "r.(?)" "p.(Leu564Phe)" "" "0000848319" "00001197" "30" "218" "0" "241" "0" "c.218_241dup" "r.(?)" "p.(Gln73_Gln80dup)" "" "0000910784" "00001197" "70" "1663" "0" "1663" "0" "c.1663G>A" "r.(?)" "p.(Val555Ile)" "" "0000928021" "00001197" "50" "1928" "0" "1928" "0" "c.1928C>T" "r.(?)" "p.(Thr643Ile)" "" "0000928022" "00001197" "50" "1652" "0" "1652" "0" "c.1652C>T" "r.(?)" "p.(Ala551Val)" "" "0000946987" "00001197" "30" "239" "0" "241" "0" "c.239_241dup" "r.(?)" "p.(Gln80dup)" "" "0000952366" "00001197" "50" "199" "0" "213" "0" "c.199_213dup" "r.(?)" "p.(Gln76_Gln80dup)" "" "0000960535" "00001197" "50" "221" "0" "241" "0" "c.221_241del" "r.(?)" "p.(Gln74_Gln80del)" "" "0000960541" "00001197" "10" "236" "0" "241" "0" "c.236_241dup" "r.(?)" "p.(Gln79_Gln80dup)" "" "0000973350" "00001197" "50" "1748" "0" "1748" "0" "c.1748A>G" "r.(?)" "p.(Tyr583Cys)" "" "0000973351" "00001197" "50" "1449" "-3900" "1449" "-3900" "c.1449-3900G>A" "r.(=)" "p.(=)" "" "0000973352" "00001197" "50" "889" "0" "891" "0" "c.889_891del" "r.(?)" "p.(Val297del)" "" "0000973353" "00001197" "50" "454" "0" "454" "0" "c.454G>A" "r.(?)" "p.(Gly152Ser)" "" "0000990379" "00001197" "30" "1914" "0" "1914" "0" "c.1914G>C" "r.(?)" "p.(Met638Ile)" "" "0000990380" "00001197" "50" "412" "0" "412" "0" "c.412G>A" "r.(?)" "p.(Gly138Ser)" "" "0000990381" "00001197" "30" "320" "0" "320" "0" "c.320C>T" "r.(?)" "p.(Ala107Val)" "" "0000990382" "00001197" "30" "137" "0" "137" "0" "c.137C>G" "r.(?)" "p.(Ala46Gly)" "" "0001011496" "00001197" "70" "1606" "0" "1606" "0" "c.1606G>A" "r.(?)" "p.(Ala536Thr)" "5" "0001031302" "00001197" "30" "1543" "0" "1543" "0" "c.1543C>T" "r.(?)" "p.(Pro515Ser)" "" "0001031303" "00001197" "50" "1498" "0" "1498" "0" "c.1498C>G" "r.(?)" "p.(Leu500Val)" "" "0001031304" "00001197" "50" "933" "9338" "933" "9338" "c.933+9338G>C" "r.(=)" "p.(=)" "" "0001031305" "00001197" "50" "671" "0" "671" "0" "c.671G>A" "r.(?)" "p.(Arg224Gln)" "" "0001031306" "00001197" "50" "209" "0" "241" "0" "c.209_241dup" "r.(?)" "p.(Gln70_Gln80dup)" "" "0001031307" "00001197" "30" "227" "0" "241" "0" "c.227_241dup" "r.(?)" "p.(Gln76_Gln80dup)" "" "0001031308" "00001197" "50" "96" "0" "110" "0" "c.96_110del" "r.(?)" "p.(Gln37_Gln41del)" "" "0001050280" "00001197" "30" "221" "0" "241" "0" "c.221_241dup" "r.(?)" "p.(Gln74_Gln80dup)" "" "0001050281" "00001197" "50" "233" "0" "241" "0" "c.233_241dup" "r.(?)" "p.(Gln78_Gln80dup)" "" "0001063158" "00001197" "50" "1543" "0" "1543" "0" "c.1543C>T" "r.(?)" "p.(Pro515Ser)" "" "0001063159" "00001197" "50" "1322" "0" "1322" "0" "c.1322A>G" "r.(?)" "p.(Asn441Ser)" "" "0001063160" "00001197" "50" "1019" "0" "1019" "0" "c.1019G>A" "r.(?)" "p.(Arg340His)" "" "0001063161" "00001197" "50" "940" "0" "940" "0" "c.940A>G" "r.(?)" "p.(Met314Val)" "" "0001063162" "00001197" "30" "209" "0" "241" "0" "c.209_241dup" "r.(?)" "p.(Gln70_Gln80dup)" "" "0001063163" "00001197" "50" "218" "0" "241" "0" "c.218_241del" "r.(?)" "p.(Gln73_Gln80del)" "" "0001063164" "00001197" "30" "221" "0" "241" "0" "c.221_241dup" "r.(?)" "p.(Gln74_Gln80dup)" "" "0001063165" "00001197" "10" "227" "0" "241" "0" "c.227_241dup" "r.(?)" "p.(Gln76_Gln80dup)" "" "0001063166" "00001197" "50" "230" "0" "241" "0" "c.230_241dup" "r.(?)" "p.(Gln77_Gln80dup)" "" "0001063167" "00001197" "10" "233" "0" "241" "0" "c.233_241dup" "r.(?)" "p.(Gln78_Gln80dup)" "" "0001063168" "00001197" "10" "236" "0" "241" "0" "c.236_241dup" "r.(?)" "p.(Gln79_Gln80dup)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 14 "{{screeningid}}" "{{variantid}}" "0000000209" "0000003506" "0000017581" "0000037557" "0000181308" "0000404996" "0000241252" "0000487116" "0000241253" "0000487117" "0000241254" "0000487118" "0000241255" "0000487119" "0000327301" "0000711020" "0000327302" "0000711021" "0000327303" "0000711022" "0000381516" "0000794977" "0000393104" "0000823714" "0000445378" "0000952366" "0000457056" "0001011496"