### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = LAMA2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "LAMA2" "laminin, alpha 2" "6" "q22-q23" "unknown" "NG_008678.1" "UD_132119102218" "" "http://www.LOVD.nl/LAMA2" "" "1" "6482" "3908" "156225" "1" "1" "1" "1" "This database is one of the gene variant databases from the \"Leiden Muscular Dystrophy pages\" (LMDp)." "" "g" "https://databases.lovd.nl/shared/refseq/LAMA2_codingDNA.html" "1" "" "This database is one of the gene variant databases from the \"Leiden Muscular Dystrophy pages\" (LMDp)." "-1" "" "-1" "00002" "2002-03-30 00:00:00" "00006" "2017-03-31 14:45:02" "00006" "2025-12-05 13:23:08" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000065" "LAMA2" "laminin, alpha 2" "003" "NM_000426.3" "" "NP_000417.2" "" "" "" "-105" "9588" "9369" "129204286" "129837711" "00002" "2012-05-11 13:11:59" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 27 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000" "Healthy/Control" "Healthy individual / control" "" "" "" "" "" "00000" "2012-07-26 17:29:43" "" "" "00138" "autism" "autism" "" "209850" "" "" "" "00084" "2013-06-04 18:17:33" "00006" "2015-12-08 23:54:35" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00161" "IP" "incontinentia pigmenti (IP)" "XLD" "308300" "" "" "" "00006" "2013-06-28 11:48:50" "00006" "2021-02-04 13:31:44" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "00352" "CMD" "cardiomyopathy, dilated (CMD)" "" "" "" "" "" "00006" "2014-03-13 16:16:15" "00006" "2015-03-06 17:18:25" "00360" "MDC" "dystrophy, muscular, congenital (MDC)" "" "" "" "" "" "00006" "2014-03-21 23:02:36" "00006" "2018-07-03 16:30:02" "01617" "ABL" "abetalipoproteinaemia (ABL)" "AR" "200100" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "01926" "MEOAL;MMDS8" "mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy" "AR" "251900" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2024-11-25 10:11:25" "01959" "CMYO4A;CFTD" "myopathy, congenital, type 4A" "AD" "255310" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2025-02-07 14:49:08" "02717" "MDC1A" "dystrophy, muscular, congential, merosin deficient, type 1a (MDC-1A)" "AR" "607855" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "03282" "MDCL" "dystrophy, muscular, congenital, LMNA-related" "AD" "613205" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2023-01-21 16:40:43" "03381" "cancer, gastric" "cancer, gastric (Neoplasm of stomach)" "" "613659" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2017-07-14 15:28:09" "04147" "MRT" "mental retardation, autosomal recessive (MRT, intellectual disability (IDT))" "" "" "" "autosomal recessive" "" "00006" "2014-10-11 12:21:35" "00006" "2018-12-18 09:25:11" "04172" "CM" "cardiomyopathy (CM)" "" "" "" "" "" "00006" "2015-01-20 15:34:26" "00006" "2016-03-20 12:15:43" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "04270" "epilepsy" "epilepsy" "" "" "" "" "" "00006" "2015-05-14 16:00:06" "00006" "2017-09-07 14:25:59" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" "05126" "LGMD" "dystrophy, muscular, limb-girdle (LGMD)" "" "" "" "" "" "00006" "2016-01-26 06:05:36" "" "" "05324" "DMD" "dystrophy, muscular, Duchenne type (DMD)" "XLR" "310200" "" "" "" "00006" "2017-09-01 17:41:21" "00006" "2021-12-10 21:51:32" "05378" "BMD/DMD" "dystrophinopathy (BMD or DMD)" "" "" "" "" "" "00006" "2018-01-13 20:18:25" "00006" "2019-03-26 16:49:54" "05427" "ADPKD" "kidney, polycystic, disease, autosomal dominant (ADPKD)" "" "" "" "" "" "00006" "2018-05-08 22:37:08" "" "" "05618" "NMD" "neuromuscular disorder (NMD)" "" "" "" "" "" "00006" "2019-07-02 19:46:12" "" "" "05652" "LGMDR23" "dystrophy, muscular, limb-girdle, autosomal recessive, type 23 (LGMDR-23)" "AR" "618138" "" "" "autosomal recessive" "00006" "2019-09-14 15:01:01" "00006" "2021-12-10 21:51:32" "05976" "STHAG" "agenesis, tooth, selective (STHAG)" "" "" "" "" "" "00006" "2021-10-18 13:22:32" "" "" "07210" "scoliosis" "scoliosis" "" "" "" "" "" "00006" "2025-12-05 11:13:58" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 4 "{{geneid}}" "{{diseaseid}}" "LAMA2" "00139" "LAMA2" "00360" "LAMA2" "02717" "LAMA2" "05652" ## Individuals ## Do not remove or alter this header ## ## Count = 1194 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000012" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000017" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000018" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000036" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000039" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000040" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000048" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000049" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "0" "" "" "" "" "00000054" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000057" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000069" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000071" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000075" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000090" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000092" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000099" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00000100" "" "" "" "1" "" "00004" "{PMID:Bell 2011:21228398}" "" "" "" "" "" "" "" "" "" "" "00036032" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036033" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036034" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036035" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036036" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036037" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036038" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036040" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036041" "" "" "" "1" "" "01164" "" "" "M" "?" "Libya" "" "0" "" "" "" "77186" "00036042" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036043" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036044" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036045" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036046" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036047" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036048" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036049" "" "" "" "1" "" "01164" "" "" "F" "?" "Germany" "" "0" "" "" "" "84038" "00036050" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036051" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036052" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036053" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036054" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036055" "" "" "" "1" "" "01164" "" "" "" "" "Germany" "" "0" "" "" "" "" "00036057" "" "" "" "1" "" "01164" "" "" "M" "?" "Germany" "" "0" "" "" "" "102888" "00054672" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "F" "" "Australia" ">14y" "0" "" "" "" "Pat51" "00054676" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "" "M" "" "Australia" ">18y" "0" "" "" "" "Pat71" "00054677" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "M" "" "Australia" ">23y" "0" "" "" "" "Pat84" "00054681" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "M" "" "Australia" ">09y" "0" "" "" "" "Pat95" "00054688" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "F" "" "Australia" ">04y" "0" "" "" "" "Pat112" "00054691" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "F" "" "Australia" ">05y" "0" "" "" "" "Pat117" "00054693" "" "" "" "1" "" "01399" "{PMID:O\'Grady 2016:27159402}" "2-generation family, unaffected heterozygous carrier parents" "F" "" "Australia" ">08y" "0" "" "" "" "Pat123" "00088192" "" "" "" "2" "" "01822" "{PMID:Harris 2017:27932089}" "" "M" "no" "United Kingdom (Great Britain)" "" "0" "yes" "" "" "" "00102114" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ESN" "" "" "" "" "0" "" "" "" "?" "00102115" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures ankles, abnormal white matter, no seizures" "M" "" "(United States)" "" "0" "" "" "" "09674786-Pat12" "00102116" "" "" "" "1" "" "00006" "{PMID:Hayashi 1995:7643867}" "" "F" "no" "Japan" "1y11m" "0" "" "" "" "07643867-Pat" "00102117" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102118" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102119" "" "" "" "1" "" "00006" "acc. to {PMID:Allamand 2002:11938437}" "" "" "" "" "" "0" "" "" "" "11938437-pat?" "00102120" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102121" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}, {OMIM156225:0010}" "" "F" "" "United States" ">4y" "0" "" "" "" "12552556-Pat2" "00102122" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102123" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "" "" "" "(France)" "" "0" "" "" "" "11938437-PG" "00102124" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures ankles/knees/wrists/elbows, abnormal white matter, no seizures" "M" "" "(United States)" "" "0" "" "" "" "09674786-Pat7" "00102125" "" "" "" "1" "" "00006" "" "2-generation family, affected son, unaffected carrier father" "M" "no" "" "" "0" "" "" "" "09541105-Fam490" "00102126" "" "" "" "1" "" "00006" "{PMID:Hayashi 2001:11369186}" "" "F" "" "Japan" ">6y" "0" "" "" "" "11369186-Pat1" "00102127" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102128" "" "" "" "1" "" "00400" "{PMID:Yuan 2008:19294599}" "" "M" "no" "China" ">5m" "0" "" "" "" "19294599-Pat2" "00102129" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102130" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102131" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102132" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractures elbows/wrists/hips/knees/ankles, abnormal white matter (hypoplastics pons.), no seizures" "M" "" "Japan" "" "0" "" "" "" "09674786-Pat20/Pat9" "00102133" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102134" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102135" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102136" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102137" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102138" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102139" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "F" "" "Italy" ">7y" "0" "" "" "" "16216942-Pat7" "00102140" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102141" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractures, abnormal white matter, no seizures" "M" "" "Japan" "" "0" "" "" "" "09674786-Pat8/Pat3" "00102142" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102143" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "M" "" "United States" ">25y" "0" "" "" "" "12552556-Pat3" "00102144" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ESN" "" "" "" "" "0" "" "" "" "?" "00102145" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "F" "" "United States" ">6y" "0" "" "" "" "12552556-Pat5" "00102146" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractures elbows/hips/knees/ankles, abnormal white matter, seizures partialcomplex secondary generalized" "F" "" "Japan" ">9y" "0" "" "" "" "09674786-Pat21/Pat10" "00102147" "" "" "" "1" "" "00006" "{PMID:Guicheney 1997:9185182}" "" "" "no" "Turkey" "" "0" "" "" "" "09185182-PatT" "00102148" "" "" "" "1" "" "00006" "{PMID:Guicheney 1997:9185182}" "" "" "no" "Italy" "" "0" "" "" "" "09185182-PatI" "00102149" "" "" "" "1" "" "00006" "{PMID:Guicheney 1997:9185182}" "" "" "no" "Uruguay" "" "0" "" "" "" "09185182-PatU" "00102150" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "F" "" "(United States)" "" "0" "" "" "" "09674786-Pat2" "00102151" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102152" "" "" "" "1" "" "00006" "{PMID:Allamand 2002:11938437}" "PG" "" "" "(France)" "" "0" "" "" "" "11938437-pat?" "00102153" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures ankles, normal white matter, no seizures; death respiratory failure" "F" "" "(United States)" "6y" "0" "" "" "" "09674786-Pat3" "00102154" "" "" "" "1" "" "00006" "{PMID:Hayashi 2001:11369186}" "" "F" "" "Japan" ">7m" "0" "" "" "" "11369186-Pat5" "00102155" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102156" "" "" "" "4" "" "00426" "{PMID:Siala 2008:18053718}" "2-generation family, unaffected carrier parents, 2 brothers" "F" "" "Tunisia" "10y" "0" "" "" "" "18053718-pat" "00102157" "" "" "" "5" "" "00426" "{PMID:Louhichi 2006:19388593}, {PMID:Siala 2007:17949279}, {PMID:Siala 2008:19072569}" "2-generation family, unaffected carrier parents and brother, prenatal diagnosis unaffected carrier fetus" "M" "" "Tunisia" ">4y" "0" "" "" "" "17949279-Pat1/FamF2" "00102158" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "M" "" "(United States)" "9y" "0" "" "" "" "09674786-Pat18" "00102159" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractures wrists/ankles, abnormal white matter, no seizures" "M" "" "Japan" "" "0" "" "" "" "09674786-Pat5/Pat2" "00102160" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "M" "" "Norway" ">1y10m" "0" "" "" "" "16216942-Pat2" "00102161" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">07y" "0" "" "" "" "18700894-Pat5" "00102162" "" "" "" "2" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractures, normal white matter, open anterior opercula, seizures (generalized tonic-clonic)" "M" "" "Japan" "" "0" "" "" "" "09674786-Pat1/Pat7" "00102163" "" "" "" "4" "" "00006" "{PMID:Di Blasi 2001:11287370}" "2-generation family, affected brother/sister, unaffected carrier parents and sister" "M" "" "Italy" ">39y" "0" "" "" "" "11287370-Pat1" "00102164" "" "" "" "5" "" "00006" "{PMID:Guicheney 1997:9185182}" "2-generation family, 2 affecteds (F, M), unaffected carrier father, mother, fetus" "" "" "Tunisia" "" "0" "" "" "" "09185182-Fam2324" "00102165" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "F" "" "Tunisia" ">24m" "0" "" "" "" "16216942-Pat1" "00102166" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "Italy" "" "0" "" "" "" "09541105-Fam4836" "00102167" "" "" "" "5" "" "00006" "{PMID:Nissinen 1996:8651294}, {PMID:Guicheney 1997:9185182}" "2-generation family, 1 affected, 4 unaffacted carriers (father, mother, sister, brother)" "M" "" "Turkey" "" "0" "" "" "" "Fam1266" "00102168" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">07y" "0" "" "" "" "18700894-Pat3" "00102169" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "Turkey" "" "0" "" "" "" "09541105-Fam1663" "00102170" "" "" "" "1" "" "00006" "{PMID:Helbling-Leclerc:7550355}" "" "" "no" "France" "" "0" "" "" "" "?" "00102171" "" "" "" "4" "" "00006" "{PMID:Allamand 1997:9158149}, {OMIM156225:0003}" "brother of 9158149.case2; 2-generation family, unaffected carrier parents, carrier brother" "M" "" "Saudi Arabia" ">6y" "0" "" "" "" "09158149-Case1" "00102172" "" "" "" "2" "" "00006" "{PMID:Helbling-Leclerc:7550355}, {OMIM156225:0001}" "family, 2 affected children; unaffected carrier parents and sibs" "" "" "France" "" "0" "" "" "" "?" "00102173" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "Italy" "" "0" "" "" "" "09541105-FamSI" "00102174" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "M" "" "Senegal" ">2y6m" "0" "" "" "" "16216942-Pat5" "00102175" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "M" "" "Italy" ">10y" "0" "" "" "" "16216942-Pat10" "00102176" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractures elbows/hips/knees, abnormal white matter, no seizures" "M" "" "Japan" "" "0" "" "" "" "09674786-Pat6/Pat4" "00102177" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures knees/ankles, abnormal white matter, no seizures" "M" "" "(United States)" "10y" "0" "" "" "" "09674786-Pat17" "00102178" "" "" "" "7" "" "00006" "{PMID:Coral-Vazquez 2003:12601554}, {OMIM156225:0008}" "5-generation family, 1 affected, 6 unaffected carreirs" "F" "" "Mexico" "" "0" "" "" "" "12601554-V2" "00102179" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">27y" "0" "" "" "" "18700894-Pat15" "00102180" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">19y" "0" "" "" "" "18700894-Pat1" "00102181" "" "" "" "9" "" "00006" "Subm. FMuntoni, Mein ESHG2006 P0665" "9 families" "" "" "" "" "0" "" "" "" "?" "00102182" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "M" "" "Tunisia" "1y8m" "0" "" "" "" "16216942-Pat6" "00102183" "" "" "" "1" "" "00006" "{PMID:Prandini 2004:15452315}" "2-generation family, 2 affected sister" "F" "no" "Italy" ">13y" "0" "" "" "" "15452315-Pat" "00102184" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "France" "" "0" "" "" "" "09541105-Fam2656" "00102185" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures elbows/hips/knees/ankles, normal white matter, no seizures" "M" "" "(United States)" "" "0" "" "" "" "09674786-Pat16" "00102186" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "M" "" "(United States)" "" "0" "" "" "" "09674786-Pat9" "00102187" "" "" "" "1" "" "00006" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "case 2 in Naom 2000" "F" "" "United Kingdom (Great Britain)" ">12y" "0" "" "" "" "10611118-case2/Pat37" "00102188" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}, {PMID:Vigliano 2009:18406646}, {OMIM156225:0013}" "" "F" "no" "Italy" ">6y" "0" "" "" "" "16216942-Pat3/pat" "00102189" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">07y" "0" "" "" "" "18700894-Pat10" "00102190" "" "" "" "2" "" "00006" "{PMID:Guicheney 1998:9541105}" "2-generation family, affected brother/sister, unaffected carrier mother" "" "no" "Italy" "" "0" "" "" "" "09541105-FamLI" "00102191" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" "00y09m" "0" "" "" "" "18700894-Pat13" "00102192" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">07y" "0" "" "" "" "18700894-Pat2" "00102193" "" "" "" "1" "" "00006" "{PMID:He 2001:11591858}, {OMIM156225:0006}" "" "M" "" "France" ">12y" "0" "" "" "" "11591858-case2" "00102194" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "2-generation family, affected daugther, unaffected carrier father" "F" "no" "Italy" "" "0" "" "" "" "09541105-Fam4835" "00102195" "" "" "" "1" "" "00006" "{PMID:Mendell 1997:10694916}" "" "" "" "(United States)" ">2y6m" "0" "" "" "" "10694916-Pat" "00102196" "" "" "" "1" "" "00006" "{PMID:He 2001:11591858}, {OMIM156225:0005}" "" "M" "" "France" ">9y" "0" "" "" "" "11591858-case1" "00102197" "" "" "" "2" "" "00006" "{PMID:Naom 1998:9829280}" "sister of 9829280.case2" "F" "no" "United Kingdom (Great Britain)" ">7y" "0" "" "" "white" "09829280-Case1" "00102198" "" "" "" "3" "" "00006" "{PMID:Di Blasi:10852549}, {PMID:Carboni 2011:22006699}" "2-generation family, 1 affected, 3 unaffected carriers (father, mother, sister)" "M" "" "Italy" ">41y" "0" "" "" "" "10852549-Pat" "00102199" "" "" "" "1" "" "00006" "{PMID:Hayashi 1997:9113020}" "" "M" "" "Japan" ">41y" "0" "" "" "" "09113020_Pat" "00102200" "" "" "" "1" "" "00006" "{PMID:He 2001:11591858}, {OMIM156225:0007}" "" "M" "" "France" ">12y" "0" "" "" "" "11591858-case3" "00102201" "" "" "" "1" "" "00006" "{PMID:Pegoraro 2000:11071490}, {OMIM156225:0011}" "" "F" "" "Italy" ">14y" "0" "" "" "" "11071490-Pat" "00102202" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "2-generation family, affected daugther, unaffected carrier father" "F" "no" "France" "" "0" "" "" "" "09541105-Fam1272" "00102203" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "2-generation family, affected son, unaffected carrier mother" "M" "no" "" "" "0" "" "" "" "09541105-Fam1672" "00102204" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures fingers/elbows/knees/ankles, abnormal white matter, no seizures" "M" "" "(United States)" "" "0" "" "" "" "09674786-Pat14" "00102205" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Hayashi 2001:11369186}" "contractureselbows/ankles, abnormal white matter, no seizures" "M" "" "Japan" "" "0" "" "" "" "09674786-Pat13/Pat6" "00102206" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1996:8957020}" "" "F" "" "(United States)" "5y7m" "0" "" "" "" "08957020-Pat5/Pat15" "00102207" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1996:8957020}" "" "M" "" "(United States)" "" "0" "" "" "" "08957020-Pat2/Pat11" "00102208" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">07y" "0" "" "" "" "18700894-Pat4" "00102209" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">24y" "0" "" "" "" "18700894-Pat11" "00102210" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}, {OMIM156225:0014}" "" "M" "no" "Albania" "12y" "0" "" "" "" "16216942-Pat4" "00102211" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "2-generation family, affected sister/brother" "F" "no" "Italy" ">9y" "0" "" "" "" "16216942-Pat8" "00102212" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">17y" "0" "" "" "" "18700894-Pat6" "00102213" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">13y" "0" "" "" "" "18700894-Pat7" "00102214" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">04y" "0" "" "" "" "18700894-Pat8" "00102215" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">02y" "0" "" "" "" "18700894-Pat14" "00102216" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Spain" ">03y" "0" "" "" "" "18700894-Pat12" "00102217" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">11y" "0" "" "" "" "18700894-Pat9" "00102218" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">04y" "0" "" "" "" "18700894-Pat16" "00102219" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">02y" "0" "" "" "" "18700894-Pat17" "00102220" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102221" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102222" "" "" "" "1" "" "00006" "" "" "" "" "" "" "0" "" "" "" "?" "00102223" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102224" "" "" "" "3" "" "00006" "{PMID:Helbling-Leclerc:7550355}" "" "" "" "France" "" "0" "" "" "" "?" "00102225" "" "" "" "4" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102226" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102227" "" "" "" "1" "" "00006" "Panicker 1999, Human Mutation MPR43" "" "" "" "" "" "0" "" "" "white" "?" "00102228" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102229" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102230" "" "" "" "4" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102231" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102232" "" "" "" "33" "" "00006" "Panicker 1999, Human Mutation MPR43" "" "" "" "" "" "0" "" "" "white" "?" "00102233" "" "" "" "36" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102234" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102235" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102236" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102237" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102238" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102239" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102240" "" "" "" "1" "" "00006" "Subm. FMuntoni" "ICSM" "" "" "" "" "0" "" "" "" "?" "00102241" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}, {OMIM156225:0009}" "" "F" "" "United States" ">24y" "0" "" "" "" "12552556-Pat1" "00102242" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102243" "" "" "" "2" "" "00006" "Panicker 1999, Human Mutation MPR43" "" "" "" "" "" "0" "" "" "white" "?" "00102244" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102245" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102246" "" "" "" "48" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102247" "" "" "" "1" "" "00006" "{PMID:Hu 1994:7874173}" "dy2J mouse model" "" "" "" "" "0" "" "" "" "?" "00102248" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102249" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102250" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102251" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102252" "" "" "" "3" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102253" "" "" "" "30" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102254" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102255" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102256" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102257" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102258" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102259" "" "" "" "3" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102260" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102261" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102262" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102263" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102264" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102265" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102266" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102267" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102268" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102269" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "M" "" "United States" ">3y" "0" "" "" "" "12552556-Pat4" "00102270" "" "" "" "3" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102271" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102272" "" "" "" "6" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102273" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102274" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102275" "" "" "" "124" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102276" "" "" "" "4" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102277" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102278" "" "" "" "22" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102279" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102280" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102281" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102282" "" "" "" "32" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102283" "" "" "" "3" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102284" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102285" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102286" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102287" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102288" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102289" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102290" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102291" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102292" "" "" "" "34" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102293" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102294" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102295" "" "" "" "1" "" "00006" "Panicker 1999, Human Mutation MPR43" "" "" "" "" "" "0" "" "" "white" "?" "00102296" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102297" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102298" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "2-generation family, affected sister/brother" "M" "no" "Italy" ">5y" "0" "" "" "" "16216942-Pat9" "00102299" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102300" "" "" "" "1" "" "00006" "{PMID:Wibawa 2002:12100448}" "" "" "" "Indonesia" "" "0" "" "" "" "12100448-?" "00102301" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102302" "" "" "" "1" "" "00006" "Panicker 1999, Human Mutation MPR43" "" "" "" "" "" "0" "" "" "white" "?" "00102303" "" "" "" "1" "" "00006" "Panicker 1999, Human Mutation MPR43" "" "" "" "" "" "0" "" "" "white" "?" "00102304" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102305" "" "" "" "1" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102306" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102307" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102308" "" "" "" "12" "" "00006" "{PMID:Guicheney 1998:9541105}" "" "" "" "" "" "0" "" "" "" "09541105-con" "00102309" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102310" "" "" "" "5" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102311" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102312" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102313" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102314" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102315" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102316" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102317" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102318" "" "" "" "1" "" "00400" "" "" "" "" "Portugal" "" "0" "" "" "" "?" "00102319" "" "" "" "5" "" "00006" "" "" "" "" "" "" "0" "" "" "" "?" "00102320" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "contractures elbows/wrists/hips/knees/ankles, abnormal white matter (hypoplastics pons.), seizures generalized tonic-clonic" "F" "" "(United States)" "" "0" "" "" "" "09674786-Pat22" "00102321" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102322" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "12552556-con" "00102323" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Hispanic" "?" "00102324" "" "" "" "1" "" "00464" "" "symptomatic patient" "F" "" "United States" "" "0" "" "" "African American" "?" "00102325" "" "" "" "1" "" "01951" "" "" "M" "" "Canada" "" "0" "" "" "France" "?" "00102326" "" "" "" "2" "" "01416" "{PMID:Rajakulendran 2011:21922472}" "" "F" "" "" "" "0" "" "" "" "?" "00102327" "" "" "" "1" "" "00464" "" "" "F" "" "" "" "0" "" "" "" "?" "00102328" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Middle Eastern" "?" "00102329" "" "" "" "1" "" "00464" "" "" "F" "" "" "" "0" "" "" "Middle Eastern" "?" "00102330" "" "" "" "1" "" "00464" "" "" "F" "" "" "" "0" "" "" "Middle Eastern" "?" "00102331" "" "" "" "1" "" "00464" "" "" "F" "" "" "" "0" "" "" "" "?" "00102332" "" "" "" "1" "" "01416" "" "" "M" "" "Sweden" "" "0" "" "" "" "?" "00102333" "" "" "" "1" "" "01416" "" "" "F" "" "Ireland" "" "0" "" "" "" "?" "00102334" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102335" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102336" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102337" "" "" "" "1" "" "00464" "" "" "F" "" "" "" "0" "" "" "Middle Eastern" "?" "00102338" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1996:8957020}" "" "F" "" "(United States)" ">5y" "0" "" "" "" "08957020-Pat1" "00102339" "" "" "" "4" "" "00006" "{PMID:Allamand 1997:9158149}, {OMIM156225:0003}" "sister of 9158149.case1; 2-generation family, unaffected carrier parents, carrier brother" "F" "" "Saudi Arabia" ">4y" "0" "" "" "" "09158149-Case2" "00102340" "" "" "" "2" "" "00006" "{PMID:Naom 1998:9829280}" "brother of 9829280.case1" "M" "no" "United Kingdom (Great Britain)" ">11y" "0" "" "" "white" "09829280-Case2" "00102341" "" "" "" "4" "" "00006" "{PMID:Di Blasi 2001:11287370}" "2-generation family, affected brother/sister, unaffected carrier parents and sister" "F" "" "Italy" ">36y" "0" "" "" "" "11287370-Pat2" "00102342" "" "" "" "1" "" "00464" "" "" "" "" "" "" "0" "" "" "Arab, Middle East" "?" "00102349" "" "" "" "1" "" "00464" "" "" "F" "" "" "" "0" "" "" "Middle East" "?" "00102350" "" "" "" "1" "" "00006" "Nevo ESHG2008 P01.202" "daugther of Nevo_P2/P3" "?" "" "(Israel)" "" "0" "" "" "" "?" "00102351" "" "" "" "1" "" "00006" "Nevo ESHG2008 P01.202" "father of Nevo_P1" "M" "" "(Israel)" "" "0" "" "" "" "?" "00102352" "" "" "" "1" "" "00464" "" "unaffected parent of affected child" "" "" "United States" "" "0" "" "" "Hispanic" "?" "00102353" "" "" "" "1" "" "00464" "" "unaffected parent of affected child" "" "" "United States" "" "0" "" "" "Hispanic" "?" "00102354" "" "" "" "1" "" "00464" "" "" "" "" "" "" "0" "" "" "Middle East" "?" "00102355" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "Europe" "?" "00102356" "" "" "" "1" "" "00471" "" "" "" "" "" "" "0" "" "" "Mediterraneen" "?" "00102357" "" "" "" "1" "" "00471" "" "" "?" "" "" "" "0" "" "" "Mediterranean" "?" "00102358" "" "" "" "1" "" "00464" "" "" "F" "yes" "United States" "" "0" "" "" "" "?" "00102359" "" "" "" "1" "" "00464" "" "" "" "" "" "" "0" "" "" "Middle East" "?" "00102360" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102361" "" "" "" "1" "" "00464" "" "" "F" "" "Canada" "" "0" "" "" "" "?" "00102362" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102363" "" "" "" "1" "" "00464" "" "" "F" "" "(Saudi Arabia)" "" "0" "" "" "" "?" "00102364" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00102365" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102366" "" "" "" "1" "" "00464" "" "" "F" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102367" "" "" "" "1" "" "00464" "" "" "F" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102368" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00102369" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00102370" "" "" "" "1" "" "00464" "" "" "" "" "(Canada)" "" "0" "" "" "" "?" "00102371" "" "" "" "1" "" "00464" "" "" "F" "" "Mexico" "" "0" "" "" "Hispanic" "?" "00102372" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102373" "" "" "" "1" "" "00464" "" "" "F" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102374" "" "" "" "1" "" "00486" "" "MDC1A myoblast line 96/04 (Eurobiobank)" "M" "" "(Germany)" "" "0" "" "" "" "?" "00102375" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00102376" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00102377" "" "" "" "1" "" "00464" "" "" "F" "" "(United States)" "" "0" "" "" "" "?" "00102378" "" "" "" "1" "" "00464" "" "" "M" "" "Canada" "" "0" "" "" "French Canadian" "?" "00102379" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102380" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102381" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102382" "" "" "" "1" "" "00464" "" "1-generation family, 2 affected" "M" "" "(United States)" "" "0" "" "" "" "?" "00102383" "" "" "" "1" "" "00464" "" "" "M" "" "(Canada)" "" "0" "" "" "" "?" "00102384" "" "" "" "1" "" "00464" "" "" "" "" "(United States)" "" "0" "" "" "" "?" "00102385" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "" "?" "00102386" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102387" "" "" "" "1" "" "00464" "" "" "" "" "Russian Federation" "" "0" "" "" "" "?" "00102388" "" "" "" "1" "" "00464" "" "" "M" "" "(United States)" "" "0" "" "" "Arab" "?" "00102389" "" "" "" "1" "" "00464" "" "" "" "" "Iran" "" "0" "" "" "" "?" "00102390" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102391" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102392" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102393" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102394" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102395" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102396" "" "" "" "1" "" "00464" "" "" "F" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102397" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102398" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102399" "" "" "" "1" "" "00464" "" "" "M" "" "Iran" "" "0" "" "" "" "?" "00102400" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102401" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102402" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">5m" "0" "" "" "" "20207543-Pat01" "00102403" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">6m" "0" "" "" "" "20207543-Pat02" "00102404" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">1y3m" "0" "" "" "" "20207543-Pat03" "00102405" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">1y4m" "0" "" "" "" "20207543-Pat04" "00102406" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">1y4m" "0" "" "" "" "20207543-Pat05" "00102407" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">1y10m" "0" "" "" "" "20207543-Pat06" "00102408" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">2y" "0" "" "" "" "20207543-Pat07" "00102409" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">2y" "0" "" "" "" "20207543-Pat08" "00102410" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "United Kingdom (Great Britain)" ">2y" "0" "" "" "Ireland" "20207543-Pat09" "00102411" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">2y" "0" "" "" "" "20207543-Pat10" "00102412" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">2y1m" "0" "" "" "" "20207543-Pat11" "00102413" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">2y10m" "0" "" "" "" "20207543-Pat12" "00102414" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">3y" "0" "" "" "" "20207543-Pat13" "00102415" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">3y4m" "0" "" "" "" "20207543-Pat14" "00102416" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">3y4m" "0" "" "" "" "20207543-Pat15" "00102417" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">3y6m" "0" "" "" "" "20207543-Pat16" "00102418" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">4y" "0" "" "" "" "20207543-Pat17" "00102419" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "large family" "M" "" "Kenya" ">4y" "0" "" "" "Asian" "20207543-Pat18" "00102420" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "large family; relative of 20207543-Pat44" "F" "" "Kenya" ">4y" "0" "" "" "Asian" "20207543-Pat19" "00102421" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">4y4m" "0" "" "" "" "20207543-Pat20" "00102422" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">4y4m" "0" "" "" "" "20207543-Pat21" "00102423" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">4y5m" "0" "" "" "" "20207543-Pat22" "00102424" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">5y" "0" "" "" "" "20207543-Pat23" "00102425" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">5y6m" "0" "" "" "" "20207543-Pat24" "00102426" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">5y6m" "0" "" "" "" "20207543-Pat25" "00102427" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">6y" "0" "" "" "" "20207543-Pat26" "00102428" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">6y" "0" "" "" "" "20207543-Pat27" "00102429" "" "" "" "3" "" "00006" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "2-generation family, affected son, unaffected carrier mother and brother" "F" "" "United Kingdom (Great Britain)" ">6y" "0" "" "" "white" "10611118-case1/Pat28" "00102430" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "United Kingdom (Great Britain)" ">6y6m" "0" "" "" "Ireland" "20207543-Pat29" "00102431" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">7y9m" "0" "" "" "" "20207543-Pat30" "00102432" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">8y" "0" "" "" "" "20207543-Pat31" "00102434" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">11y" "0" "" "" "" "20207543-Pat33" "00102435" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">12y" "0" "" "" "" "20207543-Pat34" "00102436" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "large family" "F" "" "Kenya" ">12y" "0" "" "" "Asian" "20207543-Pat35" "00102437" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "United Kingdom (Great Britain)" ">12y" "0" "" "" "Ireland" "20207543-Pat36" "00102438" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">13y4m" "0" "" "" "" "20207543-Pat38" "00102439" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">15y" "0" "" "" "" "20207543-Pat39" "00102440" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">18y" "0" "" "" "" "20207543-Pat40" "00102441" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">18y8m" "0" "" "" "" "20207543-Pat41" "00102442" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">19y5m" "0" "" "" "" "20207543-Pat42" "00102443" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "20207543-Pat43/P46 are siblings" "M" "" "" ">19y6m" "0" "" "" "" "20207543-Pat43" "00102444" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "large family; maternal cousin of 20207543-Pat19" "F" "" "Kenya" ">20y" "0" "" "" "Asian" "20207543-Pat44" "00102445" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "large family" "M" "" "Kenya" ">23y" "0" "" "" "Asian" "20207543-Pat45" "00102446" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "20207543-Pat43/P46 are siblings" "F" "" "" ">24y6m" "0" "" "" "" "20207543-Pat46" "00102447" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">10m" "0" "" "" "" "20207543-Pat47" "00102448" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">2y1m" "0" "" "" "" "20207543-Pat48" "00102449" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "F" "" "" ">5y6m" "0" "" "" "" "20207543-Pat49" "00102450" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "United Kingdom (Great Britain)" ">7y7m" "0" "" "" "Ireland" "20207543-Pat50" "00102451" "" "" "" "1" "" "00006" "{PMID:Geranmayeh 2010:20207543}" "" "M" "" "" ">12y" "0" "" "" "" "20207543-Pat51" "00102452" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102453" "" "" "" "1" "" "00464" "" "" "" "" "(United States)" "" "0" "" "" "Hispanic" "?" "00102455" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102456" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102457" "" "" "" "1" "" "00464" "" "Affected twin sister" "F" "" "United States" "" "0" "" "" "" "?" "00102458" "" "" "" "1" "" "00464" "" "" "" "" "Qatar" "" "0" "" "" "" "?" "00102459" "" "" "" "1" "" "00464" "" "" "" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00102460" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Hispanic" "?" "00102461" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Hispanic" "?" "00102462" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "Hispanic" "?" "00102463" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102464" "" "" "" "1" "" "00006" "CA Valencia ASHG 2010 A1982" "" "?" "" "" "" "0" "" "" "" "ASHG2010-A1982b" "00102465" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102466" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00102467" "" "" "" "1" "" "00464" "" "affected brother" "M" "" "United States" "" "0" "" "" "" "?" "00102468" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102469" "" "" "" "1" "" "00464" "" "" "F" "" "Israel" "" "0" "" "" "Jewish-Sephardic" "?" "00102470" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102471" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102472" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102473" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102474" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102475" "" "" "" "1" "" "00464" "" "" "" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00102476" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102477" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "Mexican" "?" "00102478" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Hispanic" "?" "00102479" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Arab" "?" "00102480" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102481" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00102482" "" "" "" "1" "" "00464" "" "" "F" "" "Canada" "" "0" "" "" "" "?" "00102483" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Hispanic" "?" "00102484" "" "" "" "1" "" "00464" "" "Affected twin sister" "F" "" "United States" "" "0" "" "" "white" "?" "00102485" "" "" "" "1" "" "00464" "" "" "M" "" "Qatar" "" "0" "" "" "Arab" "?" "00102486" "" "" "" "1" "" "00464" "" "" "F" "" "Canada" "" "0" "" "" "" "?" "00102487" "" "" "" "1" "" "00006" "{PMID:Tezak 2003:12552556}" "" "" "" "United States" "" "0" "" "" "" "12552556-con" "00102488" "" "" "" "1" "" "00006" "{PMID:Wibawa 2002:12100448}" "" "" "" "Indonesia" "" "0" "" "" "" "12100448-?" "00102489" "" "" "" "1" "" "00006" "{PMID:Wibawa 2002:12100448}" "" "" "" "Indonesia" "" "0" "" "" "" "12100448-?" "00102490" "" "" "" "1" "" "00006" "{PMID:Wibawa 2002:12100448}" "" "" "" "Indonesia" "" "0" "" "" "" "12100448-?" "00102491" "" "" "" "1" "" "00006" "{PMID:Wibawa 2002:12100448}" "" "" "" "Indonesia" "" "0" "" "" "" "12100448-?" "00102492" "" "" "" "1" "" "00006" "{PMID:Prandini 2004:15452315}" "2-generation family, 2 affected sister; younger sister" "F" "no" "Italy" ">7y" "0" "" "" "" "15452315-Patsy" "00102493" "" "" "" "1" "" "00006" "{PMID:Di Blasi 2005:16216942}" "" "" "no" "Italy" "" "0" "" "" "" "16216942-con" "00102494" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2007:17765811}" "" "M" "" "" "" "0" "" "" "" "17765811-pat" "00102495" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Spain" ">07y" "0" "" "" "" "18700894-Pat18" "00102496" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}; {PMID:Oliveira 2014:27858771}" "" "M" "" "Spain" ">20y" "0" "" "" "" "18700894-Pat19; 27858771-Pat1" "00102497" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Spain" ">18y" "0" "" "" "" "18700894-Pat20" "00102498" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Switzerland" ">04y" "0" "" "" "" "18700894-Pat21" "00102499" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">00y09m" "0" "" "" "" "18700894-Pat22" "00102500" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">02y" "0" "" "" "" "18700894-Pat23" "00102501" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}; {PMID:Oliveira 2014:27858771}" "" "M" "?" "Portugal" ">03y" "0" "" "" "" "18700894-Pat24; 27858771-Pat2" "00102502" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "F" "" "Portugal" ">00y03m" "0" "" "" "" "18700894-Pat25" "00102503" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "M" "" "Portugal" ">01y" "0" "" "" "" "18700894-Pat26" "00102504" "" "" "" "1" "" "00400" "{PMID:Yuan 2008:19294599}" "" "F" "yes" "China" ">8m" "0" "" "" "" "19294599-Pat1" "00102505" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102506" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102507" "" "" "" "12" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102508" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102509" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102510" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102511" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102512" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102513" "" "" "" "1" "" "00400" "{PMID:Oliveira 2008:18700894}" "" "" "" "Portugal" "" "0" "" "" "" "18700894-con" "00102514" "" "" "" "1" "" "00006" "{PMID:Besse 2003:PMID12609503:}" "dyPAS mouse model" "" "" "" "" "0" "" "" "" "?" "00102515" "" "" "" "1" "" "00006" "{PMID:Patton 2008:18430779}" "nmf417 mouse model" "" "" "" "" "0" "" "" "" "?" "00102516" "" "" "" "1" "" "00426" "{PMID:Louhichi 2006:19388593}, {PMID:Siala 2008:19072569}" "2-generation family, prenatal diagnosis affected and unaffected (carrier) fetus" "" "" "Tunisia" "" "0" "" "" "" "19072569-FamF1" "00102517" "" "" "" "1" "" "00006" "{PMID:Piluso 2011:21896784}" "2-generation family, 2 affected sisters" "" "no" "" "" "0" "" "" "" "21896784-Pat45" "00102518" "" "" "" "1" "" "00006" "" "" "" "" "" "" "0" "" "" "" "21896784-Pat55" "00102519" "" "" "" "1" "" "00006" "{PMID:Gavassini 2011:21953594}" "" "M" "" "" "" "0" "" "" "" "21953594-Pat1" "00102520" "" "" "" "1" "" "00006" "{PMID:Gavassini 2011:21953594}" "2-generation family, sib of 21953594-Pat3" "M" "" "" "" "0" "" "" "" "21953594-Pat2" "00102521" "" "" "" "1" "" "00006" "{PMID:Gavassini 2011:21953594}" "2-generation family, sib of 21953594-Pat2" "F" "" "" "" "0" "" "" "" "21953594-Pat3" "00102522" "" "" "" "1" "" "00006" "{PMID:Gavassini 2011:21953594}" "" "M" "" "" "" "0" "" "" "" "21953594-Pat4" "00102523" "" "" "" "1" "" "00006" "{PMID:Gavassini 2011:21953594}" "" "M" "" "" "" "0" "" "" "" "21953594-Pat5" "00102524" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "M" "" "Sudan" ">11y" "0" "" "" "" "22166137-F1Pat1" "00102525" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "F" "" "Sudan" ">9y" "0" "" "" "" "22166137-F1Pat2" "00102526" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "M" "" "Saudi Arabia" "7y" "0" "" "" "" "22166137-F2Pat3" "00102527" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "M" "" "Saudi Arabia" ">6y9m" "0" "" "" "" "22166137-F2Pat4" "00102528" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "M" "" "Saudi Arabia" "16y" "0" "" "" "" "22166137-F3Pat5" "00102529" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "M" "" "Saudi Arabia" ">18y" "0" "" "" "" "22166137-F3Pat6" "00102530" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "M" "" "Saudi Arabia" ">13y" "0" "" "" "" "22166137-F4Pat7" "00102531" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "F" "" "Saudi Arabia" "" "0" "" "" "" "22166137-F4Pat8" "00102532" "" "" "" "1" "" "00006" "{PMID:DiBlasi 2011:22166137}" "" "F" "" "Saudi Arabia" "" "0" "" "" "" "22166137-F4Pat9" "00102533" "" "" "" "1" "" "00006" "{PMID:Pegoraro 1998:9674786}, {PMID:Tezak 2003:12552556}" "" "" "" "(United States)" "" "0" "" "" "" "09674786-con" "00102534" "" "" "" "2" "" "00006" "{PMID:Wang 2010:20140860}" "2-generation family, unaffected carrier parents" "F" "" "China" "" "0" "" "" "" "20140860-pat" "00102535" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "" "?" "00102536" "" "" "" "1" "" "00464" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "Arab" "?" "00102537" "" "" "" "1" "" "00426" "ESHG2010 Hadj Salem P12.119, {PMID:HadjSamen 2011:20477750}" "5-generation family, branches with CAPN3 and LAMA2 variants" "M" "yes" "Tunisia" ">05y" "0" "" "" "" "20477750-PatV3" "00102541" "" "" "" "1" "" "00426" "ESHG2010 Hadj Salem P12.119, {PMID:HadjSamen 2011:20477750}" "5-generation family, branches with CAPN3 and LAMA2 variants" "M" "yes" "Tunisia" ">22y" "0" "" "" "" "20477750-PatV4" "00102543" "" "" "" "1" "" "00426" "ESHG2010 Hadj Salem P12.119, {PMID:HadjSamen 2011:20477750}" "5-generation family, branches with CAPN3 and LAMA2 variants" "M" "yes" "Tunisia" ">15y" "0" "" "" "" "20477750-PatV6" "00102544" "" "" "" "6" "" "00426" "ESHG2010 Hadj Salem P12.119, {PMID:HadjSamen 2011:20477750}" "5-generation family, branches with CAPN3 and LAMA2 variants" "" "yes" "Tunisia" "" "0" "" "" "" "20477750-Fam" "00102546" "" "" "" "3" "" "00426" "{PMID:HadjSamen 2011:20477750}" "5-generation family, branches with CAPN3 and LAMA2 variants" "" "yes" "Tunisia" "" "0" "" "" "" "20477750-Fam" "00102547" "" "" "" "1" "" "00464" "" "" "F" "" "United States" "" "0" "" "" "Chinese" "?" "00102548" "" "" "" "1" "" "00464" "" "" "" "" "United States" "" "0" "" "" "" "?" "00102549" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "white" "?" "00102551" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102552" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102553" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102554" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102555" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102556" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102557" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102558" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102559" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102560" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102561" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102562" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102563" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102564" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102565" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102566" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102567" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102568" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102569" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102570" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102571" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102572" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102573" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102574" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102575" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102576" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102577" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102578" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102579" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102580" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102581" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102582" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102583" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102584" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102585" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102586" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102587" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102588" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102589" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102590" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102591" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102592" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102593" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102594" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102595" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102596" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102597" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102598" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102599" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102600" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102601" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102602" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102603" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102604" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102605" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102606" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102607" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102608" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102609" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102610" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102611" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102612" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102613" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102614" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102615" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102616" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102617" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102618" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102619" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102620" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102621" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102622" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102623" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102624" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102625" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102626" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102627" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102628" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102629" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102630" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102631" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102632" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102633" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102634" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102635" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102636" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102637" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102638" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102639" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102640" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102641" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102642" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102643" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102644" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102645" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102646" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102647" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102648" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102649" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102650" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102651" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102652" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102653" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102654" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "Emory-?" "00102655" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "Hispanic" "?" "00102656" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "Hispanic" "?" "00102657" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102658" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "Hispanic" "?" "00102659" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102660" "" "" "" "1" "" "00464" "" "" "F" "?" "(United States)" "" "0" "" "" "Arab" "?" "00102661" "" "" "" "1" "" "00464" "" "" "F" "" "Saudi Arabia" "" "0" "" "" "" "?" "00102662" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "" "?" "00102663" "" "" "" "1" "" "00464" "" "" "M" "" "United States" "" "0" "" "" "white" "?" "00102664" "" "" "" "1" "" "00527" "" "2-generation family, 1 affected" "F" "no" "(United States)" "" "0" "" "" "white" "?" "00102665" "" "" "" "1" "" "01953" "" "" "" "?" "Samoa" "" "0" "" "" "" "?" "00102666" "" "" "" "1" "" "01700" "{PMID:Punetha 2016:27854218}" "" "M" "" "" "" "0" "" "" "" "Pat6" "00102667" "" "" "" "3" "" "01715" "{PMID:Fattahi 2017:27234031}" "2-generation family, 3 affecteds, unaffected heterozygous carrier parents" "M" "no" "Iran" "" "0" "" "" "" "27234031-D40560" "00102668" "" "" "" "1" "" "01715" "{PMID:Fattahi 2017:27234031}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "yes" "Iran" "" "0" "" "" "" "27234031-D71257" "00102713" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "?" "Portugal" "" "0" "" "" "" "" "00102714" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "?" "Portugal" "" "0" "" "" "" "" "00102715" "" "" "" "1" "" "00503" "{PMID:Oliveira 2014:27858771}" "" "M" "" "Brazil" "" "0" "" "" "" "" "00102716" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "?" "Portugal" "" "0" "" "" "" "" "00102717" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "?" "Portugal" "" "0" "" "" "" "" "00102718" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00102719" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00102720" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" "" "0" "" "" "" "" "00102721" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" "" "0" "" "" "" "" "00102722" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00102723" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00102724" "" "" "" "2" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (1M, 1F)" "F" "" "Portugal" "" "0" "" "" "" "" "00102725" "" "" "00102724" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (1M, 1F)" "M" "" "Portugal" "" "0" "" "" "" "" "00102726" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" "" "0" "" "" "" "" "00102727" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00102728" "" "" "" "1" "" "00503" "{PMID:Marques 2014:24534542}" "" "M" "" "Portugal" "" "0" "" "" "" "24534542-Pat2" "00102729" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" "" "0" "" "" "" "" "00102731" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" "" "0" "" "" "" "" "00102732" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Mexico" "" "0" "" "" "" "" "00102733" "" "" "" "1" "" "00503" "{PMID:Oliveira 2014:27858771}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00102734" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "?" "Portugal" "" "0" "" "" "" "" "00102735" "" "" "" "2" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (1M, 1F)" "M" "" "Portugal" "" "0" "" "" "" "" "00102736" "" "" "00102735" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (1M, 1F)" "F" "" "Portugal" "" "0" "" "" "" "" "00102737" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00103126" "" "" "" "1" "" "00503" "{PMID:Marques 2014:24534542}" "" "M" "" "Portugal" ">55y" "0" "" "" "" "24534542-Pat1" "00103127" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Spain" "" "0" "" "" "" "" "00103128" "" "" "" "2" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (1M, 1F)" "F" "" "Portugal" "" "0" "" "" "" "" "00103129" "" "" "00103128" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00103130" "" "" "" "2" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (2F)" "F" "" "Portugal" "" "0" "" "" "" "" "00103131" "" "" "00103130" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "1-generation family, 2 affecteds (2F)" "M" "" "Portugal" "" "0" "" "" "" "" "00103189" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Iran" "" "0" "" "" "" "" "00103191" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00103192" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Iran" "" "0" "" "" "" "" "00103195" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" "" "0" "" "" "" "" "00103206" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "(Spain)" "" "0" "" "" "" "" "00103207" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" "" "0" "" "" "" "" "00103219" "" "" "" "1" "" "00503" "{PMID:Betyía 2013: 24225367}" "" "M" "" "" "" "0" "" "" "" "24225367-Pat1" "00103220" "" "" "" "1" "" "00503" "{PMID: Beytía 2013:24225367}" "" "F" "" "" ">07y" "0" "" "" "" "24225367-Pat2" "00103221" "" "" "" "1" "" "00503" "{PMID: Beytía 2013:24225367}" "" "F" "" "" ">11y" "0" "" "" "" "24225367-Pat3" "00103222" "" "" "" "1" "" "00503" "{PMID: Beytía 2013:24225367}" "" "M" "" "" ">00y17m" "0" "" "" "" "24225367-Pat4" "00103226" "" "" "" "1" "" "00503" "{PMID: Beytía 2013:24225367}" "" "F" "yes" "" ">30y" "0" "" "" "" "24225367-Pat5" "00103228" "" "" "" "1" "" "00503" "{PMID: Beytía 2013:24225367}" "" "M" "" "" ">19y" "0" "" "" "" "24225367-Pat6" "00103229" "" "" "" "1" "" "00503" "{PMID: Beytía 2013:24225367}" "" "M" "" "" ">00y09m" "0" "" "" "" "24225367-Pat7" "00103231" "" "" "" "1" "" "00503" "{PMID:He 2013:24223650}" "" "F" "no" "China" "" "0" "" "" "" "24223650-Pat" "00103234" "" "" "" "1" "" "00503" "{PMID:Valencia 2013:23326386}" "" "M" "?" "United States" ">01y" "0" "" "" "African American" "23326386-CMD-11" "00103235" "" "" "" "1" "" "00503" "{PMID:Valencia 2013:23326386}" "" "?" "" "" "" "0" "" "" "" "23326386-CMD-20" "00103236" "" "" "" "1" "" "00503" "{PMID:Valencia 2013:23326386}" "" "?" "" "" "" "0" "" "" "" "23326386-CMD-24" "00103244" "" "" "" "1" "" "00503" "{PMID:Valencia 2013:23326386}" "" "?" "" "" "" "0" "" "" "" "23326386-CMD-25" "00103245" "" "" "" "3" "" "00503" "{PMID:van Engelen 1992:1456743}, {PMID:Kevelam 2014:24327385}" "4-generation family, 3 affected sibs" "F" "" "" ">29y" "0" "" "" "" "24327385-Pat, 1456743-III-3" "00103246" "" "" "" "1" "" "00503" "{PMID:Reddy 2017:27708273}" "" "F" "" "United States" ">02y" "0" "" "" "white" "1409" "00103247" "" "" "" "1" "" "00503" "{PMID:Wang 2016:27353517}" "" "M" "" "China" "" "0" "" "" "" "27353517-Pat135" "00103248" "" "" "" "1" "" "00503" "{PMID:Liang 2017:28182637}" "" "F" "" "Taiwan" ">31y" "0" "" "" "" "28182637-Pat16" "00103249" "" "" "" "2" "" "00503" "{PMID:Liang 2017:28182637}" "1-generation family, 2 affecteds (2M)" "M" "" "Taiwan" ">27y" "0" "" "" "" "28182637-Pat17" "00103250" "" "" "00103249" "1" "" "00503" "{PMID:Liang 2017:28182637}" "1-generation family, 2 affecteds (2M)" "M" "" "Taiwan" "12y" "0" "" "" "" "28182637-Pat18" "00103251" "" "" "" "1" "" "00503" "{PMID:Liang 2017:28182637}" "" "M" "" "Taiwan" ">18y" "0" "" "" "" "28182637-Pat19" "00103252" "" "" "" "1" "" "00503" "{PMID:Liang 2017:28182637}" "" "F" "" "Taiwan" ">16y" "0" "" "" "" "28182637-Pat20" "00103253" "" "" "" "1" "" "00503" "{PMID:Liang 2017:28182637}" "" "F" "" "Taiwan" ">18y" "0" "" "" "" "28182637-Pat21" "00103254" "" "" "" "1" "" "00503" "{PMID: Komulainen 2015:25940035}" "" "?" "" "" "" "0" "" "" "" "25940035-Pat3" "00103255" "" "" "" "1" "" "00503" "{PMID:Yang 2015:25544356}, {PMID:Xiong 2014:24611677}" "1-generation family, 2 affecteds (2M)\r\nBrother of 25544356-Pat2, 24611677-Pat42 (00103256); probable duplicate in Tan 2021" "M" "" "China" "" "0" "" "" "" "Pat1;Pat41" "00103256" "" "" "" "1" "" "00503" "{PMID:Yang 2015:25544356}, {PMID:Xiong 2014:24611677}" "1-generation family, 2 affecteds (2M)\r\nBrother of 25544356-Pat2, 24611677-Pat41 (00103255); probable duplicate in Tan 2021" "M" "" "China" ">00y04m" "0" "" "" "" "Pat2;Pat42" "00103257" "" "" "" "1" "" "00503" "{PMID: Camacho 2015: 25500573}" "" "M" "yes" "" ">05y" "0" "" "" "" "25500573-Pat" "00103268" "" "" "" "1" "" "00503" "Chan 2014" "" "F" "no" "" ">13y" "0" "" "" "" "Pat" "00103324" "" "" "" "1" "" "00503" "{PMID:Di Blasi 2000: 10852549}" "" "M" "" "" ">29y" "0" "" "" "" "10852549-Pat" "00103325" "" "" "" "1" "" "00503" "{PMID:Nelson 2015:27858741}" "" "M" "no" "Turkey" ">38y" "0" "" "" "" "27858741-Pat1" "00103326" "" "" "" "1" "" "00503" "{PMID:Nelson 2015: 27858741}" "" "M" "yes" "France" ">32y" "0" "" "" "Algerian parents" "27858741-Pat2" "00103327" "" "" "" "2" "" "00503" "{PMID:Nelson 2015: 27858741}" "1-generation family, 2 affecteds (2M)" "M" "" "France" ">50y" "0" "" "" "Portuguese parents" "27858741-Pat3" "00103461" "" "" "00103327" "1" "" "00503" "{PMID:Nelson 2015: 27858741}" "1-generation family, 2 affecteds (2M)" "M" "" "France" "" "0" "" "" "Portuguese parents" "27858741-Pat4" "00103630" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "M" "" "Denmark" ">04y" "0" "" "" "" "25663498-Pat1" "00103631" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "M" "" "Denmark" ">11y" "0" "" "" "" "25663498-Pat2" "00103632" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "M" "" "Denmark" ">07y" "0" "" "" "" "25663498-Pat3" "00103633" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "F" "" "Denmark" ">04y" "0" "" "" "" "25663498-Pat4" "00103634" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "M" "" "Denmark" ">14y" "0" "" "" "" "25663498-Pat5" "00103635" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "M" "" "Denmark" ">69y" "0" "" "" "" "25663498-Pat6" "00103636" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "F" "" "Denmark" ">32y" "0" "" "" "" "25663498-Pat7" "00103637" "" "" "" "1" "" "00503" "{PMID:Løkken 2015: 25663498}" "" "M" "" "Denmark" ">54y" "0" "" "" "" "25663498-Pat8" "00103654" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">11y" "0" "" "" "" "Pat1" "00103655" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">12y" "0" "" "" "" "Pat2" "00103656" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" "" "0" "" "" "" "Pat3" "00103657" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">08y" "0" "" "" "" "Pat4" "00103658" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "?" "China" ">06y" "0" "" "" "" "Pat5" "00103659" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">10y" "0" "" "" "" "Pat6" "00103660" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">05y" "0" "" "" "" "Pat7" "00103661" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">07y" "0" "" "" "" "Pat8" "00103662" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">02y" "0" "" "" "" "Pat9" "00103663" "" "" "" "2" "" "00503" "{PMID:Xiong 2014:24611677}" "Sister of 24611677-Pat11 (00103664); probable duplicate in Tan 2021" "F" "" "China" ">06y" "0" "" "" "" "Pat10" "00103664" "" "" "00103663" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Sister of patient 24611677-Pat11 (00103663); probable duplicate in Tan 2021" "F" "" "China" "00y18m" "0" "" "" "" "Pat11" "00103665" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">06y" "0" "" "" "" "Pat12" "00103666" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" "" "0" "" "" "" "Pat13" "00103667" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">07y" "0" "" "" "" "Pat14" "00103668" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Sister of patient 24611677-Pat15 (00103669); probable duplicate in Tan 2021" "F" "" "China" ">05y" "0" "" "" "Uyghur" "Pat15" "00103669" "" "" "00103668" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Sister of patient 24611677-Pat15 (00103668); probable duplicate in Tan 2021" "F" "" "China" "13y" "0" "" "" "" "Pat16" "00103726" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "yes" "China" "09y" "0" "" "" "" "Pat17" "00103727" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">05y" "0" "" "" "" "Pat18" "00103728" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">03y" "0" "" "" "" "Pat19" "00103729" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">07y" "0" "" "" "" "Pat20" "00103730" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">05y" "0" "" "" "" "Pat21" "00103731" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">06y" "0" "" "" "" "Pat22" "00103732" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">07y" "0" "" "" "" "Pat23" "00103733" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Brother of 24611677-Pat25 (00103734); probable duplicate in Tan 2021" "M" "yes" "(China)" ">07y" "0" "" "" "Arab" "Pat24" "00103734" "" "" "00103733" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Brother of 24611677-Pat24 (00103733); probable duplicate in Tan 2021" "M" "yes" "(China)" "03y" "0" "" "" "Arab" "Pat25" "00103735" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">04y" "0" "" "" "" "Pat26" "00103736" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" "03y" "0" "" "" "" "Pat27" "00103737" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">04y" "0" "" "" "" "Pat28" "00103755" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "yes" "China" "" "0" "" "" "" "Pat29" "00103760" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">02y" "0" "" "" "" "Pat30" "00103761" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Brother of 24611677-Pat32 (00103762); probable duplicate in Tan 2021" "M" "" "China" ">03y" "0" "" "" "" "Pat31" "00103765" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "Sister of 24611677-Pat31 (00103761); probable duplicate in Tan 2021" "F" "" "China" ">04y" "0" "" "" "" "Pat32" "00103766" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">02y" "0" "" "" "" "Pat33" "00103767" "" "" "" "2" "" "00503" "{PMID:Xiong 2014:24611677}" "2-generation family, 2 affected, unaffected heterozygous carrier parents; sister of Pat35 (00103768); probable duplicate in Tan 2021" "F" "" "China" "" "0" "" "" "" "FamPat34" "00103768" "" "" "00103767" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "brother Pat34 (00103767); probable duplicate in Tan 2021" "M" "" "China" ">02y" "0" "" "" "" "FamPat35" "00103772" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">19y" "0" "" "" "" "Pat36" "00103773" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">04y" "0" "" "" "" "Pat37" "00103774" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">00y18m" "0" "" "" "" "Pat38" "00103777" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "" "China" ">12y" "0" "" "" "" "Pat39" "00103778" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "M" "yes" "China" ">03y" "0" "" "" "" "Pat40" "00103781" "" "" "" "1" "" "00503" "{PMID:Xiong 2014:24611677}" "probable duplicate in Tan 2021" "F" "" "China" ">01y" "0" "" "" "" "Pat43" "00103919" "" "" "" "1" "" "00503" "{PMID:Bhowmik 2016:26104111}" "" "M" "yes" "(India)" ">00y14m" "0" "" "" "" "26104111-Pat" "00103949" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "?" "Portugal" "" "0" "" "" "" "" "00103950" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "yes" "Portugal" "" "0" "" "" "" "" "00103951" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "?" "Portugal" "" "0" "" "" "" "" "00103952" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Portugal" "" "0" "" "" "" "" "00103969" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Portugal" "" "0" "" "" "" "" "00103970" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Portugal" "" "0" "" "" "" "" "00103971" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Portugal" "" "0" "" "" "" "" "00103972" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "M" "" "Portugal" ">25y" "0" "" "" "" "" "00103973" "" "" "" "1" "" "00503" "{PMID:Kim 2017:28445022}" "1-generation family, 2 affecteds (2F)" "F" "" "(Korea, South (Republic))" ">04y" "0" "" "" "" "28445022-Pat" "00103974" "" "" "" "1" "" "00503" "{PMID:Yu:28403181}" "" "M" "" "(China)" ">43y" "0" "" "" "" "28403181-Pat69" "00103975" "" "" "" "1" "" "00503" "{PMID:Yu:28403181}" "" "M" "" "" ">07y" "0" "" "" "" "28403181-Pat92" "00103994" "" "" "" "1" "" "00587" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "54 patients from 53 families with genetically unexplained diffuse-type and intestinal-type gastric cancer" "" "" "" "" "0" "" "" "" "Vogelaar-042A" "00105043" "" "" "" "1" "" "00503" "{PMID:Dean 2017:28533353}" "" "M" "yes" "" ">06y" "0" "" "" "Southeast Asia" "28533353-Pat" "00111373" "" "" "" "1" "" "01164" "" "" "M" "?" "Turkey" "" "0" "" "" "" "89747" "00111374" "" "" "" "1" "" "01164" "" "" "M" "yes" "Turkey" "" "0" "" "" "" "90481" "00111375" "" "" "" "1" "" "01164" "" "" "M" "yes" "Saudi Arabia" "" "0" "" "" "" "83993" "00111376" "" "" "" "1" "" "01164" "" "" "M" "yes" "Turkey" "" "0" "" "" "" "83808" "00111377" "" "" "" "1" "" "01164" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "84069" "00111379" "" "" "" "1" "" "01164" "" "" "F" "?" "Germany" "" "0" "" "" "" "84038" "00111380" "" "" "" "1" "" "01164" "" "" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "86093" "00131883" "" "" "" "1" "" "01164" "" "" "M" "?" "Italy" "00y02m" "0" "" "" "" "120958" "00131941" "" "" "" "1" "" "00503" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "F" "" "Portugal" ">33y" "0" "" "" "" "" "00131976" "" "" "" "1" "" "02274" "" "" "M" "" "United States" "" "0" "" "" "" "" "00132007" "" "" "" "1" "" "02274" "" "1-generation family, 2 affected" "M" "" "United States" "" "0" "" "" "" "" "00132008" "" "" "" "1" "" "02274" "" "" "F" "" "United States" "" "0" "" "" "" "" "00132009" "" "" "" "1" "" "02274" "" "" "M" "" "United States" "" "0" "" "" "Hispanic" "" "00132010" "" "" "" "1" "" "02274" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "" "00132011" "" "" "" "1" "" "02274" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "" "00132012" "" "" "" "1" "" "02274" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "" "00132013" "" "" "" "1" "" "02274" "" "" "M" "" "Saudi Arabia" "" "0" "" "" "" "" "00132014" "" "" "" "1" "" "02274" "" "" "F" "" "United States" "" "0" "" "" "" "" "00132015" "" "" "" "1" "" "02274" "" "" "F" "" "United States" "" "0" "" "" "" "" "00132016" "" "" "" "1" "" "02274" "" "" "M" "" "United States" "" "0" "" "" "" "" "00132025" "" "" "" "1" "" "02274" "" "" "M" "" "United States" "" "0" "" "" "" "" "00165139" "" "" "" "1" "" "02521" "" "" "-" "no" "France" ">42y" "0" "" "" "" "" "00183389" "" "" "" "1" "" "02947" "{PMID:Giugliano 2018:30373198}" "" "M" "" "Italy" "" "0" "" "" "" "Patient V" "00183390" "" "" "" "1" "" "02947" "{PMID:Giugliano 2018:30373198}" "" "M" "?" "Italy" "" "0" "" "" "" "Patient VI" "00183391" "" "" "" "1" "" "02947" "{PMID:Giugliano 2018:30373198}" "" "F" "" "Italy" "" "0" "" "" "" "Patient VII" "00183392" "" "" "" "1" "" "02947" "{PMID:Giugliano 2018:30373198}" "" "F" "" "Italy" "" "0" "" "" "" "Patient VIII" "00208524" "" "" "" "1" "" "03127" "" "" "M" "no" "Viet Nam" "14y" "0" "" "" "" "" "00208755" "" "" "" "1" "" "01164" "" "" "F" "" "Germany" "" "0" "" "" "" "" "00208800" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00265482" "" "" "" "1" "" "00006" "{PMID:Özyilmaz 2019:31066050}" "" "M" "" "Turkey" "" "0" "" "" "" "Pat34" "00269868" "" "" "" "1" "" "03524" "" "" "M" "" "" "03y" "0" "" "" "" "" "00269869" "" "" "" "1" "" "03524" "" "" "F" "" "" "" "0" "" "" "" "" "00274312" "" "" "" "1" "" "00006" "{PMID:Reddy 2017:27708273}" "" "F" "" "United States" "" "0" "" "" "NE Europe" "Fam1409" "00288102" "" "" "" "1" "" "00006" "{PMID:Wang 2019:31404137}" "analysis 70 unrelated MD families" "F" "" "China" "" "0" "" "" "" "P63" "00288103" "" "" "" "1" "" "00006" "{PMID:Wang 2019:31404137}" "analysis 70 unrelated MD families" "M" "" "China" "" "0" "" "" "" "P64" "00288970" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat24" "00288987" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat41" "00289006" "" "" "" "1" "" "00006" "{PMID:Punetha 2016:27854218}" "analysis 94 myopathy cases" "" "" "" "" "0" "" "" "" "Pat60" "00289291" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00293969" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293970" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293972" "" "" "" "9" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293974" "" "" "" "7" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293975" "" "" "" "50" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293976" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293977" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293978" "" "" "" "42" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293979" "" "" "" "18" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00293980" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295438" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295641" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00301610" "" "" "" "1" "" "03678" "" "compound heterozygous patient" "M" "" "Greece" "39y" "" "" "" "" "" "00303651" "" "" "" "1" "" "02119" "Quijano-Roy et al, 2020" "" "F" "no" "Chile" "" "" "" "" "" "" "00303652" "" "" "" "1" "" "02119" "" "" "M" "no" "Chile" "" "" "" "" "" "" "00303942" "" "" "" "2" "" "02119" "" "" "M" "" "Chile" "" "" "" "" "" "" "00303943" "" "" "00303942" "1" "" "02119" "" "" "F" "?" "Chile" "" "0" "" "" "" "" "00305054" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305055" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305788" "" "" "" "1" "" "00006" "{PMID:Yu 2017:28403181}" "analysis 180 LGMD patients" "M" "" "China" "" "0" "" "" "" "P69" "00305806" "" "" "" "1" "" "00006" "{PMID:Yu 2017:28403181}" "analysis 180 LGMD patients" "M" "" "China" "" "0" "" "" "" "P92" "00307952" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:28940097}" "familial" "M" "" "" "" "0" "" "" "" "17DG0769" "00309888" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00313767" "" "" "" "1" "" "00006" "{PMID:Magri 2015:26404900}" "" "M" "" "Italy" "" "0" "" "" "" "Fam101Pat1" "00314337" "" "" "" "3" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314338" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314339" "" "" "" "2" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314340" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314341" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314342" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314343" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314344" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314345" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314346" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314347" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314348" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314349" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314350" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314351" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314352" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00314353" "" "" "" "1" "" "00006" "{PMID:Topf 2020:32528171}" "analysis 1001 patients with unexplained limb-girdle weakness" "" "" "" "" "0" "" "" "" "" "00320296" "" "" "" "1" "" "00006" "{PMID:Isbister 2020:32931854}" "" "" "" "Australia" "" "0" "" "" "" "BDO1" "00325411" "" "" "" "1" "" "00006" "{PMID:Hong 2020:33333793}" "" "M" "" "Taiwan" "" "0" "" "" "" "Pat24" "00361606" "" "" "" "1" "" "00006" "{PMID:Anazi 2017:27431290}" "familial" "F" "yes" "Saudi Arabia" "" "0" "" "" "" "11DG0854" "00361917" "" "" "" "1" "" "04047" "{PMID:Saat 2021:33963534}" "" "M" "yes" "Turkey" "" "0" "" "" "" "Pat5" "00374363" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4928" "00374364" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-4167" "00374365" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5626" "00374366" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3611" "00374367" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-3227" "00374368" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2689" "00374369" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-246" "00374370" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "R-0569" "00374371" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2749" "00374372" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-2392" "00374373" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-5563" "00374374" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-369" "00374375" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1525" "00374701" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-0297" "00375215" "" "" "" "1" "" "01164" "" "" "?" "" "" "" "0" "" "" "" "" "00376428" "" "" "" "1" "" "00006" "{PMID:Nguyen 2021:34011823}" "" "" "" "Viet Nam" "" "0" "" "" "" "Pat182" "00380777" "" "" "" "1" "" "00000" "{PMID:Nair 2018:30293248}" "" "?" "" "Lebanon" "" "0" "" "" "" "?" "00384562" "" "" "" "3" "" "04175" "" "" "M" "no" "Russian Federation" "" "" "" "" "" "" "00386489" "" "" "" "1" "" "00006" "{PMID:Nair 2018:30293248}" "patient" "" "" "Lebanon" "" "0" "" "" "" "" "00388673" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "M" "" "India" "" "0" "" "" "India" "Pat109" "00388691" "" "" "" "1" "" "00006" "{PMID:Chakravorty 2020:33250842}" "" "F" "" "India" "" "0" "" "" "India" "Pat42" "00391935" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/0116/B-128" "00391936" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/0118/B-130" "00391938" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/0126/B-138" "00391940" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "" "MDCRC/0146/B-153" "00391942" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/0153/B-158" "00391961" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "yes" "India" "" "0" "yes" "" "" "MDCRC/0782/DBI-691" "00391997" "" "" "" "1" "" "03501" "{PMID:Karthikeyan 2024:39548682}" "" "M" "no" "India" "" "0" "yes" "" "" "MDCRC/1688/DBI-1382" "00397769" "" "" "" "1" "" "00006" "{PMID:Patel 2021:34925456}" "patient" "" "" "India" "" "0" "" "" "India-W" "P60" "00398992" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "F" "" "Spain" "" "0" "" "" "" "P11" "00398994" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P15" "00399024" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P65" "00399077" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P156" "00399092" "" "" "" "1" "" "00006" "{PMID:Gonzalez-Quereda 2020:32403337}" "patient" "M" "" "Spain" "" "0" "" "" "" "P175" "00411241" "" "" "" "1" "" "00000" "{PMID:Macke_1993:8317502}" "" "F" "" "United States" "" "0" "" "" "" "HS461-4" "00411284" "" "" "" "1" "" "03320" "" "" "M" "no" "Thailand" "" "" "" "" "" "" "00411587" "" "" "" "1" "" "00000" "{PMID:Oh 2000:10980774}" "no individual ID, only number of individuals with the mutation; mutation report" "M" "" "United States" "" "0" "" "" "" "III:3" "00411884" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "M" "" "United States" "" "0" "" "" "" "2_P1" "00411896" "" "" "" "1" "" "00000" "{PMID:Aleman 2008:18385078}" "" "F" "" "United States" "" "0" "" "" "" "9_P3" "00414704" "" "" "" "1" "" "00000" "{PMID:Bell 2011:21228398}" "" "?" "" "" "" "0" "" "" "" "NA01210" "00415543" "" "" "" "1" "" "00006" "{PMID:Bruels 2022:35734998}" "2 generation family, 1 affected, unaffected heterozygous carrier parents" "" "" "United States" "" "0" "" "" "" "120-1" "00415544" "" "" "" "1" "" "00006" "{PMID:Bruels 2022:35734998}" "" "" "" "United States" "" "0" "" "" "" "1126-1" "00416905" "" "" "" "1" "" "01164" "" "" "F" "no" "Yugoslavia" "" "0" "" "" "" "203300" "00426480" "" "" "" "3" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "family, 3 affected (F, 2M)" "M" "" "China" "3m" "0" "" "" "" "Pat1" "00426481" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat4" "00426482" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "family, 2 affected sisters" "F" "" "Tajikistan" "8m" "0" "" "" "" "Pat5" "00426483" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat6" "00426484" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat7" "00426485" "" "" "" "3" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "family, 3 affected brothers" "M" "" "China" "" "0" "" "" "" "Pat8" "00426486" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "family, affected sister/brother" "F" "yes" "" "9m" "0" "" "" "Arab" "Pat9" "00426487" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "yes" "" "1y" "0" "" "" "Arab" "Pat10" "00426488" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat11" "00426489" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat12" "00426490" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat13" "00426491" "" "" "" "2" "" "00006" "{PMID:Tan 2021:34281576}" "family affected brother/sister" "M" "" "China" "" "0" "" "" "" "Pat15" "00426492" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat16" "00426493" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat17" "00426494" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "family 2 affected sisters" "F" "" "China" "1y6m" "0" "" "" "" "Pat18" "00426495" "" "" "" "2" "" "00006" "{PMID:Tan 2021:34281576}" "family affected brother/sister" "F" "" "China" "" "0" "" "" "" "Pat19" "00426496" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat20" "00426497" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat21" "00426498" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat22" "00426499" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat23" "00426500" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat24" "00426501" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "2y6m" "0" "" "" "" "Pat25" "00426502" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "yes" "China" "" "0" "" "" "" "Pat26" "00426503" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat27" "00426504" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat28" "00426505" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat29" "00426506" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat30" "00426507" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat31" "00426508" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "3y5m" "0" "" "" "" "Pat32" "00426509" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat33" "00426510" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat34" "00426511" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat35" "00426512" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "4y" "0" "" "" "" "Pat37" "00426513" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat38" "00426514" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat39" "00426515" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "family affected brother/sister" "F" "" "China" "" "0" "" "" "" "Pat40" "00426516" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat41" "00426517" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat42" "00426518" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat43" "00426519" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat44" "00426520" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat46" "00426521" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat47" "00426522" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat48" "00426523" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat49" "00426524" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat50" "00426525" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "family affected brother/sister" "F" "" "China" "" "0" "" "" "" "Pat51" "00426526" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "family affected brother/sister" "F" "" "China" "" "0" "" "" "" "Pat52" "00426527" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat53" "00426528" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat54" "00426529" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat55" "00426530" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "yes" "China" "6y4m" "0" "" "" "" "Pat57" "00426531" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat58" "00426532" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat59" "00426533" "" "" "" "2" "" "00006" "{PMID:Tan 2021:34281576}" "family affected brother/sister" "M" "" "China" "" "0" "" "" "" "Pat60" "00426534" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat61" "00426535" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "7y2m" "0" "" "" "" "Pat62" "00426536" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat63" "00426537" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "family affected brother/sister" "M" "" "China" "" "0" "" "" "" "Pat64" "00426538" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat65" "00426539" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat66" "00426540" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat67" "00426541" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat68" "00426542" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat69" "00426543" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat70" "00426544" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat72" "00426545" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "yes" "China" "" "0" "" "" "" "Pat73" "00426546" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat74" "00426547" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat75" "00426548" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat76" "00426549" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat77" "00426550" "" "" "00426495" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "cousin" "M" "" "China" "" "0" "" "" "" "Pat78" "00426551" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat79" "00426552" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "yes" "China" "" "0" "" "" "" "Pat80" "00426553" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat82" "00426554" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat83" "00426555" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "9y9m" "0" "" "" "" "Pat84" "00426556" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat85" "00426557" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat86" "00426558" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat87" "00426559" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat88" "00426560" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat91" "00426561" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat92" "00426562" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat93" "00426563" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "12y8m" "0" "" "" "" "Pat94" "00426564" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "family, 2 affected sisters" "F" "" "China" "" "0" "" "" "Uighur" "Pat95" "00426565" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat96" "00426566" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "13y" "0" "" "" "" "Pat98" "00426567" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat99" "00426568" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "13y1m" "0" "" "" "" "Pat100" "00426569" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat101" "00426570" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "13y6m" "0" "" "" "" "Pat102" "00426571" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat103" "00426572" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "14y4m" "0" "" "" "" "Pat107" "00426573" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "15y" "0" "" "" "" "Pat108" "00426574" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat110" "00426575" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "M" "" "China" "" "0" "" "" "" "Pat111" "00426576" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "18y" "0" "" "" "" "Pat112" "00426577" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat113" "00426578" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat115" "00426579" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat116" "00426580" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat117" "00426581" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat118" "00426582" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat119" "00426583" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat120" "00426584" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat121" "00426585" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat122" "00426586" "" "" "" "1" "" "00006" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "F" "" "China" "" "0" "" "" "" "Pat123" "00426587" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat124" "00426588" "" "" "" "2" "" "00006" "{PMID:Ding 2016:26304763}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "family affected sister/brother" "F" "" "China" "" "0" "" "" "" "proband;Pat125" "00426589" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat126" "00426590" "" "" "" "2" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "family affected sister/brother" "F" "" "China" "" "0" "" "" "" "Pat128" "00426591" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "M" "" "China" "" "0" "" "" "" "Pat129" "00426592" "" "" "00426480" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "elder sister" "F" "" "China" "3m" "0" "" "" "" "Pat2" "00426593" "" "" "00426480" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "elder brother" "M" "" "China" "5m" "0" "" "" "" "Pat3" "00426594" "" "" "00426482" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "sister" "F" "" "Tajikistan" "" "0" "" "" "" "Pat14" "00426595" "" "" "00426485" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "elder brother" "M" "" "China" "" "0" "" "" "" "Pat56" "00426596" "" "" "00426485" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "younfer brother" "M" "" "China" "8y7m" "0" "" "" "" "Pat71" "00426597" "" "" "00426486" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "brother" "M" "yes" "" "" "0" "" "" "Arab" "Pat36" "00426598" "" "" "00426491" "1" "" "00006" "{PMID:Tan 2021:34281576}" "sister" "F" "" "China" "" "0" "" "" "" "Pat45" "00426599" "" "" "00426494" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "sister" "F" "" "China" "" "0" "" "" "" "Pat104" "00426600" "" "" "00426515" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "elder brother" "M" "" "China" "15y6m" "0" "" "" "" "Pat109" "00426601" "" "" "00426525" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "brother" "M" "" "China" "" "0" "" "" "" "Pat81" "00426602" "" "" "00426526" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "brother" "M" "" "China" "" "0" "" "" "" "Pat106" "00426603" "" "" "00426533" "1" "" "00006" "{PMID:Tan 2021:34281576}" "elder sister" "F" "" "China" "" "0" "" "" "" "Pat89" "00426604" "" "" "00426537" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "sister" "F" "" "China" "" "0" "" "" "" "Pat105" "00426605" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat114" "00426606" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "F" "" "China" "" "0" "" "" "" "Pat90" "00426607" "" "" "00426564" "1" "" "00006" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "sister" "F" "" "China" "13y" "0" "" "" "Uighur" "Pat97" "00426608" "" "" "00426588" "1" "" "00006" "{PMID:Ding 2016:26304763}, {PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "elder brother" "M" "" "China" "14y01m" "0" "" "" "" "?;Pat127" "00426609" "" "" "00426590" "1" "" "00006" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "brother" "M" "" "China" "" "0" "" "" "" "Pat130" "00427145" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427146" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427147" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427148" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427149" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427150" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427151" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427152" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427153" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427154" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427155" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427156" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427157" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427158" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427159" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427160" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427161" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427162" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427163" "" "" "" "1" "" "00006" "{PMID:Ge 2019:31066047}" "" "" "" "China" "" "0" "" "" "" "" "00427170" "" "" "" "1" "" "00006" "{PMID:Rui 2022:36334577}" "" "M" "" "China" "" "0" "" "" "" "patient" "00428469" "" "" "" "1" "" "01164" "" "" "M" "no" "Germany" "" "0" "" "" "" "212733" "00430393" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 146 neuromuscular disease patients" "F" "" "Turkey" "" "0" "" "" "" "D4" "00430399" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 146 neuromuscular disease patients" "M" "" "Turkey" "" "0" "" "" "" "D10" "00430400" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 146 neuromuscular disease patients" "F" "" "Turkey" "" "0" "" "" "" "D11" "00433435" "" "" "" "1" "" "04483" "{PMID:Tran 2023:37388928}" "" "M" "no" "Viet Nam" ">02y" "" "yes" "no" "Kinh" "Pat1" "00433436" "" "" "" "1" "" "04483" "{PMID:Tran 2023:37388928}" "" "M" "no" "Viet Nam" ">03y" "" "yes" "" "Kinh" "Pat2" "00433437" "" "" "" "1" "" "04483" "{PMID:Tran 2023:37388928}" "" "M" "no" "Viet Nam" ">05y" "" "yes" "" "Kinh" "Pat3" "00433438" "" "" "" "1" "" "04483" "{PMID:Tran 2023:37388928}" "" "M" "no" "Viet Nam" "" "" "" "" "1" "Pat4" "00433439" "" "" "" "2" "" "04483" "{PMID:Tran 2023:37388928}" "family, 2 affected brothers" "M" "no" "Viet Nam" ">06y" "0" "yes" "" "Kinh" "FamPat5/6" "00435042" "" "" "" "1" "" "00006" "{PMID:Washington 2023:37038535}" "2-generation family, 1 affected, unaffected heterozygous parents" "F" "" "United States" "" "0" "" "" "" "patient" "00435679" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat1" "00435680" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat2" "00435681" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat3" "00435682" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat4" "00435683" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat5" "00435684" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat6" "00435685" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat7" "00435686" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat8" "00435687" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat9" "00435688" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat10" "00435689" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat11" "00435690" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat12" "00435691" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat13" "00435692" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat14" "00435693" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat15" "00435694" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat16" "00435695" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat17" "00435696" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat18" "00435697" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat19" "00435698" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat20" "00435699" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat21" "00435700" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat22" "00435701" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat23" "00435702" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat24" "00435703" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat25" "00435704" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat26" "00435705" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat27" "00435706" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat28" "00435707" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat29" "00435708" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat30" "00435709" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat31" "00435710" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat32" "00435711" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat33" "00435712" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat34" "00435713" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat35" "00435714" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat36" "00435715" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat37" "00435716" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat38" "00435717" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat39" "00435718" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat40" "00435719" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat41" "00435720" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat42" "00435721" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat43" "00435722" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat44" "00435723" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat45" "00435724" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat46" "00435725" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat47" "00435726" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat48" "00435727" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "F" "" "Brazil" "" "0" "" "" "" "Pat49" "00435728" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat50" "00435729" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat51" "00435730" "" "" "" "1" "" "00006" "{PMID:Camelo 2023:37182895}" "" "M" "" "Brazil" "" "0" "" "" "" "Pat52" "00436845" "" "" "" "1" "" "00006" "{PMID:Tavakoli 2023:37350320}" "CK-MM 36,781 newborn screening" "M" "" "United States" "" "0" "" "" "Hispanic" "Pat40" "00436849" "" "" "" "1" "" "00006" "{PMID:Tavakoli 2023:37350320}" "CK-MM 36,781 newborn screening" "M" "" "United States" "" "0" "" "" "" "Pat31" "00438471" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 67 patients muscular dystrophy/myopathy (not DMD)" "F" "" "Turkey" "" "0" "" "" "" "D4" "00438477" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 67 patients muscular dystrophy/myopathy (not DMD)" "M" "" "Turkey" "" "0" "" "" "" "D10" "00438478" "" "" "" "1" "" "00006" "{PMID:Cavdarli 2023:36575883}" "analysis 67 patients muscular dystrophy/myopathy (not DMD)" "F" "" "Turkey" "" "0" "" "" "" "D11" "00442608" "" "" "" "1" "" "00006" "{PMID:Saito 2023:37933889}" "" "F" "" "Japan" "" "0" "" "" "" "Pat1" "00442609" "" "" "" "1" "" "00006" "{PMID:Saito 2023:37933889}" "" "F" "" "Japan" "" "0" "" "" "" "Pat2" "00442610" "" "" "" "1" "" "00006" "{PMID:Saito 2023:37933889}" "" "M" "" "Japan" "" "0" "" "" "" "Pat3" "00442708" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat80" "00442713" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "F" "" "" "" "0" "" "" "" "Pat85" "00442796" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat168" "00442797" "" "" "" "1" "" "00006" "{PMID:Westra 2019:31127727}" "" "M" "" "" "" "0" "" "" "" "Pat169" "00445403" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "" "" "" "" "" "00445446" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "" "" "" "" "" "00445447" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446365" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446396" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446397" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "" "" "" "" "" "00446398" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446399" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446401" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "0" "" "" "" "" "00446402" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "" "" "" "" "" "00446403" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446405" "" "" "" "2" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00446406" "" "" "00446405" "1" "" "03652" "" "sibling of Individual 00446405" "M" "no" "Argentina" "" "0" "" "" "" "" "00448421" "" "" "" "1" "" "00435" "" "" "F" "yes" "Egypt" "" "" "" "" "" "" "00449567" "" "" "" "1" "" "03652" "" "index case" "M" "no" "Argentina" "" "" "" "" "" "" "00449569" "" "" "" "1" "" "03652" "" "index case" "F" "no" "Argentina" "" "" "" "" "" "" "00452804" "" "" "" "1" "" "01164" "" "" "M" "likely" "Iraq" "" "0" "" "" "" "299822" "00452839" "" "" "" "1" "" "01164" "" "" "M" "yes" "Iraq" "" "0" "" "" "" "299822" "00457666" "" "" "" "1" "" "00006" "{PMID:Lord 2024:39243181}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "PatLAMA2" "00460227" "" "" "" "1" "" "00006" "{PMID:Mao 2025:39815277}" "family, 2 affecteds" "F" "" "China" "" "0" "" "" "" "G100-1" "00464193" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat1" "00464194" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat2" "00464195" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat3" "00464196" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat4" "00464197" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat5" "00464198" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat6" "00464199" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat7" "00464200" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat8" "00464201" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat9" "00464202" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat10" "00464203" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat11" "00464204" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat12" "00464205" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat13" "00464206" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat14" "00464207" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat15" "00464208" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat16" "00464209" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat17" "00464210" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat18" "00464211" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat19" "00464212" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat20" "00464213" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat21" "00464214" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat22" "00464215" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat23" "00464216" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat24" "00464217" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat25" "00464218" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat26" "00464219" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat27" "00464220" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat28" "00464221" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat29" "00464222" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat30" "00464223" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat31" "00464224" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat32" "00464225" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat33" "00464226" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat34" "00464227" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat35" "00464228" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat36" "00464229" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat37" "00464230" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat38" "00464231" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat39" "00464232" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat40" "00464233" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat41" "00464234" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat42" "00464235" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat43" "00464236" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat44" "00464237" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat45" "00464238" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat46" "00464239" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat47" "00464240" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat48" "00464241" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat49" "00464242" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat50" "00464243" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat51" "00464244" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat52" "00464245" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat53" "00464246" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat54" "00464247" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat55" "00464248" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat56" "00464249" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat57" "00464250" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat58" "00464251" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat59" "00464252" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat60" "00464253" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat61" "00464254" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat62" "00464255" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat63" "00464256" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat64" "00464257" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat65" "00464258" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat66" "00464259" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat67" "00464260" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat68" "00464261" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat69" "00464262" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat70" "00464263" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat71" "00464264" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat72" "00464265" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat73" "00464266" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat74" "00464267" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat75" "00464268" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat76" "00464269" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat77" "00464270" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat78" "00464271" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat79" "00464272" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat80" "00464273" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat81" "00464274" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat82" "00464275" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat83" "00464276" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat84" "00464277" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat85" "00464278" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat86" "00464279" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat87" "00464280" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "M" "" "Russia" "" "0" "" "" "" "Pat88" "00464281" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat89" "00464282" "" "" "" "1" "" "00006" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "patient" "F" "" "Russia" "" "0" "" "" "" "Pat90" "00466088" "" "" "" "1" "" "03652" "" "index case; 2-generation family, 1 affected, unaffected heterozygous carrier parents" "M" "no" "(Argentina)" "" "0" "" "" "" "" "00466566" "" "" "" "1" "" "00006" "{PMID:Rini 2025:40870035}, {DOI:Rini 20251: 10.3390/genes16080987}" "" "" "" "Italy" "" "0" "" "" "" "Pat14" "00466567" "" "" "" "1" "" "00006" "{PMID:Rini 2025:40870035}, {DOI:Rini 20251: 10.3390/genes16080987}" "" "" "" "Italy" "" "0" "" "" "" "Pat15" "00466568" "" "" "" "1" "" "00006" "{PMID:Rini 2025:40870035}, {DOI:Rini 20251: 10.3390/genes16080987}" "" "" "" "Italy" "" "0" "" "" "" "Pat16" "00467608" "" "" "" "1" "" "00006" "{PMID:Hollink 2016:26607181}" "2-generation family, 1 affected, unaffected parents" "M" "no" "Netherlands" "" "0" "" "" "" "PatA" "00468238" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat22" "00468242" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat159" "00468243" "" "" "" "1" "" "00006" "{PMID:Ayala-Ramirez 2025:41066171}" "patient" "M" "" "Colombia" "" "0" "" "" "" "Pat198" "00468279" "" "" "" "1" "" "00006" "{PMID:Nejati 2025:41188926}" "5-generation family, 1 affected, unaffected heterozygous carrier parents/relatives" "F" "no" "Iran" "" "0" "" "" "" "FamPatV2" "00468281" "" "" "" "1" "" "00006" "{PMID:Nouri 2022:35989179}" "2-generation family, 1 affected, unaffected heterozygous carrier parents" "F" "no" "Iran" "" "0" "" "" "" "patient" "00469057" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00469058" "" "" "" "1" "" "00006" "{PMID:Retterer 2016:26633542}" "analysis proband (1/3040); possible combination of variants not reported" "" "" "United States" "" "0" "" "" "" "" "00470657" "" "" "" "1" "" "00006" "{PMID:Horbacz 2025:41210864}" "patient, affected mother and father" "F" "" "Poland" "" "0" "" "" "" "Pat18" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 1192 "{{individualid}}" "{{diseaseid}}" "00000012" "00138" "00000012" "05378" "00000017" "00138" "00000017" "05378" "00000018" "00138" "00000018" "05378" "00000039" "05427" "00000054" "01617" "00036033" "00360" "00036034" "00360" "00036035" "00360" "00036036" "00360" "00036037" "00360" "00036038" "00360" "00036040" "05121" "00036041" "00360" "00036041" "01926" "00036041" "05121" "00036042" "00360" "00036043" "00360" "00036044" "00360" "00036045" "00360" "00036046" "00360" "00036047" "05121" "00036049" "00360" "00036050" "00360" "00036051" "00360" "00036052" "00360" "00036053" "00360" "00036054" "00360" "00036055" "00360" "00036057" "00360" "00054672" "00360" "00054676" "00360" "00054677" "00360" "00054681" "00360" "00054688" "00360" "00054691" "00360" "00054693" "00360" "00088192" "00360" "00102114" "00198" "00102115" "00360" "00102116" "00360" "00102117" "00360" "00102118" "00198" "00102119" "00360" "00102120" "00360" "00102121" "00360" "00102122" "00360" "00102123" "00360" "00102124" "00360" "00102125" "00360" "00102126" "00360" "00102127" "00198" "00102128" "00360" "00102129" "00198" "00102130" "00360" "00102131" "00360" "00102132" "00360" "00102133" "00360" "00102134" "00360" "00102135" "00198" "00102136" "00198" "00102137" "00360" "00102138" "00360" "00102139" "00360" "00102140" "00360" "00102141" "00360" "00102142" "00360" "00102143" "00360" "00102144" "00198" "00102145" "00360" "00102146" "00360" "00102147" "00360" "00102148" "00360" "00102149" "00360" "00102150" "00360" "00102151" "00198" "00102152" "00360" "00102153" "00360" "00102154" "00360" "00102155" "00198" "00102156" "00360" "00102157" "00360" "00102158" "00360" "00102159" "00360" "00102160" "00360" "00102161" "00360" "00102162" "00360" "00102163" "05121" "00102164" "00360" "00102165" "00360" "00102166" "00360" "00102167" "00360" "00102168" "00360" "00102169" "00360" "00102170" "00360" "00102171" "00360" "00102172" "00360" "00102173" "00360" "00102174" "00360" "00102175" "00360" "00102176" "00360" "00102177" "00360" "00102178" "00360" "00102179" "00360" "00102180" "00360" "00102181" "00360" "00102182" "00360" "00102183" "00360" "00102184" "00360" "00102185" "00360" "00102186" "00360" "00102187" "00360" "00102188" "00360" "00102189" "00360" "00102190" "00360" "00102191" "00360" "00102192" "00360" "00102193" "00360" "00102194" "00360" "00102195" "00360" "00102196" "00360" "00102197" "05126" "00102198" "00198" "00102199" "00360" "00102200" "00360" "00102201" "00360" "00102202" "00360" "00102203" "00360" "00102204" "00360" "00102205" "00360" "00102206" "00360" "00102207" "00360" "00102208" "00360" "00102209" "05121" "00102210" "00360" "00102211" "00360" "00102212" "00360" "00102213" "00360" "00102214" "00360" "00102215" "00360" "00102216" "00360" "00102217" "00360" "00102218" "00360" "00102219" "00360" "00102220" "00000" "00102221" "00000" "00102222" "00000" "00102223" "00000" "00102224" "00000" "00102225" "00000" "00102226" "00000" "00102227" "00000" "00102228" "00000" "00102229" "00000" "00102230" "00000" "00102231" "00000" "00102232" "00000" "00102233" "00000" "00102234" "00000" "00102235" "00000" "00102236" "00000" "00102237" "00000" "00102238" "00000" "00102239" "00000" "00102240" "00198" "00102241" "00360" "00102242" "00000" "00102243" "00000" "00102244" "00000" "00102245" "00000" "00102246" "00000" "00102247" "00360" "00102248" "00000" "00102249" "00000" "00102250" "00000" "00102251" "00000" "00102252" "00000" "00102253" "00000" "00102254" "00000" "00102255" "00000" "00102256" "00000" "00102257" "00000" "00102258" "00000" "00102259" "00000" "00102260" "00000" "00102261" "00000" "00102262" "00000" "00102263" "00000" "00102264" "00000" "00102265" "00000" "00102266" "00000" "00102267" "00000" "00102268" "00000" "00102269" "00360" "00102270" "00000" "00102271" "00000" "00102272" "00000" "00102273" "00000" "00102274" "00000" "00102275" "00000" "00102276" "00000" "00102277" "00000" "00102278" "00000" "00102279" "00000" "00102280" "00000" "00102281" "00000" "00102282" "00000" "00102283" "00000" "00102284" "00000" "00102285" "00000" "00102286" "00000" "00102287" "00000" "00102288" "00000" "00102289" "00000" "00102290" "00000" "00102291" "00000" "00102292" "00000" "00102293" "00000" "00102294" "00000" "00102295" "00000" "00102296" "00000" "00102297" "00000" "00102298" "00360" "00102299" "00000" "00102300" "00198" "00102301" "00000" "00102302" "00000" "00102303" "00000" "00102304" "00000" "00102305" "00000" "00102306" "00000" "00102307" "00000" "00102308" "00000" "00102309" "00000" "00102310" "00000" "00102311" "00000" "00102312" "00000" "00102313" "00000" "00102314" "00000" "00102315" "00000" "00102316" "00000" "00102317" "00000" "00102318" "00000" "00102319" "00000" "00102320" "00360" "00102321" "00000" "00102322" "00000" "00102323" "00244" "00102324" "00198" "00102325" "00198" "00102326" "05121" "00102327" "00360" "00102328" "00360" "00102329" "00360" "00102330" "00360" "00102331" "00360" "00102332" "00360" "00102333" "00360" "00102334" "00360" "00102335" "00360" "00102336" "00360" "00102337" "00360" "00102338" "00360" "00102339" "00360" "00102340" "05126" "00102341" "05121" "00102342" "00360" "00102349" "00360" "00102350" "00360" "00102351" "00000" "00102352" "00360" "00102353" "00360" "00102354" "00360" "00102355" "00360" "00102356" "00000" "00102357" "00000" "00102358" "00360" "00102359" "00360" "00102360" "00360" "00102361" "00360" "00102362" "00360" "00102363" "00360" "00102364" "00360" "00102365" "00198" "00102366" "00360" "00102367" "00360" "00102368" "00360" "00102369" "00360" "00102370" "00360" "00102371" "00360" "00102372" "00360" "00102373" "00360" "00102374" "00360" "00102375" "00360" "00102376" "00360" "00102377" "00360" "00102378" "00360" "00102379" "00360" "00102380" "00360" "00102381" "00360" "00102382" "00360" "00102383" "00360" "00102384" "00360" "00102385" "00360" "00102386" "00360" "00102387" "00360" "00102388" "00360" "00102389" "00360" "00102390" "00360" "00102391" "00360" "00102392" "00360" "00102393" "00360" "00102394" "00360" "00102395" "00360" "00102396" "00360" "00102397" "00360" "00102398" "00360" "00102399" "00360" "00102400" "00360" "00102401" "00360" "00102402" "00360" "00102403" "00360" "00102404" "00360" "00102405" "00360" "00102406" "00360" "00102407" "00360" "00102408" "00360" "00102409" "00360" "00102410" "00360" "00102411" "00360" "00102412" "00360" "00102413" "00360" "00102414" "00360" "00102415" "00360" "00102416" "00360" "00102417" "00360" "00102418" "00360" "00102419" "00360" "00102420" "00360" "00102421" "00360" "00102422" "00360" "00102423" "00360" "00102424" "00360" "00102425" "00360" "00102426" "00360" "00102427" "00360" "00102428" "00360" "00102429" "00360" "00102430" "00360" "00102431" "00360" "00102432" "00360" "00102434" "00360" "00102435" "00360" "00102436" "00360" "00102437" "00360" "00102438" "00360" "00102439" "00360" "00102440" "00360" "00102441" "00360" "00102442" "00360" "00102443" "00360" "00102444" "00360" "00102445" "00360" "00102446" "00360" "00102447" "00360" "00102448" "00360" "00102449" "00360" "00102450" "00360" "00102451" "00360" "00102452" "00360" "00102453" "00360" "00102455" "00360" "00102456" "00360" "00102457" "00360" "00102458" "00360" "00102459" "00360" "00102460" "00360" "00102461" "00360" "00102462" "00360" "00102463" "00360" "00102464" "00198" "00102465" "00360" "00102466" "00360" "00102467" "00360" "00102468" "00360" "00102469" "00360" "00102470" "00360" "00102471" "00360" "00102472" "00360" "00102473" "00360" "00102474" "00360" "00102475" "00360" "00102476" "00360" "00102477" "00360" "00102478" "00360" "00102479" "00360" "00102480" "00360" "00102481" "00360" "00102482" "00360" "00102483" "00360" "00102484" "00360" "00102485" "00360" "00102486" "00360" "00102487" "00000" "00102488" "00198" "00102489" "00198" "00102490" "00198" "00102491" "00198" "00102492" "00360" "00102493" "00360" "00102494" "00360" "00102495" "00360" "00102496" "00360" "00102497" "00360" "00102498" "00360" "00102499" "00360" "00102500" "00360" "00102501" "00360" "00102502" "00360" "00102503" "00360" "00102504" "00360" "00102505" "00000" "00102506" "00000" "00102507" "00000" "00102508" "00000" "00102509" "00000" "00102510" "00000" "00102511" "00000" "00102512" "00000" "00102513" "00000" "00102514" "00360" "00102515" "00360" "00102516" "00360" "00102517" "05121" "00102518" "00244" "00102519" "05126" "00102520" "05126" "00102521" "05126" "00102522" "05126" "00102523" "05126" "00102524" "00360" "00102525" "00360" "00102526" "00360" "00102527" "00360" "00102528" "00360" "00102529" "00360" "00102530" "00360" "00102531" "00360" "00102532" "00360" "00102533" "00000" "00102534" "00360" "00102535" "00360" "00102536" "00360" "00102537" "00360" "00102541" "05126" "00102543" "05126" "00102544" "00000" "00102546" "00000" "00102547" "00360" "00102548" "00360" "00102549" "00360" "00102551" "00198" "00102552" "00198" "00102553" "00198" "00102554" "00198" "00102555" "00198" "00102556" "00198" "00102557" "00198" "00102558" "00198" "00102559" "00198" "00102560" "00198" "00102561" "00198" "00102562" "00198" "00102563" "00198" "00102564" "00198" "00102565" "00198" "00102566" "00198" "00102567" "00198" "00102568" "00198" "00102569" "00198" "00102570" "00198" "00102571" "00198" "00102572" "00198" "00102573" "00198" "00102574" "00198" "00102575" "00198" "00102576" "00198" "00102577" "00198" "00102578" "00198" "00102579" "00198" "00102580" "00198" "00102581" "00198" "00102582" "00198" "00102583" "00198" "00102584" "00198" "00102585" "00198" "00102586" "00198" "00102587" "00198" "00102588" "00198" "00102589" "00198" "00102590" "00198" "00102591" "00198" "00102592" "00198" "00102593" "00198" "00102594" "00198" "00102595" "00198" "00102596" "00198" "00102597" "00198" "00102598" "00198" "00102599" "00198" "00102600" "00198" "00102601" "00198" "00102602" "00198" "00102603" "00198" "00102604" "00198" "00102605" "00198" "00102606" "00198" "00102607" "00198" "00102608" "00198" "00102609" "00198" "00102610" "00198" "00102611" "00198" "00102612" "00198" "00102613" "00198" "00102614" "00198" "00102615" "00198" "00102616" "00198" "00102617" "00198" "00102618" "00198" "00102619" "00198" "00102620" "00198" "00102621" "00198" "00102622" "00198" "00102623" "00198" "00102624" "00198" "00102625" "00198" "00102626" "00198" "00102627" "00198" "00102628" "00198" "00102629" "00198" "00102630" "00198" "00102631" "00198" "00102632" "00198" "00102633" "00198" "00102634" "00198" "00102635" "00198" "00102636" "00198" "00102637" "00198" "00102638" "00198" "00102639" "00198" "00102640" "00198" "00102641" "00198" "00102642" "00198" "00102643" "00198" "00102644" "00198" "00102645" "00198" "00102646" "00198" "00102647" "00198" "00102648" "00198" "00102649" "00198" "00102650" "00198" "00102651" "00198" "00102652" "00198" "00102653" "00198" "00102654" "00198" "00102655" "00360" "00102656" "00360" "00102657" "00360" "00102658" "00360" "00102659" "00360" "00102660" "00360" "00102661" "00360" "00102662" "00360" "00102663" "00360" "00102664" "00360" "00102665" "00360" "00102666" "00360" "00102667" "00360" "00102668" "00360" "00102713" "00360" "00102714" "00360" "00102715" "00360" "00102716" "00360" "00102717" "00360" "00102718" "00360" "00102718" "05121" "00102719" "00360" "00102720" "00360" "00102721" "00360" "00102722" "00360" "00102723" "00360" "00102724" "05121" "00102725" "05121" "00102726" "00360" "00102726" "05121" "00102727" "00360" "00102728" "04147" "00102728" "04270" "00102729" "00360" "00102731" "00360" "00102732" "00360" "00102733" "00360" "00102734" "05121" "00102735" "00360" "00102736" "00360" "00102737" "00360" "00103126" "05121" "00103127" "00360" "00103128" "00360" "00103129" "00360" "00103130" "00360" "00103131" "00360" "00103189" "00360" "00103191" "00360" "00103192" "00360" "00103195" "00360" "00103206" "00360" "00103207" "00360" "00103207" "05121" "00103219" "00360" "00103220" "00360" "00103221" "00360" "00103222" "00360" "00103226" "00360" "00103228" "00360" "00103229" "00360" "00103231" "00360" "00103234" "00360" "00103235" "00360" "00103236" "00360" "00103244" "00360" "00103245" "05121" "00103246" "05126" "00103247" "00360" "00103248" "00360" "00103249" "00360" "00103250" "00360" "00103251" "00360" "00103252" "00360" "00103253" "00360" "00103254" "00360" "00103255" "00360" "00103256" "00360" "00103257" "00360" "00103268" "05126" "00103324" "05121" "00103325" "05121" "00103326" "05121" "00103327" "00244" "00103461" "00244" "00103630" "00360" "00103631" "00360" "00103632" "00360" "00103633" "00360" "00103634" "00360" "00103635" "05126" "00103636" "05126" "00103637" "05126" "00103654" "00360" "00103655" "00360" "00103656" "00360" "00103657" "00360" "00103658" "00360" "00103659" "00360" "00103660" "00360" "00103661" "00360" "00103662" "00360" "00103663" "00360" "00103664" "00360" "00103665" "00360" "00103666" "00360" "00103667" "00360" "00103668" "00360" "00103669" "00360" "00103726" "00360" "00103727" "00360" "00103728" "00360" "00103729" "00360" "00103730" "00360" "00103731" "00360" "00103732" "00360" "00103733" "00360" "00103734" "00360" "00103735" "00360" "00103736" "00360" "00103737" "00360" "00103755" "00360" "00103760" "00360" "00103761" "00360" "00103765" "00360" "00103766" "00360" "00103767" "00360" "00103768" "00360" "00103772" "00360" "00103773" "00360" "00103774" "00360" "00103777" "00360" "00103778" "00360" "00103781" "00360" "00103919" "00360" "00103949" "05121" "00103950" "05121" "00103951" "05121" "00103952" "05121" "00103969" "05121" "00103970" "05121" "00103971" "05121" "00103972" "00360" "00103972" "05121" "00103973" "05121" "00103974" "05126" "00103975" "05126" "00103994" "03381" "00105043" "00360" "00111373" "00360" "00111374" "00360" "00111375" "00360" "00111376" "00360" "00111377" "00360" "00111379" "00360" "00111380" "00360" "00131883" "00360" "00131941" "05121" "00131976" "00360" "00132007" "00360" "00132008" "00360" "00132009" "00360" "00132010" "00360" "00132011" "00360" "00132012" "00360" "00132013" "00360" "00132014" "05121" "00132015" "00198" "00132016" "00360" "00132016" "05121" "00132025" "00198" "00132025" "00360" "00165139" "05126" "00183389" "00360" "00183390" "00360" "00183391" "00360" "00183392" "00360" "00208524" "03282" "00265482" "00360" "00269868" "00360" "00269869" "00360" "00274312" "05126" "00288102" "05378" "00288103" "05378" "00288970" "01959" "00288987" "05126" "00289006" "05126" "00289291" "00198" "00293969" "00198" "00293970" "00198" "00293972" "00198" "00293974" "00198" "00293975" "00198" "00293976" "00198" "00293977" "00198" "00293978" "00198" "00293979" "00198" "00293980" "00198" "00295438" "00198" "00295641" "00198" "00301610" "05652" "00303651" "02717" "00303652" "02717" "00303942" "02717" "00303943" "02717" "00305054" "00198" "00305055" "00198" "00305788" "05126" "00305806" "05126" "00307952" "00139" "00309888" "00198" "00313767" "05126" "00314337" "05126" "00314338" "05126" "00314339" "05126" "00314340" "05126" "00314341" "05126" "00314342" "05126" "00314343" "05126" "00314344" "05126" "00314345" "05126" "00314346" "05126" "00314347" "05126" "00314348" "05126" "00314349" "05126" "00314350" "05126" "00314351" "05126" "00314352" "05126" "00314353" "05126" "00320296" "04172" "00325411" "00198" "00361606" "00139" "00361917" "05126" "00374363" "00198" "00374364" "00198" "00374365" "00198" "00374366" "00198" "00374367" "00198" "00374368" "00198" "00374369" "00198" "00374370" "00198" "00374371" "00198" "00374372" "00198" "00374373" "00198" "00374374" "00198" "00374375" "00198" "00374701" "00198" "00375215" "00198" "00376428" "00352" "00380777" "00360" "00384562" "02717" "00386489" "00198" "00388673" "00244" "00388691" "00244" "00391935" "05324" "00391936" "05324" "00391938" "05324" "00391940" "05324" "00391942" "05324" "00391961" "05324" "00391997" "05324" "00397769" "05121" "00398992" "05618" "00398994" "05618" "00399024" "05618" "00399077" "05618" "00399092" "05618" "00411241" "04214" "00411284" "02717" "00411587" "04214" "00411884" "04214" "00411896" "04214" "00414704" "04214" "00415543" "05121" "00415544" "00360" "00416905" "05652" "00426480" "00360" "00426481" "00360" "00426482" "00360" "00426483" "00360" "00426484" "00360" "00426485" "00360" "00426486" "00360" "00426487" "00360" "00426488" "00360" "00426489" "00360" "00426490" "00360" "00426491" "00360" "00426492" "00360" "00426493" "00360" "00426494" "00360" "00426495" "00360" "00426496" "00360" "00426497" "00360" "00426498" "00360" "00426499" "00360" "00426500" "00360" "00426501" "00360" "00426502" "00360" "00426503" "00360" "00426504" "00360" "00426505" "00360" "00426506" "00360" "00426507" "00360" "00426508" "00360" "00426509" "00360" "00426510" "00360" "00426511" "00360" "00426512" "00360" "00426513" "00360" "00426514" "00360" "00426515" "00360" "00426516" "00360" "00426517" "00360" "00426518" "00360" "00426519" "00360" "00426520" "00360" "00426521" "00360" "00426522" "00360" "00426523" "00360" "00426524" "00360" "00426525" "00360" "00426526" "00360" "00426527" "00360" "00426528" "00360" "00426529" "00360" "00426530" "00360" "00426531" "00360" "00426532" "00360" "00426533" "00360" "00426534" "00360" "00426535" "00360" "00426536" "00360" "00426537" "00360" "00426538" "00360" "00426539" "00360" "00426540" "00360" "00426541" "00360" "00426542" "00360" "00426543" "00360" "00426544" "00360" "00426545" "00360" "00426546" "00360" "00426547" "00360" "00426548" "00360" "00426549" "00360" "00426550" "00360" "00426551" "00360" "00426552" "00360" "00426553" "00360" "00426554" "00360" "00426555" "00360" "00426556" "00360" "00426557" "00360" "00426558" "00360" "00426559" "00360" "00426560" "00360" "00426561" "00360" "00426562" "00360" "00426563" "00360" "00426564" "00360" "00426565" "00360" "00426566" "00360" "00426567" "00360" "00426568" "00360" "00426569" "00360" "00426570" "00360" "00426571" "00360" "00426572" "00360" "00426573" "00360" "00426574" "00360" "00426575" "00360" "00426576" "00360" "00426577" "00360" "00426578" "00360" "00426579" "00360" "00426580" "00360" "00426581" "00360" "00426582" "00360" "00426583" "00360" "00426584" "00360" "00426585" "00360" "00426586" "00360" "00426587" "00360" "00426588" "00360" "00426589" "00360" "00426590" "00360" "00426591" "00360" "00426592" "00360" "00426593" "00360" "00426594" "00360" "00426595" "00360" "00426596" "00360" "00426597" "00360" "00426598" "00360" "00426599" "00360" "00426600" "00360" "00426601" "00360" "00426602" "00360" "00426603" "00360" "00426604" "00360" "00426605" "00360" "00426606" "00360" "00426607" "00360" "00426608" "00360" "00426609" "00360" "00427145" "00360" "00427146" "00360" "00427147" "00360" "00427148" "00360" "00427149" "00360" "00427150" "00360" "00427151" "00360" "00427152" "00360" "00427153" "00360" "00427154" "00360" "00427155" "00360" "00427156" "00360" "00427157" "00360" "00427158" "00360" "00427159" "00360" "00427160" "00360" "00427161" "00360" "00427162" "00360" "00427163" "00360" "00427170" "00360" "00428469" "02717" "00430393" "05618" "00430399" "05618" "00430400" "05618" "00433435" "02717" "00433436" "02717" "00433437" "02717" "00433438" "02717" "00433439" "02717" "00435042" "00161" "00435042" "05121" "00435042" "05976" "00435679" "05121" "00435680" "05121" "00435681" "05121" "00435682" "05121" "00435683" "05121" "00435684" "05121" "00435685" "05121" "00435686" "05121" "00435687" "05121" "00435688" "05121" "00435689" "05121" "00435690" "05121" "00435691" "05121" "00435692" "05121" "00435693" "05121" "00435694" "05121" "00435695" "05121" "00435696" "05121" "00435697" "05121" "00435698" "05121" "00435699" "05121" "00435700" "05121" "00435701" "05121" "00435702" "05121" "00435703" "05121" "00435704" "05121" "00435705" "05121" "00435706" "05121" "00435707" "05121" "00435708" "05121" "00435709" "05121" "00435710" "05121" "00435711" "05121" "00435712" "05121" "00435713" "05121" "00435714" "05121" "00435715" "05121" "00435716" "05121" "00435717" "05121" "00435718" "05121" "00435719" "05121" "00435720" "05121" "00435721" "05121" "00435722" "05121" "00435723" "05121" "00435724" "05121" "00435725" "05121" "00435726" "05121" "00435727" "05121" "00435728" "05121" "00435729" "05121" "00435730" "05121" "00436845" "00198" "00436849" "00198" "00438471" "05121" "00438477" "05121" "00438478" "05121" "00442608" "00360" "00442609" "00360" "00442610" "00360" "00442708" "05618" "00442713" "05618" "00442796" "05618" "00442797" "05618" "00445403" "02717" "00445446" "02717" "00445447" "02717" "00446365" "02717" "00446396" "02717" "00446397" "02717" "00446398" "02717" "00446399" "02717" "00446401" "05652" "00446402" "02717" "00446403" "02717" "00446405" "02717" "00446406" "02717" "00448421" "00244" "00449567" "02717" "00449569" "02717" "00452804" "02717" "00452839" "02717" "00457666" "00244" "00460227" "00360" "00464193" "05121" "00464194" "05121" "00464195" "05121" "00464196" "05121" "00464197" "05121" "00464198" "05121" "00464199" "05121" "00464200" "05121" "00464201" "05121" "00464202" "05121" "00464203" "05121" "00464204" "05121" "00464205" "05121" "00464206" "05121" "00464207" "05121" "00464208" "05121" "00464209" "05121" "00464210" "05121" "00464211" "05121" "00464212" "05121" "00464213" "05121" "00464214" "05121" "00464215" "05121" "00464216" "05121" "00464217" "05121" "00464218" "05121" "00464219" "05121" "00464220" "05121" "00464221" "05121" "00464222" "05121" "00464223" "05121" "00464224" "05121" "00464225" "05121" "00464226" "05121" "00464227" "05121" "00464228" "05121" "00464229" "05121" "00464230" "05121" "00464231" "05121" "00464232" "05121" "00464233" "05121" "00464234" "05121" "00464235" "05121" "00464236" "05121" "00464237" "05121" "00464238" "05121" "00464239" "05121" "00464240" "05121" "00464241" "05121" "00464242" "05121" "00464243" "05121" "00464244" "05121" "00464245" "05121" "00464246" "05121" "00464247" "05121" "00464248" "05121" "00464249" "05121" "00464250" "05121" "00464251" "05121" "00464252" "05121" "00464253" "05121" "00464254" "05121" "00464255" "05121" "00464256" "05121" "00464257" "05121" "00464258" "05121" "00464259" "05121" "00464260" "05121" "00464261" "05121" "00464262" "05121" "00464263" "05121" "00464264" "05121" "00464265" "05121" "00464266" "05121" "00464267" "05121" "00464268" "05121" "00464269" "05121" "00464270" "05121" "00464271" "05121" "00464272" "05121" "00464273" "05121" "00464274" "05121" "00464275" "05121" "00464276" "05121" "00464277" "05121" "00464278" "05121" "00464279" "05121" "00464280" "05121" "00464281" "05121" "00464282" "05121" "00466088" "02717" "00466566" "05126" "00466567" "05126" "00466568" "05126" "00467608" "00139" "00468238" "00244" "00468242" "00244" "00468243" "00244" "00468279" "05121" "00468281" "05121" "00469057" "00198" "00469058" "00198" "00470657" "07210" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00000, 00138, 00139, 00161, 00198, 00244, 00352, 00360, 01617, 01926, 01959, 02717, 03282, 03381, 04147, 04172, 04214, 04270, 05121, 05126, 05324, 05378, 05427, 05618, 05652, 05976, 07210 ## Count = 1140 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000080396" "00000" "00102220" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080397" "00000" "00102221" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080398" "00000" "00102222" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080399" "00000" "00102223" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080400" "00000" "00102224" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080401" "00000" "00102225" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080402" "00000" "00102226" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080403" "00000" "00102227" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080404" "00000" "00102228" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080405" "00000" "00102229" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080406" "00000" "00102230" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080407" "00000" "00102231" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080408" "00000" "00102232" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080409" "00000" "00102233" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080410" "00000" "00102234" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080411" "00000" "00102235" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080412" "00000" "00102236" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080413" "00000" "00102237" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080414" "00000" "00102238" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080415" "00000" "00102239" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080416" "00198" "00102240" "00006" "Unknown" "" "" "" "" "" "merosin staining partial" "" "" "" "" "" "" "" "0000080418" "00000" "00102242" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080419" "00000" "00102243" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080420" "00000" "00102244" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080421" "00000" "00102245" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080422" "00000" "00102246" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080424" "00000" "00102248" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080425" "00000" "00102249" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080426" "00000" "00102250" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080427" "00000" "00102251" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080428" "00000" "00102252" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080429" "00000" "00102253" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080430" "00000" "00102254" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080431" "00000" "00102255" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080432" "00000" "00102256" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080433" "00000" "00102257" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080434" "00000" "00102258" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080435" "00000" "00102259" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080436" "00000" "00102260" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080437" "00000" "00102261" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080438" "00000" "00102262" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080439" "00000" "00102263" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080440" "00000" "00102264" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080441" "00000" "00102265" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080442" "00000" "00102266" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080443" "00000" "00102267" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080444" "00000" "00102268" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080446" "00000" "00102270" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080447" "00000" "00102271" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080448" "00000" "00102272" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080449" "00000" "00102273" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080450" "00000" "00102274" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080451" "00000" "00102275" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080452" "00000" "00102276" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080453" "00000" "00102277" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080454" "00000" "00102278" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080455" "00000" "00102279" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080456" "00000" "00102280" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080457" "00000" "00102281" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080458" "00000" "00102282" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080459" "00000" "00102283" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080460" "00000" "00102284" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080461" "00000" "00102285" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080462" "00000" "00102286" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080463" "00000" "00102287" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080464" "00000" "00102288" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080465" "00000" "00102289" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080466" "00000" "00102290" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080467" "00000" "00102291" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080468" "00000" "00102292" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080469" "00000" "00102293" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080470" "00000" "00102294" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080471" "00000" "00102295" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080472" "00000" "00102296" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080473" "00000" "00102297" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080475" "00000" "00102299" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080477" "00000" "00102301" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080478" "00000" "00102302" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080479" "00000" "00102303" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080480" "00000" "00102304" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080481" "00000" "00102305" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080482" "00000" "00102306" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080483" "00000" "00102307" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080484" "00000" "00102308" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080485" "00000" "00102309" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080486" "00000" "00102310" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080487" "00000" "00102311" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080488" "00000" "00102312" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080489" "00000" "00102313" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080490" "00000" "00102314" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080491" "00000" "00102315" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080492" "00000" "00102316" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080493" "00000" "00102317" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080494" "00000" "00102318" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080495" "00000" "00102319" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080497" "00000" "00102321" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080498" "00000" "00102322" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080532" "00000" "00102356" "00471" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080533" "00000" "00102357" "00471" "Isolated (sporadic)" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080663" "00000" "00102487" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080681" "00000" "00102505" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080682" "00000" "00102506" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080683" "00000" "00102507" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080684" "00000" "00102508" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080685" "00000" "00102509" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080686" "00000" "00102510" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080687" "00000" "00102511" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080688" "00000" "00102512" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080689" "00000" "00102513" "00400" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080709" "00000" "00102533" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000080720" "00000" "00102544" "00426" "Familial, autosomal recessive" "" "calve hypertrophy; functional grade 4" "" "" "" "" "" "" "" "" "" "" "" "0000080722" "00000" "00102546" "00426" "Familial, autosomal recessive" "" "calve hypertrophy; functional grade 4" "" "" "" "" "" "" "" "" "" "" "" "0000080867" "05121" "00102726" "00503" "Isolated (sporadic)" "42y" "•Gait impairment since 1.5yrs of age.\r\n•Unable to stand up or walk unaided, in the last 2 yrs.\r\n•Brain MRI: white matter changes.\r\n•Tetraparesis grade 4+/5 in upper limbs, grade 4-/5 in lower limbs.\r\n•Mild intellectual disability.\r\n•Partial epilepsy with secondary generalization, due to CNS structural defects (MRI below), with frequent seizures, refractory to treatment." "01y06m" "" "Gait impairment" "muscle, IHC for LAMA2, normal" "" "" "" "" "" "" "" "0000080869" "04270" "00102728" "00503" "Isolated (sporadic)" "21y" "Macrocephaly (1y); refractory epilepsy with progressive cognitive regression (6y); bilateral strabismus; with normal strength and without muscle complaints (able to run, climb stairs and run) at 21y; brain MRI: white matter changes and occypital agyria." "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "" "" "" "0000081283" "05121" "00103207" "00503" "Isolated (sporadic)" "" "Motor delay (HP:0001270), Hyperlordosis (HP:0003307), Elevated serum creatine phosphokinase (HP:0003236), Intellectual disability (HP:0001249)" ">02y" "" "Motor delay" "" "" "" "" "" "" "" "" "0000081904" "05121" "00103972" "00503" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000081928" "03381" "00103994" "00587" "Unknown" "" "diffuse-type or intestinal-type gastric cancer" "" "" "" "" "" "" "" "" "" "" "" "0000087465" "00360" "00111380" "01164" "Familial, autosomal recessive" "01y" "CK elevation (2600-5400 U/l), proximal muscle weakness (shoulder, no free standing), no mental retardation, no other affected family members" "00y" "" "" "" "" "" "" "" "" "" "" "0000124869" "00198" "00102114" "00006" "Unknown" "" "" "" "" "" "merosin staining partial" "" "" "" "" "" "?" "" "0000124870" "00198" "00102118" "00006" "Unknown" "" "" "" "" "" "merosin absent" "" "" "" "" "" "?" "" "0000124871" "00198" "00102127" "00006" "Unknown" "" "" "" "" "" "merosin absent" "" "" "" "" "" "?" "" "0000124872" "00198" "00102129" "00006" "Unknown" "" "" "" "" "" "merosin staining partial" "" "" "" "" "" "?" "" "0000124873" "00198" "00102135" "00006" "Unknown" "" "" "" "" "" "merosin absent" "" "" "" "" "" "?" "" "0000124874" "00198" "00102136" "00006" "Unknown" "" "" "" "" "" "merosin reduced" "" "" "" "" "" "?" "" "0000124875" "00198" "00102144" "00006" "Unknown" "" "" "" "" "" "merosin reduced" "" "" "" "" "" "?" "" "0000124876" "00198" "00102151" "00006" "Unknown" "" "" "" "" "" "merosin absent" "" "" "" "" "" "?" "" "0000124877" "00198" "00102155" "00006" "Unknown" "" "" "" "" "" "merosin absent" "" "" "" "" "" "?" "" "0000124878" "00198" "00102198" "00006" "Isolated (sporadic)" "" "myopathy, vacuolar; cardiomyopathy, dilated; leukoencephalopathy, inclusion body-like myositis; pes cavus, mild wasting proximal leg muscles, calf hypertrophy, mild weakness all leg muscles; knee reflexes decreased, ankle reflexes brisk, no clonus/other pyramidal signs; >30y-developed dilated cardiomyopathy; CPK: 471-1236 U/L (n<195); IQ85; w18m" "28y" "" "transient neurological symptoms after electrical shock" "IHC partial LAMA2" "" "" "" "" "" "?" "" "0000124879" "00198" "00102240" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124880" "00198" "00102300" "00006" "Unknown" "" "leprosy" "" "" "" "" "" "" "" "" "" "?" "" "0000124881" "00198" "00102324" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "atypical" "" "0000124882" "00198" "00102325" "01951" "Unknown" "" "" "" "" "" "LAMA2 deficient" "" "" "" "" "" "?" "" "0000124883" "00198" "00102365" "00464" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124884" "00198" "00102464" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124885" "00198" "00102488" "00006" "Unknown" "" "leprosy" "" "" "" "" "" "" "" "" "" "?" "" "0000124886" "00198" "00102489" "00006" "Unknown" "" "leprosy" "" "" "" "" "" "" "" "" "" "?" "" "0000124887" "00198" "00102490" "00006" "Unknown" "" "leprosy" "" "" "" "" "" "" "" "" "" "?" "" "0000124888" "00198" "00102491" "00006" "Unknown" "" "leprosy" "" "" "" "" "" "" "" "" "" "?" "" "0000124889" "00198" "00102551" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124890" "00198" "00102552" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124891" "00198" "00102553" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124892" "00198" "00102554" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124893" "00198" "00102555" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124894" "00198" "00102556" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124895" "00198" "00102557" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124896" "00198" "00102558" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124897" "00198" "00102559" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124898" "00198" "00102560" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124899" "00198" "00102561" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124900" "00198" "00102562" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124901" "00198" "00102563" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124902" "00198" "00102564" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124903" "00198" "00102565" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124904" "00198" "00102566" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124905" "00198" "00102567" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124906" "00198" "00102568" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124907" "00198" "00102569" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124908" "00198" "00102570" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124909" "00198" "00102571" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124910" "00198" "00102572" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124911" "00198" "00102573" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124912" "00198" "00102574" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124913" "00198" "00102575" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124914" "00198" "00102576" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124915" "00198" "00102577" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124916" "00198" "00102578" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124917" "00198" "00102579" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124918" "00198" "00102580" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124919" "00198" "00102581" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124920" "00198" "00102582" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124921" "00198" "00102583" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124922" "00198" "00102584" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124923" "00198" "00102585" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124924" "00198" "00102586" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124925" "00198" "00102587" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124926" "00198" "00102588" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124927" "00198" "00102589" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124928" "00198" "00102590" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124929" "00198" "00102591" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124930" "00198" "00102592" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124931" "00198" "00102593" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124932" "00198" "00102594" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124933" "00198" "00102595" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124934" "00198" "00102596" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124935" "00198" "00102597" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124936" "00198" "00102598" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124937" "00198" "00102599" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124938" "00198" "00102600" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124939" "00198" "00102601" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124940" "00198" "00102602" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124941" "00198" "00102603" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124942" "00198" "00102604" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124943" "00198" "00102605" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124944" "00198" "00102606" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124945" "00198" "00102607" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124946" "00198" "00102608" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124947" "00198" "00102609" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124948" "00198" "00102610" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124949" "00198" "00102611" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124950" "00198" "00102612" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124951" "00198" "00102613" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124952" "00198" "00102614" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124953" "00198" "00102615" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124954" "00198" "00102616" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124955" "00198" "00102617" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124956" "00198" "00102618" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124957" "00198" "00102619" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124958" "00198" "00102620" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124959" "00198" "00102621" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124960" "00198" "00102622" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124961" "00198" "00102623" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124962" "00198" "00102624" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124963" "00198" "00102625" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124964" "00198" "00102626" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124965" "00198" "00102627" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124966" "00198" "00102628" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124967" "00198" "00102629" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124968" "00198" "00102630" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124969" "00198" "00102631" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124970" "00198" "00102632" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124971" "00198" "00102633" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124972" "00198" "00102634" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124973" "00198" "00102635" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124974" "00198" "00102636" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124975" "00198" "00102637" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124976" "00198" "00102638" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124977" "00198" "00102639" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124978" "00198" "00102640" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124979" "00198" "00102641" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124980" "00198" "00102642" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124981" "00198" "00102643" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124982" "00198" "00102644" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124983" "00198" "00102645" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124984" "00198" "00102646" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124985" "00198" "00102647" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124986" "00198" "00102648" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124987" "00198" "00102649" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124988" "00198" "00102650" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124989" "00198" "00102651" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124990" "00198" "00102652" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124991" "00198" "00102653" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124992" "00198" "00102654" "00430" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124993" "00198" "00132015" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "?" "" "0000124994" "00360" "00132025" "02274" "Unknown" "" "Abnormality of the cerebral white matter (HP:0002500), elevated serum creatine phosphokinase (HP:0003236), Muscle weakness (HP:0001324)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related" "" "0000124995" "00360" "00036049" "00006" "Unknown" "" "polyneuropathy, asymptomatic leukoencephalopathy" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000124996" "00244" "00102323" "00464" "Unknown" "" "myopathy" "" "" "" "IHC no LAMA2" "" "" "" "" "" "myopathy" "" "0000124997" "00244" "00102518" "00006" "Unknown" "" "myopathy; sarcotubular proliferation" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000124998" "00244" "00103327" "00503" "Familial, autosomal recessive" "49y" "Elevated serum creatine phosphokinase (HP:0003236), proximal muscle weakness in lower limbs (HP:0008994) and upper limbs (HP:0008997), joint contracture (HP:0001371), calf muscle hypertrophy (HP:0008981), dilated cardiomyopathy (HP:0001644), hyperintensity of cerebral white matter on MRI (HP:0030890)" "06y" "" "Stiff elbow (HP:0025259) and spinal rigidity (HP:0003306)" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "myopathy" "" "0000124999" "00244" "00103461" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), proximal muscle weakness in lower limbs (HP:0008994) and upper limbs (HP:0008997), joint contracture (HP:0001371), hyperintensity of cerebral white matter on MRI (HP:0030890)" "02y06m" "" "Frequent falls (HP:0002359), delayed gross motor development (HP:0002194)" "" "" "" "" "" "" "myopathy" "" "0000125000" "00360" "00054672" "01399" "Familial, autosomal recessive" "14y" "gross motor delay, contractures, nocturnal ventilation, MRI - cobblestone lissencephaly; CPK elevated (487-3260); IHC LAMA2; histology dystrophic" "3m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125001" "00360" "00054676" "01399" "Familial, autosomal recessive" "18y" "infantile onset, gross motor delay, walked at 4 years, contractures, spinal rigidity; CPK normal; IHC LAMA2; histology dystrophic" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125002" "00360" "00054677" "01399" "Familial, autosomal recessive" "23y" "proximal weakness, mild scoliosis; CPK elevated (3195); IHC LAMA2; histology dystrophic" "6m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125003" "00360" "00054681" "01399" "Familial, autosomal recessive" "9y" "infantile hypotonia and weakness, arthrogryposis, congenital hip dislocation, gross motor delay, contractures; CPK elevated (2600); IHC LAMA2; histology dystrophic" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125004" "00360" "00054688" "01399" "Familial, autosomal recessive" "4y" "infantile hypotonia, arthrogryposis, gross motor delay, contractures; CPK elevated (1650); IHC LAMA2; histology dystrophic" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125005" "00360" "00054691" "01399" "Familial, autosomal recessive" "5y" "gross motor delay, standing at 4y; CPK elevated (1157)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125006" "00360" "00054693" "01399" "Familial, autosomal recessive" "8y" "infantile hypotonia, congenital hip dysplasia, gross motor delay, sat age 2y, contractures, nocturnal hypoventilation, MRI - white matter signal abnormality; CPK elevated (2500); IHC LAMA2; histology dystrophic" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125007" "00360" "00102115" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 4394; rolling on side-9m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125008" "00360" "00102116" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; generalized hypotonia, no head control/sit, absent deep tendon reflexes CT-scan brain diffuse low density areas cerebral white matter, EMG myogenic patterns; died of pneumonia caused by respiratory deficit; CPK: 1214 U/L; delayed" "1y4m" "" "delayed motor milestones" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125009" "00360" "00102117" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125010" "00360" "00102119" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125011" "00360" "00102120" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125012" "00360" "00102121" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; muscle weakness, hypotonia; 4y-contractures, no seizures; CPK: 2000 U/L; s10m" "" "" "floppy infant, pectus excavatum" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125013" "00360" "00102122" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 mild reduction" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125014" "00360" "00102123" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125015" "00360" "00102124" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 4360; s24m" "0d" "" "floppiness, clubfoot left" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125016" "00360" "00102125" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125017" "00360" "00102126" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; MRI brain high intensity; CPK: 625-65900; s6y" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125018" "00360" "00102128" "00400" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; delayed motor milestones, weakness/hypotonicity limb girdle muscles, bilateral talipes equinovarus, no respiratory/cardiac problems, EMG anterior tibial muscle myopathic changes, MRI brain high intensity bilateral white matter; CPK: 1339 U/L (n<150)" "0d" "" "delayed spontaneous movements, poor head control" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125019" "00360" "00102130" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125020" "00360" "00102131" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125021" "00360" "00102132" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 25000; s24m" "0d" "" "floppiness, contractures knees/elbows, difficulty feeding" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125022" "00360" "00102133" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125023" "00360" "00102134" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125024" "00360" "00102137" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125025" "00360" "00102138" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125026" "00360" "00102140" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125027" "00360" "00102141" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 2360; move arms/legs-6m" "0d" "" "floppiness, wrists drop" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125028" "00360" "00102142" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125029" "00360" "00102143" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; waddling gait, bilateral pes cavus,; 25y-multiple contractures, tonic-clonic seizures; CPK: 739 U/L; w3y" "0d" "" "floppy, club foot" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125030" "00360" "00102145" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; 6y-waddling gait, proximal muscle weakness; 7y-complex partial seizures; CPK: 3000 U/L; w32m" "0d" "" "mild hypotonia" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125031" "00360" "00102146" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 314-6192; s12m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125032" "00360" "00102147" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125033" "00360" "00102148" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125034" "00360" "00102149" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125035" "00360" "00102150" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 8000; move arms/legs" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125036" "00360" "00102152" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125037" "00360" "00102153" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 4200; move arms/legs (not vs. Gravity)" "0d" "" "floppiness, contracture 2nd finger hand left" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125038" "00360" "00102154" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; CPK: 1200; 2y-move arms/legs vs. gGravity" "" "" "" "merosin absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125039" "00360" "00102158" "00006" "Unknown" "" "dystrophy, muscular, congenital; contractures knees, abnormal white matter, no seizures; death respiratory failure; CPK: 839; s20m" "0d" "" "floppiness, funnel chest" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125040" "00360" "00102159" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 2000-3000; sit21m" "0d" "" "floppiness, contractures ankles" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125041" "00360" "00102162" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 3296; move arms/legs" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125042" "00360" "00102164" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125043" "00360" "00102166" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125044" "00360" "00102167" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; hypotonia (neonatal), deleayed motor milestones, mild contractures knees/ankles, increasing lumbar lordosis; MRI abnormalities; CPK: 387 U/L; no mental retardation; h12m, s2y" "" "" "" "IHC weak LAMA2, normal DMD" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125045" "00360" "00102169" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125046" "00360" "00102170" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "merosin absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125047" "00360" "00102171" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; mild; hypotonia muscle, 5m-no head control, stumbled easily, difficulty raising from sitting; CPK: 1187 U/L (n<180); ro5m, s7m, w26m" "3y6m" "" "muscle weakness, motor development delay" "IHC N-terminal partial LAMA2 staining, C-terminal normal, WB altered size" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125048" "00360" "00102172" "00006" "Familial" "" "dystrophy, muscular, congenital" "" "" "" "merosin absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125049" "00360" "00102173" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125050" "00360" "00102176" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 2200; s36m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125051" "00360" "00102177" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 3780; s15m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125052" "00360" "00102178" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; marked generalized weakness limb-girdle muscles, contractures elbows/wrists/knees/ankles, bilateral talipes equinovarus, hypertrophic upper/lower extremities were hypertrophic; MRI low signal intensity T1-weighted images, high signal intensity T2-weighted images hyperintensity periventricular images that corresponded to areas of demyelinization; CPK: 2897 U/L" "1m" "" "hypotonic, poor intake, irritability, reduced spontaneous movements, poor suction" "IHC no LAMA2, normal DMD, SGCA/SGCB/SGCG/SGCD" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125053" "00360" "00102181" "00006" "Familial" "" "dystrophy, muscular, congenital" "" "" "" "IHC LAMA2 partial" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125054" "00360" "00102183" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; delayed motor development; 3y-muscle hypotonia, waddling gait (left foot turned inward), proximal muscle weakness; muscle biopsy dystrophic; 12y-ankle retractions surgically corrected; 13y-waddling gait, moderate proximal muscle weakness, mild dorsal scoliosis, EMG myopathic pattern, slight reduction motor nerve conduction velocity, brain MRI severe widespread white matter alteration; CPK: 1431 U/L (n<200); s6m, w2y" "0d" "" "sever hypotonia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125055" "00360" "00102184" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125056" "00360" "00102185" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 3000; s18m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125057" "00360" "00102186" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 6000" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125058" "00360" "00102190" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125059" "00360" "00102193" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; 6y-progressive scoliosis; 9y-onset partial seizures; 12y-limb girdle/facial weakness, weak hip/elbow contractions, moderate lung function restriction; hypodensity white matter; CPK: 1500-5170 U/L (<200 U/L); no mental retardation; s10m,never walked" "0d" "" "mild hypotonic" "IHC markedly reduced LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125060" "00360" "00102194" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125061" "00360" "00102195" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; 1y-CT scan brain diffuse leukoencephalopathy; CPK: 3-5x" "8d" "" "hypotonic, weak cry, diminished limb movements, flexion contractures elbows/knees" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125062" "00360" "00102196" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; mildly hypotonic, proximal weakness, hyporeflexia; 9y-tires easily, no Gower\'s maneuver, nomuscle hypertrophy/contractures, never seizures; hypodensity white matter; CPK: 3500 U/L (<200 U/L); no mental retardation; s8m, w18m" "4y" "" "waddling gait, slow awkard run" "IHC partial LAMA2 staining" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125063" "00360" "00102199" "00006" "Unknown" "" "dystrophy, muscular, congenital; delayed motor milestones (climb up/down staircase 10y); 35y walk with support, slowly progressive muscle weakness; 39y respiratory distress; MRI brain diffuse leucodystrophic changes; muslce biopsy dystrophic changes; ro16m, w6y; wheelchair bound 39y" "" "" "" "IHC/WB partially positive LAMA2, no LAMA2 peripheral nerve Schwann cell basal lamina" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125064" "00360" "00102200" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; severe progressive kyphoscoliosis, chest deformity, hip/ankle contractures, severe respiratory insufficiency necessitating nocturnal ventilation; hypodensity white matter; CPK: 321-1585 U/L (<200 U/L); no mental retardation; max. few steps with support" "0d" "" "mild hypotonia, arthrogryposis" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125065" "00360" "00102201" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; EMG myopathy; 10d-muscle biopsy dystrophic; severly delayed motor milestones; 7y-absence seizures with myoclonic jerks upper limbs/eyelids; 9y-seizures partial complex, brain MRI tetraventricular dilatation, severe widespread white matter alterations; 14y-severe hypotonia, hypotrophy four limbs, scoliosis, multiple contractures; CPK elevated; moderate mental retardation; max. wa6y; wheelchair bound <14y" "0d" "" "severe hypotonia, joint contractures" "IHC LAMA2 partially positive" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125066" "00360" "00102202" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125067" "00360" "00102203" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125068" "00360" "00102204" "00006" "Unknown" "" "dystrophy, muscular, congenital; move arms/legs (not vs. gravity)-6.5m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125069" "00360" "00102205" "00006" "Unknown" "" "dystrophy, muscular, congenital; CPK: 1500; head control, s24m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125070" "00360" "00102206" "00006" "Unknown" "" "dystrophy, muscular, congenital; contractures elbows/hips/knees/ankles; death respiratory failure; CPK: 2020-4720; sit-7m" "0d" "" "floppiness, difficulties feeding/breathing" "merosin absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125071" "00360" "00102207" "00006" "Unknown" "" "dystrophy, muscular, congenital; contractures, abnormal white matter, no seizures, EMG normal; CPK: 9890; move arms/legs-11m" "0d" "" "floppiness, contractures ankles" "merosin absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125072" "00360" "00102241" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; contractures knees/elbows, mild scoliosis, cognitive decline 18-24y; 21y-complex seizures; CPK: 762 U/L; w24m; wheelchair bound 18y" "" "" "floppy infant, delayed motor development" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125073" "00360" "00102247" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125074" "00360" "00102269" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; 3y-normal gait, waddling run, no seizures; CPK: 20000 U/L; w3y" "2m" "" "unable to lift head" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125075" "00360" "00102320" "00006" "Unknown" "" "dystrophy, muscular, congenital; sit-18m" "0d" "" "floppiness" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125076" "00360" "00102329" "00464" "Unknown" "" "dystrophy, muscular, congenital; white matter changes" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125077" "00360" "00102331" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125078" "00360" "00102336" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125079" "00360" "00102338" "00006" "Unknown" "" "dystrophy, muscular, congenital; EMG myopathic; CPK: 8000" "0d" "" "" "merosin absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125080" "00360" "00102339" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; mild; CPK: 256 U/L (n<180); w3y8m" "" "" "hypotonia, poor head control" "IHC N-terminal partial LAMA2 staining, C-terminal normal, WB altered size" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125081" "00360" "00102350" "00006" "Unknown" "" "dystrophy, muscular, congenital; hypotonia, muscle weakness, seizures; CPK: 650-1420; no mental retardation" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125082" "00360" "00102366" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125083" "00360" "00102380" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125084" "00360" "00102393" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125085" "00360" "00102394" "00464" "Unknown" "" "dystrophy, muscular, congenital" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125086" "00360" "00102399" "00464" "Unknown" "" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), elbow flexion contracture (HP:0002987), wrist flexion contracture (HP:0001239), EMG: myopathic abnormalities (HP:0003458), Distal muscle weakness (HP:0002460), Proximal muscle weakness (HP:0003701), normal intelligence" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125087" "00360" "00102401" "00464" "Unknown" "" "muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125088" "00360" "00102453" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125089" "00360" "00102465" "00464" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125090" "00360" "00102492" "00006" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; 5.5y-EMG myopathic pattern, slight decreased MCV, brain MRI severe white matter alteration; 7y-severly delayed motor milestones, contractures hips/knees, unaffected cardiac/pulmonary functions ; s6m, stand supported 5y" "0d" "" "sever hypotonia, difficulty swallowing" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125091" "00360" "00102496" "00400" "Isolated (sporadic)" "" "muscular weakness with axial, proximal predominance, scoliosis; contractures elbows/ankles; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 3264; no mental retardation; walk" "0d" "" "generalized hypotonia and areflexia" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125092" "00360" "00102504" "00400" "Isolated (sporadic)" "" "dystrophy, muscular, congenital; delayed motor milestones, generalized weakness limb girdle muscles, bilateral talipes equinovarus, no respiratory/cardiac problems, ENG myopathic changes, fibrillation/positive sharp waves, delayed sensory nerve conduction velocity, normal motor nerve conduction velocitie, CT-scan white matter hypodensity; CPK: 1475 U/L (n<150); not sit" "0d" "" "floppy, hypotonia, reduced spontaneous movements, poor sucking" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125093" "00360" "00102514" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125094" "00360" "00102515" "00006" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125095" "00360" "00102524" "00006" "Unknown" "" "dystrophy, muscular, congenital; calf muscle hypertrophy, no contractures, MRI brain white matter attenuation; CPK: 2603; w4y; wheelchair bound >13y" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125096" "00360" "00102525" "00006" "Unknown" "" "dystrophy, muscular, congenital; calf muscle hypertrophy, mild scoliosis concave to the right, MRI brain white matter attenuation; CPK: 2349; w4y; wheelchair bound >11y" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125097" "00360" "00102526" "00006" "Unknown" "" "dystrophy, muscular, congenital; no muscle hypertrophy, no contractures, MRI brain white matter attenuation, EEG normal; CPK: 1990-23270; sit supported; never walked" "0d" "" "" "IHC reduced LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125098" "00360" "00102527" "00006" "Unknown" "" "dystrophy, muscular, congenital; no muscle hypertrophy, contractures hips/knees/ankles with bilateral equinovarus; CPK: 2864; no sit; never walked" "2m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125099" "00360" "00102528" "00006" "Unknown" "" "dystrophy, muscular, congenital; calf/hamstrings muscle hypertrophy, contracturesips/knees/elbows with equinovarus, kyphoscoliosis, MRI brain white matter attenuation, 4y-ECG normal; CPK: 2280; stand supported; never walked" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125100" "00360" "00102529" "00006" "Unknown" "" "dystrophy, muscular, congenital; no muscle hypertrophy, contractures hips/knees/elbows/heel cords, MRI brain white matter attenuation, 5y-ECG normal; CPK: 21063; sit supported; never walked" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125101" "00360" "00102530" "00006" "Unknown" "" "dystrophy, muscular, congenital; calf muscle hypertrophy, contractures bilateral equinovarus, MRI brain diffuse white matter attenuation, 6y-ECG normal; CPK: 22506; w3y; wheelchair bound 13y" "<6m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125102" "00360" "00102531" "00006" "Unknown" "" "dystrophy, muscular, congenital; calf muscle hypertrophy, contractures right equinovarus, CT-scan brain accentuated white matter hypodensity, 3y-ECG normal; CPK: 221929; w3.5y; wheelchair bound >12y" "<6m" "" "" "IHC reduced LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125103" "00360" "00102532" "00006" "Unknown" "" "dystrophy, muscular, congenital; calf muscle hypertrophy, no contractures, MRI brain diffuse white matter attenuation, 2y-ECG normal; CPK: 249; w4y; wheelchair bound >8y" "<6m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125104" "00360" "00102537" "00426" "Familial, autosomal recessive" "" "dystrophy, muscular, congenital; calve hypertrophy; CPK: 338; wheelchair bound >5y" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125105" "00360" "00102656" "00464" "Familial, autosomal recessive" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125106" "00360" "00102662" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125107" "00360" "00102666" "01700" "Unknown" "" "dystrophy, muscular, congenital; Muscle biopsy showed presence of dystrophic features, white matter changes on MRI." "" "" "" "Laminin a2 absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125108" "00360" "00103127" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125109" "00360" "00103191" "00006" "Unknown" "" "" "" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125110" "00360" "00103192" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125111" "00360" "00103235" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125112" "00360" "00103236" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125113" "00360" "00103244" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125115" "00360" "00132008" "02274" "Unknown" "" "Muscular hypotonia (HP:0001252) (neonatal), Talipes equinovarus (HP:0001762), elevated serum creatine phosphokinase (HP:0003236), Elevated aldolase level (HP:0012544)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125116" "00360" "00132009" "02274" "Unknown" "" "Muscular hypotonia (HP:0001252)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125117" "00360" "00132012" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125118" "00360" "00132013" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125119" "00360" "00036057" "01164" "Familial, autosomal recessive" "" "leukodystrophy (MRT), persistent CK elevation, delayed development (motor)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital, merosin negative" "" "0000125120" "00360" "00088192" "01822" "Familial, autosomal recessive" "" "muscular dystrophy, due to partial LAMA2 deficiency" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125121" "00360" "00102139" "00006" "Familial, autosomal recessive" "" "no epilepsy, MRI brain classic abnormalities white matter changes; CPK: <1000 U/L; no mental retardation; walk" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125122" "00360" "00102156" "00426" "Familial, autosomal recessive" "" "no calf hypertrophy/respiratory complications, deep tendon reflex abolished, foot exhibited equinovarus deformity, lumbar scoliosis; 4y-speaking, never walked, brain MRI increased signal periventricular white matter without structural brain involvement; 6y-respiratory complications, lumbar scoliosis pronounced; 19y-died after respiratory complications/severe amyotrophy; CPK: 1000 UI/L; mental retardation" "0d" "" "st36m" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125123" "00360" "00102157" "00426" "Familial, autosomal recessive" "" "2y-delayed motor milestones (not stand), axial/peripheral hypotonia, joint contractures, no calf hypertrophy, deep tendon reflex abolished, foot exhibited equinovarus deformity, brain MRI abnormal signal periventricular white matter; CPK: 950 UI/L; no mental retardation" "0d" "" "generalized hypotonia, weakness, joint contractures" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125124" "00360" "00102160" "00006" "Familial, autosomal recessive" "" "no epilepsy, MRI brain classic abnormalities white matter changes; CPK: >1000 U/L; no mental retardation; sit" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125125" "00360" "00102161" "00400" "Familial, autosomal recessive" "" "muscular weakness with facial/bulbar paresis and slight improvement in motor function; contractures knees; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 1156; no mental retardation; sit" "0d" "" "hypotonia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125126" "00360" "00102165" "00006" "Familial, autosomal recessive" "" "no epilepsy; CPK: >1000 U/L; no mental retardation; sit" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125127" "00360" "00102168" "00400" "Familial, autosomal recessive" "" "proximal weakness; no seizures; MRI brain white matter changes, abnormal bilateral frontal gyration; CPK: 3265; no mental retardation; sit" "4m" "" "hypotonia, areflexia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125128" "00360" "00102174" "00006" "Familial, autosomal recessive" "" "no epilepsy, MRI brain classic abnormalities white matter changes; 1y-no neuropathy; CPK: >1000 U/L; no mental retardation; sit" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125129" "00360" "00102175" "00006" "Familial, autosomal recessive" "" "epilepsy, MRI brain classic abnormalities white matter changes; CPK: >1000 U/L; moderate mental retardation; walk" "" "" "" "IHC LAMA2 reduced" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125130" "00360" "00102179" "00400" "Familial, autosomal recessive" "" "proximal weakness, scoliosis; contractures elbows/knees; seizures, 2y-generalized epilepsy; MRI brain white matter changes, abnormal bilateral frontal gyration; no mental retardation; sit" "0d" "" "hypotonia, arthrogryposis" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125131" "00360" "00102180" "00400" "Familial, autosomal recessive" "" "severe generalized weakness, scoliosis; contractures all joints; no seizures; MRI brain white matter changes, abnormal bilateral frontal gyration; CPK: 1410; no mental retardation; none" "0d" "" "hypotonia, feeding problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125132" "00360" "00102182" "00006" "Familial, autosomal recessive" "" "no epilepsy; 18m-MRI brain classic abnormalities white matter changes (normal at 4m); CPK: >1000 U/L; moderate mental retardation; poor head control" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125133" "00360" "00102187" "00006" "Familial, autosomal recessive" "" "early onset, delayed motor milestones; 7m-limb/truncal hypotonia, marked facial weakness; ventilatory support, mild contractres, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A; CPK: 1761; w32m; not wheelchair bound" "1m14d" "" "hypotonic" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125134" "00360" "00102188" "00006" "Familial, autosomal recessive" "" "EEG pathological, MRI brain classic abnormalities white matter changes, EMG myogenic potentials; 6.9y-epileptic seizures, psychomotor arrest, hallucinations, focal cortical dysplasia; CPK: 643-1173 mU/mL; no mental retardation; w3.8y 10 m" "0d" "" "severe hypotonia, marked proximal weakness, ankle contractures, absent tendon reflexes" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125135" "00360" "00102189" "00400" "Familial, autosomal recessive" "" "muscular weakness with axial and proximal predominance; contractures elbows/knees; no seizures; CPK: 2697; no mental retardation; sit" "0d" "" "hypotonia and poor spontaneous movements" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125136" "00360" "00102191" "00400" "Familial, autosomal recessive" "" "generalized axial hypotonia, pectus excavatum; respiratory distress episodes; no contractures; no seizures; no mental retardation; none" "00y00m00d" "" "hypotonia, hyporeflexia, bilateral talipes equinus" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125137" "00360" "00102192" "00400" "Familial, autosomal recessive" "" "generalized weakness with proximal predominance; contractures knees/hips, limited ankle movements; no seizures; MRI brain white matter changes, abnormal bilateral frontal gyration; CPK: 2697; no mental retardation; assisted trunk control" "0d" "" "hypotonia, poor spontaneous movements" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125138" "00360" "00102208" "00400" "Familial, autosomal recessive" "" "generalized weakness with axial/proximal predominance, improvement in motor function; no seizures; MRI brain white matter changes and abnormal occipital gyration; CPK: 1650; no mental retardation; sit" "0d" "" "hypotonia, feeding problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125139" "00360" "00102210" "00006" "Familial, autosomal recessive" "" "no epilepsy, MRI brain classic abnormalities white matter changes; CPK: <1000 U/L; no mental retardation; sit" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125140" "00360" "00102211" "00006" "Familial, autosomal recessive" "" "no epilepsy, MRI brain classic abnormalities white matter changes; 3m-no neuropathy; CPK: <1000 U/L; no mental retardation; sit" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125141" "00360" "00102212" "00400" "Familial, autosomal recessive" "" "generalized weakness with axial predominance; contractures knees; no seizures; MRI brain white matter changes, no gyral abnormalities; no mental retardation; head control, sit" "0d" "" "hypotonia, arthrogryposis" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125142" "00360" "00102213" "00400" "Familial, autosomal recessive" "" "proximal weakness with mild progression, facial/bulbar paresis, severe scoliosis (0.9y), nocturnal ventilation (0.3y); contractures generalized; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 840; no mental retardation; head control, sit" "2m" "" "generalized hypotonia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125143" "00360" "00102214" "00400" "Familial, autosomal recessive" "" "muscular weakness with axial/proximal predominance; contractures bilateral talipes equinus; no seizures; CPK: 3782; no mental retardation; head control, moves hands" "0d" "" "hypotonia and neonatal asphyxia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125144" "00360" "00102215" "00400" "Familial, autosomal recessive" "" "muscular weakness with axial/proximal predominance; no contractures; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 1999; no mental retardation; sit" "00y00m00d" "" "hypotonia, feeding/respiratory problems" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125145" "00360" "00102216" "00400" "Familial, autosomal recessive" "" "generalized axial weakness, respiratory distress episodesnocontractures; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 1085; no mental retardation; sit" "0d" "" "hypotonia, mild neonatal distress" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125146" "00360" "00102217" "00400" "Familial, autosomal recessive" "" "muscular weakness with axial/proximal predominance, scoliosis; contractures elbows/knees; no seizures; no mental retardation; head control, trunk control" "0d" "" "hypotonia, feeding problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125147" "00360" "00102218" "00400" "Familial, autosomal recessive" "" "muscular weakness with facial diparesis, scoliosis, severe muscle atrophy, under BIPAP; contractures generalized; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 4460; no mental retardation; plays with hands" "<0d" "" "hypotonia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125148" "00360" "00102219" "00400" "Familial, autosomal recessive" "" "muscular weakness with facial diparesis; no contractures; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 3866; no mental retardation; sit" "00y00m00d" "" "hypotonia, bilateral talipes equinus" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125149" "00360" "00102298" "00006" "Familial, autosomal recessive" "" "no epilepsy, MRI brain classic abnormalities white matter changes, cortical dysplasia; 8m-no neuropathy; CPK: <1000 U/L; no mental retardation; sit" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125150" "00360" "00102327" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125151" "00360" "00102328" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125152" "00360" "00102330" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125153" "00360" "00102332" "01416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125154" "00360" "00102333" "01416" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125155" "00360" "00102334" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125156" "00360" "00102335" "00464" "Familial, autosomal recessive" "" "" "" "" "" "LAMA2 absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125157" "00360" "00102337" "00464" "Familial, autosomal recessive" "" "MRI abnormal white matter; muscle weakness; CPK elevated" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125158" "00360" "00102342" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125159" "00360" "00102349" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125160" "00360" "00102352" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125161" "00360" "00102353" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125162" "00360" "00102354" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125163" "00360" "00102355" "00464" "Familial, autosomal recessive" "" "" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125164" "00360" "00102358" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500), elevated serum creatine phosphokinase (HP:0003236), Progressive proximal muscle weakness (HP:0009073)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125165" "00360" "00102359" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125166" "00360" "00102360" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125167" "00360" "00102361" "00464" "Familial, autosomal recessive" "02y" "Muscular hypotonia (HP:0001252), Elevated serum creatine phosphokinase (HP:0003236), EMG: myopathic abnormalities (HP:0003458), Neuromuscular dysphagia (HP:0002068)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125168" "00360" "00102362" "00464" "Familial, autosomal recessive" "" "" "" "" "" "merosin deficient biopsy" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125169" "00360" "00102363" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500), elevated serum creatine phosphokinase (HP:0003236), Muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125170" "00360" "00102364" "00464" "Familial, autosomal recessive" "" "Central nervous system cyst (HP:0030724)" "" "" "" "LAMA2 deficient biopsy" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125171" "00360" "00102367" "00464" "Familial, autosomal recessive" "" "MRI brain abnormal" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125172" "00360" "00102368" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125173" "00360" "00102369" "00464" "Familial, autosomal recessive" "" "" "" "" "" "skin fibroblasts LAMA2 decreased" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125174" "00360" "00102370" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125175" "00360" "00102371" "00464" "Familial, autosomal recessive" "" "Muscular dystrophy (HP:0003560)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125176" "00360" "00102372" "00464" "Familial, autosomal recessive" "" "brain MRI consistent with MDC1A" "" "" "" "LAMA2 decreased" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125177" "00360" "00102373" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125178" "00360" "00102374" "00486" "Familial, autosomal recessive" "" "hypotonia" "" "8m" "" "IHC/WB LAMA2 negative" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125179" "00360" "00102375" "00464" "Familial, autosomal recessive" "" "brain MRI abnormal" "" "" "" "IHC LAMA2 deficient" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125180" "00360" "00102376" "00464" "Familial, autosomal recessive" "00y03m" "elevated serum creatine phosphokinase (HP:0003236), Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125181" "00360" "00102377" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125182" "00360" "00102378" "00464" "Familial, autosomal recessive" "" "Congenital muscular dystrophy (HP:0003741), Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125183" "00360" "00102379" "00464" "Familial, autosomal recessive" "" "Seizures (HP:0001250)" "" "" "" "fibroblasts, IHC for LAMA2, partial deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125184" "00360" "00102381" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125185" "00360" "00102382" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "muscle, IHC for LAMA2, partial deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125186" "00360" "00102383" "00464" "Familial, autosomal recessive" "" "" "" "" "" "IHC LAMA2 deficient" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125187" "00360" "00102384" "00464" "Familial, autosomal recessive" "" "" "" "" "" "IHC LAMA2 deficient" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125188" "00360" "00102385" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125189" "00360" "00102386" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125190" "00360" "00102387" "00464" "Familial, autosomal recessive" "" "" "" "" "" "merosin deficient biopsy" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125191" "00360" "00102388" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125192" "00360" "00102389" "00464" "Familial, autosomal recessive" "" "scoliosis, contractures elbows, wrist, knees; MRI white matter abnormal; CPK: 5500; no mental retardation" "" "" "" "IHC LAMA2 negative" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125193" "00360" "00102390" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125194" "00360" "00102391" "00464" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125195" "00360" "00102392" "00464" "Familial, autosomal recessive" "" "confluent posterior white matter changes; CPK elevated" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125196" "00360" "00102395" "00464" "Familial, autosomal recessive" "" "MRI with characteristic whitematter changes; CPK: ~3000" "" "" "" "IHC absence merosin (LAMA2)" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125197" "00360" "00102396" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125198" "00360" "00102397" "00464" "Familial, autosomal recessive" "" "Muscular hypotonia (HP:0001252), Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125199" "00360" "00102398" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125200" "00360" "00102400" "00464" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125201" "00360" "00102402" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), ?, feeding problems (incl. bulbar weakness), MRI normal in neonatal period; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125202" "00360" "00102403" "00006" "Familial, autosomal recessive" "" "ventilatory support, mild contractres, enteral feeding, MRI subtle abnormalities pons medulla; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125203" "00360" "00102404" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres to contractures, 1y-enteral feeding, MRI normal in neonatal period, 0.5y-normal echo; sit(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125204" "00360" "00102405" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres to contractures, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A; no mental retardation; sit(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125205" "00360" "00102406" "00006" "Familial, autosomal recessive" "" "feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A; sit; wheelchair bound" "<6m" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125206" "00360" "00102407" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres, 1.5y-enteral feeding; no mental retardation; head control; wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125207" "00360" "00102408" "00006" "Familial, autosomal recessive" "" "mild contractres, feeding problems (incl. bulbar weakness), MRI bilateral occipital polymicrogyria with white matter change, ophthalmoplegia, mitral regurgitation; mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125208" "00360" "00102409" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), contractures, feeding problems (incl. bulbar weakness); no mental retardation; sit(s); wheelchair bound" "<6m" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125209" "00360" "00102410" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), contractures, feeding problems (incl. bulbar weakness), MRI white matter change, occipital agyria; no mental retardation; sit(s); wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125210" "00360" "00102411" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A; head control; wheelchair bound" "<7d" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125211" "00360" "00102412" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A, abnormal cortical folding medial temporal/occipital lobes; no mental retardation; sit; wheelchair bound" "<6m" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125212" "00360" "00102413" "00006" "Familial, autosomal recessive" "" "mild contractres, MRI typical white matter change MDC1A; no mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125213" "00360" "00102414" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), contractures, feeding problems (incl. bulbar weakness); no mental retardation; sit; wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125214" "00360" "00102415" "00006" "Familial, autosomal recessive" "" "2y-ventilatory support, mild contractres to contractures, 1.5y-enteral feeding, MRI normal in neonatal period; no mental retardation; head control; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125215" "00360" "00102416" "00006" "Familial, autosomal recessive" "" "ventilatory support, mild contractres to contractures, enteral feeding, MRI typical white matter change MDC1A, 0.5y-normal echo; no mental retardation; sit; wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125216" "00360" "00102417" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres, MRI typical white matter change MDC1A; no mental retardation; walk; not wheelchair bound" ">1y" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125217" "00360" "00102418" "00006" "Familial, autosomal recessive" "" "contractures, MRI typical white matter change MDC1A, bilateral occipital polymicrogyria; no mental retardation; sit(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125218" "00360" "00102419" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), contractures, 3.3y-enteral feeding, MRI typical white matter change MDC1A, palpitations; no mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125219" "00360" "00102420" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres, feeding problems (incl. bulbar weakness); no mental retardation; walk; not wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125220" "00360" "00102421" "00006" "Familial, autosomal recessive" "" "ventilatory support, contractures, 1.5y-enteral feeding, MRI typical white matter change MDC1A, subtle abnormality in cortical folding, craniosynostosis; no mental retardation; sit(s); wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125221" "00360" "00102422" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), severe contractures; no mental retardation; sit(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125222" "00360" "00102423" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres to contractures, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A, occipital lissencephaly, rotated vermis; walk(s); ambulant with aid" "<7d" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125223" "00360" "00102424" "00006" "Familial, autosomal recessive" "" "mild contractres to contractures, MRI typical white matter change MDC1A, fronto-parietal polymicrogyria; no mental retardation; walk(s); ambulant with aid" "<1y" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125224" "00360" "00102425" "00006" "Familial, autosomal recessive" "" "2y-ventilatory support, scoliosis, contractures to severe contractures, 1y-enteral feeding, MRI bilateral occipital micropolygyria, fronto-parietal white matter change, generalised seizures; no mental retardation; bottom shuffle; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125225" "00360" "00102426" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), severe contractures, 5.5y-enteral feeding; no mental retardation; stand(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125226" "00360" "00102427" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres to contractures, feeding problems (incl. bulbar weakness), neonatal seizures, ophthalmoplegia; no mental retardation; walk(s); wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125227" "00360" "00102428" "00006" "Familial, autosomal recessive" "" "no mental retardation; walk; not wheelchair bound" "<6m" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125228" "00360" "00102429" "00006" "Familial, autosomal recessive" "" "early onset, delayed motor milestones; mild contractres, MRI typical white matter change MDC1A, 2.5y-normal echo; CPK: 723-928; no mental retardation; s8m, c15m, w28m; not wheelchair bound" "1y8m" "" "difficulty pullin up to standing" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125229" "00360" "00102430" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), scoliosis, contractures to severe contractures, feeding problems (incl. bulbar weakness), simple partial seizures, 0.4y-normal echo; mild mental retardation; bottom shuffle; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125230" "00360" "00102431" "00006" "Familial, autosomal recessive" "" "7y-ventilatory support, scoliosis, mild contractres to contractures, MRI typical white matter change MDC1A, bilateral occipital patchygyria; mild communication difficulty; ; wheelchair bound" "<1y" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125231" "00360" "00102432" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), contractures, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A, mild cortical atrophy; no mental retardation; stand(s); wheelchair bound" "<6m" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125233" "00360" "00102434" "00006" "Familial, autosomal recessive" "" "ventilatory support, scoliosis, contractures, enteral feeding, ophthalmoplegia; no mental retardation; stand(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125234" "00360" "00102435" "00006" "Familial, autosomal recessive" "" "ventilatory support, scoliosis, mild contractres to contractures, 5y-enteral feeding, MRI typical white matter change MDC1A, 11y-normal echo; no mental retardation; sit; wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125235" "00360" "00102436" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), scoliosis, mild contractres, 9.5y-enteral feeding, MRI typical white matter change MDC1A, 12y-normal echo; no mental retardation; sit; wheelchair bound" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125236" "00360" "00102437" "00006" "Familial, autosomal recessive" "" "12y-ventilatory support, scoliosis, severe contractures, 12y-enteral feeding, WM change, narrow aquaduct, dilated ventricles, thin corpus callosum, 11y-normal echo; no mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125237" "00360" "00102438" "00006" "Familial, autosomal recessive" "" "ventilatory support, scoliosis, mild contractres, 10y-enteral feeding, MRI typical white matter change MDC1A, ophthalmoplegia, wall hypokinesia on echocardiogram; no mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125238" "00360" "00102439" "00006" "Familial, autosomal recessive" "" "scoliosis, contractures, MRI typical white matter change MDC1A, complex partial seizures, 12y-normal echo; no mental retardation; walk(s); ambulant with aid" "<1y" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125239" "00360" "00102440" "00006" "Familial, autosomal recessive" "" "ventilatory support, scoliosis, contractures, 8y-enteral feeding, palpitations, pulmonary hypertention; no mental retardation; stand(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125240" "00360" "00102441" "00006" "Familial, autosomal recessive" "" "12y-ventilatory support, scoliosis, mild contractres to contractures, 15y-enteral feeding, MRI typical white matter change MDC1A, ophthalmoplegia, 14y-normal echo; no mental retardation; stand(s); wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125241" "00360" "00102442" "00006" "Familial, autosomal recessive" "" "17y-ventilatory support, severe contractures, MRI typical white matter change MDC1A; no mental retardation; wheelchair bound" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125242" "00360" "00102443" "00006" "Familial, autosomal recessive" "" "no mental retardation; run; not wheelchair bound" "<1y" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125243" "00360" "00102444" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), scoliosis, mild contractres, feeding problems (incl. bulbar weakness), wall hypokinesia on echocardiogram; no mental retardation; walk; wheelchair bound >10y" "<6m" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125244" "00360" "00102445" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), scoliosis, mild contractres, feeding problems (incl. bulbar weakness), MRI typical white matter change MDC1A, generalised seizures, ophthalmoplegia; no mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125245" "00360" "00102446" "00006" "Familial, autosomal recessive" "" "no mental retardation; walk; not wheelchair bound" "<1y" "" "" "IHC residual LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125246" "00360" "00102447" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), contractures to severe contractures, MRI hydrocephalus later shuntedy; head control; wheelchair bound" "<7d" "" "" "IHC LAMA2 ?" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125247" "00360" "00102448" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), mild contractres, feeding problems (incl. bulbar weakness), MRI symmetrical diffuse leucodystrophy; no mental retardation; sit(s); wheelchair bound" "<7d" "" "" "IHC LAMA2 ?" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125248" "00360" "00102449" "00006" "Familial, autosomal recessive" "" "5y-ventilatory support, mild contractres to contractures, 1.5y-enteral feeding, MRI normal in neonatal period; no mental retardation; sit; wheelchair bound" "<7d" "" "" "IHC LAMA2 ?" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125249" "00360" "00102450" "00006" "Familial, autosomal recessive" "" "ventilatory support, mild contractres to contractures, 4y-enteral feeding; no mental retardation; bottom shuffle; wheelchair bound" "<7d" "" "" "IHC LAMA2 ?" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125250" "00360" "00102451" "00006" "Familial, autosomal recessive" "" "decreased lung capacity (<70%FVC), scoliosis, contractures; no mental retardation; stand(s); wheelchair bound" "<6m" "" "" "IHC LAMA2 ?" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125251" "00360" "00102452" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125252" "00360" "00102455" "00464" "Familial, autosomal recessive" "" "" "" "" "" "IHC LAMA2 deficient" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125253" "00360" "00102456" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125254" "00360" "00102457" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125255" "00360" "00102458" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125256" "00360" "00102459" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125257" "00360" "00102460" "00464" "Familial, autosomal recessive" "" "" "0d" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125258" "00360" "00102461" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125259" "00360" "00102462" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125260" "00360" "00102463" "00464" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125261" "00360" "00102466" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125262" "00360" "00102467" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125263" "00360" "00102468" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125264" "00360" "00102469" "00464" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125265" "00360" "00102470" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125266" "00360" "00102471" "00464" "Familial, autosomal recessive" "" "Polymicrogyria (HP:0002126)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125267" "00360" "00102472" "00464" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125268" "00360" "00102473" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125269" "00360" "00102474" "00464" "Familial, autosomal recessive" "" "muscular hypotonia (HP:0001252)" "" "" "" "muscle, IHC for LAMA2, partial deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125270" "00360" "00102475" "00464" "Familial, autosomal recessive" "" "Global developmental delay (HP:0001263), muscular hypotonia (HP:0001252)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125271" "00360" "00102476" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125272" "00360" "00102477" "00464" "Familial, autosomal recessive" "" "MRI brain suggestive of leukodystrophy; muscle biopsy merosin deficiency; CPK: 3878" "" "" "" "IHC LAMA2 deficient" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125273" "00360" "00102478" "00464" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947) (2y), elevated serum creatine phosphokinase (HP:0003236), Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125274" "00360" "00102479" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125275" "00360" "00102480" "00464" "Familial, autosomal recessive" "" "" "" "" "" "absence of merosin staining in muscle biopsy" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125276" "00360" "00102481" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125277" "00360" "00102482" "00464" "Familial, autosomal recessive" "" "seizures. abnl white matter. cervical spine fusion." "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125278" "00360" "00102483" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125279" "00360" "00102484" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125280" "00360" "00102485" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125281" "00360" "00102486" "00464" "Familial, autosomal recessive" "" "Muscular hypotonia (HP:0001252), elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560)" "" "" "" "merosin deficient muscle biopsy" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125282" "00360" "00102493" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125283" "00360" "00102494" "00006" "Familial, autosomal recessive" "" "muscle biopsy fiber diameter variability, sporadic atrophic/hypertrophic fibers, basophilic fibers (swollen nuclei), endomysial fibrosis close to atrophic fibers, increased type IIC fibers, normal oxidative activity; CPK: 2753-4405 lU (n<210 lU); s2y" "0d" "" "generalized hypotonia, pes adductus equinovarus, wrist contractures" "IHC no LAMA2, normal DMD/SGCA/DAG1" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125284" "00360" "00102495" "00400" "Familial, autosomal recessive" "" "severe and generalized weakness, hypotonia, scoliosis, equinus varus feet, under BIPAP; contractures generalized; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 5080; no mental retardation; no trunk or head control" "0d" "" "generalized hypotonia, areflexia" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125285" "00360" "00102497" "00400" "Familial, autosomal recessive" "" "generalized weakness, no scoliosis, no contractures; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 593; no mental retardation; walk" "02y" "" "generalized hypotonia, areflexia" "IHC LAMA2 partial absence" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125286" "00360" "00102498" "00400" "Familial, autosomal recessive" "" "scoliosis, plagiocephalus; no contractures; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 6987; no mental retardation; assisted trunk control" "00y00m00d" "" "hypotonia, hydronephrosis (left kidney)" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125287" "00360" "00102499" "00400" "Familial, autosomal recessive" "" "muscular weakness with proximal predominance, slight improvement in motor function; contractures elbows/knees/ankles; no seizures; MRI brain no neonatal changes; CPK: 4706; no mental retardation; incomplete head control" "0d" "" "hypotonia, poor spontaneous movements, feeding problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125288" "00360" "00102500" "00400" "Familial, autosomal recessive" "" "muscular weakness with axial/proximal predominance; contractures elbows/knees; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 1700; no mental retardation; sit" "0d" "" "hypotonia, feeding/respiratory problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125289" "00360" "00102501" "00400" "Familial, autosomal recessive" "" "muscular weakness with proximal predominance, hip congenital luxation; contractures knees; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 1770; no mental retardation; head control, assisted trunk control" "0d" "" "hypotonia, feeding problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125290" "00360" "00102502" "00400" "Familial, autosomal recessive" "" "muscular weakness with axial/proximal predominance; contractures knees/ankles; no seizures; MRI brain white matter changes , no gyral abnormalities; CPK: 5530; no mental retardation; no head control" "<0d" "" "generalized hypotonia with proximal predominance, feeding problems" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125291" "00360" "00102503" "00400" "Familial, autosomal recessive" "" "severe muscular weakness with proximal predominance, facial diparesis; contractures knees; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 5615; no mental retardation; sit" "<0d" "" "hypotonia, arthrogryposis (hands and feet)" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125292" "00360" "00102516" "00426" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125293" "00360" "00102534" "00006" "Familial, autosomal recessive" "" "delayed motor development, myopathic face, MRI brain white matter signal intensity changes; CPK elevated" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125294" "00360" "00102535" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125295" "00360" "00102536" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125296" "00360" "00102547" "00464" "Familial, autosomal recessive" "" "Muscle weakness (HP:0001324)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125297" "00360" "00102548" "00464" "Familial, autosomal recessive" "" "" "" "" "" "merosin deficient muscle biopsy" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125298" "00360" "00102549" "00464" "Familial, autosomal recessive" "" "Nystagmus (HP:0000639), Abnormality of the cerebral white matter (HP:0002500), elevated serum creatine phosphokinase (HP:0003236)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125299" "00360" "00102655" "00464" "Familial, autosomal recessive" "" "Muscular dystrophy (HP:0003560) (2y)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125300" "00360" "00102657" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125301" "00360" "00102658" "00464" "Familial, autosomal recessive" "" "elevated serum creatine phosphokinase (HP:0003236)" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125302" "00360" "00102659" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125303" "00360" "00102660" "00464" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125304" "00360" "00102661" "00464" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125305" "00360" "00102663" "00464" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125306" "00360" "00102664" "00527" "Familial, autosomal recessive" "" "severe, looked like possible SMA; scoliosis and respiratory insufficiency, never walked; was quite severe from early infancy; CPK: 270; wasn\'t crawling, never walked" "5y6m" "" "4m" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125307" "00360" "00102665" "01953" "Familial, autosomal recessive" "" "dystrophy, muscular, congenital, merosin-deficient; paediatric assessment at about 6 weeks of age showed reduced movement, central hypotonia and contractures of both the wrists and ankles. Serum creatine kinase levels around this time ranged between 3780 and 5841. A variety of metabolic investigations were normal. An MRI scan at 7 weeks of age demonstrated T2 hyperintense and FLAIR/T1 hypointense white matter changes in the frontal and parietal white matter." "" "1m20d" "6 weeks" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125308" "00360" "00102667" "01715" "Familial, autosomal recessive" "" "Muscular dystrophy, congenital merosin-deficient" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125309" "00360" "00102668" "01715" "Familial, autosomal recessive" "" "Muscular dystrophy, congenital merosin-deficient" "0d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125310" "00360" "00102713" "00006" "Familial, autosomal recessive" "" "" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125311" "00360" "00102714" "00503" "Familial, autosomal recessive" "" "Congenital muscular dystrophy (HP:0003741), hyperintensity of cerebral white matter on MRI (HP:0030890)" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125312" "00360" "00102715" "00006" "Familial, autosomal recessive" "" "" "" "" "" "IHC LAMA2 partial absence" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125313" "00360" "00102716" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125314" "00360" "00102717" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125315" "00360" "00102719" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125316" "00360" "00102720" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125317" "00360" "00102721" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125318" "00360" "00102722" "00006" "Familial, autosomal recessive" "" "" "" "" "" "IHC no LAMA2" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125319" "00360" "00102723" "00503" "Familial, autosomal recessive" "" "Myopathy; epilepsy; Brain MRI: white matter changes" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125320" "00360" "00102727" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125321" "00360" "00102729" "00006" "Familial, autosomal recessive" "" "" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125322" "00360" "00102731" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125323" "00360" "00102732" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125325" "00360" "00102735" "00503" "Familial, autosomal recessive" "" "Muscle weakness (HP:0001324), muscular dystrophy (HP:0003560)" ">03y" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000125326" "00360" "00102736" "00503" "Familial, autosomal recessive" "" "Muscle weakness since infancy" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000125327" "00360" "00102737" "00503" "Familial, autosomal recessive" "" "Brain MRI: white matter changes; IHC LAMA2 partially absent." "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125328" "00360" "00103128" "00503" "Familial, autosomal recessive" "" "hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125329" "00360" "00103129" "00503" "Familial, autosomal recessive" "" "hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125330" "00360" "00103130" "00503" "Familial, autosomal recessive" "" "hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), easy fatigability (HP:0003388)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125331" "00360" "00103131" "00503" "Familial, autosomal recessive" "" "Facial palsy (HP:0010628), elevated serum creatine phosphokinase (HP:0003236)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125332" "00360" "00103189" "00006" "Familial, autosomal recessive" "" "" "" "" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125333" "00360" "00103195" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125334" "00360" "00103206" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125335" "00360" "00103219" "00503" "Familial, autosomal recessive" "" "Poor weight gain (HP:0001508), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), elevated serum creatine phosphokinase (HP:0003236)" "01y" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125336" "00360" "00103220" "00503" "Familial, autosomal recessive" "" "Ophthalmoplegia (HP:0000602), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), elevated serum creatine phosphokinase (HP:0003236), seizures (HP:0001250)" "01y" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125337" "00360" "00103221" "00503" "Familial, autosomal recessive" "" "Ophthalmoplegia (HP:0000602), elevated serum creatine phosphokinase (HP:0003236), seizures (HP:0001250), lumbar scoliosis (HP:0004626), facial weakness (HP:0010628)" "00y02m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125338" "00360" "00103222" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), hyperintensity of cerebral white matter on MRI (HP:0030890), delayed speech and language development (HP:0000750), recurrent pulmonary infections (HP:0006532). No head control" "00y02m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125339" "00360" "00103226" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), respiratory insufficiency due to muscle weakness (HP:0002747), muscular dystrophy (HP:0003560), hyperintensity of cerebral white matter on MRI (HP:0030890), seizures (HP:0001250), lumbar scoliosis (HP:0004626), hip dislocation (HP:0002827). Sits with support, not ambulant." "00y01m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125340" "00360" "00103228" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), hyperintensity of cerebral white matter on MRI (HP:0030890), lumbar scoliosis (HP:0004626), Respiratory insufficiency due to muscle weakness (HP:0002747), hip dislocation (HP:0002827), cardiomyopathy (HP:0001638), facial weakness (HP:0010628). Sits with support, not ambulant." "00y08m" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125341" "00360" "00103229" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), seizures (HP:0001250), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), seizures (HP:0001250), lumbar scoliosis (HP:0004626), hip dislocation (HP:0002827). Sits with support, not ambulant" ">00y09m" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125342" "00360" "00103231" "00503" "Familial, autosomal recessive" "03y" "Elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), axial hypotonia (HP:0008936), EMG: myopathic abnormalities (HP:0003458). Sits with support." "00y06m" "" "Delevolpment delay, hypotonia, feeding difficulties" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125343" "00360" "00103234" "00503" "Familial, autosomal recessive" "" "Gowers sign (HP:0003391), developmental delay (HP:0001263), muscle weakness (HP:0001324)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125344" "00360" "00103247" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125345" "00360" "00103248" "00503" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), epilepsy (HP:0001250), inability to walk (HP:0002540), intellectual disability, mild (HP:0001256)." "00y06m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125346" "00360" "00103249" "00503" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), epilepsy (HP:0001250), inability to walk (HP:0002540), intellectual disability, mild (HP:0002342)." "00y06m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125347" "00360" "00103250" "00503" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), epilepsy (HP:0001250), inability to walk (HP:0002540), intellectual disability, mild (HP:0001256)." "00y04m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125348" "00360" "00103251" "00503" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), inability to walk (HP:0002540), intellectual disability, borderline (HP:0006889)." "00y04m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125349" "00360" "00103252" "00503" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890)." "00y04m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125350" "00360" "00103253" "00503" "Familial, autosomal recessive" "" "Infantile muscular hypotonia (HP:0008947), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), inability to walk (HP:0002540)." "00y05m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125351" "00360" "00103254" "00503" "Familial, autosomal recessive" "" "Severe muscular hypotonia (HP:0006829), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), EMG: myopathic abnormalities (HP:0003458)" "00y09m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125352" "00360" "00103255" "00503" "Familial, autosomal recessive" "06y" "Limb muscle weakness (HP:0003690), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), difficulty walking (HP:0002355)" "00y00m00d" "" "feeding difficulties (HP:0011968), weak cry (HP:0001612), hypokinesia (HP:0002375)" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125353" "00360" "00103256" "00503" "Familial, autosomal recessive" "00y04m" "neonatal hypotonia (HP:0001319), elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890)" "00y00m00d" "" "feeding difficulties (HP:0011968), weak cry (HP:0001612), hypokinesia (HP:0002375)" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125354" "00360" "00103257" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), seizures (HP:0001250)" "00y00m00d" "" "Generalized muscle weakness (HP:0003324), severe muscular hypotonia (HP:0006829)" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125355" "00360" "00103630" "00503" "Familial, autosomal recessive" "04y" "elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), inability to walk (HP:0002540), feeding difficulties (HP:0011968), scoliosis (HP:0002650), joint contracture (HP:0001371), respiratory insufficiency due to muscle weakness (HP:0002747)" "00y01m15d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125356" "00360" "00103631" "00503" "Familial, autosomal recessive" "" "elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), inability to walk (HP:0002540), hyperintensity of cerebral white matter on MRI (HP:0030890), feeding difficulties (HP:0011968), scoliosis (HP:0002650), joint contracture (HP:0001371), respiratory insufficiency due to muscle weakness (HP:0002747)" "" "" "15d" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125357" "00360" "00103632" "00503" "Familial, autosomal recessive" "07y" "elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), Gowers sign (HP:0003391)" "00y01m" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125358" "00360" "00103633" "00503" "Familial, autosomal recessive" "04y" "elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), inability to walk (HP:0002540), hyperintensity of cerebral white matter on MRI (HP:0030890), feeding difficulties (HP:0011968), joint contracture (HP:0001371), respiratory insufficiency due to muscle weakness (HP:0002747)" "00y02m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125359" "00360" "00103634" "00503" "Familial, autosomal recessive" "14y" "elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), inability to walk (HP:0002540), hyperintensity of cerebral white matter on MRI (HP:0030890), feeding difficulties (HP:0011968), scoliosis (HP:0002650), joint contracture (HP:0001371), respiratory insufficiency due to muscle weakness (HP:0002747)" "" "" "1m" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125360" "00360" "00103654" "00503" "Familial, autosomal recessive" "11y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y02m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125361" "00360" "00103655" "00503" "Familial, autosomal recessive" "" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125362" "00360" "00103656" "00503" "Familial, autosomal recessive" "10y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125363" "00360" "00103657" "00503" "Familial, autosomal recessive" "08y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), EMG: decremental response of compound muscle action potential to repetitive nerve stimulation (HP:0003403), seizures (HP:0001250)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125364" "00360" "00103658" "00503" "Familial, autosomal recessive" "" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125365" "00360" "00103659" "00503" "Familial, autosomal recessive" "10y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), EMG: myopathic abnormalities (HP:0003458), seizures (HP:0001250)" "00y04m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125366" "00360" "00103660" "00503" "Familial, autosomal recessive" "05y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)," "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125367" "00360" "00103661" "00503" "Familial, autosomal recessive" "07y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), seizures (HP:0001250)" "00y03m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125368" "00360" "00103662" "00503" "Familial, autosomal recessive" "02y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)," "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125369" "00360" "00103663" "00503" "Familial, autosomal recessive" "06y" "" "00y03m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125370" "00360" "00103664" "00503" "Familial, autosomal recessive" "00y18m" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125371" "00360" "00103665" "00503" "Familial, autosomal recessive" "06y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y04m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125372" "00360" "00103666" "00503" "Familial, autosomal recessive" "08y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125373" "00360" "00103667" "00503" "Familial, autosomal recessive" "07y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), EMG: decremental response of compound muscle action potential to repetitive nerve stimulation (HP:0003403)" "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125374" "00360" "00103668" "00503" "Familial, autosomal recessive" "05y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), scoliosis (HP:0002650), EMG: myopathic abnormalities (HP:0003458)" "00y04m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125375" "00360" "00103669" "00503" "Familial, autosomal recessive" "13y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125376" "00360" "00103726" "00503" "Familial, autosomal recessive" "06y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), decreased nerve conduction velocity (HP:0000762)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125377" "00360" "00103727" "00503" "Familial, autosomal recessive" "05y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), EMG: decremental response of compound muscle action potential to repetitive nerve stimulation (HP:0003403)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125378" "00360" "00103728" "00503" "Familial, autosomal recessive" "03y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125379" "00360" "00103729" "00503" "Familial, autosomal recessive" "07y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), seizures (HP:0001250), scoliosis (HP:0002650)" "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125380" "00360" "00103730" "00503" "Familial, autosomal recessive" ">05y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125381" "00360" "00103731" "00503" "Familial, autosomal recessive" ">06y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), seizures (HP:0001250)" "00y03m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125382" "00360" "00103732" "00503" "Familial, autosomal recessive" ">07y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), scoliosis (HP:0002650), decreased nerve conduction velocity (HP:0000762)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125383" "00360" "00103733" "00503" "Familial, autosomal recessive" "07y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), scoliosis (HP:0002650), seizures (HP:0001250)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125384" "00360" "00103734" "00503" "Familial, autosomal recessive" "03y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125385" "00360" "00103735" "00503" "Familial, autosomal recessive" "04y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125386" "00360" "00103736" "00503" "Familial, autosomal recessive" "03y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), decreased nerve conduction velocity (HP:0000762)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125387" "00360" "00103737" "00503" "Familial, autosomal recessive" "04y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125388" "00360" "00103755" "00503" "Familial, autosomal recessive" "02y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y03m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125389" "00360" "00103760" "00503" "Familial, autosomal recessive" "02y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371, inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125390" "00360" "00103761" "00503" "Familial, autosomal recessive" "03y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), EMG: myopathic abnormalities (HP:0003458)" "00y04m" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125391" "00360" "00103765" "00503" "Familial, autosomal recessive" "04y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371)" "00y05m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125392" "00360" "00103766" "00503" "Familial, autosomal recessive" "02y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "muscle, IHC for LAMA2, normal expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125393" "00360" "00103767" "00503" "Familial, autosomal recessive" "13y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458), scoliosis (HP:0002650)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125394" "00360" "00103768" "00503" "Familial, autosomal recessive" "02y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125395" "00360" "00103772" "00503" "Familial, autosomal recessive" "19y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), loss of ambulation (12y), EMG: myopathic abnormalities (HP:0003458), scoliosis (HP:0002650), seizures (HP:0001250)" "00y04m" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125396" "00360" "00103773" "00503" "Familial, autosomal recessive" "04y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), inability to walk (HP:0002540), EMG: myopathic abnormalities (HP:0003458)" "00y00m00d" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125397" "00360" "00103774" "00503" "Familial, autosomal recessive" "00y18m" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), EMG: myopathic abnormalities (HP:0003458)" "00y03m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125398" "00360" "00103777" "00503" "Familial, autosomal recessive" "12y" "hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), scoliosis (HP:0002650), inability to walk (HP:0002540), seizures (HP:0001250), intellectual disability (HP:0001249)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125399" "00360" "00103778" "00503" "Familial, autosomal recessive" "00y10m" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), seizures (HP:0001250)" "00y00m00d" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125400" "00360" "00103781" "00503" "Familial, autosomal recessive" "01y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890)" "00y04m" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125401" "00360" "00103919" "00503" "Familial, autosomal recessive" "00y14m" "elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125402" "00360" "00105043" "00503" "Familial, autosomal recessive" "06y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), motor delay (HP:0001270)" "00y00m00d" ">06y" "neonatal hypotonia (HP:0001319), muscle weakness (HP:0001324)" "muscle, IHC for LAMA2, partial deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125403" "00360" "00111373" "01164" "Familial, autosomal recessive" "09y" "Laminin-a2-deficiency in muscle biopsy" "" "07y" "" "muscle, IHC for LAMA2, deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125404" "00360" "00111374" "01164" "Familial, autosomal recessive" "02y" "congenital muscle dystrophy, a biopsy confirmed merosin deficiency (MDC1A)" "00y" "" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125405" "00360" "00111375" "01164" "Familial, autosomal recessive" "02y" "Congenital muscular dystrophy, merosin deficiency" "00y" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125406" "00360" "00111376" "01164" "Familial, autosomal recessive" "02y" "confirmed congenital muscular dystrophy with merosin deficiency, loss of laminin-a2-expression" "00y" "03y" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125407" "00360" "00111377" "01164" "Familial, autosomal recessive" "02y" "congenital muscular dystrophy, type 1a, merosin deficiency" "00y" "02y" "" "muscle, IHC for LAMA2, no expression" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125408" "00360" "00111379" "01164" "Isolated (sporadic)" "45y" "Myopathy, polyneuropathy, asymptomatic leukoencephalopathy" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000125409" "00360" "00131883" "01164" "Familial, autosomal recessive" "00y02m" "congenital muscular dystrophy, merosin (laminin-alfa2 deficiency confirmed by immunohistochemistry" "" "" "" "muscle, IHC for LAMA2, deficient" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125410" "00360" "00131976" "02274" "Familial, autosomal recessive" "" "Muscle weakness (HP:0001324) (since birth), elevated serum creatine phosphokinase (HP:0003236), loss of ability to walk (HP:0006957) (9y)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125411" "00360" "00132007" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125412" "00360" "00132010" "02274" "Familial, autosomal recessive" "" "elevated serum creatine phosphokinase (HP:0003236), progressive proximal muscle weakness (HP:0009073)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125413" "00360" "00132011" "02274" "Familial, autosomal recessive" "" "Abnormality of the cerebral white matter (HP:0002500), elevated serum creatine phosphokinase (HP:0003236), muscle weakness (HP:0001324) (generalized)" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, congenital" "" "0000125414" "00360" "00036041" "01164" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000125416" "05121" "00102163" "00006" "Isolated (sporadic)" "" "dystrophy, muscular; 32y-difficulty getting up from floor/climbing stairs/holding heavy weights, severe contractures neck/arm muscles preventing head rotation/bending39y-mild limb-girdle weakness; CPK: 4x" "15y" "" "difficulty running/jumping" "IHC LAMA2 partially positive" "" "" "" "" "" "dystrophy, muscular" "" "0000125417" "05121" "00102209" "00400" "Isolated (sporadic)" "" "slowly progressive spastic paraparesis; no contractures; no seizures; MRI brain white matter changes, no gyral abnormalities; CPK: 838; slight mental retardation; spastic gait" "03y" "" "Spastic paraparesis" "IHC LAMA2 partial absence" "" "" "" "" "" "dystrophy, muscular" "" "0000125418" "05121" "00102326" "01416" "Unknown" "" "dystrophy, muscular, congenital" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125419" "05121" "00102341" "00006" "Isolated (sporadic)" "" "dystrophy, muscular; difficulty walking, congenital bilateral hip dislocation; CPK: 2x" "" "" "" "IHC LAMA2 partially positive" "" "" "" "" "" "dystrophy, muscular" "" "0000125420" "05121" "00102517" "00006" "Isolated (sporadic)" "" "dystrophy, muscular; muscular dystrophy Becker/limb-girdle like" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125421" "00360" "00102718" "00006" "Unknown" "" "" "" "" "" "IHC LAMA2 partially absent" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000125422" "05121" "00102724" "00503" "Familial" "41y" "dystrophy, muscular, limb-girdle; gait mild valgus posture both feet, reflexes sluggish, no muscle pseudohypertrophy/wasting; muscle biopsy overtly dystrophic; 7y-Gowersí manoeuvre; CPK: 4025-4621 UI/L; s7m, w23m" "30y?" "" "Walking and limb movement disabilities" "normal LAMA2 IHC" "" "" "" "" "" "dystrophy, muscular" "" "0000125423" "05121" "00102725" "00503" "Familial" "49y" "running difficulties since his thirties, progressive lower limb weakness.\r\n• Brain MRI: white matter changes.\r\n• Noticed upper limb weakness 10yrs later.\r\n• Paresis (4/5 grade) proximal in upper limbs, distal and proximal in lower limbs.\r\n• Paresis of trunk and neck flexion (grade 2 and 4+, respectively).\r\n• Lordosis and myopathic gait with slight steppage." "30y?" "" "Running difficulties" "IHC no LAMA2 changes" "" "" "" "" "" "dystrophy, muscular" "" "0000125425" "05121" "00102734" "00503" "Isolated (sporadic)" "70y" "gait impairment since youth, stable throughout life.\r\n•Initially investigated with the suspicion of LGMD, but without specific etiology.\r\n•Proximal tetraparesis(grade 4/5,\r\n4-/5 in lower limbs).\r\n•Currently unable to walk independently (wheelchair-bound).\r\n•Moderate intellectual disability (dementia over the last 2 yrs).\r\n•Brain MRI: white matter changes." "" "" "Gait impairment" "normal LAMA2 IHC" "" "" "" "" "" "dystrophy, muscular" "" "0000125426" "05121" "00103126" "00503" "Isolated (sporadic)" "55y" "Delayed gross motor development (HP:0002194), proximal muscle weakness (HP:0003701), difficulty running (HP:0009046), frequent falls (HP:0002359), gowers sign (HP:0003391), spinal rigidity (HP:0003306), hyperintensity of cerebral white matter on MRI (HP:0030890), EMG: myopathic abnormalities (HP:0003458), abnormal cardiac ventricular function (HP:0030872), muscular dystrophy (HP:0003560)" ">02y" "" "Difficulty running" "IHC LAMA2 partially absent" "" "" "" "" "" "dystrophy, muscular" "" "0000125428" "05121" "00103245" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), muscular dystrophy (HP:0003560), hyperintensity of cerebral white matter on MRI (HP:0030890), generalized tonic-clonic seizures (HP:0007334) (22y), difficulty walking (HP:0002355), distal muscle weakness (HP:0002460), spastic gait (HP:0002064), inability to walk (HP:0002540) (28y), bilateral myopia (HP:0000545). Slightly increased calf bulk, and bilateral pes cavus without muscle wasting. Bilateral predominantly right-sided pyramidal and cerebellar syndrome. Cognitive functions were normal." "18y" "" "Exercise-induced walking difficulties, mainly due to a left-side footdrop" "muscle, IHC for LAMA2, normal expression" "" "" "" "" "" "dystrophy, muscular" "" "0000125429" "05121" "00103324" "00503" "Isolated (sporadic)" "" "Motor delay (HP:0001270), decreased patellar reflex (HP:0011808), pes cavus (HP:0001761), wasting of thigh muscle (HP:0008956), calf muscle hypertrophy (HP:0008981), elevated serum creatine phosphokinase (HP:0003236),hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), rimmed vacuoles (HP:0003805)" "" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular" "" "0000125430" "05121" "00103325" "00503" "Isolated (sporadic)" "38y" "Elevated serum creatine phosphokinase (HP:0003236), proximal muscle weakness in lower limbs (HP:0008994) and upper limbs (HP:0008997), joint contracture (HP:0001371), calf muscle hypertrophy (HP:0008981), dilated cardiomyopathy (HP:0001644)" "10y" "" "Exercise-induced myalgia (HP:0003738), tip-toe gait (HP:0030051)" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular" "" "0000125431" "05121" "00103326" "00503" "Isolated (sporadic)" "32y" "Elevated serum creatine phosphokinase (HP:0003236), proximal muscle weakness in lower limbs (HP:0008994) and upper limbs (HP:0008997), axial muscle weakness (HP:0003327), joint contracture (HP:0001371), polymicrogyria (HP:0002126), lissencephaly (HP:0001339), follicular hyperkeratosis (HP:0007502)" "00y00m00d" "" "Severe muscular hypotonia (HP:0006829)" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular" "" "0000125432" "05121" "00103949" "00503" "Familial" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125434" "05121" "00103951" "00503" "Familial" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125435" "05121" "00103952" "00503" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125436" "05121" "00103969" "00503" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125437" "05121" "00103970" "00503" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125438" "05121" "00103971" "00503" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125440" "05121" "00103973" "00503" "Familial, autosomal recessive" "" "Elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560)" "" "" "Motor delay (HP:0001270)" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular" "" "0000125441" "05121" "00131941" "00503" "Isolated (sporadic)" "" "" "" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular" "" "0000125442" "05121" "00132014" "02274" "Unknown" "" "Muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125443" "00360" "00132016" "02274" "Unknown" "" "Muscle weakness (HP:0001324)" "" "" "" "muscle, IHC for LAMA2, partial deficiency" "" "" "" "" "MDC-1A" "dystrophy, muscular, LAMA2-related, late onset" "" "0000125444" "05126" "00102197" "00006" "Isolated (sporadic)" "" "gait mild valgus posture both feet, reflexes sluggish, no muscle pseudohypertrophy/wasting; muscle biopsy overtly dystrophic; 7y-Gowersí manoeuvre; CPK: 4025-4621 UI/L; s7m, w23m" "1y11m" "" "" "IHC reduced LAMA2, DMD normal" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125445" "05126" "00102340" "00006" "Isolated (sporadic)" "" "23m-waddling gait, difficulty pulling to stand, no calf pseudohypertrophy/joint tightness, reflexes present but difficult to elicit; EMG myopathic features; 2y-muscle biopsy unequivocal dystrophic picture; 4y-Gowersí manoeuvre, mild iliotibial band tightness, no tendo-Achilles contractures; 11y-mild contractures tendo-Achilles/long finger flexors; CPK: 4400 UI/L; h4m, s7m, w18m" "1y10m" "" "frequent falls, waddling gait, difficulty rising floor" "IHC reduced LAMA2, DMD normal" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125446" "05126" "00102519" "00006" "Unknown" "" "CPK: 655; IQ low normal; walk" "1y2m" "" "waddling gait, frequent falls" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125447" "05126" "00102520" "00006" "Unknown" "" "CPK: 309; no mental retardation; walk" "23y" "" "cramps, difficulty running" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125448" "05126" "00102521" "00006" "Unknown" "" "CPK: 405; walk" "40y" "" "slight impairment climbing stairs" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125449" "05126" "00102522" "00006" "Unknown" "" "CPK: 1053; no mental retardation; walk" "10y" "" "epilepsy" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125450" "05126" "00102523" "00006" "Unknown" "" "CPK: 859; walk" "59y" "" "difficulty climbing stairs" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125451" "05126" "00102541" "00426" "Familial, autosomal recessive" "" "calve hypertrophy; functional grade 3; CPK: 4062; wheelchair bound >22y" "12y" "" "" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125452" "05126" "00102543" "00426" "Familial, autosomal recessive" "" "calve hypertrophy; functional grade 4; CPK: 5675; wheelchair bound >15y" "7y" "" "" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125453" "05126" "00103246" "00503" "Isolated (sporadic)" "" "Elbow, knee and neck contractures" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125456" "05126" "00103268" "00503" "Isolated (sporadic)" "" "Elevated serum creatine phosphokinase (HP:0003236), deep cerebral white matter hyperdensities (HP:0030892), muscular dystrophy (HP:0003560), kyphosis (HP:0002808), limb-girdle muscle weakness (HP:0003325), demyelinating peripheral neuropathy (HP:0007108), Elbow flexion contracture (HP:0002987)" "" "" ">5y" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125457" "05126" "00103635" "00503" "Unknown" "69y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), Gowers sign (HP:0003391), myopathic features in muscle biopsy" "56y" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125458" "05126" "00103636" "00503" "Unknown" "32y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), joint contracture (HP:0001371), Gowers sign (HP:0003391)" "01y" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125459" "05126" "00103637" "00503" "Unknown" "54y" "elevated serum creatine phosphokinase (HP:0003236), hyperintensity of cerebral white matter on MRI (HP:0030890), muscular dystrophy (HP:0003560), Gowers sign (HP:0003391)" "10y" "" "" "muscle, IHC for LAMA2, residual expression" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125460" "05126" "00103974" "00503" "Unknown" "" "Scapular winging (HP:0003691), distal muscle weakness (HP:0002460), skeletal muscle hypertrophy (HP:0003712)" "08y" "" "" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125461" "05126" "00103975" "00503" "Unknown" "" "elevated serum creatine phosphokinase (HP:0003236), joint contracture (HP:0001371), distal muscle weakness (HP:0002460), neck flexor weakness (HP:0003722)" "02y" "" "" "" "" "" "" "" "" "dystrophy, muscular, limb-girdle" "" "0000125462" "00360" "00036033" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125463" "00360" "00036034" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125464" "00360" "00036035" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125465" "00360" "00036036" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125466" "00360" "00036037" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125467" "00360" "00036038" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125468" "00360" "00036042" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125469" "00360" "00036043" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125470" "00360" "00036044" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125471" "00360" "00036045" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125472" "00360" "00036046" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125473" "00360" "00036050" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125474" "00360" "00036051" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125475" "00360" "00036053" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125476" "00360" "00036054" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125477" "00360" "00036055" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative" "" "0000125478" "05121" "00036040" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125479" "05121" "00036047" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular" "" "0000125480" "00360" "00036052" "01164" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dystrophy, muscular, congenital, merosin negative, suspected" "" "0000130035" "05126" "00165139" "02521" "Familial, autosomal recessive" "29y" "LGMD with pelvic femoral predominance and cerebral MRI white matter abnormalities" "19y" "41y" "recurrent falls" "" "" "" "" "" "LGMD related to LAMA2 mutations" "LGMD" "" "0000154673" "01617" "00000054" "00006" "Familial, autosomal recessive" "" "see paper; …" "" "" "" "" "" "" "" "" "ABL" "abetalipoproteinaemia" "" "0000156339" "01926" "00036041" "01164" "Unknown" "" "Muscular Dystrophy, no further information" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000157199" "03282" "00208524" "03127" "Familial, autosomal recessive" "14y" "muscular dystrophy; gross motor developmental delay; severe scoliosis, limb-girdle muscular dystrophy; White mater abnormality" "" "14y" "14y" "" "" "" "" "" "MDC1A" "metachromatic leukodystrophy" "" "0000157373" "00198" "00208755" "01164" "Unknown" "" "HP:0003198 (Myopathy); HP:0003457 (EMG abnormality)" "" "" "" "" "" "" "" "" "" "" "" "0000171323" "00360" "00183389" "00006" "Familial, autosomal recessive" "" "onset juvenile, epilepsy, mild scapula winging, no muscle weakness, elevated CPK (20x), biopsy dystrophic features" "" "" "" "LAMA2 partial deficiency (80/300 kD)" "" "" "" "" "" "epilepsy" "" "0000171324" "00360" "00183390" "00006" "Familial, autosomal recessive" "" "psychomotor delay, no muscle weakness, no elevated CPK, autism" "00y00m01d" "" "psychomotor delay" "" "" "" "" "" "" "psychomotor delay" "" "0000171325" "00360" "00183391" "00006" "Familial, autosomal recessive" "" "onset juvenile, distal muscle weakness, slight bilateral scapula winging, positive Gowers sign, mild waddling gait, slight atrophy (right more than left upper > lower limbs), elevated CPK (6-10x), EMG myopathic, mild pectus excavatum" "" "" "" "" "" "" "" "" "" "distal muscle weakness" "" "0000171326" "00360" "00183392" "00006" "Familial, autosomal recessive" "" "juvenile onset, difficulty walking, muscle weakness lower limbs, elevated CPK (10x), respiratory function 0.72 (2400mL)" "" "" "" "" "" "" "" "" "" "difficulty walking" "" "0000203279" "00360" "00265482" "00006" "Familial, autosomal recessive" "1y" "high CK, severe muscle weakness" "" "" "" "" "" "" "" "" "LGMDR-23" "CMD" "" "0000207665" "00360" "00269868" "03524" "Unknown" "" "Spinal rigidity HP:0003306\r\nJoint laxity HP:0001388\r\nRespiratory insufficiency HP:0002093" "" "" "" "" "" "" "" "" "" "" "" "0000209257" "05126" "00274312" "00006" "Familial, autosomal recessive" "" "elevated CK level (30.000); no cardiac/respiratory complications; non-ambulatory" "2y" "" "" "" "" "" "" "" "" "LGMD" "" "0000221835" "05378" "00288102" "00006" "Familial, autosomal recessive" "" "0.6y-muscle weakness, muscular hypotonia, motor delay, dysphagia, weak cry; CK 2,594 U/L; EMG myopathic abnormalities" "" "" "" "" "" "" "" "" "MDC1A" "BMD/DMD" "" "0000221836" "05378" "00288103" "00006" "Familial, autosomal recessive" "" "0.4y-muscle weakness, muscular hypotonia, motor delay, dysphagia, weak cry; CK 2,391 U/L; EMG myopathic abnormalities" "" "" "" "" "" "" "" "" "MDC1A" "BMD/DMD" "" "0000222605" "01959" "00288970" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "CFTD" "CFTD" "" "0000222622" "05126" "00288987" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "LGMD" "" "0000222641" "05126" "00289006" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "LGMD" "" "0000222922" "00198" "00289291" "01164" "Unknown" "" "Leukoencephalopathy (HP:0002352); Limb-girdle muscle weakness (HP:0003325)" "" "" "" "" "" "" "" "" "" "" "" "0000223205" "00198" "00295641" "01164" "Unknown" "" "Global developmental delay (HP:0001263); Myopathic facies (HP:0002058); Myotonia (HP:0002486); Ptosis (HP:0000508); Intellectual disability (HP:0001249); Leukoencephalopathy (HP:0002352); Abnormality of the hairline (HP:0009553); Muscle weakness (HP:0001324); Elevated serum creatine phosphokinase (HP:0003236)" "" "" "" "" "" "" "" "" "" "" "" "0000228715" "05652" "00301610" "03678" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000231634" "05126" "00305788" "00006" "Unknown" "43y" "severe (MRC grade <3/5); lower limbs more severe than upper limbs; distal weakness; hypertrophy; scapular winging; elevated serum CK (max. 1190 IU/L); biopsy dystrophic; multi-core; mitochondrial dysfunction;  " "8y" "" "" "IHC DMD absent/reduced  " "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000231652" "05126" "00305806" "00006" "Unknown" "7y" "severe (MRC grade <3/5); lower limbs more severe than upper limbs; distal weakness; neck flexor weakness (HP:0003722); contractures; elevated serum CK (max. 1358 IU/L); biopsy myopathic; inflammation" "2y" "" "" "   " "" "" "" "" "" "limb-girdle muscular dystrophy" "" "0000233375" "00139" "00307952" "00006" "Familial, autosomal recessive" "11y1m" "see paper; ..., Global developmental delay, Neonatal hypotonia, Nephrotic syndrome, Plagiocephaly, Open bite, Scoliosis, Cafe-au-lait spot, Areflexia" "" "" "" "" "" "" "" "" "" "intellectual diability" "" "0000235205" "00198" "00309888" "01164" "Unknown" "" "Muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "" "" "" "0000238088" "05126" "00313767" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000242324" "04172" "00320296" "00006" "Unknown" "" "survived sudden cardiac arrest" "" "" "" "" "" "" "" "" "" "cardiomyopathy" "" "0000243898" "00198" "00325411" "00006" "Familial, autosomal recessive" "" "1m15d-onset seizures; severe global developmental delay" "" "2y" "" "" "" "" "" "" "" "hypotonia, seizures; focal seizures" "" "0000257011" "00139" "00361606" "00006" "Familial, autosomal recessive" "8y" "syndromic; intellectual disability, spina bifida occulta, asthma" "" "" "" "" "" "" "" "" "" "intellectual disability" "" "0000257315" "05126" "00361917" "04047" "Familial, autosomal recessive" "" "Muscle weakness HP:0001324" "" "" "" "" "" "" "" "" "" "" "" "0000269573" "00198" "00374363" "00006" "Familial, autosomal recessive" "" "Developmental delay, partially achieved milestones and global hypotonia, EMG findings were indicative of myopathy" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000269574" "00198" "00374364" "00006" "Familial, autosomal recessive" "" "Features suggestive of MD-CMD" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269575" "00198" "00374365" "00006" "Familial, autosomal recessive" "" "Motor developmental delay, decreased muscle tone in upper limbs and had a history of difficulty in feeding and apnoea" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269576" "00198" "00374366" "00006" "Familial, autosomal recessive" "" "Merosin negative congenital muscular dystrophy and delayed motor milestones. Electromyography suggests mild myopathic pattern" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269577" "00198" "00374367" "00006" "Familial, autosomal recessive" "" "Features suggestive of MD-CMD" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269578" "00198" "00374368" "00006" "Familial, autosomal recessive" "" "Significant motor delay, good higher mental functions and cognition" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269579" "00198" "00374369" "00006" "Familial, autosomal recessive" "" "Developmental delay, inability to walk or sit without support, pigmented sparse hair, hypotonia and pyloric stenosis" "" "" "" "" "" "" "" "" "" "developmental delay" "" "0000269580" "00198" "00374370" "00006" "Familial, autosomal recessive" "" "Developmental delay and paucity of movements of all four limbs" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269581" "00198" "00374371" "00006" "Familial, autosomal recessive" "" "Global developmental delay, motor delay and features suggestive of congenital muscular dystrophy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269582" "00198" "00374372" "00006" "Familial, autosomal recessive" "" "Delayed motor development, hypotonia, muscle wasting, macrocephaly, joint contractures and myopathic facies. MRI suggestive of leukodystrophy" "" "" "" "" "" "" "" "" "" "muscular dystrophy, leukodystrophy" "" "0000269583" "00198" "00374373" "00006" "Familial, autosomal recessive" "" "Gross motor delay and muscular dystrophy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269584" "00198" "00374374" "00006" "Familial, autosomal recessive" "" "Gross motor delay and increased CPK. Brain MRI and muscle biopsy were suggestive of MD-CMD" "" "" "" "" "" "" "" "" "" "merosin-deficient congenital muscular dystrophy" "" "0000269585" "00198" "00374375" "00006" "Familial, autosomal recessive" "" "Features suggestive of muscular dystrophy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000269911" "00198" "00374701" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000270425" "00198" "00375215" "01164" "Unknown" "" "Muscle weakness (HP:0001324)" "" "" "" "" "" "" "" "" "" "" "" "0000271636" "00352" "00376428" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000274630" "00360" "00380777" "00000" "Familial" "" "MD; elevated CK (Neurological)" "" "" "" "" "" "" "" "" "Congenital muscular dystrophy, merosin-deficient" "" "" "0000278346" "02717" "00384562" "04175" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000280295" "00198" "00386489" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000282213" "00244" "00388673" "00006" "Familial, autosomal recessive" "40y" "proximal muscle weakness; CK level 9083 IU/L; difficulty getting up from ground; Winging of scapula, calf hypertrophy; Mild upper and lower girdle weakness" "36y" "" "" "" "" "" "" "" "" "" "" "0000282231" "00244" "00388691" "00006" "Familial, autosomal recessive" "24y" "proximal muscle weakness; CK level 10500 IU/L; Difficulty running, change in gait, wasting of calves, biceps lump; Most-affected muscles: Gastrocnemius, Iliopsoas, hip adductors, hamstrings and quadriceps; no cardiac involvement; 24y-ambulant" "19y" "" "" "IHC no DYSF" "" "" "" "" "" "" "" "0000285225" "05324" "00391935" "03501" "Unknown" "9y" "Gowers sign (HP:0003391), difficulty climbing stairs (HP:0003551)" "3y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285226" "05324" "00391936" "03501" "Unknown" "23y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), difficulty climbing stairs (HP:0003551)" "15y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285228" "05324" "00391938" "03501" "Unknown" "2y" "Gowers sign (HP:0003391), frequent falls (HP:0002359), difficulty climbing stairs (HP:0003551)" "1d" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285230" "05324" "00391940" "03501" "Unknown" "4y" "proximal muscle weakness (HP:0003701), difficulty climbing stairs (HP:0003551)" "2y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285232" "05324" "00391942" "03501" "Unknown" "6y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), difficulty climbing stairs (HP:0003551), frequent falls (HP:0002359)" "4y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285251" "05324" "00391961" "03501" "Unknown" "5y" "Gowers sign (HP:0003391), frequent falls (HP:0002359), difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), waddling gait (HP:0002515), proximal muscle weakness (HP:0003701)" "4y" "" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000285287" "05324" "00391997" "03501" "Unknown" "21y" "calf muscle hypertrophy (HP:0008981), Gowers sign (HP:0003391), frequent falls (HP:0002359), difficulty climbing stairs (HP:0003551), difficulty walking (HP:0002355), waddling gait (HP:0002515), proximal muscle weakness (HP:0003701), toe walking (HP:0040083)" "06y" "12y" "" "" "" "" "" "" "muscular dystrophy" "DMD" "" "0000290896" "05121" "00397769" "00006" "Familial, autosomal recessive" "9y" "" "" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000292080" "05618" "00398992" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000292082" "05618" "00398994" "00006" "Unknown" "" "muscle biopsy dystrophic pattern; axial and peripheral hypotonia" "1d" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000292112" "05618" "00399024" "00006" "Unknown" "" "serum CK 2286 U/L; muscle biopsy dystrophic pattern, partial merosin deficiency" "18m" "" "" "" "" "" "" "" "" "LAMA2-related congenital muscular dystrophy" "" "0000292165" "05618" "00399077" "00006" "Unknown" "" "serum CK 3500U/L; muscle biopsy dystrophic pattern; muscle weakness" "<1m" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000292180" "05618" "00399092" "00006" "Unknown" "" "serum CK 2400 U/L; muscle biopsy dystrophic pattern, partial merosin deficiency" "18m" "" "" "" "" "" "" "" "" "LAMA2-related congenital muscular dystrophy" "" "0000303317" "04214" "00411241" "00000" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303360" "02717" "00411284" "03320" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "MDC1A" "Merosin deficient muscular dystrophy" "" "0000303615" "04214" "00411587" "00000" "Familial, autosomal dominant" "35y7m" "current best corrected visual acuity right, left eye: 20/20 OU, 20/20; manifest refraction: -0.75 + 0.75 x 155, -0.75 + 0.75 x 055; Goldmann perimetry results: Superior loss with Island; reduction scotopic dim flash electroretinogram,%: 35.4; fundus findings: bone spicule-like pigmentation and atrophy in inferior and nasal distributions of midperiphery" "23y" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303911" "04214" "00411884" "00000" "Familial, autosomal dominant" "6y" "best corrected visual acuity right, left eye: 20/63,20/100; refraction: +1; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 53; electroretinogram amplitude rod b-Wave: not detectable; cone flicker: 4" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000303923" "04214" "00411896" "00000" "Familial, autosomal dominant" "44y" "best corrected visual acuity right, left eye: 20/20; refraction: -0.75; kinetic visual field extent (V-4e) - percentage of normal mean of V-4e target; 2 SD below normal equals 90%; average both eyes; similar in the two eyes unless specified: 93; electroretinogram amplitude rod b-Wave: 55; cone flicker: 81" "" "" "" "" "" "" "" "" "retinitis pigmentosa" "" "" "0000306499" "04214" "00414704" "00000" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "galactosemia" "" "" "0000307324" "05121" "00415543" "00006" "Familial, autosomal recessive" "" "congenital muscular dystrophy, suspected merosin deficiency" "" "" "" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000307325" "00360" "00415544" "00006" "Unknown" "" "congenital muscular dystrophy, suspected merosin deficiency" "" "" "" "" "" "" "" "" "" "congenital muscular dystrophy" "" "0000308417" "05652" "00416905" "01164" "Unknown" "02y" "Elevated circulating creatine kinase concentration, Proximal muscle weakness, Hyporeflexia, Seizure; (CK elevation as incidental finding in clarification after seizure, differential diagnosis aspiration event/bolus event. Values between 800 and 1000 U/L, mild proximal muscle weakness, hypo-/reflexia.)" "" "" "" "" "" "" "" "" "" "" "" "0000317635" "00360" "00426480" "00006" "Familial, autosomal recessive" "3m" "3m-died severe pneumonia; no head control; recurrent respiratory tract infection, severe pneumonia; no intellectual disability, no seizures" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317636" "00360" "00426481" "00006" "Familial, autosomal recessive" "6m" "no head control; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 18d-3761 U/L; EMG 1m-myopathic changes, reduced motor nerve compound muscle action potential amplitude; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317637" "00360" "00426482" "00006" "Familial, autosomal recessive" "8m" "8m-died severe pneumonia; no head control; no motor regression; contractures ankle; no spinal deformity; recurrent respiratory tract infection, severe pneumonia; no intellectual disability, no seizures" "1m" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317638" "00360" "00426483" "00006" "Familial, autosomal recessive" "8m" "no head control; no motor regression; contractures ankle; no spinal deformity; no respiratory involvement; ECG sinus tachycardia; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5m-3159 U/L; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317639" "00360" "00426484" "00006" "Familial, autosomal recessive" "8m" "6m-head control; no motor regression; contractures knee, ankle; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram 1m-atrial septal defect; 1d-feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3d-26570 U/L; MRI brain 5d-normal" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317640" "00360" "00426485" "00006" "Familial, autosomal recessive" "9m" "9m-sit; no contractures; no spinal deformity; 1d-feeding difficulty; no intellectual disability, no seizures; raised serum CK highest 3m-5354 U/L; EMG myopathic changes; MRI brain 4m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317641" "00360" "00426486" "00006" "Familial, autosomal recessive" "9m" "9m-died severe pneumonia; no head control; recurrent respiratory tract infection, severe pneumonia; no intellectual disability, no seizures" "3m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317642" "00360" "00426487" "00006" "Familial, autosomal recessive" "1.0y" "1y-died following severe pneumonia; 11m-sit; contractures knee; no spinal deformity; recurrent respiratory tract infection, severe pneumonia; no intellectual disability, no seizures; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317643" "00360" "00426488" "00006" "Familial, autosomal recessive" "1.0y" "7m-head control, 8m-sit; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG sinus tachycardia; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 7m-2155 U/L; EMG 7m-myopathic changes; MRI brain 7m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317644" "00360" "00426489" "00006" "Familial, autosomal recessive" "1.2y" "5m-head control, 8m-sit; no motor regression; contractures knee, ankle; no spinal deformity; recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram 4m-patent foramen ovale; no feeding difficulty; regular rehabilitation; intellectual disability, no seizures; raised serum CK highest 4m-3600 U/L; EMG 4m-myopathic changes; MRI brain 4m-focal changes" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317645" "00360" "00426490" "00006" "Familial, autosomal recessive" "1.3y" "9m-head control, 1y-sit; no motor regression; contractures knee, hip; no spinal deformity; no feeding difficulty; intellectual disability, no seizures; raised serum CK highest 1.5y-1807 U/L; EMG myopathic changes, reduced motor nerve conduction velocity; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317646" "00360" "00426491" "00006" "Familial, autosomal recessive" "1.3y" "4m-head control; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram 1m-patent ductus arteriosus; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-57985 U/L" "5m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317647" "00360" "00426492" "00006" "Familial, autosomal recessive" "1.4y" "1.4y-head control, 7m-sit; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 10m-5536 U/L; EMG 10m-reduced motor nerve conduction velocity; MRI brain 10m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317648" "00360" "00426493" "00006" "Familial, autosomal recessive" "1.5y" "8m-head control, 1.3y-sit; no motor regression; no contractures; no spinal deformity; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; 1d-feeding difficulty; regular rehabilitation; intellectual disability, no seizures; raised serum CK highest 1d-87452 U/L; MRI brain 1.5y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317649" "00360" "00426494" "00006" "Familial, autosomal recessive" "1.5y" "1y6m-died severe pneumonia; 5m-head control, 1y-sit; contractures ankle; no spinal deformity; recurrent respiratory tract infection, severe pneumonia; no feeding difficulty; no intellectual disability, no seizures; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317650" "00360" "00426495" "00006" "Familial, autosomal recessive" "1.6y" "no head control; no motor regression; contractures ankle; no spinal deformity; no respiratory involvement; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-6567 U/L; EMG myopathic changes; MRI brain 6m-abnormal white matter hyperintensities" "3m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317651" "00360" "00426496" "00006" "Familial, autosomal recessive" "1.7y" "3m-head control, 1y-sit; no motor regression; contractures knee, hip; no spinal deformity; ECG right bundle branch block; normal ultrasonic cardiogram; constipation; intellectual disability, no seizures; raised serum CK highest 1.7y-2493 U/L; EMG myopathic changes; MRI brain 7m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317652" "00360" "00426497" "00006" "Familial, autosomal recessive" "1.8y" "6m-head control, 1.5y-sit; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram 8m-atrial septal defect; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-26909 U/L; MRI brain 9d-focal changes; 1d-hypoglycaemia, pectus excavatum, dislocation of hip" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317653" "00360" "00426498" "00006" "Familial, autosomal recessive" "1.9y" "3m-head control, 9m-sit, 1.5y-walk; no motor regression; no spinal deformity; no feeding difficulty; no intellectual disability, no seizures; raised serum CK highest 2y-1978 U/L; EMG myopathic changes" "6m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317654" "00360" "00426499" "00006" "Familial, autosomal recessive" "2.0y" "3m-head control, 1y-sit; no motor regression; contractures elbow, hip; no spinal deformity; 1d-respiratory difficulty; 1d-feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-1200 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities; 2d-mechanical ventilation; pectus excavatum" "1d" "" "muscle weakness, hypotonia, feeding difficulty, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317655" "00360" "00426500" "00006" "Familial, autosomal recessive" "2.0y" "1y-head control, 1y-sit; no motor regression; contractures knee, ankle; no spinal deformity; no feeding difficulty; intellectual disability, no seizures; raised serum CK highest 1y-1246 U/L; EMG myopathic changes, reduced motor nerve conduction velocity; MRI brain 1.8y-abnormal white matter hyperintensities, occipital pachygyria; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry" "2y-IHC weak LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317656" "00360" "00426501" "00006" "Familial, autosomal recessive" "2.5y" "2y6m-died severe pneumonia; no head control; no motor regression; contractures knee; no spinal deformity; recurrent respiratory tract infection, severe pneumonia; normal ultrasonic cardiogram; 1d-feeding difficulty; no intellectual disability, no seizures; raised serum CK highest 2m-4404 U/L; EMG reduced motor nerve conduction velocity; MRI brain 2m-normal; pectus excavatum" "1d" "" "muscle weakness, hypotonia weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317657" "00360" "00426502" "00006" "Familial, autosomal recessive" "2.7y" "7m-head control, 10m-sit; no motor regression; contractures knee, ankle; no spinal deformity; no respiratory involvement; difficulty chewing; no intellectual disability, no seizures; raised serum CK highest 10m-3148 U/L; MRI brain 6m-abnormal white matter hyperintensities; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317658" "00360" "00426503" "00006" "Familial, autosomal recessive" "2.8y" "4m-head control, 11m-sit; no motor regression; contractures knee, elbow; 2.3y-scoliosis; recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram 1m-patent foramen ovale; constipation, difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1m-5430 U/L; MRI brain 1m-normal, 17m-abnormal white matter hyperintensities; dislocation hip, pectus excavatum" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317659" "00360" "00426504" "00006" "Familial, autosomal recessive" "3.1y" "4m-head control, 1.5y-sit; no motor regression; contractures knee, ankle, elbow; no spinal deformity; no respiratory involvement; ECG 2m-sinus tachycardia; no feeding difficulty; regular rehabilitation; intellectual disability, no seizures; raised serum CK highest 2m-3385 U/L; pectus carinatum" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317660" "00360" "00426505" "00006" "Familial, autosomal recessive" "3.1y" "1y-head control, 7m-sit; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 7m-2874 U/L; EMG 7m-myopathic changes; MRI brain 7m, 1.1y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration; pectus carinatum" "4m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317661" "00360" "00426506" "00006" "Familial, autosomal recessive" "3.1y" "1y-sit; no motor regression; contractures knee; no spinal deformity; 2y-recurrent respiratory tract infection; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-2667 U/L; EMG myopathic changes; MRI brain 6m, 1y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "11m-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317662" "00360" "00426507" "00006" "Familial, autosomal recessive" "3.3y" "9m-head control, 9m-sit; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; ECG 6m-sinus arrhythmia, 1.4y-normal; ultrasonic cardiogram 6m-mild tricuspid regurgitation, 1.4y-normal; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-3670 U/L; EMG 6m-myopathic changes; MRI brain 6m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317663" "00360" "00426508" "00006" "Familial, autosomal recessive" "3.4y" "3.4y-died severe pneumonia; 12m-head control, 14m-sit; no motor regression; contractures knee, ankle; no spinal deformity; recurrent respiratory tract infection, severe pneumonia; ECG sinus tachycardia; normal ultrasonic cardiogram; 1d-feeding difficulty; no intellectual disability, no seizures; raised serum CK highest 1.4y-1630 U/L; EMG myopathic changes, reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317664" "00360" "00426509" "00006" "Familial, autosomal recessive" "3.5y" "10m-sit; no motor regression; contractures knee, ankle; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; Normal intellect/ febrile seizure (2.3 y); raised serum CK highest 10m-2431 U/L; MRI brain 1.9y-abnormal white matter hyperintensities" "4m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317665" "00360" "00426510" "00006" "Familial, autosomal recessive" "3.5y" "18m-head control, 1y-sit; no motor regression; no contractures; no spinal deformity; recurrent respiratory tract infection; constipation, difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2m-3230 U/L; EMG 3m-myopathic changes; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317666" "00360" "00426511" "00006" "Familial, autosomal recessive" "3.8y" "7m-sit; no motor regression; contractures knee; no spinal deformity; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-2465 U/L; MRI brain 2y-abnormal white matter hyperintensities, pontine hypoplasia; MRI thigh muscle diffuse fatty infiltration; dislocation hip" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317667" "00360" "00426512" "00006" "Familial, autosomal recessive" "4.0y" "4y-died severe pneumonia; no head control; recurrent respiratory tract infection; 1d-feeding difficulty; no intellectual disability, no seizures; raised serum CK highest 5m-1552 U/L; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317668" "00360" "00426513" "00006" "Familial, autosomal recessive" "4.2y" "31m-head control, 6m-sit; no motor regression; contractures knee, ankle; 3y-lordosis; no respiratory involvement; constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3m-3483 U/L; EMG 5m-myopathic changes; MRI brain 1m-normal, 6m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317669" "00360" "00426514" "00006" "Familial, autosomal recessive" "4.3y" "3y-head control, 17m-sit; no motor regression; contractures knee; no spinal deformity; 2y-4y-recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram 6m-patent foramen ovale; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; EMG 6m-normal; MRI brain 5m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317670" "00360" "00426515" "00006" "Familial, autosomal recessive" "4.6y" "1.5y-head control, 8m-sit; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; no regular rehabilitation; intellectual disability, no seizures; raised serum CK highest 1.2y-2000 U/L; EMG 8m-myopathic changes; MRI brain 7m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317671" "00360" "00426516" "00006" "Familial, autosomal recessive" "4.7y" "10m-sit; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; 1d-feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-6000 U/L; EMG 11m-myopathic changes; MRI brain 11m-abnormal white matter hyperintensities; pectus carinatum" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317672" "00360" "00426517" "00006" "Familial, autosomal recessive" "4.8y" "2y-head control, 2y-sit; no motor regression; contractures knee, ankle, elbow, hip; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram 4m-patent foramen ovale; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.3y-3496 U/L; EMG 4m-myopathic changes; MRI brain 14m-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317673" "00360" "00426518" "00006" "Familial, autosomal recessive" "5y" "1y-sit; no motor regression; contractures knee, ankle, elbow; no spinal deformity; no respiratory involvement; normal ultrasonic cardiogram; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 9m-1878 U/L; EMG myopathic changes; MRI brain 6d-normal; MRI thigh muscle diffuse fatty infiltration; dislocation hip" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317674" "00360" "00426519" "00006" "Familial, autosomal recessive" "5.1y" "no head control; no motor regression; contractures knee, elbow, ankle; no spinal deformity; 3y-4y-recurrent respiratory tract infection; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2m-8010 U/L; MRI brain 5m-normal; pectus carinatum" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317675" "00360" "00426520" "00006" "Familial, autosomal recessive" "5.3y" "18m-sit; no motor regression; contractures knee, ankle, elbow; no spinal deformity; 4y-recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-86425 U/L; MRI brain 4m-abnormal white matter hyperintensities; pectus carinatum" "1d" "" "muscle weakness, hypotonia, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317676" "00360" "00426521" "00006" "Familial, autosomal recessive" "5.5y" "10m-head control, 8m-sit; no motor regression; contractures knee, elbow; no spinal deformity; 4y-recurrent respiratory tract infection; ECG normal; constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5m-3488 U/L; EMG myopathic changes; MRI brain 6m, 1y-abnormal white matter hyperintensities, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317677" "00360" "00426522" "00006" "Familial, autosomal recessive" "5.6y" "7m-head control, 8m-sit; no motor regression; contractures knee, elbow; 5y-scoliosis; no respiratory involvement; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5.2y-924 U/L; MRI brain 11m, 3.8y-abnormal white matter hyperintensities, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317678" "00360" "00426523" "00006" "Familial, autosomal recessive" "5.7y" "6m-head control, 1y-sit; L3.8y-loss rolling; contractures knee, ankle; 4y-lordosis; no respiratory involvement; ECG normal; ultrasonic cardiogram 1m-patent foramen ovale, 11m-normal; difficulty chewing, constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1m-10661 U/L; EMG 1m-myopathic changes; MRI brain 3m-focal changes; pectus excavatum, dislocation of hip" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317679" "00360" "00426524" "00006" "Familial, autosomal recessive" "5.8y" "6m-head control, 9m-sit; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram 1y-patent foramen ovale, 3y-normal; constipation, difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5m-2151 U/L; EMG 6m-myopathic changes; MRI brain 5m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317680" "00360" "00426525" "00006" "Familial, autosomal recessive" "6y" "8m-head control, 1y-sit, 2.5y-walk; no motor regression; contractures ankle; no spinal deformity; 4y-recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 4.7y-2500 U/L; EMG 1.4y-myopathic changes; MRI brain 4.1y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317681" "00360" "00426526" "00006" "Familial, autosomal recessive" "6y" "2m-head control, 7m-sit; 4.1y-loss sitting; contractures knee, elbow, ankle; 6y-scoliosis; 4y-recurrent respiratory tract infection; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-2757 U/L; MRI brain 6m-abnormal white matter hyperintensities, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317682" "00360" "00426527" "00006" "Familial, autosomal recessive" "6y" "5m-head control, 6m-sit, 3.5y-walk; no motor regression; contractures knee; no spinal deformity; no respiratory involvement; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.4y-1701 U/L; EMG 7m-myopathic changes; MRI brain 10m, 3.4y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "4m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317683" "00360" "00426528" "00006" "Familial, autosomal recessive" "6y" "2y-head control, 1y-sit; no motor regression; no contractures; no spinal deformity; 1d-respiratory difficulty; ultrasonic cardiogram left ventricular false tendon; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-43830 U/L; EMG myopathic changes; MRI brain 1m-normal, 9m-abnormal white matter hyperintensities; 1d-mechanical ventilation; dislocation of hip, pectus excavatum" "1d" "" "muscle weakness, hypotonia, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317684" "00360" "00426529" "00006" "Familial, autosomal recessive" "6y" "3y-head control, 3y-sit; no motor regression; contractures knee, elbow, ankle, hip; no spinal deformity; 3d-respiratory difficulty, 8y-9y-recurrent respiratory tract infection; difficulty chewing, difficulty swallowing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-88680 U/L; EMG 17m-reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 1y-abnormal white matter hyperintensities; 1d-mechanical ventilation; pectus excavatum" "1d" "" "muscle weakness, hypotonia, feeding difficulty, respiratory difficulty" "6m-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317685" "00360" "00426530" "00006" "Familial, autosomal recessive" "6.3y" "6.3y-died severe pneumonia; 6m-head control, 8m-sit; no motor regression; contractures knee, elbow, hip; 6y-scoliosis; recurrent respiratory tract infection, 6y-severe pneumonia; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6y-91 U/L; EMG myopathic changes, reduced motor nerve conduction velocity; MRI brain 6.1y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317686" "00360" "00426531" "00006" "Familial, autosomal recessive" "6.3y" "5m-head control, 6m-sit, 2y-walk; 6y-loss walking; contractures ankle; no spinal deformity; 4y-6y-recurrent respiratory tract infection; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 8m-3551 U/L; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "1y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317687" "00360" "00426532" "00006" "Familial, autosomal recessive" "6.5y" "4m-head control, 6m-sit; no motor regression; contractures knee, ankle; no spinal deformity; 1y-2y-recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram 5.3y-patent foramen ovale; 1d-feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5m-3714 U/L; EMG 9m-myopathic changes, reduced motor nerve compound muscle action potential amplitude; MRI brain 5m-abnormal white matter hyperintensities; 3y-dislocation hip" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317688" "00360" "00426533" "00006" "Familial, autosomal recessive" "6.7y" "4m-head control, 6m-sit, 1.5y-walk; no motor regression; contractures elbow; no spinal deformity; 3y-4y-recurrent respiratory tract infection; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3y-2000 U/L; MRI thigh muscle diffuse fatty infiltration" "4m" "" "muscle weakness" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317689" "00360" "00426534" "00006" "Familial, autosomal recessive" "6.9y" "4m-head control, 7m-sit; no motor regression; contractures knee, ankle; no spinal deformity; 3y-recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 11m-1715 U/L; EMG 11m-myopathic changes; MRI brain 10m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317690" "00360" "00426535" "00006" "Familial, autosomal recessive" "7.2y" "7.2y-died severe pneumonia; 2.5y-sit; no motor regression; contractures; 6y-scoliosis; recurrent respiratory tract infection; ultrasonic cardiogram 5m-patent foramen ovale; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3m-2612 U/L; EMG myopathic changes; MRI brain 3m-normal, 7m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317691" "00360" "00426536" "00006" "Familial, autosomal recessive" "7.5y" "10m-head control, 1y-sit; 5.6y-loss sitting; contractures knee, ankle, elbow, hip; 2y-lordosis; 1y-6y-recurrent respiratory tract infection; ultrasonic cardiogram mild tricuspid regurgitation, mild ventricular septal hypertrophy; difficulty chewing, constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 7m-2167 U/L; EMG 10m-myopathic changes; MRI brain 7m-abnormal white matter hyperintensities; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317692" "00360" "00426537" "00006" "Familial, autosomal recessive" "7.8y" "3m-head control, 7m-sit; no motor regression; contractures knee, ankle, elbow, hip; no spinal deformity; recurrent respiratory tract infection; normal ultrasonic cardiogram; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.8y-1662 U/L; MRI brain 1.8y-abnormal white matter hyperintensities, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317693" "00360" "00426538" "00006" "Familial, autosomal recessive" "8.0y" "no head control; no motor regression; contractures knee, ankle, elbow; 4y-scoliosis; 1y-6y-recurrent respiratory tract infection; ECG 5m-sinus tachycardia; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-45243 U/L; MRI brain 7d-normal, 6m-abnormal white matter hyperintensities; pectus excavatum" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317694" "00360" "00426539" "00006" "Familial, autosomal recessive" "8.1y" "7m-sit; no motor regression; contractures knee, ankle, elbow, hip; 6y-scoliosis; no respiratory involvement; difficulty chewing, difficulty swallowing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2y-611 U/L; EMG 2y-myopathic changes, reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "1d" "" "muscle weakness, hypotonia" "2y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317695" "00360" "00426540" "00006" "Familial, autosomal recessive" "8.3y" "5m-head control, 1.5y-sit, 6y-walk; no motor regression; contractures knee, ankle, hip; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 9m-4627 U/L; MRI brain 9m-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317696" "00360" "00426541" "00006" "Familial, autosomal recessive" "8.3y" "1y-head control, 2y-sit; no motor regression; contractures knee, ankle, elbow; 3y-lordosis; 3y-recurrent respiratory tract infection; ultrasonic cardiogram 6m-mild pulmonary regurgitation; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-10080 U/L; EMG myopathic changes; MRI brain 6m-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317697" "00360" "00426542" "00006" "Familial, autosomal recessive" "8.3y" "7m-head control, 1.2y-sit; 6.4y-muscle weakness; contractures knee, ankle, elbow; 6y-scoliosis; recurrent respiratory tract infection; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5y-1019 U/L; EMG myopathic changes; MRI brain 1.9y-abnormal white matter hyperintensities, occipital pachygyria; dislocation hip" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317698" "00360" "00426543" "00006" "Familial, autosomal recessive" "8.5y" "2y-sit; 6.6y-muscle weakness; contractures knee, elbow; no spinal deformity; 2d-respiratory difficulty, 1y-3y-recurrent respiratory tract infection; ECG normal; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 11m-2798 U/L" "1d" "" "muscle weakness, hypotonia, weak cry, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317699" "00360" "00426544" "00006" "Familial, autosomal recessive" "8.7y" "3y-head control; no motor regression; contractures knee, ankle, elbow, hip; 1y-scoliosis; 1d-respiratory difficulty, 1y-3y-recurrent respiratory tract infection; normal ultrasonic cardiogram; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.1y-5901 U/L; EMG 4m-myopathic changes; MRI brain abnormal white matter hyperintensities; 3d-mechanical ventilation; pectus excavatum" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317700" "00360" "00426545" "00006" "Familial, autosomal recessive" "8.7y" "1y-head control, 1.5y-sit; no motor regression; contractures knee, ankle, elbow; 4y-scoliosis; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2y-1200 U/L; EMG myopathic changes, reduced motor nerve conduction velocity; MRI brain abnormal white matter hyperintensities; pectus excavatum" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317701" "00360" "00426546" "00006" "Familial, autosomal recessive" "8.8y" "4m-head control, 8m-sit; no motor regression; contractures knee, elbow, hip; 6y-scoliosis; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.5y-1150 U/L; EMG myopathic changes; MRI brain 9m, 2y-abnormal white matter hyperintensities, occipital pachygyria; pectus carinatum" "3m" "" "muscle weakness, hypotonia" "2.7y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317702" "00360" "00426547" "00006" "Familial, autosomal recessive" "8.8y" "6m-head control, 11m-sit; 6.8y-loss head control, 5y-loss rolling; contractures knee, ankle, elbow, hip; 7y-scoliosis; 3y-recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram 1y-iIncreased left ventricle; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-1730 U/L; EMG 6m-normal; MRI brain 1.3y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "4m" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317703" "00360" "00426548" "00006" "Familial, autosomal recessive" "9y" "4m-head control, 7m-sit; 7y-muscle weakness; contractures knee; no spinal deformity; 7y-recurrent respiratory tract infection; constipation; regular rehabilitation; intellectual disability, no seizures; raised serum CK highest 8m-4224 U/L; EMG myopathic changes; MRI brain 2y-abnormal white matter hyperintensities, occipital pachygyria, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317704" "00360" "00426549" "00006" "Familial, autosomal recessive" "9.3y" "5m-head control, 8m-sit, 3y-walk; 8.5y-loss walking; contractures knee, ankle; 3y-lordosis; recurrent respiratory tract infection; 1d-feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 10m-2025 U/L; EMG myopathic changes; MRI brain 10m-abnormal white matter hyperintensities" "3m" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317705" "00360" "00426550" "00006" "Familial, autosomal recessive" "9.3y" "6m-head control, 9m-sit; 5y-loss sitting; contractures knee, elbow; no spinal deformity; 7.3y-respiratory difficulty, 7y-recurrent respiratory tract infection; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.2y-8111 U/L; MRI brain 1.8y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration, atrophy" "1d" "" "muscle weakness, hypotonia" "2y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317706" "00360" "00426551" "00006" "Familial, autosomal recessive" "9.3y" "4m-head control, 1y-sit; 4y-loss rolling; contractures knee, ankle, elbow; 6y-scoliosis; 8y-recurrent respiratory tract infection; normal ultrasonic cardiogram; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-1778 U/L; EMG 6m-myopathic changes; MRI brain 8m-abnormal white matter hyperintensities, occipital pachygyria; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry" "10m-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317707" "00360" "00426552" "00006" "Familial, autosomal recessive" "9.4y" "3m-head control, 8m-sit; 8.5y-loss sitting; contractures knee, ankle, elbow; 7y-scoliosis; 7y-recurrent respiratory tract infection; ECG 1.8y-sinus tachycardia, 3.7y-ST-T wave change; ultrasonic cardiogram 1.8y-0.45-left ventricular ejection fraction, 4y-normal; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 7m-2540 U/L; EMG 6m-myopathic changes; MRI brain 6m-abnormal white matter hyperintensities; pectus carinatum" "3m" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317708" "00360" "00426553" "00006" "Familial, autosomal recessive" "9.5y" "8m-head control, 10m-sit; no motor regression; contractures knee, elbow; no spinal deformity; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; difficulty chewing; regular rehabilitation; no intellectual disability, 9y-epilepsy; raised serum CK highest 11m-3436 U/L; EMG myopathic changes; MRI brain 3m-normal, 5m, 11m-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "1.2y-IHC weak LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317709" "00360" "00426554" "00006" "Familial, autosomal recessive" "9.7y" "6m-head control, 9m-sit; no motor regression; contractures knee, ankle, elbow; 5y-scoliosis; recurrent respiratory tract infection; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 8m-1222 U/L; EMG 10m-myopathic changes; MRI brain 9y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317710" "00360" "00426555" "00006" "Familial, autosomal recessive" "9.8y" "9.8y-died; 5m-head control, 9m-sit; no motor regression; contractures knee, ankle, elbow; 6y-scoliosis; 4d-respiratory difficulty, 1y-4y-recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram mildmitral regurgitation, 8.3y-tricuspid regurgitation; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-17000 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317711" "00360" "00426556" "00006" "Familial, autosomal recessive" "10.3y" "3m-head control, 7m-sit; no motor regression; contractures knee, elbow; 7y-scoliosis; recurrent respiratory tract infection; ECG 1y-sinus arrhythmia, 5y-normal; difficulty chewing, constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2m-4089 U/L; EMG myopathic changes; MRI brain 1y, 3.2y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317712" "00360" "00426557" "00006" "Familial, autosomal recessive" "10.5y" "6m-head control, 2y-sit; 8y-loss sitting; contractures knee, elbow, hip; 9y-scoliosis; no respiratory involvement; normal ultrasonic cardiogram; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2y-1500 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities; dislocation hip" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317713" "00360" "00426558" "00006" "Familial, autosomal recessive" "10.6y" "1y-head control, 2y-sit; 6y-loss sitting; contractures knee, ankle, elbow, hip; 6y-scoliosis; 6y-respiratory difficulty, recurrent respiratory tract infection; ECG sinus arrhythmia; normal ultrasonic cardiogram; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3m-6045 U/L; EMG 1.3y-myopathic changes, reduced motor nerve conduction velocity; MRI brain 1.2y-abnormal white matter hyperintensities; 8.2y-invasive mechanical ventilation, pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317714" "00360" "00426559" "00006" "Familial, autosomal recessive" "10.8y" "4m-head control, 10m-sit, 1.7y-walk; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram mild tricuspid regurgitation; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3y-343 U/L; EMG myopathic changes; MRI brain 2y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration, atrophy; pectus carinatum" "4m" "" "muscle weakness, hypotonia" "2.4y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317715" "00360" "00426560" "00006" "Familial, autosomal recessive" "11.7y" "6m-head control, 1y-sit; 9.8y-loss head control; contractures knee, ankle, elbow; 9y-scoliosis; no respiratory involvement; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-852 U/L; EMG 6m-myopathic changes; MRI brain 2y-abnormal white matter hyperintensities; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317716" "00360" "00426561" "00006" "Familial, autosomal recessive" "11.8y" "8m-head control, 14m-sit, 4y-walk; 11y-loss walking; contractures knee, ankle, elbow, hip; 6y-spinal ankylosis; no respiratory involvement; 1d-feeding difficulty; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.3y-1899 U/L; EMG myopathic changes; MRI brain 2y-abnormal white matter hyperintensities, occipital pachygyria" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317717" "00360" "00426562" "00006" "Familial, autosomal recessive" "12.6y" "8m-head control, 1y-sit; 12y-loss rolling; contractures elbow; no spinal deformity; 1d-respiratory difficulty; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 8m-2481 U/L; EMG myopathic changes, reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 2y-abnormal white matter hyperintensities; dislocation hip" "1d" "" "muscle weakness, hypotonia, respiratory difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317718" "00360" "00426563" "00006" "Familial, autosomal recessive" "12.7y" "12.7y-died severe pneumonia; 1y-head control, 1.3y-sit; 11y-loss head control, 11y-loss sitting; contractures knee, ankle, elbow, hip; 3y-scoliosis; recurrent respiratory tract infection, 11y-respiratory difficulty; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 10m-3264 U/L; EMG 10m-myopathic changes, reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 10m-abnormal white matter hyperintensities; 12.6y-non-invasive mechanical ventilation; pectus excavatum" "1d" "" "muscle weakness, hypotonia, feeding difficulty" "2y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317719" "00360" "00426564" "00006" "Familial, autosomal recessive" "12.8y" "3m-head control, 10m-sit, 4.5y-walk; 7.5y-loss sitting, 6.8y-loss walking; contractures knee, elbow; 8y-scoliosis; 10.8y-respiratory difficulty; ECG normal; constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 9m-2427 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities; pectus carinatum" "4m" "" "hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317720" "00360" "00426565" "00006" "Familial, autosomal recessive" "13y" "2y-head control, 1y-sit; no motor regression; contractures knee, ankle, elbow; 9y-scoliosis; no respiratory involvement; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3y-3008 U/L; MRI brain 2.8y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317721" "00360" "00426566" "00006" "Familial, autosomal recessive" "13y" "13y-died epilepsy; 8m-head control, 1y-sit; no motor regression; contractures ankle, elbow; 12y-scoliosis; no respiratory involvement; ECG normal; 8y-difficulty swallowing; constipation; intellectual disability, 3y-epilepsy; EMG 3.8y-myopathic changes; MRI brain 2y, 3.4y-abnormal white matter hyperintensities, occipital pachygyria" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317722" "00360" "00426567" "00006" "Familial, autosomal recessive" "13y" "3m-head control, 1y-sit; 12y-loss rolling; contractures knee, ankle, elbow, hip; 7y-lordosis; 2y-recurrent respiratory tract infection; ECG normal; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1m-2762 U/L; EMG myopathic changes; MRI brain 6m-abnormal white matter hyperintensities; pectus carinatum" "1d" "" "muscle weakness, hypotonia" "6m-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317723" "00360" "00426568" "00006" "Familial, autosomal recessive" "13.1y" "13y1m-died severe pneumonia; 7m-head control, 9m-sit, 1.5y-walk; 1.7y-loss walking; contractures knee, ankle, elbow, hip; 7y-scoliosis; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; difficulty chewing, difficulty swallowing, constipation; no regular rehabilitation; no intellectual disability, neonatal epilepsy; raised serum CK highest 3.3y-1011 U/L; EMG myopathic changes; MRI brain 4.3y-abnormal white matter hyperintensities, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "3y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317724" "00360" "00426569" "00006" "Familial, autosomal recessive" "13.2y" "1y-head control, 1.5y-sit; no motor regression; contractures knee, elbow; 8y-scoliosis; 11y-respiratory difficulty; normal ultrasonic cardiogram; 1d-feeding difficulty; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-1261 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities; 11.2y-non-invasive mechanical ventilation; pectus carinatum" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317725" "00360" "00426570" "00006" "Familial, autosomal recessive" "13.5y" "13y6m-died feeding difficulty; 13m-head control, 1y-sit; 9y-loss sitting; contractures knee, ankle, elbow, hip; 8y-scoliosis; recurrent respiratory tract infection; ECG 8d-sinus tachycardia; ultrasonic cardiogram patent foramen ovale; difficulty chewing, difficulty swallowing, constipation; no regular rehabilitation; no intellectual disability, 3y-epilepsy; raised serum CK highest 1.5y-1573 U/L; EMG 4y-myopathic changes, reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 15d-normal, abnormal white matter hyperintensities, 1.7y-occipital pachygyria" "1d" "" "muscle weakness, hypotonia" "1.3y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317726" "00360" "00426571" "00006" "Familial, autosomal recessive" "13.6y" "4m-head control, 9m-sit; 10y-loss head control; contractures knee, ankle, elbow, hip; 6y-scoliosis; 12y-recurrent respiratory tract infection; 1d-feeding difficulty; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 10m-4436 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities; dislocation hip" "4m" "" "muscle weakness, hypotonia" "3.5y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317727" "00360" "00426572" "00006" "Familial, autosomal recessive" "14.3y" "4y4m-died severe pneumonia; 1y-head control, 1y-sit; Loss of rolling, 7y-loss head control, 9y-loss sitting; contractures knee, ankle, elbow, hip; 11y-scoliosis; recurrent respiratory tract infection; ECG normal; difficulty chewing, difficulty swallowing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 11.1y-259 U/L; MRI thigh muscle diffuse fatty infiltration, atrophy" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317728" "00360" "00426573" "00006" "Familial, autosomal recessive" "15y" "15y-died epilepsy; 10m-head control, 14m-sit; no motor regression; contractures knee, ankle, elbow; 8y-scoliosis; 14y-respiratory difficulty, recurrent respiratory tract infection; difficulty swallowing, constipation; no regular rehabilitation; no intellectual disability, 13y-epilepsy; raised serum CK highest 3m-770 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "3y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317729" "00360" "00426574" "00006" "Familial, autosomal recessive" "17.1y" "5m-head control, 1y-sit, 7y-walk; no motor regression; contractures knee, elbow; 4y-scoliosis; 16y-respiratory difficulty; ECG normal; no feeding difficulty; no regular rehabilitation; Normal intellect/ febrile seizure (4y), epilepsy (15.5 y); raised serum CK highest 6m-1565 U/L; EMG myopathic changes; MRI brain 6m, 4y-abnormal white matter hyperintensities; newborn subarachnoid hemorrhage" "4m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317730" "00360" "00426575" "00006" "Familial, autosomal recessive" "17.3y" "1y-sit; 14y-loss sitting; contractures knee, ankle, elbow, hip; 0.5y-scoliosis; 8y-respiratory difficulty; ultrasonic cardiogram mild tricuspid insufficiency; difficulty chewing, difficulty swallowing, constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-3549 U/L; EMG 6m-myopathic changes; MRI brain 3y, 8y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "1d" "" "muscle weakness, hypotonia" "6m-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317731" "00360" "00426576" "00006" "Familial, autosomal recessive" "18y" "18y-died feeding difficulty; 6m-head control, 1.1y-sit; contractures knee, ankle, elbow, hip; 12y-scoliosis; 1d-respiratory difficulty; difficulty chewing, difficulty swallowing, constipation; no regular rehabilitation; intellectual disability, no seizures; raised serum CK highest 8m-9640 U/L; EMG 6m-myopathic changes; MRI brain 2y-abnormal white matter hyperintensities" "1d" "" "respiratory difficulty" "1.3y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317732" "00360" "00426577" "00006" "Familial, autosomal recessive" "18.6y" "7m-sit, 4y-walk; 11y-loss sitting, 8y-loss walking; contractures knee, ankle, elbow, hip; 6y-scoliosis; no respiratory involvement; difficulty chewing, difficulty swallowing, constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1.2y-1097 U/L; EMG myopathic changes; MRI brain 13m-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "2m" "" "muscle weakness, hypotonia" "1.2y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317733" "00360" "00426578" "00006" "Familial, autosomal recessive" "26y" "5m-head control, 11m-sit, 2y-walk; 5y-loss walking; contractures knee, ankle, elbow; 6y-scoliosis; 24y-respiratory difficulty; no feeding difficulty; regular rehabilitation; no intellectual disability, 15y-epilepsy; raised serum CK highest 6y-356 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities" "4m" "" "muscle weakness, hypotonia" "13.5y-IHC weak LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317734" "00360" "00426579" "00006" "Familial, autosomal recessive" "27.3y" "5m-head control, 8m-sit, 1.5y-walk; 8y-loss walking; contractures knee, ankle, elbow; scoliosis, 6y-lordosis; 13y-15y-recurrent respiratory tract infection; difficulty chewing, constipation; no regular rehabilitation; intellectual disability, 13y-epilepsy; raised serum CK highest 5y-1000 U/L; EMG myopathic changes; MRI brain 13.9y-abnormal white matter hyperintensities; intellectual regression after epilepsy" "3m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317735" "00360" "00426580" "00006" "Familial, autosomal recessive" "3.2y" "3m-head control, 7m-sit, 1.2y-walk; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2y-1344 U/L; EMG 1y-reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 2y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "1y2m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317736" "00360" "00426581" "00006" "Familial, autosomal recessive" "5.5y" "3m-head control, 6m-sit, 1.1y-walk, 2y-run; no motor regression; no contractures; no spinal deformity; 3y-4y-recurrent respiratory tract infection; ECG sinus tachycardia; ultrasonic cardiogram patent foramen ovale; constipation; regular rehabilitation; Normal intellect/ febrile seizure (1.5 y ); raised serum CK highest 11m-2253 U/L; MRI brain 1.8y-abnormal white matter hyperintensities" "2y6m" "" "difficulty running and jumping" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317737" "00360" "00426582" "00006" "Familial, autosomal recessive" "6y" "3m-head control, 6m-sit, 1.5y-walk, 4y-run; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3.2y-4362 U/L; EMG 3.3y-myopathic changes; MRI brain abnormal white matter hyperintensities" "1y6m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317738" "00360" "00426583" "00006" "Familial, autosomal recessive" "6.3y" "2m-head control, 6m-sit, 1.1y-walk, 4y-run; no motor regression; no contractures; no spinal deformity; 1y-4y-recurrent respiratory tract infection; ECG sinus arrhythmia; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 8m-709 U/L; EMG myopathic changes; MRI brain 3.6y-abnormal white matter hyperintensities" "1y1m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317739" "00360" "00426584" "00006" "Familial, autosomal recessive" "6.4y" "3m-head control, 6m-sit, 1.5y-walk, 4.5y-run; no motor regression; no contractures; no spinal deformity; recurrent respiratory tract infection; ECG normal; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 2y-1337 U/L; EMG 1.7y-myopathic changes, reduced motor nerve conduction velocity; MRI brain 1.7y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "1y6m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317740" "00360" "00426585" "00006" "Familial, autosomal recessive" "6.4y" "3m-head control, 8m-sit, 1.6y-walk, 2.5y-run; no motor regression; no contractures; no spinal deformity; no respiratory involvement; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 5y-2000 U/L; EMG 2.3y-normal; MRI brain 3.6y-frontal horn of lateral ventrical; MRI thigh muscle diffuse fatty infiltration" "1y6m" "" "myopathic gait" "2.3y-IHC weak LAMA2" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317741" "00360" "00426586" "00006" "Familial, autosomal recessive" "7.9y" "3m-head control, 6m-sit, 1.7y-walk, 2.5y-run; 5.5y-loss walking; contractures knee, ankle; no spinal deformity; no respiratory involvement; ECG sinus tachycardia; no feeding difficulty; regular rehabilitation; Normal intellect/ febrile seizure (2.6 y); raised serum CK highest 2.5y-3078 U/L; EMG 1.6y-myopathic changes, reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 1.6y, 2.3y-abnormal white matter hyperintensities; grandfather\'s brother had epilepsy" "2y" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317742" "00360" "00426587" "00006" "Familial, autosomal recessive" "8.5y" "4m-head control, 6m-sit, 1.5y-walk, 3y-run; no motor regression; no contractures; no spinal deformity; no respiratory involvement; normal ultrasonic cardiogram; constipation; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-3103 U/L; EMG myopathic changes" "1y6m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317743" "00360" "00426588" "00006" "Familial, autosomal recessive" "9.6y" "4m-head control, 7m-sit, 1.2y-walk, 2.5y-run; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-1481 U/L; EMG myopathic changes; MRI brain 2.5y, 8.9y-mild change" "1y2m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317744" "00360" "00426589" "00006" "Familial, autosomal recessive" "11.3y" "3m-head control, 6m-sit, 1.5y-walk; no motor regression; contractures ankle; 10y-scoliosis; 1y-7y-recurrent respiratory tract infection; ECG sinus tachycardia; no feeding difficulty; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6y-1018 U/L; EMG 6y-myopathic changes, reduced motor nerve conduction velocity; MRI brain 5.7y-abnormal white matter hyperintensities; MRI thigh muscle diffuse fatty infiltration" "2y" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317745" "00360" "00426590" "00006" "Familial, autosomal recessive" "18.2y" "4m-head control, 6m-sit, 1.5y-walk, 17y-run; no motor regression; no contractures; no spinal deformity; 16y-recurrent respiratory tract infection; ECG normal; no feeding difficulty; no regular rehabilitation; no intellectual disability, 11y-epilepsy; raised serum CK highest 13.2y-442 U/L; MRI brain 13.2y-abnormal white matter hyperintensities, occipital pachygyria" "13y" "" "epilepsy" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317746" "00360" "00426591" "00006" "Familial, autosomal recessive" "23.6y" "3m-head control, 6m-sit, 1.3y-walk, 2y-run; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ultrasonic cardiogram mild tricuspid regurgitation; no feeding difficulty; no regular rehabilitation; no intellectual disability, 14y-epilepsy; raised serum CK highest 15.5y-934 U/L; MRI brain 18y-posterior horn of lateral ventrical" "1y4m" "" "myopathic gait" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317747" "00360" "00426592" "00006" "Familial, autosomal recessive" "3m" "3m-died severe pneumonia; no head control; recurrent respiratory tract infection, severe pneumonia; no intellectual disability, no seizures" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317748" "00360" "00426593" "00006" "Familial, autosomal recessive" "5m" "5m-died severe pneumonia; no head control; no motor regression; contractures ankle; no spinal deformity; recurrent respiratory tract infection, severe pneumonia; normal ultrasonic cardiogram; no intellectual disability, no seizures; raised serum CK highest 2d-4110 U/L; EMG 1m-myopathic changes; MRI brain 10d-focal changes; pectus excavatum" "1d" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317749" "00360" "00426594" "00006" "Familial, autosomal recessive" "1.3y" "no head control; no motor regression; contractures ankle; no spinal deformity; 20d-feeding difficulty; no intellectual disability, no seizures; pectus excavatum" "1m" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317750" "00360" "00426595" "00006" "Familial, autosomal recessive" "6.0y" "9m-sit; contractures; 6y-scoliosis; 1d-feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6y-491 U/L; EMG myopathic changes; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317751" "00360" "00426596" "00006" "Familial, autosomal recessive" "8.6y" "8.6y-died severe pneumonia; 1y-head control, 1.1y-sit; 6.5y-loss sitting; contractures knee, ankle, elbow, hip; 5y-scoliosis; recurrent respiratory tract infection; ECG normal; ultrasonic cardiogram 2y-mild tricuspid regurgitation; difficulty chewing, constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3m-3983 U/L; EMG 2m-myopathic changes, reduced motor nerve conduction velocity; MRI brain 9m, 2.3y-abnormal white matter hyperintensities, pontine hypoplasia" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "3m-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317752" "00360" "00426597" "00006" "Familial, autosomal recessive" "3.9y" "1.5y-sit; no motor regression; contractures knee; no spinal deformity; constipation; Normal intellect/ febrile seizure (3 y); EMG myopathic changes; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317753" "00360" "00426598" "00006" "Familial, autosomal recessive" "5.1y" "5m-head control, 8m-sit; no motor regression; contractures ankle; no spinal deformity; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; difficulty chewing; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1d-88680 U/L; EMG 5m-reduced motor nerve conduction velocity, reduced motor nerve compound muscle action potential amplitude; MRI brain 5m-abnormal white matter hyperintensities; pectus carinatum" "5m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317754" "00360" "00426599" "00006" "Familial, autosomal recessive" "13.8y" "6m-head control, 10m-sit; 6y-loss rolling, 9y-loss sitting; contractures knee, ankle, elbow, hip; 3y-scoliosis; 1y-12y-recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; 1d-feeding difficulty; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 1y-596 U/L; EMG myopathic changes; MRI brain 1.3y-abnormal white matter hyperintensities; pectus excavatum" "3m" "" "muscle weakness, hypotonia, weak cry" "1.8y-IHC no LAMA2" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317755" "00360" "00426600" "00006" "Familial, autosomal recessive" "15.5y" "15y6m-died severe pneumonia; 3m-head control, 1y-sit; no motor regression; contractures knee, ankle, elbow; 10y-scoliosis; recurrent respiratory tract infection; ECG normal; normal ultrasonic cardiogram; difficulty chewing; no regular rehabilitation; intellectual disability, 13y-epilepsy" "6m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317756" "00360" "00426601" "00006" "Familial, autosomal recessive" "9.4y" "7m-head control, 1y-sit, 3y-walk; no motor regression; contractures knee, ankle; 6y-lordosis; no respiratory involvement; ECG normal; normal ultrasonic cardiogram; constipation; regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 8y-1800 U/L; EMG myopathic changes; MRI brain 8y-abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia, weak cry, feeding difficulty" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317757" "00360" "00426602" "00006" "Familial, autosomal recessive" "14y" "3m-head control, 7m-sit; 8y-loss sitting, 10y-loss head control; contractures knee, ankle, elbow; 8y-scoliosis; 12y-respiratory difficulty; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317758" "00360" "00426603" "00006" "Familial, autosomal recessive" "11.2y" "5m-head control, 8m-sit, 2y-walk; 8y-loss walking; contractures knee, ankle, elbow; 8y-scoliosis; 5y-11y-recurrent respiratory tract infection; ECG normal; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6y-900 U/L; EMG 5.6y-myopathic changes; MRI brain 2y-abnormal white matter hyperintensities" "3m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317759" "00360" "00426604" "00006" "Familial, autosomal recessive" "13.9y" "5m-head control, 10m-sit; Loss of rolling, loss head control, 7y-loss sitting; contractures knee, ankle, elbow; 6y-scoliosis; 12y-respiratory difficulty; difficulty chewing, difficulty swallowing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6m-3620 U/L; EMG myopathic changes; MRI brain 2.3y, 2.7y-abnormal white matter hyperintensities" "3m" "" "muscle weakness, hypotonia, weak cry" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317760" "00360" "00426605" "00006" "Familial, autosomal recessive" "20.8y" "5m-head control, 9m-sit; 6y-loss rolling, 19y-loss sitting; contractures knee, ankle, elbow, hip; 8y-scoliosis; 13y-respiratory difficulty, 13y-20y-recurrent respiratory tract infection; ECG 10y-sinus tachycardia; ultrasonic cardiogram mild tricuspid regurgitation; difficulty chewing; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 3m-4479 U/L; EMG 6m, 8.8y-myopathic changes; MRI brain 8.8y, 11.1y-abnormal white matter hyperintensities; 18.9y-non-invasive mechanical ventilation" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317761" "00360" "00426606" "00006" "Familial, autosomal recessive" "11.7y" "5m-head control, 10m-sit, 1.7y-walk; no motor regression; contractures ankle; 3y-lordosis; no respiratory involvement; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 4y-368 U/L; MRI brain abnormal white matter hyperintensities; pectus carinatum" "5m" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317762" "00360" "00426607" "00006" "Familial, autosomal recessive" "13y" "13y-died severe pneumonia; 10m-sit; contractures knee, ankle, elbow; 8y-scoliosis; recurrent respiratory tract infection, severe pneumonia; no intellectual disability, no seizures; MRI brain abnormal white matter hyperintensities" "1d" "" "muscle weakness, hypotonia" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000317763" "00360" "00426608" "00006" "Familial, autosomal recessive" "14.1y" "14.1y-died; 4m-head control, 10m-sit, 1.3y-walk; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram mild tricuspid regurgitation; no feeding difficulty; no regular rehabilitation; no intellectual disability, no seizures; raised serum CK highest 6.4y-2103 U/L; EMG myopathic changes; MRI brain 7.8y-mild change, occipital pachygyria" "6y" "" "difficulty running and jumping" "7y-IHC weak LAMA2" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000317764" "00360" "00426609" "00006" "Familial, autosomal recessive" "27y" "4m-head control, 9m-sit, 1.5y-walk; no motor regression; no contractures; no spinal deformity; no respiratory involvement; ECG normal; ultrasonic cardiogram mildmitral regurgitation, tricuspid regurgitation; no feeding difficulty; no regular rehabilitation; no intellectual disability, 23y-epilepsy; raised serum CK highest 21y-1025 U/L; MRI brain 22y-abnormal white matter hyperintensities" "2y" "" "difficulty running and jumping" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000318162" "00360" "00427145" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318163" "00360" "00427146" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318164" "00360" "00427147" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318165" "00360" "00427148" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318166" "00360" "00427149" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318167" "00360" "00427150" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318168" "00360" "00427151" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318169" "00360" "00427152" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318170" "00360" "00427153" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318171" "00360" "00427154" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318172" "00360" "00427155" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318173" "00360" "00427156" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318174" "00360" "00427157" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318175" "00360" "00427158" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318176" "00360" "00427159" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318177" "00360" "00427160" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318178" "00360" "00427161" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318179" "00360" "00427162" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000318180" "00360" "00427163" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "conginital muscular dystrophy" "" "0000319374" "02717" "00428469" "01164" "Unknown" "00y08m" "Hypotonia, Elevated circulating creatine kinase concentration, Muscular dystrophy" "" "" "" "unknown" "" "" "" "" "" "" "" "0000321190" "05618" "00430393" "00006" "Familial, autosomal recessive" "7y" "congenital muscular dystrophy, contracture, hyperCKemia" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000321196" "05618" "00430399" "00006" "Familial, autosomal recessive" "6m" "hypotonia, hyperCKemia" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000321197" "05618" "00430400" "00006" "Familial, autosomal recessive" "2y" "hyperCKemia, congenital muscular dystrophy" "" "" "" "" "" "" "" "" "" "neuromuscular disorder" "" "0000323910" "02717" "00433435" "04483" "Familial, autosomal recessive" "02y" "Motor delay\r\nElevated circulating creatine kinase concentration\r\nProximal muscle weakness in lower limbs (HP:0008994)" "00y03m" "02y" "Weak cry (HP:0001612), hypotonia (HP:0001252)" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000323912" "02717" "00433436" "04483" "Familial, autosomal recessive" "" "Muscle weakness (HP:0001324)\r\nMotor delay (HP:0001270)\r\nElevated circulating creatine kinase concentration (HP:0003236)\r\nHypotonia (HP:0001252)\r\nNo-Seizure (HP:0001250)" "00y05m" "03y" "Muscle weakness (HP:0001324), weak movements" "nhhoang@igr.ac.vn" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000323913" "02717" "00433437" "04483" "Familial, autosomal recessive" "05y" "Proximal muscle weakness in upper and lower limbs (HP:0008997)\r\nElevated circulating creatine kinase concentration (HP:0003236)\r\nMotor delay (HP:0001270)" "00y04m" "00y05m" "Neonatal hypotonia (HP:0001319)" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000323914" "02717" "00433438" "04483" "Familial, autosomal recessive" "04y" "Proximal muscle weakness in upper limbs (HP:0008997)\r\nProximal muscle weakness in lower limbs (HP:0008994)\r\nwheelchair-dependence" "00y01m" "00y04m" "Weak cry (HP:0001612)" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000323915" "02717" "00433439" "04483" "Familial, autosomal recessive" "" "Delayed ability to roll over (HP:0032989)\r\nwheelchair dependence" "00y01m" "00y06m" "Hypotonia (HP:0001252)" "" "" "" "" "" "MDC1A" "congenital muscular dystrophy" "" "0000325280" "05121" "00435042" "00006" "Familial, autosomal recessive" "27y" "see paper for extensive description" "" "" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000325281" "00161" "00435042" "00006" "Familial, X-linked dominant" "27y" "see paper" "" "" "" "" "" "" "" "" "IP" "incontinentia pigmenti" "" "0000325282" "05976" "00435042" "00006" "Familial, autosomal dominant" "27y" "see paper" "" "" "" "" "" "" "" "" "STHAG4" "tooth agenesis" "" "0000325863" "05121" "00435679" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325864" "05121" "00435680" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325865" "05121" "00435681" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325866" "05121" "00435682" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325867" "05121" "00435683" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325868" "05121" "00435684" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325869" "05121" "00435685" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325870" "05121" "00435686" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325871" "05121" "00435687" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; no intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325872" "05121" "00435688" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325873" "05121" "00435689" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325874" "05121" "00435690" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325875" "05121" "00435691" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325876" "05121" "00435692" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325877" "05121" "00435693" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325878" "05121" "00435694" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325879" "05121" "00435695" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325880" "05121" "00435696" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325881" "05121" "00435697" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325882" "05121" "00435698" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325883" "05121" "00435699" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325884" "05121" "00435700" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325885" "05121" "00435701" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325886" "05121" "00435702" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325887" "05121" "00435703" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325888" "05121" "00435704" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325889" "05121" "00435705" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325890" "05121" "00435706" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325891" "05121" "00435707" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325892" "05121" "00435708" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; no intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325893" "05121" "00435709" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325894" "05121" "00435710" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325895" "05121" "00435711" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325896" "05121" "00435712" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325897" "05121" "00435713" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325898" "05121" "00435714" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325899" "05121" "00435715" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; no intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325900" "05121" "00435716" "00006" "Familial, autosomal recessive" "" "no cortical malformation; able to walk; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325901" "05121" "00435717" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; no intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325902" "05121" "00435718" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325903" "05121" "00435719" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325904" "05121" "00435720" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325905" "05121" "00435721" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325906" "05121" "00435722" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325907" "05121" "00435723" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325908" "05121" "00435724" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325909" "05121" "00435725" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325910" "05121" "00435726" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325911" "05121" "00435727" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325912" "05121" "00435728" "00006" "Familial, autosomal recessive" "" "no cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325913" "05121" "00435729" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; no intellectual disability; no epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000325914" "05121" "00435730" "00006" "Familial, autosomal recessive" "" "cortical malformation; not walking; intellectual disability; epilepsy" "" "" "" "" "" "" "" "" "" "muscular dystrophy" "" "0000326927" "00198" "00436845" "00006" "Unknown" "" "elevated CK (5,198-16,204 ng/ml), shoulder dystocia, respiratory distress syndrome" "" "" "" "" "" "" "" "" "" "elevated CK-MM" "" "0000326931" "00198" "00436849" "00006" "Unknown" "" "vacuum assisted vaginal delivery, elevated CK (5,317 ng/ml)" "" "" "" "" "" "" "" "" "" "elevated CK-MM" "" "0000328374" "05121" "00438471" "00006" "Familial, autosomal recessive" "7y" "congenital muscular dystrophy, contracture, hyperCKemia" "" "" "" "" "" "" "" "" "" "muscular dystrophy/myopathy" "" "0000328380" "05121" "00438477" "00006" "Familial, autosomal recessive" "9m" "hypotonia, hyperCKemia" "" "" "" "" "" "" "" "" "" "muscular dystrophy/myopathy" "" "0000328381" "05121" "00438478" "00006" "Familial, autosomal recessive" "2y" "hyperCKemia, congenital muscular dystrophy" "" "" "" "" "" "" "" "" "" "muscular dystrophy/myopathy" "" "0000331955" "00360" "00442608" "00006" "Familial, autosomal recessive" "" "see paper; ..., 9m-muscle biopsy; weak cry, poor suck, respiratory insufficiency, limb and facial muscle weakness, hypotonia; unable to sit; elevated creatine kinase (1458 IU/L); MRI brain T2-weighted imaging hyperintensity white matter; MRI skeletal muscletrophy and fat replacement in muscles (rectus femoris, vastus lateralis, soleus, gastrocnemius)" "" "" "" "IHC reduced LAMA2" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000331956" "00360" "00442609" "00006" "Familial, autosomal recessive" "" "see paper; ..., 13m-muscle biopsy; weak cry, poor suck, respiratory insufficiency, limb and facial muscle weakness, hypotonia; able to sit; elevated creatine kinase (1668 IU/L); MRI brain T2-weighted imaging hyperintensity white matter; MRI skeletal muscletrophy and fat replacement in muscles (rectus femoris, vastus lateralis, soleus, gastrocnemius)" "" "" "" "IHC reduced LAMA2" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000331957" "00360" "00442610" "00006" "Familial, autosomal recessive" "" "see paper; ..., 17m-muscle biopsy; weak cry, poor suck, respiratory insufficiency, limb and facial muscle weakness, hypotonia; able to sit; elevated creatine kinase (3527 IU/L); MRI brain T2-weighted imaging hyperintensity white matter; MRI skeletal muscletrophy and fat replacement in muscles (rectus femoris, vastus lateralis, soleus, gastrocnemius)" "" "" "" "IHC reduced LAMA2" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000332055" "05618" "00442708" "00006" "Unknown" "" "Muscle weakness and exercise intolerance" "" "" "" "" "" "" "" "" "" "muscle weakness" "" "0000332060" "05618" "00442713" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000332143" "05618" "00442796" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "limb girdle muscle weakenss" "" "0000332144" "05618" "00442797" "00006" "Unknown" "" "Distal weakness with exercise intolerance, myalgia, muscle cramps and hyperCKaemia" "" "" "" "" "" "" "" "" "" "distal muscle weakness" "" "0000334679" "02717" "00445403" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0030091 Absent muscle fiber merosin\r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000334680" "02717" "00445446" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0030091 Absent muscle fiber merosin\r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000334681" "02717" "00445447" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0002540 Inability to walk\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335600" "02717" "00446365" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0030091 Absent muscle fiber merosin\r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335622" "02717" "00446396" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0030091 Absent muscle fiber merosin\r\nHP:0002540 Inability to walk\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335623" "02717" "00446397" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335624" "02717" "00446398" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335625" "02717" "00446399" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0030091 Absent muscle fiber merosin\r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nHP:0001250 Seizure" "" "" "" "" "" "" "" "" "" "" "" "0000335626" "05652" "00446401" "03652" "Familial, autosomal recessive" "" "HP:0011463 Childhood onset \r\nNo Seizure\r\nAmbulant (7 years old)" "02y" "" "" "" "" "" "" "" "LGMDR23 (# 618138)" "" "" "0000335627" "02717" "00446402" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0030091 Absent muscle fiber merosin \r\nHP:0002540 Inability to walk\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335628" "02717" "00446403" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0002540 Inability to walk\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335629" "02717" "00446405" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0002540 Inability to walk\r\nHP:0007103 Hypointensity of cerebral white matter on MRI\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000335630" "02717" "00446406" "03652" "Familial, autosomal recessive" "" "HP:0003577 Congenital onset \r\nHP:0002540 Inability to walk\r\nNo Seizure" "" "" "" "" "" "" "" "" "MDC1A" "" "" "0000337609" "00244" "00448421" "00435" "Familial, autosomal recessive" "04y" "Delayed motor and mental development\r\nDelayed speech\r\nrecurrent attacks of myoclonic and tonic-myoclonic seizures and attacks of status epilepticus\r\npelvic girdle muscle weakness, difficulty in climbing stairs and positive Gower\'s sign\r\nAn older brother with myopathy" "02y" "04y" "Myopathy" "Laminin Subunit Alpha 2" "" "" "" "" "LAMA2 muscular dystrophy (LAMA2-MD)" "Mental subnormality, epilepsy syndrome and myopathy" "" "0000338741" "02717" "00449567" "03652" "Familial, autosomal recessive" "" "Congenital onset (HP:0003577)\r\nInability to walk (HP:0002540) \r\nAbsent muscle fiber merosin (HP:0030091)" "" "" "" "" "" "" "" "" "MDC1A (# 607855)" "" "" "0000338743" "02717" "00449569" "03652" "Familial, autosomal recessive" "" "Congenital onset (A phenotypic abnormality that is present at birth.) (HP:0003577) \r\nInability to walk (HP:0002540) \r\nAbsent muscle fiber merosin (HP:0030091)\r\nHypointensity of cerebral white matter on MRI (HP:0007103)" "" "" "" "" "" "" "" "" "MDC1A (# 607855)" "" "" "0000341364" "02717" "00452804" "01164" "Familial, autosomal recessive" "07y" "Abnormality of the nervous system, Myopathy, Multiple joint contractures, Elevated circulating creatine kinase concentration" "" "" "" "" "" "" "" "" "" "" "" "0000341402" "02717" "00452839" "01164" "Familial, autosomal recessive" "09y" "Abnormality of the nervous system, Myopathy, Multiple joint contractures, Elevated circulating creatine kinase concentration" "00y" "" "" "" "" "" "" "" "" "" "" "0000346125" "00244" "00457666" "00006" "Familial, autosomal recessive" "" "see paper; ..., myopathy; abnormal skeletal muscle morphology; muscle weakness; abnormal muscle physiology; abnormal joint physiology" "" "" "" "" "" "" "" "" "LGMDR23" "congenital myopathy" "" "0000347955" "00360" "00460227" "00006" "Familial, autosomal recessive" "6y" "see paper; ..., motor retardation; hypotonia; gait difficulties" "" "" "" "" "" "" "" "" "LGMDR23" "congenital muscular dystrophy/myopathy" "" "0000350255" "05121" "00464193" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; intellectual disability; MRI brain periventricular leukomalacia; myopathic changes" "1d" "5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350256" "05121" "00464194" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; creatine kinase level 800 U/L; MRI brain periventricular leukopathy; myopathic changes" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350257" "05121" "00464195" "00006" "Familial, autosomal recessive" "" "" "1d" "1y6m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350258" "05121" "00464196" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 5668 U/L; EMG myogenic; MRI brain periventricular white matter lesions; myopathic changes" "1d" "9y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350259" "05121" "00464197" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; MRI brain periventricular leukomalacia;" "1d" "6y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350260" "05121" "00464198" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 1530 U/L; EMG myogenic; merosin-deficiency" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350261" "05121" "00464199" "00006" "Familial, autosomal recessive" "" "" "1d" "2y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350262" "05121" "00464200" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 919 U/L; MRI brain periventricular leukopathy; merosin-deficiency" "1d" "8y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350263" "05121" "00464201" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 2539 U/L; EMG myogenic; MRI brain periventricular leukopathy;" "1d" "2y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350264" "05121" "00464202" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; creatine kinase level 2102 U/L; EMG normal;" "1d" "5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350265" "05121" "00464203" "00006" "Familial, autosomal recessive" "" "" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350266" "05121" "00464204" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; creatine kinase level high; MRI brain congenital brain malformation;" "1d" "8y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350267" "05121" "00464205" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 1886 U/L; MRI brain periventricular leukomalacia;" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350268" "05121" "00464206" "00006" "Familial, autosomal recessive" "" "" "1d" "5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350269" "05121" "00464207" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 3000 U/L;" "1d" "6y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350270" "05121" "00464208" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation;" "1d" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350271" "05121" "00464209" "00006" "Familial, autosomal recessive" "" "" "1d" "6y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350272" "05121" "00464210" "00006" "Familial, autosomal recessive" "" "" "1d" "9y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350273" "05121" "00464211" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; creatine kinase level 2000 U/L; EMG neurogenic;" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350274" "05121" "00464212" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; no large joint contractures; creatine kinase level 2090 U/L; EMG myogenic;" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350275" "05121" "00464213" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; creatine kinase level 281 U/L; MRI brain periventricular leukopathy; myopathic changes, merosin-deficiency" "1m" "4y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350276" "05121" "00464214" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; creatine kinase level 3000 U/L; EMG normal; MRI brain periventricular leukopathy;" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350277" "05121" "00464215" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 4711 U/L; MRI brain periventricular leukopathy;" "1d" "2y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350278" "05121" "00464216" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; creatine kinase level 2119 U/L;" "1d" "2.5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350279" "05121" "00464217" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; creatine kinase level 3162 U/L;" "1d" "6m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350280" "05121" "00464218" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; no intellectual disability; creatine kinase level 1206 U/L; MRI brain frontal and temporal lobe atrophy;" "1d" "8y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350281" "05121" "00464219" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; MRI brain periventricular leukopathy, moderate cerebellar hypoplasia;" "1d" "7y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350282" "05121" "00464220" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation;" "1d" "11y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350283" "05121" "00464221" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; creatine kinase level 1498 U/L; EMG myogenic;" "1m" "2y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350284" "05121" "00464222" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures;" "" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350285" "05121" "00464223" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; creatine kinase level 4000 U/L; EMG normal;" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350286" "05121" "00464224" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; creatine kinase level 2912 U/L; EMG myogenic; MRI brain periventricular leukopathy; myopathic changes, merosin-deficiency" "1d" "5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350287" "05121" "00464225" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; creatine kinase level 1490 U/L; MRI brain periventricular leukopathy;" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350288" "05121" "00464226" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; intellectual disability; creatine kinase level 4656 U/L;" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350289" "05121" "00464227" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; no large joint contractures; lost ambulation; intellectual disability; creatine kinase level 297 U/L; EMG myogenic; MRI brain periventricular white matter lesions;" "1d" "12y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350290" "05121" "00464228" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 1156 U/L; MRI brain periventricular leukomalacia;" "1d" "10y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350291" "05121" "00464229" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures;" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350292" "05121" "00464230" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; no intellectual disability; creatine kinase level 3000 U/L; EMG normal; myopathic changes, merosin-deficiency" "1d" "10y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350293" "05121" "00464231" "00006" "Familial, autosomal recessive" "" "" "1d" "7y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350294" "05121" "00464232" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; creatine kinase level 952 U/L;" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350295" "05121" "00464233" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; no large joint contractures; lost ambulation; creatine kinase level 1834 U/L; EMG myogenic; MRI brain periventricular leukopathy;" "1m" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350296" "05121" "00464234" "00006" "Familial, autosomal recessive" "" "" "" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350297" "05121" "00464235" "00006" "Familial, autosomal recessive" "" "" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350298" "05121" "00464236" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; lost ambulation; creatine kinase level 1709 U/L;" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350299" "05121" "00464237" "00006" "Familial, autosomal recessive" "" "see paper; ..., creatine kinase level 1800 U/L;" "3m" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350300" "05121" "00464238" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology;" "1d" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350301" "05121" "00464239" "00006" "Familial, autosomal recessive" "" "see paper; ..., creatine kinase level 3944 U/L;" "4m" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350302" "05121" "00464240" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; creatine kinase level 600-4000 U/L; EMG myogenic; MRI brain hydrocephaly, periventricular leukopathy;" "1d" "3.5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350303" "05121" "00464241" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; creatine kinase level 48 U/L;" "21d" "38y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350304" "05121" "00464242" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation;" "1d" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350305" "05121" "00464243" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; large joint contractures; lost ambulation; MRI brain periventricular leukopathy;" "1d" "16y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350306" "05121" "00464244" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; creatine kinase level 1858 U/L;" "1d" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350307" "05121" "00464245" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; creatine kinase level 4027 U/L;" "1d" "5m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350308" "05121" "00464246" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; creatine kinase level 2000 U/L; EMG myogenic; MRI brain periventricular leukopathy;" "1d" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350309" "05121" "00464247" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; MRI brain periventricular leukopathy;" "1d" "4y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350310" "05121" "00464248" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; EMG myogenic; MRI brain ventriculomegaly;" "1d" "3m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350311" "05121" "00464249" "00006" "Familial, autosomal recessive" "" "" "" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350312" "05121" "00464250" "00006" "Familial, autosomal recessive" "" "" "1d" "6m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350313" "05121" "00464251" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development;" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350314" "05121" "00464252" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; lost ambulation; creatine kinase level 3102 U/L; EMG myogenic;" "1d" "3y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350315" "05121" "00464253" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; creatine kinase level 3776 U/L;" "1d" "8m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350316" "05121" "00464254" "00006" "Familial, autosomal recessive" "" "see paper; ..., creatine kinase level 6000 U/L;" "1d" "8m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350317" "05121" "00464255" "00006" "Familial, autosomal recessive" "" "see paper; ..., creatine kinase level 3643 U/L; EMG myogenic; MRI brain periventricular leukopathy; myopathic changes" "1d" "4y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350318" "05121" "00464256" "00006" "Familial, autosomal recessive" "" "" "1d" "1y9m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350319" "05121" "00464257" "00006" "Familial, autosomal recessive" "" "" "1d" "1y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350320" "05121" "00464258" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; creatine kinase level 1163 U/L; EMG neurogenic;" "1d" "8m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350321" "05121" "00464259" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation; creatine kinase level 840 U/L; EMG normal; MRI brain periventricular leukopathy;" "1d" "6y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350322" "05121" "00464260" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; creatine kinase level 367 U/L; EMG myogenic; MRI brain periventricular leukopathy;" "1d" "8y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350323" "05121" "00464261" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; creatine kinase level high; EMG myogenic;" "1d" "1.5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350324" "05121" "00464262" "00006" "Familial, autosomal recessive" "" "" "1d" "15y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350325" "05121" "00464263" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; creatine kinase level 3634 U/L; EMG normal; MRI brain periventricular leukopathy;" "1d" "2y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350326" "05121" "00464264" "00006" "Familial, autosomal recessive" "" "" "1d" "2.5y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350327" "05121" "00464265" "00006" "Familial, autosomal recessive" "" "see paper; ..., creatine kinase level 2597 U/L; EMG myogenic; MRI brain periventricular leukopathy, genral cerebral atrophy; myopathic changes" "1d" "8m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350328" "05121" "00464266" "00006" "Familial, autosomal recessive" "" "" "1d" "7y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350329" "05121" "00464267" "00006" "Familial, autosomal recessive" "" "" "1d" "11m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350330" "05121" "00464268" "00006" "Familial, autosomal recessive" "" "see paper; ..., myopathic changes" "1d" "15y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350331" "05121" "00464269" "00006" "Familial, autosomal recessive" "" "" "1d" "11y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350332" "05121" "00464270" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures;" "1d" "36y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350333" "05121" "00464271" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; creatine kinase level 2769 U/L; EMG motor neuropathy; MRI brain congenital brain malformation, Dandy-Walker malformation, periventricular leukomalacia;" "1d" "6m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350334" "05121" "00464272" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; lost ambulation; creatine kinase level 973 U/L; EMG myogenic;" "1d" "2y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350335" "05121" "00464273" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; lost ambulation; creatine kinase level 3097 U/L;" "1d" "1y4m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350336" "05121" "00464274" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; lost ambulation;" "1d" "46y" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350337" "05121" "00464275" "00006" "Familial, autosomal recessive" "" "" "" "4y3m" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000350338" "05121" "00464276" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 3150 U/L; MRI brain leukodystrophy;" "1d" "20y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000350339" "05121" "00464277" "00006" "Familial, autosomal recessive" "" "see paper; ..., hospitalisation neonatal pathology; delayed motor development; no large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 2800 U/L; MRI brain leukodystrophy;" "1d" "4y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000350340" "05121" "00464278" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; no large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 1872 U/L; MRI brain periventricular leukopathy;" "1d" "13y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000350341" "05121" "00464279" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; no delayed motor development; no large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 421 U/L; EMG myogenic; MRI brain periventricular leukopathy;" "" "40y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000350342" "05121" "00464280" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; no large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 1515 U/L;" "" "10y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000350343" "05121" "00464281" "00006" "Familial, autosomal recessive" "" "see paper; ..., delayed motor development; large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 780 U/L; EMG myogenic; MRI brain leukodystrophy; merosin-deficiency" "1d" "16y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000350344" "05121" "00464282" "00006" "Familial, autosomal recessive" "" "see paper; ..., no hospitalisation neonatal pathology; delayed motor development; no large joint contractures; still ambulamt; no intellectual disability; creatine kinase level 498 U/L; EMG myogenic;" "1 y" "26y" "" "" "" "" "" "" "LGMDR23" "muscular dystrophy" "" "0000351474" "02717" "00466088" "03652" "Familial, autosomal recessive" "03y" "Talipes equinovarus (HP:0001762), Hamstring contractures (HP:0003089), Motor delay (HP:0001270), Highly elevated creatine kinase (HP:0030234), Abnormal brainstem MRI signal intensity (HP:0012747), Macroglossia (HP:0000158)" "" "03y11m" "" "" "" "" "" "" "MDC1A (# 607855)" "MDC-1A" "" "0000351929" "05126" "00466566" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000351930" "05126" "00466567" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000351931" "05126" "00466568" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "LGMDR23" "limb-girdle muscular dystrophy" "" "0000352819" "00139" "00467608" "00006" "Familial, autosomal recessive" "06y" "see paper; ..., severe developmental delay (22m at 5.1y,) intellectual disability (IQ37); 18m-walk; speech two-word sentences, echolalia; behavior happy, social; no self-mutilation; hyperactivity; no triangular face; prominent forehead; no narrow/short palpebral fissures; deep-seated eyes; no sparse eyebrows; no low-set ears; no malar hypoplasia; broad nose; no short philtrum; no wide mouth; full lips (only full lower lip); widely spaced teeth; scoliosis; clinodactyly first toe; thickened skin over hands, transient erythroblastic anemia of childhood" "" "" "" "" "" "" "" "" "ALAZS" "intellectual disability" "" "0000353390" "00244" "00468238" "00006" "Unknown" "46y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353394" "00244" "00468242" "00006" "Unknown" "9y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353395" "00244" "00468243" "00006" "Unknown" "1y" "" "" "" "" "" "" "" "" "" "" "myopathy" "" "0000353431" "05121" "00468279" "00006" "Familial, autosomal recessive" "11y" "see paper ..., normal cognitive development, congenital hypotonia, severe muscle weakness, physical abnormalities, inability to walk; 12d-seizure, scoliosis, secondary joint contractures; elevated levels CPK ( 464U/L)" "" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000353433" "05121" "00468281" "00006" "Familial, autosomal recessive" "03y06m" "see paper; ..., 6m-feeding difficulty sucking, difficulty eating from spoon, difficulty chewing/drinking from cup), failure to thrive, weak cry, no sit, muscle weakness, hypotonia; cardiomyopathy; autism-like behavior" "" "" "" "" "" "" "" "" "MDC1A" "muscular dystrophy" "" "0000354210" "00198" "00469057" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the musculature" "" "0000354211" "00198" "00469058" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "abnormality of the musculature" "" "0000355551" "07210" "00470657" "00006" "Familial" "15y" "see paper; ... scoliosis, no other skeletal defects; no symptoms; physical activity; mother scoliosis, spondylolisthesis; father scoliosis" "" "" "" "" "" "" "" "" "" "severe adolescent idiopathic scoliosis" "" ## Screenings ## Do not remove or alter this header ## ## Count = 1202 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000012" "00000012" "1" "00004" "" "2012-05-11 13:18:38" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000017" "00000017" "1" "00004" "" "2012-05-11 13:18:40" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000018" "00000018" "1" "00004" "" "2012-05-11 13:18:40" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000036" "00000036" "1" "00004" "" "2012-05-11 13:18:44" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000039" "00000039" "1" "00004" "" "2012-05-11 13:18:46" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000040" "00000040" "1" "00004" "" "2012-05-11 13:18:46" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000048" "00000048" "1" "00004" "" "2012-05-11 13:18:48" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000049" "00000049" "1" "00004" "" "2012-05-11 13:18:49" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000054" "00000054" "1" "00004" "" "2012-05-11 13:18:51" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000057" "00000057" "1" "00004" "" "2012-05-11 13:18:52" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000069" "00000069" "1" "00004" "" "2012-05-11 13:18:57" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000071" "00000071" "1" "00004" "" "2012-05-11 13:18:58" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000075" "00000075" "1" "00004" "" "2012-05-11 13:19:00" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000090" "00000090" "1" "00004" "" "2012-05-11 13:19:16" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000092" "00000092" "1" "00004" "" "2012-05-11 13:19:17" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000099" "00000099" "1" "00004" "" "2012-05-11 13:19:38" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000000100" "00000100" "1" "00004" "" "2012-05-11 13:19:41" "00006" "2019-02-14 10:06:48" "SEQ-NG" "DNA" "" "" "0000036102" "00036032" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036103" "00036033" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036104" "00036034" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036105" "00036035" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036106" "00036036" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036107" "00036037" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036108" "00036038" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036110" "00036040" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036111" "00036041" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036112" "00036042" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036113" "00036043" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036114" "00036044" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036115" "00036045" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036116" "00036046" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036117" "00036047" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036118" "00036048" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036119" "00036049" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036120" "00036050" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036121" "00036051" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036122" "00036052" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036123" "00036053" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036124" "00036054" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036125" "00036055" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000036127" "00036057" "1" "01164" "00008" "2015-04-02 13:01:39" "" "" "SEQ" "DNA" "" "" "0000054621" "00054672" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054625" "00054676" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054626" "00054677" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000054630" "00054681" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054637" "00054688" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000054640" "00054691" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000054642" "00054693" "1" "01399" "01399" "2015-11-08 12:06:11" "" "" "SEQ" "DNA" "" "" "0000088335" "00088192" "1" "01822" "01822" "2016-11-24 16:37:52" "" "" "SEQ" "DNA" "" "" "0000102565" "00102114" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102566" "00102115" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102567" "00102116" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 18:55:42" "RT-PCR" "DNA;RNA" "" "" "0000102568" "00102117" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102569" "00102118" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102570" "00102119" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102571" "00102120" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102572" "00102121" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 18:26:59" "RT-PCR;DHPLC" "DNA;RNA" "" "" "0000102573" "00102122" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102574" "00102123" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102575" "00102124" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102576" "00102125" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-10 11:45:58" "SEQ" "DNA" "" "" "0000102577" "00102126" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 18:26:59" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102578" "00102127" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102579" "00102128" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:55:42" "SEQ" "DNA" "" "" "0000102580" "00102129" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102581" "00102130" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102582" "00102131" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102583" "00102132" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102584" "00102133" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102585" "00102134" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102586" "00102135" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102587" "00102136" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102588" "00102137" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102589" "00102138" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102590" "00102139" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:08:25" "SEQ" "DNA" "" "" "0000102591" "00102140" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102592" "00102141" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102593" "00102142" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102594" "00102143" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:08:25" "RT-PCR;DHPLC" "DNA;RNA" "" "" "0000102595" "00102144" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102596" "00102145" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:08:25" "RT-PCR;SSCA" "DNA;RNA" "" "" "0000102597" "00102146" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SEQ;SSCA" "DNA;RNA" "" "" "0000102598" "00102147" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-04 16:10:17" "RT-PCR;SSCA" "DNA;RNA" "" "" "0000102599" "00102148" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-04 16:10:17" "RT-PCR;SSCA" "DNA;RNA" "" "" "0000102600" "00102149" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-04 16:10:17" "RT-PCR;SSCA" "DNA;RNA" "" "" "0000102601" "00102150" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102602" "00102151" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102603" "00102152" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102604" "00102153" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102605" "00102154" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 18:26:59" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102606" "00102155" "0" "00006" "00006" "2007-10-08 08:33:42" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102607" "00102156" "0" "00426" "00426" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102608" "00102157" "0" "00426" "00426" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102609" "00102158" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SEQ;SSCA" "DNA;RNA" "" "" "0000102610" "00102159" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102611" "00102160" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SEQ" "DNA" "" "" "0000102612" "00102161" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102613" "00102162" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102614" "00102163" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102615" "00102164" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SSCA" "DNA;RNA" "" "" "0000102616" "00102165" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102617" "00102166" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SSCA" "DNA" "" "" "0000102618" "00102167" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SSCA;SEQ" "DNA" "" "" "0000102619" "00102168" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102620" "00102169" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SSCA" "DNA" "" "" "0000102621" "00102170" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:31:36" "RT-PCR;SSCA;SEQ" "DNA;RNA" "" "" "0000102622" "00102171" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102623" "00102172" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:03:40" "RT-PCR;SSCA;SEQ" "DNA;RNA" "" "" "0000102624" "00102173" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SSCA" "DNA" "" "" "0000102625" "00102174" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102626" "00102175" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SEQ" "DNA" "" "" "0000102627" "00102176" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102628" "00102177" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102629" "00102178" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SEQ" "DNA" "" "" "0000102630" "00102179" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102631" "00102180" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102632" "00102181" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:03:40" "SEQ" "DNA" "" "" "0000102633" "00102182" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102634" "00102183" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102635" "00102184" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SSCA" "DNA" "" "" "0000102636" "00102185" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102637" "00102186" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102638" "00102187" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-10 11:32:48" "SEQ;SSCA" "DNA" "" "" "0000102639" "00102188" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "SEQ" "DNA" "" "" "0000102640" "00102189" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102641" "00102190" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-10 11:44:45" "SSCA" "DNA" "" "" "0000102642" "00102191" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102643" "00102192" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102644" "00102193" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "SSCA;SEQ" "DNA" "" "" "0000102645" "00102194" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-10 11:43:51" "SSCA" "DNA" "" "" "0000102646" "00102195" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "RT-PCR;SSCA;SEQ" "DNA;RNA" "" "" "0000102647" "00102196" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SSCA;SEQ" "DNA" "" "" "0000102648" "00102197" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102649" "00102198" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SSCA;SEQ" "DNA" "" "" "0000102650" "00102199" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:00" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102651" "00102200" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ;SSCA" "DNA" "" "" "0000102652" "00102201" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "RT-PCR;SSCA" "DNA;RNA" "" "" "0000102653" "00102202" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-10 11:36:08" "SSCA" "DNA" "" "" "0000102654" "00102203" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-10 11:42:25" "SSCA" "DNA" "" "" "0000102655" "00102204" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102656" "00102205" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102657" "00102206" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:38:29" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102658" "00102207" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-10 11:37:50" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102659" "00102208" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102660" "00102209" "1" "00400" "00400" "2007-10-08 08:33:43" "00503" "2017-04-01 00:49:32" "SEQ" "DNA" "" "" "0000102661" "00102210" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "SEQ" "DNA" "" "" "0000102662" "00102211" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "SEQ" "DNA" "" "" "0000102663" "00102212" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102664" "00102213" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102665" "00102214" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102666" "00102215" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102667" "00102216" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102668" "00102217" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102669" "00102218" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102670" "00102219" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102671" "00102220" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102672" "00102221" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102673" "00102222" "0" "00006" "00006" "2006-09-16 10:41:03" "00006" "2013-02-01 19:44:12" "SEQ" "DNA;RNA" "" "" "0000102674" "00102223" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102675" "00102224" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "RT-PCR;SSCA;SEQ" "DNA;RNA" "" "" "0000102676" "00102225" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102677" "00102226" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102678" "00102227" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102679" "00102228" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102680" "00102229" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102681" "00102230" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102682" "00102231" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102683" "00102232" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102684" "00102233" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102685" "00102234" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102686" "00102235" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102687" "00102236" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102688" "00102237" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102689" "00102238" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102690" "00102239" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102691" "00102240" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SEQ" "DNA" "" "" "0000102692" "00102241" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:26:59" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102693" "00102242" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102694" "00102243" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102695" "00102244" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102696" "00102245" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102697" "00102246" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102698" "00102247" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:00" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102699" "00102248" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102700" "00102249" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102701" "00102250" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102702" "00102251" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102703" "00102252" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102704" "00102253" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102705" "00102254" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102706" "00102255" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102707" "00102256" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102708" "00102257" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102709" "00102258" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102710" "00102259" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102711" "00102260" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102712" "00102261" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102713" "00102262" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102714" "00102263" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102715" "00102264" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102716" "00102265" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102717" "00102266" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102718" "00102267" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102719" "00102268" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102720" "00102269" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:08:25" "RT-PCR;DHPLC" "DNA;RNA" "" "" "0000102721" "00102270" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102722" "00102271" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102723" "00102272" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102724" "00102273" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102725" "00102274" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102726" "00102275" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102727" "00102276" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102728" "00102277" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102729" "00102278" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102730" "00102279" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102731" "00102280" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102732" "00102281" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102733" "00102282" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102734" "00102283" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102735" "00102284" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102736" "00102285" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102737" "00102286" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102738" "00102287" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102739" "00102288" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102740" "00102289" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102741" "00102290" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102742" "00102291" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102743" "00102292" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102744" "00102293" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102745" "00102294" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102746" "00102295" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102747" "00102296" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102748" "00102297" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA;SEQ" "DNA" "" "" "0000102749" "00102298" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "SEQ" "DNA" "" "" "0000102750" "00102299" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102751" "00102300" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102752" "00102301" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102753" "00102302" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102754" "00102303" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102755" "00102304" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102756" "00102305" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA" "" "" "0000102757" "00102306" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102758" "00102307" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102759" "00102308" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SSCA" "DNA;RNA" "" "" "0000102760" "00102309" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102761" "00102310" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102762" "00102311" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102763" "00102312" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102764" "00102313" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102765" "00102314" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102766" "00102315" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102767" "00102316" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102768" "00102317" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102769" "00102318" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102770" "00102319" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:39:26" "SEQ" "DNA;RNA" "" "" "0000102771" "00102320" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:00" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102772" "00102321" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102773" "00102322" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2013-02-01 19:44:12" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102774" "00102323" "0" "00464" "00464" "2007-12-28 17:05:35" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102775" "00102324" "0" "00464" "00464" "2008-01-10 21:04:07" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102776" "00102325" "0" "01951" "01951" "2008-01-18 20:06:04" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102777" "00102326" "0" "01416" "01416" "2008-02-12 12:41:22" "00006" "2012-03-09 19:46:27" "SEQ" "DNA" "" "" "0000102778" "00102327" "0" "00464" "00464" "2008-02-15 20:23:20" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102779" "00102328" "0" "00464" "00464" "2008-02-15 20:28:09" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102780" "00102329" "0" "00464" "00464" "2008-02-15 20:38:55" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102781" "00102330" "0" "00464" "00464" "2008-02-15 20:45:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102782" "00102331" "0" "00464" "00464" "2008-02-15 20:52:39" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102783" "00102332" "0" "01416" "01416" "2008-02-26 14:51:57" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102784" "00102333" "0" "01416" "01416" "2008-03-06 10:47:02" "00006" "2013-02-01 19:44:12" "DHPLC" "DNA" "" "" "0000102785" "00102334" "0" "00464" "00464" "2008-03-14 22:05:49" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102786" "00102335" "0" "00464" "00464" "2008-03-14 22:12:28" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102787" "00102336" "0" "00464" "00464" "2008-03-14 22:17:34" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102788" "00102337" "0" "00464" "00464" "2008-03-21 16:48:24" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102789" "00102338" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-10 11:38:19" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102790" "00102339" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102791" "00102340" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102792" "00102341" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 19:02:29" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102793" "00102342" "0" "00464" "00464" "2008-04-14 22:50:55" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102800" "00102349" "0" "00464" "00464" "2008-06-05 19:13:07" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102801" "00102350" "1" "00006" "00006" "2008-06-06 17:44:20" "00006" "2017-03-31 15:27:18" "SEQ" "DNA" "" "" "0000102802" "00102351" "0" "00006" "00006" "2008-06-06 17:45:48" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102803" "00102352" "0" "00464" "00464" "2008-06-06 22:16:02" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102804" "00102353" "0" "00464" "00464" "2008-06-06 22:19:13" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102805" "00102354" "0" "00464" "00464" "2008-06-09 16:31:44" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102806" "00102355" "0" "00464" "00464" "2008-06-10 22:56:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102807" "00102356" "0" "00471" "00471" "2008-06-27 10:50:41" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102808" "00102357" "0" "00471" "00471" "2008-06-27 10:52:19" "00006" "2012-03-09 18:26:59" "SEQ" "DNA" "" "" "0000102809" "00102358" "0" "00464" "00464" "2008-07-03 18:43:41" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102810" "00102359" "0" "00464" "00464" "2008-08-06 20:38:14" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102811" "00102360" "0" "00464" "00464" "2008-08-08 18:23:50" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102812" "00102361" "0" "00464" "00464" "2008-08-14 15:35:25" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102813" "00102362" "0" "00464" "00464" "2008-09-29 18:03:39" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102814" "00102363" "0" "00464" "00464" "2008-12-22 22:23:30" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102815" "00102364" "0" "00464" "00464" "2009-02-03 18:02:32" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102816" "00102365" "0" "00464" "00464" "2009-02-16 22:06:08" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102817" "00102366" "0" "00464" "00464" "2009-02-25 19:02:58" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102818" "00102367" "0" "00464" "00464" "2009-03-05 21:24:57" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102819" "00102368" "0" "00464" "00464" "2009-03-13 19:11:02" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102820" "00102369" "0" "00464" "00464" "2009-03-13 19:16:32" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102821" "00102370" "0" "00464" "00464" "2009-04-01 00:08:41" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102822" "00102371" "0" "00464" "00464" "2009-04-07 22:21:52" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102823" "00102372" "0" "00464" "00464" "2009-05-07 19:28:07" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102824" "00102373" "0" "00464" "00464" "2009-05-18 21:01:42" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102825" "00102374" "0" "00486" "00486" "2009-07-13 17:52:28" "00006" "2013-02-01 19:44:12" "PCR" "DNA" "" "" "0000102826" "00102375" "0" "00464" "00464" "2009-07-13 21:10:23" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102827" "00102376" "0" "00464" "00464" "2009-07-17 16:42:46" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102828" "00102377" "0" "00464" "00464" "2009-07-17 18:31:01" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102829" "00102378" "0" "00464" "00464" "2009-07-24 22:05:32" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102830" "00102379" "0" "00464" "00464" "2009-08-03 21:36:30" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102831" "00102380" "0" "00464" "00464" "2009-08-14 16:39:08" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102832" "00102381" "0" "00464" "00464" "2009-08-28 22:07:34" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102833" "00102382" "0" "00464" "00464" "2009-09-04 23:02:21" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102834" "00102383" "0" "00464" "00464" "2009-09-17 21:09:21" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102835" "00102384" "0" "00464" "00464" "2009-09-18 21:08:09" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102836" "00102385" "0" "00464" "00464" "2009-10-02 16:10:59" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102837" "00102386" "0" "00464" "00464" "2009-10-05 22:23:01" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102838" "00102387" "0" "00464" "00464" "2009-10-21 16:50:47" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102839" "00102388" "0" "00464" "00464" "2009-11-13 16:04:09" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102840" "00102389" "0" "00464" "00464" "2009-12-07 17:08:20" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102841" "00102390" "0" "00464" "00464" "2010-01-13 16:55:51" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102842" "00102391" "0" "00464" "00464" "2010-01-14 20:59:19" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102843" "00102392" "0" "00464" "00464" "2010-01-15 16:57:28" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102844" "00102393" "0" "00464" "00464" "2010-01-15 17:10:30" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102845" "00102394" "0" "00464" "00464" "2010-01-15 17:26:43" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102846" "00102395" "0" "00464" "00464" "2010-01-22 20:00:12" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102847" "00102396" "0" "00464" "00464" "2010-03-03 18:43:10" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102848" "00102397" "0" "00464" "00464" "2010-03-04 16:44:42" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102849" "00102398" "0" "00464" "00464" "2010-03-19 19:47:33" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102850" "00102399" "0" "00464" "00464" "2010-03-22 20:06:55" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102851" "00102400" "0" "00464" "00464" "2010-04-01 19:32:26" "00006" "2012-03-10 11:33:38" "PCR;SEQ" "DNA" "" "" "0000102852" "00102401" "0" "00464" "00464" "2010-04-01 19:38:01" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102853" "00102402" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102854" "00102403" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102855" "00102404" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102856" "00102405" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102857" "00102406" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102858" "00102407" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102859" "00102408" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102860" "00102409" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102861" "00102410" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102862" "00102411" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102863" "00102412" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102864" "00102413" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102865" "00102414" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102866" "00102415" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102867" "00102416" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102868" "00102417" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102869" "00102418" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102870" "00102419" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102871" "00102420" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102872" "00102421" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102873" "00102422" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102874" "00102423" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102875" "00102424" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102876" "00102425" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102877" "00102426" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102878" "00102427" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102879" "00102428" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102880" "00102429" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2012-03-10 11:40:15" "SEQ;SSCA" "DNA" "" "" "0000102881" "00102430" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102882" "00102431" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102883" "00102432" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102885" "00102434" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102886" "00102435" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102887" "00102436" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102888" "00102437" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102889" "00102438" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102890" "00102439" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102891" "00102440" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102892" "00102441" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102893" "00102442" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102894" "00102443" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102895" "00102444" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102896" "00102445" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102897" "00102446" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102898" "00102447" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102899" "00102448" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102900" "00102449" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102901" "00102450" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102902" "00102451" "0" "00006" "00006" "2010-04-11 22:50:18" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102903" "00102452" "0" "00464" "00464" "2010-06-03 17:52:57" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102904" "00102453" "0" "00464" "00464" "2010-06-07 17:29:16" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102906" "00102455" "0" "00464" "00464" "2010-07-06 18:21:03" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102907" "00102456" "0" "00464" "00464" "2010-07-06 18:23:11" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102908" "00102457" "0" "00464" "00464" "2010-07-06 18:31:11" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102909" "00102458" "0" "00464" "00464" "2010-07-06 18:33:37" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102910" "00102459" "0" "00464" "00464" "2010-08-10 18:30:36" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102911" "00102460" "0" "00464" "00464" "2010-08-20 19:45:19" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102912" "00102461" "0" "00464" "00464" "2010-10-14 22:27:11" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102913" "00102462" "0" "00464" "00464" "2010-10-14 22:35:15" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102914" "00102463" "0" "00464" "00464" "2010-10-14 22:56:41" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102915" "00102464" "0" "00006" "00006" "2010-11-12 15:54:06" "00006" "2013-02-01 19:44:12" "SEQ-NG-S;SEQ" "DNA" "" "" "0000102916" "00102465" "0" "00464" "00464" "2010-11-23 20:45:37" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102917" "00102466" "0" "00464" "00464" "2010-11-23 20:49:08" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102918" "00102467" "0" "00464" "00464" "2010-11-23 20:53:41" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102919" "00102468" "0" "00464" "00464" "2010-11-23 21:04:08" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102920" "00102469" "0" "00464" "00464" "2011-04-18 20:57:18" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102921" "00102470" "0" "00464" "00464" "2011-04-18 21:03:24" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102922" "00102471" "0" "00464" "00464" "2011-04-18 21:07:44" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102923" "00102472" "0" "00464" "00464" "2011-04-18 21:21:24" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102924" "00102473" "0" "00464" "00464" "2011-04-18 21:26:28" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102925" "00102474" "0" "00464" "00464" "2011-04-18 21:30:04" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102926" "00102475" "1" "00464" "00464" "2011-04-18 21:35:39" "00503" "2017-10-13 18:05:33" "arrayCGH" "DNA" "" "" "0000102927" "00102476" "0" "00464" "00464" "2011-05-12 20:45:21" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102928" "00102477" "0" "00464" "00464" "2011-08-30 22:16:49" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102929" "00102478" "0" "00464" "00464" "2011-08-30 22:22:57" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102930" "00102479" "0" "00464" "00464" "2011-09-02 18:06:04" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102931" "00102480" "0" "00464" "00464" "2011-09-02 21:52:57" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102932" "00102481" "0" "00464" "00464" "2011-09-02 22:02:18" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102933" "00102482" "0" "00464" "00464" "2011-09-19 18:15:46" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102934" "00102483" "0" "00464" "00464" "2011-09-19 18:33:44" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102935" "00102484" "0" "00464" "00464" "2011-09-19 18:36:54" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102936" "00102485" "0" "00464" "00464" "2011-09-19 18:39:29" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102937" "00102486" "0" "00464" "00464" "2011-12-20 11:34:16" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102938" "00102487" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "RT-PCR;SSCA;DHPLC" "DNA;RNA" "" "" "0000102939" "00102488" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102940" "00102489" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102941" "00102490" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102942" "00102491" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102943" "00102492" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-09 18:55:42" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102944" "00102493" "0" "00006" "00006" "2007-10-08 08:33:43" "00006" "2012-03-04 16:10:17" "SEQ" "DNA" "" "" "0000102945" "00102494" "0" "00006" "00006" "2011-12-20 00:00:32" "00006" "2013-02-01 19:44:12" "SEQ;SSCA" "DNA" "" "" "0000102946" "00102495" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102947" "00102496" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 19:08:25" "SEQ" "DNA" "" "" "0000102948" "00102497" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102949" "00102498" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102950" "00102499" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102951" "00102500" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102952" "00102501" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 19:08:25" "SEQ" "DNA" "" "" "0000102953" "00102502" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102954" "00102503" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102955" "00102504" "0" "00400" "00400" "2011-12-20 00:00:32" "00006" "2012-03-10 10:37:27" "SEQ" "DNA" "" "" "0000102956" "00102505" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102957" "00102506" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102958" "00102507" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102959" "00102508" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102960" "00102509" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102961" "00102510" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102962" "00102511" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102963" "00102512" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102964" "00102513" "0" "00400" "00400" "2007-10-08 08:33:43" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102965" "00102514" "0" "00006" "00006" "2011-12-20 00:00:32" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102966" "00102515" "0" "00006" "00006" "2011-12-20 00:00:32" "00006" "2012-03-10 11:47:26" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102967" "00102516" "0" "00426" "00426" "2011-12-20 00:00:32" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102968" "00102517" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2012-03-04 16:10:17" "SEQ" "DNA" "" "" "0000102969" "00102518" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102970" "00102519" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102971" "00102520" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102972" "00102521" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102973" "00102522" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102974" "00102523" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "SEQ" "DNA" "" "" "0000102975" "00102524" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102976" "00102525" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102977" "00102526" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102978" "00102527" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102979" "00102528" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102980" "00102529" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102981" "00102530" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102982" "00102531" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102983" "00102532" "0" "00006" "00006" "2011-12-20 00:00:33" "00006" "2013-02-01 19:44:12" "RT-PCR;SEQ;SSCA" "DNA;RNA" "" "" "0000102984" "00102533" "0" "00006" "00006" "1998-07-01 12:00:00" "00006" "2012-03-09 19:39:26" "PTT;SSCA;SEQ" "DNA;RNA" "" "" "0000102985" "00102534" "0" "00006" "00006" "2011-12-20 10:07:19" "00006" "2012-03-09 18:27:00" "SEQ" "DNA" "" "" "0000102986" "00102535" "0" "00464" "00464" "2012-01-06 15:56:29" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102987" "00102536" "0" "00464" "00464" "2012-02-20 17:45:15" "00006" "2013-02-01 19:44:12" "PCR;SEQ" "DNA" "" "" "0000102988" "00102537" "1" "00426" "00426" "2012-03-10 16:33:47" "00006" "2017-03-31 15:32:56" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102992" "00102541" "0" "00426" "00426" "2012-03-10 16:33:47" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102994" "00102543" "1" "00426" "00426" "2012-03-10 16:33:47" "00006" "2017-03-31 15:10:24" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000102995" "00102544" "1" "00426" "00426" "2012-03-10 16:33:47" "00006" "2017-03-31 15:14:00" "SEQ" "DNA" "" "" "0000102997" "00102546" "1" "00426" "00426" "2012-03-10 16:33:47" "00006" "2017-03-31 15:17:16" "SEQ" "DNA" "" "" "0000102998" "00102547" "0" "00464" "00464" "2012-05-30 18:26:39" "00006" "2012-05-30 21:54:52" "PCR;SEQ" "DNA" "" "" "0000102999" "00102548" "0" "00464" "00464" "2012-06-04 16:54:09" "" "" "PCR;SEQ" "DNA" "" "" "0000103000" "00102549" "0" "00464" "00464" "2012-10-16 22:47:19" "00006" "2012-10-23 21:02:50" "PCR;SEQ" "DNA" "" "" "0000103002" "00102551" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103003" "00102552" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103004" "00102553" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103005" "00102554" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103006" "00102555" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103007" "00102556" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103008" "00102557" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103009" "00102558" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103010" "00102559" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103011" "00102560" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103012" "00102561" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103013" "00102562" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103014" "00102563" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103015" "00102564" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103016" "00102565" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103017" "00102566" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103018" "00102567" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103019" "00102568" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103020" "00102569" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103021" "00102570" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103022" "00102571" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103023" "00102572" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103024" "00102573" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103025" "00102574" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103026" "00102575" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103027" "00102576" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103028" "00102577" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103029" "00102578" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103030" "00102579" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103031" "00102580" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103032" "00102581" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103033" "00102582" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103034" "00102583" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103035" "00102584" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103036" "00102585" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103037" "00102586" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103038" "00102587" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103039" "00102588" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103040" "00102589" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103041" "00102590" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103042" "00102591" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103043" "00102592" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103044" "00102593" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103045" "00102594" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103046" "00102595" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103047" "00102596" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103048" "00102597" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103049" "00102598" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103050" "00102599" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103051" "00102600" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103052" "00102601" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103053" "00102602" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103054" "00102603" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103055" "00102604" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103056" "00102605" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103057" "00102606" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103058" "00102607" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103059" "00102608" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103060" "00102609" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103061" "00102610" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103062" "00102611" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103063" "00102612" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103064" "00102613" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103065" "00102614" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103066" "00102615" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103067" "00102616" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103068" "00102617" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103069" "00102618" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103070" "00102619" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103071" "00102620" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103072" "00102621" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103073" "00102622" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103074" "00102623" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103075" "00102624" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103076" "00102625" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103077" "00102626" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103078" "00102627" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103079" "00102628" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103080" "00102629" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103081" "00102630" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103082" "00102631" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103083" "00102632" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103084" "00102633" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103085" "00102634" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103086" "00102635" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103087" "00102636" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103088" "00102637" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103089" "00102638" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103090" "00102639" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103091" "00102640" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103092" "00102641" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103093" "00102642" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103094" "00102643" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103095" "00102644" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103096" "00102645" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103097" "00102646" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103098" "00102647" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103099" "00102648" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103100" "00102649" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103101" "00102650" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103102" "00102651" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103103" "00102652" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103104" "00102653" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103105" "00102654" "0" "00430" "00430" "2012-10-23 15:54:39" "" "" "SEQ" "DNA" "" "" "0000103106" "00102655" "0" "00464" "00464" "2012-10-23 20:25:24" "00006" "2012-10-23 21:00:04" "PCR;SEQ" "DNA" "" "" "0000103107" "00102656" "0" "00464" "00464" "2013-01-15 21:35:42" "00006" "2013-01-17 21:24:35" "PCR;SEQ" "DNA" "" "" "0000103108" "00102657" "0" "00464" "00464" "2013-05-02 19:13:28" "00006" "2013-05-03 09:55:48" "PCR;SEQ" "DNA" "" "" "0000103109" "00102658" "0" "00464" "00464" "2013-06-28 23:22:55" "00006" "2013-06-29 20:50:52" "PCR;SEQ" "DNA" "" "" "0000103110" "00102659" "0" "00464" "00464" "2013-07-22 22:39:25" "00006" "2013-07-23 22:22:13" "PCR;SEQ" "DNA" "" "" "0000103111" "00102660" "0" "00464" "00464" "2013-10-31 15:28:29" "00006" "2013-11-01 17:15:34" "PCR;SEQ" "DNA" "" "" "0000103112" "00102661" "0" "00464" "00464" "2014-05-28 18:12:20" "00006" "2014-05-30 13:55:18" "PCR;SEQ" "DNA" "" "" "0000103113" "00102662" "1" "00464" "00464" "2014-06-06 19:29:32" "00503" "2017-10-13 18:11:49" "SEQ;SEQ-NG" "DNA" "" "" "0000103114" "00102663" "0" "00464" "00464" "2014-09-24 19:40:18" "00006" "2014-09-26 23:37:51" "PCR;SEQ" "DNA" "" "" "0000103115" "00102664" "0" "00527" "00527" "2014-11-27 00:29:00" "00006" "2014-11-29 15:29:06" "arrayCGH;SEQ;SEQ-NG" "DNA" "" "" "0000103116" "00102665" "0" "01953" "01953" "2015-01-08 23:16:43" "00006" "2015-01-17 12:50:43" "SEQ" "DNA" "" "" "0000103117" "00102666" "0" "01700" "01700" "2015-12-10 17:23:39" "" "" "SEQ-NG-I" "DNA" "" "" "0000103118" "00102667" "0" "01715" "01715" "2016-02-19 00:07:36" "00006" "2016-03-18 12:53:14" "SEQ-NG-I" "DNA" "" "" "0000103119" "00102668" "0" "01715" "01715" "2016-02-19 00:10:45" "" "" "SEQ-NG-I" "DNA" "" "" "0000103163" "00102496" "1" "00503" "00503" "2017-04-01 00:37:08" "" "" "MLPA;PCRlr;SEQ" "DNA" "" "" "0000103164" "00102713" "1" "00503" "00503" "2017-04-01 01:00:00" "" "" "SEQ" "DNA" "" "" "0000103165" "00102714" "1" "00503" "00503" "2017-04-01 01:05:30" "" "" "SEQ" "DNA" "" "" "0000103166" "00102715" "1" "00503" "00503" "2017-04-01 01:23:29" "" "" "MLPA;SEQ" "DNA" "" "" "0000103167" "00102501" "1" "00503" "00503" "2017-04-01 11:50:49" "" "" "MLPA;RT-PCR;SEQ" "DNA;RNA" "" "" "0000103168" "00102716" "1" "00503" "00503" "2017-04-01 12:40:15" "" "" "SEQ" "DNA" "" "" "0000103169" "00102717" "1" "00503" "00503" "2017-04-01 12:48:31" "" "" "SEQ" "DNA" "" "" "0000103170" "00102718" "1" "00503" "00503" "2017-04-01 12:56:46" "" "" "SEQ" "DNA" "" "" "0000103171" "00102719" "1" "00503" "00503" "2017-04-01 15:12:31" "" "" "SEQ" "DNA" "" "" "0000103172" "00102720" "1" "00503" "00503" "2017-04-01 15:18:48" "" "" "SEQ" "DNA" "" "" "0000103173" "00102721" "1" "00503" "00503" "2017-04-01 15:21:33" "" "" "SEQ" "DNA" "" "" "0000103174" "00102722" "1" "00503" "00503" "2017-04-01 16:48:26" "" "" "SEQ" "DNA" "" "" "0000103175" "00102723" "1" "00503" "00503" "2017-04-01 17:28:25" "" "" "SEQ" "DNA" "" "" "0000103176" "00102724" "1" "00503" "00503" "2017-04-01 17:46:57" "" "" "SEQ" "DNA" "" "" "0000103177" "00102725" "1" "00503" "00503" "2017-04-01 18:09:33" "" "" "SEQ" "DNA" "" "" "0000103178" "00102726" "1" "00503" "00503" "2017-04-01 18:19:38" "" "" "SEQ" "DNA" "" "" "0000103179" "00102727" "1" "00503" "00503" "2017-04-01 18:29:16" "" "" "SEQ" "DNA" "" "" "0000103180" "00102728" "1" "00503" "00503" "2017-04-01 23:07:57" "" "" "SEQ" "DNA" "" "" "0000103183" "00102729" "1" "00503" "00503" "2017-04-02 15:52:28" "" "" "SEQ" "DNA" "" "" "0000103184" "00102731" "1" "00503" "00503" "2017-04-02 16:11:13" "" "" "SEQ" "DNA" "" "" "0000103185" "00102732" "1" "00503" "00503" "2017-04-02 16:24:27" "" "" "SEQ" "DNA" "" "" "0000103186" "00102733" "1" "00503" "00503" "2017-04-02 16:49:24" "" "" "MLPA;SEQ;Southern" "DNA" "" "" "0000103187" "00102734" "1" "00503" "00503" "2017-04-02 18:32:15" "" "" "SEQ" "DNA" "" "" "0000103188" "00102735" "1" "00503" "00503" "2017-04-02 20:15:26" "00503" "2017-08-31 14:08:16" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000103189" "00102736" "1" "00503" "00503" "2017-04-02 21:03:55" "" "" "SEQ" "DNA" "" "" "0000103190" "00102737" "1" "00503" "00503" "2017-04-02 23:54:34" "" "" "SEQ" "DNA" "" "" "0000103579" "00103126" "1" "00503" "00503" "2017-04-04 23:08:55" "" "" "SEQ" "DNA" "" "" "0000103580" "00103127" "1" "00503" "00503" "2017-04-04 23:18:08" "" "" "SEQ" "DNA" "" "" "0000103581" "00103128" "1" "00503" "00503" "2017-04-04 23:26:21" "" "" "SEQ" "DNA" "" "" "0000103582" "00103129" "1" "00503" "00503" "2017-04-04 23:34:34" "" "" "SEQ" "DNA" "" "" "0000103584" "00103130" "1" "00503" "00503" "2017-04-05 01:11:28" "" "" "SEQ" "DNA" "" "" "0000103585" "00103131" "1" "00503" "00503" "2017-04-05 01:16:26" "" "" "SEQ" "DNA" "" "" "0000103643" "00103189" "1" "00503" "00503" "2017-04-05 11:45:04" "" "" "SEQ" "DNA" "" "" "0000103645" "00103191" "1" "00503" "00503" "2017-04-05 11:48:52" "" "" "SEQ" "DNA" "" "" "0000103646" "00103192" "1" "00503" "00503" "2017-04-05 11:54:31" "" "" "SEQ" "DNA" "" "" "0000103648" "00103195" "1" "00503" "00503" "2017-04-05 12:04:10" "" "" "SEQ" "DNA" "" "" "0000103660" "00103206" "1" "00503" "00503" "2017-04-05 16:40:02" "" "" "SEQ" "DNA" "" "" "0000103661" "00103207" "1" "00503" "00503" "2017-04-05 17:43:45" "00503" "2017-04-06 02:15:01" "SEQ-NG-IT" "DNA" "" "" "0000103665" "00102667" "1" "01715" "00503" "2017-04-07 23:35:24" "00503" "2017-04-07 23:40:35" "SEQ-NG-I" "DNA" "" "" "0000103675" "00103219" "1" "00503" "00503" "2017-04-11 01:00:41" "" "" "SEQ" "DNA" "" "" "0000103676" "00103220" "1" "00503" "00503" "2017-04-11 01:18:56" "" "" "SEQ" "DNA" "" "" "0000103677" "00103221" "1" "00503" "00503" "2017-04-11 01:33:58" "" "" "SEQ" "DNA" "" "" "0000103678" "00103222" "1" "00503" "00503" "2017-04-11 01:52:52" "" "" "SEQ" "DNA" "" "" "0000103683" "00103226" "1" "00503" "00503" "2017-04-11 14:53:18" "" "" "SEQ" "DNA" "" "" "0000103684" "00103228" "1" "00503" "00503" "2017-04-11 15:06:13" "" "" "SEQ" "DNA" "" "" "0000103685" "00103229" "1" "00503" "00503" "2017-04-11 15:37:07" "" "" "SEQ" "DNA" "" "" "0000103687" "00103231" "1" "00503" "00503" "2017-04-11 20:24:28" "" "" "SEQ" "DNA" "" "" "0000103689" "00103234" "1" "00503" "00503" "2017-04-11 21:02:32" "" "" "SEQ" "DNA" "" "" "0000103690" "00103235" "1" "00503" "00503" "2017-04-11 21:22:11" "" "" "SEQ-NG" "DNA" "" "" "0000103691" "00103236" "1" "00503" "00503" "2017-04-11 21:29:34" "" "" "SEQ-NG" "DNA" "" "" "0000103699" "00103244" "1" "00503" "00503" "2017-04-11 22:25:28" "" "" "SEQ-NG" "DNA" "" "" "0000103700" "00103245" "1" "00503" "00503" "2017-04-11 23:27:01" "" "" "SEQ-NG" "DNA" "" "" "0000103701" "00103246" "1" "00503" "00503" "2017-04-12 00:39:05" "" "" "SEQ-NG" "DNA" "" "" "0000103702" "00103247" "1" "00503" "00503" "2017-04-12 11:34:26" "" "" "SEQ-NG" "DNA" "" "" "0000103703" "00103248" "1" "00503" "00503" "2017-04-12 11:52:51" "" "" "DHPLC;SEQ" "DNA" "" "" "0000103704" "00103249" "1" "00503" "00503" "2017-04-12 12:22:08" "" "" "DHPLC;SEQ" "DNA" "" "" "0000103705" "00103250" "1" "00503" "00503" "2017-04-12 12:40:58" "" "" "DHPLC;SEQ" "DNA" "" "" "0000103706" "00103251" "1" "00503" "00503" "2017-04-12 13:01:22" "00503" "2017-04-12 15:21:41" "DHPLC;SEQ" "DNA;RNA" "" "" "0000103707" "00103252" "1" "00503" "00503" "2017-04-12 13:22:35" "" "" "DHPLC" "DNA" "" "" "0000103708" "00103253" "1" "00503" "00503" "2017-04-12 13:54:22" "" "" "DHPLC;SEQ" "DNA" "" "" "0000103709" "00103254" "1" "00503" "00503" "2017-04-12 15:20:30" "" "" "SEQ" "DNA" "" "" "0000103710" "00103255" "1" "00503" "00503" "2017-04-12 15:42:45" "00503" "2017-04-12 16:23:11" "PCRq;SEQ-NG-I" "DNA" "" "" "0000103711" "00103256" "1" "00503" "00503" "2017-04-12 16:36:47" "" "" "PCRq;SEQ-NG-I" "DNA" "" "" "0000103712" "00103257" "1" "00503" "00503" "2017-04-12 17:14:24" "" "" "SEQ" "DNA" "" "" "0000103723" "00103268" "1" "00503" "00503" "2017-04-13 22:29:34" "" "" "SEQ" "DNA" "" "" "0000103781" "00103324" "1" "00503" "00503" "2017-04-14 13:26:51" "" "" "SEQ;SSCA" "DNA" "" "" "0000103782" "00103325" "1" "00503" "00503" "2017-04-14 15:20:15" "" "" "SEQ-NG" "DNA" "" "" "0000103783" "00103326" "1" "00503" "00503" "2017-04-14 15:35:26" "" "" "SEQ-NG" "DNA" "" "" "0000103917" "00103327" "1" "00503" "00503" "2017-04-14 16:23:03" "" "" "SEQ" "DNA" "" "" "0000103918" "00103461" "1" "00503" "00503" "2017-04-14 16:57:40" "" "" "SEQ" "DNA" "" "" "0000104087" "00103630" "1" "00503" "00503" "2017-04-14 19:56:23" "" "" "SEQ" "DNA" "" "" "0000104088" "00103631" "1" "00503" "00503" "2017-04-14 20:06:53" "" "" "SEQ" "DNA" "" "" "0000104089" "00103632" "1" "00503" "00503" "2017-04-14 20:19:38" "" "" "SEQ" "DNA" "" "" "0000104090" "00103633" "1" "00503" "00503" "2017-04-14 21:43:38" "" "" "SEQ" "DNA" "" "" "0000104091" "00103634" "1" "00503" "00503" "2017-04-14 21:59:19" "" "" "SEQ" "DNA" "" "" "0000104092" "00103635" "1" "00503" "00503" "2017-04-14 22:11:17" "" "" "SEQ" "DNA" "" "" "0000104093" "00103636" "1" "00503" "00503" "2017-04-14 22:21:25" "" "" "SEQ" "DNA" "" "" "0000104094" "00103637" "1" "00503" "00503" "2017-04-14 22:29:37" "" "" "SEQ" "DNA" "" "" "0000104111" "00103654" "1" "00503" "00503" "2017-04-15 16:23:47" "" "" "SEQ" "DNA" "" "" "0000104112" "00103655" "1" "00503" "00503" "2017-04-15 17:27:09" "" "" "SEQ" "DNA" "" "" "0000104113" "00103656" "1" "00503" "00503" "2017-04-15 17:36:01" "00503" "2017-04-15 17:57:10" "MLPA;SEQ" "DNA" "" "" "0000104114" "00103657" "1" "00503" "00503" "2017-04-15 17:58:32" "" "" "SEQ" "DNA" "" "" "0000104115" "00103658" "1" "00503" "00503" "2017-04-15 18:06:14" "" "" "MLPA;SEQ" "DNA" "" "" "0000104116" "00103659" "1" "00503" "00503" "2017-04-15 18:21:37" "" "" "MLPA;SEQ" "DNA" "" "" "0000104117" "00103660" "1" "00503" "00503" "2017-04-15 20:35:44" "" "" "SEQ" "DNA" "" "" "0000104118" "00103661" "1" "00503" "00503" "2017-04-15 20:50:00" "" "" "SEQ" "DNA" "" "" "0000104119" "00103662" "1" "00503" "00503" "2017-04-15 21:15:16" "" "" "MLPA;SEQ" "DNA" "" "" "0000104120" "00103663" "1" "00503" "00503" "2017-04-15 21:36:10" "" "" "SEQ" "DNA" "" "" "0000104121" "00103664" "1" "00503" "00503" "2017-04-15 21:49:34" "" "" "SEQ" "DNA" "" "" "0000104122" "00103665" "1" "00503" "00503" "2017-04-15 21:56:54" "" "" "SEQ" "DNA" "" "" "0000104123" "00103666" "1" "00503" "00503" "2017-04-15 22:04:51" "" "" "SEQ" "DNA" "" "" "0000104124" "00103667" "1" "00503" "00503" "2017-04-15 22:19:42" "" "" "MLPA;SEQ" "DNA" "" "" "0000104125" "00103668" "1" "00503" "00503" "2017-04-15 23:19:33" "00503" "2017-04-15 23:30:09" "MLPA;SEQ" "DNA" "" "" "0000104126" "00103669" "1" "00503" "00503" "2017-04-15 23:43:38" "00503" "2017-04-15 23:55:00" "MLPA;SEQ" "DNA" "" "" "0000104183" "00103726" "1" "00503" "00503" "2017-04-17 17:08:50" "" "" "MLPA;SEQ" "DNA" "" "" "0000104184" "00103727" "1" "00503" "00503" "2017-04-17 17:13:52" "" "" "MLPA;SEQ" "DNA" "" "" "0000104185" "00103728" "1" "00503" "00503" "2017-04-17 17:21:49" "" "" "MLPA;SEQ" "DNA" "" "" "0000104186" "00103729" "1" "00503" "00503" "2017-04-17 22:56:40" "00503" "2017-04-17 23:12:36" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000104187" "00103730" "1" "00503" "00503" "2017-04-17 23:12:47" "" "" "SEQ" "DNA" "" "" "0000104188" "00103731" "1" "00503" "00503" "2017-04-17 23:28:39" "" "" "SEQ" "DNA" "" "" "0000104189" "00103732" "1" "00503" "00503" "2017-04-17 23:36:53" "" "" "SEQ" "DNA" "" "" "0000104190" "00103733" "1" "00503" "00503" "2017-04-17 23:48:48" "" "" "SEQ" "DNA" "" "" "0000104191" "00103734" "1" "00503" "00503" "2017-04-18 00:06:37" "" "" "SEQ" "DNA" "" "" "0000104192" "00103735" "1" "00503" "00503" "2017-04-18 00:23:25" "" "" "SEQ" "DNA" "" "" "0000104193" "00103736" "1" "00503" "00503" "2017-04-18 00:38:53" "" "" "SEQ" "DNA" "" "" "0000104194" "00103737" "1" "00503" "00503" "2017-04-18 01:03:06" "" "" "SEQ" "DNA" "" "" "0000104211" "00103755" "1" "00503" "00503" "2017-04-18 18:39:37" "" "" "SEQ" "DNA" "" "" "0000104213" "00103760" "1" "00503" "00503" "2017-04-18 22:16:36" "" "" "SEQ" "DNA" "" "" "0000104214" "00103761" "1" "00503" "00503" "2017-04-18 22:36:13" "" "" "SEQ" "DNA" "" "" "0000104215" "00103765" "1" "00503" "00503" "2017-04-18 23:10:41" "" "" "SEQ" "DNA" "" "" "0000104216" "00103766" "1" "00503" "00503" "2017-04-18 23:41:28" "" "" "SEQ" "DNA" "" "" "0000104217" "00103767" "1" "00503" "00503" "2017-04-19 11:27:59" "00006" "2019-07-22 12:44:46" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000104218" "00103768" "1" "00503" "00503" "2017-04-19 13:43:39" "00006" "2019-07-22 12:44:25" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000104222" "00103772" "1" "00503" "00503" "2017-04-19 15:27:31" "" "" "SEQ" "DNA" "" "" "0000104223" "00103773" "1" "00503" "00503" "2017-04-19 15:36:48" "" "" "SEQ" "DNA" "" "" "0000104225" "00103774" "1" "00503" "00503" "2017-04-19 16:05:11" "" "" "SEQ" "DNA" "" "" "0000104228" "00103777" "1" "00503" "00503" "2017-04-19 17:55:29" "" "" "SEQ" "DNA" "" "" "0000104229" "00103778" "1" "00503" "00503" "2017-04-19 18:20:48" "" "" "MLPA;SEQ" "DNA" "" "" "0000104232" "00103781" "1" "00503" "00503" "2017-04-19 23:14:26" "" "" "SEQ" "DNA" "" "" "0000104377" "00103919" "1" "00503" "00503" "2017-04-22 17:15:09" "" "" "MLPA;SEQ;SEQ-NG" "DNA" "" "" "0000104407" "00103949" "1" "00503" "00503" "2017-04-23 20:53:06" "" "" "SEQ" "DNA" "" "" "0000104408" "00103950" "1" "00503" "00503" "2017-04-23 21:02:22" "" "" "SEQ" "DNA" "" "" "0000104409" "00103951" "1" "00503" "00503" "2017-04-23 21:07:21" "" "" "SEQ" "DNA" "" "" "0000104410" "00103952" "1" "00503" "00503" "2017-04-23 21:16:48" "" "" "SEQ" "DNA" "" "" "0000104438" "00103969" "1" "00503" "00503" "2017-04-29 13:18:36" "" "" "SEQ" "DNA" "" "" "0000104439" "00103970" "1" "00503" "00503" "2017-04-29 13:29:25" "" "" "SEQ" "DNA" "" "" "0000104440" "00103971" "1" "00503" "00503" "2017-04-29 13:56:10" "" "" "SEQ" "DNA" "" "" "0000104441" "00103972" "1" "00503" "00503" "2017-04-29 15:29:04" "" "" "SEQ" "DNA" "" "" "0000104442" "00103973" "1" "00503" "00503" "2017-04-29 20:25:25" "" "" "SEQ-NG-I" "DNA" "" "" "0000104443" "00103974" "1" "00503" "00503" "2017-04-29 22:01:15" "" "" "SEQ-NG" "DNA" "" "" "0000104444" "00103975" "1" "00503" "00503" "2017-04-30 02:10:25" "" "" "SEQ-NG" "DNA" "" "" "0000104465" "00103994" "1" "00587" "00006" "2017-04-28 08:15:46" "" "" "SEQ-NG" "DNA" "" "" "0000105516" "00105043" "1" "00503" "00503" "2017-06-15 22:33:50" "" "" "SEQ-NG" "DNA" "" "" "0000111837" "00036041" "1" "01164" "01164" "2017-08-02 13:47:45" "" "" "SEQ" "DNA" "" "" "0000111838" "00111373" "1" "01164" "01164" "2017-08-02 14:31:43" "" "" "SEQ" "DNA" "" "" "0000111839" "00111374" "1" "01164" "01164" "2017-08-02 14:48:50" "" "" "SEQ" "DNA" "" "" "0000111840" "00111375" "1" "01164" "01164" "2017-08-02 15:12:23" "" "" "SEQ" "DNA" "" "" "0000111841" "00111376" "1" "01164" "01164" "2017-08-02 16:14:16" "" "" "SEQ" "DNA" "" "" "0000111842" "00111377" "1" "01164" "01164" "2017-08-02 16:22:21" "" "" "SEQ" "DNA" "" "" "0000111844" "00111379" "1" "01164" "01164" "2017-08-02 16:40:35" "" "" "SEQ" "DNA" "" "" "0000111845" "00111380" "1" "01164" "01164" "2017-08-02 16:53:13" "" "" "SEQ" "DNA" "" "" "0000132719" "00131883" "1" "01164" "01164" "2017-09-21 09:49:39" "00503" "2017-09-21 23:07:19" "SEQ-NG-I" "DNA" "" "" "0000132781" "00131941" "1" "00503" "00503" "2017-10-03 16:43:45" "" "" "SEQ" "DNA" "" "" "0000132815" "00131976" "1" "02274" "00503" "2017-10-06 00:09:39" "00503" "2017-10-06 19:31:24" "SEQ" "DNA" "" "" "0000132846" "00132007" "1" "02274" "00503" "2017-10-06 23:49:52" "" "" "SEQ" "DNA" "" "" "0000132847" "00132008" "1" "02274" "00503" "2017-10-07 00:34:29" "" "" "SEQ" "DNA" "" "" "0000132848" "00132009" "1" "02274" "00503" "2017-10-07 00:49:00" "" "" "SEQ" "DNA" "" "" "0000132849" "00132010" "1" "00503" "00503" "2017-10-07 17:04:57" "" "" "SEQ" "DNA" "" "" "0000132850" "00132011" "1" "02274" "00503" "2017-10-07 17:25:23" "" "" "SEQ" "DNA" "" "" "0000132851" "00132012" "1" "02274" "00503" "2017-10-07 17:42:02" "00503" "2017-10-13 17:37:25" "SEQ;SEQ-NG-I" "DNA" "" "" "0000132852" "00132013" "1" "02274" "00503" "2017-10-07 20:05:10" "00503" "2017-10-13 18:08:04" "SEQ;SEQ-NG-I" "DNA" "" "" "0000132853" "00132014" "1" "02274" "00503" "2017-10-08 00:59:25" "" "" "SEQ" "DNA" "" "" "0000132854" "00132015" "1" "02274" "00503" "2017-10-09 00:57:27" "00503" "2017-10-13 18:15:02" "SEQ;SEQ-NG-I" "DNA" "" "" "0000132855" "00132016" "1" "02274" "00503" "2017-10-09 03:04:33" "" "" "SEQ" "DNA" "" "" "0000132865" "00132025" "1" "02274" "00503" "2017-10-10 00:25:53" "00503" "2017-10-13 18:16:28" "SEQ;SEQ-NG-I" "DNA" "" "" "0000166014" "00165139" "1" "02521" "02521" "2018-06-27 21:59:24" "" "" "PCR" "DNA" "blood" "" "0000184352" "00183389" "1" "02947" "02947" "2018-10-25 12:17:24" "" "" "arrayCGH" "DNA" "" "" "0000184353" "00183389" "1" "02947" "02947" "2018-10-25 12:24:01" "00006" "2019-03-02 15:21:40" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000184354" "00183390" "1" "02947" "02947" "2018-10-25 12:31:23" "" "" "arrayCGH" "DNA" "" "" "0000184355" "00183390" "1" "02947" "02947" "2018-10-25 12:36:49" "" "" "SEQ-NG" "DNA" "" "" "0000184356" "00183391" "1" "02947" "02947" "2018-10-25 12:42:16" "" "" "arrayCGH" "DNA" "" "" "0000184357" "00183391" "1" "02947" "02947" "2018-10-25 12:46:12" "" "" "SEQ-NG" "DNA" "" "" "0000184358" "00183392" "1" "02947" "02947" "2018-10-25 12:50:16" "" "" "arrayCGH" "DNA" "" "" "0000184359" "00183392" "1" "02947" "02947" "2018-10-25 12:52:50" "00006" "2019-03-02 15:38:04" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "" "0000209572" "00208524" "1" "03127" "03127" "2018-12-10 08:36:38" "" "" "SEQ;SEQ-NG-I" "DNA" "" "WES" "0000209804" "00208755" "1" "01164" "01164" "2018-12-14 14:03:29" "" "" "SEQ-NG" "DNA" "" "" "0000209849" "00208800" "1" "01164" "01164" "2018-12-17 10:13:39" "" "" "SEQ-NG" "DNA" "" "" "0000266605" "00265482" "1" "00006" "00006" "2019-09-26 11:09:23" "" "" "SEQ;SEQ-NG" "DNA" "" "CMD gene panel" "0000271021" "00269868" "1" "03524" "03524" "2019-12-09 14:33:50" "" "" "SEQ-NG" "DNA" "" "" "0000271022" "00269869" "1" "03524" "03524" "2019-12-09 16:23:35" "" "" "SEQ-NG" "DNA" "" "" "0000275468" "00274312" "1" "00006" "00006" "2019-12-28 16:38:54" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000289268" "00288102" "1" "00006" "00006" "2020-02-15 21:11:32" "" "" "MLPA;SEQ" "DNA" "" "" "0000289269" "00288103" "1" "00006" "00006" "2020-02-15 21:11:32" "" "" "MLPA;SEQ" "DNA" "" "" "0000290138" "00288970" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290155" "00288987" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290174" "00289006" "1" "00006" "00006" "2020-02-24 21:34:22" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000290461" "00289291" "1" "01164" "01164" "2020-03-02 12:26:47" "" "" "SEQ-NG-S" "DNA" "" "" "0000295137" "00293969" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295138" "00293970" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295140" "00293972" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295142" "00293974" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295143" "00293975" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295144" "00293976" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295145" "00293977" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295146" "00293978" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295147" "00293979" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000295148" "00293980" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296606" "00295438" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296813" "00295641" "1" "01164" "01164" "2020-03-22 12:43:06" "" "" "SEQ-NG-S" "DNA" "" "" "0000302735" "00301610" "1" "03678" "03678" "2020-05-19 12:32:44" "" "" "SEQ-NG" "DNA" "" "" "0000304778" "00303651" "1" "02119" "02119" "2020-06-19 11:41:52" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000304779" "00303652" "1" "02119" "02119" "2020-06-19 12:04:59" "" "" "SEQ-NG-I" "DNA" "" "" "0000305069" "00303942" "1" "02119" "02119" "2020-06-19 16:26:11" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000305070" "00303943" "1" "02119" "02119" "2020-06-19 16:36:00" "" "" "SEQ-NG-I" "DNA" "blood" "" "0000306183" "00305054" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306184" "00305055" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306918" "00305788" "1" "00006" "00006" "2020-07-02 12:45:49" "" "" "SEQ;SEQ-NG" "DNA" "" "candidate 420-gene panel" "0000306936" "00305806" "1" "00006" "00006" "2020-07-02 12:45:49" "" "" "SEQ;SEQ-NG" "DNA" "" "candidate 420-gene panel" "0000309096" "00307952" "1" "00006" "00006" "2020-08-23 13:31:08" "" "" "SEQ;SEQ-NG" "DNA" "" "clinical WES" "0000311032" "00309888" "1" "01164" "01164" "2020-09-04 17:26:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000314939" "00313767" "1" "00006" "00006" "2020-10-04 10:11:01" "" "" "SEQ" "DNA" "" "" "0000315510" "00314337" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315511" "00314338" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315512" "00314339" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315513" "00314340" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315514" "00314341" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315515" "00314342" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315516" "00314343" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315517" "00314344" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315518" "00314345" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315519" "00314346" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315520" "00314347" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315521" "00314348" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315522" "00314349" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315523" "00314350" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315524" "00314351" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315525" "00314352" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000315526" "00314353" "1" "00006" "00006" "2020-10-12 14:24:44" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000321482" "00320296" "1" "00006" "00006" "2020-11-27 09:16:20" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000326622" "00325411" "1" "00006" "00006" "2021-01-02 12:18:38" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000362834" "00361606" "1" "00006" "00006" "2021-04-07 19:07:03" "" "" "SEQ-NG" "DNA" "" "758-gene panel" "0000363145" "00361917" "1" "04047" "04047" "2021-04-12 12:17:31" "" "" "SEQ-NG" "DNA" "" "" "0000375557" "00374363" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375558" "00374364" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375559" "00374365" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375560" "00374366" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375561" "00374367" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375562" "00374368" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375563" "00374369" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375564" "00374370" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375565" "00374371" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375566" "00374372" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375567" "00374373" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375568" "00374374" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375569" "00374375" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375895" "00374701" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000376409" "00375215" "1" "01164" "01164" "2021-05-31 12:09:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000377633" "00376428" "1" "00006" "00006" "2021-06-22 13:15:11" "" "" "SEQ-NG" "DNA" "" "58-gene panel" "0000381991" "00380777" "1" "00000" "03840" "2021-08-23 12:15:23" "" "" "SEQ-NG-I" "DNA" "" "whole exome sequencing" "0000385787" "00384562" "1" "04175" "04175" "2021-09-29 20:15:07" "" "" "SEQ-NG" "DNA" "" "" "0000387716" "00386489" "1" "00006" "00006" "2021-10-22 17:45:19" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000389915" "00388673" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000389933" "00388691" "1" "00006" "00006" "2021-11-04 20:51:09" "" "" "SEQ-NG" "DNA" "" "WES" "0000393177" "00391935" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, LAMA2, PLEC, PLEC, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, LAMA2, SGCA, SGCD, SGCG, SGCB, SYNE1" "0000393178" "00391936" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, COL6A3, LAMA2, BAG3, COL6A1, COL6A2, SGCB, CAPN3, DYSF, FLNC, SGCA, SGCD, SGCG, PLEC, SYNE1" "0000393180" "00391938" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, LAMA2, LAMA2, PLEC, PLEC, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, SGCB, SGCA, SGCD, SGCG, SYNE1" "0000393182" "00391940" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, CHKB, LAMA2, LAMA2, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, SGCB, SGCA, SGCD, SGCG, PLEC, SYNE1" "0000393184" "00391942" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, LAMA2, NEB, NEB, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, SGCB, SGCA, SGCD, SGCG, PLEC, SYNE1" "0000393203" "00391961" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, LAMA2, COL6A1, COL6A2, COL6A3, CAPN3, DYSF, FLNC, LAMA2, SGCA, SGCD, SGCG, PLEC, SYNE1" "0000393239" "00391997" "1" "03501" "00006" "2021-11-19 15:49:45" "" "" "SEQ-NG" "DNA" "" "screened DMD, PLEC, LAMA2" "0000399011" "00397769" "1" "00006" "00006" "2021-12-29 09:36:33" "" "" "SEQ;SEQ-NG" "DNA" "" "29-gene panel" "0000400237" "00398992" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000400239" "00398994" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000400269" "00399024" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000400322" "00399077" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000400337" "00399092" "1" "00006" "00006" "2022-01-15 16:40:49" "" "" "SEQ;SEQ-NG" "DNA" "" "166-gene panel" "0000412506" "00411241" "1" "00000" "03840" "2022-06-08 10:51:26" "" "" "DGGE" "DNA" "blood" "" "0000412553" "00411284" "1" "03320" "03320" "2022-06-10 10:49:20" "" "" "SEQ-NG" "DNA" "" "" "0000412859" "00411587" "1" "00000" "03840" "2022-06-16 18:34:09" "" "" "SSCA;SEQ" "DNA" "blood" "" "0000413156" "00411884" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000413168" "00411896" "1" "00000" "03840" "2022-06-19 17:33:49" "" "" "SEQ" "DNA" "blood" "" "0000415985" "00414704" "1" "00000" "03840" "2022-08-02 11:28:48" "" "" "SEQ-NG" "DNA;RNA" "blood" "" "0000416824" "00415543" "1" "00006" "00006" "2022-08-15 09:52:56" "" "" "SEQ-ON;SEQ-NG" "DNA" "" "WES" "0000416825" "00415544" "1" "00006" "00006" "2022-08-15 10:09:48" "" "" "SEQ-ON;SEQ-NG" "DNA" "" "WES" "0000418188" "00416905" "1" "01164" "01164" "2022-09-09 16:40:56" "" "" "SEQ-NG-I" "DNA" "" "" "0000427801" "00426480" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427802" "00426481" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427803" "00426482" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427804" "00426483" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427805" "00426484" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427806" "00426485" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427807" "00426486" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427808" "00426487" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427809" "00426488" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427810" "00426489" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427811" "00426490" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427812" "00426491" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427813" "00426492" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427814" "00426493" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427815" "00426494" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427816" "00426495" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427817" "00426496" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427818" "00426497" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427819" "00426498" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427820" "00426499" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427821" "00426500" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427822" "00426501" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427823" "00426502" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427824" "00426503" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427825" "00426504" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427826" "00426505" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427827" "00426506" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427828" "00426507" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427829" "00426508" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427830" "00426509" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427831" "00426510" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427832" "00426511" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427833" "00426512" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427834" "00426513" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427835" "00426514" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427836" "00426515" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427837" "00426516" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427838" "00426517" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427839" "00426518" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427840" "00426519" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427841" "00426520" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427842" "00426521" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427843" "00426522" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427844" "00426523" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427845" "00426524" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427846" "00426525" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427847" "00426526" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427848" "00426527" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427849" "00426528" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427850" "00426529" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427851" "00426530" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427852" "00426531" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427853" "00426532" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427854" "00426533" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427855" "00426534" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427856" "00426535" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427857" "00426536" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427858" "00426537" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427859" "00426538" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427860" "00426539" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427861" "00426540" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427862" "00426541" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427863" "00426542" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427864" "00426543" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427865" "00426544" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427866" "00426545" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427867" "00426546" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427868" "00426547" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427869" "00426548" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427870" "00426549" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427871" "00426550" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427872" "00426551" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427873" "00426552" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427874" "00426553" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427875" "00426554" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427876" "00426555" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427877" "00426556" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427878" "00426557" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427879" "00426558" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427880" "00426559" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427881" "00426560" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427882" "00426561" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427883" "00426562" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427884" "00426563" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427885" "00426564" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427886" "00426565" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427887" "00426566" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427888" "00426567" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427889" "00426568" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427890" "00426569" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427891" "00426570" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427892" "00426571" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427893" "00426572" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427894" "00426573" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427895" "00426574" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427896" "00426575" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427897" "00426576" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427898" "00426577" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427899" "00426578" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427900" "00426579" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427901" "00426580" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427902" "00426581" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427903" "00426582" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427904" "00426583" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427905" "00426584" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427906" "00426585" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427907" "00426586" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427908" "00426587" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427909" "00426588" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427910" "00426589" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427911" "00426590" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427912" "00426591" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427913" "00426592" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427914" "00426593" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427915" "00426594" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427916" "00426595" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427917" "00426596" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427918" "00426597" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427919" "00426598" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427920" "00426599" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427921" "00426600" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427922" "00426601" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427923" "00426602" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427924" "00426603" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427925" "00426604" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427926" "00426605" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427927" "00426606" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427928" "00426607" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427929" "00426608" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000427930" "00426609" "1" "00006" "00006" "2022-12-01 16:50:45" "" "" "SEQ" "DNA" "" "" "0000428466" "00427145" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428467" "00427146" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428468" "00427147" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428469" "00427148" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428470" "00427149" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428471" "00427150" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428472" "00427151" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428473" "00427152" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428474" "00427153" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428475" "00427154" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428476" "00427155" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428477" "00427156" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428478" "00427157" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428479" "00427158" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428480" "00427159" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428481" "00427160" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428482" "00427161" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428483" "00427162" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428484" "00427163" "1" "00006" "00006" "2022-12-05 21:44:21" "" "" "SEQ;SEQ-NG" "DNA" "" "custom gene panel" "0000428491" "00427170" "1" "00006" "00006" "2022-12-07 13:06:42" "" "" "SEQ" "DNA" "" "" "0000429881" "00428469" "1" "01164" "01164" "2023-01-04 09:28:41" "" "" "SEQ-NG-I" "DNA" "" "" "0000431802" "00430393" "1" "00006" "00006" "2023-01-20 11:39:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431808" "00430399" "1" "00006" "00006" "2023-01-20 11:39:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000431809" "00430400" "1" "00006" "00006" "2023-01-20 11:39:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000434890" "00433435" "1" "04483" "04483" "2023-03-09 03:48:39" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000434891" "00433436" "1" "04483" "04483" "2023-03-09 04:16:11" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000434892" "00433437" "1" "04483" "04483" "2023-03-09 08:00:43" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000434893" "00433438" "1" "04483" "04483" "2023-03-09 08:28:21" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000434894" "00433439" "1" "04483" "04483" "2023-03-09 08:40:15" "" "" "SEQ;SEQ-NG" "DNA" "blood" "" "0000436513" "00435042" "1" "00006" "00006" "2023-05-01 16:38:52" "00006" "2023-05-01 17:07:39" "RT-PCR;SEQ;SEQ-NG" "DNA;RNA" "" "WE, WGS" "0000437160" "00435679" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437161" "00435680" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437162" "00435681" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437163" "00435682" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437164" "00435683" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437165" "00435684" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437166" "00435685" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437167" "00435686" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437168" "00435687" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437169" "00435688" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437170" "00435689" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437171" "00435690" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437172" "00435691" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437173" "00435692" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437174" "00435693" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437175" "00435694" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437176" "00435695" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437177" "00435696" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437178" "00435697" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437179" "00435698" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437180" "00435699" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437181" "00435700" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437182" "00435701" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437183" "00435702" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437184" "00435703" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437185" "00435704" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437186" "00435705" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437187" "00435706" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437188" "00435707" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437189" "00435708" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437190" "00435709" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437191" "00435710" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437192" "00435711" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437193" "00435712" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437194" "00435713" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437195" "00435714" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437196" "00435715" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437197" "00435716" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437198" "00435717" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437199" "00435718" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437200" "00435719" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437201" "00435720" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437202" "00435721" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437203" "00435722" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437204" "00435723" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437205" "00435724" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437206" "00435725" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437207" "00435726" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437208" "00435727" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437209" "00435728" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437210" "00435729" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000437211" "00435730" "1" "00006" "00006" "2023-08-09 10:40:33" "" "" "SEQ" "DNA" "" "" "0000438327" "00436845" "1" "00006" "00006" "2023-10-11 15:26:56" "" "" "SEQ" "DNA" "" "gene panel" "0000438331" "00436849" "1" "00006" "00006" "2023-10-11 15:46:04" "" "" "SEQ" "DNA" "" "gene panel" "0000439953" "00438471" "1" "00006" "00006" "2023-10-21 14:47:26" "" "" "SEQ;SEQ-NG" "DNA" "" "47-gene panel" "0000439959" "00438477" "1" "00006" "00006" "2023-10-21 14:47:26" "" "" "SEQ;SEQ-NG" "DNA" "" "47-gene panel" "0000439960" "00438478" "1" "00006" "00006" "2023-10-21 14:47:26" "" "" "SEQ;SEQ-NG" "DNA" "" "47-gene panel" "0000444092" "00442608" "1" "00006" "00006" "2023-11-22 16:54:01" "" "" "SEQ" "DNA" "" "" "0000444093" "00442609" "1" "00006" "00006" "2023-11-22 16:54:01" "" "" "SEQ" "DNA" "" "" "0000444094" "00442610" "1" "00006" "00006" "2023-11-22 16:54:01" "" "" "SEQ" "DNA" "" "" "0000444192" "00442708" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444197" "00442713" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000444280" "00442796" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000444281" "00442797" "1" "00006" "00006" "2023-11-23 18:48:51" "" "" "SEQ-NG" "DNA" "" "WES" "0000447019" "00445403" "1" "03652" "03652" "2024-01-15 14:04:52" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447020" "00445446" "1" "03652" "03652" "2024-01-15 14:41:21" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447021" "00445447" "1" "03652" "03652" "2024-01-15 14:58:36" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447939" "00446365" "1" "03652" "03652" "2024-01-15 16:54:14" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447970" "00446396" "1" "03652" "03652" "2024-01-16 12:57:39" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447971" "00446397" "1" "03652" "03652" "2024-01-16 13:22:29" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447972" "00446398" "1" "03652" "03652" "2024-01-16 13:53:00" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447973" "00446399" "1" "03652" "03652" "2024-01-16 14:44:16" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447975" "00446401" "1" "03652" "03652" "2024-01-16 17:24:32" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447976" "00446402" "1" "03652" "03652" "2024-01-16 18:17:35" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447977" "00446403" "1" "03652" "03652" "2024-01-16 18:34:13" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447978" "00446405" "1" "03652" "03652" "2024-01-16 18:57:24" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000447979" "00446406" "1" "03652" "03652" "2024-01-16 19:09:13" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000449997" "00448421" "1" "00435" "00435" "2024-03-10 00:33:29" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000451158" "00449567" "1" "03652" "03652" "2024-04-26 15:53:46" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000451160" "00449569" "1" "03652" "03652" "2024-04-29 13:56:59" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000454406" "00452804" "1" "01164" "01164" "2024-07-24 13:57:26" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000454442" "00452839" "1" "01164" "01164" "2024-07-25 10:29:54" "" "" "SEQ-NG-I" "DNA" "Blood" "" "0000459286" "00457666" "1" "00006" "00006" "2024-11-15 17:35:58" "" "" "SEQ;SEQ-NG" "DNA" "" "wgs" "0000461858" "00460227" "1" "00006" "00006" "2025-01-21 21:16:51" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000465824" "00464193" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465825" "00464194" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465826" "00464195" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465827" "00464196" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465828" "00464197" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465829" "00464198" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465830" "00464199" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465831" "00464200" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465832" "00464201" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465833" "00464202" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465834" "00464203" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465835" "00464204" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465836" "00464205" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465837" "00464206" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465838" "00464207" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465839" "00464208" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465840" "00464209" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465841" "00464210" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465842" "00464211" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465843" "00464212" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465844" "00464213" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465845" "00464214" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465846" "00464215" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465847" "00464216" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465848" "00464217" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465849" "00464218" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465850" "00464219" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465851" "00464220" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465852" "00464221" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465853" "00464222" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465854" "00464223" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465855" "00464224" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465856" "00464225" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465857" "00464226" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465858" "00464227" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465859" "00464228" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465860" "00464229" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465861" "00464230" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465862" "00464231" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465863" "00464232" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465864" "00464233" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465865" "00464234" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465866" "00464235" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465867" "00464236" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465868" "00464237" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465869" "00464238" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465870" "00464239" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465871" "00464240" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465872" "00464241" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465873" "00464242" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465874" "00464243" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465875" "00464244" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465876" "00464245" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465877" "00464246" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465878" "00464247" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465879" "00464248" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465880" "00464249" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465881" "00464250" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465882" "00464251" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465883" "00464252" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465884" "00464253" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465885" "00464254" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465886" "00464255" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465887" "00464256" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465888" "00464257" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465889" "00464258" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465890" "00464259" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465891" "00464260" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465892" "00464261" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465893" "00464262" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465894" "00464263" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465895" "00464264" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465896" "00464265" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465897" "00464266" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465898" "00464267" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465899" "00464268" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465900" "00464269" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465901" "00464270" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465902" "00464271" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465903" "00464272" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465904" "00464273" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465905" "00464274" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465906" "00464275" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465907" "00464276" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465908" "00464277" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465909" "00464278" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465910" "00464279" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465911" "00464280" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465912" "00464281" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000465913" "00464282" "1" "00006" "00006" "2025-02-24 19:36:55" "" "" "SEQ;SEQ-NG" "DNA" "peripheral blood lymphocytes" "" "0000467745" "00466088" "1" "03652" "03652" "2025-08-05 15:14:26" "" "" "SEQ-NG" "DNA" "peripheral blood" "gene panel" "0000468229" "00466566" "1" "00006" "00006" "2025-09-11 16:30:53" "" "" "SEQ-NG" "DNA" "" "WES" "0000468230" "00466567" "1" "00006" "00006" "2025-09-11 16:30:53" "" "" "SEQ-NG" "DNA" "" "WES" "0000468231" "00466568" "1" "00006" "00006" "2025-09-11 16:30:53" "" "" "SEQ-NG" "DNA" "" "WES" "0000469272" "00467608" "1" "00006" "00006" "2025-10-23 22:34:04" "" "" "SEQ;SEQ-NG" "DNA" "" "trio WES" "0000469904" "00468238" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000469908" "00468242" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000469909" "00468243" "1" "00006" "00006" "2025-11-07 14:41:52" "" "" "SEQ;SEQ-NG" "DNA" "" "gene panel" "0000469945" "00468279" "1" "00006" "00006" "2025-11-08 14:56:30" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000469947" "00468281" "1" "00006" "00006" "2025-11-08 15:12:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470725" "00469057" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000470726" "00469058" "1" "00006" "00006" "2025-11-13 13:02:43" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" "0000472324" "00470657" "1" "00006" "00006" "2025-12-05 11:16:06" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 1275 "{{screeningid}}" "{{geneid}}" "0000000012" "ACADVL" "0000000012" "ADA" "0000000012" "AGL" "0000000012" "ATP7B" "0000000012" "CYP21A2" "0000000012" "DPYD" "0000000012" "ETFB" "0000000012" "GBA" "0000000012" "HGSNAT" "0000000012" "IGHMBP2" "0000000012" "LAMA2" "0000000012" "MYO5A" "0000000012" "NHLRC1" "0000000012" "NPHS1" "0000000012" "SERPINA1" "0000000012" "SLC26A2" "0000000017" "ALG6" "0000000017" "ASPA" "0000000017" "ATP7B" "0000000017" "DPYD" "0000000017" "GLB1" "0000000017" "LAMA2" "0000000017" "MMACHC" "0000000017" "MPL" "0000000017" "MYO5A" "0000000017" "NHLRC1" "0000000017" "NPHS1" "0000000017" "SERPINA1" "0000000017" "SMPD1" "0000000018" "ALG6" "0000000018" "ASPA" "0000000018" "ATP7B" "0000000018" "DPYD" "0000000018" "GLB1" "0000000018" "LAMA2" "0000000018" "MMACHC" "0000000018" "MPL" "0000000018" "MYO5A" "0000000018" "NHLRC1" "0000000018" "NPHS1" "0000000018" "SERPINA1" "0000000018" "SMPD1" "0000000036" "AHI1" "0000000036" "ATP7B" "0000000036" "CYP21A2" "0000000036" "DPYD" "0000000036" "ETFB" "0000000036" "GLB1" "0000000036" "HEXB" "0000000036" "LAMA2" "0000000036" "SMPD1" "0000000039" "AHI1" "0000000039" "ATP7B" "0000000039" "DPYD" "0000000039" "ETFB" "0000000039" "GAA" "0000000039" "GLB1" "0000000039" "LAMA2" "0000000039" "MTHFR" "0000000039" "NPHP4" "0000000039" "NPHS1" "0000000039" "P3H1" "0000000039" "SBDS" "0000000039" "SLC26A2" "0000000040" "ATP7A" "0000000040" "DPYD" "0000000040" "GLB1" "0000000040" "LAMA2" "0000000048" "ATP7B" "0000000048" "CPT1A" "0000000048" "DPYD" "0000000048" "ETFB" "0000000048" "GAA" "0000000048" "GBA" "0000000048" "GLB1" "0000000048" "IGHMBP2" "0000000048" "LAMA2" "0000000048" "MEFV" "0000000048" "NHLRC1" "0000000048" "NPHS1" "0000000048" "SERPINA1" "0000000049" "ATP7B" "0000000049" "CYP21A2" "0000000049" "DPYD" "0000000049" "ETFB" "0000000049" "GALC" "0000000049" "GLB1" "0000000049" "IGHMBP2" "0000000049" "LAMA2" "0000000049" "MPL" "0000000049" "MYO5A" "0000000049" "NPHP4" "0000000049" "SERPINA1" "0000000049" "SGSH" "0000000049" "SLC26A2" "0000000054" "ATM" "0000000054" "ATP7B" "0000000054" "DPYD" "0000000054" "ETFB" "0000000054" "GALC" "0000000054" "GLB1" "0000000054" "GNPTAB" "0000000054" "LAMA2" "0000000054" "LAMA3" "0000000054" "NHLRC1" "0000000054" "NPHS1" "0000000054" "SERPINA1" "0000000054" "SLC26A2" "0000000057" "ALDOB" "0000000057" "ATM" "0000000057" "ATP7B" "0000000057" "DPYD" "0000000057" "ERCC6" "0000000057" "ETFB" "0000000057" "GAA" "0000000057" "IGHMBP2" "0000000057" "LAMA2" "0000000057" "NHLRC1" "0000000057" "NPHS1" "0000000057" "SERPINA1" "0000000069" "AHI1" "0000000069" "ARSB" "0000000069" "ATP7B" "0000000069" "CYP27A1" "0000000069" "ETFB" "0000000069" "GLB1" "0000000069" "HEXA" "0000000069" "HEXB" "0000000069" "LAMA2" "0000000069" "MTHFR" "0000000069" "MYO5A" "0000000069" "NHLRC1" "0000000069" "NPHS1" "0000000069" "PMM2" "0000000069" "SBDS" "0000000071" "ATP7B" "0000000071" "ETFB" "0000000071" "LAMA2" "0000000071" "MTHFR" "0000000071" "NHLRC1" "0000000071" "NPC1" "0000000071" "OFD1" "0000000071" "PAH" "0000000071" "SERPINA1" "0000000071" "SMPD1" "0000000075" "ATP7B" "0000000075" "CDH23" "0000000075" "ETFB" "0000000075" "GAA" "0000000075" "HESX1" "0000000075" "IGHMBP2" "0000000075" "LAMA2" "0000000075" "MEFV" "0000000075" "NPHP4" "0000000075" "SERPINA1" "0000000090" "CYP21A2" "0000000090" "ERCC4" "0000000090" "GLB1" "0000000090" "HEXB" "0000000090" "IGHMBP2" "0000000090" "LAMA2" "0000000090" "NHLRC1" "0000000090" "NPHS1" "0000000092" "ATP8B1" "0000000092" "ETFB" "0000000092" "GLB1" "0000000092" "IGHMBP2" "0000000092" "LAMA2" "0000000092" "MYO5A" "0000000092" "NPHS1" "0000000092" "SMPD1" "0000000099" "ARSB" "0000000099" "ATP7B" "0000000099" "ETFB" "0000000099" "HESX1" "0000000099" "HGSNAT" "0000000099" "LAMA2" "0000000099" "NHLRC1" "0000000099" "SERPINA1" "0000000099" "SLC26A2" "0000000099" "TMEM216" "0000000100" "ADAMTS13" "0000000100" "ATP7B" "0000000100" "CFTR" "0000000100" "ETFB" "0000000100" "HADHA" "0000000100" "HESX1" "0000000100" "HGSNAT" "0000000100" "LAMA2" "0000000100" "NHLRC1" "0000000100" "NPHS1" "0000000100" "PKHD1" "0000000100" "SERPINA1" "0000036102" "LAMA2" "0000036103" "LAMA2" "0000036104" "LAMA2" "0000036105" "LAMA2" "0000036106" "LAMA2" "0000036107" "LAMA2" "0000036108" "LAMA2" "0000036110" "LAMA2" "0000036111" "LAMA2" "0000036112" "LAMA2" "0000036113" "LAMA2" "0000036114" "LAMA2" "0000036115" "LAMA2" "0000036116" "LAMA2" "0000036117" "LAMA2" "0000036118" "LAMA2" "0000036119" "LAMA2" "0000036120" "LAMA2" "0000036121" "LAMA2" "0000036122" "LAMA2" "0000036123" "LAMA2" "0000036124" "LAMA2" "0000036125" "LAMA2" "0000036127" "LAMA2" "0000054621" "LAMA2" "0000054625" "LAMA2" "0000054626" "LAMA2" "0000054630" "LAMA2" "0000054637" "LAMA2" "0000054640" "LAMA2" "0000054642" "LAMA2" "0000088335" "LAMA2" "0000102565" "LAMA2" "0000102566" "LAMA2" "0000102567" "LAMA2" "0000102568" "LAMA2" "0000102569" "LAMA2" "0000102570" "LAMA2" "0000102571" "LAMA2" "0000102572" "LAMA2" "0000102573" "LAMA2" "0000102574" "LAMA2" "0000102575" "LAMA2" "0000102576" "LAMA2" "0000102577" "LAMA2" "0000102578" "LAMA2" "0000102579" "LAMA2" "0000102580" "LAMA2" "0000102581" "LAMA2" "0000102582" "LAMA2" "0000102583" "LAMA2" "0000102584" "LAMA2" "0000102585" "LAMA2" "0000102586" "LAMA2" "0000102587" "LAMA2" "0000102588" "LAMA2" "0000102589" "LAMA2" "0000102590" "LAMA2" "0000102591" "LAMA2" "0000102592" "LAMA2" "0000102593" "LAMA2" "0000102594" "LAMA2" "0000102595" "LAMA2" "0000102596" "LAMA2" "0000102597" "LAMA2" "0000102598" "LAMA2" "0000102599" "LAMA2" "0000102600" "LAMA2" "0000102601" "LAMA2" "0000102602" "LAMA2" "0000102603" "LAMA2" "0000102604" "LAMA2" "0000102605" "LAMA2" "0000102606" "LAMA2" "0000102607" "LAMA2" "0000102608" "LAMA2" "0000102609" "LAMA2" "0000102610" "LAMA2" "0000102611" "LAMA2" "0000102612" "LAMA2" "0000102613" "LAMA2" "0000102614" "LAMA2" "0000102615" "LAMA2" "0000102616" "LAMA2" "0000102617" "LAMA2" "0000102618" "LAMA2" "0000102619" "LAMA2" "0000102620" "LAMA2" "0000102621" "LAMA2" "0000102622" "LAMA2" "0000102623" "LAMA2" "0000102624" "LAMA2" "0000102625" "LAMA2" "0000102626" "LAMA2" "0000102627" "LAMA2" "0000102628" "LAMA2" "0000102629" "LAMA2" "0000102630" "LAMA2" "0000102631" "LAMA2" "0000102632" "LAMA2" "0000102633" "LAMA2" "0000102634" "LAMA2" "0000102635" "LAMA2" "0000102636" "LAMA2" "0000102637" "LAMA2" "0000102638" "LAMA2" "0000102639" "LAMA2" "0000102640" "LAMA2" "0000102641" "LAMA2" "0000102642" "LAMA2" "0000102643" "LAMA2" "0000102644" "LAMA2" "0000102645" "LAMA2" "0000102646" "LAMA2" "0000102647" "LAMA2" "0000102648" "LAMA2" "0000102649" "LAMA2" "0000102650" "LAMA2" "0000102651" "LAMA2" "0000102652" "LAMA2" "0000102653" "LAMA2" "0000102654" "LAMA2" "0000102655" "LAMA2" "0000102656" "LAMA2" "0000102657" "LAMA2" "0000102658" "LAMA2" "0000102659" "LAMA2" "0000102660" "LAMA2" "0000102661" "LAMA2" "0000102662" "LAMA2" "0000102663" "LAMA2" "0000102664" "LAMA2" "0000102665" "LAMA2" "0000102666" "LAMA2" "0000102667" "LAMA2" "0000102668" "LAMA2" "0000102669" "LAMA2" "0000102670" "LAMA2" "0000102671" "LAMA2" "0000102672" "LAMA2" "0000102673" "LAMA2" "0000102674" "LAMA2" "0000102675" "LAMA2" "0000102676" "LAMA2" "0000102677" "LAMA2" "0000102678" "LAMA2" "0000102679" "LAMA2" "0000102680" "LAMA2" "0000102681" "LAMA2" "0000102682" "LAMA2" "0000102683" "LAMA2" "0000102684" "LAMA2" "0000102685" "LAMA2" "0000102686" "LAMA2" "0000102687" "LAMA2" "0000102688" "LAMA2" "0000102689" "LAMA2" "0000102690" "LAMA2" "0000102691" "LAMA2" "0000102692" "LAMA2" "0000102693" "LAMA2" "0000102694" "LAMA2" "0000102695" "LAMA2" "0000102696" "LAMA2" "0000102697" "LAMA2" "0000102698" "LAMA2" "0000102699" "LAMA2" "0000102700" "LAMA2" "0000102701" "LAMA2" "0000102702" "LAMA2" "0000102703" "LAMA2" "0000102704" "LAMA2" "0000102705" "LAMA2" "0000102706" "LAMA2" "0000102707" "LAMA2" "0000102708" "LAMA2" "0000102709" "LAMA2" "0000102710" "LAMA2" "0000102711" "LAMA2" "0000102712" "LAMA2" "0000102713" "LAMA2" "0000102714" "LAMA2" "0000102715" "LAMA2" "0000102716" "LAMA2" "0000102717" "LAMA2" "0000102718" "LAMA2" "0000102719" "LAMA2" "0000102720" "LAMA2" "0000102721" "LAMA2" "0000102722" "LAMA2" "0000102723" "LAMA2" "0000102724" "LAMA2" "0000102725" "LAMA2" "0000102726" "LAMA2" "0000102727" "LAMA2" "0000102728" "LAMA2" "0000102729" "LAMA2" "0000102730" "LAMA2" "0000102731" "LAMA2" "0000102732" "LAMA2" "0000102733" "LAMA2" "0000102734" "LAMA2" "0000102735" "LAMA2" "0000102736" "LAMA2" "0000102737" "LAMA2" "0000102738" "LAMA2" "0000102739" "LAMA2" "0000102740" "LAMA2" "0000102741" "LAMA2" "0000102742" "LAMA2" "0000102743" "LAMA2" "0000102744" "LAMA2" "0000102745" "LAMA2" "0000102746" "LAMA2" "0000102747" "LAMA2" "0000102748" "LAMA2" "0000102749" "LAMA2" "0000102750" "LAMA2" "0000102751" "LAMA2" "0000102752" "LAMA2" "0000102753" "LAMA2" "0000102754" "LAMA2" "0000102755" "LAMA2" "0000102756" "LAMA2" "0000102757" "LAMA2" "0000102758" "LAMA2" "0000102759" "LAMA2" "0000102760" "LAMA2" "0000102761" "LAMA2" "0000102762" "LAMA2" "0000102763" "LAMA2" "0000102764" "LAMA2" "0000102765" "LAMA2" "0000102766" "LAMA2" "0000102767" "LAMA2" "0000102768" "LAMA2" "0000102769" "LAMA2" "0000102770" "LAMA2" "0000102771" "LAMA2" "0000102772" "LAMA2" "0000102773" "LAMA2" "0000102774" "LAMA2" "0000102775" "LAMA2" "0000102776" "LAMA2" "0000102777" "LAMA2" "0000102778" "LAMA2" "0000102779" "LAMA2" "0000102780" "LAMA2" "0000102781" "LAMA2" "0000102782" "LAMA2" "0000102783" "LAMA2" "0000102784" "LAMA2" "0000102785" "LAMA2" "0000102786" "LAMA2" "0000102787" "LAMA2" "0000102788" "LAMA2" "0000102789" "LAMA2" "0000102790" "LAMA2" "0000102791" "LAMA2" "0000102792" "LAMA2" "0000102793" "LAMA2" "0000102800" "LAMA2" "0000102801" "FKRP" "0000102801" "LAMA2" "0000102802" "LAMA2" "0000102803" "LAMA2" "0000102804" "LAMA2" "0000102805" "LAMA2" "0000102806" "LAMA2" "0000102807" "LAMA2" "0000102808" "LAMA2" "0000102809" "LAMA2" "0000102810" "LAMA2" "0000102811" "LAMA2" "0000102812" "LAMA2" "0000102813" "LAMA2" "0000102814" "LAMA2" "0000102815" "LAMA2" "0000102816" "LAMA2" "0000102817" "LAMA2" "0000102818" "LAMA2" "0000102819" "LAMA2" "0000102820" "LAMA2" "0000102821" "LAMA2" "0000102822" "LAMA2" "0000102823" "LAMA2" "0000102824" "LAMA2" "0000102825" "LAMA2" "0000102826" "LAMA2" "0000102827" "LAMA2" "0000102828" "LAMA2" "0000102829" "LAMA2" "0000102830" "LAMA2" "0000102831" "LAMA2" "0000102832" "LAMA2" "0000102833" "LAMA2" "0000102834" "LAMA2" "0000102835" "LAMA2" "0000102836" "LAMA2" "0000102837" "LAMA2" "0000102838" "LAMA2" "0000102839" "LAMA2" "0000102840" "LAMA2" "0000102841" "LAMA2" "0000102842" "LAMA2" "0000102843" "LAMA2" "0000102844" "LAMA2" "0000102845" "LAMA2" "0000102846" "LAMA2" "0000102847" "LAMA2" "0000102848" "LAMA2" "0000102849" "LAMA2" "0000102850" "LAMA2" "0000102851" "LAMA2" "0000102852" "LAMA2" "0000102853" "LAMA2" "0000102854" "LAMA2" "0000102855" "LAMA2" "0000102856" "LAMA2" "0000102857" "LAMA2" "0000102858" "LAMA2" "0000102859" "LAMA2" "0000102860" "LAMA2" "0000102861" "LAMA2" "0000102862" "LAMA2" "0000102863" "LAMA2" "0000102864" "LAMA2" "0000102865" "LAMA2" "0000102866" "LAMA2" "0000102867" "LAMA2" "0000102868" "LAMA2" "0000102869" "LAMA2" "0000102870" "LAMA2" "0000102871" "LAMA2" "0000102872" "LAMA2" "0000102873" "LAMA2" "0000102874" "LAMA2" "0000102875" "LAMA2" "0000102876" "LAMA2" "0000102877" "LAMA2" "0000102878" "LAMA2" "0000102879" "LAMA2" "0000102880" "LAMA2" "0000102881" "LAMA2" "0000102882" "LAMA2" "0000102883" "LAMA2" "0000102885" "LAMA2" "0000102886" "LAMA2" "0000102887" "LAMA2" "0000102888" "LAMA2" "0000102889" "LAMA2" "0000102890" "LAMA2" "0000102891" "LAMA2" "0000102892" "LAMA2" "0000102893" "LAMA2" "0000102894" "LAMA2" "0000102895" "LAMA2" "0000102896" "LAMA2" "0000102897" "LAMA2" "0000102898" "LAMA2" "0000102899" "LAMA2" "0000102900" "LAMA2" "0000102901" "LAMA2" "0000102902" "LAMA2" "0000102903" "LAMA2" "0000102904" "LAMA2" "0000102906" "LAMA2" "0000102907" "LAMA2" "0000102908" "LAMA2" "0000102909" "LAMA2" "0000102910" "LAMA2" "0000102911" "LAMA2" "0000102912" "LAMA2" "0000102913" "LAMA2" "0000102914" "LAMA2" "0000102915" "LAMA2" "0000102916" "LAMA2" "0000102917" "LAMA2" "0000102918" "LAMA2" "0000102919" "LAMA2" "0000102920" "LAMA2" "0000102921" "LAMA2" "0000102922" "LAMA2" "0000102923" "LAMA2" "0000102924" "LAMA2" "0000102925" "LAMA2" "0000102926" "LAMA2" "0000102927" "LAMA2" "0000102928" "LAMA2" "0000102929" "LAMA2" "0000102930" "LAMA2" "0000102931" "LAMA2" "0000102932" "LAMA2" "0000102933" "LAMA2" "0000102934" "LAMA2" "0000102935" "LAMA2" "0000102936" "LAMA2" "0000102937" "LAMA2" "0000102938" "LAMA2" "0000102939" "LAMA2" "0000102940" "LAMA2" "0000102941" "LAMA2" "0000102942" "LAMA2" "0000102943" "LAMA2" "0000102944" "LAMA2" "0000102945" "LAMA2" "0000102946" "LAMA2" "0000102947" "LAMA2" "0000102948" "LAMA2" "0000102949" "LAMA2" "0000102950" "LAMA2" "0000102951" "LAMA2" "0000102952" "LAMA2" "0000102953" "LAMA2" "0000102954" "LAMA2" "0000102955" "LAMA2" "0000102956" "LAMA2" "0000102957" "LAMA2" "0000102958" "LAMA2" "0000102959" "LAMA2" "0000102960" "LAMA2" "0000102961" "LAMA2" "0000102962" "LAMA2" "0000102963" "LAMA2" "0000102964" "LAMA2" "0000102965" "LAMA2" "0000102966" "LAMA2" "0000102967" "LAMA2" "0000102968" "LAMA2" "0000102969" "LAMA2" "0000102970" "LAMA2" "0000102971" "LAMA2" "0000102972" "LAMA2" "0000102973" "LAMA2" "0000102974" "LAMA2" "0000102975" "LAMA2" "0000102976" "LAMA2" "0000102977" "LAMA2" "0000102978" "LAMA2" "0000102979" "LAMA2" "0000102980" "LAMA2" "0000102981" "LAMA2" "0000102982" "LAMA2" "0000102983" "LAMA2" "0000102984" "LAMA2" "0000102985" "LAMA2" "0000102986" "LAMA2" "0000102987" "LAMA2" "0000102988" "CAPN3" "0000102988" "LAMA2" "0000102992" "LAMA2" "0000102994" "CAPN3" "0000102994" "LAMA2" "0000102995" "CAPN3" "0000102995" "LAMA2" "0000102997" "CAPN3" "0000102997" "LAMA2" "0000102998" "LAMA2" "0000102999" "LAMA2" "0000103000" "LAMA2" "0000103002" "LAMA2" "0000103003" "LAMA2" "0000103004" "LAMA2" "0000103005" "LAMA2" "0000103006" "LAMA2" "0000103007" "LAMA2" "0000103008" "LAMA2" "0000103009" "LAMA2" "0000103010" "LAMA2" "0000103011" "LAMA2" "0000103012" "LAMA2" "0000103013" "LAMA2" "0000103014" "LAMA2" "0000103015" "LAMA2" "0000103016" "LAMA2" "0000103017" "LAMA2" "0000103018" "LAMA2" "0000103019" "LAMA2" "0000103020" "LAMA2" "0000103021" "LAMA2" "0000103022" "LAMA2" "0000103023" "LAMA2" "0000103024" "LAMA2" "0000103025" "LAMA2" "0000103026" "LAMA2" "0000103027" "LAMA2" "0000103028" "LAMA2" "0000103029" "LAMA2" "0000103030" "LAMA2" "0000103031" "LAMA2" "0000103032" "LAMA2" "0000103033" "LAMA2" "0000103034" "LAMA2" "0000103035" "LAMA2" "0000103036" "LAMA2" "0000103037" "LAMA2" "0000103038" "LAMA2" "0000103039" "LAMA2" "0000103040" "LAMA2" "0000103041" "LAMA2" "0000103042" "LAMA2" "0000103043" "LAMA2" "0000103044" "LAMA2" "0000103045" "LAMA2" "0000103046" "LAMA2" "0000103047" "LAMA2" "0000103048" "LAMA2" "0000103049" "LAMA2" "0000103050" "LAMA2" "0000103051" "LAMA2" "0000103052" "LAMA2" "0000103053" "LAMA2" "0000103054" "LAMA2" "0000103055" "LAMA2" "0000103056" "LAMA2" "0000103057" "LAMA2" "0000103058" "LAMA2" "0000103059" "LAMA2" "0000103060" "LAMA2" "0000103061" "LAMA2" "0000103062" "LAMA2" "0000103063" "LAMA2" "0000103064" "LAMA2" "0000103065" "LAMA2" "0000103066" "LAMA2" "0000103067" "LAMA2" "0000103068" "LAMA2" "0000103069" "LAMA2" "0000103070" "LAMA2" "0000103071" "LAMA2" "0000103072" "LAMA2" "0000103073" "LAMA2" "0000103074" "LAMA2" "0000103075" "LAMA2" "0000103076" "LAMA2" "0000103077" "LAMA2" "0000103078" "LAMA2" "0000103079" "LAMA2" "0000103080" "LAMA2" "0000103081" "LAMA2" "0000103082" "LAMA2" "0000103083" "LAMA2" "0000103084" "LAMA2" "0000103085" "LAMA2" "0000103086" "LAMA2" "0000103087" "LAMA2" "0000103088" "LAMA2" "0000103089" "LAMA2" "0000103090" "LAMA2" "0000103091" "LAMA2" "0000103092" "LAMA2" "0000103093" "LAMA2" "0000103094" "LAMA2" "0000103095" "LAMA2" "0000103096" "LAMA2" "0000103097" "LAMA2" "0000103098" "LAMA2" "0000103099" "LAMA2" "0000103100" "LAMA2" "0000103101" "LAMA2" "0000103102" "LAMA2" "0000103103" "LAMA2" "0000103104" "LAMA2" "0000103105" "LAMA2" "0000103106" "LAMA2" "0000103107" "LAMA2" "0000103108" "LAMA2" "0000103109" "LAMA2" "0000103110" "LAMA2" "0000103111" "LAMA2" "0000103112" "LAMA2" "0000103113" "LAMA2" "0000103114" "LAMA2" "0000103115" "LAMA2" "0000103116" "LAMA2" "0000103117" "LAMA2" "0000103118" "LAMA2" "0000103119" "LAMA2" "0000103163" "LAMA2" "0000103164" "LAMA2" "0000103165" "LAMA2" "0000103166" "LAMA2" "0000103167" "LAMA2" "0000103168" "LAMA2" "0000103169" "LAMA2" "0000103170" "LAMA2" "0000103171" "LAMA2" "0000103172" "LAMA2" "0000103173" "LAMA2" "0000103174" "LAMA2" "0000103175" "LAMA2" "0000103176" "LAMA2" "0000103177" "LAMA2" "0000103178" "LAMA2" "0000103179" "LAMA2" "0000103180" "LAMA2" "0000103183" "LAMA2" "0000103184" "LAMA2" "0000103185" "LAMA2" "0000103186" "LAMA2" "0000103187" "LAMA2" "0000103188" "LAMA2" "0000103189" "LAMA2" "0000103190" "LAMA2" "0000103579" "LAMA2" "0000103580" "LAMA2" "0000103581" "LAMA2" "0000103582" "LAMA2" "0000103584" "LAMA2" "0000103585" "LAMA2" "0000103643" "LAMA2" "0000103645" "LAMA2" "0000103646" "LAMA2" "0000103648" "LAMA2" "0000103660" "LAMA2" "0000103675" "LAMA2" "0000103676" "LAMA2" "0000103677" "LAMA2" "0000103678" "LAMA2" "0000103683" "LAMA2" "0000103684" "LAMA2" "0000103685" "LAMA2" "0000103687" "LAMA2" "0000103689" "LAMA2" "0000103703" "LAMA2" "0000103704" "LAMA2" "0000103705" "LAMA2" "0000103706" "LAMA2" "0000103707" "LAMA2" "0000103708" "LAMA2" "0000103709" "LAMA2" "0000103712" "LAMA2" "0000103723" "LAMA2" "0000103781" "LAMA2" "0000103783" "LAMA2" "0000103917" "LAMA2" "0000103918" "LAMA2" "0000104087" "LAMA2" "0000104088" "LAMA2" "0000104089" "LAMA2" "0000104090" "LAMA2" "0000104091" "LAMA2" "0000104092" "LAMA2" "0000104093" "LAMA2" "0000104094" "LAMA2" "0000104111" "LAMA2" "0000104112" "LAMA2" "0000104113" "LAMA2" "0000104114" "LAMA2" "0000104115" "LAMA2" "0000104116" "LAMA2" "0000104117" "LAMA2" "0000104118" "LAMA2" "0000104119" "LAMA2" "0000104120" "LAMA2" "0000104121" "LAMA2" "0000104122" "LAMA2" "0000104123" "LAMA2" "0000104124" "LAMA2" "0000104125" "LAMA2" "0000104126" "LAMA2" "0000104183" "LAMA2" "0000104184" "LAMA2" "0000104185" "LAMA2" "0000104186" "LAMA2" "0000104187" "LAMA2" "0000104188" "LAMA2" "0000104189" "LAMA2" "0000104190" "LAMA2" "0000104191" "LAMA2" "0000104192" "LAMA2" "0000104193" "LAMA2" "0000104194" "LAMA2" "0000104211" "LAMA2" "0000104213" "LAMA2" "0000104214" "LAMA2" "0000104215" "LAMA2" "0000104216" "LAMA2" "0000104217" "LAMA2" "0000104218" "LAMA2" "0000104222" "LAMA2" "0000104223" "LAMA2" "0000104225" "LAMA2" "0000104228" "LAMA2" "0000104229" "LAMA2" "0000104232" "LAMA2" "0000104407" "LAMA2" "0000104408" "LAMA2" "0000104409" "LAMA2" "0000104410" "LAMA2" "0000104438" "LAMA2" "0000104439" "LAMA2" "0000104440" "LAMA2" "0000104441" "LAMA2" "0000104444" "LAMA2" "0000111837" "LAMA2" "0000111838" "LAMA2" "0000111839" "LAMA2" "0000111840" "LAMA2" "0000111841" "LAMA2" "0000111842" "LAMA2" "0000111844" "LAMA2" "0000111845" "LAMA2" "0000132719" "LAMA2" "0000132781" "LAMA2" "0000132815" "LAMA2" "0000132846" "LAMA2" "0000132847" "LAMA2" "0000132848" "LAMA2" "0000132849" "LAMA2" "0000132850" "LAMA2" "0000132853" "LAMA2" "0000132854" "LAMA2" "0000132855" "LAMA2" "0000132865" "LAMA2" "0000166014" "LAMA2" "0000184353" "LAMA2" "0000184359" "LAMA2" "0000209572" "LAMA2" "0000266605" "LAMA2" "0000271021" "LAMA2" "0000271022" "LAMA2" "0000275468" "LAMA2" "0000289268" "LAMA2" "0000289269" "LAMA2" "0000290138" "RYR1" "0000290155" "LAMA2" "0000290174" "LAMA2" "0000302735" "LAMA2" "0000304778" "LAMA2" "0000304779" "LAMA2" "0000305069" "LAMA2" "0000305070" "LAMA2" "0000306918" "LAMA2" "0000306936" "LAMA2" "0000309096" "LAMA2" "0000314939" "LAMA2" "0000315510" "LAMA2" "0000315511" "LAMA2" "0000315512" "LAMA2" "0000315513" "LAMA2" "0000315514" "LAMA2" "0000315515" "LAMA2" "0000315516" "LAMA2" "0000315517" "LAMA2" "0000315518" "LAMA2" "0000315519" "LAMA2" "0000315520" "LAMA2" "0000315521" "LAMA2" "0000315522" "LAMA2" "0000315523" "LAMA2" "0000315524" "LAMA2" "0000315525" "LAMA2" "0000315526" "LAMA2" "0000321482" "LAMA2" "0000326622" "LAMA2" "0000362834" "LAMA2" "0000375557" "LAMA2" "0000375558" "LAMA2" "0000375559" "LAMA2" "0000375560" "LAMA2" "0000375561" "LAMA2" "0000375562" "LAMA2" "0000375563" "LAMA2" "0000375564" "LAMA2" "0000375565" "LAMA2" "0000375566" "LAMA2" "0000375567" "LAMA2" "0000375568" "LAMA2" "0000375569" "LAMA2" "0000375895" "COL6A2" "0000377633" "LAMA2" "0000385787" "LAMA2" "0000399011" "LAMA2" "0000412506" "RHO" "0000412859" "RHO" "0000413156" "RHO" "0000413168" "RHO" "0000415985" "GALT" "0000416824" "LAMA2" "0000416825" "LAMA2" "0000418188" "LAMA2" "0000427801" "LAMA2" "0000427802" "LAMA2" "0000427803" "LAMA2" "0000427804" "LAMA2" "0000427805" "LAMA2" "0000427806" "LAMA2" "0000427807" "LAMA2" "0000427808" "LAMA2" "0000427809" "LAMA2" "0000427810" "LAMA2" "0000427811" "LAMA2" "0000427812" "LAMA2" "0000427813" "LAMA2" "0000427814" "LAMA2" "0000427815" "LAMA2" "0000427816" "LAMA2" "0000427817" "LAMA2" "0000427818" "LAMA2" "0000427819" "LAMA2" "0000427820" "LAMA2" "0000427821" "LAMA2" "0000427822" "LAMA2" "0000427823" "LAMA2" "0000427824" "LAMA2" "0000427825" "LAMA2" "0000427826" "LAMA2" "0000427827" "LAMA2" "0000427828" "LAMA2" "0000427829" "LAMA2" "0000427830" "LAMA2" "0000427831" "LAMA2" "0000427832" "LAMA2" "0000427833" "LAMA2" "0000427834" "LAMA2" "0000427835" "LAMA2" "0000427836" "LAMA2" "0000427837" "LAMA2" "0000427838" "LAMA2" "0000427839" "LAMA2" "0000427840" "LAMA2" "0000427841" "LAMA2" "0000427842" "LAMA2" "0000427843" "LAMA2" "0000427844" "LAMA2" "0000427845" "LAMA2" "0000427846" "LAMA2" "0000427847" "LAMA2" "0000427848" "LAMA2" "0000427849" "LAMA2" "0000427850" "LAMA2" "0000427851" "LAMA2" "0000427852" "LAMA2" "0000427853" "LAMA2" "0000427854" "LAMA2" "0000427855" "LAMA2" "0000427856" "LAMA2" "0000427857" "LAMA2" "0000427858" "LAMA2" "0000427859" "LAMA2" "0000427860" "LAMA2" "0000427861" "LAMA2" "0000427862" "LAMA2" "0000427863" "LAMA2" "0000427864" "LAMA2" "0000427865" "LAMA2" "0000427866" "LAMA2" "0000427867" "LAMA2" "0000427868" "LAMA2" "0000427869" "LAMA2" "0000427870" "LAMA2" "0000427871" "LAMA2" "0000427872" "LAMA2" "0000427873" "LAMA2" "0000427874" "LAMA2" "0000427875" "LAMA2" "0000427876" "LAMA2" "0000427877" "LAMA2" "0000427878" "LAMA2" "0000427879" "LAMA2" "0000427880" "LAMA2" "0000427881" "LAMA2" "0000427882" "LAMA2" "0000427883" "LAMA2" "0000427884" "LAMA2" "0000427885" "LAMA2" "0000427886" "LAMA2" "0000427887" "LAMA2" "0000427888" "LAMA2" "0000427889" "LAMA2" "0000427890" "LAMA2" "0000427891" "LAMA2" "0000427892" "LAMA2" "0000427893" "LAMA2" "0000427894" "LAMA2" "0000427895" "LAMA2" "0000427896" "LAMA2" "0000427897" "LAMA2" "0000427898" "LAMA2" "0000427899" "LAMA2" "0000427900" "LAMA2" "0000427901" "LAMA2" "0000427902" "LAMA2" "0000427903" "LAMA2" "0000427904" "LAMA2" "0000427905" "LAMA2" "0000427906" "LAMA2" "0000427907" "LAMA2" "0000427908" "LAMA2" "0000427909" "LAMA2" "0000427910" "LAMA2" "0000427911" "LAMA2" "0000427912" "LAMA2" "0000427913" "LAMA2" "0000427914" "LAMA2" "0000427915" "LAMA2" "0000427916" "LAMA2" "0000427917" "LAMA2" "0000427918" "LAMA2" "0000427919" "LAMA2" "0000427920" "LAMA2" "0000427921" "LAMA2" "0000427922" "LAMA2" "0000427923" "LAMA2" "0000427924" "LAMA2" "0000427925" "LAMA2" "0000427926" "LAMA2" "0000427927" "LAMA2" "0000427928" "LAMA2" "0000427929" "LAMA2" "0000427930" "LAMA2" "0000428466" "LAMA2" "0000428467" "LAMA2" "0000428468" "LAMA2" "0000428469" "LAMA2" "0000428470" "LAMA2" "0000428471" "LAMA2" "0000428472" "LAMA2" "0000428473" "LAMA2" "0000428474" "LAMA2" "0000428475" "LAMA2" "0000428476" "LAMA2" "0000428477" "LAMA2" "0000428478" "LAMA2" "0000428479" "LAMA2" "0000428480" "LAMA2" "0000428481" "LAMA2" "0000428482" "LAMA2" "0000428483" "LAMA2" "0000428484" "LAMA2" "0000428491" "LAMA2" "0000429881" "LAMA2" "0000436513" "LAMA2" "0000437160" "LAMA2" "0000437161" "LAMA2" "0000437162" "LAMA2" "0000437163" "LAMA2" "0000437164" "LAMA2" "0000437165" "LAMA2" "0000437166" "LAMA2" "0000437167" "LAMA2" "0000437168" "LAMA2" "0000437169" "LAMA2" "0000437170" "LAMA2" "0000437171" "LAMA2" "0000437172" "LAMA2" "0000437173" "LAMA2" "0000437174" "LAMA2" "0000437175" "LAMA2" "0000437176" "LAMA2" "0000437177" "LAMA2" "0000437178" "LAMA2" "0000437179" "LAMA2" "0000437180" "LAMA2" "0000437181" "LAMA2" "0000437182" "LAMA2" "0000437183" "LAMA2" "0000437184" "LAMA2" "0000437185" "LAMA2" "0000437186" "LAMA2" "0000437187" "LAMA2" "0000437188" "LAMA2" "0000437189" "LAMA2" "0000437190" "LAMA2" "0000437191" "LAMA2" "0000437192" "LAMA2" "0000437193" "LAMA2" "0000437194" "LAMA2" "0000437195" "LAMA2" "0000437196" "LAMA2" "0000437197" "LAMA2" "0000437198" "LAMA2" "0000437199" "LAMA2" "0000437200" "LAMA2" "0000437201" "LAMA2" "0000437202" "LAMA2" "0000437203" "LAMA2" "0000437204" "LAMA2" "0000437205" "LAMA2" "0000437206" "LAMA2" "0000437207" "LAMA2" "0000437208" "LAMA2" "0000437209" "LAMA2" "0000437210" "LAMA2" "0000437211" "LAMA2" "0000444092" "LAMA2" "0000444093" "LAMA2" "0000444094" "LAMA2" "0000449997" "LAMA2" "0000454406" "LAMA2" "0000454442" "LAMA2" "0000465824" "LAMA2" "0000465825" "LAMA2" "0000465826" "LAMA2" "0000465827" "LAMA2" "0000465828" "LAMA2" "0000465829" "LAMA2" "0000465830" "LAMA2" "0000465831" "LAMA2" "0000465832" "LAMA2" "0000465833" "LAMA2" "0000465834" "LAMA2" "0000465835" "LAMA2" "0000465836" "LAMA2" "0000465837" "LAMA2" "0000465838" "LAMA2" "0000465839" "LAMA2" "0000465840" "LAMA2" "0000465841" "LAMA2" "0000465842" "LAMA2" "0000465843" "LAMA2" "0000465844" "LAMA2" "0000465845" "LAMA2" "0000465846" "LAMA2" "0000465847" "LAMA2" "0000465848" "LAMA2" "0000465849" "LAMA2" "0000465850" "LAMA2" "0000465851" "LAMA2" "0000465852" "LAMA2" "0000465853" "LAMA2" "0000465854" "LAMA2" "0000465855" "LAMA2" "0000465856" "LAMA2" "0000465857" "LAMA2" "0000465858" "LAMA2" "0000465859" "LAMA2" "0000465860" "LAMA2" "0000465861" "LAMA2" "0000465862" "LAMA2" "0000465863" "LAMA2" "0000465864" "LAMA2" "0000465865" "LAMA2" "0000465866" "LAMA2" "0000465867" "LAMA2" "0000465868" "LAMA2" "0000465869" "LAMA2" "0000465870" "LAMA2" "0000465871" "LAMA2" "0000465872" "LAMA2" "0000465873" "LAMA2" "0000465874" "LAMA2" "0000465875" "LAMA2" "0000465876" "LAMA2" "0000465877" "LAMA2" "0000465878" "LAMA2" "0000465879" "LAMA2" "0000465880" "LAMA2" "0000465881" "LAMA2" "0000465882" "LAMA2" "0000465883" "LAMA2" "0000465884" "LAMA2" "0000465885" "LAMA2" "0000465886" "LAMA2" "0000465887" "LAMA2" "0000465888" "LAMA2" "0000465889" "LAMA2" "0000465890" "LAMA2" "0000465891" "LAMA2" "0000465892" "LAMA2" "0000465893" "LAMA2" "0000465894" "LAMA2" "0000465895" "LAMA2" "0000465896" "LAMA2" "0000465897" "LAMA2" "0000465898" "LAMA2" "0000465899" "LAMA2" "0000465900" "LAMA2" "0000465901" "LAMA2" "0000465902" "LAMA2" "0000465903" "LAMA2" "0000465904" "LAMA2" "0000465905" "LAMA2" "0000465906" "LAMA2" "0000465907" "LAMA2" "0000465908" "LAMA2" "0000465909" "LAMA2" "0000465910" "LAMA2" "0000465911" "LAMA2" "0000465912" "LAMA2" "0000465913" "LAMA2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 2855 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000001131" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001132" "3" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001133" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001134" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001135" "3" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001136" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001137" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001138" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001140" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001141" "3" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001142" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001144" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000001147" "0" "50" "6" "129687396" "129687396" "subst" "0.0195317" "00006" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.129366251G>A" "" "VUS" "" "0000001148" "0" "50" "6" "129687396" "129687396" "subst" "0.0195317" "00006" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.129366251G>A" "" "VUS" "" "0000063227" "1" "10" "6" "129807714" "129807714" "subst" "0.303132" "01164" "LAMA2_000089" "g.129807714G>A" "" "" "" "" "" "Germline" "" "rs2229850" "0" "" "" "g.129486569G>A" "" "benign" "" "0000063228" "1" "10" "6" "129621725" "129621725" "subst" "0" "01164" "LAMA2_000162" "g.129621725A>G" "" "" "" "" "" "Germline" "" "rs3798666" "0" "" "" "g.129300580A>G" "" "benign" "" "0000063229" "1" "10" "6" "129807629" "129807629" "subst" "0" "01164" "LAMA2_000065" "g.129807629=" "" "" "" "" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000063230" "1" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "01164" "LAMA2_000150" "g.129813629G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic" "" "0000063231" "1" "10" "6" "129381026" "129381026" "subst" "0.960856" "01164" "LAMA2_000110" "g.129381026C>A" "" "" "" "" "" "Germline" "" "rs4404787" "0" "" "" "g.129059881C>A" "" "benign" "" "0000063232" "1" "10" "6" "129486913" "129486913" "subst" "0" "01164" "LAMA2_000158" "g.129486913T>C" "" "" "" "" "" "Germline" "" "rs3778137" "0" "" "" "g.129165768T>C" "" "benign" "" "0000063233" "1" "50" "6" "129690982" "129690982" "subst" "0" "01164" "LAMA2_000170" "g.129690982A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129369837A>G" "" "VUS" "" "0000063235" "1" "10" "6" "129622055" "129622055" "subst" "0.396641" "01164" "LAMA2_000164" "g.129622055A>G" "" "" "" "" "" "Germline" "" "rs902373" "0" "" "" "g.129300910A>G" "" "benign" "" "0000063236" "21" "70" "6" "129381042" "129381042" "subst" "0" "01164" "LAMA2_000384" "g.129381042G>A" "" "" "" "" "segregation analysis confirmed second pathogenic variant c.8586T>G transmitted from the father" "Germline" "-" "" "0" "" "" "g.129059897G>A" "" "likely pathogenic (recessive)" "" "0000063237" "1" "10" "6" "129835814" "129835814" "subst" "0" "01164" "LAMA2_000075" "g.129835814G>A" "" "" "" "" "" "Germline" "" "rs2297740" "0" "" "" "g.129514669G>A" "" "benign" "" "0000063238" "1" "10" "6" "129634255" "129634255" "subst" "0.220596" "01164" "LAMA2_000165" "g.129634255G>A" "" "" "" "" "" "Germline" "" "rs3798663" "0" "" "" "g.129313110G>A" "" "benign" "" "0000063239" "1" "10" "6" "129622257" "129622257" "subst" "0" "01164" "LAMA2_000385" "g.129622257A>G" "" "" "" "" "" "Germline" "" "rs3798664" "0" "" "" "g.129301112A>G" "" "benign" "" "0000063240" "1" "10" "6" "129777382" "129777382" "subst" "0" "01164" "LAMA2_000175" "g.129777382C>T" "" "" "" "" "" "Germline" "" "rs1811970" "0" "" "" "g.129456237C>T" "" "benign" "" "0000063241" "1" "10" "6" "129775470" "129775470" "subst" "0.156879" "01164" "LAMA2_000174" "g.129775470T>C" "" "" "" "" "" "Germline" "" "rs2297742" "0" "" "" "g.129454325T>C" "" "benign" "" "0000063242" "1" "10" "6" "129813436" "129813436" "dup" "0" "01164" "LAMA2_000180" "g.129813436dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129492291dup" "" "benign" "" "0000063243" "1" "10" "6" "129785391" "129785391" "subst" "0.609286" "01164" "LAMA2_000177" "g.129785391T>C" "" "" "" "" "" "Germline" "" "rs1414736" "0" "" "" "g.129464246T>C" "" "benign" "" "0000063244" "1" "30" "6" "129380844" "129380844" "subst" "0" "01164" "LAMA2_000383" "g.129380844A>G" "gnomAD: MAF 0.28" "" "" "" "" "Germline" "" "rs74936600" "0" "" "" "g.129059699A>G" "" "likely benign" "" "0000063245" "1" "50" "6" "129663792" "129663792" "subst" "0" "01164" "LAMA2_000386" "g.129663792T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129342647T>C" "" "VUS" "" "0000063246" "1" "10" "6" "129635800" "129635800" "subst" "0.0648408" "01164" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "rs2306942" "0" "" "" "g.129314655G>A" "" "benign" "" "0000063247" "1" "50" "6" "129663469" "129663471" "del" "0" "01164" "LAMA2_000212" "g.129663469_129663471del" "" "" "" "4312-21_4312-19delCTT" "" "Germline" "" "rs200038968" "0" "" "" "g.129342324_129342326del" "" "VUS" "" "0000063248" "1" "10" "6" "129807699" "129807699" "subst" "0.672742" "01164" "LAMA2_000067" "g.129807699G>C" "" "" "" "" "" "Germline" "" "rs6569606" "0" "" "" "g.129486554G>C" "" "benign" "" "0000063249" "1" "10" "6" "129785282" "129785282" "subst" "0" "01164" "LAMA2_000387" "g.129785282G>A" "" "" "" "" "" "Germline" "" "rs2297741" "0" "" "" "g.129464137G>A" "" "benign" "" "0000063250" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "01164" "LAMA2_000052" "g.129762112G>A" "" "" "" "" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000063252" "1" "50" "6" "129380843" "129380844" "ins" "0" "01164" "LAMA2_000382" "g.129380843_129380844insG" "" "" "" "" "" "Germline" "" "rs143205326" "0" "" "" "g.129059698_129059699insG" "" "VUS" "" "0000084571" "1" "90" "6" "129670529" "129670529" "subst" "0" "01399" "LAMA2_000394" "g.129670529G>C" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129349384G>C" "" "pathogenic (recessive)" "" "0000084575" "1" "50" "6" "129687506" "129687506" "subst" "0" "01399" "LAMA2_000388" "g.129687506G>A" "" "{PMID:O\'Grady 2016:27159402}" "" "" "no variant 2nd chromosome" "Germline" "yes" "" "0" "" "" "g.129366361G>A" "" "VUS" "" "0000084576" "1" "90" "6" "129802526" "129802526" "subst" "0" "01399" "LAMA2_000063" "g.129802526T>C" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129481381T>C" "" "pathogenic (recessive)" "" "0000084580" "1" "90" "6" "129609010" "129609010" "del" "0" "01399" "LAMA2_000247" "g.129609010del" "" "{PMID:O\'Grady 2016:27159402}" "" "2556delT" "" "Germline" "yes" "" "0" "" "" "g.129287865del" "" "pathogenic (recessive)" "" "0000084587" "1" "90" "6" "129609010" "129609010" "del" "0" "01399" "LAMA2_000247" "g.129609010del" "" "{PMID:O\'Grady 2016:27159402}" "" "2556delT" "" "Germline" "yes" "" "0" "" "" "g.129287865del" "" "pathogenic (recessive)" "" "0000084590" "3" "90" "6" "129608991" "129608991" "subst" "0" "01399" "LAMA2_000184" "g.129608991G>C" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129287846G>C" "" "pathogenic (recessive)" "" "0000084592" "1" "90" "6" "129807768" "129807768" "subst" "0" "01399" "LAMA2_000389" "g.129807768G>A" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129486623G>A" "" "pathogenic (recessive)" "" "0000084614" "2" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "01399" "LAMA2_000041" "g.129674430C>T" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000084616" "2" "90" "6" "129837376" "129837376" "subst" "4.06461E-6" "01399" "LAMA2_000078" "g.129837376C>T" "" "{PMID:O\'Grady 2016:27159402}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129516231C>T" "" "pathogenic (recessive)" "" "0000084620" "2" "90" "6" "129781396" "129781397" "del" "0" "01399" "LAMA2_000054" "g.129781396_129781397del" "" "{PMID:O\'Grady 2016:27159402}" "" "6919_6920delTA" "" "Germline" "yes" "" "0" "" "" "g.129460251_129460252del" "" "pathogenic (recessive)" "" "0000084624" "2" "90" "6" "129636695" "129636695" "del" "0" "01399" "LAMA2_000142" "g.129636695del" "" "{PMID:O\'Grady 2016:27159402}" "" "3630delT" "" "Germline" "yes" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "" "0000084625" "2" "90" "6" "129833581" "129833583" "del" "0" "01399" "LAMA2_000390" "g.129833581_129833583del" "" "{PMID:O\'Grady 2016:27159402}" "" "8931_8933delTCT" "" "Germline" "yes" "" "0" "" "" "g.129512436_129512438del" "" "pathogenic (recessive)" "" "0000146005" "1" "70" "6" "129419532" "129419532" "subst" "0" "01822" "LAMA2_000391" "g.129419532C>T" "" "{PMID:Harris 2017:27932089}" "" "" "reduced laminin alpha 2 on skin biopsy" "Germline" "" "" "0" "" "" "g.129098387C>T" "" "likely pathogenic (recessive)" "" "0000146006" "1" "70" "6" "129674318" "129674318" "del" "0" "01822" "LAMA2_000392" "g.129674318del" "" "{PMID:Harris 2017:27932089}" "" "" "reduced laminin alpha 2 on skin biopsy" "Germline" "yes" "" "0" "" "" "g.129353173del" "" "likely pathogenic (recessive)" "" "0000165300" "0" "50" "6" "129687511" "129687511" "subst" "0" "00006" "LAMA2_000043" "g.129687511G>A" "" "Subm. FMuntoni" "" "" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.129366366G>A" "" "VUS" "" "0000165301" "1" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Pegoraro 1998:09674786}" "" "8124-8293del" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165303" "1" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "1/40 patients" "{PMID:Hayashi 1995:07643867}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165304" "2" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "1/40 patients" "{PMID:Hayashi 1995:07643867}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165305" "1" "90" "6" "129204505" "129204505" "subst" "0" "00006" "LAMA2_000084" "g.129204505A>G" "" "{PMID:Allamand 2002:11938437}" "" "161+3A>G" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.128883360A>G" "" "pathogenic (recessive)" "" "0000165307" "1" "50" "6" "129475830" "129475830" "subst" "0" "00006" "LAMA2_000011" "g.129475830T>G" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129154685T>G" "" "VUS" "" "0000165308" "1" "90" "6" "129486720" "129486720" "subst" "0" "00006" "LAMA2_000085" "g.129486720G>C" "" "acc. to {PMID:Allamand 2002:11938437}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129165575G>C" "" "pathogenic (recessive)" "" "0000165310" "1" "90" "6" "129498921" "129498921" "del" "4.06365E-6" "00006" "LAMA2_000012" "g.129498921del" "" "{PMID:Allamand 2002:11938437}" "" "1426delC" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129177776del" "" "pathogenic (recessive)" "" "0000165312" "1" "90" "6" "129511462" "129511462" "subst" "0" "00006" "LAMA2_000132" "g.129511462G>A" "" "{PMID:Tezak 2003:12552556}, {OMIM156225:0010}" "" "1629G>A" "not in 100 normal chromosomes" "Germline" "" "" "0" "" "" "g.129190317G>A" "" "pathogenic (recessive)" "" "0000165313" "2" "50" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Tezak 2003:12552556}, {OMIM156225:0010}" "" "" "allele not expressed" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000165314" "1" "90" "6" "129571267" "129571269" "del" "0" "00006" "LAMA2_000014" "g.129571267_129571269del" "" "{PMID:Allamand 2002:11938437}" "" "1841-1843del" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129250122_129250124del" "" "pathogenic (recessive)" "" "0000165316" "1" "90" "6" "129571328" "129571335" "dup" "0" "00006" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Allamand 2002:11938437}" "" "1903-1910dup" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000165318" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}" "" "2096-2097del" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165321" "21" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Guicheney 1998:09541105}" "" "2098delAG ex13" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165322" "21" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "" "{PMID:Guicheney 1998:09541105}" "" "2848A>G" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165323" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Hayashi 2001:11369186}" "" "2097-2098del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165324" "2" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Hayashi 2001:11369186}" "" "2097-2098del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165325" "1" "50" "6" "129581937" "129581937" "subst" "0" "00006" "LAMA2_000019" "g.129581937C>A" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129260792C>A" "" "VUS" "" "0000165326" "1" "90" "6" "129618880" "129618880" "subst" "0" "00400" "LAMA2_000289" "g.129618880C>A" "" "{PMID:Yuan 2008:19294599}" "ApoI+" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129297735C>A" "" "pathogenic (recessive)" "" "0000165327" "2" "90" "6" "129618880" "129618880" "subst" "0" "00400" "LAMA2_000289" "g.129618880C>A" "" "{PMID:Yuan 2008:19294599}" "ApoI+" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129297735C>A" "" "pathogenic (recessive)" "" "0000165328" "1" "50" "6" "129371207" "129371207" "subst" "0" "00006" "LAMA2_000007" "g.129371207G>A" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129050062G>A" "" "VUS" "" "0000165329" "1" "90" "6" "129612758" "129612758" "subst" "4.06359E-6" "00006" "LAMA2_000023" "g.129612758G>A" "" "{PMID:Allamand 2002:11938437}" "" "2791-1G>A" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129291613G>A" "" "pathogenic (recessive)" "" "0000165330" "1" "90" "6" "129618927" "129618927" "subst" "0" "00006" "LAMA2_000026" "g.129618927G>A" "" "{PMID:Allamand 2002:11938437}" "" "3003G>A" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129297782G>A" "" "pathogenic (recessive)" "" "0000165331" "1" "90" "6" "129204392" "129204392" "subst" "0" "00006" "LAMA2_000003" "g.129204392T>C" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "T51C" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.128883247T>C" "" "pathogenic (recessive)" "" "0000165332" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Allamand 2002:11938437}" "" "3134C>T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165333" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Allamand 2002:11938437}" "" "C4025T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165334" "1" "50" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "VUS" "" "0000165335" "1" "50" "6" "129641681" "129641681" "subst" "0" "00006" "LAMA2_000035" "g.129641681A>G" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129320536A>G" "" "VUS" "" "0000165336" "1" "90" "6" "129649526" "129649526" "del" "0" "00006" "LAMA2_000086" "g.129649526del" "" "{PMID:Allamand 2002:11938437}" "" "4329delG" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129328381del" "" "pathogenic (recessive)" "" "0000165337" "1" "90" "6" "129649555" "129649555" "subst" "0" "00006" "LAMA2_000037" "g.129649555C>T" "" "{PMID:Allamand 2002:11938437}" "" "4358C>T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129328410C>T" "" "pathogenic (recessive)" "" "0000165338" "1" "90" "6" "129663551" "129663551" "del" "0" "00006" "LAMA2_000141" "g.129663551del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129342406del" "" "pathogenic (recessive)" "" "0000165339" "1" "90" "6" "129674475" "129674475" "subst" "0" "00006" "LAMA2_000042" "g.129674475C>T" "" "{PMID:Allamand 2002:11938437}" "" "4739C>T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129353330C>T" "" "pathogenic (recessive)" "" "0000165340" "1" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "C5165T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000165341" "1" "90" "6" "129722410" "129722411" "del" "0" "00006" "LAMA2_000047" "g.129722410_129722411del" "" "{PMID:Allamand 2002:11938437}" "" "5536-5537del" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129401265_129401266del" "" "pathogenic (recessive)" "" "0000165342" "1" "90" "6" "129722490" "129722490" "subst" "0" "00006" "LAMA2_000133" "g.129722490G>A" "" "{PMID:Tezak 2003:12552556}" "SpeI+" "IVS37+5G>A" "not in 100 normal chromosomes; unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129401345G>A" "" "pathogenic (recessive)" "" "0000165343" "1" "50" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "Subm. FMuntoni" "SpeI+" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "VUS" "" "0000165344" "11" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Tezak 2003:12552556}" "MaeIII+" "IVS37+5G>C" "not in 100 normal chromosomes; unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000165345" "1" "90" "6" "129725105" "129725105" "del" "0" "00006" "LAMA2_000051" "g.129725105del" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "5914del" "described as 5914delC in Allemand 2002; unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129403960del" "" "pathogenic (recessive)" "" "0000165346" "1" "90" "6" "129419549" "129419549" "subst" "0" "00006" "LAMA2_000009" "g.129419549G>T" "" "{PMID:Guicheney 1997:09185182}" "" "677G>T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129098404G>T" "" "pathogenic (recessive)" "" "0000165347" "1" "90" "6" "129781396" "129781397" "del" "0" "00006" "LAMA2_000054" "g.129781396_129781397del" "" "{PMID:Guicheney 1997:09185182}" "" "6968delTA" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129460251_129460252del" "" "pathogenic (recessive)" "" "0000165348" "1" "90" "6" "129781425" "129781425" "subst" "0" "00006" "LAMA2_000055" "g.129781425G>A" "" "{PMID:Guicheney 1997:09185182}" "" "6997G>A" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129460280G>A" "" "pathogenic (recessive)" "" "0000165349" "1" "90" "6" "129781432" "129781432" "subst" "1.63043E-5" "00006" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Pegoraro 1998:09674786}" "" "C7004T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "pathogenic (recessive)" "" "0000165350" "1" "50" "6" "129785513" "129785513" "subst" "0" "00006" "LAMA2_000058" "g.129785513G>A" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129464368G>A" "" "VUS" "" "0000165351" "1" "90" "6" "129794435" "129794435" "dup" "0" "00006" "LAMA2_000060" "g.129794435dup" "" "{PMID:Allamand 2002:11938437}" "" "7426insT" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129473290dup" "" "pathogenic (recessive)" "" "0000165352" "1" "90" "6" "129794493" "129794494" "del" "0" "00006" "LAMA2_000061" "g.129794493_129794494del" "" "{PMID:Pegoraro 1998:09674786}" "" "7484-7485del" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129473348_129473349del" "" "pathogenic (recessive)" "" "0000165353" "1" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Hayashi 2001:11369186}" "" "r.7798-7947del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165354" "2" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Hayashi 2001:11369186}" "" "r.7798-7947del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165355" "1" "50" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "VUS" "" "0000165356" "10" "90" "6" "129591901" "129591907" "del" "0" "00426" "LAMA2_000183" "g.129591901_129591907del" "" "{PMID:Siala 2008:18053718}" "MaeIII" "" "not in 200 control chromosomes; skip from expression cloning" "Germline" "" "" "0" "" "" "g.129270756_129270762del" "" "pathogenic (recessive)" "" "0000165357" "11" "10" "6" "129762112" "129762112" "subst" "0.173011" "00426" "LAMA2_000052" "g.129762112G>A" "" "" "" "6286G>A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000165358" "21" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "{PMID:Siala 2008:18053718}" "" "" "not in 200 control chromosomes" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000165359" "21" "10" "6" "129571330" "129571330" "subst" "0.1735" "00426" "LAMA2_000016" "g.129571330G>A" "" "" "" "1905G>A" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165360" "21" "10" "6" "129722425" "129722425" "subst" "0.49225" "00426" "LAMA2_000048" "g.129722425G>A" "" "" "" "5551A>G" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000165361" "1" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00426" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Louhichi 2006:19388593}, {PMID:Siala 2007:17949279}, {PMID:Siala 2008:19072569}" "NspI-" "IVS58+1G>A" "not in 200 control chromosomes; 2.6x reduced muscle mRNA" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165362" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00426" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Louhichi 2006:19388593}, {PMID:Siala 2007:17949279}, {PMID:Siala 2008:19072569}" "NspI-" "IVS58+1G>A" "not in 200 control chromosomes; 2.6x reduced muscle mRNA" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165363" "1" "90" "6" "129204472" "129204472" "subst" "4.69572E-6" "00006" "LAMA2_000004" "g.129204472C>T" "" "{PMID:Pegoraro 1998:09674786}" "" "C131T" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.128883327C>T" "" "pathogenic (recessive)" "" "0000165364" "1" "90" "6" "129835630" "129835633" "dup" "0" "00006" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "9154-9157ins" "" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000165365" "2" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "" "variant in promoter?" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165366" "1" "90" "6" "129513885" "129513885" "subst" "0" "00006" "LAMA2_000137" "g.129513885C>T" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129192740C>T" "" "pathogenic (recessive)" "" "0000165367" "2" "90" "6" "129513885" "129513885" "subst" "0" "00006" "LAMA2_000137" "g.129513885C>T" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129192740C>T" "" "pathogenic (recessive)" "" "0000165368" "1" "90" "6" "129571328" "129571335" "dup" "0" "00400" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2008:18700894}" "" "1854_1861dupACGTGTTC" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000165369" "3" "90" "6" "129571328" "129571335" "dup" "0" "00400" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2008:18700894}" "" "1854_1861dupACGTGTTC" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000165370" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "2096-2097del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165371" "2" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "2096-2097del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165372" "1" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Di Blasi 2001:11287370}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000165373" "2" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Di Blasi 2001:11287370}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000165374" "11" "90" "6" "129591815" "129591815" "del" "0" "00006" "LAMA2_000021" "g.129591815del" "" "{PMID:Guicheney 1997:09185182}" "ScrfI-" "2418delC" "" "Germline" "" "" "0" "" "" "g.129270670del" "" "pathogenic (recessive)" "" "0000165375" "21" "90" "6" "129591815" "129591815" "del" "0" "00006" "LAMA2_000021" "g.129591815del" "" "{PMID:Guicheney 1997:09185182}" "ScrfI-" "2418delC" "" "Germline" "" "" "0" "" "" "g.129270670del" "" "pathogenic (recessive)" "" "0000165376" "1" "90" "6" "129371233" "129371233" "subst" "0" "00006" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "" "0000165377" "2" "90" "6" "129371233" "129371233" "subst" "0" "00006" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "" "0000165378" "1" "90" "6" "129618935" "129618935" "subst" "0" "00006" "LAMA2_000027" "g.129618935C>T" "" "{PMID:Guicheney 1998:09541105}" "NlaIV-" "3011C>T ex20" "" "Germline" "" "" "0" "" "" "g.129297790C>T" "" "pathogenic (recessive)" "" "0000165379" "2" "90" "6" "129618935" "129618935" "subst" "0" "00006" "LAMA2_000027" "g.129618935C>T" "" "{PMID:Guicheney 1998:09541105}" "NlaIV-" "3011C>T ex20" "" "Germline" "" "" "0" "" "" "g.129297790C>T" "" "pathogenic (recessive)" "" "0000165380" "11" "90" "6" "129618959" "129618959" "subst" "0" "00006" "LAMA2_000028" "g.129618959T>C" "" "{PMID:Nissinen 1996:8651294}, {PMID:Guicheney 1997:9185182}" "MaeII+" "3035T>C" "not in 332 control chromosomes (224 France, 108 Turkey)" "Germline" "" "" "0" "" "" "g.129297814T>C" "" "pathogenic (recessive)" "" "0000165381" "21" "90" "6" "129618959" "129618959" "subst" "0" "00006" "LAMA2_000028" "g.129618959T>C" "" "{PMID:Nissinen 1996:8651294}, {PMID:Guicheney 1997:9185182}" "MaeII+" "3035T>C" "not in 332 control chromosomes (224 France, 108 Turkey)" "Germline" "" "" "0" "" "" "g.129297814T>C" "" "pathogenic (recessive)" "" "0000165382" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165383" "2" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165384" "1" "90" "6" "129621965" "129621965" "del" "0" "00006" "LAMA2_000030" "g.129621965del" "" "{PMID:Guicheney 1998:09541105}" "" "3171delG ex21" "" "Germline" "" "" "0" "" "" "g.129300820del" "" "pathogenic (recessive)" "" "0000165385" "2" "90" "6" "129621965" "129621965" "del" "0" "00006" "LAMA2_000030" "g.129621965del" "" "{PMID:Guicheney 1998:09541105}" "" "3171delG ex21" "" "Germline" "" "" "0" "" "" "g.129300820del" "" "pathogenic (recessive)" "" "0000165386" "1" "10" "6" "129511373" "129511373" "subst" "0.0319401" "00006" "LAMA2_000083" "g.129511373T>C" "" "{PMID:Helbling-Leclerc:07550355}" "" "" "" "Germline" "" "" "0" "" "" "g.129190228T>C" "" "benign" "" "0000165387" "1" "90" "6" "129636783" "129636783" "subst" "0" "00006" "LAMA2_000001" "g.129636783C>T" "" "{PMID:Helbling-Leclerc:07550355}, {OMIM156225:0002}" "" "3767C>T (Q1241X)" "" "Germline" "" "" "0" "" "" "g.129315638C>T" "" "pathogenic (recessive)" "" "0000165388" "2" "90" "6" "129636783" "129636783" "subst" "0" "00006" "LAMA2_000001" "g.129636783C>T" "" "{PMID:Helbling-Leclerc:07550355}, {OMIM156225:0002}" "" "3767C>T (Q1241X)" "" "Germline" "" "" "0" "" "" "g.129315638C>T" "" "pathogenic (recessive)" "" "0000165389" "11" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:Allamand 1997:09158149}, {OMIM156225:0003}" "" "IVS25+2T>C" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165390" "21" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:Allamand 1997:09158149}, {OMIM156225:0003}" "" "IVS25+2T>C" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165391" "11" "90" "6" "129674307" "129674307" "subst" "0" "00006" "LAMA2_000002" "g.129674307A>T" "" "{PMID:Helbling-Leclerc:07550355}, {OMIM156225:0001}" "" "4573-2A>T" "" "Germline" "" "" "0" "" "" "g.129353162A>T" "" "pathogenic (recessive)" "" "0000165392" "21" "90" "6" "129674307" "129674307" "subst" "0" "00006" "LAMA2_000002" "g.129674307A>T" "" "{PMID:Helbling-Leclerc:07550355}, {OMIM156225:0001}" "" "4573-2A>T" "" "Germline" "" "" "0" "" "" "g.129353162A>T" "" "pathogenic (recessive)" "" "0000165393" "1" "90" "6" "129674423" "129674423" "subst" "0" "00006" "LAMA2_000040" "g.129674423C>A" "" "{PMID:Guicheney 1998:09541105}" "PlnI-" "4687C>A ex31" "" "Germline" "" "" "0" "" "" "g.129353278C>A" "" "pathogenic (recessive)" "" "0000165394" "2" "90" "6" "129674423" "129674423" "subst" "0" "00006" "LAMA2_000040" "g.129674423C>A" "" "{PMID:Guicheney 1998:09541105}" "PlnI-" "4687C>A ex31" "" "Germline" "" "" "0" "" "" "g.129353278C>A" "" "pathogenic (recessive)" "" "0000165395" "1" "90" "6" "129691037" "129691037" "del" "4.07352E-6" "00006" "LAMA2_000139" "g.129691037del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129369892del" "" "pathogenic (recessive)" "" "0000165396" "2" "90" "6" "129691037" "129691037" "del" "4.07352E-6" "00006" "LAMA2_000139" "g.129691037del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129369892del" "" "pathogenic (recessive)" "" "0000165397" "1" "90" "6" "129419421" "129419421" "subst" "0" "00006" "LAMA2_000144" "g.129419421A>C" "" "{PMID:Di Blasi 2005:16216942}" "" "" "not in 200 control chromosomes" "Germline" "" "" "0" "" "" "g.129098276A>C" "" "pathogenic (recessive)" "" "0000165398" "2" "90" "6" "129419421" "129419421" "subst" "0" "00006" "LAMA2_000144" "g.129419421A>C" "" "{PMID:Di Blasi 2005:16216942}" "" "" "not in 200 control chromosomes" "Germline" "" "" "0" "" "" "g.129098276A>C" "" "pathogenic (recessive)" "" "0000165399" "1" "90" "6" "129781432" "129781432" "subst" "1.63043E-5" "00006" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "C7004T" "" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "pathogenic (recessive)" "" "0000165400" "2" "90" "6" "129781432" "129781432" "subst" "1.63043E-5" "00006" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "C7004T" "" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "pathogenic (recessive)" "" "0000165401" "1" "90" "6" "129785437" "129785437" "del" "0" "00006" "LAMA2_000057" "g.129785437del" "" "{PMID:Pegoraro 1998:09674786}" "" "7043del" "" "Germline" "" "" "0" "" "" "g.129464292del" "" "pathogenic (recessive)" "" "0000165402" "2" "90" "6" "129785437" "129785437" "del" "0" "00006" "LAMA2_000057" "g.129785437del" "" "{PMID:Pegoraro 1998:09674786}" "" "7043del" "" "Germline" "" "" "0" "" "" "g.129464292del" "" "pathogenic (recessive)" "" "0000165403" "11" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Coral-Vazquez 2003:12601554}, {OMIM156225:0008}" "" "C7781T ex54" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165404" "21" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Coral-Vazquez 2003:12601554}, {OMIM156225:0008}" "" "C7781T ex54" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165405" "1" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165406" "2" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165407" "1" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165408" "2" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165409" "1" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "Subm. FMuntoni, Mein ESHG2006 P0665" "" "" "" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165410" "2" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "Subm. FMuntoni, Mein ESHG2006 P0665" "" "" "" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165411" "1" "90" "6" "129813154" "129813154" "del" "0" "00006" "LAMA2_000140" "g.129813154del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000165412" "2" "90" "6" "129813154" "129813154" "del" "0" "00006" "LAMA2_000140" "g.129813154del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000165413" "11" "90" "6" "129813223" "129813224" "del" "0" "00006" "LAMA2_000145" "g.129813223_129813224del" "" "{PMID:Prandini 2004:15452315}" "" "" "muscle mRNA reduced to 0.2" "Germline" "" "" "0" "" "" "g.129492078_129492079del" "" "pathogenic (recessive)" "" "0000165414" "21" "90" "6" "129813223" "129813224" "del" "0" "00006" "LAMA2_000145" "g.129813223_129813224del" "" "{PMID:Prandini 2004:15452315}" "" "" "muscle mRNA reduced to 0.2" "Germline" "" "" "0" "" "" "g.129492078_129492079del" "" "pathogenic (recessive)" "" "0000165415" "1" "90" "6" "129823824" "129823824" "del" "0" "00006" "LAMA2_000070" "g.129823824del" "" "{PMID:Guicheney 1998:09541105}" "" "8314delA ex58" "" "Germline" "" "" "0" "" "" "g.129502679del" "" "pathogenic (recessive)" "" "0000165416" "2" "90" "6" "129823824" "129823824" "del" "0" "00006" "LAMA2_000070" "g.129823824del" "" "{PMID:Guicheney 1998:09541105}" "" "8314delA ex58" "" "Germline" "" "" "0" "" "" "g.129502679del" "" "pathogenic (recessive)" "" "0000165417" "1" "90" "6" "129835630" "129835633" "dup" "0" "00006" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Pegoraro 1998:09674786}" "" "9154-9157ins" "" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000165418" "2" "90" "6" "129835630" "129835633" "dup" "0" "00006" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Pegoraro 1998:09674786}" "" "9154-9157ins" "" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000165419" "1" "90" "6" "129470165" "129470166" "dup" "0" "00006" "LAMA2_000010" "g.129470165_129470166dup" "" "{PMID:Pegoraro 1998:09674786}" "" "1001-1002ins" "" "Germline" "" "" "0" "" "" "g.129149020_129149021dup" "" "pathogenic (recessive)" "" "0000165420" "2" "90" "6" "129470165" "129470166" "dup" "0" "00006" "LAMA2_000010" "g.129470165_129470166dup" "" "{PMID:Pegoraro 1998:09674786}" "" "1001-1002ins" "" "Germline" "" "" "0" "" "" "g.129149020_129149021dup" "" "pathogenic (recessive)" "" "0000165421" "1" "50" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "SpeI+" "IVS37+5G>C" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "VUS" "" "0000165422" "1" "50" "6" "129835746" "129835746" "subst" "0.000691467" "00006" "LAMA2_000272" "g.129835746T>C" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "" "IVS63+6T>C" "not in 180 control chromosomes" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "VUS" "" "0000165423" "2" "50" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "SpeI+" "IVS37+5G>C" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "VUS" "" "0000165424" "2" "50" "6" "129835746" "129835746" "subst" "0.000691467" "00006" "LAMA2_000272" "g.129835746T>C" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "" "IVS63+6T>C" "not in 180 control chromosomes" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "VUS" "" "0000165425" "1" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "00006" "LAMA2_000025" "g.129618874C>A" "" "{PMID:Di Blasi 2005:16216942}, {PMID:Vigliano 2009:18406646}, {OMIM156225:0013}" "" "" "" "Germline" "" "" "0" "" "" "g.129297729C>A" "" "pathogenic (recessive)" "" "0000165426" "2" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "00006" "LAMA2_000025" "g.129618874C>A" "" "{PMID:Di Blasi 2005:16216942}, {PMID:Vigliano 2009:18406646}, {OMIM156225:0013}" "" "" "" "Germline" "" "" "0" "" "" "g.129297729C>A" "" "pathogenic (recessive)" "" "0000165427" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00400" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165428" "2" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00400" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165429" "21" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "" "{PMID:Guicheney 1998:09541105}" "" "2848A>G" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165430" "21" "10" "6" "129722453" "129722453" "subst" "0.0104121" "00006" "LAMA2_000092" "g.129722453C>A" "" "{PMID:Guicheney 1998:09541105}" "" "5579C>A" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "benign" "" "0000165431" "21" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "00006" "LAMA2_000025" "g.129618874C>A" "" "{PMID:Guicheney 1998:09541105}, {OMIM156225:0013}" "" "2950C>A ex20" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129297729C>A" "" "pathogenic (recessive)" "" "0000165432" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165433" "2" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165434" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00400" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165435" "2" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00400" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165436" "11" "90" "6" "129823824" "129823824" "del" "0" "00006" "LAMA2_000070" "g.129823824del" "" "{PMID:He 2001:11591858}, {OMIM156225:0006}" "" "8314delA" "" "Germline" "" "" "0" "" "" "g.129502679del" "" "pathogenic (recessive)" "" "0000165437" "21" "90" "6" "129823824" "129823824" "del" "0" "00006" "LAMA2_000070" "g.129823824del" "" "{PMID:He 2001:11591858}, {OMIM156225:0006}" "" "8314delA" "" "Germline" "" "" "0" "" "" "g.129502679del" "" "pathogenic (recessive)" "" "0000165438" "11" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "" "{PMID:Guicheney 1998:09541105}" "" "1905G>A" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165439" "11" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "" "{PMID:Guicheney 1998:09541105}" "" "2848A>G" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165440" "11" "10" "6" "129722453" "129722453" "subst" "0.0104121" "00006" "LAMA2_000092" "g.129722453C>A" "" "{PMID:Guicheney 1998:09541105}" "" "5579C>A" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "benign" "" "0000165441" "11" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "00006" "LAMA2_000025" "g.129618874C>A" "" "{PMID:Guicheney 1998:09541105}, {OMIM156225:0013}" "" "2950C>A ex20" "" "Germline" "" "" "0" "" "" "g.129297729C>A" "" "pathogenic (recessive)" "" "0000165442" "2" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "" "{PMID:Guicheney 1998:09541105}" "" "1905G>A" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165443" "1" "90" "6" "129419419" "129419419" "subst" "4.06114E-6" "00006" "LAMA2_000008" "g.129419419G>A" "" "{PMID:Mendell 1998:10694916}" "" "547G>A" "" "Germline" "" "" "0" "" "" "g.129098274G>A" "" "pathogenic (recessive)" "" "0000165444" "2" "90" "6" "129802493" "129802493" "del" "0" "00006" "LAMA2_000062" "g.129802493del" "" "{PMID:Mendell 1998:10694916}" "" "7707delC" "" "Germline" "" "" "0" "" "" "g.129481348del" "" "pathogenic (recessive)" "" "0000165445" "10" "90" "6" "129837376" "129837376" "subst" "4.06461E-6" "00006" "LAMA2_000078" "g.129837376C>T" "" "{PMID:He 2001:11591858}, {OMIM156225:0005}" "" "C9302T" "not in 300 control chromosomes" "Germline" "" "" "0" "" "" "g.129516231C>T" "" "pathogenic (recessive)" "" "0000165446" "21" "90" "6" "129802526" "129802526" "subst" "0" "00006" "LAMA2_000063" "g.129802526T>C" "" "{PMID:He 2001:11591858}, {OMIM156225:0004}" "" "T7740C" "not in 300 control chromosomes" "Germline" "" "" "0" "" "" "g.129481381T>C" "" "pathogenic (recessive)" "" "0000165447" "11" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Naom 1998:09829280}" "" "5525C>T" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165448" "21" "90" "6" "129663487" "129663487" "subst" "0" "00006" "LAMA2_000038" "g.129663487G>C" "" "{PMID:Naom 1998:09829280}" "" "43511-1G>C" "" "Germline" "" "" "0" "" "" "g.129342342G>C" "" "pathogenic (recessive)" "" "0000165449" "3" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00006" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Di Blasi 2000:10852549}, {PMID:Carboni 2011:22006699}" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165450" "10" "90" "6" "129204503" "129371062" "" "0" "00006" "LAMA2_000006" "g.(129204503_129371062)?" "" "{PMID:Hayashi 1997:09113020}" "" "162ins75" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165451" "21" "90" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Hayashi 1997:09113020}" "" "1939-1943del" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "" "0000165452" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:He 2001:11591858}, {OMIM156225:0007}" "" "2098delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165453" "2" "90" "6" "129777640" "129777640" "subst" "0" "00006" "LAMA2_000053" "g.129777640G>A" "" "{PMID:He 2001:11591858}" "" "6916+1G>A" "" "Germline" "" "" "0" "" "" "g.129456495G>A" "" "pathogenic (recessive)" "" "0000165454" "1" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00006" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Pegoraro 2000:11071490}, {OMIM156225:0011}" "" "4694C>T" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165455" "2" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Pegoraro 2000:11071490}, {OMIM156225:0012}" "NlaIII+" "7196C>T" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "" "0000165456" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Guicheney 1998:09541105}" "" "2098delAG ex13" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165457" "11" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "" "{PMID:Guicheney 1998:09541105}" "" "2848A>G" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165458" "21" "90" "6" "129511372" "129511373" "del" "0" "00006" "LAMA2_000013" "g.129511372_129511373del" "" "{PMID:Guicheney 1998:09541105}" "SpeI+" "1539delGT ex10" "" "Germline" "" "" "0" "" "" "g.129190227_129190228del" "" "pathogenic (recessive)" "" "0000165459" "21" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "" "{PMID:Guicheney 1998:09541105}" "SpeI+" "1905G>A" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165460" "21" "10" "6" "129722425" "129722425" "subst" "0.49225" "00006" "LAMA2_000048" "g.129722425G>A" "" "{PMID:Guicheney 1998:09541105}" "SpeI-" "5551A>G" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000165461" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Guicheney 1998:09541105}" "" "2098delAG ex13" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165462" "11" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "" "{PMID:Guicheney 1998:09541105}" "" "2848A>G" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165463" "20" "90" "6" "129777640" "129777640" "subst" "0" "00006" "LAMA2_000053" "g.129777640G>A" "" "{PMID:Guicheney 1998:09541105}" "" "6916+1G>A in47" "" "Germline" "" "" "0" "" "" "g.129456495G>A" "" "pathogenic (recessive)" "" "0000165464" "1" "90" "6" "129636688" "129636710" "del" "0" "00006" "LAMA2_000031" "g.129636688_129636710del" "" "{PMID:Pegoraro 1998:09674786}" "" "3672-3694del" "" "Germline" "" "" "0" "" "" "g.129315543_129315565del" "" "pathogenic (recessive)" "" "0000165465" "2" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}" "" "2096-2097del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165466" "1" "90" "6" "129785516" "129785516" "subst" "2.44345E-5" "00006" "LAMA2_000059" "g.129785516C>A" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "C7123A" "" "Germline" "" "" "0" "" "" "g.129464371C>A" "" "pathogenic (recessive)" "" "0000165467" "2" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}, {PMID:Hayashi 2001:11369186}" "" "2096-2097del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165468" "0" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "" "{PMID:Pegoraro 1996:08957020}" "" "T7809C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165469" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "" "{PMID:Pegoraro 1996:08957020}" "Sau3A-" "C7879G" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165470" "1" "90" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Pegoraro 1996:08957020}, {PMID0Pegoraro 1998:9674786:}" "" "1890_1894del, 1939-1943del" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "" "0000165471" "11" "10" "6" "129621942" "129621942" "subst" "8.12236E-6" "00006" "LAMA2_000101" "g.129621942T>A" "" "{PMID:Pegoraro 1996:08957020}" "" "A3099T" "" "Germline" "" "" "0" "" "" "g.129300797T>A" "" "benign" "" "0000165472" "11" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "" "{PMID:Pegoraro 1996:08957020}" "" "T7809C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165473" "11" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "" "{PMID:Pegoraro 1996:08957020}" "Sau3A-" "C7879G" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165474" "11" "10" "6" "129807714" "129807714" "subst" "0.303132" "00006" "LAMA2_000089" "g.129807714G>A" "" "{PMID:Pegoraro 1996:08957020}" "HinfI-" "G7894A" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000165475" "11" "90" "6" "129634046" "129634046" "del" "0" "00006" "LAMA2_000109" "g.129634046del" "" "{PMID:Pegoraro 1996:08957020}, {PMID:Pegoraro 1998:9674786}" "" "del3264" "" "Germline" "" "" "0" "" "" "g.129312901del" "" "pathogenic (recessive)" "" "0000165476" "21" "90" "6" "129634005" "129807768" "" "0" "00006" "LAMA2_000108" "g.(129622018_129634005)_(129807768_129813045)del" "" "{PMID:Pegoraro 1996:08957020}, {PMID:Pegoraro 1998:09674786}" "" "del>3264-7894" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165477" "1" "90" "6" "129687385" "129687385" "dup" "0" "00400" "LAMA2_000134" "g.129687385dup" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "" "0000165478" "2" "90" "6" "129799876" "129799879" "dup" "0" "00400" "LAMA2_000005" "g.129799876_129799879dup" "" "{PMID:Oliveira 2008:18700894}" "" "7490_7493dupAAGA" "" "Germline" "" "" "0" "" "" "g.129478731_129478734dup" "" "pathogenic (recessive)" "" "0000165479" "1" "90" "6" "129637003" "129637003" "subst" "0" "00400" "LAMA2_000135" "g.129637003G>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "not in 300 control chromosomes" "Germline" "" "" "0" "" "" "g.129315858G>T" "" "pathogenic (recessive)" "" "0000165480" "2" "90" "6" "129571328" "129571335" "dup" "0" "00400" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2008:18700894}" "" "1854_1861dupACGTGTTC" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000165481" "1" "90" "6" "129468109" "129468109" "del" "0" "00006" "LAMA2_000138" "g.129468109del" "" "{PMID:Di Blasi 2005:16216942}, {OMIM156225:0014}" "" "" "" "Germline" "" "" "0" "" "" "g.129146964del" "" "pathogenic (recessive)" "" "0000165482" "2" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "00006" "LAMA2_000025" "g.129618874C>A" "" "{PMID:Di Blasi 2005:16216942}, {OMIM156225:0013}" "" "" "" "Germline" "" "" "0" "" "" "g.129297729C>A" "" "pathogenic (recessive)" "" "0000165483" "1" "90" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Di Blasi 2005:16216942}" "" "4695_4698dupTGCA" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "pathogenic (recessive)" "" "0000165484" "2" "90" "6" "129636695" "129636695" "del" "0" "00006" "LAMA2_000142" "g.129636695del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "" "0000165485" "1" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165486" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00400" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165487" "1" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00400" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "" "0000165488" "2" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165489" "1" "90" "6" "129663494" "129663494" "subst" "0" "00400" "LAMA2_000147" "g.129663494C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129342349C>T" "" "pathogenic (recessive)" "" "0000165490" "2" "90" "6" "129687385" "129687385" "dup" "0" "00400" "LAMA2_000134" "g.129687385dup" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "" "0000165491" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165492" "2" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165493" "11" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165495" "21" "90" "6" "129571328" "129571335" "dup" "0" "00400" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2008:18700894}" "" "1854_1861dupACGTGTTC" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000165496" "21" "10" "6" "129622055" "129622055" "subst" "0.396641" "00400" "LAMA2_000164" "g.129622055A>G" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "rs902373" "0" "" "" "g.129300910A>G" "" "benign" "" "0000165497" "21" "10" "6" "129722389" "129722389" "subst" "0.493666" "00400" "LAMA2_000045" "g.129722389A>G" "" "{PMID:Oliveira 2008:18700894}" "" "5466G>A" "" "Germline" "" "" "0" "" "" "g.129401244A>G" "" "benign" "" "0000165498" "21" "10" "6" "129722425" "129722425" "subst" "0.49225" "00400" "LAMA2_000048" "g.129722425G>A" "" "{PMID:Oliveira 2008:18700894}" "" "5502A>G" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000165499" "21" "10" "6" "129724942" "129724945" "delins" "0" "00400" "LAMA2_000171" "g.129724942_129724945delinsACTG" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129403797_129403800delinsACTG" "" "benign" "" "0000165500" "21" "10" "6" "129775470" "129775470" "subst" "0.156879" "00400" "LAMA2_000174" "g.129775470T>C" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "rs2297742" "0" "" "" "g.129454325T>C" "" "benign" "" "0000165501" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165502" "2" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165503" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165504" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00400" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165505" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00400" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165506" "2" "90" "6" "129828706" "129828722" "del" "0" "00400" "LAMA2_000151" "g.129828706_129828722del" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129507561_129507577del" "" "pathogenic (recessive)" "" "0000165507" "0" "10" "6" "129475698" "129475698" "subst" "0" "00006" "LAMA2_000113" "g.129475698T>C" "0.10" "{PMID:Tezak 2003:12552556}" "" "1125T>C ex7" "" "Germline" "" "" "0" "" "" "g.129154553T>C" "" "benign" "" "0000165508" "1" "10" "6" "129475804" "129475804" "subst" "0" "00006" "LAMA2_000095" "g.129475804T>A" "0.63" "{PMID:Pegoraro 1998:09674786}, {PMID:Tezak 2003:12552556}" "" "A1231T" "" "Germline" "" "" "0" "" "" "g.129154659T>A" "" "benign" "" "0000165509" "1" "50" "6" "129837610" "129837610" "subst" "0" "00006" "LAMA2_000076" "g.129837610T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129516465T>C" "" "VUS" "" "0000165510" "0" "10" "6" "129498963" "129498963" "subst" "0" "00006" "LAMA2_000114" "g.129498963G>A" "0.03" "{PMID:Tezak 2003:12552556}" "" "1468G>A ex9" "" "Germline" "" "" "0" "" "" "g.129177818G>A" "" "benign" "" "0000165511" "1" "10" "6" "129511373" "129511373" "subst" "0.0319401" "00006" "LAMA2_000083" "g.129511373T>C" "3/200" "{PMID:Helbling-Leclerc:07550355}" "" "" "" "Germline" "" "" "0" "" "" "g.129190228T>C" "" "benign" "" "0000165512" "1" "10" "6" "129511373" "129511373" "subst" "0.0319401" "00006" "LAMA2_000083" "g.129511373T>C" "4/200" "{PMID:Guicheney 1998:09541105}" "PstI+" "1540T>A" "" "Germline" "" "" "0" "" "" "g.129190228T>C" "" "benign" "" "0000165513" "0" "10" "6" "129371106" "129371106" "subst" "0.0986835" "00400" "LAMA2_000153" "g.129371106C>T" "" "" "" "" "" "Germline" "" "rs1140366" "0" "" "" "g.129049961C>T" "" "benign" "" "0000165514" "0" "10" "6" "129513850" "129513850" "subst" "0.00301853" "00006" "LAMA2_000087" "g.129513850T>A" "1/234" "Panicker 1999, Human Mutation MPR43" "" "1683T>A ex11" "" "Germline" "" "" "0" "" "" "g.129192705T>A" "" "benign" "" "0000165515" "1" "10" "6" "129513850" "129513850" "subst" "0.00301853" "00006" "LAMA2_000087" "g.129513850T>A" "" "{PMID:Pegoraro 1998:09674786}" "" "T1683A" "" "Germline" "" "" "0" "" "" "g.129192705T>A" "" "benign" "" "0000165516" "0" "10" "6" "129571272" "129571272" "subst" "0.0138918" "00006" "LAMA2_000090" "g.129571272G>A" "0.06" "{PMID:Tezak 2003:12552556}" "MnlI-" "1847G>A ex12" "" "Germline" "" "" "0" "" "" "g.129250127G>A" "" "benign" "" "0000165517" "1" "10" "6" "129571272" "129571272" "subst" "0.0138918" "00006" "LAMA2_000090" "g.129571272G>A" "4/200" "{PMID:Guicheney 1998:09541105}" "MnlI-" "1847G>A" "" "Germline" "" "" "0" "" "" "g.129250127G>A" "" "benign" "" "0000165518" "1" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "0.06" "{PMID:Tezak 2003:12552556}" "" "G1905A ex12" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165519" "0" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "33/234" "Panicker 1999, Human Mutation MPR43" "Hsp92II+, MaeII-" "1905G>A ex12" "incl. 3 homozygous cases" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165520" "1" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "36/200" "{PMID:Guicheney 1998:09541105}" "MaeII-" "1905G>A" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000165521" "0" "10" "6" "129573398" "129573398" "subst" "0" "00006" "LAMA2_000115" "g.129573398T>C" "0.02" "{PMID:Tezak 2003:12552556}" "MnlI-" "2103T>C ex13" "" "Germline" "" "" "0" "" "" "g.129252253T>C" "" "benign" "" "0000165522" "0" "10" "6" "129582009" "129582009" "subst" "0" "00400" "LAMA2_000159" "g.129582009C>T" "5/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129260864C>T" "" "benign" "" "0000165523" "1" "10" "6" "129588277" "129588277" "subst" "0" "00006" "LAMA2_000096" "g.129588277T>A" "" "{PMID:Pegoraro 1998:09674786}" "" "T2284A" "" "Germline" "" "" "0" "" "" "g.129267132T>A" "" "benign" "" "0000165524" "1" "10" "6" "129588337" "129588337" "subst" "0" "00006" "LAMA2_000097" "g.129588337C>A" "" "{PMID:Pegoraro 1998:09674786}" "" "C2344A" "" "Germline" "" "" "0" "" "" "g.129267192C>A" "" "benign" "" "0000165525" "1" "10" "6" "129609004" "129609004" "subst" "0" "00006" "LAMA2_000098" "g.129609004C>G" "" "{PMID:Pegoraro 1998:09674786}" "" "C2599G" "" "Germline" "" "" "0" "" "" "g.129287859C>G" "" "benign" "" "0000165526" "0" "10" "6" "129609030" "129609030" "subst" "0" "00006" "LAMA2_000116" "g.129609030G>T" "0.03" "{PMID:Tezak 2003:12552556}" "" "2625G>T ex18" "" "Germline" "" "" "0" "" "" "g.129287885G>T" "" "benign" "" "0000165527" "1" "50" "6" "129609038" "129609038" "subst" "0" "00006" "LAMA2_000022" "g.129609038T>C" "" "Subm. FMuntoni" "" "" "" "Germline" "" "" "0" "" "" "g.129287893T>C" "" "VUS" "" "0000165528" "1" "90" "6" "129609038" "129609038" "subst" "0" "00006" "LAMA2_000022" "g.129609038T>C" "" "{PMID:Tezak 2003:12552556}, {OMIM156225:0009}" "" "2633T>C" "not in 100 normal chromosomes" "Germline" "" "" "0" "" "" "g.129287893T>C" "" "pathogenic (recessive)" "" "0000165529" "2" "50" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Tezak 2003:12552556}, {OMIM156225:0009}" "" "" "allele not expressed" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000165530" "1" "10" "6" "129609085" "129609085" "subst" "0" "00006" "LAMA2_000099" "g.129609085C>G" "" "{PMID:Pegoraro 1998:09674786}" "" "C2680G" "" "Germline" "" "" "0" "" "" "g.129287940C>G" "" "benign" "" "0000165531" "0" "10" "6" "129612765" "129612765" "subst" "0.0113137" "00006" "LAMA2_000088" "g.129612765G>T" "2/214" "Panicker 1999, Human Mutation MPR43" "" "2805G>T ex19" "" "Germline" "" "" "0" "" "" "g.129291620G>T" "" "benign" "" "0000165532" "0" "10" "6" "129612765" "129612765" "subst" "0.0113137" "00006" "LAMA2_000088" "g.129612765G>T" "0.02" "{PMID:Tezak 2003:12552556}" "" "2805G>T ex19" "" "Germline" "" "" "0" "" "" "g.129291620G>T" "" "benign" "" "0000165533" "1" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "0.25" "{PMID:Tezak 2003:12552556}" "" "A2848G ex19" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165534" "1" "10" "6" "129612808" "129612808" "subst" "0.269063" "00006" "LAMA2_000024" "g.129612808A>G" "48/200" "{PMID:Guicheney 1998:09541105}" "-" "2848A>G" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165536" "3" "90" "6" "129371234" "129371234" "subst" "1.21842E-5" "00006" "LAMA2_000000" "g.129371234G>A" "" "{PMID:Hu 1994:07874173}" "" "" "" "In vitro (cloned)" "" "" "0" "" "" "g.129050089G>A" "" "NA" "" "0000165537" "0" "10" "6" "129486913" "129486913" "subst" "0" "00400" "LAMA2_000158" "g.129486913T>C" "0.11" "" "" "" "" "Germline" "" "rs3778137" "0" "" "" "g.129165768T>C" "" "benign" "" "0000165538" "0" "10" "6" "129380798" "129380798" "subst" "0" "00400" "LAMA2_000154" "g.129380798C>T" "0.11" "" "" "" "" "Germline" "" "rs10499148" "0" "" "" "g.129059653C>T" "" "benign" "" "0000165539" "0" "10" "6" "129380844" "129380844" "delins" "0" "00400" "LAMA2_000155" "g.129380844delinsGG" "5/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129059699delinsGG" "" "benign" "" "0000165540" "0" "10" "6" "129619150" "129619150" "subst" "0" "00400" "LAMA2_000160" "g.129619150G>A" "0.28" "" "" "" "" "Germline" "" "rs1027200" "0" "" "" "g.129298005G>A" "" "benign" "" "0000165541" "0" "10" "6" "129621725" "129621725" "subst" "0" "00400" "LAMA2_000162" "g.129621725A>G" "3/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "rs3798666" "0" "" "" "g.129300580A>G" "" "benign" "" "0000165542" "0" "10" "6" "129621586" "129621586" "subst" "0" "00400" "LAMA2_000161" "g.129621586A>G" "30/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "rs2326798" "0" "" "" "g.129300441A>G" "" "benign" "" "0000165543" "1" "10" "6" "129621882" "129621882" "subst" "0" "00006" "LAMA2_000100" "g.129621882T>G" "" "{PMID:Pegoraro 1998:09674786}" "" "T3088G" "" "Germline" "" "" "0" "" "" "g.129300737T>G" "" "benign" "" "0000165544" "1" "10" "6" "129621942" "129621942" "subst" "8.12236E-6" "00006" "LAMA2_000101" "g.129621942T>A" "0.32" "{PMID:Tezak 2003:12552556}" "" "A3148T ex21" "" "Germline" "" "" "0" "" "" "g.129300797T>A" "" "benign" "" "0000165545" "0" "10" "6" "129621978" "129621978" "subst" "0" "00400" "LAMA2_000163" "g.129621978A>G" "5/50" "{PMID:Oliveira 2008:18700894}" "" "A1045A" "" "Germline" "" "" "0" "" "" "g.129300833A>G" "" "benign" "" "0000165546" "0" "10" "6" "129622055" "129622055" "subst" "0.396641" "00400" "LAMA2_000164" "g.129622055A>G" "0.27" "" "" "" "" "Germline" "" "rs902373" "0" "" "" "g.129300910A>G" "" "benign" "" "0000165547" "0" "10" "6" "129634255" "129634255" "subst" "0.220596" "00400" "LAMA2_000165" "g.129634255G>A" "0.11" "" "" "" "" "Germline" "" "rs3798663" "0" "" "" "g.129313110G>A" "" "benign" "" "0000165548" "0" "10" "6" "129636432" "129636432" "subst" "0" "00400" "LAMA2_000166" "g.129636432C>G" "3/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129315287C>G" "" "benign" "" "0000165549" "0" "10" "6" "129636784" "129636784" "subst" "0" "00006" "LAMA2_000119" "g.129636784A>T" "0.06" "{PMID:Tezak 2003:12552556}" "" "3768A>T ex24" "" "Germline" "" "" "0" "" "" "g.129315639A>T" "" "benign" "" "0000165550" "0" "10" "6" "129381026" "129381026" "subst" "0.960856" "00006" "LAMA2_000110" "g.129381026C>A" "0.02" "{PMID:Tezak 2003:12552556}" "" "430A>C (error)" "" "Germline" "" "" "0" "" "" "g.129059881C>A" "" "benign" "" "0000165551" "0" "10" "6" "129637188" "129637188" "subst" "0" "00006" "LAMA2_000120" "g.129637188A>G" "0.06" "{PMID:Tezak 2003:12552556}" "" "3979A>G ex26" "" "Germline" "" "" "0" "" "" "g.129316043A>G" "" "benign" "" "0000165552" "0" "10" "6" "129419332" "129419332" "subst" "0.0029569" "00006" "LAMA2_000111" "g.129419332G>A" "0.02" "{PMID:Tezak 2003:12552556}" "" "460G>A" "" "Germline" "" "" "0" "" "" "g.129098187G>A" "" "benign" "" "0000165553" "0" "10" "6" "129649350" "129649350" "subst" "0" "00400" "LAMA2_000167" "g.129649350C>T" "5/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129328205C>T" "" "benign" "" "0000165554" "0" "10" "6" "129663271" "129663271" "subst" "0" "00400" "LAMA2_000168" "g.129663271T>C" "0.33" "" "" "" "" "Germline" "" "rs1387918" "0" "" "" "g.129342126T>C" "" "benign" "" "0000165555" "0" "10" "6" "129663583" "129663583" "subst" "0" "00006" "LAMA2_000121" "g.129663583T>C" "0.01" "{PMID:Tezak 2003:12552556}" "" "4456T>C ex29" "" "Germline" "" "" "0" "" "" "g.129342438T>C" "" "benign" "" "0000165556" "0" "10" "6" "129670452" "129670452" "subst" "0" "00006" "LAMA2_000122" "g.129670452C>T" "0.06" "{PMID:Tezak 2003:12552556}" "" "4495C>T ex30" "" "Germline" "" "" "0" "" "" "g.129349307C>T" "" "benign" "" "0000165557" "0" "10" "6" "129674062" "129674062" "subst" "0" "00400" "LAMA2_000169" "g.129674062A>G" "5/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129352917A>G" "" "benign" "" "0000165558" "1" "93" "6" "129687396" "129687396" "subst" "0.0195317" "00006" "LAMA2_000123" "g.129687396G>A" "" "{PMID:Tezak 2003:12552556}" "" "4799G>A ex32" "not in 100 normal chromosomes; unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "pathogenic (recessive)" "" "0000165559" "0" "10" "6" "129690982" "129690982" "subst" "0" "00400" "LAMA2_000170" "g.129690982A>G" "3/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129369837A>G" "" "benign" "" "0000165560" "1" "10" "6" "129691132" "129691132" "subst" "0.0884706" "00006" "LAMA2_000091" "g.129691132C>G" "0.03" "{PMID:Tezak 2003:12552556}" "EcoRII-" "C5005G ex33" "" "Germline" "" "" "0" "" "" "g.129369987C>G" "" "benign" "" "0000165561" "1" "10" "6" "129691132" "129691132" "subst" "0.0884706" "00006" "LAMA2_000091" "g.129691132C>G" "6/200" "{PMID:Guicheney 1998:09541105}" "EcoRII-" "5005C>G" "" "Germline" "" "" "0" "" "" "g.129369987C>G" "" "benign" "" "0000165562" "0" "10" "6" "129714337" "129714337" "subst" "1.62501E-5" "00006" "LAMA2_000124" "g.129714337A>T" "0.01" "{PMID:Tezak 2003:12552556}" "" "5431A>T ex36" "" "Germline" "" "" "0" "" "" "g.129393192A>T" "" "benign" "" "0000165563" "1" "10" "6" "129722425" "129722425" "subst" "0.49225" "00006" "LAMA2_000048" "g.129722425G>A" "0.53" "{PMID:Pegoraro 1998:09674786}, {PMID:Tezak 2003:12552556}" "MnlI+" "A5551G" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000165564" "1" "10" "6" "129722425" "129722425" "subst" "0.49225" "00006" "LAMA2_000048" "g.129722425G>A" "124/200" "{PMID:Guicheney 1998:09541105}" "MnlI-" "5551A>G" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000165565" "1" "10" "6" "129722453" "129722453" "subst" "0.0104121" "00006" "LAMA2_000092" "g.129722453C>A" "4/200" "{PMID:Guicheney 1998:09541105}" "-" "5579C>A" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "benign" "" "0000165566" "0" "10" "6" "129723620" "129723620" "subst" "0" "00006" "LAMA2_000125" "g.129723620C>G" "0.16" "{PMID:Tezak 2003:12552556}" "" "5763C>G ex38" "" "Germline" "" "" "0" "" "" "g.129402475C>G" "" "benign" "" "0000165567" "0" "10" "6" "129724942" "129724945" "delins" "0" "00400" "LAMA2_000171" "g.129724942_129724945delinsACTG" "22/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129403797_129403800delinsACTG" "" "benign" "" "0000165568" "0" "10" "6" "129725279" "129725279" "subst" "0" "00400" "LAMA2_000172" "g.129725279A>C" "5/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129404134A>C" "" "benign" "" "0000165569" "1" "10" "6" "129762028" "129762028" "subst" "4.07299E-6" "00006" "LAMA2_000102" "g.129762028A>T" "" "{PMID:Pegoraro 1998:09674786}" "" "A6202T" "" "Germline" "" "" "0" "" "" "g.129440883A>T" "" "benign" "" "0000165570" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "0.01" "{PMID:Tezak 2003:12552556}" "BsmI-" "G6286A ex42" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000165571" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "32/200" "{PMID:Guicheney 1998:09541105}" "BsmI-" "6286G>A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000165572" "0" "10" "6" "129762220" "129762220" "subst" "0" "00400" "LAMA2_000173" "g.129762220C>T" "3/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129441075C>T" "" "benign" "" "0000165573" "0" "10" "6" "129774153" "129774153" "subst" "0.00018354" "00006" "LAMA2_000126" "g.129774153A>T" "0.03" "{PMID:Tezak 2003:12552556}" "" "6499A>T ex45" "" "Germline" "" "" "0" "" "" "g.129453008A>T" "" "benign" "" "0000165574" "1" "10" "6" "129774162" "129774162" "subst" "0" "00006" "LAMA2_000103" "g.129774162C>T" "" "{PMID:Pegoraro 1998:09674786}" "" "C6508T" "" "Germline" "" "" "0" "" "" "g.129453017C>T" "" "benign" "" "0000165575" "0" "10" "6" "129775470" "129775470" "subst" "0.156879" "00400" "LAMA2_000174" "g.129775470T>C" "0.17" "" "" "" "" "Germline" "" "rs2297742" "0" "" "" "g.129454325T>C" "" "benign" "" "0000165576" "0" "10" "6" "129777382" "129777382" "subst" "0" "00400" "LAMA2_000175" "g.129777382C>T" "0.39" "" "" "" "" "Germline" "" "rs1811970" "0" "" "" "g.129456237C>T" "" "benign" "" "0000165577" "0" "10" "6" "129781192" "129781192" "subst" "0" "00400" "LAMA2_000176" "g.129781192C>A" "0.11" "" "" "" "" "Germline" "" "rs10499159" "0" "" "" "g.129460047C>A" "" "benign" "" "0000165578" "0" "10" "6" "129785391" "129785391" "subst" "0.609286" "00400" "LAMA2_000177" "g.129785391T>C" "0.61" "" "" "" "" "Germline" "" "rs1414736" "0" "" "" "g.129464246T>C" "" "benign" "" "0000165579" "1" "10" "6" "129794453" "129794453" "subst" "5.70953E-5" "00006" "LAMA2_000104" "g.129794453T>C" "" "{PMID:Pegoraro 1998:09674786}" "" "T7444C" "" "Germline" "" "" "0" "" "" "g.129473308T>C" "" "benign" "" "0000165580" "1" "10" "6" "129802449" "129802449" "subst" "8.13273E-6" "00006" "LAMA2_000105" "g.129802449G>A" "" "{PMID:Pegoraro 1998:09674786}" "" "G7663A" "" "Germline" "" "" "0" "" "" "g.129481304G>A" "" "benign" "" "0000165581" "1" "10" "6" "129802455" "129802455" "subst" "0" "00006" "LAMA2_000093" "g.129802455C>G" "34/200" "{PMID:Guicheney 1998:09541105}" "-" "7669C>G" "" "Germline" "" "" "0" "" "" "g.129481310C>G" "" "benign" "" "0000165582" "0" "10" "6" "129802496" "129802496" "subst" "0" "00006" "LAMA2_000127" "g.129802496T>C" "0.03" "{PMID:Tezak 2003:12552556}" "" "7710C>T (error) ex54" "" "Germline" "" "" "0" "" "" "g.129481351T>C" "" "benign" "" "0000165583" "0" "10" "6" "129807483" "129807483" "subst" "0" "00400" "LAMA2_000178" "g.129807483C>G" "0.56" "" "" "" "" "Germline" "" "rs6569604" "0" "" "" "g.129486338C>G" "" "benign" "" "0000165584" "0" "10" "6" "129807625" "129807625" "subst" "0" "00006" "LAMA2_000107" "g.129807625T>C" "" "Panicker 1999, Human Mutation MPR43" "" "7805T>C ex55" "" "Germline" "" "" "0" "" "" "g.129486480T>C" "" "benign" "" "0000165585" "1" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "0.16" "{PMID:Tezak 2003:12552556}" "" "T7809C ex55" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165586" "1" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "" "{PMID:Guicheney 1998:09541105}" "-" "7809T>C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165587" "1" "90" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Di Blasi 2005:16216942}" "" "4695_4698dupTGCA" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "pathogenic (recessive)" "" "0000165588" "2" "90" "6" "129636695" "129636695" "del" "0" "00006" "LAMA2_000142" "g.129636695del" "" "{PMID:Di Blasi 2005:16216942}" "" "" "" "Germline" "" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "" "0000165589" "1" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "0.24" "{PMID:Tezak 2003:12552556}" "Sau3A-" "C7879G ex55" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165590" "1" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "7/222" "{PMID:Wibawa 2002:12100448}" "Sau3A-" "T7809C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165591" "1" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "7/222" "{PMID:Wibawa 2002:12100448}" "" "C7879G" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165592" "1" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "" "{PMID:Guicheney 1998:09541105}" "Sau3A+" "7879C>G" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165593" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "" "Panicker 1999, Human Mutation MPR43" "Sau3A-" "7879C>G ex55" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165594" "0" "10" "6" "129807709" "129807709" "subst" "0" "00006" "LAMA2_000106" "g.129807709G>A" "" "Panicker 1999, Human Mutation MPR43" "" "7889G>A ex55" "" "Germline" "" "" "0" "" "" "g.129486564G>A" "" "benign" "" "0000165595" "1" "10" "6" "129807714" "129807714" "subst" "0.303132" "00006" "LAMA2_000089" "g.129807714G>A" "0.16" "{PMID:Tezak 2003:12552556}" "HinfI-" "G7894A ex55" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000165596" "1" "10" "6" "129807714" "129807714" "subst" "0.303132" "00006" "LAMA2_000089" "g.129807714G>A" "" "{PMID:Guicheney 1998:09541105}" "HinfI-" "7894G>A" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000165597" "0" "10" "6" "129807869" "129807869" "subst" "0" "00400" "LAMA2_000179" "g.129807869C>A" "0.56" "" "" "" "" "Germline" "" "rs6938825" "0" "" "" "g.129486724C>A" "" "benign" "" "0000165598" "0" "10" "6" "129813053" "129813053" "subst" "0.0870047" "00006" "LAMA2_000069" "g.129813053A>G" "0.14" "{PMID:Tezak 2003:12552556}" "" "7955A>G ex56" "" "Germline" "" "" "0" "" "" "g.129491908A>G" "" "benign" "" "0000165599" "1" "10" "6" "129813053" "129813053" "subst" "0.0870047" "00006" "LAMA2_000069" "g.129813053A>G" "12/200" "{PMID:Guicheney 1998:09541105}" "-" "7955A>G" "" "Germline" "" "" "0" "" "" "g.129491908A>G" "" "benign" "" "0000165600" "0" "10" "6" "129813076" "129813076" "subst" "0" "00006" "LAMA2_000128" "g.129813076A>G" "0.06" "{PMID:Tezak 2003:12552556}" "" "7978A>G ex56" "" "Germline" "" "" "0" "" "" "g.129491931A>G" "" "benign" "" "0000165601" "0" "10" "6" "129813436" "129813436" "dup" "0" "00400" "LAMA2_000180" "g.129813436dup" "5/50" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129492291dup" "" "benign" "" "0000165602" "0" "10" "6" "129813508" "129813508" "subst" "0.00428874" "00006" "LAMA2_000129" "g.129813508T>A" "0.06" "{PMID:Tezak 2003:12552556}" "" "8173T>A ex57" "" "Germline" "" "" "0" "" "" "g.129492363T>A" "" "benign" "" "0000165603" "0" "10" "6" "129465422" "129465422" "subst" "0" "00400" "LAMA2_000156" "g.129465422G>A" "0.06" "" "" "" "" "Germline" "" "rs17056847" "0" "" "" "g.129144277G>A" "" "benign" "" "0000165604" "0" "10" "6" "129823645" "129823645" "subst" "0" "00400" "LAMA2_000074" "g.129823645A>G" "0.72" "" "" "" "" "Germline" "" "rs7754167" "0" "" "" "g.129502500A>G" "" "benign" "" "0000165605" "0" "10" "6" "129468130" "129468130" "subst" "0" "00006" "LAMA2_000112" "g.129468130A>T" "0.06" "{PMID:Tezak 2003:12552556}" "" "895A>T ex5" "" "Germline" "" "" "0" "" "" "g.129146985A>T" "" "benign" "" "0000165606" "0" "10" "6" "129826383" "129826383" "subst" "0.000711209" "00006" "LAMA2_000130" "g.129826383T>C" "0.02" "{PMID:Tezak 2003:12552556}" "" "8635T>C ex60" "" "Germline" "" "" "0" "" "" "g.129505238T>C" "" "benign" "" "0000165607" "0" "10" "6" "129833575" "129833575" "subst" "0" "00006" "LAMA2_000131" "g.129833575A>T" "0.14" "{PMID:Tezak 2003:12552556}" "" "8974A>T ex62" "" "Germline" "" "" "0" "" "" "g.129512430A>T" "" "benign" "" "0000165608" "0" "10" "6" "129468288" "129468288" "subst" "0" "00400" "LAMA2_000157" "g.129468288A>T" "0.06" "" "" "" "" "Germline" "" "rs2279165" "0" "" "" "g.129147143A>T" "" "benign" "" "0000165609" "0" "10" "6" "129835814" "129835814" "subst" "0" "00400" "LAMA2_000075" "g.129835814G>A" "0.67" "" "" "" "" "Germline" "" "rs2297740" "0" "" "" "g.129514669G>A" "" "benign" "" "0000165610" "1" "10" "6" "129837554" "129837557" "dup" "0" "00006" "LAMA2_000071" "g.129837554_129837557dup" "5/43" "" "" "" "" "Germline" "" "" "0" "" "" "g.129516409_129516412dup" "" "benign" "" "0000165611" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}" "" "2096-2097del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165612" "2" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Pegoraro 1998:09674786}" "" "2096-2097del" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165613" "1" "10" "6" "129470195" "129470195" "subst" "0" "00006" "LAMA2_000094" "g.129470195G>A" "" "{PMID:Pegoraro 1998:09674786}" "" "G1030A" "" "Germline" "" "" "0" "" "" "g.129149050G>A" "" "benign" "" "0000165614" "1" "10" "6" "129722389" "129722389" "subst" "0.493666" "00006" "LAMA2_000045" "g.129722389A>G" "0.53" "{PMID:Tezak 2003:12552556}" "" "G5515A ex37" "" "Germline" "" "" "0" "" "" "g.129401244A>G" "" "benign" "" "0000165615" "10" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00464" "LAMA2_000041" "g.129674430C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165616" "20" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00464" "LAMA2_000041" "g.129674430C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165617" "0" "90" "6" "129635860" "129635860" "subst" "0" "00464" "LAMA2_000181" "g.129635860A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314715A>T" "" "pathogenic (recessive)" "" "0000165618" "0" "50" "6" "129712680" "129712680" "subst" "2.4431E-5" "01951" "LAMA2_000044" "g.129712680C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "VUS" "" "0000165619" "1" "90" "6" "129475799" "129475799" "subst" "0" "01416" "LAMA2_000187" "g.129475799T>G" "" "{PMID:Rajakulendran 2011:21922472}" "" "" "" "Germline" "" "" "0" "" "" "g.129154654T>G" "" "pathogenic (recessive)" "" "0000165620" "2" "50" "6" "129609204" "129609204" "subst" "4.06967E-6" "01416" "LAMA2_000186" "g.129609204G>A" "" "{PMID:Rajakulendran 2011:21922472}" "" "" "" "Germline" "" "" "0" "" "" "g.129288059G>A" "" "VUS" "" "0000165621" "0" "50" "6" "129608991" "129608991" "subst" "0" "00464" "LAMA2_000184" "g.129608991G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129287846G>C" "" "VUS" "" "0000165622" "0" "10" "6" "129618782" "129618782" "subst" "1.25133E-5" "00464" "LAMA2_000185" "g.129618782C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129297637C>G" "" "benign" "" "0000165623" "0" "90" "6" "129513978" "129513978" "del" "0" "00464" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "pathogenic (recessive)" "" "0000165624" "0" "90" "6" "129513978" "129513978" "del" "0" "00464" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "pathogenic (recessive)" "" "0000165625" "0" "50" "6" "129571358" "129571358" "subst" "0" "00464" "LAMA2_000118" "g.129571358G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250213G>A" "" "VUS" "" "0000165626" "0" "50" "6" "129571358" "129571358" "subst" "0" "00464" "LAMA2_000118" "g.129571358G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250213G>A" "" "VUS" "" "0000165627" "0" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165628" "0" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165629" "0" "10" "6" "129633974" "129633975" "del" "0" "00464" "LAMA2_000188" "g.129633974_129633975del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "benign" "" "0000165630" "0" "90" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "pathogenic (recessive)" "" "0000165631" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "01416" "LAMA2_000033" "g.129637234C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165632" "0" "90" "6" "129704313" "129704313" "del" "4.07624E-6" "01416" "LAMA2_000117" "g.129704313del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129383168del" "" "pathogenic (recessive)" "" "0000165633" "0" "90" "6" "129573393" "129573394" "del" "0" "01416" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165634" "11" "90" "6" "129636970" "129636992" "del" "0" "01416" "LAMA2_000189" "g.129636970_129636992del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315825_129315847del" "" "pathogenic (recessive)" "" "0000165635" "0" "50" "6" "129204425" "129204425" "subst" "0" "00464" "LAMA2_000190" "g.129204425T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883280T>G" "" "VUS" "" "0000165636" "0" "70" "6" "129786431" "129786431" "subst" "0" "00464" "LAMA2_000191" "g.129786431C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129465286C>T" "" "likely pathogenic (recessive)" "" "0000165637" "0" "90" "6" "129204392" "129204392" "subst" "0" "00464" "LAMA2_000003" "g.129204392T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883247T>C" "" "pathogenic (recessive)" "" "0000165638" "0" "30" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000165639" "0" "90" "6" "129785433" "129785433" "subst" "1.62934E-5" "00464" "LAMA2_000036" "g.129785433A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129464288A>C" "" "pathogenic (recessive)" "" "0000165640" "0" "50" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "VUS" "" "0000165641" "0" "70" "6" "129837358" "129837361" "dup" "0" "00464" "LAMA2_000192" "g.129837358_129837361dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129516213_129516216dup" "" "likely pathogenic (recessive)" "" "0000165642" "0" "70" "6" "129837358" "129837361" "dup" "0" "00464" "LAMA2_000192" "g.129837358_129837361dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129516213_129516216dup" "" "likely pathogenic (recessive)" "" "0000165643" "11" "10" "6" "129621942" "129621942" "subst" "8.12236E-6" "00006" "LAMA2_000101" "g.129621942T>A" "" "{PMID:Pegoraro 1996:08957020}" "" "A3099T" "" "Germline" "" "" "0" "" "" "g.129300797T>A" "" "benign" "" "0000165644" "11" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:Pegoraro 1996:08957020}" "BsmI-" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000165645" "11" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "" "{PMID:Pegoraro 1996:08957020}" "" "T7809C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165646" "11" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "" "{PMID:Pegoraro 1996:08957020}" "Sau3A-" "C7879G" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165647" "11" "10" "6" "129807714" "129807714" "subst" "0.303132" "00006" "LAMA2_000089" "g.129807714G>A" "" "{PMID:Pegoraro 1996:08957020}" "HinfI-" "G7894A" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000165648" "11" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:Allamand 1997:09158149}, {OMIM156225:0003}" "" "IVS25+2T>C" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165649" "21" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:Allamand 1997:09158149}, {OMIM156225:0003}" "" "IVS25+2T>C" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165650" "11" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Naom 1998:09829280}" "" "5525C>T" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165651" "21" "90" "6" "129663487" "129663487" "subst" "0" "00006" "LAMA2_000038" "g.129663487G>C" "" "{PMID:Naom 1998:09829280}" "" "43511-1G>C" "" "Germline" "" "" "0" "" "" "g.129342342G>C" "" "pathogenic (recessive)" "" "0000165652" "1" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Di Blasi 2001:11287370}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000165653" "2" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Di Blasi 2001:11287370}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000165654" "1" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165655" "2" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165666" "3" "70" "6" "129513978" "129513978" "del" "0" "00464" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "likely pathogenic (recessive)" "" "0000165667" "21" "90" "6" "129714214" "129714214" "del" "0" "00006" "LAMA2_000195" "g.129714214del" "" "Nevo ESHG2008 P01.202" "" "" "" "Germline" "" "" "0" "" "" "g.129393069del" "" "pathogenic (recessive)" "" "0000165668" "0" "50" "6" "129714214" "129714214" "del" "0" "00006" "LAMA2_000195" "g.129714214del" "" "Nevo ESHG2008 P01.202" "" "" "" "Germline" "" "" "0" "" "" "g.129393069del" "" "VUS" "" "0000165669" "0" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165670" "0" "50" "6" "129712630" "129712630" "del" "0" "00464" "LAMA2_000196" "g.129712630del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391485del" "" "VUS" "" "0000165671" "0" "90" "6" "129691117" "129691117" "del" "0" "00464" "LAMA2_000197" "g.129691117del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129369972del" "" "pathogenic (recessive)" "" "0000165672" "1" "30" "6" "129633974" "129633975" "del" "0" "00464" "LAMA2_000188" "g.129633974_129633975del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "likely benign" "" "0000165673" "11" "70" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "likely pathogenic (recessive)" "" "0000165674" "2" "30" "6" "129633974" "129633975" "del" "0" "00464" "LAMA2_000188" "g.129633974_129633975del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "likely benign" "" "0000165675" "21" "70" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "likely pathogenic (recessive)" "" "0000165676" "0" "70" "6" "129636695" "129636695" "del" "0" "00464" "LAMA2_000142" "g.129636695del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315550del" "" "likely pathogenic (recessive)" "" "0000165677" "0" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00464" "LAMA2_000150" "g.129813629G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165678" "10" "30" "6" "129622039" "129622040" "ins" "0" "00471" "LAMA2_000199" "g.129622039_129622040insAT" "1.0" "" "" "c.3174+23insAT" "" "Germline" "" "" "0" "" "" "g.129300894_129300895insAT" "" "likely benign" "" "0000165679" "20" "30" "6" "129622039" "129622040" "ins" "0" "00471" "LAMA2_000199" "g.129622039_129622040insAT" "1.0" "" "" "c.3174+23insAT" "" "Germline" "" "" "0" "" "" "g.129300894_129300895insAT" "" "likely benign" "" "0000165680" "10" "30" "6" "129759907" "129759907" "del" "0" "00471" "LAMA2_000200" "g.129759907del" "1.0" "" "" "c.6085+12delA" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.129438762del" "" "likely benign" "" "0000165681" "20" "30" "6" "129759907" "129759907" "del" "0" "00471" "LAMA2_000200" "g.129759907del" "1.0" "" "" "c.6085+12delA" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "Germline" "" "" "0" "" "" "g.129438762del" "" "likely benign" "" "0000165682" "1" "70" "6" "129712746" "129712746" "del" "0" "00464" "LAMA2_000201" "g.129712746del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391601del" "" "likely pathogenic (recessive)" "" "0000165683" "2" "70" "6" "129712746" "129712746" "del" "0" "00464" "LAMA2_000201" "g.129712746del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391601del" "" "likely pathogenic (recessive)" "" "0000165684" "0" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00464" "LAMA2_000046" "g.129722399C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165685" "0" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00464" "LAMA2_000046" "g.129722399C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165686" "0" "10" "6" "129802516" "129802516" "subst" "9.3499E-5" "00464" "LAMA2_000202" "g.129802516G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481371G>A" "" "benign" "" "0000165687" "0" "10" "6" "129802516" "129802516" "subst" "9.3499E-5" "00464" "LAMA2_000202" "g.129802516G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481371G>A" "" "benign" "" "0000165688" "0" "70" "6" "129498870" "129498870" "subst" "0" "00464" "LAMA2_000203" "g.129498870T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129177725T>G" "" "likely pathogenic (recessive)" "" "0000165689" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00464" "LAMA2_000033" "g.129637234C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165690" "0" "70" "6" "129204484" "129204484" "subst" "0" "00464" "LAMA2_000205" "g.129204484C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883339C>T" "" "likely pathogenic (recessive)" "" "0000165691" "0" "70" "6" "129823802" "129823802" "subst" "0" "00464" "LAMA2_000204" "g.129823802A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0000165692" "0" "30" "6" "129571408" "129571408" "subst" "0.00184807" "00464" "LAMA2_000207" "g.129571408A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250263A>C" "" "likely benign" "" "0000165693" "0" "30" "6" "129633974" "129633975" "del" "0" "00464" "LAMA2_000188" "g.129633974_129633975del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "likely benign" "" "0000165694" "0" "70" "6" "129759820" "129759820" "del" "0" "00464" "LAMA2_000206" "g.129759820del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129438675del" "" "likely pathogenic (recessive)" "" "0000165695" "0" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00464" "LAMA2_000082" "g.129785589C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "" "0000165696" "1" "90" "6" "129513978" "129513978" "del" "0" "00464" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "pathogenic (recessive)" "" "0000165697" "2" "90" "6" "129513978" "129513978" "del" "0" "00464" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "pathogenic (recessive)" "" "0000165698" "0" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165699" "0" "70" "6" "129663524" "129663524" "subst" "1.22058E-5" "00464" "LAMA2_000208" "g.129663524C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129342379C>T" "" "likely pathogenic (recessive)" "" "0000165700" "0" "70" "6" "129748945" "129748945" "subst" "0" "00464" "LAMA2_000209" "g.129748945C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129427800C>T" "" "likely pathogenic (recessive)" "" "0000165701" "0" "70" "6" "129381042" "129381042" "subst" "2.44095E-5" "00464" "LAMA2_000210" "g.129381042G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129059897G>T" "" "likely pathogenic (recessive)" "" "0000165702" "0" "90" "6" "129419419" "129419419" "subst" "4.06114E-6" "00464" "LAMA2_000008" "g.129419419G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129098274G>A" "" "pathogenic (recessive)" "" "0000165703" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00464" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165704" "2" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00464" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165705" "0" "50" "6" "129465151" "129465151" "subst" "8.14604E-6" "00464" "LAMA2_000211" "g.129465151C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129144006C>T" "" "VUS" "" "0000165706" "0" "90" "6" "129835630" "129835633" "dup" "0" "00464" "LAMA2_000077" "g.129835630_129835633dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000165707" "0" "50" "6" "129722453" "129722453" "subst" "0.0104121" "00464" "LAMA2_000092" "g.129722453C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "VUS" "" "0000165708" "0" "70" "6" "129826466" "129826466" "dup" "0" "00464" "LAMA2_000213" "g.129826466dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129505321dup" "" "likely pathogenic (recessive)" "" "0000165709" "0" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00464" "LAMA2_000044" "g.129712680C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000165710" "0" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00464" "LAMA2_000046" "g.129722399C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165711" "21" "90" "6" "129618935" "129618935" "subst" "0" "00464" "LAMA2_000027" "g.129618935C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129297790C>T" "" "pathogenic (recessive)" "" "0000165712" "0" "30" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000165713" "11" "70" "6" "129762141" "129762141" "del" "0" "00464" "LAMA2_000215" "g.129762141del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129440996del" "" "likely pathogenic (recessive)" "" "0000165714" "0" "70" "6" "129204392" "129204392" "subst" "0" "00464" "LAMA2_000003" "g.129204392T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883247T>C" "" "likely pathogenic (recessive)" "" "0000165715" "0" "50" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "VUS" "" "0000165716" "0" "70" "6" "129722490" "129722490" "subst" "2.04232E-5" "00464" "LAMA2_000049" "g.129722490G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "likely pathogenic (recessive)" "" "0000165717" "0" "50" "6" "129835746" "129835746" "subst" "0.000691467" "00464" "LAMA2_000272" "g.129835746T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "VUS" "" "0000165718" "0" "70" "6" "129470153" "129470154" "del" "2.84474E-5" "00464" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "939_940delAT" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "likely pathogenic (recessive)" "" "0000165719" "0" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00464" "LAMA2_000146" "g.129802567C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165720" "0" "10" "6" "129381026" "129381026" "subst" "0.960856" "00486" "LAMA2_000110" "g.129381026C>A" "" "" "" "" "DNA analyzed by exon sequencing at Prevention Genetics" "Germline" "" "" "0" "" "" "g.129059881C>A" "" "benign" "" "0000165721" "0" "10" "6" "129511373" "129511373" "subst" "0.0319401" "00486" "LAMA2_000083" "g.129511373T>C" "" "" "" "" "DNA analyzed by exon sequencing at Prevention Genetics" "Germline" "" "" "0" "" "" "g.129190228T>C" "" "benign" "" "0000165722" "0" "50" "6" "129514008" "129514008" "subst" "0.000598572" "00486" "LAMA2_000217" "g.129514008C>T" "" "" "" "" "DNA analyzed by exon sequencing at Prevention Genetics" "Germline" "" "" "0" "" "" "g.129192863C>T" "" "VUS" "" "0000165723" "0" "10" "6" "129612808" "129612808" "subst" "0.269063" "00486" "LAMA2_000024" "g.129612808A>G" "" "" "" "" "DNA analyzed by exon sequencing at Prevention Genetics" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000165724" "0" "10" "6" "129619059" "129619059" "subst" "0.142546" "00486" "LAMA2_000218" "g.129619059G>A" "" "" "" "" "DNA analyzed by exon sequencing at Prevention Genetics" "Germline" "" "" "0" "" "" "g.129297914G>A" "" "benign" "" "0000165725" "0" "30" "6" "129633974" "129633975" "del" "0" "00486" "LAMA2_000188" "g.129633974_129633975del" "" "" "" "3175-32_3175-33delTG" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "likely benign" "" "0000165726" "0" "10" "6" "129634255" "129634255" "subst" "0.220596" "00486" "LAMA2_000165" "g.129634255G>A" "" "" "" "" "" "Germline" "" "rs3798663" "0" "" "" "g.129313110G>A" "" "benign" "" "0000165727" "0" "30" "6" "129722389" "129722389" "subst" "0.493666" "00486" "LAMA2_000045" "g.129722389A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401244A>G" "" "likely benign" "" "0000165728" "0" "10" "6" "129722425" "129722425" "subst" "0.49225" "00486" "LAMA2_000048" "g.129722425G>A" "" "" "" "" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000165729" "0" "10" "6" "129724942" "129724945" "delins" "0" "00486" "LAMA2_000171" "g.129724942_129724945delinsACTG" "" "" "" "[5727-24 T>A; 5727-22_21CT>TG]" "" "Germline" "" "" "0" "" "" "g.129403797_129403800delinsACTG" "" "benign" "" "0000165730" "0" "10" "6" "129785391" "129785391" "subst" "0.609286" "00486" "LAMA2_000177" "g.129785391T>C" "" "" "" "" "" "Germline" "" "rs1414736" "0" "" "" "g.129464246T>C" "" "benign" "" "0000165731" "0" "10" "6" "129807629" "129807629" "subst" "0" "00486" "LAMA2_000065" "g.129807629=" "" "" "" "" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165732" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "00486" "LAMA2_000067" "g.129807699G>C" "" "" "" "" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165733" "0" "70" "6" "129833500" "129833500" "subst" "0" "00486" "LAMA2_000228" "g.129833500T>G" "" "{PMID:Vishnudas 2009:19692349}" "" "8845-8T>G" "predicted to change splice site" "Germline" "" "" "0" "" "" "g.129512355T>G" "" "likely pathogenic (recessive)" "" "0000165734" "0" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00464" "LAMA2_000020" "g.129588272C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000165735" "0" "70" "6" "129714280" "129714280" "dup" "0" "00464" "LAMA2_000229" "g.129714280dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129393135dup" "" "likely pathogenic (recessive)" "" "0000165736" "11" "70" "6" "129204437" "129204437" "del" "0" "00464" "LAMA2_000230" "g.129204437del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883292del" "" "likely pathogenic (recessive)" "" "0000165737" "21" "70" "6" "129204392" "129204392" "subst" "0" "00464" "LAMA2_000003" "g.129204392T>C" "" "" "" "(Met1Thr)" "" "Germline" "" "" "0" "" "" "g.128883247T>C" "" "likely pathogenic (recessive)" "" "0000165738" "21" "30" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000165739" "0" "70" "6" "129470123" "129470123" "subst" "0" "00464" "LAMA2_000231" "g.129470123G>T" "" "" "" "" "apparently homozygous" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "likely pathogenic (recessive)" "" "0000165740" "0" "70" "6" "129470123" "129470123" "subst" "0" "00464" "LAMA2_000231" "g.129470123G>T" "" "" "" "" "apparently homozygous" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "likely pathogenic (recessive)" "" "0000165741" "1" "70" "6" "129371114" "129371114" "del" "0" "00464" "LAMA2_000232" "g.129371114del" "" "" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129049969del" "" "likely pathogenic (recessive)" "" "0000165742" "0" "70" "6" "129775314" "129775314" "dup" "0" "00464" "LAMA2_000233" "g.129775314dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129454169dup" "" "likely pathogenic (recessive)" "" "0000165743" "0" "70" "6" "129799957" "129799957" "subst" "0" "00464" "LAMA2_000234" "g.129799957A>T" "" "" "" "" "predicted to disrupt splice donor site" "Germline" "" "" "0" "" "" "g.129478812A>T" "" "likely pathogenic (recessive)" "" "0000165744" "0" "70" "6" "129813629" "129813629" "subst" "0" "00464" "LAMA2_000235" "g.129813629G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>C" "" "likely pathogenic (recessive)" "" "0000165745" "3" "70" "6" "129711182" "129712718" "delins" "0" "00464" "LAMA2_000236" "g.129711182_129712718delinsAGATTGCC" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129390037_129391573delinsAGATTGCC" "" "likely pathogenic (recessive)" "" "0000165746" "0" "70" "6" "129470153" "129470154" "del" "2.84474E-5" "00464" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "939_940delAT" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "likely pathogenic (recessive)" "" "0000165747" "0" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00464" "LAMA2_000049" "g.129722490G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000165748" "0" "30" "6" "129835746" "129835746" "subst" "0.000691467" "00464" "LAMA2_000272" "g.129835746T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "likely benign" "" "0000165749" "11" "70" "6" "129637000" "129637000" "subst" "0" "00464" "LAMA2_000227" "g.129637000C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic (recessive)" "" "0000165750" "11" "50" "6" "129796583" "129796583" "subst" "0" "00464" "LAMA2_000225" "g.129796583A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129475438A>G" "" "VUS" "" "0000165751" "21" "50" "6" "129674439" "129674439" "subst" "1.21877E-5" "00464" "LAMA2_000226" "g.129674439G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129353294G>A" "" "VUS" "" "0000165752" "0" "50" "6" "129748945" "129748945" "subst" "0" "00464" "LAMA2_000209" "g.129748945C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129427800C>T" "" "VUS" "" "0000165753" "0" "70" "6" "129634169" "129634176" "dup" "0" "00464" "LAMA2_000224" "g.129634169_129634176dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129313024_129313031dup" "" "likely pathogenic (recessive)" "" "0000165754" "0" "70" "6" "129762082" "129762082" "subst" "0" "00464" "LAMA2_000223" "g.129762082C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129440937C>A" "" "likely pathogenic (recessive)" "" "0000165755" "0" "70" "6" "129381042" "129381042" "subst" "2.44095E-5" "00464" "LAMA2_000210" "g.129381042G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129059897G>T" "" "likely pathogenic (recessive)" "" "0000165756" "0" "90" "6" "129674477" "129674480" "dup" "0" "00464" "LAMA2_000143" "g.129674477_129674480dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "pathogenic (recessive)" "" "0000165757" "0" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00464" "LAMA2_000146" "g.129802567C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165758" "0" "30" "6" "129571272" "129571272" "subst" "0.0138918" "00464" "LAMA2_000090" "g.129571272G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250127G>A" "" "likely benign" "" "0000165759" "0" "30" "6" "129633974" "129633975" "del" "0" "00464" "LAMA2_000188" "g.129633974_129633975del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "likely benign" "" "0000165760" "0" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165761" "0" "70" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "likely pathogenic (recessive)" "" "0000165762" "10" "70" "6" "129826462" "129826462" "subst" "0" "00464" "LAMA2_000222" "g.129826462G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129505317G>A" "" "likely pathogenic (recessive)" "" "0000165763" "20" "70" "6" "129826462" "129826462" "subst" "0" "00464" "LAMA2_000222" "g.129826462G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129505317G>A" "" "likely pathogenic (recessive)" "" "0000165764" "10" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165765" "20" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165766" "1" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165767" "2" "70" "6" "129823917" "129823917" "subst" "0" "00464" "LAMA2_000221" "g.129823917G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129502772G>A" "" "likely pathogenic (recessive)" "" "0000165768" "10" "70" "6" "129573320" "129573320" "subst" "0" "00464" "LAMA2_000220" "g.129573320C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252175C>A" "" "likely pathogenic (recessive)" "" "0000165769" "20" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00464" "LAMA2_000033" "g.129637234C>T" "" "" "" "3967C>T" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165770" "0" "30" "6" "129775432" "129775432" "subst" "0" "00464" "LAMA2_000214" "g.129775432A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129454287A>C" "" "likely benign" "" "0000165771" "1" "70" "6" "129649444" "129649444" "subst" "4.06352E-6" "00464" "LAMA2_000219" "g.129649444C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "likely pathogenic (recessive)" "" "0000165772" "0" "90" "6" "129634046" "129634046" "del" "0" "00464" "LAMA2_000109" "g.129634046del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129312901del" "" "pathogenic (recessive)" "" "0000165773" "0" "30" "6" "129663469" "129663471" "del" "0" "00464" "LAMA2_000212" "g.129663469_129663471del" "" "" "" "4312-19_-17delTCT" "" "Germline" "" "" "0" "" "" "g.129342324_129342326del" "" "likely benign" "" "0000165774" "11" "50" "6" "129591816" "129591816" "subst" "0" "00464" "LAMA2_000237" "g.129591816T>A" "" "" "" "Pro790Pro" "creates possible new splice acceptor site" "Germline" "" "" "0" "" "" "g.129270671T>A" "" "VUS" "" "0000165775" "21" "50" "6" "129722453" "129722453" "subst" "0.0104121" "00464" "LAMA2_000092" "g.129722453C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "VUS" "" "0000165776" "21" "70" "6" "129826466" "129826466" "dup" "0" "00464" "LAMA2_000213" "g.129826466dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129505321dup" "" "likely pathogenic (recessive)" "" "0000165777" "10" "70" "6" "129470153" "129470154" "del" "2.84474E-5" "00464" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "939_940delAT" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "likely pathogenic (recessive)" "" "0000165778" "20" "70" "6" "129470153" "129470154" "del" "2.84474E-5" "00464" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "939_940delAT" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "likely pathogenic (recessive)" "" "0000165779" "0" "30" "6" "129687396" "129687396" "subst" "0.0195317" "00464" "LAMA2_000123" "g.129687396G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000165780" "1" "70" "6" "129591829" "129591829" "subst" "4.06706E-6" "00464" "LAMA2_000238" "g.129591829G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129270684G>T" "" "likely pathogenic (recessive)" "" "0000165781" "2" "70" "6" "129687407" "129687407" "dup" "0" "00464" "LAMA2_000239" "g.129687407dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366262dup" "" "likely pathogenic (recessive)" "" "0000165782" "0" "30" "6" "129722453" "129722453" "subst" "0.0104121" "00464" "LAMA2_000092" "g.129722453C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "likely benign" "" "0000165783" "1" "50" "6" "129465224" "129465224" "subst" "0" "00464" "LAMA2_000240" "g.129465224G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129144079G>A" "" "VUS" "" "0000165784" "2" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00464" "LAMA2_000033" "g.129637234C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165785" "11" "50" "6" "129774251" "129774251" "subst" "0" "00464" "LAMA2_000241" "g.129774251T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453106T>G" "" "VUS" "" "0000165786" "21" "50" "6" "129774251" "129774251" "subst" "0" "00464" "LAMA2_000241" "g.129774251T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453106T>G" "" "VUS" "" "0000165787" "0" "30" "6" "129722453" "129722453" "subst" "0.0104121" "00464" "LAMA2_000092" "g.129722453C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "likely benign" "" "0000165788" "0" "70" "6" "129618874" "129618874" "subst" "8.12381E-6" "00464" "LAMA2_000025" "g.129618874C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129297729C>A" "" "likely pathogenic (recessive)" "" "0000165789" "0" "70" "6" "129766967" "129766967" "subst" "0" "00464" "LAMA2_000242" "g.129766967G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129445822G>T" "" "likely pathogenic (recessive)" "" "0000165790" "0" "30" "6" "129835746" "129835746" "subst" "0.000691467" "00464" "LAMA2_000272" "g.129835746T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "likely benign" "" "0000165791" "1" "70" "6" "129637307" "129637307" "del" "0" "00464" "LAMA2_000243" "g.129637307del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316162del" "" "likely pathogenic (recessive)" "" "0000165792" "2" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00464" "LAMA2_000049" "g.129722490G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000165793" "1" "90" "6" "129498849" "129498849" "subst" "4.06379E-6" "00006" "LAMA2_000266" "g.129498849A>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129177704A>G" "" "pathogenic (recessive)" "" "0000165794" "2" "90" "6" "129785435" "129785441" "del" "0" "00006" "LAMA2_000258" "g.129785435_129785441del" "" "{PMID:Geranmayeh 2010:20207543}" "" "6993_6999delTCCTCAG" "possible splice site mutation described at DNA level instead of RNA level?" "Germline" "" "" "0" "" "" "g.129464290_129464296del" "" "pathogenic (recessive)" "" "0000165795" "1" "90" "6" "129774191" "129774191" "del" "0" "00006" "LAMA2_000198" "g.129774191del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165796" "2" "90" "6" "129774191" "129774191" "del" "0" "00006" "LAMA2_000198" "g.129774191del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165797" "1" "90" "6" "129636716" "129636716" "del" "0" "00006" "LAMA2_000249" "g.129636716del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129315571del" "" "pathogenic (recessive)" "" "0000165798" "2" "90" "6" "129636716" "129636716" "del" "0" "00006" "LAMA2_000249" "g.129636716del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129315571del" "" "pathogenic (recessive)" "" "0000165799" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165800" "2" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165801" "1" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165802" "2" "90" "6" "129833639" "129833639" "subst" "0" "00006" "LAMA2_000244" "g.129833639G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129512494G>A" "" "pathogenic (recessive)" "" "0000165803" "1" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000165804" "2" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000165805" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165806" "2" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165807" "1" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000165808" "1" "90" "6" "129835746" "129835746" "subst" "0.000691467" "00006" "LAMA2_000272" "g.129835746T>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "pathogenic (recessive)" "" "0000165809" "2" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165810" "3" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant, founder haplotype (Ireland)" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165811" "1" "90" "6" "129609010" "129609010" "del" "0" "00006" "LAMA2_000247" "g.129609010del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129287865del" "" "pathogenic (recessive)" "" "0000165812" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165813" "3" "50" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown chromosome" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000165814" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165815" "2" "90" "6" "129636970" "129636992" "del" "0" "00006" "LAMA2_000189" "g.129636970_129636992del" "" "{PMID:Geranmayeh 2010:20207543}" "" "3799_3821del23" "" "Germline" "" "" "0" "" "" "g.129315825_129315847del" "" "pathogenic (recessive)" "" "0000165816" "1" "90" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Geranmayeh 2010:20207543}" "" "1893_1897delCTTGA" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "" "0000165817" "2" "90" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Geranmayeh 2010:20207543}" "" "1893_1897delCTTGA" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "" "0000165818" "1" "90" "6" "129581969" "129581969" "subst" "8.14034E-6" "00006" "LAMA2_000267" "g.129581969T>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129260824T>C" "" "pathogenic (recessive)" "" "0000165819" "2" "90" "6" "129581969" "129581969" "subst" "8.14034E-6" "00006" "LAMA2_000267" "g.129581969T>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129260824T>C" "" "pathogenic (recessive)" "" "0000165820" "1" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000165821" "2" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000165822" "1" "90" "6" "129636970" "129636992" "del" "0" "00006" "LAMA2_000189" "g.129636970_129636992del" "" "{PMID:Geranmayeh 2010:20207543}" "" "3799_3821del23" "" "Germline" "" "" "0" "" "" "g.129315825_129315847del" "" "pathogenic (recessive)" "" "0000165823" "2" "90" "6" "129419391" "129419391" "subst" "8.1217E-6" "00006" "LAMA2_000263" "g.129419391C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129098246C>T" "" "pathogenic (recessive)" "" "0000165824" "1" "90" "6" "129609010" "129609010" "del" "0" "00006" "LAMA2_000247" "g.129609010del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129287865del" "" "pathogenic (recessive)" "" "0000165825" "2" "90" "6" "129636695" "129636695" "del" "0" "00006" "LAMA2_000142" "g.129636695del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "" "0000165826" "1" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165827" "2" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165828" "1" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165829" "2" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165830" "1" "90" "6" "129371234" "129371234" "subst" "1.21842E-5" "00006" "LAMA2_000261" "g.129371234G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>A" "" "pathogenic (recessive)" "" "0000165831" "2" "90" "6" "129381036" "129381036" "subst" "0" "00006" "LAMA2_000262" "g.129381036C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129059891C>T" "" "pathogenic (recessive)" "" "0000165832" "1" "90" "6" "129636939" "129636942" "dup" "0" "00006" "LAMA2_000250" "g.129636939_129636942dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "3768_3771dupAATC" "" "Germline" "" "" "0" "" "" "g.129315794_129315797dup" "" "pathogenic (recessive)" "" "0000165833" "2" "90" "6" "129636939" "129636942" "dup" "0" "00006" "LAMA2_000250" "g.129636939_129636942dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "3768_3771dupAATC" "" "Germline" "" "" "0" "" "" "g.129315794_129315797dup" "" "pathogenic (recessive)" "" "0000165834" "1" "90" "6" "129837358" "129837361" "dup" "0" "00006" "LAMA2_000192" "g.129837358_129837361dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "9235_9238dupACAA" "" "Germline" "" "" "0" "" "" "g.129516213_129516216dup" "" "pathogenic (recessive)" "" "0000165835" "2" "90" "6" "129837358" "129837361" "dup" "0" "00006" "LAMA2_000192" "g.129837358_129837361dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "9235_9238dupACAA" "" "Germline" "" "" "0" "" "" "g.129516213_129516216dup" "" "pathogenic (recessive)" "" "0000165836" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165837" "2" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000165838" "1" "90" "6" "129204503" "129204503" "subst" "0" "00006" "LAMA2_000260" "g.129204503G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.128883358G>A" "" "pathogenic (recessive)" "" "0000165839" "2" "90" "6" "129794498" "129794498" "subst" "4.08343E-6" "00006" "LAMA2_000251" "g.129794498G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129473353G>A" "" "pathogenic (recessive)" "" "0000165840" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165841" "2" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165842" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165843" "2" "90" "6" "129636695" "129636695" "del" "0" "00006" "LAMA2_000142" "g.129636695del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "" "0000165844" "2" "90" "6" "129608991" "129608991" "subst" "0" "00006" "LAMA2_000184" "g.129608991G>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129287846G>C" "" "pathogenic (recessive)" "" "0000165845" "11" "90" "6" "129723560" "129723560" "del" "0" "00006" "LAMA2_000050" "g.129723560del" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "HindIII-" "5702delA" "reported as 5655delG by Geranmayeh 2010; reduced level LAMA2 RNA; de novo, in patient (paternal allele)" "De novo" "" "" "0" "" "" "g.129402415del" "" "pathogenic (recessive)" "" "0000165846" "21" "50" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "SpeI+" "IVS37+5G>C" "not in 100 control chromosomes; reduced level LAMA2 RNA" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "VUS" "" "0000165847" "21" "50" "6" "129835746" "129835746" "subst" "0.000691467" "00006" "LAMA2_000272" "g.129835746T>C" "" "{PMID:Naom 2000:10611118}, {PMID:Geranmayeh 2010:20207543}" "" "IVS63+6T>C" "not in 180 control chromosomes; reduced level LAMA2 RNA" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "VUS" "" "0000165848" "3" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant, founder haplotype (Ireland)" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165849" "1" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000165850" "2" "90" "6" "129722473" "129722493" "delins" "0" "00006" "LAMA2_000256" "g.129722473_129722493delinsG" "" "{PMID:Geranmayeh 2010:20207543}" "" "5550-5562+8del21insG" "" "Germline" "" "" "0" "" "" "g.129401328_129401348delinsG" "" "pathogenic (recessive)" "" "0000165851" "1" "90" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Geranmayeh 2010:20207543}" "" "1893_1897delCTTGA" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "" "0000165852" "2" "90" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Geranmayeh 2010:20207543}" "" "1893_1897delCTTGA" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "" "0000165854" "1" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "00006" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "" "0000165855" "2" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165856" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165857" "2" "90" "6" "129634125" "129634125" "del" "0" "00006" "LAMA2_000248" "g.129634125del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129312980del" "" "pathogenic (recessive)" "" "0000165858" "1" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165859" "2" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165860" "3" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant, founder haplotype (Ireland)" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165861" "1" "90" "6" "129637293" "129637293" "subst" "0" "00006" "LAMA2_000252" "g.129637293T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316148T>G" "" "pathogenic (recessive)" "" "0000165862" "2" "90" "6" "129637293" "129637293" "subst" "0" "00006" "LAMA2_000252" "g.129637293T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316148T>G" "" "pathogenic (recessive)" "" "0000165863" "1" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00006" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165864" "2" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00006" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165865" "1" "90" "6" "129591897" "129591897" "subst" "0" "00006" "LAMA2_000259" "g.129591897G>C" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129270752G>C" "" "pathogenic (recessive)" "" "0000165866" "2" "90" "6" "129722453" "129722453" "subst" "0.0104121" "00006" "LAMA2_000092" "g.129722453C>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "pathogenic (recessive)" "" "0000165867" "1" "90" "6" "129581937" "129581937" "subst" "0" "00006" "LAMA2_000019" "g.129581937C>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129260792C>A" "" "pathogenic (recessive)" "" "0000165868" "2" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000165869" "1" "90" "6" "129687498" "129687498" "subst" "0" "00006" "LAMA2_000254" "g.129687498G>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129366353G>T" "" "pathogenic (recessive)" "" "0000165870" "2" "90" "6" "129687498" "129687498" "subst" "0" "00006" "LAMA2_000254" "g.129687498G>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129366353G>T" "" "pathogenic (recessive)" "" "0000165871" "2" "90" "6" "129486720" "129486720" "subst" "4.10139E-6" "00006" "LAMA2_000264" "g.129486720G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129165575G>A" "" "pathogenic (recessive)" "" "0000165872" "1" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165873" "2" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165874" "1" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165875" "2" "90" "6" "129807750" "129807750" "subst" "0" "00006" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "founder haplotype (Kenya)" "Germline" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "" "0000165876" "2" "90" "6" "129486720" "129486720" "subst" "4.10139E-6" "00006" "LAMA2_000264" "g.129486720G>A" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129165575G>A" "" "pathogenic (recessive)" "" "0000165877" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165878" "2" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165879" "1" "90" "6" "129714245" "129714245" "dup" "0" "00006" "LAMA2_000255" "g.129714245dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129393100dup" "" "pathogenic (recessive)" "" "0000165880" "2" "90" "6" "129714245" "129714245" "dup" "0" "00006" "LAMA2_000255" "g.129714245dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129393100dup" "" "pathogenic (recessive)" "" "0000165881" "1" "90" "6" "129687421" "129687421" "dup" "0" "00006" "LAMA2_000253" "g.129687421dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129366276dup" "" "pathogenic (recessive)" "" "0000165882" "2" "90" "6" "129714280" "129714280" "dup" "0" "00006" "LAMA2_000229" "g.129714280dup" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129393135dup" "" "pathogenic (recessive)" "" "0000165883" "3" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000000" "g.?" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "unknown variant, founder haplotype (Ireland)" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165884" "1" "90" "6" "129807768" "129807768" "subst" "0" "00006" "LAMA2_000246" "g.129807768G>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129486623G>T" "" "pathogenic (recessive)" "" "0000165885" "2" "90" "6" "129807768" "129807768" "subst" "0" "00006" "LAMA2_000246" "g.129807768G>T" "" "{PMID:Geranmayeh 2010:20207543}" "" "" "" "Germline" "" "" "0" "" "" "g.129486623G>T" "" "pathogenic (recessive)" "" "0000165886" "1" "50" "6" "129468139" "129468139" "subst" "0" "00464" "LAMA2_000268" "g.129468139G>T" "" "" "" "" "in silico prediction; splice donor site created" "Germline" "" "" "0" "" "" "g.129146994G>T" "" "VUS" "" "0000165887" "2" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00464" "LAMA2_000034" "g.129637306C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000165888" "1" "50" "6" "129475799" "129475799" "subst" "0" "00464" "LAMA2_000187" "g.129475799T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129154654T>G" "" "VUS" "" "0000165889" "2" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165891" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00464" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165892" "2" "50" "6" "129777464" "129777464" "subst" "0" "00464" "LAMA2_000270" "g.129777464A>G" "" "" "" "" "potentially creates new splice acceptor site" "Germline" "" "" "0" "" "" "g.129456319A>G" "" "VUS" "" "0000165893" "10" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165894" "20" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165895" "10" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165896" "21" "50" "6" "129670529" "129670529" "subst" "4.06402E-6" "00464" "LAMA2_000277" "g.129670529G>A" "" "" "" "" "in silico model predicts 31i splice donor site is affected." "Germline" "" "" "0" "" "" "g.129349384G>A" "" "VUS" "" "0000165897" "10" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165898" "20" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165899" "10" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165900" "20" "90" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000165901" "1" "70" "6" "129573361" "129573361" "subst" "0" "00464" "LAMA2_000300" "g.129573361G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252216G>T" "" "likely pathogenic (recessive)" "" "0000165902" "2" "70" "6" "129573367" "129573368" "del" "0" "00464" "LAMA2_000301" "g.129573367_129573368del" "" "" "" "2023_2024delAT" "" "Germline" "" "" "0" "" "" "g.129252222_129252223del" "" "likely pathogenic (recessive)" "" "0000165903" "10" "90" "6" "129748945" "129748945" "subst" "0" "00464" "LAMA2_000209" "g.129748945C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129427800C>T" "" "pathogenic (recessive)" "" "0000165904" "20" "90" "6" "129748945" "129748945" "subst" "0" "00464" "LAMA2_000209" "g.129748945C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129427800C>T" "" "pathogenic (recessive)" "" "0000165905" "10" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00464" "LAMA2_000150" "g.129813629G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165906" "20" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00464" "LAMA2_000150" "g.129813629G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000165907" "0" "70" "6" "129371235" "129371235" "del" "0" "00464" "LAMA2_000073" "g.129371235del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129050090del" "" "likely pathogenic (recessive)" "" "0000165908" "0" "50" "6" "129513784" "129513818" "inv" "0" "00464" "LAMA2_000302" "g.129513784_129513818inv" "" "" "" "1609-41_1609-7inv35" "" "Germline" "" "" "0" "" "" "g.129192639_129192673inv" "" "VUS" "" "0000165909" "1" "90" "6" "129621997" "129621997" "subst" "0.000125903" "00006" "LAMA2_000303" "g.129621997A>G" "" "CA Valencia ASHG 2010 A1982" "" "" "" "Germline" "" "" "0" "" "" "g.129300852A>G" "" "pathogenic (recessive)" "" "0000165910" "0" "50" "6" "129573398" "129573398" "subst" "0" "00464" "LAMA2_000115" "g.129573398T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252253T>C" "" "VUS" "" "0000165911" "0" "50" "6" "129704250" "129704250" "subst" "0" "00464" "LAMA2_000304" "g.129704250C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129383105C>A" "" "VUS" "" "0000165912" "10" "70" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "likely pathogenic (recessive)" "" "0000165913" "20" "70" "6" "129637097" "129637097" "subst" "0" "00464" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "likely pathogenic (recessive)" "" "0000165914" "1" "70" "6" "129470205" "129470205" "subst" "4.06593E-6" "00464" "LAMA2_000305" "g.129470205A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129149060A>T" "" "likely pathogenic (recessive)" "" "0000165915" "2" "90" "6" "129714280" "129714280" "dup" "0" "00464" "LAMA2_000229" "g.129714280dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129393135dup" "" "pathogenic (recessive)" "" "0000165916" "0" "50" "6" "129470244" "129470244" "subst" "4.07083E-6" "00464" "LAMA2_000245" "g.129470244A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129149099A>G" "" "VUS" "" "0000165917" "0" "50" "6" "129475839" "129475839" "subst" "0.00232884" "00464" "LAMA2_000269" "g.129475839C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129154694C>T" "" "VUS" "" "0000165918" "0" "70" "6" "129807679" "129807679" "subst" "8.13848E-6" "00464" "LAMA2_000066" "g.129807679C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "likely pathogenic (recessive)" "" "0000165919" "1" "90" "6" "129714214" "129714214" "del" "0" "00464" "LAMA2_000195" "g.129714214del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129393069del" "" "pathogenic (recessive)" "" "0000165920" "2" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00464" "LAMA2_000082" "g.129785589C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "" "0000165921" "1" "70" "6" "129775343" "129775343" "del" "0" "00464" "LAMA2_000306" "g.129775343del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129454198del" "" "likely pathogenic (recessive)" "" "0000165922" "2" "50" "6" "129419358" "129419358" "subst" "0" "00464" "LAMA2_000278" "g.129419358C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129098213C>T" "" "VUS" "" "0000165923" "11" "70" "6" "129571297" "129571298" "del" "0" "00464" "LAMA2_000276" "g.129571297_129571298del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250152_129250153del" "" "likely pathogenic (recessive)" "" "0000165924" "21" "70" "6" "129571297" "129571298" "del" "0" "00464" "LAMA2_000276" "g.129571297_129571298del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250152_129250153del" "" "likely pathogenic (recessive)" "" "0000165925" "1" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165926" "2" "70" "6" "129826466" "129826466" "dup" "0" "00464" "LAMA2_000213" "g.129826466dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129505321dup" "" "likely pathogenic (recessive)" "" "0000165927" "1" "90" "6" "129609010" "129609010" "del" "0" "00464" "LAMA2_000247" "g.129609010del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129287865del" "" "pathogenic (recessive)" "" "0000165928" "2" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00464" "LAMA2_000033" "g.129637234C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000165929" "1" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00464" "LAMA2_000049" "g.129722490G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000165930" "2" "70" "6" "129835624" "129835624" "dup" "0" "00464" "LAMA2_000283" "g.129835624dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129514479dup" "" "likely pathogenic (recessive)" "" "0000165931" "3" "70" "6" "129808499" "129876774" "del" "0" "00464" "LAMA2_000412" "g.129808499_129876774del" "" "" "" "g.129,808,499_g.129,876,774 del" "deletion incl. exons 57 to 65 and part of 3\' UTR" "Germline" "" "" "0" "" "" "g.129487354_129555629del" "" "likely pathogenic (recessive)" "" "0000165933" "11" "70" "6" "129419562" "129419562" "subst" "0" "00464" "LAMA2_000274" "g.129419562T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129098417T>A" "" "likely pathogenic (recessive)" "" "0000165934" "21" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "2049_2050del2" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165935" "10" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00464" "LAMA2_000146" "g.129802567C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165936" "20" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00464" "LAMA2_000146" "g.129802567C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000165937" "1" "70" "6" "129381042" "129381042" "subst" "2.44095E-5" "00464" "LAMA2_000210" "g.129381042G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129059897G>T" "" "likely pathogenic (recessive)" "" "0000165938" "2" "70" "6" "129775416" "129775416" "subst" "0" "00464" "LAMA2_000275" "g.129775416C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129454271C>A" "" "likely pathogenic (recessive)" "" "0000165939" "10" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165940" "20" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165941" "1" "70" "6" "129799877" "129799877" "del" "0" "00464" "LAMA2_000296" "g.129799877del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129478732del" "" "likely pathogenic (recessive)" "" "0000165942" "2" "50" "6" "129813631" "129813634" "del" "0" "00464" "LAMA2_000298" "g.129813631_129813634del" "" "" "" "8244+3_+6delAAGT" "" "Germline" "" "" "0" "" "" "g.129492486_129492489del" "" "VUS" "" "0000165943" "10" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165944" "20" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165945" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00464" "LAMA2_000148" "g.129712799G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165946" "2" "50" "6" "129601216" "129601216" "subst" "0" "00464" "LAMA2_000297" "g.129601216A>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "VUS" "" "0000165947" "1" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00464" "LAMA2_000041" "g.129674430C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000165948" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00464" "LAMA2_000148" "g.129712799G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165949" "11" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165950" "21" "50" "6" "129670529" "129670529" "subst" "4.06402E-6" "00464" "LAMA2_000277" "g.129670529G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129349384G>A" "" "VUS" "" "0000165951" "10" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165952" "20" "90" "6" "129774191" "129774191" "del" "0" "00464" "LAMA2_000198" "g.129774191del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "" "0000165953" "11" "70" "6" "129636625" "129636634" "del" "0" "00464" "LAMA2_000307" "g.129636625_129636634del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315480_129315489del" "" "likely pathogenic (recessive)" "" "0000165954" "21" "90" "6" "129636625" "129636634" "del" "0" "00464" "LAMA2_000307" "g.129636625_129636634del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315480_129315489del" "" "pathogenic (recessive)" "" "0000165955" "0" "10" "6" "129635800" "129635800" "subst" "0.0648408" "00006" "LAMA2_000064" "g.129635800G>A" "0.06" "{PMID:Tezak 2003:12552556}" "" "3461G>A ex23" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000165956" "1" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "1/222" "{PMID:Wibawa 2002:12100448}" "Sau3A-" "T7809C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165957" "1" "10" "6" "129807714" "129807714" "subst" "0.303132" "00006" "LAMA2_000089" "g.129807714G>A" "3/222" "{PMID:Wibawa 2002:12100448}" "" "G7894A" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000165958" "1" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "153/222" "{PMID:Wibawa 2002:12100448}" "" "C7879G" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000165959" "1" "10" "6" "129807629" "129807629" "subst" "0" "00006" "LAMA2_000065" "g.129807629=" "56/222" "{PMID:Wibawa 2002:12100448}" "Sau3A-" "T7809C" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000165960" "1" "10" "6" "129807714" "129807714" "subst" "0.303132" "00006" "LAMA2_000089" "g.129807714G>A" "56/222" "{PMID:Wibawa 2002:12100448}" "" "G7894A" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000165961" "11" "90" "6" "129813223" "129813224" "del" "0" "00006" "LAMA2_000145" "g.129813223_129813224del" "" "{PMID:Prandini 2004:15452315}" "" "" "" "Germline" "" "" "0" "" "" "g.129492078_129492079del" "" "pathogenic (recessive)" "" "0000165962" "21" "90" "6" "129813223" "129813224" "del" "0" "00006" "LAMA2_000145" "g.129813223_129813224del" "" "{PMID:Prandini 2004:15452315}" "" "" "" "Germline" "" "" "0" "" "" "g.129492078_129492079del" "" "pathogenic (recessive)" "" "0000165963" "0" "10" "6" "129371106" "129371106" "subst" "0.0986835" "00006" "LAMA2_000153" "g.129371106C>T" "0.19" "{PMID:Di Blasi 2005:16216942}" "" "I521I" "" "Germline" "" "rs1140366" "0" "" "" "g.129049961C>T" "" "benign" "" "0000165964" "1" "90" "6" "129636970" "129636992" "del" "0" "00006" "LAMA2_000189" "g.129636970_129636992del" "" "{PMID:DiBlasi 2007:17765811}" "" "" "" "Germline" "" "" "0" "" "" "g.129315825_129315847del" "" "pathogenic (recessive)" "" "0000165965" "2" "90" "6" "129674307" "129674307" "subst" "0" "00006" "LAMA2_000273" "g.129674307A>G" "" "{PMID:DiBlasi 2007:17765811}" "" "" "" "Germline" "" "" "0" "" "" "g.129353162A>G" "" "pathogenic (recessive)" "" "0000165966" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165967" "2" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165968" "1" "90" "6" "129571272" "129571274" "del" "0" "00400" "LAMA2_000081" "g.129571272_129571274del" "" "{PMID:Oliveira 2008:18700894}" "" "1798_1800delGGA" "not in 300 control chromosomes; unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129250127_129250129del" "" "pathogenic (recessive)" "" "0000165969" "1" "90" "6" "129826410" "129826410" "dup" "0" "00400" "LAMA2_000194" "g.129826410dup" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129505265dup" "" "pathogenic (recessive)" "" "0000165970" "2" "90" "6" "129419333" "129419333" "subst" "0" "00400" "LAMA2_000193" "g.129419333T>C" "" "{PMID:Oliveira 2008:18700894}" "" "" "not in 300 control chromosomes" "Germline" "" "" "0" "" "" "g.129098188T>C" "" "pathogenic (recessive)" "" "0000165971" "1" "90" "6" "129573393" "129573394" "del" "0" "00400" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000165972" "2" "90" "6" "129785433" "129785433" "subst" "1.62934E-5" "00400" "LAMA2_000036" "g.129785433A>C" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129464288A>C" "" "pathogenic (recessive)" "" "0000165973" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00400" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165974" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00400" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165975" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165976" "2" "90" "6" "129805906" "129810892" "del" "0" "00400" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2008:18700894}" "" "7750-1713_7899-2153del" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000165977" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00400" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000165978" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00400" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165979" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00400" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000165980" "1" "90" "6" "129824321" "129824328" "del" "0" "00400" "LAMA2_000280" "g.129824321_129824328del" "" "{PMID:Oliveira 2008:18700894}" "" "8443_8450delACAGTTCA" "" "Germline" "" "" "0" "" "" "g.129503176_129503183del" "" "pathogenic (recessive)" "" "0000165981" "2" "90" "6" "129824321" "129824328" "del" "0" "00400" "LAMA2_000280" "g.129824321_129824328del" "" "{PMID:Oliveira 2008:18700894}" "" "8443_8450delACAGTTCA" "" "Germline" "" "" "0" "" "" "g.129503176_129503183del" "" "pathogenic (recessive)" "" "0000165982" "11" "10" "6" "129635800" "129635800" "subst" "0.0648408" "00400" "LAMA2_000064" "g.129635800G>A" "" "{PMID:Yuan 2008:19294599}" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000165983" "11" "90" "6" "129835630" "129835633" "dup" "0" "00400" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Yuan 2008:19294599}" "" "9101_9104dupAACA" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000165984" "21" "10" "6" "129635800" "129635800" "subst" "0.0648408" "00400" "LAMA2_000064" "g.129635800G>A" "" "{PMID:Yuan 2008:19294599}" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000165985" "21" "90" "6" "129835630" "129835633" "dup" "0" "00400" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Yuan 2008:19294599}" "" "9101_9104dupAACA" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000165986" "0" "10" "6" "129498736" "129498736" "subst" "0" "00400" "LAMA2_000281" "g.129498736A>C" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129177591A>C" "" "benign" "" "0000165987" "0" "10" "6" "129511228" "129511228" "subst" "0" "00400" "LAMA2_000282" "g.129511228G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129190083G>A" "" "benign" "" "0000165988" "0" "10" "6" "129633974" "129633975" "del" "0" "00400" "LAMA2_000188" "g.129633974_129633975del" "12/50" "{PMID:Oliveira 2008:18700894}" "" "3175-32_3175-31delGT" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "benign" "" "0000165989" "0" "10" "6" "129635800" "129635800" "subst" "0.0648408" "00400" "LAMA2_000064" "g.129635800G>A" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000165990" "0" "10" "6" "129802664" "129802664" "subst" "0" "00400" "LAMA2_000284" "g.129802664C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129481519C>T" "" "benign" "" "0000165991" "0" "10" "6" "129802716" "129802716" "subst" "0" "00400" "LAMA2_000285" "g.129802716A>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129481571A>T" "" "benign" "" "0000165992" "0" "10" "6" "129807532" "129807532" "subst" "0" "00400" "LAMA2_000286" "g.129807532C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129486387C>T" "" "benign" "" "0000165993" "0" "10" "6" "129807945" "129807945" "subst" "0" "00400" "LAMA2_000287" "g.129807945C>T" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129486800C>T" "" "benign" "" "0000165994" "0" "10" "6" "129823611" "129823611" "subst" "0" "00400" "LAMA2_000288" "g.129823611T>C" "" "{PMID:Oliveira 2008:18700894}" "" "" "" "Germline" "" "" "0" "" "" "g.129502466T>C" "" "benign" "" "0000165995" "11" "90" "6" "0" "0" "" "0" "00006" "LAMA2_000411" "g.(129704379_129712635)[ins?]" "" "{PMID:Besse 2003:PMID12609503}" "" "" "mouse model; 6.1 Kb insertion (290 bp insertion intracisternal A-particle gene LTR in mRNA)" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000165997" "3" "90" "6" "129371197" "129371197" "subst" "0" "00006" "LAMA2_000413" "g.129371197T>C" "" "{PMID:Patton 2008:18430779}" "" "" "animal model" "Germline" "" "" "0" "" "" "g.129050052T>C" "" "pathogenic (recessive)" "" "0000165998" "1" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "{PMID:Louhichi 2006:19388593}, {PMID:Siala 2008:19072569}" "" "" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000165999" "2" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "{PMID:Louhichi 2006:19388593}, {PMID:Siala 2008:19072569}" "" "" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000166000" "1" "90" "6" "129465045" "129513999" "" "0" "00006" "LAMA2_000080" "g.(129419561_129465045)_(129513999_129571346)dup" "" "{PMID:Piluso 2011:21896784}" "" "g.(129503539_129507201)_(129573766_129593644)dup" "48.8 kb duplication (also described as dup ex5-10); unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000166001" "0" "10" "6" "129691132" "129691132" "subst" "0.0884706" "00006" "LAMA2_000091" "g.129691132C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129369987C>G" "" "benign" "" "0000166002" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "00006" "LAMA2_000067" "g.129807699G>C" "" "" "" "" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000166003" "11" "10" "6" "129766816" "129766816" "subst" "0.00079464" "00006" "LAMA2_000299" "g.129766816C>T" "" "" "" "(A2093A)" "lymphocyte mRNA allele not expressed" "Germline" "" "" "0" "" "" "g.129445671C>T" "" "benign" "" "0000166004" "21" "90" "6" "129551663" "129716081" "del" "0" "00006" "LAMA2_000257" "g.129551663_129716081del" "" "{PMID:Piluso 2011:21896784}" "" "g.(129555720_129612876)_(129756115_129764002)del" "164.4 Kb deletion" "Germline" "" "" "0" "" "" "g.129230518_129394936del" "" "pathogenic (recessive)" "" "0000166005" "1" "90" "6" "129468134" "129468134" "subst" "0" "00006" "LAMA2_000290" "g.129468134G>A" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129146989G>A" "" "pathogenic (recessive)" "" "0000166006" "2" "90" "6" "129468134" "129468134" "subst" "0" "00006" "LAMA2_000290" "g.129468134G>A" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129146989G>A" "" "pathogenic (recessive)" "" "0000166007" "1" "90" "6" "129465134" "129465134" "subst" "0" "00006" "LAMA2_000291" "g.129465134T>C" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129143989T>C" "" "pathogenic (recessive)" "" "0000166008" "2" "90" "6" "129687508" "129687508" "delins" "0" "00006" "LAMA2_000292" "g.129687508delinsGGCC" "" "{PMID:Gavassini 2011:21953594}" "" "4860+2T>G_4860+3insGCC" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129366363delinsGGCC" "" "pathogenic (recessive)" "" "0000166009" "1" "90" "6" "129465134" "129465134" "subst" "0" "00006" "LAMA2_000291" "g.129465134T>C" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129143989T>C" "" "pathogenic (recessive)" "" "0000166010" "2" "90" "6" "129687508" "129687508" "delins" "0" "00006" "LAMA2_000292" "g.129687508delinsGGCC" "" "{PMID:Gavassini 2011:21953594}" "" "4860+2T>G_4860+3insGCC" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129366363delinsGGCC" "" "pathogenic (recessive)" "" "0000166011" "1" "90" "6" "129419305" "129419319" "del" "0" "00006" "LAMA2_000294" "g.129419305_129419319del" "" "{PMID:Gavassini 2011:21953594}" "" "397-1_397-15del" "not in 100 control chromosomes; reports r.397_403del but no AG splice acceptor?" "Germline" "" "" "0" "" "" "g.129098160_129098174del" "" "pathogenic (recessive)" "" "0000166012" "2" "90" "6" "129794489" "129794489" "subst" "0.00212545" "00006" "LAMA2_000293" "g.129794489A>T" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129473344A>T" "" "pathogenic (recessive)" "" "0000166013" "1" "90" "6" "129419375" "129419375" "subst" "0" "00006" "LAMA2_000295" "g.129419375T>G" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129098230T>G" "" "pathogenic (recessive)" "" "0000166014" "2" "90" "6" "129419375" "129419375" "subst" "0" "00006" "LAMA2_000295" "g.129419375T>G" "" "{PMID:Gavassini 2011:21953594}" "" "" "not in 100 control chromosomes" "Germline" "" "" "0" "" "" "g.129098230T>G" "" "pathogenic (recessive)" "" "0000166015" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166016" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166017" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166018" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166019" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166020" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166021" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166022" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166023" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166024" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166025" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166026" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166027" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166028" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166029" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166030" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166031" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166032" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166033" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166034" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166035" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166036" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166037" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166038" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166039" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166040" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166041" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166042" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166043" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166044" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166045" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166046" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166047" "1" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166048" "1" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166049" "2" "90" "6" "129637097" "129637097" "subst" "0" "00006" "LAMA2_000032" "g.129637097T>C" "" "{PMID:DiBlasi 2011:22166137}" "" "" "shared haplotype" "Germline" "" "" "0" "" "" "g.129315952T>C" "" "pathogenic (recessive)" "" "0000166050" "2" "10" "6" "129762112" "129762112" "subst" "0.173011" "00006" "LAMA2_000052" "g.129762112G>A" "" "{PMID:DiBlasi 2011:22166137}" "" "G6286A" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166051" "1" "10" "6" "129571330" "129571330" "subst" "0.1735" "00006" "LAMA2_000016" "g.129571330G>A" "0.06" "{PMID:Pegoraro 1998:09674786}, {PMID:Tezak 2003:12552556}" "" "G1905A" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000166052" "11" "90" "6" "129465223" "129465223" "subst" "0" "00006" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Wang 2010:20140860}" "" "" "" "Germline" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "" "0000166053" "11" "90" "6" "129465223" "129465223" "subst" "0" "00006" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Wang 2010:20140860}" "" "" "" "Germline" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "" "0000166054" "1" "70" "6" "129637260" "129637260" "subst" "0" "00464" "LAMA2_000308" "g.129637260T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316115T>G" "" "likely pathogenic (recessive)" "" "0000166055" "2" "90" "6" "129802493" "129802493" "del" "0" "00464" "LAMA2_000062" "g.129802493del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481348del" "" "pathogenic (recessive)" "" "0000166056" "3" "50" "6" "129204502" "129204502" "subst" "0" "00464" "LAMA2_000309" "g.129204502G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883357G>A" "" "VUS" "" "0000166057" "3" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "ESHG2010 Hadj Salem P12.119, {PMID20477750:HadjSamen 2011}" "" "8005delT" "" "Germline" "yes" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000166062" "1" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "ESHG2010 Hadj Salem P12.119, {PMID20477750:HadjSamen 2011}" "" "8005delT" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000166064" "1" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "ESHG2010 Hadj Salem P12.119, {PMID:HadjSamen 2011:20477750}" "" "8005delT" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000166065" "1" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "{PMID:HadjSamen 2011:20477750}" "" "8005delT" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000166067" "1" "90" "6" "129813154" "129813154" "del" "0" "00426" "LAMA2_000140" "g.129813154del" "" "{PMID:HadjSamen 2011:20477750}" "" "8005delT" "" "Germline" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "" "0000166068" "1" "70" "6" "129608991" "129608991" "subst" "0" "00464" "LAMA2_000310" "g.129608991G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129287846G>A" "" "likely pathogenic (recessive)" "" "0000166069" "2" "70" "6" "129636802" "129636802" "subst" "0" "00464" "LAMA2_000311" "g.129636802T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315657T>A" "" "likely pathogenic (recessive)" "" "0000166070" "1" "90" "6" "129204392" "129204392" "subst" "0" "00464" "LAMA2_000003" "g.129204392T>C" "" "" "" "Met1Thr" "" "Germline" "" "" "0" "" "" "g.128883247T>C" "" "pathogenic (recessive)" "" "0000166071" "2" "70" "6" "129799959" "129799959" "subst" "0" "00464" "LAMA2_000312" "g.129799959G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129478814G>A" "" "likely pathogenic (recessive)" "" "0000166072" "1" "90" "6" "129802493" "129802493" "del" "0" "00464" "LAMA2_000062" "g.129802493del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481348del" "" "pathogenic (recessive)" "" "0000166073" "2" "50" "6" "129498870" "129498870" "subst" "0" "00464" "LAMA2_000203" "g.129498870T>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129177725T>G" "" "VUS" "" "0000166075" "0" "50" "6" "129204374" "129204374" "del" "0" "00430" "LAMA2_000314" "g.129204374del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.128883229del" "" "VUS" "" "0000166076" "0" "50" "6" "129204503" "129204503" "subst" "0" "00430" "LAMA2_000260" "g.129204503G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.128883358G>A" "" "VUS" "" "0000166077" "0" "10" "6" "129371106" "129371106" "subst" "0.0986835" "00430" "LAMA2_000153" "g.129371106C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs1140366" "0" "" "" "g.129049961C>T" "" "benign" "" "0000166078" "0" "50" "6" "129371134" "129371134" "subst" "0" "00430" "LAMA2_000315" "g.129371134G>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129049989G>T" "" "VUS" "" "0000166079" "0" "10" "6" "129381026" "129381026" "subst" "0.960856" "00430" "LAMA2_000110" "g.129381026C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129059881C>A" "" "benign" "" "0000166080" "0" "10" "6" "129419303" "129419303" "subst" "0.000296806" "00430" "LAMA2_000316" "g.129419303G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129098158G>A" "" "benign" "" "0000166081" "0" "50" "6" "129419454" "129419454" "subst" "7.31107E-5" "00430" "LAMA2_000317" "g.129419454C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129098309C>T" "" "VUS" "" "0000166082" "0" "10" "6" "129465020" "129465020" "subst" "0.193631" "00430" "LAMA2_000318" "g.129465020G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129143875G>A" "" "benign" "" "0000166083" "0" "50" "6" "129465081" "129465081" "subst" "0.000667714" "00430" "LAMA2_000319" "g.129465081C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129143936C>T" "" "VUS" "" "0000166084" "0" "50" "6" "129465119" "129465119" "subst" "0" "00430" "LAMA2_000320" "g.129465119C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129143974C>A" "" "VUS" "" "0000166085" "0" "50" "6" "129468114" "129468114" "subst" "8.1477E-6" "00430" "LAMA2_000321" "g.129468114C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129146969C>T" "" "VUS" "" "0000166086" "0" "90" "6" "129470153" "129470154" "del" "2.84474E-5" "00430" "LAMA2_000216" "g.129470153_129470154del" "" "from website {DBsub-Emory}" "" "939_940delAT" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "pathogenic (recessive)" "" "0000166087" "0" "10" "6" "129475839" "129475839" "subst" "0.00232884" "00430" "LAMA2_000269" "g.129475839C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129154694C>T" "" "benign" "" "0000166088" "0" "10" "6" "129498947" "129498947" "subst" "0.00144678" "00430" "LAMA2_000323" "g.129498947C>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129177802C>G" "" "benign" "" "0000166089" "0" "10" "6" "129511373" "129511373" "subst" "0.0319401" "00430" "LAMA2_000083" "g.129511373T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129190228T>C" "" "benign" "" "0000166090" "0" "10" "6" "129511415" "129511415" "subst" "0.00500008" "00430" "LAMA2_000324" "g.129511415T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129190270T>C" "" "benign" "" "0000166091" "0" "90" "6" "129513828" "129513828" "subst" "0" "00430" "LAMA2_000325" "g.129513828C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129192683C>T" "" "pathogenic (recessive)" "" "0000166092" "0" "50" "6" "129513917" "129513917" "subst" "0.00169336" "00430" "LAMA2_000326" "g.129513917C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129192772C>T" "" "VUS" "" "0000166093" "0" "10" "6" "129571272" "129571272" "subst" "0.0138918" "00430" "LAMA2_000090" "g.129571272G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129250127G>A" "" "benign" "" "0000166094" "0" "10" "6" "129571330" "129571330" "subst" "0.1735" "00430" "LAMA2_000016" "g.129571330G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000166095" "0" "90" "6" "129573393" "129573394" "del" "0" "00430" "LAMA2_000018" "g.129573393_129573394del" "" "from website {DBsub-Emory}" "" "2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000166096" "0" "50" "6" "129573428" "129573428" "subst" "2.03565E-5" "00430" "LAMA2_000327" "g.129573428A>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129252283A>T" "" "VUS" "" "0000166097" "0" "50" "6" "129581936" "129581936" "subst" "0" "00430" "LAMA2_000328" "g.129581936G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129260791G>A" "" "VUS" "" "0000166098" "0" "10" "6" "129609237" "129609237" "subst" "0.00891062" "00430" "LAMA2_000329" "g.129609237T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129288092T>C" "" "benign" "" "0000166099" "0" "10" "6" "129612765" "129612765" "subst" "0.0113137" "00430" "LAMA2_000088" "g.129612765G>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129291620G>T" "" "benign" "" "0000166100" "0" "10" "6" "129612808" "129612808" "subst" "0.269063" "00430" "LAMA2_000024" "g.129612808A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000166101" "0" "10" "6" "129618791" "129618791" "subst" "0.010987" "00430" "LAMA2_000330" "g.129618791T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129297646T>C" "" "benign" "" "0000166102" "0" "10" "6" "129619059" "129619059" "subst" "0.142546" "00430" "LAMA2_000218" "g.129619059G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129297914G>A" "" "benign" "" "0000166103" "0" "50" "6" "129621997" "129621997" "subst" "0.000125903" "00430" "LAMA2_000303" "g.129621997A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129300852A>G" "" "VUS" "" "0000166104" "0" "10" "6" "129622055" "129622055" "subst" "0.396641" "00430" "LAMA2_000164" "g.129622055A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs902373" "0" "" "" "g.129300910A>G" "" "benign" "" "0000166105" "0" "50" "6" "129633974" "129633975" "del" "0" "00430" "LAMA2_000188" "g.129633974_129633975del" "" "from website {DBsub-Emory}" "" "3175-32_3175-31delGT" "" "Germline" "" "" "0" "" "" "g.129312829_129312830del" "" "VUS" "" "0000166106" "0" "90" "6" "129634046" "129634046" "del" "0" "00430" "LAMA2_000109" "g.129634046del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129312901del" "" "pathogenic (recessive)" "" "0000166107" "0" "90" "6" "129634068" "129634068" "subst" "0" "00430" "LAMA2_000331" "g.129634068C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129312923C>A" "" "pathogenic (recessive)" "" "0000166108" "0" "10" "6" "129634255" "129634255" "subst" "0.220596" "00430" "LAMA2_000165" "g.129634255G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs3798663" "0" "" "" "g.129313110G>A" "" "benign" "" "0000166109" "0" "10" "6" "129635800" "129635800" "subst" "0.0648408" "00430" "LAMA2_000064" "g.129635800G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000166110" "0" "10" "6" "129636678" "129636678" "subst" "0.00309041" "00430" "LAMA2_000332" "g.129636678A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129315533A>G" "" "benign" "" "0000166111" "0" "50" "6" "129636688" "129636710" "del" "0" "00430" "LAMA2_000031" "g.129636688_129636710del" "" "from website {DBsub-Emory}" "" "3623_3645delAGGGCATTcTTTTTCAACATCCA" "del description contains error (c for G)" "Germline" "" "" "0" "" "" "g.129315543_129315565del" "" "VUS" "" "0000166112" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00430" "LAMA2_000033" "g.129637234C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000166113" "0" "50" "6" "129663469" "129663471" "del" "0" "00430" "LAMA2_000212" "g.129663469_129663471del" "" "from website {DBsub-Emory}" "" "4312-19_4312-17delTCT" "" "Germline" "" "" "0" "" "" "g.129342324_129342326del" "" "VUS" "" "0000166114" "0" "50" "6" "129670493" "129670493" "subst" "0.00370939" "00430" "LAMA2_000333" "g.129670493C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129349348C>T" "" "VUS" "" "0000166115" "0" "10" "6" "129670548" "129670548" "subst" "0.0888911" "00430" "LAMA2_000334" "g.129670548C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129349403C>T" "" "benign" "" "0000166116" "0" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00430" "LAMA2_000041" "g.129674430C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000166117" "0" "93" "6" "129687396" "129687396" "subst" "0.0195317" "00430" "LAMA2_000123" "g.129687396G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "pathogenic (recessive)" "" "0000166118" "0" "10" "6" "129691132" "129691132" "subst" "0.0884706" "00430" "LAMA2_000091" "g.129691132C>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129369987C>G" "" "benign" "" "0000166119" "0" "50" "6" "129704250" "129704250" "subst" "0" "00430" "LAMA2_000304" "g.129704250C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129383105C>A" "" "VUS" "" "0000166120" "0" "10" "6" "129704396" "129704396" "subst" "0.00569303" "00430" "LAMA2_000335" "g.129704396A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129383251A>G" "" "benign" "" "0000166121" "0" "50" "6" "129712630" "129712630" "del" "0" "00430" "LAMA2_000196" "g.129712630del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129391485del" "" "VUS" "" "0000166122" "0" "50" "6" "129714202" "129714202" "subst" "0.0006543" "00430" "LAMA2_000336" "g.129714202C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129393057C>T" "" "VUS" "" "0000166123" "0" "50" "6" "129714235" "129714235" "subst" "0.000659808" "00430" "LAMA2_000337" "g.129714235G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129393090G>A" "" "VUS" "" "0000166124" "0" "10" "6" "129722389" "129722389" "subst" "0.493666" "00430" "LAMA2_000045" "g.129722389A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129401244A>G" "" "benign" "" "0000166125" "0" "10" "6" "129722425" "129722425" "subst" "0.49225" "00430" "LAMA2_000048" "g.129722425G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs3749878" "0" "" "" "g.129401280G>A" "" "benign" "" "0000166126" "0" "10" "6" "129722453" "129722453" "subst" "0.0104121" "00430" "LAMA2_000092" "g.129722453C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "benign" "" "0000166127" "0" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00430" "LAMA2_000049" "g.129722490G>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000166128" "0" "50" "6" "129723520" "129723520" "subst" "2.03403E-5" "00430" "LAMA2_000338" "g.129723520G>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129402375G>T" "" "VUS" "" "0000166129" "0" "90" "6" "129723612" "129723618" "del" "8.13425E-6" "00430" "LAMA2_000339" "g.129723612_129723618del" "" "from website {DBsub-Emory}" "" "5706_5712delCTCATCT" "" "Germline" "" "" "0" "" "" "g.129402467_129402473del" "" "pathogenic (recessive)" "" "0000166130" "0" "10" "6" "129723671" "129723671" "subst" "0.0033931" "00430" "LAMA2_000340" "g.129723671T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129402526T>C" "" "benign" "" "0000166131" "0" "10" "6" "129724942" "129724945" "delins" "0" "00430" "LAMA2_000171" "g.129724942_129724945delinsACTG" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129403797_129403800delinsACTG" "" "benign" "" "0000166132" "0" "10" "6" "129724942" "129724942" "subst" "0.484869" "00430" "LAMA2_000341" "g.129724942T>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129403797T>A" "" "benign" "" "0000166133" "0" "10" "6" "129724944" "129724944" "subst" "0.485037" "00430" "LAMA2_000342" "g.129724944C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129403799C>T" "" "benign" "" "0000166134" "0" "10" "6" "129724945" "129724945" "subst" "0.485016" "00430" "LAMA2_000343" "g.129724945T>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129403800T>G" "" "benign" "" "0000166135" "0" "90" "6" "129748945" "129748945" "subst" "0" "00430" "LAMA2_000209" "g.129748945C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129427800C>T" "" "pathogenic (recessive)" "" "0000166136" "0" "10" "6" "129749027" "129749027" "subst" "0.0023762" "00430" "LAMA2_000344" "g.129749027T>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129427882T>A" "" "benign" "" "0000166137" "0" "50" "6" "129759833" "129759833" "del" "0" "00430" "LAMA2_000345" "g.129759833del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129438688del" "" "VUS" "" "0000166138" "0" "90" "6" "129759860" "129759860" "del" "0" "00430" "LAMA2_000346" "g.129759860del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129438715del" "" "pathogenic (recessive)" "" "0000166139" "0" "10" "6" "129761921" "129761921" "subst" "0.00653768" "00430" "LAMA2_000347" "g.129761921C>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129440776C>G" "" "benign" "" "0000166140" "0" "10" "6" "129762025" "129762025" "subst" "0.000883817" "00430" "LAMA2_000348" "g.129762025T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129440880T>C" "" "benign" "" "0000166141" "0" "10" "6" "129762042" "129762042" "subst" "0.006623" "00430" "LAMA2_000349" "g.129762042C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129440897C>A" "" "benign" "" "0000166142" "0" "10" "6" "129762109" "129762109" "subst" "0.00347587" "00430" "LAMA2_000350" "g.129762109A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129440964A>G" "" "benign" "" "0000166143" "0" "10" "6" "129762112" "129762112" "subst" "0.173011" "00430" "LAMA2_000052" "g.129762112G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs2297738" "0" "" "" "g.129440967G>A" "" "benign" "" "0000166144" "0" "10" "6" "129764217" "129764217" "subst" "0.00643176" "00430" "LAMA2_000351" "g.129764217C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129443072C>T" "" "benign" "" "0000166145" "0" "10" "6" "129764237" "129764237" "subst" "0.00198075" "00430" "LAMA2_000352" "g.129764237C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129443092C>T" "" "benign" "" "0000166146" "0" "10" "6" "129764260" "129764260" "subst" "0.00618476" "00430" "LAMA2_000353" "g.129764260A>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129443115A>T" "" "benign" "" "0000166147" "0" "50" "6" "129766859" "129766859" "subst" "7.74088E-5" "00430" "LAMA2_000354" "g.129766859C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129445714C>T" "" "VUS" "" "0000166148" "0" "90" "6" "129775343" "129775343" "del" "0" "00430" "LAMA2_000306" "g.129775343del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129454198del" "" "pathogenic (recessive)" "" "0000166149" "0" "90" "6" "129775416" "129775416" "subst" "0" "00430" "LAMA2_000275" "g.129775416C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129454271C>A" "" "pathogenic (recessive)" "" "0000166150" "0" "10" "6" "129775470" "129775470" "subst" "0.156879" "00430" "LAMA2_000174" "g.129775470T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs2297742" "0" "" "" "g.129454325T>C" "" "benign" "" "0000166151" "0" "50" "6" "129781432" "129781432" "subst" "1.63043E-5" "00430" "LAMA2_000056" "g.129781432C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "VUS" "" "0000166152" "0" "10" "6" "129785391" "129785391" "subst" "0.609286" "00430" "LAMA2_000177" "g.129785391T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs1414736" "0" "" "" "g.129464246T>C" "" "benign" "" "0000166153" "0" "50" "6" "129796515" "129796515" "del" "0" "00430" "LAMA2_000356" "g.129796515del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129475370del" "" "VUS" "" "0000166154" "0" "90" "6" "129799922" "129799922" "del" "0" "00430" "LAMA2_000357" "g.129799922del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "pathogenic (recessive)" "" "0000166155" "0" "50" "6" "129799958" "129799958" "subst" "0" "00430" "LAMA2_000358" "g.129799958G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129478813G>A" "" "VUS" "" "0000166156" "0" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00430" "LAMA2_000146" "g.129802567C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000166157" "0" "10" "6" "129807629" "129807629" "subst" "0" "00430" "LAMA2_000065" "g.129807629=" "" "from website {DBsub-Emory}" "" "7760C>T" "" "Germline" "" "rs2229848" "0" "" "" "g.129486484=" "" "benign" "" "0000166158" "0" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00430" "LAMA2_000066" "g.129807679C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "" "0000166159" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "00430" "LAMA2_000067" "g.129807699G>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs2229849" "0" "" "" "g.129486554G>C" "" "benign" "" "0000166160" "0" "10" "6" "129807714" "129807714" "subst" "0.303132" "00430" "LAMA2_000089" "g.129807714G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000166161" "0" "90" "6" "129807757" "129807757" "subst" "4.06851E-6" "00430" "LAMA2_000359" "g.129807757C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129486612C>T" "" "pathogenic (recessive)" "" "0000166162" "0" "10" "6" "129813053" "129813053" "subst" "0.0870047" "00430" "LAMA2_000069" "g.129813053A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129491908A>G" "" "benign" "" "0000166163" "0" "50" "6" "129813112" "129813112" "subst" "0.000191001" "00430" "LAMA2_000360" "g.129813112C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129491967C>A" "" "VUS" "" "0000166164" "0" "10" "6" "129813175" "129813175" "subst" "0.0120307" "00430" "LAMA2_000361" "g.129813175T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129492030T>C" "" "benign" "" "0000166165" "0" "10" "6" "129813508" "129813508" "subst" "0.00428874" "00430" "LAMA2_000129" "g.129813508T>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129492363T>A" "" "benign" "" "0000166166" "0" "90" "6" "129813631" "129813634" "del" "0" "00430" "LAMA2_000298" "g.129813631_129813634del" "" "from website {DBsub-Emory}" "" "8244+3_8244+6delAAGT" "" "Germline" "" "" "0" "" "" "g.129492486_129492489del" "" "pathogenic (recessive)" "" "0000166167" "0" "50" "6" "129823841" "129823841" "subst" "0.000191065" "00430" "LAMA2_000362" "g.129823841T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129502696T>C" "" "VUS" "" "0000166168" "0" "10" "6" "129824406" "129824406" "subst" "0.00551725" "00430" "LAMA2_000363" "g.129824406A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129503261A>G" "" "benign" "" "0000166169" "0" "30" "6" "129826335" "129826335" "subst" "0.00853019" "00430" "LAMA2_000364" "g.129826335T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129505190T>C" "" "likely benign" "" "0000166170" "0" "50" "6" "129826383" "129826383" "subst" "0.000711209" "00430" "LAMA2_000130" "g.129826383T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129505238T>C" "" "VUS" "" "0000166171" "0" "10" "6" "129826488" "129826488" "subst" "0.00399161" "00430" "LAMA2_000072" "g.129826488A>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs2228599" "0" "" "" "g.129505343A>G" "" "benign" "" "0000166172" "0" "90" "6" "129828678" "129828678" "del" "8.13266E-6" "00430" "LAMA2_000365" "g.129828678del" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129507533del" "" "pathogenic (recessive)" "" "0000166173" "0" "50" "6" "129828831" "129828831" "subst" "0.000309356" "00430" "LAMA2_000366" "g.129828831C>T" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129507686C>T" "" "VUS" "" "0000166174" "0" "50" "6" "129835746" "129835746" "subst" "0.000691467" "00430" "LAMA2_000272" "g.129835746T>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129514601T>C" "" "VUS" "" "0000166175" "0" "10" "6" "129835765" "129835765" "subst" "0.00075937" "00430" "LAMA2_000367" "g.129835765A>C" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129514620A>C" "" "benign" "" "0000166176" "0" "10" "6" "129837320" "129837320" "subst" "0.0233204" "00430" "LAMA2_000368" "g.129837320C>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129516175C>A" "" "benign" "" "0000166177" "0" "50" "6" "129837334" "129837334" "subst" "0" "00430" "LAMA2_000369" "g.129837334G>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129516189G>A" "" "VUS" "" "0000166178" "0" "50" "6" "129837375" "129837375" "subst" "0" "00430" "LAMA2_000370" "g.129837375C>G" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "" "0" "" "" "g.129516230C>G" "" "VUS" "" "0000166179" "1" "90" "6" "129470153" "129470154" "del" "2.84474E-5" "00464" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "pathogenic (recessive)" "" "0000166180" "2" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00464" "LAMA2_000146" "g.129802567C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000166181" "3" "50" "6" "129670529" "129670529" "subst" "4.06402E-6" "00464" "LAMA2_000277" "g.129670529G>A" "" "" "" "" "c.4523G is adjacent to intron 31 splice donor site" "Germline" "" "" "0" "" "" "g.129349384G>A" "" "VUS" "" "0000166182" "1" "50" "6" "129511429" "129511429" "subst" "0" "00464" "LAMA2_000371" "g.129511429A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129190284A>G" "" "VUS" "" "0000166183" "2" "70" "6" "129828678" "129828678" "del" "8.13266E-6" "00464" "LAMA2_000365" "g.129828678del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129507533del" "" "likely pathogenic (recessive)" "" "0000166184" "1" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00464" "LAMA2_000152" "g.129381008C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "" "0000166185" "2" "90" "6" "129712696" "129712696" "del" "0" "00464" "LAMA2_000373" "g.129712696del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129391551del" "" "pathogenic (recessive)" "" "0000166186" "1" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000166187" "2" "90" "6" "129649444" "129649444" "subst" "4.06352E-6" "00464" "LAMA2_000219" "g.129649444C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "pathogenic (recessive)" "" "0000166188" "3" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00464" "LAMA2_000066" "g.129807679C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "" "0000166189" "3" "90" "6" "129618848" "129618848" "subst" "0" "00464" "LAMA2_000374" "g.129618848C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129297703C>T" "" "pathogenic (recessive)" "" "0000166190" "1" "90" "6" "129371234" "129371234" "subst" "1.21842E-5" "00464" "LAMA2_000261" "g.129371234G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>A" "" "pathogenic (recessive)" "" "0000166191" "2" "90" "6" "129649507" "129649507" "subst" "0" "00464" "LAMA2_000375" "g.129649507C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129328362C>T" "" "pathogenic (recessive)" "" "0000166192" "1" "90" "6" "129573393" "129573394" "del" "0" "00464" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000166193" "2" "90" "6" "129637307" "129637307" "del" "0" "00464" "LAMA2_000243" "g.129637307del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129316162del" "" "pathogenic (recessive)" "" "0000166194" "0" "90" "6" "129204503" "129204503" "subst" "0" "00527" "LAMA2_000260" "g.129204503G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.128883358G>A" "" "pathogenic (recessive)" "" "0000166195" "0" "70" "6" "129419445" "129419455" "dup" "0" "00527" "LAMA2_000377" "g.129419445_129419455dup" "" "" "" "524_534dupAGTGCCTAACG" "" "Germline" "" "" "0" "" "" "g.129098300_129098310dup" "" "likely pathogenic (recessive)" "" "0000166196" "3" "70" "6" "129807731" "129807731" "subst" "0" "01953" "LAMA2_000378" "g.129807731G>T" "" "{PMID:Turner 2015:26249246}" "" "" "6/8 protein analysis programmes predict p.Gly2621Val as likely be disease-causing; 2/3 transcript analysis programmes suggested the variant could create a splice donor site and hence would give rise to a mis-spliced transcript (c.7861_7898del; p.(Gly2621Hisfs*8))" "Germline" "" "" "0" "" "" "g.129486586G>T" "" "likely pathogenic (recessive)" "" "0000166197" "0" "70" "6" "129802526" "129802526" "subst" "0" "01700" "LAMA2_000063" "g.129802526T>C" "" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline" "" "" "0" "" "" "g.129481381T>C" "" "likely pathogenic (recessive)" "" "0000166198" "0" "70" "6" "129837376" "129837376" "subst" "4.06461E-6" "01700" "LAMA2_000078" "g.129837376C>T" "" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline" "" "" "0" "" "" "g.129516231C>T" "" "likely pathogenic (recessive)" "" "0000166199" "1" "70" "6" "129826462" "129826462" "subst" "0" "01715" "LAMA2_000222" "g.129826462G>A" "" "{PMID:Fattahi 2017:27234031}" "" "" "" "Germline" "" "" "0" "" "" "g.129505317G>A" "" "likely pathogenic (recessive)" "" "0000166200" "3" "70" "6" "129774131" "129774131" "subst" "0" "01715" "LAMA2_000380" "g.129774131A>G" "" "{PMID:Fattahi 2017:27234031}" "" "" "" "Germline" "" "" "0" "" "" "g.129452986A>G" "" "likely pathogenic (recessive)" "" "0000166254" "0" "90" "6" "129588623" "129593933" "del" "0" "00503" "LAMA2_000395" "g.129588623_129593933del" "" "{PMID:Oliveira 2014:27858771}" "" "" "" "Germline" "?" "" "0" "" "" "g.129267478_129272788del" "" "pathogenic (recessive)" "" "0000166255" "3" "90" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000166256" "3" "70" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000166257" "1" "90" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2014:27858771}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000166258" "2" "70" "6" "129380928" "129486821" "del" "0" "00503" "LAMA2_000396" "g.(129371234_129380928)_(129486821_129498850)del" "" "{PMID:Oliveira 2014:27858771}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000166259" "2" "90" "6" "129641682" "129649558" "dup" "0" "00503" "LAMA2_000397" "g.(129637317_129641682)_(129649558_129663487)dup" "" "{PMID:Oliveira 2014:27858771}" "" "" "" "Germline" "?" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000166260" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166261" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00503" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000166262" "3" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166263" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166264" "2" "70" "6" "129634066" "129634066" "subst" "0" "00503" "LAMA2_000398" "g.129634066T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129312921T>G" "" "pathogenic (recessive)" "" "0000166265" "3" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166266" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166267" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166268" "2" "90" "6" "129826410" "129826410" "dup" "0" "00503" "LAMA2_000194" "g.129826410dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129505265dup" "" "pathogenic (recessive)" "" "0000166269" "2" "90" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000166270" "3" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "" "0000166271" "1" "50" "6" "129777479" "129777479" "subst" "0" "00503" "LAMA2_000399" "g.129777479G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129456334G>T" "" "likely pathogenic (recessive)" "" "0000166272" "0" "50" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000166273" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000166274" "0" "90" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000166275" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000166276" "0" "90" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000166277" "0" "90" "6" "129634066" "129634066" "subst" "0" "00503" "LAMA2_000398" "g.129634066T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129312921T>G" "" "likely pathogenic (recessive)" "" "0000166278" "0" "90" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000166279" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000166280" "0" "90" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000166281" "1" "70" "6" "129465218" "129465218" "subst" "0" "00503" "LAMA2_000400" "g.129465218C>T" "0/300 control chromosomes" "{PMID:Marques 2014:24534542}" "" "" "" "Germline" "" "" "0" "" "" "g.129144073C>T" "" "likely pathogenic (recessive)" "" "0000166282" "2" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Marques 2014:24534542}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000166284" "1" "90" "6" "129833639" "129833639" "subst" "0" "00503" "LAMA2_000244" "g.129833639G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129512494G>A" "" "pathogenic (recessive)" "" "0000166285" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00503" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000166286" "1" "09" "6" "129381008" "129381008" "subst" "8.12552E-6" "00503" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "" "0000166287" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00503" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000166288" "1" "50" "6" "129381042" "129381042" "subst" "2.44095E-5" "00503" "LAMA2_000210" "g.129381042G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129059897G>T" "" "likely pathogenic (recessive)" "" "0000166289" "2" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00503" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000166290" "1" "90" "6" "129419418" "129419418" "subst" "4.06118E-6" "00503" "LAMA2_000401" "g.129419418G>A" "" "{PMID:Oliveira 2014:27858771}" "" "" "" "Germline" "" "" "0" "" "" "g.129098273G>A" "" "pathogenic (recessive)" "" "0000166291" "2" "70" "6" "129376244" "129419170" "delins" "0" "00503" "LAMA2_000402" "g.129376244_129419170delinsA" "" "{PMID:Oliveira 2014:27858771}" "" "c.284-4685_397-146delinsATA" "" "Germline" "" "" "0" "" "" "g.129055099_129098025delinsA" "" "likely pathogenic (recessive)" "" "0000166292" "3" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000166293" "0" "70" "6" "129465227" "129465227" "subst" "0" "00503" "LAMA2_000403" "g.129465227T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129144082T>C" "" "likely pathogenic (recessive)" "" "0000166294" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000166295" "0" "70" "6" "129465227" "129465227" "subst" "0" "00503" "LAMA2_000403" "g.129465227T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129144082T>C" "" "likely pathogenic (recessive)" "" "0000166296" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000166297" "0" "70" "6" "129826353" "129826355" "del" "0" "00503" "LAMA2_000404" "g.129826353_129826355del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129505208_129505210del" "" "likely pathogenic (recessive)" "" "0000166298" "0" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00503" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000167010" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "0/300 control chromosomes" "{PMID:Marques 2014:24534542 }" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000167011" "0" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00503" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Marques 2014:24534542}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "" "0000167012" "0" "90" "6" "129635908" "129635908" "subst" "0" "00503" "LAMA2_000405" "g.129635908C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129314763C>T" "" "pathogenic (recessive)" "" "0000167013" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000167014" "3" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000167015" "3" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000167017" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000167018" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000167019" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000167092" "0" "90" "6" "129714218" "129714218" "subst" "0" "00503" "LAMA2_000406" "g.129714218A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129393073A>T" "" "pathogenic (recessive)" "" "0000167095" "0" "90" "6" "129774204" "129774204" "subst" "0" "00503" "LAMA2_000407" "g.129774204C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129453059C>G" "" "pathogenic (recessive)" "" "0000167096" "0" "70" "6" "129591900" "129591900" "subst" "0" "00503" "LAMA2_000408" "g.129591900A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129270755A>G" "" "likely pathogenic (recessive)" "" "0000167097" "0" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00503" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "" "0000167098" "3" "90" "6" "129781456" "129781456" "subst" "0" "00503" "LAMA2_000409" "g.129781456G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129460311G>T" "" "pathogenic (recessive)" "" "0000167101" "3" "90" "6" "129799876" "129799879" "dup" "0" "00503" "LAMA2_000005" "g.129799876_129799879dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129478731_129478734dup" "" "pathogenic (recessive)" "" "0000167128" "0" "90" "6" "129591796" "129591796" "dup" "0" "00503" "LAMA2_000410" "g.129591796dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129270651dup" "" "pathogenic (recessive)" "" "0000167129" "0" "90" "6" "129674477" "129674480" "dup" "0" "00503" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "pathogenic (recessive)" "" "0000167130" "1" "70" "6" "129465227" "129465227" "subst" "0" "00503" "LAMA2_000403" "g.129465227T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129144082T>C" "" "likely pathogenic (recessive)" "" "0000167131" "2" "90" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000167134" "2" "70" "6" "129774131" "129774131" "subst" "0" "01715" "LAMA2_000380" "g.129774131A>G" "" "{PMID:Fattahi 2017:27234031}" "" "" "" "Germline" "" "" "0" "" "" "g.129452986A>G" "" "likely pathogenic (recessive)" "" "0000167146" "0" "70" "6" "129475744" "129475744" "del" "0" "00503" "LAMA2_000414" "g.129475744del" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129154599del" "" "pathogenic (recessive)" "" "0000167147" "0" "90" "6" "129609204" "129609204" "subst" "4.06967E-6" "00503" "LAMA2_000186" "g.129609204G>A" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129288059G>A" "" "pathogenic (recessive)" "" "0000167148" "0" "90" "6" "129468114" "129468114" "subst" "8.1477E-6" "00503" "LAMA2_000321" "g.129468114C>T" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129146969C>T" "" "pathogenic (recessive)" "" "0000167149" "0" "90" "6" "129785579" "129785579" "subst" "0" "00503" "LAMA2_000415" "g.129785579T>A" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129464434T>A" "" "pathogenic (recessive)" "" "0000167150" "0" "90" "6" "129649444" "129649444" "subst" "4.06352E-6" "00503" "LAMA2_000219" "g.129649444C>T" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "pathogenic (recessive)" "" "0000167151" "0" "90" "6" "129824419" "129824419" "subst" "0" "00503" "LAMA2_000416" "g.129824419G>A" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129503274G>A" "" "pathogenic (recessive)" "" "0000167152" "3" "70" "6" "129573433" "129573433" "subst" "0" "00503" "LAMA2_000417" "g.129573433A>G" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129252288A>G" "" "likely pathogenic (recessive)" "" "0000167153" "3" "30" "6" "129687396" "129687396" "subst" "0.0195317" "00503" "LAMA2_000123" "g.129687396G>A" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000167160" "3" "90" "6" "129634219" "129634240" "dup" "0" "00503" "LAMA2_000418" "g.129634219_129634240dup" "" "{PMID: Beytía 2013:24225367}" "" "3388_4409dup (Gln1130*1)" "variant description uncertain" "Germline" "" "" "0" "" "" "g.129313074_129313095dup" "" "pathogenic" "" "0000167161" "0" "90" "6" "129475744" "129475744" "del" "0" "00503" "LAMA2_000414" "g.129475744del" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129154599del" "" "pathogenic (recessive)" "" "0000167162" "0" "90" "6" "129823802" "129823802" "subst" "0" "00503" "LAMA2_000204" "g.129823802A>G" "" "{PMID: Beytía 2013:24225367}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "pathogenic (recessive)" "" "0000167164" "0" "90" "6" "129824419" "129824419" "subst" "0" "00503" "LAMA2_000416" "g.129824419G>A" "" "{PMID: Beytía 2013:24225367}" "" "" "unknown variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129503274G>A" "" "pathogenic (recessive)" "" "0000167166" "3" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00503" "LAMA2_000082" "g.129785589C>T" "" "{PMID:He 2013:24223650}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "" "0000167168" "0" "70" "6" "129621997" "129621997" "subst" "0.000125903" "00503" "LAMA2_000303" "g.129621997A>G" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "?" "" "0" "" "" "g.129300852A>G" "" "pathogenic (recessive)" "" "0000167169" "0" "90" "6" "129775343" "129775343" "del" "0" "00503" "LAMA2_000306" "g.129775343del" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "" "" "0" "" "" "g.129454198del" "" "pathogenic (recessive)" "" "0000167171" "0" "90" "6" "129465058" "129465059" "del" "0" "00503" "LAMA2_000419" "g.129465058_129465059del" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "" "" "0" "" "" "g.129143913_129143914del" "" "pathogenic (recessive)" "" "0000167172" "0" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00503" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000167173" "3" "90" "6" "129511462" "129511462" "subst" "0" "00503" "LAMA2_000132" "g.129511462G>A" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "" "" "0" "" "" "g.129190317G>A" "" "pathogenic (recessive)" "" "0000167181" "0" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00503" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000167182" "0" "90" "6" "129511462" "129511462" "subst" "0" "00503" "LAMA2_000132" "g.129511462G>A" "" "{PMID:Valencia 2013:23326386}" "" "" "" "Germline" "" "" "0" "" "" "g.129190317G>A" "" "pathogenic (recessive)" "" "0000167183" "1" "90" "6" "129670522" "129670522" "subst" "0" "00503" "LAMA2_000420" "g.129670522T>A" "" "{PMID:Kevelam 2014:2437385}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129349377T>A" "" "pathogenic (recessive)" "" "0000167184" "2" "90" "6" "129774169" "129774169" "subst" "0" "00503" "LAMA2_000421" "g.129774169C>T" "" "{PMID:Kevelam 2014:2437385}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129453024C>T" "" "pathogenic (recessive)" "" "0000167185" "1" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00503" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Reddy 2017:27708273}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000167186" "2" "90" "6" "129826501" "129826501" "subst" "0" "00503" "LAMA2_000422" "g.129826501G>A" "" "{PMID:Reddy 2017:27708273}" "" "" "" "Germline" "" "" "0" "" "" "g.129505356G>A" "" "pathogenic (recessive)" "" "0000167187" "1" "00" "6" "129588259" "129588259" "subst" "0.00100105" "00503" "LAMA2_000423" "g.129588259G>T" "" "{PMID:Wang 2016:27353517}, {dbSNP:rs192317605}" "" "" "" "Germline" "" "" "0" "" "" "g.129267114G>T" "" "" "" "0000167188" "2" "70" "6" "129674425" "129674425" "subst" "3.65678E-5" "00503" "LAMA2_000424" "g.129674425C>T" "" "{PMID:Wang 2016:27353517}, {dbSNP:rs778106503}" "" "" "" "Germline" "" "" "0" "" "" "g.129353280C>T" "" "likely pathogenic (recessive)" "" "0000167189" "21" "90" "6" "129419545" "129419545" "del" "0" "00503" "LAMA2_000425" "g.129419545del" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129098400del" "" "pathogenic (recessive)" "" "0000167190" "11" "90" "6" "129588248" "129588249" "del" "0" "00503" "LAMA2_000426" "g.129588248_129588249del" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129267103_129267104del" "" "pathogenic (recessive)" "" "0000167191" "21" "90" "6" "129826451" "129826451" "subst" "0" "00503" "LAMA2_000427" "g.129826451T>C" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129505306T>C" "" "pathogenic (recessive)" "" "0000167192" "11" "90" "6" "129618918" "129618918" "dup" "0" "00503" "LAMA2_000428" "g.129618918dup" "" "{PMID:Liang 2017:28182637}" "" "c.2945insG" "" "Germline" "" "" "0" "" "" "g.129297773dup" "" "pathogenic (recessive)" "" "0000167193" "11" "90" "6" "129618918" "129618918" "dup" "0" "00503" "LAMA2_000428" "g.129618918dup" "" "{PMID:Liang 2017:28182637}" "" "c.2945insG" "" "Germline" "" "" "0" "" "" "g.129297773dup" "" "pathogenic (recessive)" "" "0000167194" "21" "90" "6" "129826451" "129826451" "subst" "0" "00503" "LAMA2_000427" "g.129826451T>C" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129505306T>C" "" "pathogenic (recessive)" "" "0000167195" "21" "90" "6" "129774216" "129774218" "del" "0" "00503" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "" "0000167196" "11" "90" "6" "129649557" "129649557" "subst" "0" "00503" "LAMA2_000430" "g.129649557G>A" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129328412G>A" "" "pathogenic (recessive)" "" "0000167197" "21" "95" "6" "129835506" "129835506" "subst" "0.00046042" "00503" "LAMA2_000431" "g.129835506C>G" "" "{PMID:Liang 2017:28182637}, {dbSNP:rs144860334}, {CV:RCV000248588.1}}" "" "" "" "Germline" "" "" "0" "" "" "g.129514361C>G" "" "pathogenic (recessive)" "" "0000167198" "11" "90" "6" "129601200" "129601200" "subst" "1.21937E-5" "00503" "LAMA2_000432" "g.129601200A>G" "" "{PMID:Liang 2017:28182637}" "" "c.2451+6A>G" "" "Somatic" "" "" "0" "" "" "g.129280055A>G" "" "pathogenic (recessive)" "" "0000167199" "11" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000167200" "0" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "00503" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Liang 2017:28182637}" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "" "0000167201" "3" "90" "6" "129687417" "129687417" "subst" "0" "00503" "LAMA2_000433" "g.129687417C>T" "" "{PMID: Komulainen 2015: 25940035}" "" "" "" "Germline" "" "" "0" "" "" "g.129366272C>T" "" "pathogenic (recessive)" "" "0000167202" "11" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Yang 2015:25544356}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000167203" "21" "90" "6" "129465045" "129465226" "" "0" "00503" "LAMA2_000434" "g.(129419561_129465045)_(129465226_129468103)del" "" "{PMID:Yang 2015:25544356}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000167204" "21" "90" "6" "129465045" "129465226" "" "0" "00503" "LAMA2_000434" "g.(129419561_129465045)_(129465226_129468103)del" "" "{PMID:Yang 2015:25544356}" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000167205" "11" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Yang 2015:25544356}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000167206" "3" "90" "6" "129663573" "129663573" "subst" "0" "00503" "LAMA2_000435" "g.129663573G>A" "" "{PMID: Camacho 2015: 25500573}" "" "" "" "Germline" "" "" "0" "" "" "g.129342428G>A" "" "pathogenic (recessive)" "" "0000167219" "21" "90" "6" "129381036" "129381036" "subst" "0" "00503" "LAMA2_000262" "g.129381036C>T" "" "Chan 2014" "" "" "" "Germline" "" "" "0" "" "" "g.129059891C>T" "" "pathogenic (recessive)" "" "0000167220" "11" "50" "6" "129419516" "129419516" "subst" "4.0619E-6" "00503" "LAMA2_000438" "g.129419516T>A" "" "Chan 2014" "" "" "" "Germline" "" "" "0" "" "" "g.129098371T>A" "" "VUS" "" "0000167221" "11" "75" "6" "129670493" "129670493" "subst" "0.00370939" "00503" "LAMA2_000333" "g.129670493C>T" "" "Chan 2014" "" "" "" "Germline" "" "" "0" "" "" "g.129349348C>T" "" "likely pathogenic (recessive)" "" "0000168324" "21" "90" "6" "129663581" "129663581" "subst" "0" "00503" "LAMA2_000439" "g.129663581T>C" "" "{PMID:Di Blasi 2000: 10852549}" "" "" "not in 200 control chromosomes tested" "Germline" "" "" "0" "" "" "g.129342436T>C" "" "pathogenic (recessive)" "" "0000168325" "11" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00503" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Di Blasi 2000: 10852549}" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "" "0000168326" "3" "90" "6" "129691112" "129691112" "subst" "0" "00503" "LAMA2_000440" "g.129691112G>T" "" "{PMID:Nelson 2015: 27858741}" "" "" "" "Germline" "" "" "0" "" "" "g.129369967G>T" "" "pathogenic (recessive)" "" "0000168327" "3" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00503" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Nelson 2015: 27858741}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000168461" "11" "90" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Nelson 2015: 27858741}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000168462" "21" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Nelson 2015: 27858741}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000168463" "11" "90" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Nelson 2015: 27858741}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000168464" "21" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Nelson 2015: 27858741}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000168697" "0" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000168698" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000168699" "0" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000168700" "0" "90" "6" "129714215" "129714215" "del" "1.63239E-5" "00503" "LAMA2_000441" "g.129714215del" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129393070del" "" "pathogenic (recessive)" "" "0000168701" "0" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00503" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000168702" "0" "90" "6" "129470244" "129470244" "subst" "4.07083E-6" "00503" "LAMA2_000245" "g.129470244A>G" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129149099A>G" "" "pathogenic (recessive)" "" "0000168703" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000168704" "0" "90" "6" "129670530" "129670530" "subst" "0" "00503" "LAMA2_000442" "g.129670530G>A" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129349385G>A" "" "pathogenic (recessive)" "" "0000168705" "3" "90" "6" "129618935" "129618935" "subst" "0" "00503" "LAMA2_000027" "g.129618935C>T" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129297790C>T" "" "pathogenic (recessive)" "" "0000168706" "3" "90" "6" "129419375" "129419375" "subst" "0" "00503" "LAMA2_000295" "g.129419375T>G" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129098230T>G" "" "pathogenic (recessive)" "" "0000168707" "0" "90" "6" "129204425" "129204425" "subst" "0" "00503" "LAMA2_000190" "g.129204425T>G" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.128883280T>G" "" "pathogenic (recessive)" "" "0000168708" "0" "90" "6" "129636929" "129636929" "subst" "0" "00503" "LAMA2_000443" "g.129636929T>G" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129315784T>G" "" "pathogenic (recessive)" "" "0000168709" "0" "90" "6" "129794489" "129794489" "subst" "0.00212545" "00503" "LAMA2_000293" "g.129794489A>T" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129473344A>T" "" "pathogenic (recessive)" "" "0000168710" "0" "90" "6" "129419305" "129419319" "del" "0" "00503" "LAMA2_000294" "g.129419305_129419319del" "" "{PMID:Løkken 2015: 25663498}" "" "" "" "Germline" "" "" "0" "" "" "g.129098160_129098174del" "" "pathogenic (recessive)" "" "0000168741" "11" "90" "6" "129762145" "129762145" "subst" "0" "00503" "LAMA2_000444" "g.129762145T>C" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129441000T>C" "" "pathogenic (recessive)" "" "0000168742" "21" "90" "6" "129712720" "129712723" "del" "0" "00503" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "" "0000168743" "0" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00503" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "" "0000168744" "0" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00503" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "" "0000168745" "11" "90" "6" "129823803" "129833639" "del" "0" "00503" "LAMA2_000446" "g.(129813629_129823803)_(129833639_129835517)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168746" "21" "90" "6" "129381008" "129381008" "subst" "0" "00503" "LAMA2_000447" "g.129381008C>G" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129059863C>G" "" "pathogenic (recessive)" "" "0000168747" "3" "90" "6" "129465223" "129465223" "subst" "0" "00503" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "" "0000168748" "11" "90" "6" "129498850" "129513999" "" "0" "00503" "LAMA2_000448" "g.(129486821_129498850)_(129513999_129571256)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168749" "21" "90" "6" "129835630" "129835633" "dup" "0" "00503" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "" "0000168750" "11" "90" "6" "129419403" "129419406" "dup" "0" "00503" "LAMA2_000449" "g.129419403_129419406dup" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129098258_129098261dup" "" "pathogenic (recessive)" "" "0000168751" "21" "90" "6" "129748896" "129777640" "del" "0" "00503" "LAMA2_000450" "g.(129725105_129748896)_(129777640_129781344)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168752" "11" "90" "6" "129371233" "129371233" "subst" "0" "00503" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "" "0000168753" "21" "90" "6" "129813068" "129813068" "subst" "0" "00503" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "" "0000168754" "11" "90" "6" "129833637" "129833637" "del" "0" "00503" "LAMA2_000452" "g.129833637del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129512492del" "" "pathogenic (recessive)" "" "0000168755" "21" "90" "6" "129621939" "129621939" "subst" "0" "00503" "LAMA2_000453" "g.129621939C>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129300794C>A" "" "pathogenic (recessive)" "" "0000168756" "11" "90" "6" "129419317" "129419561" "" "0" "00503" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168757" "21" "90" "6" "129609019" "129609019" "del" "0" "00503" "LAMA2_000455" "g.129609019del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129287874del" "" "pathogenic (recessive)" "" "0000168758" "11" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000168759" "21" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00503" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "" "0000168760" "11" "90" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000168761" "21" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00503" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "" "0000168762" "11" "90" "6" "129774216" "129774218" "del" "0" "00503" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "" "0000168763" "21" "90" "6" "129637317" "129637317" "subst" "0" "00503" "LAMA2_000456" "g.129637317G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316172G>A" "" "pathogenic (recessive)" "" "0000168764" "21" "90" "6" "129618932" "129618932" "dup" "0" "00503" "LAMA2_000457" "g.129618932dup" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129297787dup" "" "pathogenic (recessive)" "" "0000168765" "11" "90" "6" "129824233" "129824233" "subst" "0" "00503" "LAMA2_000458" "g.129824233C>G" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129503088C>G" "" "pathogenic (recessive)" "" "0000168766" "21" "90" "6" "129637213" "129637213" "subst" "0" "00503" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "" "0000168767" "11" "90" "6" "129419317" "129419561" "" "0" "00503" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168768" "11" "90" "6" "129371062" "129381042" "del" "0" "00503" "LAMA2_000460" "g.(129204503_129371062)_(129381042_129419317)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168769" "21" "90" "6" "129704379" "129704379" "subst" "4.1587E-6" "00503" "LAMA2_000461" "g.129704379G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129383234G>A" "" "pathogenic (recessive)" "" "0000168770" "11" "90" "6" "129371062" "129381042" "del" "0" "00503" "LAMA2_000460" "g.(129204503_129371062)_(129381042_129419317)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168771" "21" "90" "6" "129704379" "129704379" "subst" "4.1587E-6" "00503" "LAMA2_000461" "g.129704379G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129383234G>A" "" "pathogenic (recessive)" "" "0000168833" "3" "90" "6" "129419317" "129419561" "" "0" "00503" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168834" "3" "90" "6" "129419317" "129419561" "" "0" "00503" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168835" "11" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00503" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000168836" "21" "90" "6" "129833507" "129833639" "" "0" "00503" "LAMA2_000462" "g.(129828788_129833507)_(129833639_129835517)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168837" "11" "90" "6" "129637317" "129637317" "subst" "0" "00503" "LAMA2_000456" "g.129637317G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316172G>A" "" "pathogenic (recessive)" "" "0000168838" "21" "90" "6" "129380974" "129380974" "subst" "4.0622E-6" "00503" "LAMA2_000463" "g.129380974G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129059829G>A" "" "pathogenic (recessive)" "" "0000168839" "11" "90" "6" "129634114" "129634114" "subst" "0" "00503" "LAMA2_000464" "g.129634114C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129312969C>T" "" "pathogenic (recessive)" "" "0000168840" "21" "90" "6" "129470123" "129470123" "subst" "0" "00503" "LAMA2_000231" "g.129470123G>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "pathogenic (recessive)" "" "0000168841" "11" "90" "6" "129475775" "129475776" "del" "0" "00503" "LAMA2_000465" "g.129475775_129475776del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129154630_129154631del" "" "pathogenic (recessive)" "" "0000168842" "21" "90" "6" "129823823" "129823823" "subst" "0" "00503" "LAMA2_000466" "g.129823823C>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129502678C>A" "" "pathogenic (recessive)" "" "0000168843" "3" "90" "6" "129465045" "129465045" "subst" "0" "00503" "LAMA2_000467" "g.129465045G>C" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129143900G>C" "" "pathogenic (recessive)" "" "0000168844" "3" "90" "6" "129601217" "129601217" "subst" "0.0019305" "00503" "LAMA2_000468" "g.129601217C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129280072C>T" "" "pathogenic (recessive)" "" "0000168845" "3" "90" "6" "129601217" "129601217" "subst" "0.0019305" "00503" "LAMA2_000468" "g.129601217C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129280072C>T" "" "pathogenic (recessive)" "" "0000168846" "11" "90" "6" "129785433" "129785433" "subst" "0" "00503" "LAMA2_000469" "g.129785433A>G" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129464288A>G" "" "pathogenic (recessive)" "" "0000168847" "21" "90" "6" "129807767" "129807767" "subst" "0" "00503" "LAMA2_000470" "g.129807767G>C" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129486622G>C" "" "pathogenic (recessive)" "" "0000168848" "11" "90" "6" "129573320" "129573320" "subst" "0" "00503" "LAMA2_000220" "g.129573320C>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129252175C>A" "" "pathogenic (recessive)" "" "0000168849" "21" "90" "6" "129813068" "129813068" "subst" "0" "00503" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "" "0000168850" "11" "90" "6" "129637189" "129637189" "subst" "0" "00503" "LAMA2_000471" "g.129637189T>G" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316044T>G" "" "pathogenic (recessive)" "" "0000168851" "21" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "00503" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "" "0000168868" "3" "90" "6" "129637213" "129637213" "subst" "0" "00503" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "" "0000168870" "11" "90" "6" "129618931" "129618931" "subst" "0" "00503" "LAMA2_000472" "g.129618931G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129297786G>A" "" "pathogenic (recessive)" "" "0000168871" "21" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00503" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000168872" "0" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00503" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "" "0000168873" "0" "90" "6" "129371234" "129371234" "subst" "0" "00503" "LAMA2_000473" "g.129371234G>C" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129050089G>C" "" "pathogenic (recessive)" "" "0000168874" "0" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00503" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "" "0000168875" "0" "90" "6" "129371234" "129371234" "subst" "0" "00503" "LAMA2_000473" "g.129371234G>C" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129050089G>C" "" "pathogenic (recessive)" "" "0000168876" "11" "90" "6" "129511435" "129511435" "subst" "0" "00503" "LAMA2_000474" "g.129511435G>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129190290G>A" "" "pathogenic (recessive)" "" "0000168877" "21" "90" "6" "129712720" "129712723" "del" "0" "00503" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "" "0000168878" "11" "90" "6" "129636608" "129636608" "subst" "2.03074E-5" "00503" "LAMA2_000475" "g.129636608T>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129315463T>A" "" "pathogenic (recessive)" "" "0000168879" "21" "90" "6" "129691062" "129691062" "del" "0" "00503" "LAMA2_000476" "g.129691062del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129369917del" "" "pathogenic (recessive)" "" "0000168883" "11" "90" "6" "129636608" "129636608" "subst" "2.03074E-5" "00503" "LAMA2_000475" "g.129636608T>A" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129315463T>A" "" "pathogenic (recessive)" "" "0000168884" "21" "90" "6" "129691062" "129691062" "del" "0" "00503" "LAMA2_000476" "g.129691062del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129369917del" "" "pathogenic (recessive)" "" "0000168885" "3" "90" "6" "129663485" "129663485" "subst" "0" "00503" "LAMA2_000477" "g.129663485C>G" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129342340C>G" "" "pathogenic (recessive)" "" "0000168886" "11" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00503" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "" "0000168887" "21" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00503" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "" "0000168888" "11" "90" "6" "129813631" "129813634" "del" "0" "00503" "LAMA2_000298" "g.129813631_129813634del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129492486_129492489del" "" "pathogenic (recessive)" "" "0000168889" "21" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00503" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "" "0000168892" "21" "90" "6" "129813068" "129813068" "subst" "0" "00503" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "" "0000168893" "0" "90" "6" "129419317" "129419561" "" "0" "00503" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168894" "3" "90" "6" "129380928" "129419561" "del" "0" "00503" "LAMA2_000478" "g.(129371234_129380928)_(129419561_129465045)del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000168897" "11" "90" "6" "129813138" "129813138" "del" "0" "00503" "LAMA2_000479" "g.129813138del" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129491993del" "" "pathogenic (recessive)" "" "0000168898" "21" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00503" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Xiong 2014:24611677}" "" "" "probable duplicate in Tan 2021" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "" "0000169070" "3" "90" "6" "129781344" "129781470" "" "0" "00503" "LAMA2_000480" "g.(129777640_129781344)_(129781470_129785434)del" "" "{PMID:Bhowmik 2016:26104111}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000169132" "3" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169133" "3" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169134" "3" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169135" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169136" "0" "90" "6" "129687385" "129687385" "dup" "0" "00503" "LAMA2_000134" "g.129687385dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "" "0000169175" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169176" "0" "50" "6" "129204422" "129204422" "subst" "0" "00503" "LAMA2_000482" "g.129204422T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.128883277T>C" "" "VUS" "" "0000169177" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169178" "0" "90" "6" "129634203" "129634203" "dup" "0" "00503" "LAMA2_000483" "g.129634203dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129313058dup" "" "pathogenic (recessive)" "" "0000169179" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000169180" "0" "50" "6" "129775433" "129775433" "subst" "0" "00503" "LAMA2_000484" "g.129775433G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "Last base of exon, predicted to affect donor splice site" "Germline" "" "" "0" "" "" "g.129454288G>A" "" "VUS" "" "0000169181" "0" "90" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "" "0000169182" "0" "70" "6" "129591900" "129591900" "subst" "0" "00503" "LAMA2_000408" "g.129591900A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "Predicted to affect donor splice site and to activate a cryptical donor splice site" "Germline" "" "" "0" "" "" "g.129270755A>G" "" "likely pathogenic (recessive)" "" "0000169183" "0" "50" "6" "129785499" "129785499" "subst" "9.77517E-5" "00503" "LAMA2_000485" "g.129785499C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129464354C>T" "" "VUS" "" "0000169184" "1" "90" "6" "129828655" "129828655" "subst" "0" "00503" "LAMA2_000486" "g.129828655T>C" "" "{PMID:Kim 2017: 28445022}" "" "" "" "Germline" "" "" "0" "" "" "g.129507510T>C" "" "pathogenic (recessive)" "" "0000169185" "2" "90" "6" "129781432" "129781432" "subst" "1.63043E-5" "00503" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Kim 2017:28445022}" "" "" "" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "pathogenic (recessive)" "" "0000169186" "0" "90" "6" "129475706" "129475707" "ins" "0" "00503" "LAMA2_000487" "g.129475706_129475707insTT" "" "{PMID: Yu: 28403181}" "" "" "" "De novo" "" "" "0" "" "" "g.129154561_129154562insTT" "" "pathogenic (recessive)" "" "0000169187" "1" "90" "6" "129470123" "129470123" "subst" "0" "00503" "LAMA2_000231" "g.129470123G>T" "" "{PMID: Yu: 28403181}" "" "" "" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "pathogenic (recessive)" "" "0000169206" "0" "70" "6" "129714215" "129714215" "del" "1.63239E-5" "00587" "LAMA2_000441" "g.129714215del" "" "{PMID:Vogelaar 2017:28875981}, {DOI:Vogelaar 2017:10.1038/ejhg.2017.138}" "" "NM_000426.3(LAMA2):c.5260del p.(Val1754*)" "variant could not be associated with disease phenotype" "Germline" "" "" "0" "" "" "g.129393070del" "" "likely pathogenic" "" "0000170962" "3" "90" "6" "129465119" "129465119" "subst" "0" "00503" "LAMA2_000320" "g.129465119C>A" "" "{PMID:Dean 2017:28533353}" "" "" "" "Germline" "" "" "0" "" "" "g.129143974C>A" "" "pathogenic (recessive)" "" "0000177865" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000177956" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "{PMID:Bell 2011:21228398}" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000178986" "11" "70" "6" "129826383" "129826383" "subst" "0" "01164" "LAMA2_000393" "g.129826383T>G" "" "" "" "" "segregation analysis confirmed second pathogenic variant c.396+1G>A transmitted from the mother" "Germline" "-" "" "0" "" "" "g.129505238T>G" "" "likely pathogenic (recessive)" "" "0000178987" "1" "70" "6" "129781432" "129781432" "subst" "1.63043E-5" "01164" "LAMA2_000056" "g.129781432C>T" "" "" "" "" "" "Germline" "?" "rs398123383" "0" "" "" "g.129460287C>T" "" "likely pathogenic (recessive)" "" "0000178988" "2" "70" "6" "129833597" "129833597" "subst" "0" "01164" "LAMA2_000488" "g.129833597C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129512452C>T" "" "likely pathogenic (recessive)" "" "0000178989" "0" "30" "6" "129636606" "129636606" "subst" "0.00801755" "01164" "LAMA2_000489" "g.129636606T>G" "gnomAD: MAF 0.007" "" "" "" "" "Germline" "" "rs17741922" "0" "" "" "g.129315461T>G" "" "likely benign" "ACMG" "0000178990" "11" "70" "6" "129807769" "129807769" "subst" "0" "01164" "LAMA2_000490" "g.129807769T>G" "" "" "" "" "A pathogenic splice variant at position c.7898+1G>T has been published by Gernmayeh et al 2010, affection also the splice donor of intron 56" "Germline" "?" "" "0" "" "" "g.129486624T>G" "" "likely pathogenic (recessive)" "" "0000178991" "21" "70" "6" "129807769" "129807769" "subst" "0" "01164" "LAMA2_000490" "g.129807769T>G" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129486624T>G" "" "likely pathogenic (recessive)" "" "0000178992" "1" "70" "6" "129637097" "129637097" "subst" "0" "01164" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129315952T>C" "" "likely pathogenic (recessive)" "" "0000178993" "2" "70" "6" "129637097" "129637097" "subst" "0" "01164" "LAMA2_000032" "g.129637097T>C" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129315952T>C" "" "likely pathogenic (recessive)" "" "0000178994" "3" "70" "6" "129712698" "129712717" "del" "0" "01164" "LAMA2_000494" "g.129712698_129712717del" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129391553_129391572del" "" "likely pathogenic (recessive)" "" "0000178996" "11" "70" "6" "129722399" "129722399" "subst" "2.84706E-5" "01164" "LAMA2_000046" "g.129722399C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129401254C>T" "" "likely pathogenic (recessive)" "" "0000178997" "21" "70" "6" "129722399" "129722399" "subst" "2.84706E-5" "01164" "LAMA2_000046" "g.129722399C>T" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129401254C>T" "" "likely pathogenic (recessive)" "" "0000178998" "3" "10" "6" "129609190" "129609190" "subst" "8.53929E-5" "01164" "LAMA2_000493" "g.129609190G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129288045G>A" "" "benign" "ACMG" "0000179000" "0" "70" "6" "129799959" "129799959" "subst" "0" "01164" "LAMA2_000312" "g.129799959G>A" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129478814G>A" "" "likely pathogenic (recessive)" "" "0000179001" "0" "50" "6" "129371195" "129371195" "subst" "0" "01164" "LAMA2_000491" "g.129371195A>T" "" "" "" "" "PolyPhen-2 score 0.99 (probably pathogenic)" "Germline" "?" "" "0" "" "" "g.129050050A>T" "" "VUS" "ACMG" "0000179002" "11" "50" "6" "129813630" "129813630" "dup" "0" "01164" "LAMA2_000492" "g.129813630dup" "" "" "" "" "splicing prediction implies the destruction of splice donor site and probably skipping of exon 58, not tested on cDNA, no cDNA available" "Germline" "?" "" "0" "" "" "g.129492485dup" "" "likely pathogenic (recessive)" "" "0000179003" "21" "50" "6" "129813630" "129813630" "dup" "0" "01164" "LAMA2_000492" "g.129813630dup" "" "" "" "" "" "Germline" "?" "" "0" "" "" "g.129492485dup" "" "likely pathogenic (recessive)" "" "0000221903" "1" "70" "6" "129704357" "129704357" "subst" "0" "01164" "LAMA2_000495" "g.129704357G>T" "" "" "" "" "{CV:SCV000229767.3},{CV:SCV000110635.3}; italian founder variant c.2901C>A (p.Cys967*) on the other allele" "Germline" "?" "rs201632009" "0" "" "" "g.129383212G>T" "" "likely pathogenic (recessive)" "" "0000221904" "2" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "01164" "LAMA2_000025" "g.129618874C>A" "" "" "" "" "{CV:SCV000035632.1}{CV:SCV000054524.1}" "Germline" "?" "rs121913577" "0" "" "" "g.129297729C>A" "" "pathogenic" "ACMG" "0000221960" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000221964" "0" "90" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "" "0000221965" "0" "90" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "" "0000221997" "0" "70" "6" "129381042" "129381042" "subst" "2.44095E-5" "02274" "LAMA2_000210" "g.129381042G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129059897G>T" "" "likely pathogenic (recessive)" "" "0000221998" "0" "90" "6" "129774204" "129774204" "subst" "8.1489E-6" "02274" "LAMA2_000496" "g.129774204C>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129453059C>A" "" "pathogenic (recessive)" "" "0000222028" "0" "90" "6" "129470153" "129470154" "del" "2.84474E-5" "02274" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "pathogenic (recessive)" "" "0000222029" "0" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "02274" "LAMA2_000049" "g.129722490G>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "pathogenic (recessive)" "" "0000222030" "0" "90" "6" "129470153" "129470154" "del" "2.84474E-5" "02274" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "pathogenic (recessive)" "" "0000222031" "0" "90" "6" "129802493" "129802493" "del" "0" "02274" "LAMA2_000062" "g.129802493del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129481348del" "" "pathogenic (recessive)" "" "0000222032" "3" "90" "6" "129470153" "129470154" "del" "2.84474E-5" "02274" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129149008_129149009del" "" "pathogenic (recessive)" "" "0000222033" "3" "70" "6" "129513978" "129513978" "del" "0" "02274" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "likely pathogenic (recessive)" "" "0000222034" "21" "70" "6" "129513978" "129513978" "del" "0" "02274" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "likely pathogenic (recessive)" "" "0000222035" "11" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "02274" "LAMA2_000265" "g.129486817C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "" "0000222036" "3" "70" "6" "129513978" "129513978" "del" "0" "02274" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "likely pathogenic (recessive)" "" "0000222037" "3" "70" "6" "129513978" "129513978" "del" "0" "02274" "LAMA2_000182" "g.129513978del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192833del" "" "likely pathogenic (recessive)" "" "0000222038" "0" "70" "6" "129608991" "129608991" "subst" "0" "02274" "LAMA2_000310" "g.129608991G>A" "" "" "" "" "No second variant found" "Germline" "" "" "0" "" "" "g.129287846G>A" "" "pathogenic (recessive)" "" "0000222040" "0" "90" "6" "129748945" "129748945" "subst" "0" "02274" "LAMA2_000209" "g.129748945C>T" "" "" "" "" "No second variant found" "Germline" "" "" "0" "" "" "g.129427800C>T" "" "pathogenic (recessive)" "" "0000222041" "3" "70" "6" "129766967" "129766967" "subst" "0" "02274" "LAMA2_000242" "g.129766967G>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129445822G>T" "" "likely pathogenic (recessive)" "" "0000222051" "0" "70" "6" "129835624" "129835624" "dup" "0" "02274" "LAMA2_000283" "g.129835624dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129514479dup" "" "pathogenic (recessive)" "" "0000222059" "0" "50" "6" "129687506" "129687506" "subst" "0" "02274" "LAMA2_000388" "g.129687506G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129366361G>A" "" "VUS" "" "0000222316" "0" "50" "6" "129635800" "129635800" "subst" "0.0648408" "00002" "LAMA2_000064" "g.129635800G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "VUS" "" "0000246447" "0" "10" "6" "129612808" "129612808" "subst" "0.269063" "02330" "LAMA2_000024" "g.129612808A>G" "" "" "" "LAMA2(NM_000426.4):c.2799A>G (p.Q933=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000246451" "0" "10" "6" "129813053" "129813053" "subst" "0.0870047" "02330" "LAMA2_000069" "g.129813053A>G" "" "" "" "LAMA2(NM_000426.4):c.7906A>G (p.T2636A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129491908A>G" "" "benign" "" "0000246455" "0" "10" "6" "129763368" "129763368" "subst" "0" "02330" "LAMA2_000561" "g.129763368A>G" "" "" "" "LAMA2(NM_001079823.2):c.6269-840A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129442223A>G" "" "benign" "" "0000246476" "0" "10" "6" "129824406" "129824406" "subst" "0.00551725" "02330" "LAMA2_000363" "g.129824406A>G" "" "" "" "LAMA2(NM_000426.3):c.8528A>G (p.(Asn2843Ser)), LAMA2(NM_000426.4):c.8528A>G (p.N2843S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129503261A>G" "" "benign" "" "0000248364" "0" "10" "6" "129612808" "129612808" "subst" "0.269063" "02325" "LAMA2_000024" "g.129612808A>G" "" "" "" "LAMA2(NM_000426.4):c.2799A>G (p.Q933=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000248418" "0" "10" "6" "129813053" "129813053" "subst" "0.0870047" "02325" "LAMA2_000069" "g.129813053A>G" "" "" "" "LAMA2(NM_000426.4):c.7906A>G (p.T2636A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129491908A>G" "" "benign" "" "0000252766" "0" "50" "6" "129794489" "129794489" "subst" "0.00212545" "02326" "LAMA2_000293" "g.129794489A>T" "" "" "" "LAMA2(NM_000426.3):c.7431A>T (p.R2477S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129473344A>T" "" "VUS" "" "0000254937" "0" "30" "6" "129618850" "129618850" "subst" "9.34185E-5" "01943" "LAMA2_000512" "g.129618850A>G" "" "" "" "LAMA2(NM_000426.3):c.2877A>G (p.Q959=, p.(Gln959=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129297705A>G" "" "likely benign" "" "0000256684" "0" "50" "6" "129581891" "129581891" "subst" "0.000178865" "01943" "LAMA2_000504" "g.129581891A>G" "" "" "" "LAMA2(NM_000426.3):c.2132A>G (p.Y711C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129260746A>G" "" "VUS" "" "0000278632" "0" "30" "6" "129511373" "129511373" "subst" "0.0319401" "02330" "LAMA2_000083" "g.129511373T>C" "" "" "" "LAMA2(NM_000426.3):c.1491T>C (p.(=)), LAMA2(NM_000426.4):c.1491T>C (p.C497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129190228T>C" "" "likely benign" "" "0000278633" "0" "10" "6" "129371106" "129371106" "subst" "0.0986835" "02330" "LAMA2_000153" "g.129371106C>T" "" "" "" "LAMA2(NM_000426.4):c.156C>T (p.I52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129049961C>T" "" "benign" "" "0000278634" "0" "30" "6" "129571272" "129571272" "subst" "0.0138918" "02330" "LAMA2_000090" "g.129571272G>A" "" "" "" "LAMA2(NM_000426.3):c.1798G>A (p.(Gly600Arg), p.G600R), LAMA2(NM_000426.4):c.1798G>A (p.G600R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129250127G>A" "" "likely benign" "" "0000278635" "0" "10" "6" "129571330" "129571330" "subst" "0.1735" "02330" "LAMA2_000016" "g.129571330G>A" "" "" "" "LAMA2(NM_000426.4):c.1856G>A (p.R619H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000278636" "0" "10" "6" "129601187" "129601187" "subst" "4.47318E-5" "02330" "LAMA2_000505" "g.129601187C>T" "" "" "" "LAMA2(NM_000426.4):c.2451-19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129280042C>T" "" "benign" "" "0000278637" "0" "10" "6" "129371205" "129371205" "subst" "0.000507581" "02330" "LAMA2_000497" "g.129371205C>T" "" "" "" "LAMA2(NM_000426.3):c.255C>T (p.I85=, p.(Ile85=)), LAMA2(NM_000426.4):c.255C>T (p.I85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129050060C>T" "" "benign" "" "0000278638" "0" "10" "6" "129634255" "129634255" "subst" "0.220596" "02330" "LAMA2_000165" "g.129634255G>A" "" "" "" "LAMA2(NM_000426.4):c.3411+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129313110G>A" "" "benign" "" "0000278639" "0" "30" "6" "129635800" "129635800" "subst" "0.0648408" "02330" "LAMA2_000064" "g.129635800G>A" "" "" "" "LAMA2(NM_000426.3):c.3412G>A (p.V1138M), LAMA2(NM_000426.4):c.3412G>A (p.V1138M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129314655G>A" "" "likely benign" "" "0000278640" "0" "10" "6" "129381026" "129381026" "subst" "0.960856" "02330" "LAMA2_000110" "g.129381026C>A" "" "" "" "LAMA2(NM_000426.4):c.381C>A (p.T127=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129059881C>A" "" "benign" "" "0000278641" "0" "30" "6" "129670548" "129670548" "subst" "0.0888911" "02330" "LAMA2_000334" "g.129670548C>T" "" "" "" "LAMA2(NM_000426.4):c.4523+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129349403C>T" "" "likely benign" "" "0000278642" "0" "30" "6" "129687396" "129687396" "subst" "0.0195317" "02330" "LAMA2_000123" "g.129687396G>A" "" "" "" "LAMA2(NM_000426.3):c.4750G>A (p.G1584S), LAMA2(NM_000426.4):c.4750G>A (p.G1584S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000278643" "0" "10" "6" "129691132" "129691132" "subst" "0.0884706" "02330" "LAMA2_000091" "g.129691132C>G" "" "" "" "LAMA2(NM_000426.4):c.4956C>G (p.T1652=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129369987C>G" "" "benign" "" "0000278644" "0" "10" "6" "129722425" "129722425" "subst" "0.49225" "02330" "LAMA2_000048" "g.129722425G>A" "" "" "" "LAMA2(NM_000426.4):c.5502G>A (p.E1834=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401280G>A" "" "benign" "" "0000278645" "0" "10" "6" "129724945" "129724945" "subst" "0.485016" "02330" "LAMA2_000343" "g.129724945T>G" "" "" "" "LAMA2(NM_000426.4):c.5727-21T>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129403800T>G" "" "benign" "" "0000278646" "0" "30" "6" "129759852" "129759852" "subst" "0" "02330" "LAMA2_000525" "g.129759852G>T" "" "" "" "LAMA2(NM_000426.4):c.6030G>T (p.G2010=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129438707G>T" "" "likely benign" "" "0000278647" "0" "10" "6" "129762042" "129762042" "subst" "0.006623" "02330" "LAMA2_000349" "g.129762042C>A" "" "" "" "LAMA2(NM_000426.4):c.6167C>A (p.T2056K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440897C>A" "" "benign" "" "0000278648" "0" "10" "6" "129762112" "129762112" "subst" "0.173011" "02330" "LAMA2_000052" "g.129762112G>A" "" "" "" "LAMA2(NM_000426.4):c.6237G>A (p.T2079=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440967G>A" "" "benign" "" "0000278649" "0" "30" "6" "129786444" "129786444" "subst" "0.000623626" "02330" "LAMA2_000533" "g.129786444T>A" "" "" "" "LAMA2(NM_000426.3):c.7300+10T>A (p.(=)), LAMA2(NM_000426.4):c.7300+10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129465299T>A" "" "likely benign" "" "0000278650" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "02330" "LAMA2_000067" "g.129807699G>C" "" "" "" "LAMA2(NM_000426.4):c.7830G>C (p.V2610=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486554G>C" "" "benign" "" "0000278651" "0" "10" "6" "129807714" "129807714" "subst" "0.303132" "02330" "LAMA2_000089" "g.129807714G>A" "" "" "" "LAMA2(NM_000426.4):c.7845G>A (p.P2615=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000278652" "0" "10" "6" "129813175" "129813175" "subst" "0.0120307" "02330" "LAMA2_000361" "g.129813175T>C" "" "" "" "LAMA2(NM_000426.3):c.8028T>C (p.(Asn2676=)), LAMA2(NM_000426.4):c.8028T>C (p.N2676=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129492030T>C" "" "benign" "" "0000278653" "0" "10" "6" "129826335" "129826335" "subst" "0.00853019" "02330" "LAMA2_000364" "g.129826335T>C" "" "" "" "LAMA2(NM_000426.3):c.8548-10T>C (p.(=)), LAMA2(NM_000426.4):c.8548-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129505190T>C" "" "benign" "" "0000281971" "0" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "02325" "LAMA2_000265" "g.129486817C>T" "" "" "" "LAMA2(NM_000426.4):c.1303C>T (p.R435*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic" "" "0000281972" "0" "10" "6" "129571330" "129571330" "subst" "0.1735" "02325" "LAMA2_000016" "g.129571330G>A" "" "" "" "LAMA2(NM_000426.4):c.1856G>A (p.R619H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000281973" "0" "30" "6" "129588259" "129588259" "subst" "0.00100105" "02325" "LAMA2_000423" "g.129588259G>T" "" "" "" "LAMA2(NM_000426.4):c.2217G>T (p.W739C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129267114G>T" "" "likely benign" "" "0000281974" "0" "10" "6" "129634255" "129634255" "subst" "0.220596" "02325" "LAMA2_000165" "g.129634255G>A" "" "" "" "LAMA2(NM_000426.4):c.3411+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129313110G>A" "" "benign" "" "0000281975" "0" "10" "6" "129635800" "129635800" "subst" "0.0648408" "02325" "LAMA2_000064" "g.129635800G>A" "" "" "" "LAMA2(NM_000426.3):c.3412G>A (p.V1138M), LAMA2(NM_000426.4):c.3412G>A (p.V1138M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000281976" "0" "10" "6" "129381026" "129381026" "subst" "0.960856" "02325" "LAMA2_000110" "g.129381026C>A" "" "" "" "LAMA2(NM_000426.4):c.381C>A (p.T127=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129059881C>A" "" "benign" "" "0000281977" "0" "10" "6" "129670548" "129670548" "subst" "0.0888911" "02325" "LAMA2_000334" "g.129670548C>T" "" "" "" "LAMA2(NM_000426.4):c.4523+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129349403C>T" "" "benign" "" "0000281978" "0" "30" "6" "129704300" "129704300" "subst" "0.000456763" "02325" "LAMA2_000518" "g.129704300G>A" "" "" "" "LAMA2(NM_000426.4):c.4993G>A (p.G1665R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129383155G>A" "" "likely benign" "" "0000281979" "0" "10" "6" "129722425" "129722425" "subst" "0.49225" "02325" "LAMA2_000048" "g.129722425G>A" "" "" "" "LAMA2(NM_000426.4):c.5502G>A (p.E1834=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401280G>A" "" "benign" "" "0000281980" "0" "50" "6" "129419474" "129419474" "subst" "7.31059E-5" "02325" "LAMA2_000499" "g.129419474C>T" "" "" "" "LAMA2(NM_000426.4):c.553C>T (p.R185C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129098329C>T" "" "VUS" "" "0000281981" "0" "30" "6" "129759786" "129759786" "subst" "0.000241435" "02325" "LAMA2_000523" "g.129759786C>T" "" "" "" "LAMA2(NM_000426.4):c.5969-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129438641C>T" "" "likely benign" "" "0000281982" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "02325" "LAMA2_000067" "g.129807699G>C" "" "" "" "LAMA2(NM_000426.4):c.7830G>C (p.V2610=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486554G>C" "" "benign" "" "0000281983" "0" "10" "6" "129807714" "129807714" "subst" "0.303132" "02325" "LAMA2_000089" "g.129807714G>A" "" "" "" "LAMA2(NM_000426.4):c.7845G>A (p.P2615=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000281984" "0" "30" "6" "129828685" "129828685" "subst" "0.000487753" "02325" "LAMA2_000534" "g.129828685C>T" "" "" "" "LAMA2(NM_000426.3):c.8755C>T (p.P2919S), LAMA2(NM_000426.4):c.8755C>T (p.P2919S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129507540C>T" "" "likely benign" "" "0000285865" "0" "10" "6" "129635800" "129635800" "subst" "0.0648408" "02326" "LAMA2_000064" "g.129635800G>A" "" "" "" "LAMA2(NM_000426.3):c.3412G>A (p.V1138M), LAMA2(NM_000426.4):c.3412G>A (p.V1138M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000285866" "0" "10" "6" "129687396" "129687396" "subst" "0.0195317" "02326" "LAMA2_000123" "g.129687396G>A" "" "" "" "LAMA2(NM_000426.3):c.4750G>A (p.G1584S), LAMA2(NM_000426.4):c.4750G>A (p.G1584S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129366251G>A" "" "benign" "" "0000285867" "0" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "02326" "LAMA2_000044" "g.129712680C>T" "" "" "" "LAMA2(NM_000426.3):c.5116C>T (p.R1706*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic" "" "0000285868" "0" "30" "6" "129781422" "129781422" "subst" "0" "02326" "LAMA2_000562" "g.129781422G>T" "" "" "" "LAMA2(NM_000426.3):c.6945G>T (p.L2315F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129460277G>T" "" "likely benign" "" "0000285869" "0" "90" "6" "129799959" "129799959" "subst" "0" "02326" "LAMA2_000312" "g.129799959G>A" "" "" "" "LAMA2(NM_000426.3):c.7572+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129478814G>A" "" "pathogenic" "" "0000285870" "0" "90" "6" "129828788" "129828788" "subst" "0" "02326" "LAMA2_000536" "g.129828788G>A" "" "" "" "LAMA2(NM_000426.3):c.8857+1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129507643G>A" "" "pathogenic" "" "0000285871" "0" "30" "6" "129835746" "129835746" "subst" "0.000691467" "02326" "LAMA2_000272" "g.129835746T>C" "" "" "" "LAMA2(NM_000426.3):c.9211+6T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129514601T>C" "" "likely benign" "" "0000290649" "0" "10" "6" "129511468" "129511468" "subst" "0.00284855" "01943" "LAMA2_000501" "g.129511468G>A" "" "" "" "LAMA2(NM_000426.3):c.1586G>A (p.S529N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129190323G>A" "" "benign" "" "0000290650" "0" "30" "6" "129513850" "129513850" "subst" "0.00301853" "01943" "LAMA2_000087" "g.129513850T>A" "" "" "" "LAMA2(NM_000426.3):c.1634T>A (p.L545Q, p.(Leu545Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129192705T>A" "" "likely benign" "" "0000290651" "0" "30" "6" "129513861" "129513861" "subst" "7.30953E-5" "01943" "LAMA2_000502" "g.129513861C>T" "" "" "" "LAMA2(NM_000426.3):c.1645C>T (p.P549S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129192716C>T" "" "likely benign" "" "0000290652" "0" "10" "6" "129513917" "129513917" "subst" "0.00169336" "01943" "LAMA2_000326" "g.129513917C>T" "" "" "" "LAMA2(NM_000426.3):c.1701C>T (p.I567=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129192772C>T" "" "benign" "" "0000290653" "0" "30" "6" "129601231" "129601231" "subst" "0.00543796" "01943" "LAMA2_000506" "g.129601231C>T" "" "" "" "LAMA2(NM_000426.3):c.2476C>T (p.R826W, p.(Arg826Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129280086C>T" "" "likely benign" "" "0000290654" "0" "30" "6" "129371205" "129371205" "subst" "0.000507581" "01943" "LAMA2_000497" "g.129371205C>T" "" "" "" "LAMA2(NM_000426.3):c.255C>T (p.I85=, p.(Ile85=)), LAMA2(NM_000426.4):c.255C>T (p.I85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129050060C>T" "" "likely benign" "" "0000290655" "0" "30" "6" "129609091" "129609091" "subst" "0" "01943" "LAMA2_000507" "g.129609091T>C" "" "" "" "LAMA2(NM_000426.3):c.2637T>C (p.C879=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129287946T>C" "" "likely benign" "" "0000290656" "0" "30" "6" "129612776" "129612776" "subst" "6.09231E-5" "01943" "LAMA2_000509" "g.129612776G>A" "" "" "" "LAMA2(NM_000426.3):c.2767G>A (p.G923S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129291631G>A" "" "likely benign" "" "0000290657" "0" "30" "6" "129621987" "129621987" "subst" "4.06144E-6" "01943" "LAMA2_000513" "g.129621987C>T" "" "" "" "LAMA2(NM_000426.3):c.3144C>T (p.T1048=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129300842C>T" "" "likely benign" "" "0000290658" "0" "30" "6" "129419332" "129419332" "subst" "0.0029569" "01943" "LAMA2_000111" "g.129419332G>A" "" "" "" "LAMA2(NM_000426.3):c.411G>A (p.A137=, p.(Ala137=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129098187G>A" "" "likely benign" "" "0000290659" "0" "30" "6" "129649468" "129649468" "subst" "0" "01943" "LAMA2_000557" "g.129649468C>G" "" "" "" "LAMA2(NM_000426.3):c.4222C>G (p.R1408G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129328323C>G" "" "likely benign" "" "0000290660" "0" "10" "6" "129670438" "129670438" "subst" "0.00575796" "01943" "LAMA2_000558" "g.129670438T>A" "" "" "" "LAMA2(NM_000426.3):c.4437-5T>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129349293T>A" "" "benign" "" "0000290661" "0" "30" "6" "129670476" "129670476" "subst" "0.00552536" "01943" "LAMA2_000515" "g.129670476C>T" "" "" "" "LAMA2(NM_000426.3):c.4470C>T (p.D1490=, p.(Asp1490=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129349331C>T" "" "likely benign" "" "0000290662" "0" "50" "6" "129691085" "129691085" "subst" "6.10764E-5" "01943" "LAMA2_000559" "g.129691085G>A" "" "" "" "LAMA2(NM_000426.3):c.4909G>A (p.E1637K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129369940G>A" "" "VUS" "" "0000290663" "0" "50" "6" "129691106" "129691106" "subst" "8.14571E-5" "01943" "LAMA2_000560" "g.129691106G>A" "" "" "" "LAMA2(NM_000426.3):c.4930G>A (p.V1644M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129369961G>A" "" "VUS" "" "0000290664" "0" "10" "6" "129691111" "129691111" "subst" "0.00086766" "01943" "LAMA2_000517" "g.129691111C>A" "" "" "" "LAMA2(NM_000426.3):c.4935C>A (p.T1645=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129369966C>A" "" "benign" "" "0000290665" "0" "10" "6" "129714202" "129714202" "subst" "0.0006543" "01943" "LAMA2_000336" "g.129714202C>T" "" "" "" "LAMA2(NM_000426.3):c.5247C>T (p.A1749=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129393057C>T" "" "benign" "" "0000290666" "0" "30" "6" "129714235" "129714235" "subst" "0.000659808" "01943" "LAMA2_000337" "g.129714235G>A" "" "" "" "LAMA2(NM_000426.3):c.5280G>A (p.E1760=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129393090G>A" "" "likely benign" "" "0000290667" "0" "50" "6" "129723539" "129723539" "subst" "0.000561217" "01943" "LAMA2_000520" "g.129723539C>T" "" "" "" "LAMA2(NM_000426.3):c.5633C>T (p.S1878F)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129402394C>T" "" "VUS" "" "0000290668" "0" "50" "6" "129723598" "129723598" "subst" "8.13372E-6" "01943" "LAMA2_000521" "g.129723598G>T" "" "" "" "LAMA2(NM_000426.3):c.5692G>T (p.A1898S), LAMA2(NM_000426.4):c.5692G>T (p.A1898S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129402453G>T" "" "VUS" "" "0000290669" "0" "30" "6" "129759824" "129759824" "subst" "0.000252671" "01943" "LAMA2_000524" "g.129759824G>A" "" "" "" "LAMA2(NM_000426.3):c.6002G>A (p.R2001K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129438679G>A" "" "likely benign" "" "0000290670" "0" "10" "6" "129762025" "129762025" "subst" "0.000883817" "01943" "LAMA2_000348" "g.129762025T>C" "" "" "" "LAMA2(NM_000426.3):c.6150T>C (p.D2050=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440880T>C" "" "benign" "" "0000290671" "0" "10" "6" "129465081" "129465081" "subst" "0.000667714" "01943" "LAMA2_000319" "g.129465081C>T" "" "" "" "LAMA2(NM_000426.3):c.675C>T (p.A225=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129143936C>T" "" "benign" "" "0000290672" "0" "50" "6" "129785560" "129785560" "subst" "0.00018329" "01943" "LAMA2_000563" "g.129785560C>T" "" "" "" "LAMA2(NM_000426.3):c.7118C>T (p.S2373L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129464415C>T" "" "VUS" "" "0000290673" "0" "50" "6" "129794482" "129794482" "subst" "2.44798E-5" "01943" "LAMA2_000564" "g.129794482C>T" "" "" "" "LAMA2(NM_000426.3):c.7424C>T (p.T2475M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129473337C>T" "" "VUS" "" "0000290674" "0" "10" "6" "129828685" "129828685" "subst" "0.000487753" "01943" "LAMA2_000534" "g.129828685C>T" "" "" "" "LAMA2(NM_000426.3):c.8755C>T (p.P2919S), LAMA2(NM_000426.4):c.8755C>T (p.P2919S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129507540C>T" "" "benign" "" "0000290675" "0" "10" "6" "129835652" "129835652" "subst" "0.00201511" "01943" "LAMA2_000538" "g.129835652C>T" "" "" "" "LAMA2(NM_000426.3):c.9123C>T (p.V3041=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129514507C>T" "" "benign" "" "0000331180" "0" "50" "6" "129419312" "129419312" "subst" "0" "01804" "LAMA2_000498" "g.129419312C>T" "" "" "" "LAMA2(NM_000426.3):c.397-6C>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129098167C>T" "" "VUS" "" "0000331181" "0" "30" "6" "129419332" "129419332" "subst" "0.0029569" "01804" "LAMA2_000111" "g.129419332G>A" "" "" "" "LAMA2(NM_000426.3):c.411G>A (p.A137=, p.(Ala137=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129098187G>A" "" "likely benign" "" "0000331182" "0" "50" "6" "129470136" "129470136" "subst" "0.00106875" "01804" "LAMA2_000500" "g.129470136G>A" "" "" "" "LAMA2(NM_000426.3):c.922G>A (p.E308K, p.(Glu308Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129148991G>A" "" "VUS" "" "0000331186" "0" "30" "6" "129601231" "129601231" "subst" "0.00543796" "01804" "LAMA2_000506" "g.129601231C>T" "" "" "" "LAMA2(NM_000426.3):c.2476C>T (p.R826W, p.(Arg826Trp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129280086C>T" "" "likely benign" "" "0000331187" "0" "30" "6" "129609124" "129609124" "subst" "0.00012997" "01804" "LAMA2_000508" "g.129609124A>C" "" "" "" "LAMA2(NM_000426.3):c.2670A>C (p.(Lys890Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129287979A>C" "" "likely benign" "" "0000331189" "0" "50" "6" "129612779" "129612779" "subst" "0" "01804" "LAMA2_000510" "g.129612779G>T" "" "" "" "LAMA2(NM_000426.3):c.2770G>T (p.(Gly924Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129291634G>T" "" "VUS" "" "0000331191" "0" "30" "6" "129636606" "129636606" "subst" "0.00801755" "01804" "LAMA2_000489" "g.129636606T>G" "" "" "" "LAMA2(NM_000426.3):c.3556-15T>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129315461T>G" "" "likely benign" "" "0000331192" "0" "50" "6" "129636970" "129636992" "del" "0" "01804" "LAMA2_000189" "g.129636970_129636992del" "" "" "" "LAMA2(NM_000426.3):c.3797_3819del (p.(Phe1267AspfsTer11)), LAMA2(NM_000426.4):c.3799_3821delTTCTCTACATATAATCCTCAAGT (p.F1267Dfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129315825_129315847del" "" "VUS" "" "0000331195" "0" "50" "6" "129691111" "129691111" "subst" "0.00086766" "01804" "LAMA2_000517" "g.129691111C>A" "" "" "" "LAMA2(NM_000426.3):c.4935C>A (p.T1645=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129369966C>A" "" "VUS" "" "0000331197" "0" "30" "6" "129722453" "129722453" "subst" "0.0104121" "01804" "LAMA2_000092" "g.129722453C>A" "" "" "" "LAMA2(NM_000426.3):c.5530C>A (p.(Arg1844Ser), p.R1844S), LAMA2(NM_000426.4):c.5530C>A (p.R1844S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401308C>A" "" "likely benign" "" "0000331198" "0" "30" "6" "129759783" "129759783" "subst" "0" "01804" "LAMA2_000522" "g.129759783A>T" "" "" "" "LAMA2(NM_000426.3):c.5969-8A>T (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129438638A>T" "" "likely benign" "" "0000331199" "0" "30" "6" "129762036" "129762036" "subst" "0.000790153" "01804" "LAMA2_000526" "g.129762036A>G" "" "" "" "LAMA2(NM_000426.3):c.6161A>G (p.Q2054R, p.(Gln2054Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440891A>G" "" "likely benign" "" "0000331200" "0" "50" "6" "129774164" "129774164" "subst" "0" "01804" "LAMA2_000527" "g.129774164G>A" "" "" "" "LAMA2(NM_000426.3):c.6461G>A (p.(Cys2154Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129453019G>A" "" "VUS" "" "0000331202" "0" "30" "6" "129777477" "129777477" "subst" "0.000345894" "01804" "LAMA2_000529" "g.129777477A>C" "" "" "" "LAMA2(NM_000426.3):c.6708-3A>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129456332A>C" "" "likely benign" "" "0000331203" "0" "50" "6" "129777553" "129777553" "subst" "0" "01804" "LAMA2_000530" "g.129777553C>T" "" "" "" "LAMA2(NM_000426.3):c.6781C>T (p.(His2261Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129456408C>T" "" "VUS" "" "0000331204" "0" "50" "6" "129777560" "129777560" "subst" "0.000862216" "01804" "LAMA2_000531" "g.129777560C>T" "" "" "" "LAMA2(NM_000426.3):c.6788C>T (p.(Thr2263Met), p.T2263M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129456415C>T" "" "VUS" "" "0000331207" "0" "50" "6" "129785448" "129785448" "subst" "0" "01804" "LAMA2_000608" "g.129785448G>C" "" "" "" "LAMA2(NM_000426.3):c.7006G>C (p.(Asp2336His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129464303G>C" "" "VUS" "" "0000331210" "0" "30" "6" "129824406" "129824406" "subst" "0.00551725" "01804" "LAMA2_000363" "g.129824406A>G" "" "" "" "LAMA2(NM_000426.3):c.8528A>G (p.(Asn2843Ser)), LAMA2(NM_000426.4):c.8528A>G (p.N2843S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129503261A>G" "" "likely benign" "" "0000331211" "0" "30" "6" "129826335" "129826335" "subst" "0.00853019" "01804" "LAMA2_000364" "g.129826335T>C" "" "" "" "LAMA2(NM_000426.3):c.8548-10T>C (p.(=)), LAMA2(NM_000426.4):c.8548-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129505190T>C" "" "likely benign" "" "0000331212" "0" "30" "6" "129828704" "129828704" "subst" "0.00136957" "01804" "LAMA2_000535" "g.129828704C>T" "" "" "" "LAMA2(NM_000426.3):c.8774C>T (p.(Pro2925Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129507559C>T" "" "likely benign" "" "0000331213" "0" "30" "6" "129835567" "129835567" "subst" "0" "01804" "LAMA2_000537" "g.129835567A>C" "" "" "" "LAMA2(NM_000426.3):c.9038A>C (p.D3013A, p.(Asp3013Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129514422A>C" "" "likely benign" "" "0000331215" "0" "30" "6" "129837320" "129837320" "subst" "0.0233204" "01804" "LAMA2_000368" "g.129837320C>A" "" "" "" "LAMA2(NM_000426.3):c.9212-15C>A (p.(=)), LAMA2(NM_000426.4):c.9212-15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129516175C>A" "" "likely benign" "" "0000337127" "0" "90" "6" "129465045" "129465045" "subst" "0" "02327" "LAMA2_000545" "g.129465045G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129143900G>T" "" "pathogenic" "" "0000337128" "0" "10" "6" "129634255" "129634255" "subst" "0.220596" "02327" "LAMA2_000165" "g.129634255G>A" "" "" "" "LAMA2(NM_000426.4):c.3411+13G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129313110G>A" "" "benign" "" "0000337129" "0" "30" "6" "129636606" "129636606" "subst" "0.00801755" "02327" "LAMA2_000489" "g.129636606T>G" "" "" "" "LAMA2(NM_000426.3):c.3556-15T>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129315461T>G" "" "likely benign" "" "0000337130" "0" "10" "6" "129670548" "129670548" "subst" "0.0888911" "02327" "LAMA2_000334" "g.129670548C>T" "" "" "" "LAMA2(NM_000426.4):c.4523+19C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129349403C>T" "" "benign" "" "0000337131" "0" "10" "6" "129764217" "129764217" "subst" "0.00643176" "02327" "LAMA2_000351" "g.129764217C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129443072C>T" "" "benign" "" "0000337133" "0" "10" "6" "129826335" "129826335" "subst" "0.00853019" "02327" "LAMA2_000364" "g.129826335T>C" "" "" "" "LAMA2(NM_000426.3):c.8548-10T>C (p.(=)), LAMA2(NM_000426.4):c.8548-10T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129505190T>C" "" "benign" "" "0000337134" "0" "30" "6" "129835746" "129835746" "subst" "0.000691467" "02327" "LAMA2_000272" "g.129835746T>C" "" "" "" "LAMA2(NM_000426.3):c.9211+6T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129514601T>C" "" "likely benign" "" "0000337135" "0" "10" "6" "129837320" "129837320" "subst" "0.0233204" "02327" "LAMA2_000368" "g.129837320C>A" "" "" "" "LAMA2(NM_000426.3):c.9212-15C>A (p.(=)), LAMA2(NM_000426.4):c.9212-15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129516175C>A" "" "benign" "" "0000337136" "0" "10" "6" "129837549" "129837549" "subst" "0" "02327" "LAMA2_000556" "g.129837549A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129516404A>C" "" "benign" "" "0000337137" "0" "10" "6" "129837610" "129837610" "subst" "0" "02327" "LAMA2_000076" "g.129837610T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129516465T>C" "" "benign" "" "0000339381" "0" "10" "6" "129371106" "129371106" "subst" "0.0986835" "02327" "LAMA2_000153" "g.129371106C>T" "" "" "" "LAMA2(NM_000426.4):c.156C>T (p.I52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129049961C>T" "" "benign" "" "0000339382" "0" "10" "6" "129381026" "129381026" "subst" "0.960856" "02327" "LAMA2_000110" "g.129381026C>A" "" "" "" "LAMA2(NM_000426.4):c.381C>A (p.T127=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129059881C>A" "" "benign" "" "0000339385" "0" "10" "6" "129513917" "129513917" "subst" "0.00169336" "02327" "LAMA2_000326" "g.129513917C>T" "" "" "" "LAMA2(NM_000426.3):c.1701C>T (p.I567=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129192772C>T" "" "benign" "" "0000339386" "0" "10" "6" "129612808" "129612808" "subst" "0.269063" "02327" "LAMA2_000024" "g.129612808A>G" "" "" "" "LAMA2(NM_000426.4):c.2799A>G (p.Q933=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129291663A>G" "" "benign" "" "0000339387" "0" "30" "6" "129618847" "129618847" "subst" "1.62458E-5" "02327" "LAMA2_000549" "g.129618847A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129297702A>G" "" "likely benign" "" "0000339388" "0" "10" "6" "129691132" "129691132" "subst" "0.0884706" "02327" "LAMA2_000091" "g.129691132C>G" "" "" "" "LAMA2(NM_000426.4):c.4956C>G (p.T1652=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129369987C>G" "" "benign" "" "0000339389" "0" "10" "6" "129722389" "129722389" "subst" "0.493666" "02327" "LAMA2_000045" "g.129722389A>G" "" "" "" "LAMA2(NM_000426.4):c.5466A>G (p.E1822=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401244A>G" "" "benign" "" "0000339390" "0" "10" "6" "129722425" "129722425" "subst" "0.49225" "02327" "LAMA2_000048" "g.129722425G>A" "" "" "" "LAMA2(NM_000426.4):c.5502G>A (p.E1834=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401280G>A" "" "benign" "" "0000339391" "0" "10" "6" "129762112" "129762112" "subst" "0.173011" "02327" "LAMA2_000052" "g.129762112G>A" "" "" "" "LAMA2(NM_000426.4):c.6237G>A (p.T2079=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440967G>A" "" "benign" "" "0000339392" "0" "10" "6" "129807699" "129807699" "subst" "0.672742" "02327" "LAMA2_000067" "g.129807699G>C" "" "" "" "LAMA2(NM_000426.4):c.7830G>C (p.V2610=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486554G>C" "" "benign" "" "0000339393" "0" "10" "6" "129807714" "129807714" "subst" "0.303132" "02327" "LAMA2_000089" "g.129807714G>A" "" "" "" "LAMA2(NM_000426.4):c.7845G>A (p.P2615=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486569G>A" "" "benign" "" "0000339394" "0" "10" "6" "129813175" "129813175" "subst" "0.0120307" "02327" "LAMA2_000361" "g.129813175T>C" "" "" "" "LAMA2(NM_000426.3):c.8028T>C (p.(Asn2676=)), LAMA2(NM_000426.4):c.8028T>C (p.N2676=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129492030T>C" "" "benign" "" "0000340783" "0" "10" "6" "129813508" "129813508" "subst" "0.00428874" "02327" "LAMA2_000129" "g.129813508T>A" "" "" "" "LAMA2(NM_000426.3):c.8124T>A (p.(Gly2708=)), LAMA2(NM_000426.4):c.8124T>A (p.G2708=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129492363T>A" "" "benign" "" "0000341480" "0" "50" "6" "129371099" "129371099" "subst" "3.65453E-5" "02327" "LAMA2_000541" "g.129371099C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129049954C>T" "" "VUS" "" "0000341852" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "02327" "LAMA2_000033" "g.129637234C>T" "" "" "" "LAMA2(NM_000426.3):c.3976C>T (p.(Arg1326Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic" "" "0000341871" "0" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "02327" "LAMA2_000034" "g.129637306C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic" "" "0000341981" "0" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "02327" "LAMA2_000041" "g.129674430C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic" "" "0000342115" "0" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "02327" "LAMA2_000046" "g.129722399C>T" "" "" "" "LAMA2(NM_000426.3):c.5476C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic" "" "0000342123" "0" "10" "6" "129722453" "129722453" "subst" "0.0104121" "02327" "LAMA2_000092" "g.129722453C>A" "" "" "" "LAMA2(NM_000426.3):c.5530C>A (p.(Arg1844Ser), p.R1844S), LAMA2(NM_000426.4):c.5530C>A (p.R1844S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129401308C>A" "" "benign" "" "0000342404" "0" "10" "6" "129794489" "129794489" "subst" "0.00212545" "02327" "LAMA2_000293" "g.129794489A>T" "" "" "" "LAMA2(NM_000426.3):c.7431A>T (p.R2477S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129473344A>T" "" "benign" "" "0000342458" "0" "90" "6" "129807757" "129807757" "subst" "4.06851E-6" "02327" "LAMA2_000359" "g.129807757C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129486612C>T" "" "pathogenic" "" "0000342893" "0" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "02327" "LAMA2_000265" "g.129486817C>T" "" "" "" "LAMA2(NM_000426.4):c.1303C>T (p.R435*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic" "" "0000343175" "0" "10" "6" "129571330" "129571330" "subst" "0.1735" "02327" "LAMA2_000016" "g.129571330G>A" "" "" "" "LAMA2(NM_000426.4):c.1856G>A (p.R619H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129250185G>A" "" "benign" "" "0000344393" "0" "50" "6" "129498874" "129498874" "subst" "0" "02327" "LAMA2_000546" "g.129498874T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129177729T>C" "" "VUS" "" "0000344408" "0" "10" "6" "129511373" "129511373" "subst" "0.0319401" "02327" "LAMA2_000083" "g.129511373T>C" "" "" "" "LAMA2(NM_000426.3):c.1491T>C (p.(=)), LAMA2(NM_000426.4):c.1491T>C (p.C497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129190228T>C" "" "benign" "" "0000344647" "0" "30" "6" "129762036" "129762036" "subst" "0.000790153" "02327" "LAMA2_000526" "g.129762036A>G" "" "" "" "LAMA2(NM_000426.3):c.6161A>G (p.Q2054R, p.(Gln2054Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440891A>G" "" "likely benign" "" "0000344655" "0" "90" "6" "129766847" "129766847" "subst" "0" "02327" "LAMA2_000553" "g.129766847C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129445702C>T" "" "pathogenic" "" "0000344764" "0" "90" "6" "129204484" "129204484" "subst" "0" "02327" "LAMA2_000205" "g.129204484C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.128883339C>T" "" "pathogenic" "" "0000345754" "0" "30" "6" "129687396" "129687396" "subst" "0.0195317" "02327" "LAMA2_000123" "g.129687396G>A" "" "" "" "LAMA2(NM_000426.3):c.4750G>A (p.G1584S), LAMA2(NM_000426.4):c.4750G>A (p.G1584S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "" "0000346260" "0" "50" "6" "129588296" "129588296" "subst" "0" "02327" "LAMA2_000548" "g.129588296G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129267151G>A" "" "VUS" "" "0000347283" "0" "50" "6" "129573398" "129573398" "subst" "0" "02327" "LAMA2_000115" "g.129573398T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129252253T>C" "" "VUS" "" "0000348823" "0" "50" "6" "129419532" "129419532" "subst" "0" "02327" "LAMA2_000391" "g.129419532C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129098387C>T" "" "VUS" "" "0000349356" "0" "10" "6" "129762042" "129762042" "subst" "0.006623" "02327" "LAMA2_000349" "g.129762042C>A" "" "" "" "LAMA2(NM_000426.4):c.6167C>A (p.T2056K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129440897C>A" "" "benign" "" "0000349396" "0" "10" "6" "129813053" "129813053" "subst" "0.0870047" "02327" "LAMA2_000069" "g.129813053A>G" "" "" "" "LAMA2(NM_000426.4):c.7906A>G (p.T2636A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129491908A>G" "" "benign" "" "0000349673" "0" "90" "6" "129380972" "129380972" "subst" "0" "02327" "LAMA2_000543" "g.129380972G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129059827G>A" "" "pathogenic" "" "0000349700" "0" "90" "6" "129674473" "129674473" "subst" "0" "02327" "LAMA2_000551" "g.129674473G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129353328G>A" "" "pathogenic" "" "0000349760" "0" "90" "6" "129824419" "129824419" "subst" "0" "02327" "LAMA2_000416" "g.129824419G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129503274G>A" "" "pathogenic" "" "0000349975" "0" "90" "6" "129419530" "129419530" "subst" "0" "02327" "LAMA2_000544" "g.129419530C>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129098385C>A" "" "pathogenic" "" "0000350247" "0" "10" "6" "129635800" "129635800" "subst" "0.0648408" "02327" "LAMA2_000064" "g.129635800G>A" "" "" "" "LAMA2(NM_000426.3):c.3412G>A (p.V1138M), LAMA2(NM_000426.4):c.3412G>A (p.V1138M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0000350353" "0" "90" "6" "129714215" "129714215" "del" "1.63239E-5" "02327" "LAMA2_000441" "g.129714215del" "" "" "" "LAMA2(NM_000426.3):c.5260delG (p.(Val1754*)), LAMA2(NM_000426.3):c.5260delG (p.V1754*), LAMA2(NM_000426.4):c.5260delG (p.V1754*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129393070del" "" "pathogenic" "" "0000350879" "0" "10" "6" "129704396" "129704396" "subst" "0.00569303" "02327" "LAMA2_000335" "g.129704396A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129383251A>G" "" "benign" "" "0000350881" "0" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "02327" "LAMA2_000150" "g.129813629G>A" "" "" "" "LAMA2(NM_000426.3):c.8244+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic" "" "0000369877" "21" "50" "6" "129775432" "129775432" "subst" "0" "02521" "LAMA2_000565" "g.129775432A>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.129454287A>G" "" "VUS" "" "0000369941" "0" "99" "6" "129371234" "129371234" "subst" "1.21842E-5" "00503" "LAMA2_000000" "g.129371234G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050089G>A" "" "pathogenic (recessive)" "ACMG" "0000369942" "0" "99" "6" "129636783" "129636783" "subst" "0" "00503" "LAMA2_000001" "g.129636783C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315638C>T" "" "pathogenic (recessive)" "ACMG" "0000369943" "0" "99" "6" "129674307" "129674307" "subst" "0" "00503" "LAMA2_000002" "g.129674307A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353162A>T" "" "pathogenic (recessive)" "ACMG" "0000369944" "0" "99" "6" "129204392" "129204392" "subst" "0" "00503" "LAMA2_000003" "g.129204392T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883247T>C" "" "pathogenic (recessive)" "ACMG" "0000369945" "0" "99" "6" "129204472" "129204472" "subst" "4.69572E-6" "00503" "LAMA2_000004" "g.129204472C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883327C>T" "" "pathogenic (recessive)" "ACMG" "0000369946" "0" "99" "6" "129799876" "129799879" "dup" "0" "00503" "LAMA2_000005" "g.129799876_129799879dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129478731_129478734dup" "" "pathogenic (recessive)" "ACMG" "0000369948" "0" "55" "6" "129371207" "129371207" "subst" "0" "00503" "LAMA2_000007" "g.129371207G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050062G>A" "" "VUS" "ACMG" "0000369949" "0" "99" "6" "129419419" "129419419" "subst" "4.06114E-6" "00503" "LAMA2_000008" "g.129419419G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098274G>A" "" "pathogenic (recessive)" "ACMG" "0000369950" "0" "99" "6" "129419549" "129419549" "subst" "0" "00503" "LAMA2_000009" "g.129419549G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098404G>T" "" "pathogenic (recessive)" "ACMG" "0000369951" "0" "99" "6" "129470165" "129470166" "dup" "0" "00503" "LAMA2_000010" "g.129470165_129470166dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129149020_129149021dup" "" "pathogenic (recessive)" "ACMG" "0000369952" "0" "77" "6" "129475830" "129475830" "subst" "0" "00503" "LAMA2_000011" "g.129475830T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154685T>G" "" "likely pathogenic (recessive)" "ACMG" "0000369953" "0" "99" "6" "129498921" "129498921" "del" "4.06365E-6" "00503" "LAMA2_000012" "g.129498921del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177776del" "" "pathogenic (recessive)" "ACMG" "0000369954" "0" "99" "6" "129511372" "129511373" "del" "0" "00503" "LAMA2_000013" "g.129511372_129511373del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190227_129190228del" "" "pathogenic (recessive)" "ACMG" "0000369955" "0" "99" "6" "129571267" "129571269" "del" "0" "00503" "LAMA2_000014" "g.129571267_129571269del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250122_129250124del" "" "pathogenic (recessive)" "ACMG" "0000369956" "0" "99" "6" "129571328" "129571335" "dup" "0" "00503" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "ACMG" "0000369957" "0" "11" "6" "129571330" "129571330" "subst" "0.1735" "00503" "LAMA2_000016" "g.129571330G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250185G>A" "" "benign" "ACMG" "0000369958" "0" "99" "6" "129573237" "129573241" "del" "0" "00503" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252092_129252096del" "" "pathogenic (recessive)" "ACMG" "0000369959" "0" "99" "6" "129573393" "129573394" "del" "0" "00503" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000369960" "0" "99" "6" "129581937" "129581937" "subst" "0" "00503" "LAMA2_000019" "g.129581937C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129260792C>A" "" "pathogenic (recessive)" "ACMG" "0000369961" "0" "99" "6" "129588272" "129588272" "subst" "4.06865E-6" "00503" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "ACMG" "0000369962" "0" "99" "6" "129591815" "129591815" "del" "0" "00503" "LAMA2_000021" "g.129591815del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270670del" "" "pathogenic (recessive)" "ACMG" "0000369963" "0" "99" "6" "129609038" "129609038" "subst" "0" "00503" "LAMA2_000022" "g.129609038T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287893T>C" "" "pathogenic (recessive)" "ACMG" "0000369964" "0" "99" "6" "129612758" "129612758" "subst" "4.06359E-6" "00503" "LAMA2_000023" "g.129612758G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129291613G>A" "" "pathogenic (recessive)" "ACMG" "0000369965" "0" "11" "6" "129612808" "129612808" "subst" "0.269063" "00503" "LAMA2_000024" "g.129612808A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129291663A>G" "" "benign" "ACMG" "0000369966" "0" "99" "6" "129618874" "129618874" "subst" "8.12381E-6" "00503" "LAMA2_000025" "g.129618874C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297729C>A" "" "pathogenic (recessive)" "ACMG" "0000369967" "0" "99" "6" "129618927" "129618927" "subst" "0" "00503" "LAMA2_000026" "g.129618927G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297782G>A" "" "pathogenic (recessive)" "ACMG" "0000369968" "0" "99" "6" "129618935" "129618935" "subst" "0" "00503" "LAMA2_000027" "g.129618935C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297790C>T" "" "pathogenic (recessive)" "ACMG" "0000369969" "0" "99" "6" "129618959" "129618959" "subst" "0" "00503" "LAMA2_000028" "g.129618959T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297814T>C" "" "pathogenic (recessive)" "ACMG" "0000369970" "0" "99" "6" "129621928" "129621928" "subst" "4.06128E-6" "00503" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000369971" "0" "99" "6" "129621965" "129621965" "del" "0" "00503" "LAMA2_000030" "g.129621965del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300820del" "" "pathogenic (recessive)" "ACMG" "0000369972" "0" "99" "6" "129636688" "129636710" "del" "0" "00503" "LAMA2_000031" "g.129636688_129636710del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315543_129315565del" "" "pathogenic (recessive)" "ACMG" "0000369973" "0" "77" "6" "129637097" "129637097" "subst" "0" "00503" "LAMA2_000032" "g.129637097T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315952T>C" "" "likely pathogenic (recessive)" "ACMG" "0000369974" "0" "99" "6" "129637234" "129637234" "subst" "5.69018E-5" "00503" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000369975" "0" "99" "6" "129637306" "129637306" "subst" "1.22104E-5" "00503" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "ACMG" "0000369976" "0" "77" "6" "129641681" "129641681" "subst" "0" "00503" "LAMA2_000035" "g.129641681A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129320536A>G" "" "likely pathogenic (recessive)" "ACMG" "0000369977" "0" "99" "6" "129785433" "129785433" "subst" "1.62934E-5" "00503" "LAMA2_000036" "g.129785433A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464288A>C" "" "pathogenic (recessive)" "ACMG" "0000369978" "0" "99" "6" "129649555" "129649555" "subst" "0" "00503" "LAMA2_000037" "g.129649555C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328410C>T" "" "pathogenic (recessive)" "ACMG" "0000369979" "0" "99" "6" "129663487" "129663487" "subst" "0" "00503" "LAMA2_000038" "g.129663487G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342342G>C" "" "pathogenic (recessive)" "ACMG" "0000369980" "0" "99" "6" "129674423" "129674423" "subst" "0" "00503" "LAMA2_000040" "g.129674423C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353278C>A" "" "pathogenic (recessive)" "ACMG" "0000369981" "0" "99" "6" "129674430" "129674430" "subst" "8.12599E-6" "00503" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "ACMG" "0000369982" "0" "99" "6" "129674475" "129674475" "subst" "0" "00503" "LAMA2_000042" "g.129674475C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353330C>T" "" "pathogenic (recessive)" "ACMG" "0000369983" "0" "77" "6" "129687511" "129687511" "subst" "0" "00503" "LAMA2_000043" "g.129687511G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "Variant Error [EMISMATCH/ESYNTAX]: This transcript variant has an error. Please fix this entry and then remove this message." "SUMMARY record" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000369984" "0" "99" "6" "129712680" "129712680" "subst" "2.4431E-5" "00503" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "ACMG" "0000369985" "0" "11" "6" "129722389" "129722389" "subst" "0.493666" "00503" "LAMA2_000045" "g.129722389A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401244A>G" "" "benign" "ACMG" "0000369986" "0" "99" "6" "129722399" "129722399" "subst" "2.84706E-5" "00503" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "ACMG" "0000369987" "0" "99" "6" "129722410" "129722411" "del" "0" "00503" "LAMA2_000047" "g.129722410_129722411del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401265_129401266del" "" "pathogenic (recessive)" "ACMG" "0000369988" "0" "11" "6" "129722425" "129722425" "subst" "0.49225" "00503" "LAMA2_000048" "g.129722425G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401280G>A" "" "benign" "ACMG" "0000369989" "0" "77" "6" "129722490" "129722490" "subst" "2.04232E-5" "00503" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401345G>C" "" "likely pathogenic (recessive)" "ACMG" "0000369990" "0" "99" "6" "129723560" "129723560" "del" "0" "00503" "LAMA2_000050" "g.129723560del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402415del" "" "pathogenic (recessive)" "ACMG" "0000369991" "0" "99" "6" "129725105" "129725105" "del" "0" "00503" "LAMA2_000051" "g.129725105del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129403960del" "" "pathogenic (recessive)" "ACMG" "0000369992" "0" "11" "6" "129762112" "129762112" "subst" "0.173011" "00503" "LAMA2_000052" "g.129762112G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440967G>A" "" "benign" "ACMG" "0000369993" "0" "99" "6" "129777640" "129777640" "subst" "0" "00503" "LAMA2_000053" "g.129777640G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456495G>A" "" "pathogenic (recessive)" "ACMG" "0000369994" "0" "99" "6" "129781396" "129781397" "del" "0" "00503" "LAMA2_000054" "g.129781396_129781397del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460251_129460252del" "" "pathogenic (recessive)" "ACMG" "0000369995" "0" "99" "6" "129781425" "129781425" "subst" "0" "00503" "LAMA2_000055" "g.129781425G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460280G>A" "" "pathogenic (recessive)" "ACMG" "0000369996" "0" "99" "6" "129781432" "129781432" "subst" "1.63043E-5" "00503" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460287C>T" "" "pathogenic (recessive)" "ACMG" "0000369997" "0" "99" "6" "129785437" "129785437" "del" "0" "00503" "LAMA2_000057" "g.129785437del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464292del" "" "pathogenic (recessive)" "ACMG" "0000369998" "0" "77" "6" "129785513" "129785513" "subst" "0" "00503" "LAMA2_000058" "g.129785513G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464368G>A" "" "likely pathogenic (recessive)" "ACMG" "0000369999" "0" "99" "6" "129785516" "129785516" "subst" "2.44345E-5" "00503" "LAMA2_000059" "g.129785516C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464371C>A" "" "pathogenic (recessive)" "ACMG" "0000370000" "0" "99" "6" "129794435" "129794435" "dup" "0" "00503" "LAMA2_000060" "g.129794435dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129473290dup" "" "pathogenic (recessive)" "ACMG" "0000370001" "0" "99" "6" "129794493" "129794494" "del" "0" "00503" "LAMA2_000061" "g.129794493_129794494del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129473348_129473349del" "" "pathogenic (recessive)" "ACMG" "0000370002" "0" "99" "6" "129802493" "129802493" "del" "0" "00503" "LAMA2_000062" "g.129802493del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481348del" "" "pathogenic (recessive)" "ACMG" "0000370003" "0" "77" "6" "129802526" "129802526" "subst" "0" "00503" "LAMA2_000063" "g.129802526T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481381T>C" "" "likely pathogenic (recessive)" "ACMG" "0000370004" "0" "11" "6" "129635800" "129635800" "subst" "0.0648408" "00503" "LAMA2_000064" "g.129635800G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129314655G>A" "" "benign" "ACMG" "0000370005" "0" "11" "6" "129807629" "129807629" "subst" "0" "00503" "LAMA2_000065" "g.129807629=" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486484=" "" "benign" "ACMG" "0000370006" "0" "99" "6" "129807679" "129807679" "subst" "8.13848E-6" "00503" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000370007" "0" "11" "6" "129807699" "129807699" "subst" "0.672742" "00503" "LAMA2_000067" "g.129807699G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486554G>C" "" "benign" "ACMG" "0000370008" "0" "99" "6" "129807750" "129807750" "subst" "0" "00503" "LAMA2_000068" "g.129807750T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486605T>G" "" "pathogenic (recessive)" "ACMG" "0000370009" "0" "11" "6" "129813053" "129813053" "subst" "0.0870047" "00503" "LAMA2_000069" "g.129813053A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129491908A>G" "" "benign" "ACMG" "0000370010" "0" "99" "6" "129823824" "129823824" "del" "0" "00503" "LAMA2_000070" "g.129823824del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502679del" "" "pathogenic (recessive)" "ACMG" "0000370011" "0" "33" "6" "129837554" "129837557" "dup" "0" "00503" "LAMA2_000071" "g.129837554_129837557dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516409_129516412dup" "" "likely benign" "ACMG" "0000370012" "0" "33" "6" "129826488" "129826488" "subst" "0.00399161" "00503" "LAMA2_000072" "g.129826488A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505343A>G" "" "likely benign" "ACMG" "0000370013" "0" "77" "6" "129371235" "129371235" "del" "0" "00503" "LAMA2_000073" "g.129371235del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050090del" "" "likely pathogenic (recessive)" "ACMG" "0000370014" "0" "11" "6" "129823645" "129823645" "subst" "0" "00503" "LAMA2_000074" "g.129823645A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502500A>G" "" "benign" "ACMG" "0000370015" "0" "11" "6" "129835814" "129835814" "subst" "0" "00503" "LAMA2_000075" "g.129835814G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514669G>A" "" "benign" "ACMG" "0000370016" "0" "11" "6" "129837610" "129837610" "subst" "0" "00503" "LAMA2_000076" "g.129837610T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516465T>C" "" "benign" "ACMG" "0000370017" "0" "99" "6" "129835630" "129835633" "dup" "0" "00503" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "ACMG" "0000370018" "0" "99" "6" "129837376" "129837376" "subst" "4.06461E-6" "00503" "LAMA2_000078" "g.129837376C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516231C>T" "" "pathogenic (recessive)" "ACMG" "0000370019" "0" "99" "6" "129465045" "129513999" "dup" "0" "00503" "LAMA2_000080" "g.(129419561_129465045)_(129513999_129571346)dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370020" "0" "99" "6" "129571272" "129571274" "del" "0" "00503" "LAMA2_000081" "g.129571272_129571274del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250127_129250129del" "" "pathogenic (recessive)" "ACMG" "0000370021" "0" "99" "6" "129785589" "129785589" "subst" "1.62966E-5" "00503" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000370022" "0" "11" "6" "129511373" "129511373" "subst" "0.0319401" "00503" "LAMA2_000083" "g.129511373T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190228T>C" "" "benign" "ACMG" "0000370023" "0" "99" "6" "129204505" "129204505" "subst" "0" "00503" "LAMA2_000084" "g.129204505A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883360A>G" "" "pathogenic (recessive)" "ACMG" "0000370024" "0" "99" "6" "129486720" "129486720" "subst" "0" "00503" "LAMA2_000085" "g.129486720G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129165575G>C" "" "pathogenic (recessive)" "ACMG" "0000370025" "0" "99" "6" "129649526" "129649526" "del" "0" "00503" "LAMA2_000086" "g.129649526del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328381del" "" "pathogenic (recessive)" "ACMG" "0000370026" "0" "11" "6" "129513850" "129513850" "subst" "0.00301853" "00503" "LAMA2_000087" "g.129513850T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192705T>A" "" "benign" "ACMG" "0000370027" "0" "33" "6" "129612765" "129612765" "subst" "0.0113137" "00503" "LAMA2_000088" "g.129612765G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129291620G>T" "" "likely benign" "ACMG" "0000370028" "0" "11" "6" "129807714" "129807714" "subst" "0.303132" "00503" "LAMA2_000089" "g.129807714G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486569G>A" "" "benign" "ACMG" "0000370029" "0" "11" "6" "129571272" "129571272" "subst" "0.0138918" "00503" "LAMA2_000090" "g.129571272G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250127G>A" "" "benign" "ACMG" "0000370030" "0" "11" "6" "129691132" "129691132" "subst" "0.0884706" "00503" "LAMA2_000091" "g.129691132C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369987C>G" "" "benign" "ACMG" "0000370031" "0" "33" "6" "129802455" "129802455" "subst" "0" "00503" "LAMA2_000093" "g.129802455C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481310C>G" "" "likely benign" "ACMG" "0000370032" "0" "11" "6" "129470195" "129470195" "subst" "0" "00503" "LAMA2_000094" "g.129470195G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129149050G>A" "" "benign" "ACMG" "0000370033" "0" "11" "6" "129475804" "129475804" "subst" "0" "00503" "LAMA2_000095" "g.129475804T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154659T>A" "" "benign" "ACMG" "0000370034" "0" "33" "6" "129588277" "129588277" "subst" "0" "00503" "LAMA2_000096" "g.129588277T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267132T>A" "" "likely benign" "ACMG" "0000370035" "0" "33" "6" "129588337" "129588337" "subst" "0" "00503" "LAMA2_000097" "g.129588337C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267192C>A" "" "likely benign" "ACMG" "0000370036" "0" "33" "6" "129609004" "129609004" "subst" "0" "00503" "LAMA2_000098" "g.129609004C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287859C>G" "" "likely benign" "ACMG" "0000370037" "0" "33" "6" "129609085" "129609085" "subst" "0" "00503" "LAMA2_000099" "g.129609085C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287940C>G" "" "likely benign" "ACMG" "0000370038" "0" "33" "6" "129621882" "129621882" "subst" "0" "00503" "LAMA2_000100" "g.129621882T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300737T>G" "" "likely benign" "ACMG" "0000370039" "0" "33" "6" "129621942" "129621942" "subst" "8.12236E-6" "00503" "LAMA2_000101" "g.129621942T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300797T>A" "" "likely benign" "ACMG" "0000370040" "0" "33" "6" "129762028" "129762028" "subst" "4.07299E-6" "00503" "LAMA2_000102" "g.129762028A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440883A>T" "" "likely benign" "ACMG" "0000370041" "0" "33" "6" "129774162" "129774162" "subst" "0" "00503" "LAMA2_000103" "g.129774162C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453017C>T" "" "likely benign" "ACMG" "0000370042" "0" "33" "6" "129794453" "129794453" "subst" "5.70953E-5" "00503" "LAMA2_000104" "g.129794453T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129473308T>C" "" "likely benign" "ACMG" "0000370043" "0" "33" "6" "129802449" "129802449" "subst" "8.13273E-6" "00503" "LAMA2_000105" "g.129802449G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481304G>A" "" "likely benign" "ACMG" "0000370044" "0" "55" "6" "129807709" "129807709" "subst" "0" "00503" "LAMA2_000106" "g.129807709G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486564G>A" "" "VUS" "ACMG" "0000370045" "0" "55" "6" "129807625" "129807625" "subst" "0" "00503" "LAMA2_000107" "g.129807625T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486480T>C" "" "VUS" "ACMG" "0000370046" "0" "99" "6" "129634005" "129807768" "del" "0" "00503" "LAMA2_000108" "g.(129622018_129634005)_(129807768_129813045)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370047" "0" "99" "6" "129634046" "129634046" "del" "0" "00503" "LAMA2_000109" "g.129634046del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129312901del" "" "pathogenic (recessive)" "ACMG" "0000370048" "0" "11" "6" "129381026" "129381026" "subst" "0.960856" "00503" "LAMA2_000110" "g.129381026C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059881C>A" "" "benign" "ACMG" "0000370049" "0" "33" "6" "129419332" "129419332" "subst" "0.0029569" "00503" "LAMA2_000111" "g.129419332G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098187G>A" "" "likely benign" "ACMG" "0000370050" "0" "11" "6" "129468130" "129468130" "subst" "0" "00503" "LAMA2_000112" "g.129468130A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129146985A>T" "" "benign" "ACMG" "0000370051" "0" "11" "6" "129475698" "129475698" "subst" "0" "00503" "LAMA2_000113" "g.129475698T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154553T>C" "" "benign" "ACMG" "0000370052" "0" "11" "6" "129498963" "129498963" "subst" "0" "00503" "LAMA2_000114" "g.129498963G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177818G>A" "" "benign" "ACMG" "0000370053" "0" "55" "6" "129573398" "129573398" "subst" "0" "00503" "LAMA2_000115" "g.129573398T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252253T>C" "" "VUS" "ACMG" "0000370054" "0" "33" "6" "129609030" "129609030" "subst" "0" "00503" "LAMA2_000116" "g.129609030G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287885G>T" "" "likely benign" "ACMG" "0000370055" "0" "99" "6" "129704313" "129704313" "del" "4.07624E-6" "00503" "LAMA2_000117" "g.129704313del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129383168del" "" "pathogenic (recessive)" "ACMG" "0000370056" "0" "55" "6" "129571358" "129571358" "subst" "0" "00503" "LAMA2_000118" "g.129571358G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250213G>A" "" "VUS" "ACMG" "0000370057" "0" "33" "6" "129636784" "129636784" "subst" "0" "00503" "LAMA2_000119" "g.129636784A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315639A>T" "" "likely benign" "ACMG" "0000370058" "0" "33" "6" "129637188" "129637188" "subst" "0" "00503" "LAMA2_000120" "g.129637188A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316043A>G" "" "likely benign" "ACMG" "0000370059" "0" "33" "6" "129663583" "129663583" "subst" "0" "00503" "LAMA2_000121" "g.129663583T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342438T>C" "" "likely benign" "ACMG" "0000370060" "0" "33" "6" "129670452" "129670452" "subst" "0" "00503" "LAMA2_000122" "g.129670452C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349307C>T" "" "likely benign" "ACMG" "0000370061" "0" "33" "6" "129687396" "129687396" "subst" "0.0195317" "00503" "LAMA2_000123" "g.129687396G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366251G>A" "" "likely benign" "ACMG" "0000370062" "0" "33" "6" "129714337" "129714337" "subst" "1.62501E-5" "00503" "LAMA2_000124" "g.129714337A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393192A>T" "" "likely benign" "ACMG" "0000370063" "0" "33" "6" "129723620" "129723620" "subst" "0" "00503" "LAMA2_000125" "g.129723620C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402475C>G" "" "likely benign" "ACMG" "0000370064" "0" "33" "6" "129774153" "129774153" "subst" "0.00018354" "00503" "LAMA2_000126" "g.129774153A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453008A>T" "" "likely benign" "ACMG" "0000370065" "0" "33" "6" "129802496" "129802496" "subst" "0" "00503" "LAMA2_000127" "g.129802496T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481351T>C" "" "likely benign" "ACMG" "0000370066" "0" "33" "6" "129813076" "129813076" "subst" "0" "00503" "LAMA2_000128" "g.129813076A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129491931A>G" "" "likely benign" "ACMG" "0000370067" "0" "33" "6" "129813508" "129813508" "subst" "0.00428874" "00503" "LAMA2_000129" "g.129813508T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492363T>A" "" "likely benign" "ACMG" "0000370068" "0" "33" "6" "129826383" "129826383" "subst" "0.000711209" "00503" "LAMA2_000130" "g.129826383T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505238T>C" "" "likely benign" "ACMG" "0000370069" "0" "33" "6" "129833575" "129833575" "subst" "0" "00503" "LAMA2_000131" "g.129833575A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129512430A>T" "" "likely benign" "ACMG" "0000370070" "0" "99" "6" "129511462" "129511462" "subst" "0" "00503" "LAMA2_000132" "g.129511462G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190317G>A" "" "pathogenic (recessive)" "ACMG" "0000370071" "0" "99" "6" "129722490" "129722490" "subst" "0" "00503" "LAMA2_000133" "g.129722490G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401345G>A" "" "pathogenic (recessive)" "ACMG" "0000370072" "0" "99" "6" "129687385" "129687385" "dup" "0" "00503" "LAMA2_000134" "g.129687385dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "ACMG" "0000370073" "0" "99" "6" "129637003" "129637003" "subst" "0" "00503" "LAMA2_000135" "g.129637003G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315858G>T" "" "pathogenic (recessive)" "ACMG" "0000370074" "0" "99" "6" "129371233" "129371233" "subst" "0" "00503" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "ACMG" "0000370075" "0" "99" "6" "129513885" "129513885" "subst" "0" "00503" "LAMA2_000137" "g.129513885C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192740C>T" "" "pathogenic (recessive)" "ACMG" "0000370076" "0" "99" "6" "129468109" "129468109" "del" "0" "00503" "LAMA2_000138" "g.129468109del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129146964del" "" "pathogenic (recessive)" "ACMG" "0000370077" "0" "99" "6" "129691037" "129691037" "del" "4.07352E-6" "00503" "LAMA2_000139" "g.129691037del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369892del" "" "pathogenic (recessive)" "ACMG" "0000370078" "0" "99" "6" "129813154" "129813154" "del" "0" "00503" "LAMA2_000140" "g.129813154del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492009del" "" "pathogenic (recessive)" "ACMG" "0000370079" "0" "99" "6" "129663551" "129663551" "del" "0" "00503" "LAMA2_000141" "g.129663551del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342406del" "" "pathogenic (recessive)" "ACMG" "0000370080" "0" "99" "6" "129636695" "129636695" "del" "0" "00503" "LAMA2_000142" "g.129636695del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "ACMG" "0000370081" "0" "99" "6" "129674477" "129674480" "dup" "0" "00503" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353332_129353335dup" "" "pathogenic (recessive)" "ACMG" "0000370082" "0" "99" "6" "129419421" "129419421" "subst" "0" "00503" "LAMA2_000144" "g.129419421A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098276A>C" "" "pathogenic (recessive)" "ACMG" "0000370083" "0" "99" "6" "129813223" "129813224" "del" "0" "00503" "LAMA2_000145" "g.129813223_129813224del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492078_129492079del" "" "pathogenic (recessive)" "ACMG" "0000370084" "0" "99" "6" "129802567" "129802567" "subst" "5.28305E-5" "00503" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "ACMG" "0000370085" "0" "99" "6" "129663494" "129663494" "subst" "0" "00503" "LAMA2_000147" "g.129663494C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342349C>T" "" "pathogenic (recessive)" "ACMG" "0000370086" "0" "99" "6" "129712799" "129712799" "subst" "8.14518E-6" "00503" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000370087" "0" "99" "6" "129805906" "129810892" "del" "0" "00503" "LAMA2_000149" "g.129805906_129810892del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129484761_129489747del" "" "pathogenic (recessive)" "ACMG" "0000370088" "0" "99" "6" "129813629" "129813629" "subst" "4.07428E-6" "00503" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "ACMG" "0000370089" "0" "99" "6" "129828706" "129828722" "del" "0" "00503" "LAMA2_000151" "g.129828706_129828722del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507561_129507577del" "" "pathogenic (recessive)" "ACMG" "0000370090" "0" "99" "6" "129381008" "129381008" "subst" "8.12552E-6" "00503" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "ACMG" "0000370091" "0" "11" "6" "129371106" "129371106" "subst" "0.0986835" "00503" "LAMA2_000153" "g.129371106C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129049961C>T" "" "benign" "ACMG" "0000370092" "0" "11" "6" "129380798" "129380798" "subst" "0" "00503" "LAMA2_000154" "g.129380798C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059653C>T" "" "benign" "ACMG" "0000370093" "0" "11" "6" "129380844" "129380844" "delins" "0" "00503" "LAMA2_000155" "g.129380844delinsGG" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059699delinsGG" "" "benign" "ACMG" "0000370094" "0" "11" "6" "129465422" "129465422" "subst" "0" "00503" "LAMA2_000156" "g.129465422G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129144277G>A" "" "benign" "ACMG" "0000370095" "0" "11" "6" "129468288" "129468288" "subst" "0" "00503" "LAMA2_000157" "g.129468288A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129147143A>T" "" "benign" "ACMG" "0000370096" "0" "11" "6" "129486913" "129486913" "subst" "0" "00503" "LAMA2_000158" "g.129486913T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129165768T>C" "" "benign" "ACMG" "0000370097" "0" "11" "6" "129582009" "129582009" "subst" "0" "00503" "LAMA2_000159" "g.129582009C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129260864C>T" "" "benign" "ACMG" "0000370098" "0" "11" "6" "129619150" "129619150" "subst" "0" "00503" "LAMA2_000160" "g.129619150G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129298005G>A" "" "benign" "ACMG" "0000370099" "0" "11" "6" "129621586" "129621586" "subst" "0" "00503" "LAMA2_000161" "g.129621586A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300441A>G" "" "benign" "ACMG" "0000370100" "0" "11" "6" "129621725" "129621725" "subst" "0" "00503" "LAMA2_000162" "g.129621725A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300580A>G" "" "benign" "ACMG" "0000370101" "0" "33" "6" "129621978" "129621978" "subst" "0" "00503" "LAMA2_000163" "g.129621978A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300833A>G" "" "likely benign" "ACMG" "0000370102" "0" "11" "6" "129622055" "129622055" "subst" "0.396641" "00503" "LAMA2_000164" "g.129622055A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300910A>G" "" "benign" "ACMG" "0000370103" "0" "11" "6" "129634255" "129634255" "subst" "0.220596" "00503" "LAMA2_000165" "g.129634255G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129313110G>A" "" "benign" "ACMG" "0000370104" "0" "11" "6" "129636432" "129636432" "subst" "0" "00503" "LAMA2_000166" "g.129636432C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315287C>G" "" "benign" "ACMG" "0000370105" "0" "33" "6" "129649350" "129649350" "subst" "0" "00503" "LAMA2_000167" "g.129649350C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328205C>T" "" "likely benign" "ACMG" "0000370106" "0" "11" "6" "129663271" "129663271" "subst" "0" "00503" "LAMA2_000168" "g.129663271T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342126T>C" "" "benign" "ACMG" "0000370107" "0" "33" "6" "129674062" "129674062" "subst" "0" "00503" "LAMA2_000169" "g.129674062A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129352917A>G" "" "likely benign" "ACMG" "0000370108" "0" "33" "6" "129690982" "129690982" "subst" "0" "00503" "LAMA2_000170" "g.129690982A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369837A>G" "" "likely benign" "ACMG" "0000370109" "0" "11" "6" "129724942" "129724945" "delins" "0" "00503" "LAMA2_000171" "g.129724942_129724945delinsACTG" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129403797_129403800delinsACTG" "" "benign" "ACMG" "0000370110" "0" "33" "6" "129725279" "129725279" "subst" "0" "00503" "LAMA2_000172" "g.129725279A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129404134A>C" "" "likely benign" "ACMG" "0000370111" "0" "33" "6" "129762220" "129762220" "subst" "0" "00503" "LAMA2_000173" "g.129762220C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129441075C>T" "" "likely benign" "ACMG" "0000370112" "0" "11" "6" "129775470" "129775470" "subst" "0.156879" "00503" "LAMA2_000174" "g.129775470T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129454325T>C" "" "benign" "ACMG" "0000370113" "0" "11" "6" "129777382" "129777382" "subst" "0" "00503" "LAMA2_000175" "g.129777382C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456237C>T" "" "benign" "ACMG" "0000370114" "0" "11" "6" "129781192" "129781192" "subst" "0" "00503" "LAMA2_000176" "g.129781192C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460047C>A" "" "benign" "ACMG" "0000370115" "0" "11" "6" "129785391" "129785391" "subst" "0.609286" "00503" "LAMA2_000177" "g.129785391T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464246T>C" "" "benign" "ACMG" "0000370116" "0" "11" "6" "129807483" "129807483" "subst" "0" "00503" "LAMA2_000178" "g.129807483C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486338C>G" "" "benign" "ACMG" "0000370117" "0" "11" "6" "129807869" "129807869" "subst" "0" "00503" "LAMA2_000179" "g.129807869C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486724C>A" "" "benign" "ACMG" "0000370118" "0" "33" "6" "129813436" "129813436" "dup" "0" "00503" "LAMA2_000180" "g.129813436dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492291dup" "" "likely benign" "ACMG" "0000370119" "0" "77" "6" "129635860" "129635860" "subst" "0" "00503" "LAMA2_000181" "g.129635860A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129314715A>T" "" "likely pathogenic (recessive)" "ACMG" "0000370120" "0" "99" "6" "129513978" "129513978" "del" "0" "00503" "LAMA2_000182" "g.129513978del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192833del" "" "pathogenic (recessive)" "ACMG" "0000370121" "0" "99" "6" "129591901" "129591907" "del" "0" "00503" "LAMA2_000183" "g.129591901_129591907del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270756_129270762del" "" "pathogenic (recessive)" "ACMG" "0000370122" "0" "99" "6" "129608991" "129608991" "subst" "0" "00503" "LAMA2_000184" "g.129608991G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287846G>C" "" "pathogenic (recessive)" "ACMG" "0000370123" "0" "55" "6" "129618782" "129618782" "subst" "1.25133E-5" "00503" "LAMA2_000185" "g.129618782C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297637C>G" "" "VUS" "ACMG" "0000370124" "0" "77" "6" "129609204" "129609204" "subst" "4.06967E-6" "00503" "LAMA2_000186" "g.129609204G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129288059G>A" "" "likely pathogenic (recessive)" "ACMG" "0000370125" "0" "99" "6" "129475799" "129475799" "subst" "0" "00503" "LAMA2_000187" "g.129475799T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154654T>G" "" "pathogenic (recessive)" "ACMG" "0000370126" "0" "11" "6" "129633974" "129633975" "del" "0" "00503" "LAMA2_000188" "g.129633974_129633975del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129312829_129312830del" "" "benign" "ACMG" "0000370127" "0" "99" "6" "129636970" "129636992" "del" "0" "00503" "LAMA2_000189" "g.129636970_129636992del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315825_129315847del" "" "pathogenic (recessive)" "ACMG" "0000370128" "0" "99" "6" "129204425" "129204425" "subst" "0" "00503" "LAMA2_000190" "g.129204425T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883280T>G" "" "pathogenic (recessive)" "ACMG" "0000370129" "0" "77" "6" "129786431" "129786431" "subst" "0" "00503" "LAMA2_000191" "g.129786431C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129465286C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370130" "0" "99" "6" "129837358" "129837361" "dup" "0" "00503" "LAMA2_000192" "g.129837358_129837361dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516213_129516216dup" "" "pathogenic (recessive)" "ACMG" "0000370131" "0" "99" "6" "129419333" "129419333" "subst" "0" "00503" "LAMA2_000193" "g.129419333T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098188T>C" "" "pathogenic (recessive)" "ACMG" "0000370132" "0" "99" "6" "129826410" "129826410" "dup" "0" "00503" "LAMA2_000194" "g.129826410dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505265dup" "" "pathogenic (recessive)" "ACMG" "0000370133" "0" "99" "6" "129714214" "129714214" "del" "0" "00503" "LAMA2_000195" "g.129714214del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393069del" "" "pathogenic (recessive)" "ACMG" "0000370134" "0" "55" "6" "129712630" "129712630" "del" "0" "00503" "LAMA2_000196" "g.129712630del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391485del" "" "VUS" "ACMG" "0000370135" "0" "77" "6" "129691117" "129691117" "del" "0" "00503" "LAMA2_000197" "g.129691117del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369972del" "" "likely pathogenic (recessive)" "ACMG" "0000370136" "0" "99" "6" "129774191" "129774191" "del" "0" "00503" "LAMA2_000198" "g.129774191del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453046del" "" "pathogenic (recessive)" "ACMG" "0000370137" "0" "11" "6" "129622039" "129622040" "ins" "0" "00503" "LAMA2_000199" "g.129622039_129622040insAT" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300894_129300895insAT" "" "benign" "ACMG" "0000370138" "0" "77" "6" "129712746" "129712746" "del" "0" "00503" "LAMA2_000201" "g.129712746del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391601del" "" "likely pathogenic (recessive)" "ACMG" "0000370139" "0" "33" "6" "129802516" "129802516" "subst" "9.3499E-5" "00503" "LAMA2_000202" "g.129802516G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481371G>A" "" "likely benign" "ACMG" "0000370140" "0" "55" "6" "129498870" "129498870" "subst" "0" "00503" "LAMA2_000203" "g.129498870T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177725T>G" "" "VUS" "ACMG" "0000370141" "0" "99" "6" "129823802" "129823802" "subst" "0" "00503" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502657A>G" "" "pathogenic (recessive)" "ACMG" "0000370142" "0" "77" "6" "129204484" "129204484" "subst" "0" "00503" "LAMA2_000205" "g.129204484C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883339C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370143" "0" "77" "6" "129759820" "129759820" "del" "0" "00503" "LAMA2_000206" "g.129759820del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438675del" "" "likely pathogenic (recessive)" "ACMG" "0000370144" "0" "55" "6" "129571408" "129571408" "subst" "0.00184807" "00503" "LAMA2_000207" "g.129571408A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250263A>C" "" "VUS" "ACMG" "0000370145" "0" "99" "6" "129663524" "129663524" "subst" "1.22058E-5" "00503" "LAMA2_000208" "g.129663524C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342379C>T" "" "pathogenic (recessive)" "ACMG" "0000370146" "0" "99" "6" "129748945" "129748945" "subst" "0" "00503" "LAMA2_000209" "g.129748945C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129427800C>T" "" "pathogenic (recessive)" "ACMG" "0000370147" "0" "99" "6" "129381042" "129381042" "subst" "2.44095E-5" "00503" "LAMA2_000210" "g.129381042G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059897G>T" "" "pathogenic (recessive)" "ACMG" "0000370148" "0" "55" "6" "129465151" "129465151" "subst" "8.14604E-6" "00503" "LAMA2_000211" "g.129465151C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129144006C>T" "" "VUS" "ACMG" "0000370149" "0" "33" "6" "129663469" "129663471" "del" "0" "00503" "LAMA2_000212" "g.129663469_129663471del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342324_129342326del" "" "likely benign" "ACMG" "0000370150" "0" "99" "6" "129826466" "129826466" "dup" "0" "00503" "LAMA2_000213" "g.129826466dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505321dup" "" "pathogenic (recessive)" "ACMG" "0000370151" "0" "55" "6" "129775432" "129775432" "subst" "0" "00503" "LAMA2_000214" "g.129775432A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129454287A>C" "" "VUS" "ACMG" "0000370152" "0" "99" "6" "129762141" "129762141" "del" "0" "00503" "LAMA2_000215" "g.129762141del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440996del" "" "pathogenic (recessive)" "ACMG" "0000370153" "0" "99" "6" "129470153" "129470154" "del" "2.84474E-5" "00503" "LAMA2_000216" "g.129470153_129470154del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129149008_129149009del" "" "pathogenic (recessive)" "ACMG" "0000370154" "0" "55" "6" "129514008" "129514008" "subst" "0.000598572" "00503" "LAMA2_000217" "g.129514008C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192863C>T" "" "VUS" "ACMG" "0000370155" "0" "11" "6" "129619059" "129619059" "subst" "0.142546" "00503" "LAMA2_000218" "g.129619059G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297914G>A" "" "benign" "ACMG" "0000370156" "0" "99" "6" "129649444" "129649444" "subst" "4.06352E-6" "00503" "LAMA2_000219" "g.129649444C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328299C>T" "" "pathogenic (recessive)" "ACMG" "0000370157" "0" "99" "6" "129573320" "129573320" "subst" "0" "00503" "LAMA2_000220" "g.129573320C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252175C>A" "" "pathogenic (recessive)" "ACMG" "0000370158" "0" "99" "6" "129823917" "129823917" "subst" "0" "00503" "LAMA2_000221" "g.129823917G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502772G>A" "" "pathogenic (recessive)" "ACMG" "0000370159" "0" "77" "6" "129826462" "129826462" "subst" "0" "00503" "LAMA2_000222" "g.129826462G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505317G>A" "" "likely pathogenic (recessive)" "ACMG" "0000370160" "0" "77" "6" "129762082" "129762082" "subst" "0" "00503" "LAMA2_000223" "g.129762082C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440937C>A" "" "likely pathogenic (recessive)" "ACMG" "0000370161" "0" "77" "6" "129634169" "129634176" "dup" "0" "00503" "LAMA2_000224" "g.129634169_129634176dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129313024_129313031dup" "" "likely pathogenic (recessive)" "ACMG" "0000370162" "0" "55" "6" "129796583" "129796583" "subst" "0" "00503" "LAMA2_000225" "g.129796583A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129475438A>G" "" "VUS" "ACMG" "0000370163" "0" "55" "6" "129674439" "129674439" "subst" "1.21877E-5" "00503" "LAMA2_000226" "g.129674439G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353294G>A" "" "VUS" "ACMG" "0000370164" "0" "77" "6" "129637000" "129637000" "subst" "0" "00503" "LAMA2_000227" "g.129637000C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370165" "0" "55" "6" "129833500" "129833500" "subst" "0" "00503" "LAMA2_000228" "g.129833500T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129512355T>G" "" "VUS" "ACMG" "0000370166" "0" "99" "6" "129714280" "129714280" "dup" "0" "00503" "LAMA2_000229" "g.129714280dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393135dup" "" "pathogenic (recessive)" "ACMG" "0000370167" "0" "99" "6" "129204437" "129204437" "del" "0" "00503" "LAMA2_000230" "g.129204437del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883292del" "" "pathogenic (recessive)" "ACMG" "0000370168" "0" "77" "6" "129470123" "129470123" "subst" "0" "00503" "LAMA2_000231" "g.129470123G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129148978G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370169" "0" "77" "6" "129371114" "129371114" "del" "0" "00503" "LAMA2_000232" "g.129371114del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129049969del" "" "likely pathogenic (recessive)" "ACMG" "0000370170" "0" "77" "6" "129775314" "129775314" "dup" "0" "00503" "LAMA2_000233" "g.129775314dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129454169dup" "" "likely pathogenic (recessive)" "ACMG" "0000370171" "0" "55" "6" "129799957" "129799957" "subst" "0" "00503" "LAMA2_000234" "g.129799957A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129478812A>T" "" "VUS" "ACMG" "0000370172" "0" "77" "6" "129813629" "129813629" "subst" "0" "00503" "LAMA2_000235" "g.129813629G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492484G>C" "" "likely pathogenic (recessive)" "ACMG" "0000370173" "0" "77" "6" "129711182" "129712718" "delins" "0" "00503" "LAMA2_000236" "g.129711182_129712718delinsAGATTGCC" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129390037_129391573delinsAGATTGCC" "" "likely pathogenic (recessive)" "ACMG" "0000370174" "0" "55" "6" "129591816" "129591816" "subst" "0" "00503" "LAMA2_000237" "g.129591816T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270671T>A" "" "VUS" "ACMG" "0000370175" "0" "77" "6" "129591829" "129591829" "subst" "4.06706E-6" "00503" "LAMA2_000238" "g.129591829G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270684G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370176" "0" "77" "6" "129687407" "129687407" "dup" "0" "00503" "LAMA2_000239" "g.129687407dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366262dup" "" "likely pathogenic (recessive)" "ACMG" "0000370177" "0" "55" "6" "129465224" "129465224" "subst" "0" "00503" "LAMA2_000240" "g.129465224G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129144079G>A" "" "VUS" "ACMG" "0000370178" "0" "55" "6" "129774251" "129774251" "subst" "0" "00503" "LAMA2_000241" "g.129774251T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453106T>G" "" "VUS" "ACMG" "0000370179" "0" "77" "6" "129766967" "129766967" "subst" "0" "00503" "LAMA2_000242" "g.129766967G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129445822G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370180" "0" "99" "6" "129637307" "129637307" "del" "0" "00503" "LAMA2_000243" "g.129637307del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316162del" "" "pathogenic (recessive)" "ACMG" "0000370181" "0" "99" "6" "129833639" "129833639" "subst" "0" "00503" "LAMA2_000244" "g.129833639G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129512494G>A" "" "pathogenic (recessive)" "ACMG" "0000370182" "0" "99" "6" "129470244" "129470244" "subst" "4.07083E-6" "00503" "LAMA2_000245" "g.129470244A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129149099A>G" "" "pathogenic (recessive)" "ACMG" "0000370183" "0" "99" "6" "129807768" "129807768" "subst" "0" "00503" "LAMA2_000246" "g.129807768G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486623G>T" "" "pathogenic (recessive)" "ACMG" "0000370184" "0" "99" "6" "129609010" "129609010" "del" "0" "00503" "LAMA2_000247" "g.129609010del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287865del" "" "pathogenic (recessive)" "ACMG" "0000370185" "0" "99" "6" "129634125" "129634125" "del" "0" "00503" "LAMA2_000248" "g.129634125del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129312980del" "" "pathogenic (recessive)" "ACMG" "0000370186" "0" "99" "6" "129636716" "129636716" "del" "0" "00503" "LAMA2_000249" "g.129636716del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315571del" "" "pathogenic (recessive)" "ACMG" "0000370187" "0" "99" "6" "129636939" "129636942" "dup" "0" "00503" "LAMA2_000250" "g.129636939_129636942dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315794_129315797dup" "" "pathogenic (recessive)" "ACMG" "0000370188" "0" "99" "6" "129794498" "129794498" "subst" "4.08343E-6" "00503" "LAMA2_000251" "g.129794498G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129473353G>A" "" "pathogenic (recessive)" "ACMG" "0000370189" "0" "99" "6" "129637293" "129637293" "subst" "0" "00503" "LAMA2_000252" "g.129637293T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316148T>G" "" "pathogenic (recessive)" "ACMG" "0000370190" "0" "99" "6" "129687421" "129687421" "dup" "0" "00503" "LAMA2_000253" "g.129687421dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366276dup" "" "pathogenic (recessive)" "ACMG" "0000370191" "0" "99" "6" "129687498" "129687498" "subst" "0" "00503" "LAMA2_000254" "g.129687498G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366353G>T" "" "pathogenic (recessive)" "ACMG" "0000370192" "0" "99" "6" "129714245" "129714245" "dup" "0" "00503" "LAMA2_000255" "g.129714245dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393100dup" "" "pathogenic (recessive)" "ACMG" "0000370193" "0" "99" "6" "129722473" "129722493" "delins" "0" "00503" "LAMA2_000256" "g.129722473_129722493delinsG" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129401328_129401348delinsG" "" "pathogenic (recessive)" "ACMG" "0000370194" "0" "99" "6" "129551663" "129716081" "del" "0" "00503" "LAMA2_000257" "g.129551663_129716081del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129230518_129394936del" "" "pathogenic (recessive)" "ACMG" "0000370195" "0" "99" "6" "129785435" "129785441" "del" "0" "00503" "LAMA2_000258" "g.129785435_129785441del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464290_129464296del" "" "pathogenic (recessive)" "ACMG" "0000370196" "0" "99" "6" "129591897" "129591897" "subst" "0" "00503" "LAMA2_000259" "g.129591897G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270752G>C" "" "pathogenic (recessive)" "ACMG" "0000370197" "0" "99" "6" "129204503" "129204503" "subst" "0" "00503" "LAMA2_000260" "g.129204503G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883358G>A" "" "pathogenic (recessive)" "ACMG" "0000370198" "0" "99" "6" "129371234" "129371234" "subst" "1.21842E-5" "00503" "LAMA2_000261" "g.129371234G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050089G>A" "" "pathogenic (recessive)" "ACMG" "0000370199" "0" "99" "6" "129381036" "129381036" "subst" "0" "00503" "LAMA2_000262" "g.129381036C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059891C>T" "" "pathogenic (recessive)" "ACMG" "0000370200" "0" "99" "6" "129419391" "129419391" "subst" "8.1217E-6" "00503" "LAMA2_000263" "g.129419391C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098246C>T" "" "pathogenic (recessive)" "ACMG" "0000370201" "0" "99" "6" "129486720" "129486720" "subst" "4.10139E-6" "00503" "LAMA2_000264" "g.129486720G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129165575G>A" "" "pathogenic (recessive)" "ACMG" "0000370202" "0" "99" "6" "129486817" "129486817" "subst" "1.63597E-5" "00503" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "ACMG" "0000370203" "0" "99" "6" "129498849" "129498849" "subst" "4.06379E-6" "00503" "LAMA2_000266" "g.129498849A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177704A>G" "" "pathogenic (recessive)" "ACMG" "0000370204" "0" "99" "6" "129581969" "129581969" "subst" "8.14034E-6" "00503" "LAMA2_000267" "g.129581969T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129260824T>C" "" "pathogenic (recessive)" "ACMG" "0000370205" "0" "55" "6" "129468139" "129468139" "subst" "0" "00503" "LAMA2_000268" "g.129468139G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129146994G>T" "" "VUS" "ACMG" "0000370206" "0" "11" "6" "129475839" "129475839" "subst" "0.00232884" "00503" "LAMA2_000269" "g.129475839C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154694C>T" "" "benign" "ACMG" "0000370207" "0" "55" "6" "129777464" "129777464" "subst" "0" "00503" "LAMA2_000270" "g.129777464A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456319A>G" "" "VUS" "ACMG" "0000370208" "0" "99" "6" "129465223" "129465223" "subst" "0" "00503" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "ACMG" "0000370209" "0" "55" "6" "129835746" "129835746" "subst" "0.000691467" "00503" "LAMA2_000272" "g.129835746T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514601T>C" "" "VUS" "ACMG" "0000370210" "0" "99" "6" "129674307" "129674307" "subst" "0" "00503" "LAMA2_000273" "g.129674307A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353162A>G" "" "pathogenic (recessive)" "ACMG" "0000370211" "0" "77" "6" "129419562" "129419562" "subst" "0" "00503" "LAMA2_000274" "g.129419562T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098417T>A" "" "likely pathogenic (recessive)" "ACMG" "0000370212" "0" "77" "6" "129775416" "129775416" "subst" "0" "00503" "LAMA2_000275" "g.129775416C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129454271C>A" "" "likely pathogenic (recessive)" "ACMG" "0000370213" "0" "77" "6" "129571297" "129571298" "del" "0" "00503" "LAMA2_000276" "g.129571297_129571298del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250152_129250153del" "" "likely pathogenic (recessive)" "ACMG" "0000370214" "0" "99" "6" "129670529" "129670529" "subst" "4.06402E-6" "00503" "LAMA2_000277" "g.129670529G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349384G>A" "" "pathogenic (recessive)" "ACMG" "0000370215" "0" "55" "6" "129419358" "129419358" "subst" "0" "00503" "LAMA2_000278" "g.129419358C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098213C>T" "" "VUS" "ACMG" "0000370216" "0" "99" "6" "129824321" "129824328" "del" "0" "00503" "LAMA2_000280" "g.129824321_129824328del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129503176_129503183del" "" "pathogenic (recessive)" "ACMG" "0000370217" "0" "11" "6" "129498736" "129498736" "subst" "0" "00503" "LAMA2_000281" "g.129498736A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177591A>C" "" "benign" "ACMG" "0000370218" "0" "11" "6" "129511228" "129511228" "subst" "0" "00503" "LAMA2_000282" "g.129511228G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190083G>A" "" "benign" "ACMG" "0000370219" "0" "77" "6" "129835624" "129835624" "dup" "0" "00503" "LAMA2_000283" "g.129835624dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514479dup" "" "likely pathogenic (recessive)" "ACMG" "0000370220" "0" "33" "6" "129802664" "129802664" "subst" "0" "00503" "LAMA2_000284" "g.129802664C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481519C>T" "" "likely benign" "ACMG" "0000370221" "0" "33" "6" "129802716" "129802716" "subst" "0" "00503" "LAMA2_000285" "g.129802716A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129481571A>T" "" "likely benign" "ACMG" "0000370222" "0" "33" "6" "129807532" "129807532" "subst" "0" "00503" "LAMA2_000286" "g.129807532C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486387C>T" "" "likely benign" "ACMG" "0000370223" "0" "33" "6" "129807945" "129807945" "subst" "0" "00503" "LAMA2_000287" "g.129807945C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486800C>T" "" "likely benign" "ACMG" "0000370224" "0" "33" "6" "129823611" "129823611" "subst" "0" "00503" "LAMA2_000288" "g.129823611T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502466T>C" "" "likely benign" "ACMG" "0000370225" "0" "99" "6" "129618880" "129618880" "subst" "0" "00503" "LAMA2_000289" "g.129618880C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297735C>A" "" "pathogenic (recessive)" "ACMG" "0000370226" "0" "99" "6" "129468134" "129468134" "subst" "0" "00503" "LAMA2_000290" "g.129468134G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129146989G>A" "" "pathogenic (recessive)" "ACMG" "0000370227" "0" "99" "6" "129465134" "129465134" "subst" "0" "00503" "LAMA2_000291" "g.129465134T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143989T>C" "" "pathogenic (recessive)" "ACMG" "0000370228" "0" "99" "6" "129687508" "129687508" "delins" "0" "00503" "LAMA2_000292" "g.129687508delinsGGCC" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366363delinsGGCC" "" "pathogenic (recessive)" "ACMG" "0000370229" "0" "99" "6" "129794489" "129794489" "subst" "0.00212545" "00503" "LAMA2_000293" "g.129794489A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129473344A>T" "" "pathogenic (recessive)" "ACMG" "0000370230" "0" "99" "6" "129419305" "129419319" "del" "0" "00503" "LAMA2_000294" "g.129419305_129419319del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098160_129098174del" "" "pathogenic (recessive)" "ACMG" "0000370231" "0" "99" "6" "129419375" "129419375" "subst" "0" "00503" "LAMA2_000295" "g.129419375T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098230T>G" "" "pathogenic (recessive)" "ACMG" "0000370232" "0" "77" "6" "129799877" "129799877" "del" "0" "00503" "LAMA2_000296" "g.129799877del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129478732del" "" "likely pathogenic (recessive)" "ACMG" "0000370233" "0" "99" "6" "129601216" "129601216" "subst" "0" "00503" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "ACMG" "0000370234" "0" "99" "6" "129813631" "129813634" "del" "0" "00503" "LAMA2_000298" "g.129813631_129813634del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492486_129492489del" "" "pathogenic (recessive)" "ACMG" "0000370235" "0" "77" "6" "129573361" "129573361" "subst" "0" "00503" "LAMA2_000300" "g.129573361G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252216G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370236" "0" "77" "6" "129573367" "129573368" "del" "0" "00503" "LAMA2_000301" "g.129573367_129573368del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252222_129252223del" "" "likely pathogenic (recessive)" "ACMG" "0000370237" "0" "55" "6" "129513784" "129513818" "inv" "0" "00503" "LAMA2_000302" "g.129513784_129513818inv" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192639_129192673inv" "" "VUS" "ACMG" "0000370238" "0" "77" "6" "129621997" "129621997" "subst" "0.000125903" "00503" "LAMA2_000303" "g.129621997A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300852A>G" "" "likely pathogenic (recessive)" "ACMG" "0000370239" "0" "55" "6" "129704250" "129704250" "subst" "0" "00503" "LAMA2_000304" "g.129704250C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129383105C>A" "" "VUS" "ACMG" "0000370240" "0" "77" "6" "129470205" "129470205" "subst" "4.06593E-6" "00503" "LAMA2_000305" "g.129470205A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129149060A>T" "" "likely pathogenic (recessive)" "ACMG" "0000370241" "0" "99" "6" "129775343" "129775343" "del" "0" "00503" "LAMA2_000306" "g.129775343del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129454198del" "" "pathogenic (recessive)" "ACMG" "0000370242" "0" "99" "6" "129636625" "129636634" "del" "0" "00503" "LAMA2_000307" "g.129636625_129636634del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315480_129315489del" "" "pathogenic (recessive)" "ACMG" "0000370243" "0" "99" "6" "129637260" "129637260" "subst" "0" "00503" "LAMA2_000308" "g.129637260T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316115T>G" "" "pathogenic (recessive)" "ACMG" "0000370244" "0" "55" "6" "129204502" "129204502" "subst" "0" "00503" "LAMA2_000309" "g.129204502G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883357G>A" "" "VUS" "ACMG" "0000370245" "0" "77" "6" "129608991" "129608991" "subst" "0" "00503" "LAMA2_000310" "g.129608991G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287846G>A" "" "likely pathogenic (recessive)" "ACMG" "0000370246" "0" "77" "6" "129636802" "129636802" "subst" "0" "00503" "LAMA2_000311" "g.129636802T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315657T>A" "" "likely pathogenic (recessive)" "ACMG" "0000370247" "0" "99" "6" "129799959" "129799959" "subst" "0" "00503" "LAMA2_000312" "g.129799959G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129478814G>A" "" "pathogenic (recessive)" "ACMG" "0000370248" "0" "55" "6" "129204374" "129204374" "del" "0" "00503" "LAMA2_000314" "g.129204374del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883229del" "" "VUS" "ACMG" "0000370249" "0" "77" "6" "129371134" "129371134" "subst" "0" "00503" "LAMA2_000315" "g.129371134G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129049989G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370250" "0" "11" "6" "129419303" "129419303" "subst" "0.000296806" "00503" "LAMA2_000316" "g.129419303G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098158G>A" "" "benign" "ACMG" "0000370251" "0" "55" "6" "129419454" "129419454" "subst" "7.31107E-5" "00503" "LAMA2_000317" "g.129419454C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098309C>T" "" "VUS" "ACMG" "0000370252" "0" "11" "6" "129465020" "129465020" "subst" "0.193631" "00503" "LAMA2_000318" "g.129465020G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143875G>A" "" "benign" "ACMG" "0000370253" "0" "55" "6" "129465081" "129465081" "subst" "0.000667714" "00503" "LAMA2_000319" "g.129465081C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143936C>T" "" "VUS" "ACMG" "0000370254" "0" "99" "6" "129465119" "129465119" "subst" "0" "00503" "LAMA2_000320" "g.129465119C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143974C>A" "" "pathogenic (recessive)" "ACMG" "0000370255" "0" "99" "6" "129468114" "129468114" "subst" "8.1477E-6" "00503" "LAMA2_000321" "g.129468114C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129146969C>T" "" "pathogenic (recessive)" "ACMG" "0000370256" "0" "55" "6" "129498947" "129498947" "subst" "0.00144678" "00503" "LAMA2_000323" "g.129498947C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177802C>G" "" "VUS" "ACMG" "0000370257" "0" "33" "6" "129511415" "129511415" "subst" "0.00500008" "00503" "LAMA2_000324" "g.129511415T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190270T>C" "" "likely benign" "ACMG" "0000370258" "0" "77" "6" "129513828" "129513828" "subst" "0" "00503" "LAMA2_000325" "g.129513828C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192683C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370259" "0" "55" "6" "129513917" "129513917" "subst" "0.00169336" "00503" "LAMA2_000326" "g.129513917C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192772C>T" "" "VUS" "ACMG" "0000370260" "0" "55" "6" "129573428" "129573428" "subst" "2.03565E-5" "00503" "LAMA2_000327" "g.129573428A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252283A>T" "" "VUS" "ACMG" "0000370261" "0" "55" "6" "129581936" "129581936" "subst" "0" "00503" "LAMA2_000328" "g.129581936G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129260791G>A" "" "VUS" "ACMG" "0000370262" "0" "11" "6" "129609237" "129609237" "subst" "0.00891062" "00503" "LAMA2_000329" "g.129609237T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129288092T>C" "" "benign" "ACMG" "0000370263" "0" "33" "6" "129618791" "129618791" "subst" "0.010987" "00503" "LAMA2_000330" "g.129618791T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297646T>C" "" "likely benign" "ACMG" "0000370264" "0" "77" "6" "129634068" "129634068" "subst" "0" "00503" "LAMA2_000331" "g.129634068C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129312923C>A" "" "likely pathogenic (recessive)" "ACMG" "0000370265" "0" "33" "6" "129636678" "129636678" "subst" "0.00309041" "00503" "LAMA2_000332" "g.129636678A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315533A>G" "" "likely benign" "ACMG" "0000370266" "0" "77" "6" "129670493" "129670493" "subst" "0.00370939" "00503" "LAMA2_000333" "g.129670493C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349348C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370267" "0" "33" "6" "129670548" "129670548" "subst" "0.0888911" "00503" "LAMA2_000334" "g.129670548C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349403C>T" "" "likely benign" "ACMG" "0000370268" "0" "33" "6" "129704396" "129704396" "subst" "0.00569303" "00503" "LAMA2_000335" "g.129704396A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129383251A>G" "" "likely benign" "ACMG" "0000370269" "0" "55" "6" "129714202" "129714202" "subst" "0.0006543" "00503" "LAMA2_000336" "g.129714202C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393057C>T" "" "VUS" "ACMG" "0000370270" "0" "55" "6" "129714235" "129714235" "subst" "0.000659808" "00503" "LAMA2_000337" "g.129714235G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393090G>A" "" "VUS" "ACMG" "0000370271" "0" "55" "6" "129723520" "129723520" "subst" "2.03403E-5" "00503" "LAMA2_000338" "g.129723520G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402375G>T" "" "VUS" "ACMG" "0000370272" "0" "77" "6" "129723612" "129723618" "del" "8.13425E-6" "00503" "LAMA2_000339" "g.129723612_129723618del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402467_129402473del" "" "likely pathogenic (recessive)" "ACMG" "0000370273" "0" "33" "6" "129723671" "129723671" "subst" "0.0033931" "00503" "LAMA2_000340" "g.129723671T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402526T>C" "" "likely benign" "ACMG" "0000370274" "0" "11" "6" "129724942" "129724942" "subst" "0.484869" "00503" "LAMA2_000341" "g.129724942T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129403797T>A" "" "benign" "ACMG" "0000370275" "0" "11" "6" "129724944" "129724944" "subst" "0.485037" "00503" "LAMA2_000342" "g.129724944C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129403799C>T" "" "benign" "ACMG" "0000370276" "0" "11" "6" "129724945" "129724945" "subst" "0.485016" "00503" "LAMA2_000343" "g.129724945T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129403800T>G" "" "benign" "ACMG" "0000370277" "0" "33" "6" "129749027" "129749027" "subst" "0.0023762" "00503" "LAMA2_000344" "g.129749027T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129427882T>A" "" "likely benign" "ACMG" "0000370278" "0" "77" "6" "129759833" "129759833" "del" "0" "00503" "LAMA2_000345" "g.129759833del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438688del" "" "likely pathogenic (recessive)" "ACMG" "0000370279" "0" "77" "6" "129759860" "129759860" "del" "0" "00503" "LAMA2_000346" "g.129759860del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438715del" "" "likely pathogenic (recessive)" "ACMG" "0000370280" "0" "33" "6" "129761921" "129761921" "subst" "0.00653768" "00503" "LAMA2_000347" "g.129761921C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440776C>G" "" "likely benign" "ACMG" "0000370281" "0" "33" "6" "129762025" "129762025" "subst" "0.000883817" "00503" "LAMA2_000348" "g.129762025T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440880T>C" "" "likely benign" "ACMG" "0000370282" "0" "33" "6" "129762042" "129762042" "subst" "0.006623" "00503" "LAMA2_000349" "g.129762042C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440897C>A" "" "likely benign" "ACMG" "0000370283" "0" "33" "6" "129762109" "129762109" "subst" "0.00347587" "00503" "LAMA2_000350" "g.129762109A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440964A>G" "" "likely benign" "ACMG" "0000370284" "0" "33" "6" "129764217" "129764217" "subst" "0.00643176" "00503" "LAMA2_000351" "g.129764217C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129443072C>T" "" "likely benign" "ACMG" "0000370285" "0" "33" "6" "129764237" "129764237" "subst" "0.00198075" "00503" "LAMA2_000352" "g.129764237C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129443092C>T" "" "likely benign" "ACMG" "0000370286" "0" "33" "6" "129764260" "129764260" "subst" "0.00618476" "00503" "LAMA2_000353" "g.129764260A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129443115A>T" "" "likely benign" "ACMG" "0000370287" "0" "55" "6" "129766859" "129766859" "subst" "7.74088E-5" "00503" "LAMA2_000354" "g.129766859C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129445714C>T" "" "VUS" "ACMG" "0000370288" "0" "55" "6" "129796515" "129796515" "del" "0" "00503" "LAMA2_000356" "g.129796515del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129475370del" "" "VUS" "ACMG" "0000370289" "0" "77" "6" "129799922" "129799922" "del" "0" "00503" "LAMA2_000357" "g.129799922del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "ACMG" "0000370290" "0" "55" "6" "129799958" "129799958" "subst" "0" "00503" "LAMA2_000358" "g.129799958G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129478813G>A" "" "VUS" "ACMG" "0000370291" "0" "99" "6" "129807757" "129807757" "subst" "4.06851E-6" "00503" "LAMA2_000359" "g.129807757C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486612C>T" "" "pathogenic (recessive)" "ACMG" "0000370292" "0" "55" "6" "129813112" "129813112" "subst" "0.000191001" "00503" "LAMA2_000360" "g.129813112C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129491967C>A" "" "VUS" "ACMG" "0000370293" "0" "33" "6" "129813175" "129813175" "subst" "0.0120307" "00503" "LAMA2_000361" "g.129813175T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492030T>C" "" "likely benign" "ACMG" "0000370294" "0" "55" "6" "129823841" "129823841" "subst" "0.000191065" "00503" "LAMA2_000362" "g.129823841T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502696T>C" "" "VUS" "ACMG" "0000370295" "0" "33" "6" "129824406" "129824406" "subst" "0.00551725" "00503" "LAMA2_000363" "g.129824406A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129503261A>G" "" "likely benign" "ACMG" "0000370296" "0" "11" "6" "129826335" "129826335" "subst" "0.00853019" "00503" "LAMA2_000364" "g.129826335T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505190T>C" "" "benign" "ACMG" "0000370297" "0" "77" "6" "129828678" "129828678" "del" "8.13266E-6" "00503" "LAMA2_000365" "g.129828678del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507533del" "" "likely pathogenic (recessive)" "ACMG" "0000370298" "0" "55" "6" "129828831" "129828831" "subst" "0.000309356" "00503" "LAMA2_000366" "g.129828831C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507686C>T" "" "VUS" "ACMG" "0000370299" "0" "55" "6" "129835765" "129835765" "subst" "0.00075937" "00503" "LAMA2_000367" "g.129835765A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514620A>C" "" "VUS" "ACMG" "0000370300" "0" "33" "6" "129837320" "129837320" "subst" "0.0233204" "00503" "LAMA2_000368" "g.129837320C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516175C>A" "" "likely benign" "ACMG" "0000370301" "0" "77" "6" "129837334" "129837334" "subst" "0" "00503" "LAMA2_000369" "g.129837334G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516189G>A" "" "likely pathogenic (recessive)" "ACMG" "0000370302" "0" "55" "6" "129837375" "129837375" "subst" "0" "00503" "LAMA2_000370" "g.129837375C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516230C>G" "" "VUS" "ACMG" "0000370303" "0" "55" "6" "129511429" "129511429" "subst" "0" "00503" "LAMA2_000371" "g.129511429A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190284A>G" "" "VUS" "ACMG" "0000370304" "0" "99" "6" "129712696" "129712696" "del" "0" "00503" "LAMA2_000373" "g.129712696del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391551del" "" "pathogenic (recessive)" "ACMG" "0000370305" "0" "99" "6" "129618848" "129618848" "subst" "0" "00503" "LAMA2_000374" "g.129618848C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297703C>T" "" "pathogenic (recessive)" "ACMG" "0000370306" "0" "99" "6" "129649507" "129649507" "subst" "0" "00503" "LAMA2_000375" "g.129649507C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328362C>T" "" "pathogenic (recessive)" "ACMG" "0000370307" "0" "99" "6" "129419445" "129419455" "dup" "0" "00503" "LAMA2_000377" "g.129419445_129419455dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098300_129098310dup" "" "pathogenic (recessive)" "ACMG" "0000370308" "0" "77" "6" "129807731" "129807731" "subst" "0" "00503" "LAMA2_000378" "g.129807731G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486586G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370309" "0" "77" "6" "129774131" "129774131" "subst" "0" "00503" "LAMA2_000380" "g.129774131A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129452986A>G" "" "likely pathogenic (recessive)" "ACMG" "0000370310" "0" "33" "6" "129380843" "129380844" "ins" "0" "00503" "LAMA2_000382" "g.129380843_129380844insG" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059698_129059699insG" "" "likely benign" "ACMG" "0000370311" "0" "33" "6" "129380844" "129380844" "subst" "0" "00503" "LAMA2_000383" "g.129380844A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059699A>G" "" "likely benign" "ACMG" "0000370312" "0" "77" "6" "129381042" "129381042" "subst" "0" "00503" "LAMA2_000384" "g.129381042G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059897G>A" "" "likely pathogenic (recessive)" "ACMG" "0000370313" "0" "11" "6" "129622257" "129622257" "subst" "0" "00503" "LAMA2_000385" "g.129622257A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129301112A>G" "" "benign" "ACMG" "0000370314" "0" "55" "6" "129663792" "129663792" "subst" "0" "00503" "LAMA2_000386" "g.129663792T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342647T>C" "" "VUS" "ACMG" "0000370315" "0" "11" "6" "129785282" "129785282" "subst" "0" "00503" "LAMA2_000387" "g.129785282G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464137G>A" "" "benign" "ACMG" "0000370316" "0" "55" "6" "129687506" "129687506" "subst" "0" "00503" "LAMA2_000388" "g.129687506G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366361G>A" "" "VUS" "ACMG" "0000370317" "0" "99" "6" "129807768" "129807768" "subst" "0" "00503" "LAMA2_000389" "g.129807768G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486623G>A" "" "pathogenic (recessive)" "ACMG" "0000370318" "0" "99" "6" "129833581" "129833583" "del" "0" "00503" "LAMA2_000390" "g.129833581_129833583del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129512436_129512438del" "" "pathogenic (recessive)" "ACMG" "0000370319" "0" "77" "6" "129419532" "129419532" "subst" "0" "00503" "LAMA2_000391" "g.129419532C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098387C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370320" "0" "77" "6" "129674318" "129674318" "del" "0" "00503" "LAMA2_000392" "g.129674318del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353173del" "" "likely pathogenic (recessive)" "ACMG" "0000370321" "0" "99" "6" "129826383" "129826383" "subst" "0" "00503" "LAMA2_000393" "g.129826383T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505238T>G" "" "pathogenic (recessive)" "ACMG" "0000370322" "0" "99" "6" "129670529" "129670529" "subst" "0" "00503" "LAMA2_000394" "g.129670529G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349384G>C" "" "pathogenic (recessive)" "ACMG" "0000370323" "0" "99" "6" "129588623" "129593933" "del" "0" "00503" "LAMA2_000395" "g.129588623_129593933del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267478_129272788del" "" "pathogenic (recessive)" "ACMG" "0000370324" "0" "99" "6" "129380928" "129486821" "del" "0" "00503" "LAMA2_000396" "g.(129371234_129380928)_(129486821_129498850)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370325" "0" "99" "6" "129641682" "129649558" "dup" "0" "00503" "LAMA2_000397" "g.(129637317_129641682)_(129649558_129663487)dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370326" "0" "99" "6" "129634066" "129634066" "subst" "0" "00503" "LAMA2_000398" "g.129634066T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129312921T>G" "" "pathogenic (recessive)" "ACMG" "0000370327" "0" "77" "6" "129777479" "129777479" "subst" "0" "00503" "LAMA2_000399" "g.129777479G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456334G>T" "" "likely pathogenic (recessive)" "ACMG" "0000370328" "0" "77" "6" "129465218" "129465218" "subst" "0" "00503" "LAMA2_000400" "g.129465218C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129144073C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370329" "0" "99" "6" "129419418" "129419418" "subst" "4.06118E-6" "00503" "LAMA2_000401" "g.129419418G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098273G>A" "" "pathogenic (recessive)" "ACMG" "0000370330" "0" "77" "6" "129376244" "129419170" "delins" "0" "00503" "LAMA2_000402" "g.129376244_129419170delinsA" "" "" "" "c.284-4685_397-146delinsATA" "" "SUMMARY record" "" "" "0" "" "" "g.129055099_129098025delinsA" "" "likely pathogenic (recessive)" "ACMG" "0000370331" "0" "99" "6" "129465227" "129465227" "subst" "0" "00503" "LAMA2_000403" "g.129465227T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129144082T>C" "" "pathogenic (recessive)" "ACMG" "0000370332" "0" "77" "6" "129826353" "129826355" "del" "0" "00503" "LAMA2_000404" "g.129826353_129826355del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505208_129505210del" "" "likely pathogenic (recessive)" "ACMG" "0000370333" "0" "99" "6" "129635908" "129635908" "subst" "0" "00503" "LAMA2_000405" "g.129635908C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129314763C>T" "" "pathogenic (recessive)" "ACMG" "0000370334" "0" "99" "6" "129714218" "129714218" "subst" "0" "00503" "LAMA2_000406" "g.129714218A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393073A>T" "" "pathogenic (recessive)" "ACMG" "0000370335" "0" "99" "6" "129774204" "129774204" "subst" "0" "00503" "LAMA2_000407" "g.129774204C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453059C>G" "" "pathogenic (recessive)" "ACMG" "0000370336" "0" "77" "6" "129591900" "129591900" "subst" "0" "00503" "LAMA2_000408" "g.129591900A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270755A>G" "" "likely pathogenic (recessive)" "ACMG" "0000370337" "0" "99" "6" "129781456" "129781456" "subst" "0" "00503" "LAMA2_000409" "g.129781456G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460311G>T" "" "pathogenic (recessive)" "ACMG" "0000370338" "0" "99" "6" "129591796" "129591796" "dup" "0" "00503" "LAMA2_000410" "g.129591796dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129270651dup" "" "pathogenic (recessive)" "ACMG" "0000370339" "0" "77" "6" "129808499" "129876774" "del" "0" "00503" "LAMA2_000412" "g.129808499_129876774del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129487354_129555629del" "" "likely pathogenic (recessive)" "ACMG" "0000370340" "0" "99" "6" "129371197" "129371197" "subst" "0" "00503" "LAMA2_000413" "g.129371197T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050052T>C" "" "pathogenic (recessive)" "ACMG" "0000370341" "0" "99" "6" "129475744" "129475744" "del" "0" "00503" "LAMA2_000414" "g.129475744del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154599del" "" "pathogenic (recessive)" "ACMG" "0000370342" "0" "99" "6" "129785579" "129785579" "subst" "0" "00503" "LAMA2_000415" "g.129785579T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464434T>A" "" "pathogenic (recessive)" "ACMG" "0000370343" "0" "99" "6" "129824419" "129824419" "subst" "0" "00503" "LAMA2_000416" "g.129824419G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129503274G>A" "" "pathogenic (recessive)" "ACMG" "0000370344" "0" "77" "6" "129573433" "129573433" "subst" "0" "00503" "LAMA2_000417" "g.129573433A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129252288A>G" "" "likely pathogenic (recessive)" "ACMG" "0000370346" "0" "99" "6" "129465058" "129465059" "del" "0" "00503" "LAMA2_000419" "g.129465058_129465059del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143913_129143914del" "" "pathogenic (recessive)" "ACMG" "0000370347" "0" "99" "6" "129670522" "129670522" "subst" "0" "00503" "LAMA2_000420" "g.129670522T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349377T>A" "" "pathogenic (recessive)" "ACMG" "0000370348" "0" "99" "6" "129774169" "129774169" "subst" "0" "00503" "LAMA2_000421" "g.129774169C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453024C>T" "" "pathogenic (recessive)" "ACMG" "0000370349" "0" "99" "6" "129826501" "129826501" "subst" "0" "00503" "LAMA2_000422" "g.129826501G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505356G>A" "" "pathogenic (recessive)" "ACMG" "0000370350" "0" "55" "6" "129588259" "129588259" "subst" "0.00100105" "00503" "LAMA2_000423" "g.129588259G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267114G>T" "" "VUS" "ACMG" "0000370351" "0" "55" "6" "129674425" "129674425" "subst" "3.65678E-5" "00503" "LAMA2_000424" "g.129674425C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353280C>T" "" "VUS" "ACMG" "0000370352" "0" "99" "6" "129419545" "129419545" "del" "0" "00503" "LAMA2_000425" "g.129419545del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098400del" "" "pathogenic (recessive)" "ACMG" "0000370353" "0" "99" "6" "129588248" "129588249" "del" "0" "00503" "LAMA2_000426" "g.129588248_129588249del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267103_129267104del" "" "pathogenic (recessive)" "ACMG" "0000370354" "0" "99" "6" "129826451" "129826451" "subst" "0" "00503" "LAMA2_000427" "g.129826451T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129505306T>C" "" "pathogenic (recessive)" "ACMG" "0000370355" "0" "99" "6" "129618918" "129618918" "dup" "0" "00503" "LAMA2_000428" "g.129618918dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297773dup" "" "pathogenic (recessive)" "ACMG" "0000370356" "0" "99" "6" "129774216" "129774218" "del" "0" "00503" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "ACMG" "0000370357" "0" "99" "6" "129649557" "129649557" "subst" "0" "00503" "LAMA2_000430" "g.129649557G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328412G>A" "" "pathogenic (recessive)" "ACMG" "0000370358" "0" "55" "6" "129835506" "129835506" "subst" "0.00046042" "00503" "LAMA2_000431" "g.129835506C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514361C>G" "" "VUS" "ACMG" "0000370359" "0" "99" "6" "129601200" "129601200" "subst" "1.21937E-5" "00503" "LAMA2_000432" "g.129601200A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129280055A>G" "" "pathogenic (recessive)" "ACMG" "0000370360" "0" "99" "6" "129687417" "129687417" "subst" "0" "00503" "LAMA2_000433" "g.129687417C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366272C>T" "" "pathogenic (recessive)" "ACMG" "0000370361" "0" "99" "6" "129465045" "129465226" "del" "0" "00503" "LAMA2_000434" "g.(129419561_129465045)_(129465226_129468103)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370362" "0" "99" "6" "129663573" "129663573" "subst" "0" "00503" "LAMA2_000435" "g.129663573G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342428G>A" "" "pathogenic (recessive)" "ACMG" "0000370363" "0" "99" "6" "129498902" "129498902" "subst" "0" "00503" "LAMA2_000436" "g.129498902G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177757G>C" "" "pathogenic (recessive)" "ACMG" "0000370364" "0" "99" "6" "129711227" "132942814" "del" "0" "00503" "LAMA2_000437" "g.(129710204_129711227)_(132942814_133179434)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370365" "0" "55" "6" "129419516" "129419516" "subst" "4.0619E-6" "00503" "LAMA2_000438" "g.129419516T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098371T>A" "" "VUS" "ACMG" "0000370366" "0" "99" "6" "129663581" "129663581" "subst" "0" "00503" "LAMA2_000439" "g.129663581T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342436T>C" "" "pathogenic (recessive)" "ACMG" "0000370367" "0" "99" "6" "129691112" "129691112" "subst" "0" "00503" "LAMA2_000440" "g.129691112G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369967G>T" "" "pathogenic (recessive)" "ACMG" "0000370368" "0" "99" "6" "129714215" "129714215" "del" "1.63239E-5" "00503" "LAMA2_000441" "g.129714215del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129393070del" "" "pathogenic (recessive)" "ACMG" "0000370369" "0" "99" "6" "129670530" "129670530" "subst" "0" "00503" "LAMA2_000442" "g.129670530G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349385G>A" "" "pathogenic (recessive)" "ACMG" "0000370370" "0" "99" "6" "129636929" "129636929" "subst" "0" "00503" "LAMA2_000443" "g.129636929T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315784T>G" "" "pathogenic (recessive)" "ACMG" "0000370371" "0" "99" "6" "129762145" "129762145" "subst" "0" "00503" "LAMA2_000444" "g.129762145T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129441000T>C" "" "pathogenic (recessive)" "ACMG" "0000370372" "0" "99" "6" "129712720" "129712723" "del" "0" "00503" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000370373" "0" "99" "6" "129823803" "129833639" "del" "0" "00503" "LAMA2_000446" "g.(129813629_129823803)_(129833639_129835517)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370374" "0" "99" "6" "129381008" "129381008" "subst" "0" "00503" "LAMA2_000447" "g.129381008C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059863C>G" "" "pathogenic (recessive)" "ACMG" "0000370375" "0" "99" "6" "129498850" "129513999" "del" "0" "00503" "LAMA2_000448" "g.(129486821_129498850)_(129513999_129571256)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370376" "0" "99" "6" "129419403" "129419406" "dup" "0" "00503" "LAMA2_000449" "g.129419403_129419406dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098258_129098261dup" "" "pathogenic (recessive)" "ACMG" "0000370377" "0" "99" "6" "129748896" "129777640" "del" "0" "00503" "LAMA2_000450" "g.(129725105_129748896)_(129777640_129781344)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370378" "0" "99" "6" "129813068" "129813068" "subst" "0" "00503" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "ACMG" "0000370379" "0" "99" "6" "129833637" "129833637" "del" "0" "00503" "LAMA2_000452" "g.129833637del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129512492del" "" "pathogenic (recessive)" "ACMG" "0000370380" "0" "99" "6" "129621939" "129621939" "subst" "0" "00503" "LAMA2_000453" "g.129621939C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300794C>A" "" "pathogenic (recessive)" "ACMG" "0000370381" "0" "99" "6" "129419317" "129419561" "del" "0" "00503" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370382" "0" "99" "6" "129609019" "129609019" "del" "0" "00503" "LAMA2_000455" "g.129609019del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287874del" "" "pathogenic (recessive)" "ACMG" "0000370383" "0" "99" "6" "129637317" "129637317" "subst" "0" "00503" "LAMA2_000456" "g.129637317G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316172G>A" "" "pathogenic (recessive)" "ACMG" "0000370384" "0" "99" "6" "129618932" "129618932" "dup" "0" "00503" "LAMA2_000457" "g.129618932dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297787dup" "" "pathogenic (recessive)" "ACMG" "0000370385" "0" "99" "6" "129824233" "129824233" "subst" "0" "00503" "LAMA2_000458" "g.129824233C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129503088C>G" "" "pathogenic (recessive)" "ACMG" "0000370386" "0" "99" "6" "129637213" "129637213" "subst" "0" "00503" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "ACMG" "0000370387" "0" "99" "6" "129371062" "129381042" "del" "0" "00503" "LAMA2_000460" "g.(129204503_129371062)_(129381042_129419317)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370388" "0" "99" "6" "129704379" "129704379" "subst" "4.1587E-6" "00503" "LAMA2_000461" "g.129704379G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129383234G>A" "" "pathogenic (recessive)" "ACMG" "0000370389" "0" "99" "6" "129833507" "129833639" "del" "0" "00503" "LAMA2_000462" "g.(129828788_129833507)_(129833639_129835517)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370390" "0" "99" "6" "129380974" "129380974" "subst" "4.0622E-6" "00503" "LAMA2_000463" "g.129380974G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059829G>A" "" "pathogenic (recessive)" "ACMG" "0000370391" "0" "99" "6" "129634114" "129634114" "subst" "0" "00503" "LAMA2_000464" "g.129634114C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129312969C>T" "" "pathogenic (recessive)" "ACMG" "0000370392" "0" "99" "6" "129475775" "129475776" "del" "0" "00503" "LAMA2_000465" "g.129475775_129475776del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154630_129154631del" "" "pathogenic (recessive)" "ACMG" "0000370393" "0" "99" "6" "129823823" "129823823" "subst" "0" "00503" "LAMA2_000466" "g.129823823C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129502678C>A" "" "pathogenic (recessive)" "ACMG" "0000370394" "0" "99" "6" "129465045" "129465045" "subst" "0" "00503" "LAMA2_000467" "g.129465045G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143900G>C" "" "pathogenic (recessive)" "ACMG" "0000370395" "0" "99" "6" "129601217" "129601217" "subst" "0.0019305" "00503" "LAMA2_000468" "g.129601217C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129280072C>T" "" "pathogenic (recessive)" "ACMG" "0000370396" "0" "99" "6" "129785433" "129785433" "subst" "0" "00503" "LAMA2_000469" "g.129785433A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464288A>G" "" "pathogenic (recessive)" "ACMG" "0000370397" "0" "99" "6" "129807767" "129807767" "subst" "0" "00503" "LAMA2_000470" "g.129807767G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486622G>C" "" "pathogenic (recessive)" "ACMG" "0000370398" "0" "99" "6" "129637189" "129637189" "subst" "0" "00503" "LAMA2_000471" "g.129637189T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129316044T>G" "" "pathogenic (recessive)" "ACMG" "0000370399" "0" "99" "6" "129618931" "129618931" "subst" "0" "00503" "LAMA2_000472" "g.129618931G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297786G>A" "" "pathogenic (recessive)" "ACMG" "0000370400" "0" "99" "6" "129371234" "129371234" "subst" "0" "00503" "LAMA2_000473" "g.129371234G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050089G>C" "" "pathogenic (recessive)" "ACMG" "0000370401" "0" "99" "6" "129511435" "129511435" "subst" "0" "00503" "LAMA2_000474" "g.129511435G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190290G>A" "" "pathogenic (recessive)" "ACMG" "0000370402" "0" "99" "6" "129636608" "129636608" "subst" "2.03074E-5" "00503" "LAMA2_000475" "g.129636608T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315463T>A" "" "pathogenic (recessive)" "ACMG" "0000370403" "0" "99" "6" "129691062" "129691062" "del" "0" "00503" "LAMA2_000476" "g.129691062del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369917del" "" "pathogenic (recessive)" "ACMG" "0000370404" "0" "99" "6" "129663485" "129663485" "subst" "0" "00503" "LAMA2_000477" "g.129663485C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129342340C>G" "" "pathogenic (recessive)" "ACMG" "0000370405" "0" "99" "6" "129380928" "129419561" "del" "0" "00503" "LAMA2_000478" "g.(129371234_129380928)_(129419561_129465045)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370406" "0" "99" "6" "129813138" "129813138" "del" "0" "00503" "LAMA2_000479" "g.129813138del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129491993del" "" "pathogenic (recessive)" "ACMG" "0000370407" "0" "99" "6" "129781344" "129781470" "del" "0" "00503" "LAMA2_000480" "g.(129777640_129781344)_(129781470_129785434)del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000370408" "0" "55" "6" "129204422" "129204422" "subst" "0" "00503" "LAMA2_000482" "g.129204422T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883277T>C" "" "VUS" "ACMG" "0000370409" "0" "77" "6" "129634203" "129634203" "dup" "0" "00503" "LAMA2_000483" "g.129634203dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129313058dup" "" "likely pathogenic (recessive)" "ACMG" "0000370410" "0" "55" "6" "129775433" "129775433" "subst" "0" "00503" "LAMA2_000484" "g.129775433G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129454288G>A" "" "VUS" "ACMG" "0000370411" "0" "55" "6" "129785499" "129785499" "subst" "9.77517E-5" "00503" "LAMA2_000485" "g.129785499C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464354C>T" "" "VUS" "ACMG" "0000370412" "0" "99" "6" "129828655" "129828655" "subst" "0" "00503" "LAMA2_000486" "g.129828655T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507510T>C" "" "pathogenic (recessive)" "ACMG" "0000370413" "0" "99" "6" "129475706" "129475707" "ins" "0" "00503" "LAMA2_000487" "g.129475706_129475707insTT" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129154561_129154562insTT" "" "pathogenic (recessive)" "ACMG" "0000370414" "0" "99" "6" "129833597" "129833597" "subst" "0" "00503" "LAMA2_000488" "g.129833597C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129512452C>T" "" "pathogenic (recessive)" "ACMG" "0000370415" "0" "11" "6" "129636606" "129636606" "subst" "0.00801755" "00503" "LAMA2_000489" "g.129636606T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315461T>G" "" "benign" "ACMG" "0000370416" "0" "77" "6" "129807769" "129807769" "subst" "0" "00503" "LAMA2_000490" "g.129807769T>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129486624T>G" "" "likely pathogenic (recessive)" "ACMG" "0000370417" "0" "55" "6" "129371195" "129371195" "subst" "0" "00503" "LAMA2_000491" "g.129371195A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050050A>T" "" "VUS" "ACMG" "0000370418" "0" "77" "6" "129813630" "129813630" "dup" "0" "00503" "LAMA2_000492" "g.129813630dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129492485dup" "" "likely pathogenic (recessive)" "ACMG" "0000370419" "0" "55" "6" "129609190" "129609190" "subst" "8.53929E-5" "00503" "LAMA2_000493" "g.129609190G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129288045G>A" "" "VUS" "ACMG" "0000370420" "0" "99" "6" "129712698" "129712717" "del" "0" "00503" "LAMA2_000494" "g.129712698_129712717del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391553_129391572del" "" "pathogenic (recessive)" "ACMG" "0000370421" "0" "99" "6" "129704357" "129704357" "subst" "0" "00503" "LAMA2_000495" "g.129704357G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129383212G>T" "" "pathogenic (recessive)" "ACMG" "0000370422" "0" "99" "6" "129774204" "129774204" "subst" "8.1489E-6" "00503" "LAMA2_000496" "g.129774204C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453059C>A" "" "pathogenic (recessive)" "ACMG" "0000370423" "0" "33" "6" "129371205" "129371205" "subst" "0.000507581" "00503" "LAMA2_000497" "g.129371205C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050060C>T" "" "likely benign" "ACMG" "0000370424" "0" "55" "6" "129419312" "129419312" "subst" "0" "00503" "LAMA2_000498" "g.129419312C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098167C>T" "" "VUS" "ACMG" "0000370425" "0" "55" "6" "129419474" "129419474" "subst" "7.31059E-5" "00503" "LAMA2_000499" "g.129419474C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098329C>T" "" "VUS" "ACMG" "0000370426" "0" "55" "6" "129470136" "129470136" "subst" "0.00106875" "00503" "LAMA2_000500" "g.129470136G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129148991G>A" "" "VUS" "ACMG" "0000370427" "0" "55" "6" "129511468" "129511468" "subst" "0.00284855" "00503" "LAMA2_000501" "g.129511468G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129190323G>A" "" "VUS" "ACMG" "0000370428" "0" "55" "6" "129513861" "129513861" "subst" "7.30953E-5" "00503" "LAMA2_000502" "g.129513861C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192716C>T" "" "VUS" "ACMG" "0000370429" "0" "55" "6" "129571374" "129571374" "subst" "1.63243E-5" "00503" "LAMA2_000503" "g.129571374C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129250229C>T" "" "VUS" "ACMG" "0000370430" "0" "55" "6" "129581891" "129581891" "subst" "0.000178865" "00503" "LAMA2_000504" "g.129581891A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129260746A>G" "" "VUS" "ACMG" "0000370431" "0" "11" "6" "129601187" "129601187" "subst" "4.47318E-5" "00503" "LAMA2_000505" "g.129601187C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129280042C>T" "" "benign" "ACMG" "0000370432" "0" "33" "6" "129601231" "129601231" "subst" "0.00543796" "00503" "LAMA2_000506" "g.129601231C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129280086C>T" "" "likely benign" "ACMG" "0000370433" "0" "55" "6" "129609091" "129609091" "subst" "0" "00503" "LAMA2_000507" "g.129609091T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287946T>C" "" "VUS" "ACMG" "0000370434" "0" "55" "6" "129609124" "129609124" "subst" "0.00012997" "00503" "LAMA2_000508" "g.129609124A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129287979A>C" "" "VUS" "ACMG" "0000370435" "0" "55" "6" "129612776" "129612776" "subst" "6.09231E-5" "00503" "LAMA2_000509" "g.129612776G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129291631G>A" "" "VUS" "ACMG" "0000370436" "0" "55" "6" "129612779" "129612779" "subst" "0" "00503" "LAMA2_000510" "g.129612779G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129291634G>T" "" "VUS" "ACMG" "0000370437" "0" "55" "6" "129618817" "129618817" "subst" "0.000308795" "00503" "LAMA2_000511" "g.129618817C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297672C>T" "" "VUS" "ACMG" "0000370438" "0" "55" "6" "129618850" "129618850" "subst" "9.34185E-5" "00503" "LAMA2_000512" "g.129618850A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297705A>G" "" "VUS" "ACMG" "0000370439" "0" "55" "6" "129621987" "129621987" "subst" "4.06144E-6" "00503" "LAMA2_000513" "g.129621987C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129300842C>T" "" "VUS" "ACMG" "0000370440" "0" "55" "6" "129670476" "129670476" "subst" "0.00552536" "00503" "LAMA2_000515" "g.129670476C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349331C>T" "" "VUS" "ACMG" "0000370441" "0" "55" "6" "129687408" "129687408" "subst" "8.95226E-5" "00503" "LAMA2_000516" "g.129687408C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129366263C>T" "" "VUS" "ACMG" "0000370442" "0" "55" "6" "129691111" "129691111" "subst" "0.00086766" "00503" "LAMA2_000517" "g.129691111C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369966C>A" "" "VUS" "ACMG" "0000370443" "0" "55" "6" "129704300" "129704300" "subst" "0.000456763" "00503" "LAMA2_000518" "g.129704300G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129383155G>A" "" "VUS" "ACMG" "0000370444" "0" "55" "6" "129712638" "129712638" "subst" "0.000411536" "00503" "LAMA2_000519" "g.129712638G>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129391493G>C" "" "VUS" "ACMG" "0000370445" "0" "55" "6" "129723539" "129723539" "subst" "0.000561217" "00503" "LAMA2_000520" "g.129723539C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402394C>T" "" "VUS" "ACMG" "0000370446" "0" "55" "6" "129723598" "129723598" "subst" "8.13372E-6" "00503" "LAMA2_000521" "g.129723598G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129402453G>T" "" "VUS" "ACMG" "0000370447" "0" "55" "6" "129759783" "129759783" "subst" "0" "00503" "LAMA2_000522" "g.129759783A>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438638A>T" "" "VUS" "ACMG" "0000370448" "0" "55" "6" "129759786" "129759786" "subst" "0.000241435" "00503" "LAMA2_000523" "g.129759786C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438641C>T" "" "VUS" "ACMG" "0000370449" "0" "55" "6" "129759824" "129759824" "subst" "0.000252671" "00503" "LAMA2_000524" "g.129759824G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438679G>A" "" "VUS" "ACMG" "0000370450" "0" "55" "6" "129759852" "129759852" "subst" "0" "00503" "LAMA2_000525" "g.129759852G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129438707G>T" "" "VUS" "ACMG" "0000370451" "0" "33" "6" "129762036" "129762036" "subst" "0.000790153" "00503" "LAMA2_000526" "g.129762036A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129440891A>G" "" "likely benign" "ACMG" "0000370452" "0" "55" "6" "129774164" "129774164" "subst" "0" "00503" "LAMA2_000527" "g.129774164G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453019G>A" "" "VUS" "ACMG" "0000370453" "0" "55" "6" "129774209" "129774209" "subst" "0.000146628" "00503" "LAMA2_000528" "g.129774209A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129453064A>G" "" "VUS" "ACMG" "0000370454" "0" "55" "6" "129777477" "129777477" "subst" "0.000345894" "00503" "LAMA2_000529" "g.129777477A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456332A>C" "" "VUS" "ACMG" "0000370455" "0" "55" "6" "129777553" "129777553" "subst" "0" "00503" "LAMA2_000530" "g.129777553C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456408C>T" "" "VUS" "ACMG" "0000370456" "0" "55" "6" "129777560" "129777560" "subst" "0.000862216" "00503" "LAMA2_000531" "g.129777560C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456415C>T" "" "VUS" "ACMG" "0000370457" "0" "55" "6" "129781442" "129781444" "del" "0" "00503" "LAMA2_000532" "g.129781442_129781444del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460297_129460299del" "" "VUS" "ACMG" "0000370458" "0" "55" "6" "129786444" "129786444" "subst" "0.000623626" "00503" "LAMA2_000533" "g.129786444T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129465299T>A" "" "VUS" "ACMG" "0000370459" "0" "55" "6" "129828685" "129828685" "subst" "0.000487753" "00503" "LAMA2_000534" "g.129828685C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507540C>T" "" "VUS" "ACMG" "0000370460" "0" "55" "6" "129828704" "129828704" "subst" "0.00136957" "00503" "LAMA2_000535" "g.129828704C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507559C>T" "" "VUS" "ACMG" "0000370461" "0" "77" "6" "129828788" "129828788" "subst" "0" "00503" "LAMA2_000536" "g.129828788G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129507643G>A" "" "likely pathogenic (recessive)" "ACMG" "0000370462" "0" "55" "6" "129835567" "129835567" "subst" "0" "00503" "LAMA2_000537" "g.129835567A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514422A>C" "" "VUS" "ACMG" "0000370463" "0" "55" "6" "129835652" "129835652" "subst" "0.00201511" "00503" "LAMA2_000538" "g.129835652C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129514507C>T" "" "VUS" "ACMG" "0000370464" "0" "99" "6" "129204457" "129204461" "del" "0" "00503" "LAMA2_000539" "g.129204457_129204461del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883312_128883316del" "" "pathogenic (recessive)" "ACMG" "0000370465" "0" "55" "6" "129204502" "129204502" "subst" "0" "00503" "LAMA2_000540" "g.129204502G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.128883357G>T" "" "VUS" "ACMG" "0000370466" "0" "55" "6" "129371099" "129371099" "subst" "3.65453E-5" "00503" "LAMA2_000541" "g.129371099C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129049954C>T" "" "VUS" "ACMG" "0000370467" "0" "55" "6" "129371227" "129371227" "subst" "1.21827E-5" "00503" "LAMA2_000542" "g.129371227C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129050082C>A" "" "VUS" "ACMG" "0000370468" "0" "99" "6" "129380972" "129380972" "subst" "0" "00503" "LAMA2_000543" "g.129380972G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129059827G>A" "" "pathogenic (recessive)" "ACMG" "0000370469" "0" "99" "6" "129419530" "129419530" "subst" "0" "00503" "LAMA2_000544" "g.129419530C>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129098385C>A" "" "pathogenic (recessive)" "ACMG" "0000370470" "0" "99" "6" "129465045" "129465045" "subst" "0" "00503" "LAMA2_000545" "g.129465045G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129143900G>T" "" "pathogenic (recessive)" "ACMG" "0000370471" "0" "55" "6" "129498874" "129498874" "subst" "0" "00503" "LAMA2_000546" "g.129498874T>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129177729T>C" "" "VUS" "ACMG" "0000370472" "0" "77" "6" "129513957" "129513957" "del" "0" "00503" "LAMA2_000547" "g.129513957del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129192812del" "" "likely pathogenic (recessive)" "ACMG" "0000370473" "0" "55" "6" "129588296" "129588296" "subst" "0" "00503" "LAMA2_000548" "g.129588296G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129267151G>A" "" "VUS" "ACMG" "0000370474" "0" "55" "6" "129618847" "129618847" "subst" "1.62458E-5" "00503" "LAMA2_000549" "g.129618847A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129297702A>G" "" "VUS" "ACMG" "0000370475" "0" "77" "6" "129636691" "129636691" "del" "0" "00503" "LAMA2_000550" "g.129636691del" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129315546del" "" "likely pathogenic (recessive)" "ACMG" "0000370476" "0" "99" "6" "129674473" "129674473" "subst" "0" "00503" "LAMA2_000551" "g.129674473G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129353328G>A" "" "pathogenic (recessive)" "ACMG" "0000370477" "0" "77" "6" "129766847" "129766847" "subst" "0" "00503" "LAMA2_000553" "g.129766847C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129445702C>T" "" "likely pathogenic (recessive)" "ACMG" "0000370478" "0" "77" "6" "129777486" "129777486" "dup" "0" "00503" "LAMA2_000554" "g.129777486dup" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129456341dup" "" "likely pathogenic (recessive)" "ACMG" "0000370479" "0" "77" "6" "129786288" "129786288" "subst" "0" "00503" "LAMA2_000555" "g.129786288A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129465143A>G" "" "likely pathogenic (recessive)" "ACMG" "0000370480" "0" "55" "6" "129837549" "129837549" "subst" "0" "00503" "LAMA2_000556" "g.129837549A>C" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129516404A>C" "" "VUS" "ACMG" "0000370481" "0" "55" "6" "129649468" "129649468" "subst" "0" "00503" "LAMA2_000557" "g.129649468C>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129328323C>G" "" "VUS" "ACMG" "0000370482" "0" "55" "6" "129670438" "129670438" "subst" "0.00575796" "00503" "LAMA2_000558" "g.129670438T>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129349293T>A" "" "VUS" "ACMG" "0000370483" "0" "55" "6" "129691085" "129691085" "subst" "6.10764E-5" "00503" "LAMA2_000559" "g.129691085G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369940G>A" "" "VUS" "ACMG" "0000370484" "0" "55" "6" "129691106" "129691106" "subst" "8.14571E-5" "00503" "LAMA2_000560" "g.129691106G>A" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129369961G>A" "" "VUS" "ACMG" "0000370485" "0" "33" "6" "129763368" "129763368" "subst" "0" "00503" "LAMA2_000561" "g.129763368A>G" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129442223A>G" "" "likely benign" "ACMG" "0000370486" "0" "55" "6" "129781422" "129781422" "subst" "0" "00503" "LAMA2_000562" "g.129781422G>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129460277G>T" "" "VUS" "ACMG" "0000370487" "0" "55" "6" "129785560" "129785560" "subst" "0.00018329" "00503" "LAMA2_000563" "g.129785560C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129464415C>T" "" "VUS" "ACMG" "0000370488" "0" "55" "6" "129794482" "129794482" "subst" "2.44798E-5" "00503" "LAMA2_000564" "g.129794482C>T" "" "{PMID:Oliveira 2018:30055037}, {DOI:Oliveira 2018:10.1002/humu.23599}" "" "" "" "SUMMARY record" "" "" "0" "" "" "g.129473337C>T" "" "VUS" "ACMG" "0000403761" "11" "90" "6" "129571267" "129571269" "del" "0" "02521" "LAMA2_000014" "g.129571267_129571269del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129250122_129250124del" "" "pathogenic (recessive)" "" "0000408395" "11" "90" "6" "129612848" "129803512" "dup" "0" "02947" "LAMA2_000569" "g.(129609204_129612848)_(129803512_129807618)dup" "" "{PMID:Giugliano 2018:30373198}" "" "dup ex21-55" "190.6 kb intragenic duplication" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000408396" "21" "90" "6" "129714329" "129714329" "subst" "0" "02947" "LAMA2_000571" "g.129714329G>T" "" "{PMID:Giugliano 2018:30373198}" "" "" "" "Germline" "" "" "0" "" "" "g.129393184G>T" "" "pathogenic (recessive)" "" "0000408397" "10" "90" "6" "129552776" "129715068" "del" "0" "02947" "LAMA2_000567" "g.(129513999_129552776)_(129715068_129722368)del" "" "{PMID:Giugliano 2018:30373198}" "" "g.129552776_129715068del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000408398" "21" "70" "6" "129775325" "129775325" "subst" "1.22015E-5" "02947" "LAMA2_000573" "g.129775325G>A" "" "{PMID:Giugliano 2018:30373198}" "" "" "" "Germline" "" "" "0" "" "" "g.129454180G>A" "" "pathogenic (recessive)" "" "0000408399" "21" "90" "6" "129555369" "129578909" "del" "0" "02947" "LAMA2_000568" "g.(129513999_129555369)_(129578909_129581855)del" "" "{PMID:Giugliano 2018:30373198}" "" "g.129555369_129578909del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000408400" "11" "90" "6" "129663487" "129663487" "subst" "0" "02947" "LAMA2_000570" "g.129663487G>A" "" "{PMID:Giugliano 2018:30373198}" "" "" "" "Germline" "" "" "0" "" "" "g.129342342G>A" "" "pathogenic (recessive)" "" "0000408401" "11" "90" "6" "129419317" "129540205" "dup" "0" "02947" "LAMA2_000566" "g.(129381042_129419317)_(129540205_129571256)dup" "" "{PMID:Giugliano 2018:30373198}" "" "g.129465182_129540205dup" "75 kb intragenic duplication ex4–12" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000408402" "21" "90" "6" "129766969" "129766969" "subst" "0" "02947" "LAMA2_000572" "g.129766969A>C" "" "{PMID:Giugliano 2018:30373198}" "" "" "" "Germline" "" "" "0" "" "" "g.129445824A>C" "" "pathogenic (recessive)" "" "0000439723" "0" "90" "6" "129573308" "129573308" "subst" "0" "03127" "LAMA2_000574" "g.129573308T>C" "" "" "" "" "" "De novo" "yes" "" "0" "" "" "g.129252163T>C" "" "pathogenic" "" "0000439724" "21" "90" "6" "129636608" "129636608" "subst" "2.03074E-5" "03127" "LAMA2_000475" "g.129636608T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315463T>A" "" "pathogenic" "" "0000440017" "0" "50" "6" "129635854" "129635854" "subst" "8.12348E-6" "01164" "LAMA2_000575" "g.129635854G>A" "" "" "" "" "" "Germline" "" "rs754256231" "0" "" "" "g.129314709G>A" "" "VUS" "ACMG" "0000440077" "0" "70" "6" "129837376" "129837376" "subst" "4.06461E-6" "01164" "LAMA2_000078" "g.129837376C>T" "" "" "" "" "unaffected carrier; sister with merosin-neg muscular dystrophy; reported in He 2001. Neurology 57: 1319" "Germline" "" "rs121913571" "0" "" "" "g.129516231C>T" "" "likely pathogenic (recessive)" "ACMG" "0000527110" "0" "30" "6" "129204403" "129204403" "subst" "9.85766E-5" "01804" "LAMA2_000576" "g.129204403G>A" "" "" "" "LAMA2(NM_000426.3):c.13G>A (p.(Ala5Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.128883258G>A" "" "likely benign" "" "0000527111" "0" "90" "6" "129204444" "129204454" "del" "0" "02325" "LAMA2_000577" "g.129204444_129204454del" "" "" "" "LAMA2(NM_000426.4):c.54_64delGGGCGTACAGG (p.G19Afs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.128883299_128883309del" "" "pathogenic" "" "0000527112" "0" "30" "6" "129204464" "129204464" "subst" "0.000380818" "01804" "LAMA2_000578" "g.129204464C>T" "" "" "" "LAMA2(NM_000426.3):c.74C>T (p.(Pro25Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.128883319C>T" "" "likely benign" "" "0000527115" "0" "50" "6" "129470136" "129470136" "subst" "0.00106875" "01943" "LAMA2_000500" "g.129470136G>A" "" "" "" "LAMA2(NM_000426.3):c.922G>A (p.E308K, p.(Glu308Lys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129148991G>A" "" "VUS" "" "0000527116" "0" "30" "6" "129498852" "129498852" "subst" "0.00125973" "01943" "LAMA2_000579" "g.129498852T>G" "" "" "" "LAMA2(NM_000426.3):c.1308T>G (p.G436=, p.(Gly436=)), LAMA2(NM_000426.4):c.1308T>G (p.G436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129177707T>G" "" "likely benign" "" "0000527117" "0" "30" "6" "129498852" "129498852" "subst" "0.00125973" "01804" "LAMA2_000579" "g.129498852T>G" "" "" "" "LAMA2(NM_000426.3):c.1308T>G (p.G436=, p.(Gly436=)), LAMA2(NM_000426.4):c.1308T>G (p.G436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129177707T>G" "" "likely benign" "" "0000527118" "0" "30" "6" "129498852" "129498852" "subst" "0.00125973" "02325" "LAMA2_000579" "g.129498852T>G" "" "" "" "LAMA2(NM_000426.3):c.1308T>G (p.G436=, p.(Gly436=)), LAMA2(NM_000426.4):c.1308T>G (p.G436=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129177707T>G" "" "likely benign" "" "0000527119" "0" "30" "6" "129498944" "129498944" "subst" "0.000170685" "01943" "LAMA2_000580" "g.129498944A>G" "" "" "" "LAMA2(NM_000426.3):c.1400A>G (p.K467R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129177799A>G" "" "likely benign" "" "0000527120" "0" "30" "6" "129511373" "129511373" "subst" "0.0319401" "01804" "LAMA2_000083" "g.129511373T>C" "" "" "" "LAMA2(NM_000426.3):c.1491T>C (p.(=)), LAMA2(NM_000426.4):c.1491T>C (p.C497=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129190228T>C" "" "likely benign" "" "0000527121" "0" "30" "6" "129511415" "129511415" "subst" "0.00500008" "01804" "LAMA2_000324" "g.129511415T>C" "" "" "" "LAMA2(NM_000426.3):c.1533T>C (p.(Asn511=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129190270T>C" "" "likely benign" "" "0000527122" "0" "30" "6" "129513850" "129513850" "subst" "0.00301853" "01804" "LAMA2_000087" "g.129513850T>A" "" "" "" "LAMA2(NM_000426.3):c.1634T>A (p.L545Q, p.(Leu545Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129192705T>A" "" "likely benign" "" "0000527123" "0" "30" "6" "129571272" "129571272" "subst" "0.0138918" "01804" "LAMA2_000090" "g.129571272G>A" "" "" "" "LAMA2(NM_000426.3):c.1798G>A (p.(Gly600Arg), p.G600R), LAMA2(NM_000426.4):c.1798G>A (p.G600R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129250127G>A" "" "likely benign" "" "0000527124" "0" "30" "6" "129573274" "129573274" "subst" "0.00212287" "01804" "LAMA2_000581" "g.129573274C>G" "" "" "" "LAMA2(NM_000426.3):c.1930C>G (p.(His644Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129252129C>G" "" "likely benign" "" "0000527125" "0" "30" "6" "129573291" "129573291" "subst" "2.0325E-5" "01804" "LAMA2_000582" "g.129573291T>C" "" "" "" "LAMA2(NM_000426.3):c.1947T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129252146T>C" "" "likely benign" "" "0000527126" "0" "30" "6" "129601217" "129601217" "subst" "0.0019305" "02325" "LAMA2_000468" "g.129601217C>T" "" "" "" "LAMA2(NM_000426.3):c.2462C>T (p.T821M, p.(Thr821Met)), LAMA2(NM_000426.4):c.2462C>T (p.T821M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129280072C>T" "" "likely benign" "" "0000527128" "0" "50" "6" "129609189" "129609189" "subst" "2.84611E-5" "01943" "LAMA2_000584" "g.129609189C>T" "" "" "" "LAMA2(NM_000426.3):c.2735C>T (p.A912V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129288044C>T" "" "VUS" "" "0000527129" "0" "10" "6" "129612765" "129612765" "subst" "0.0113137" "01804" "LAMA2_000088" "g.129612765G>T" "" "" "" "LAMA2(NM_000426.3):c.2756G>T (p.(Arg919Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129291620G>T" "" "benign" "" "0000527131" "0" "50" "6" "129618966" "129618966" "subst" "0" "01804" "LAMA2_000586" "g.129618966G>T" "" "" "" "LAMA2(NM_000426.3):c.2993G>T (p.(Arg998Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129297821G>T" "" "VUS" "" "0000527132" "0" "30" "6" "129634048" "129634048" "subst" "8.12466E-6" "01943" "LAMA2_000587" "g.129634048A>G" "" "" "" "LAMA2(NM_000426.3):c.3217A>G (p.N1073D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129312903A>G" "" "likely benign" "" "0000527133" "0" "30" "6" "129634062" "129634062" "subst" "4.062E-6" "01804" "LAMA2_000588" "g.129634062C>G" "" "" "" "LAMA2(NM_000426.3):c.3231C>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129312917C>G" "" "likely benign" "" "0000527136" "0" "30" "6" "129634127" "129634127" "subst" "0.00121417" "01804" "LAMA2_000590" "g.129634127A>G" "" "" "" "LAMA2(NM_000426.3):c.3296A>G (p.(Asn1099Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129312982A>G" "" "likely benign" "" "0000527138" "0" "50" "6" "129636771" "129636771" "subst" "4.06095E-6" "01804" "LAMA2_000591" "g.129636771A>G" "" "" "" "LAMA2(NM_000426.3):c.3706A>G (p.(Lys1236Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129315626A>G" "" "VUS" "" "0000527140" "0" "50" "6" "129637235" "129637235" "subst" "2.845E-5" "01943" "LAMA2_000592" "g.129637235G>A" "" "" "" "LAMA2(NM_000426.3):c.3977G>A (p.R1326Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129316090G>A" "" "VUS" "" "0000527141" "0" "30" "6" "129637246" "129637246" "subst" "0" "01804" "LAMA2_000593" "g.129637246T>C" "" "" "" "LAMA2(NM_000426.3):c.3988T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129316101T>C" "" "likely benign" "" "0000527142" "0" "30" "6" "129637308" "129637308" "subst" "0" "01804" "LAMA2_000594" "g.129637308A>G" "" "" "" "LAMA2(NM_000426.3):c.4050A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129316163A>G" "" "likely benign" "" "0000527143" "0" "30" "6" "129670438" "129670438" "subst" "0.00575796" "01804" "LAMA2_000558" "g.129670438T>A" "" "" "" "LAMA2(NM_000426.3):c.4437-5T>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129349293T>A" "" "likely benign" "" "0000527144" "0" "30" "6" "129670476" "129670476" "subst" "0.00552536" "01804" "LAMA2_000515" "g.129670476C>T" "" "" "" "LAMA2(NM_000426.3):c.4470C>T (p.D1490=, p.(Asp1490=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129349331C>T" "" "likely benign" "" "0000527145" "0" "10" "6" "129670493" "129670493" "subst" "0.00370939" "01943" "LAMA2_000333" "g.129670493C>T" "" "" "" "LAMA2(NM_000426.3):c.4487C>T (p.A1496V, p.(Ala1496Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129349348C>T" "" "benign" "" "0000527146" "0" "30" "6" "129670493" "129670493" "subst" "0.00370939" "01804" "LAMA2_000333" "g.129670493C>T" "" "" "" "LAMA2(NM_000426.3):c.4487C>T (p.A1496V, p.(Ala1496Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129349348C>T" "" "likely benign" "" "0000527147" "0" "30" "6" "129670493" "129670493" "subst" "0.00370939" "02327" "LAMA2_000333" "g.129670493C>T" "" "" "" "LAMA2(NM_000426.3):c.4487C>T (p.A1496V, p.(Ala1496Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129349348C>T" "" "likely benign" "" "0000527148" "0" "30" "6" "129674481" "129674481" "subst" "4.87409E-5" "01804" "LAMA2_000595" "g.129674481C>T" "" "" "" "LAMA2(NM_000426.3):c.4696C>T (p.(Arg1566Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129353336C>T" "" "likely benign" "" "0000527149" "0" "30" "6" "129687449" "129687449" "subst" "6.1063E-5" "01943" "LAMA2_000596" "g.129687449G>A" "" "" "" "LAMA2(NM_000426.3):c.4803G>A (p.P1601=, p.(Pro1601=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129366304G>A" "" "likely benign" "" "0000527151" "0" "30" "6" "129712638" "129712638" "subst" "0.000411536" "01943" "LAMA2_000519" "g.129712638G>C" "" "" "" "LAMA2(NM_000426.3):c.5074G>C (p.V1692L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129391493G>C" "" "likely benign" "" "0000527152" "0" "30" "6" "129712669" "129712669" "subst" "0" "01804" "LAMA2_000598" "g.129712669C>G" "" "" "" "LAMA2(NM_000426.3):c.5105C>G (p.(Thr1702Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129391524C>G" "" "likely benign" "" "0000527155" "0" "10" "6" "129722389" "129722389" "subst" "0.493666" "02330" "LAMA2_000045" "g.129722389A>G" "" "" "" "LAMA2(NM_000426.4):c.5466A>G (p.E1822=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401244A>G" "" "benign" "" "0000527156" "0" "10" "6" "129722389" "129722389" "subst" "0.493666" "02325" "LAMA2_000045" "g.129722389A>G" "" "" "" "LAMA2(NM_000426.4):c.5466A>G (p.E1822=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401244A>G" "" "benign" "" "0000527157" "0" "50" "6" "129722453" "129722453" "subst" "0.0104121" "02330" "LAMA2_000092" "g.129722453C>A" "" "" "" "LAMA2(NM_000426.3):c.5530C>A (p.(Arg1844Ser), p.R1844S), LAMA2(NM_000426.4):c.5530C>A (p.R1844S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401308C>A" "" "VUS" "" "0000527158" "0" "30" "6" "129722453" "129722453" "subst" "0.0104121" "02326" "LAMA2_000092" "g.129722453C>A" "" "" "" "LAMA2(NM_000426.3):c.5530C>A (p.(Arg1844Ser), p.R1844S), LAMA2(NM_000426.4):c.5530C>A (p.R1844S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401308C>A" "" "likely benign" "" "0000527159" "0" "30" "6" "129722454" "129722454" "subst" "0.0001711" "01943" "LAMA2_000600" "g.129722454G>A" "" "" "" "LAMA2(NM_000426.3):c.5531G>A (p.R1844H, p.(Arg1844His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401309G>A" "" "likely benign" "" "0000527160" "0" "30" "6" "129722454" "129722454" "subst" "0.0001711" "01804" "LAMA2_000600" "g.129722454G>A" "" "" "" "LAMA2(NM_000426.3):c.5531G>A (p.R1844H, p.(Arg1844His))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401309G>A" "" "likely benign" "" "0000527161" "0" "30" "6" "129723561" "129723561" "subst" "0" "01804" "LAMA2_000601" "g.129723561G>T" "" "" "" "LAMA2(NM_000426.3):c.5655G>T (p.(Lys1885Asn))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129402416G>T" "" "likely benign" "" "0000527162" "0" "50" "6" "129723628" "129723628" "subst" "4.06888E-6" "02327" "LAMA2_000602" "g.129723628G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129402483G>A" "" "VUS" "" "0000527163" "0" "30" "6" "129725074" "129725074" "subst" "0" "01943" "LAMA2_000603" "g.129725074C>G" "" "" "" "LAMA2(NM_000426.3):c.5835C>G (p.A1945=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129403929C>G" "" "likely benign" "" "0000527165" "0" "30" "6" "129762011" "129762011" "subst" "4.07272E-5" "01943" "LAMA2_000605" "g.129762011G>A" "" "" "" "LAMA2(NM_000426.3):c.6136G>A (p.D2046N), LAMA2(NM_000426.4):c.6136G>A (p.D2046N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129440866G>A" "" "likely benign" "" "0000527166" "0" "30" "6" "129774153" "129774153" "subst" "0.00018354" "01804" "LAMA2_000126" "g.129774153A>T" "" "" "" "LAMA2(NM_000426.3):c.6450A>T (p.(Ser2150=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129453008A>T" "" "likely benign" "" "0000527167" "0" "50" "6" "129774269" "129774269" "subst" "0" "01804" "LAMA2_000606" "g.129774269C>A" "" "" "" "LAMA2(NM_000426.3):c.6566C>A (p.(Ala2189Asp))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129453124C>A" "" "VUS" "" "0000527168" "0" "50" "6" "129777604" "129777604" "subst" "0.000134177" "01804" "LAMA2_000607" "g.129777604A>G" "" "" "" "LAMA2(NM_000426.3):c.6832A>G (p.(Met2278Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129456459A>G" "" "VUS" "" "0000527170" "0" "90" "6" "129785598" "129785598" "subst" "0" "02327" "LAMA2_000610" "g.129785598G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129464453G>A" "" "pathogenic" "" "0000527171" "0" "30" "6" "129786365" "129786365" "subst" "2.45054E-5" "01943" "LAMA2_000611" "g.129786365G>A" "" "" "" "LAMA2(NM_000426.3):c.7231G>A (p.V2411I), LAMA2(NM_000426.4):c.7231G>A (p.V2411I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129465220G>A" "" "likely benign" "" "0000527174" "0" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "02327" "LAMA2_000146" "g.129802567C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129481422C>T" "" "pathogenic" "" "0000527175" "0" "10" "6" "129807629" "129807629" "subst" "0.672419" "02330" "LAMA2_000614" "g.129807629C>T" "" "" "" "LAMA2(NM_000426.4):c.7760C>T (p.A2587V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129486484C>T" "" "benign" "" "0000527176" "0" "10" "6" "129807629" "129807629" "subst" "0.672419" "02325" "LAMA2_000614" "g.129807629C>T" "" "" "" "LAMA2(NM_000426.4):c.7760C>T (p.A2587V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129486484C>T" "" "benign" "" "0000527177" "0" "30" "6" "129807663" "129807663" "subst" "0" "01943" "LAMA2_000615" "g.129807663T>C" "" "" "" "LAMA2(NM_000426.3):c.7794T>C (p.H2598=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129486518T>C" "" "likely benign" "" "0000527178" "0" "10" "6" "129813508" "129813508" "subst" "0.00428874" "02330" "LAMA2_000129" "g.129813508T>A" "" "" "" "LAMA2(NM_000426.3):c.8124T>A (p.(Gly2708=)), LAMA2(NM_000426.4):c.8124T>A (p.G2708=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129492363T>A" "" "benign" "" "0000527179" "0" "30" "6" "129813508" "129813508" "subst" "0.00428874" "01804" "LAMA2_000129" "g.129813508T>A" "" "" "" "LAMA2(NM_000426.3):c.8124T>A (p.(Gly2708=)), LAMA2(NM_000426.4):c.8124T>A (p.G2708=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129492363T>A" "" "likely benign" "" "0000527180" "0" "30" "6" "129813552" "129813552" "subst" "8.1412E-6" "01943" "LAMA2_000617" "g.129813552C>G" "" "" "" "LAMA2(NM_000426.3):c.8168C>G (p.A2723G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129492407C>G" "" "likely benign" "" "0000527181" "0" "50" "6" "129813629" "129813629" "subst" "4.07428E-6" "01804" "LAMA2_000150" "g.129813629G>A" "" "" "" "LAMA2(NM_000426.3):c.8244+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129492484G>A" "" "VUS" "" "0000527183" "0" "30" "6" "129824398" "129824398" "subst" "0" "01943" "LAMA2_000619" "g.129824398C>A" "" "" "" "LAMA2(NM_000426.3):c.8520C>A (p.T2840=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129503253C>A" "" "likely benign" "" "0000527184" "0" "70" "6" "129826343" "129826343" "subst" "0" "01943" "LAMA2_000620" "g.129826343A>G" "" "" "" "LAMA2(NM_000426.3):c.8548-2A>G, LAMA2(NM_000426.4):c.8548-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129505198A>G" "" "likely pathogenic" "" "0000527187" "0" "30" "6" "129826488" "129826488" "subst" "0.00399161" "01804" "LAMA2_000072" "g.129826488A>G" "" "" "" "LAMA2(NM_000426.3):c.8691A>G (p.(Arg2897=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129505343A>G" "" "likely benign" "" "0000527188" "0" "30" "6" "129828658" "129828658" "subst" "0.000569254" "01804" "LAMA2_000622" "g.129828658G>A" "" "" "" "LAMA2(NM_000426.3):c.8728G>A (p.V2910I, p.(Val2910Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129507513G>A" "" "likely benign" "" "0000527189" "0" "50" "6" "129833632" "129833632" "subst" "0" "01804" "LAMA2_000623" "g.129833632T>A" "" "" "" "LAMA2(NM_000426.3):c.8982T>A (p.(Asp2994Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129512487T>A" "" "VUS" "" "0000527190" "0" "30" "6" "129833632" "129833632" "subst" "0.000788785" "01804" "LAMA2_000624" "g.129833632T>C" "" "" "" "LAMA2(NM_000426.3):c.8982T>C (p.(Asp2994=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129512487T>C" "" "likely benign" "" "0000527191" "0" "10" "6" "129837320" "129837320" "subst" "0.0233204" "02330" "LAMA2_000368" "g.129837320C>A" "" "" "" "LAMA2(NM_000426.3):c.9212-15C>A (p.(=)), LAMA2(NM_000426.4):c.9212-15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129516175C>A" "" "benign" "" "0000527192" "0" "10" "6" "129837320" "129837320" "subst" "0.0233204" "02326" "LAMA2_000368" "g.129837320C>A" "" "" "" "LAMA2(NM_000426.3):c.9212-15C>A (p.(=)), LAMA2(NM_000426.4):c.9212-15C>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129516175C>A" "" "benign" "" "0000597311" "3" "90" "6" "129371114" "129371114" "del" "0" "00006" "LAMA2_000232" "g.129371114del" "" "{PMID:Özyilmaz 2019:31066050}" "" "c.164delA" "ACMG PVS1, PM2, PP3" "Germline" "" "" "0" "" "" "g.129049969del" "" "pathogenic" "ACMG" "0000609983" "0" "30" "6" "129380951" "129380951" "subst" "4.06256E-5" "02327" "LAMA2_000625" "g.129380951T>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129059806T>A" "" "likely benign" "" "0000609984" "0" "50" "6" "129419329" "129419329" "subst" "4.06253E-6" "02327" "LAMA2_000626" "g.129419329C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129098184C>G" "" "VUS" "" "0000609985" "0" "50" "6" "129419400" "129419400" "subst" "5.68537E-5" "02327" "LAMA2_000627" "g.129419400A>T" "" "" "" "LAMA2(NM_000426.4):c.479A>T (p.(Asp160Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129098255A>T" "" "VUS" "" "0000609986" "0" "50" "6" "129419442" "129419442" "subst" "4.46766E-5" "02327" "LAMA2_000628" "g.129419442C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129098297C>T" "" "VUS" "" "0000609987" "0" "30" "6" "129465153" "129465153" "subst" "8.14571E-6" "02327" "LAMA2_000629" "g.129465153C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129144008C>T" "" "likely benign" "" "0000609989" "0" "50" "6" "129571288" "129571288" "subst" "0.00027649" "01943" "LAMA2_000630" "g.129571288C>T" "" "" "" "LAMA2(NM_000426.3):c.1814C>T (p.T605I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129250143C>T" "" "VUS" "" "0000609990" "0" "30" "6" "129581891" "129581891" "subst" "0.000178865" "02327" "LAMA2_000504" "g.129581891A>G" "" "" "" "LAMA2(NM_000426.3):c.2132A>G (p.Y711C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129260746A>G" "" "likely benign" "" "0000609991" "0" "50" "6" "129588279" "129588279" "subst" "4.06802E-6" "02327" "LAMA2_000631" "g.129588279A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129267134A>G" "" "VUS" "" "0000609992" "0" "30" "6" "129601217" "129601217" "subst" "0.0019305" "02326" "LAMA2_000468" "g.129601217C>T" "" "" "" "LAMA2(NM_000426.3):c.2462C>T (p.T821M, p.(Thr821Met)), LAMA2(NM_000426.4):c.2462C>T (p.T821M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129280072C>T" "" "likely benign" "" "0000609993" "0" "30" "6" "129621987" "129621987" "subst" "4.06144E-6" "02327" "LAMA2_000513" "g.129621987C>T" "" "" "" "LAMA2(NM_000426.3):c.3144C>T (p.T1048=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129300842C>T" "" "likely benign" "" "0000609994" "0" "30" "6" "129621996" "129621996" "subst" "6.4981E-5" "01943" "LAMA2_000633" "g.129621996C>T" "" "" "" "LAMA2(NM_000426.3):c.3153C>T (p.H1051=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129300851C>T" "" "likely benign" "" "0000609995" "0" "30" "6" "129622006" "129622006" "subst" "0" "02327" "LAMA2_000634" "g.129622006A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129300861A>G" "" "likely benign" "" "0000609996" "0" "50" "6" "129634181" "129634181" "subst" "4.06174E-6" "02327" "LAMA2_000635" "g.129634181C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129313036C>T" "" "VUS" "" "0000609997" "0" "30" "6" "129649468" "129649468" "subst" "0" "02327" "LAMA2_000557" "g.129649468C>G" "" "" "" "LAMA2(NM_000426.3):c.4222C>G (p.R1408G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129328323C>G" "" "likely benign" "" "0000609998" "0" "30" "6" "129674506" "129674506" "subst" "6.50126E-5" "02325" "LAMA2_000638" "g.129674506C>T" "" "" "" "LAMA2(NM_000426.4):c.4717+4C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129353361C>T" "" "likely benign" "" "0000609999" "0" "50" "6" "129723598" "129723598" "subst" "8.13372E-6" "02325" "LAMA2_000521" "g.129723598G>T" "" "" "" "LAMA2(NM_000426.3):c.5692G>T (p.A1898S), LAMA2(NM_000426.4):c.5692G>T (p.A1898S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129402453G>T" "" "VUS" "" "0000610000" "0" "30" "6" "129759786" "129759786" "subst" "0.000241435" "02327" "LAMA2_000523" "g.129759786C>T" "" "" "" "LAMA2(NM_000426.4):c.5969-5C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129438641C>T" "" "likely benign" "" "0000610001" "0" "30" "6" "129774128" "129774128" "dup" "0" "02327" "LAMA2_000640" "g.129774128dup" "" "" "" "LAMA2(NM_000426.4):c.6430-5dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129452983dup" "" "likely benign" "" "0000610002" "0" "30" "6" "129775375" "129775375" "subst" "0.000321342" "02327" "LAMA2_000641" "g.129775375G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129454230G>A" "" "likely benign" "" "0000610004" "0" "50" "6" "129785561" "129785561" "subst" "8.14717E-5" "02327" "LAMA2_000643" "g.129785561G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129464416G>A" "" "VUS" "" "0000610005" "0" "30" "6" "129794414" "129794414" "subst" "8.164E-6" "01943" "LAMA2_000644" "g.129794414G>A" "" "" "" "LAMA2(NM_000426.3):c.7356G>A (p.S2452=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129473269G>A" "" "likely benign" "" "0000610006" "0" "50" "6" "129794472" "129794472" "subst" "2.44814E-5" "01943" "LAMA2_000645" "g.129794472G>T" "" "" "" "LAMA2(NM_000426.3):c.7414G>T (p.G2472C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129473327G>T" "" "VUS" "" "0000610007" "0" "50" "6" "129794473" "129794473" "subst" "0.000118337" "01943" "LAMA2_000646" "g.129794473G>T" "" "" "" "LAMA2(NM_000426.3):c.7415G>T (p.G2472V, p.(Gly2472Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129473328G>T" "" "VUS" "" "0000610008" "0" "30" "6" "129813607" "129813607" "subst" "0.000276882" "02327" "LAMA2_000649" "g.129813607G>A" "" "" "" "LAMA2(NM_000426.3):c.8223G>A (p.(Thr2741=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129492462G>A" "" "likely benign" "" "0000610009" "0" "50" "6" "129824345" "129824345" "subst" "8.12975E-5" "02327" "LAMA2_000650" "g.129824345C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129503200C>T" "" "VUS" "" "0000610010" "0" "50" "6" "129824402" "129824402" "subst" "8.13094E-5" "02327" "LAMA2_000651" "g.129824402A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129503257A>G" "" "VUS" "" "0000610013" "0" "30" "6" "129826468" "129826468" "subst" "4.06412E-6" "01804" "LAMA2_000653" "g.129826468C>G" "" "" "" "LAMA2(NM_000426.3):c.8671C>G (p.(Pro2891Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129505323C>G" "" "likely benign" "" "0000610014" "0" "30" "6" "129828658" "129828658" "subst" "0.000569254" "01943" "LAMA2_000622" "g.129828658G>A" "" "" "" "LAMA2(NM_000426.3):c.8728G>A (p.V2910I, p.(Val2910Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129507513G>A" "" "likely benign" "" "0000610015" "0" "50" "6" "129828772" "129828772" "subst" "0.000361645" "02327" "LAMA2_000654" "g.129828772G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129507627G>A" "" "VUS" "" "0000610016" "0" "30" "6" "129837340" "129837340" "subst" "8.12625E-6" "01804" "LAMA2_000655" "g.129837340C>T" "" "" "" "LAMA2(NM_000426.3):c.9217C>T (p.(Leu3073Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129516195C>T" "" "likely benign" "" "0000621628" "0" "50" "6" "129612764" "129612764" "subst" "0.000288451" "01943" "LAMA2_000632" "g.129612764C>T" "" "" "" "LAMA2(NM_000426.3):c.2755C>T (p.R919C, p.(Arg919Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129291619C>T" "" "VUS" "" "0000621629" "0" "30" "6" "129649447" "129649447" "subst" "0" "01943" "LAMA2_000636" "g.129649447C>T" "" "" "" "LAMA2(NM_000426.3):c.4201C>T (p.L1401=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129328302C>T" "" "likely benign" "" "0000621630" "0" "30" "6" "129663525" "129663525" "subst" "0.000215633" "01943" "LAMA2_000637" "g.129663525G>A" "" "" "" "LAMA2(NM_000426.3):c.4349G>A (p.R1450Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129342380G>A" "" "likely benign" "" "0000621632" "0" "30" "6" "129722392" "129722392" "subst" "6.10193E-5" "02325" "LAMA2_000639" "g.129722392C>T" "" "" "" "LAMA2(NM_000426.4):c.5469C>T (p.S1823=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129401247C>T" "" "likely benign" "" "0000621633" "0" "50" "6" "129799923" "129799923" "subst" "3.2564E-5" "02325" "LAMA2_000647" "g.129799923G>A" "" "" "" "LAMA2(NM_000426.4):c.7537G>A (p.D2513N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129478778G>A" "" "VUS" "" "0000621634" "0" "30" "6" "129813606" "129813606" "subst" "2.84926E-5" "01943" "LAMA2_000648" "g.129813606C>T" "" "" "" "LAMA2(NM_000426.3):c.8222C>T (p.T2741M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129492461C>T" "" "likely benign" "" "0000624863" "0" "70" "6" "129573393" "129573394" "del" "0" "03524" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "ACMG" "0000624864" "0" "70" "6" "129674430" "129674430" "subst" "8.12599E-6" "03524" "LAMA2_000041" "g.129674430C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "likely pathogenic (recessive)" "ACMG" "0000624865" "11" "70" "6" "129636783" "129636783" "subst" "0" "03524" "LAMA2_000001" "g.129636783C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129315638C>T" "" "likely pathogenic (recessive)" "ACMG" "0000624866" "21" "70" "6" "129775432" "129775432" "subst" "0" "03524" "LAMA2_000565" "g.129775432A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129454287A>G" "" "likely pathogenic (recessive)" "ACMG" "0000629483" "1" "90" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Reddy 2017:27708273}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "pathogenic (recessive)" "" "0000629484" "1" "90" "6" "129826501" "129826501" "subst" "0" "00006" "LAMA2_000422" "g.129826501G>A" "" "{PMID:Reddy 2017:27708273}" "" "" "" "Germline" "" "" "0" "" "" "g.129505356G>A" "" "pathogenic (recessive)" "" "0000645191" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "1/70 cases" "{PMID:Wang 2019:31404137}" "" "2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "" "0000645192" "21" "90" "6" "129513888" "129513888" "subst" "0" "00006" "LAMA2_000656" "g.129513888C>T" "1/70 cases" "{PMID:Wang 2019:31404137}" "" "" "" "Germline" "" "" "0" "" "" "g.129192743C>T" "" "pathogenic (recessive)" "" "0000645193" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "2/70 cases" "{PMID:Wang 2019:31404137}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "" "0000645194" "21" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "2/70 cases" "{PMID:Wang 2019:31404137}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "" "0000646779" "1" "50" "6" "129670493" "129670493" "subst" "0.00370939" "00006" "LAMA2_000333" "g.129670493C>T" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129349348C>T" "" "VUS" "" "0000646798" "1" "50" "6" "129835674" "129835674" "subst" "9.75063E-5" "00006" "LAMA2_000657" "g.129835674C>G" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129514529C>G" "" "VUS" "" "0000646811" "0" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "1/94 cases" "{PMID:Punetha 2016:27854218}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0000647129" "0" "70" "6" "129581968" "129581968" "subst" "0" "01164" "LAMA2_000658" "g.129581968G>A" "" "" "" "" "Leukoencephalopathy of unknown origin, weakness of the limb girdle, muscular pseudohypertrophy" "Germline" "" "" "0" "" "" "g.129260823G>A" "" "likely pathogenic (recessive)" "ACMG" "0000647130" "0" "50" "6" "129828645" "129828645" "subst" "0" "01164" "LAMA2_000659" "g.129828645C>A" "" "" "" "" "Leukoencephalopathy of unknown origin, weakness of the limb girdle, muscular pseudohypertrophy" "Germline" "" "" "0" "" "" "g.129507500C>A" "" "VUS" "ACMG" "0000651826" "1" "90" "6" "129371134" "129371134" "subst" "0" "03575" "LAMA2_000315" "g.129371134G>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs398123368}" "Germline" "" "rs398123368" "0" "" "" "g.129049989G>T" "" "pathogenic (recessive)" "" "0000651827" "1" "50" "6" "129475707" "129475707" "subst" "0.00020309" "03575" "LAMA2_000660" "g.129475707G>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs182958473}" "Germline" "" "rs182958473" "0" "" "" "g.129154562G>T" "" "VUS" "" "0000651829" "1" "50" "6" "129588259" "129588259" "subst" "0.00100105" "03575" "LAMA2_000423" "g.129588259G>T" "9/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 9 heterozygous; {DB:CLININrs192317605}" "Germline" "" "rs192317605" "0" "" "" "g.129267114G>T" "" "VUS" "" "0000651831" "1" "50" "6" "129601217" "129601217" "subst" "0.0019305" "03575" "LAMA2_000468" "g.129601217C>T" "7/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 7 heterozygous, no homozygous; {DB:CLININrs117422805}" "Germline" "" "rs117422805" "0" "" "" "g.129280072C>T" "" "VUS" "" "0000651832" "1" "30" "6" "129618791" "129618791" "subst" "0.010987" "03575" "LAMA2_000330" "g.129618791T>C" "50/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "50 heterozygous; {DB:CLININrs117096733}" "Germline" "" "rs117096733" "0" "" "" "g.129297646T>C" "" "likely benign" "" "0000651833" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "03575" "LAMA2_000033" "g.129637234C>T" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs398123373}" "Germline" "" "rs398123373" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "" "0000651834" "1" "50" "6" "129641684" "129641684" "subst" "2.84407E-5" "03575" "LAMA2_000661" "g.129641684A>G" "1/2792 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs143674727}" "Germline" "" "rs143674727" "0" "" "" "g.129320539A>G" "" "VUS" "" "0000651835" "1" "10" "6" "129687396" "129687396" "subst" "0.0195317" "03575" "LAMA2_000123" "g.129687396G>A" "42/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "42 heterozygous, no homozygous; {DB:CLININrs117781224}" "Germline" "" "rs117781224" "0" "" "" "g.129366251G>A" "" "benign" "" "0000651836" "1" "50" "6" "129762081" "129762081" "subst" "0.000407136" "03575" "LAMA2_000663" "g.129762081A>G" "18/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 18 heterozygous, no homozygous; {DB:CLININrs117884199}" "Germline" "" "rs117884199" "0" "" "" "g.129440936A>G" "" "VUS" "" "0000651837" "1" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "03575" "LAMA2_000082" "g.129785589C>T" "1/2793 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs121913576}" "Germline" "" "rs121913576" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "" "0000653295" "1" "90" "6" "129759833" "129759833" "del" "0" "03575" "LAMA2_000662" "g.129759833del" "1/2790 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs398123379}" "Germline" "" "rs398123379" "0" "" "" "g.129438688del" "" "pathogenic (recessive)" "" "0000653526" "3" "70" "6" "129486722" "129486722" "del" "0" "01164" "LAMA2_000664" "g.129486722del" "" "" "" "" "ACMG: PVS1,PM2; Progressive muscle weakness, facies myopathica, contractures elbow, CK > 1000 U/l, mild intelligence decrease, leukoencephalopathy, parents consanguin (cousin/cousin 1°)" "Germline" "" "" "0" "" "" "g.129165577del" "" "likely pathogenic (recessive)" "ACMG" "0000655477" "0" "50" "6" "129470160" "129470160" "subst" "0.000170707" "01943" "LAMA2_000665" "g.129470160G>A" "" "" "" "LAMA2(NM_000426.3):c.946G>A (p.D316N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129149015G>A" "" "VUS" "" "0000655478" "0" "30" "6" "129618973" "129618973" "subst" "0" "01943" "LAMA2_000666" "g.129618973C>G" "" "" "" "LAMA2(NM_000426.3):c.3000C>G (p.A1000=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129297828C>G" "" "likely benign" "" "0000655479" "0" "50" "6" "129635920" "129635920" "subst" "0.000442629" "02327" "LAMA2_000667" "g.129635920G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129314775G>A" "" "VUS" "" "0000655480" "0" "50" "6" "129786384" "129786384" "subst" "0.000171501" "01943" "LAMA2_000668" "g.129786384A>G" "" "" "" "LAMA2(NM_000426.3):c.7250A>G (p.H2417R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.129465239A>G" "" "VUS" "" "0000666082" "0" "70" "6" "129581971" "129581986" "del" "0" "03678" "LAMA2_000670" "g.129581971_129581986del" "" "" "" "2208+4_2208+19delAGCTTGCAAGAATGTA" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129260826_129260841del" "" "VUS" "" "0000666083" "0" "70" "6" "129799907" "129799907" "dup" "0" "03678" "LAMA2_000669" "g.129799907dup" "" "" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129478762dup" "" "VUS" "" "0000668313" "11" "70" "6" "129468200" "129468200" "subst" "0" "02119" "LAMA2_000671" "g.129468200A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000668314" "21" "70" "6" "129499013" "129499013" "subst" "0" "02119" "LAMA2_000672" "g.129499013T>C" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "" "0000668315" "0" "50" "6" "129468200" "129468200" "subst" "0" "02119" "LAMA2_000671" "g.129468200A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000668316" "0" "90" "6" "129571327" "129571328" "ins" "0" "02119" "LAMA2_000673" "g.129571327_129571328insACGTGTTC" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000668634" "3" "50" "6" "129468200" "129468200" "subst" "0" "02119" "LAMA2_000671" "g.129468200A>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000668635" "3" "50" "6" "129468200" "129468200" "subst" "0" "02119" "LAMA2_000671" "g.129468200A>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "" "" "VUS" "" "0000669871" "3" "50" "6" "129588259" "129588259" "subst" "0.00100105" "03575" "LAMA2_000423" "g.129588259G>T" "1/2794 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "conflicting interpretations of pathogenicity; 1 homozygous; {DB:CLININrs192317605}" "Germline" "" "rs192317605" "0" "" "" "g.129267114G>T" "" "VUS" "" "0000669872" "3" "30" "6" "129618791" "129618791" "subst" "0.010987" "03575" "LAMA2_000330" "g.129618791T>C" "1/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 homozygous; {DB:CLININrs117096733}" "Germline" "" "rs117096733" "0" "" "" "g.129297646T>C" "" "likely benign" "" "0000670735" "0" "90" "6" "129475706" "129475707" "ins" "0" "00006" "LAMA2_000487" "g.129475706_129475707insTT" "" "{PMID:Yu 2017:28403181}" "" "" "no variant 2nd chromosome" "De novo" "" "" "0" "" "" "g.129154561_129154562insTT" "" "pathogenic (recessive)" "" "0000670753" "1" "90" "6" "129470123" "129470123" "subst" "0" "00006" "LAMA2_000231" "g.129470123G>T" "" "{PMID:Yu 2017:28403181}" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "pathogenic (recessive)" "" "0000677615" "0" "30" "6" "129513837" "129513837" "subst" "0.00164999" "01943" "LAMA2_000674" "g.129513837A>G" "" "" "" "LAMA2(NM_000426.3):c.1621A>G (p.S541G, p.(Ser541Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677616" "0" "90" "6" "129513999" "129513999" "subst" "0" "01804" "LAMA2_000675" "g.129513999G>A" "" "" "" "LAMA2(NM_000426.3):c.1782+1G>A (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000677617" "0" "30" "6" "129581880" "129581880" "subst" "0.000223537" "01943" "LAMA2_000676" "g.129581880C>T" "" "" "" "LAMA2(NM_000426.3):c.2121C>T (p.S707=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000677618" "0" "90" "6" "129663524" "129663524" "subst" "1.22058E-5" "01943" "LAMA2_000208" "g.129663524C>T" "" "" "" "LAMA2(NM_000426.3):c.4348C>T (p.R1450*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000683559" "3" "70" "6" "129573440" "129573440" "subst" "0" "00006" "LAMA2_000677" "g.129573440G>T" "" "{PMID:Anazi 2017:28940097}" "" "" "ACMG PM1,PP1,PM2,PP3" "Germline" "" "" "0" "" "" "g.129252295G>T" "" "likely pathogenic (recessive)" "ACMG" "0000686206" "0" "70" "6" "129571267" "129571269" "del" "0" "01164" "LAMA2_000014" "g.129571267_129571269del" "" "Savarese et al. 2014. Acta Neuropathol Commun 11: 100" "" "" "ACMG grading: PM2,PM3,PM4,PP4" "Germline" "" "" "0" "" "" "g.129250122_129250124del" "" "likely pathogenic" "ACMG" "0000686207" "0" "50" "6" "129419449" "129419449" "subst" "0" "01164" "LAMA2_000678" "g.129419449C>G" "" "" "" "" "ACMG grading: PM2,PP3,PP4" "Germline" "" "" "0" "" "" "" "" "VUS" "ACMG" "0000689616" "0" "50" "6" "129419330" "129419330" "subst" "0.000109675" "01943" "LAMA2_000679" "g.129419330G>A" "" "" "" "LAMA2(NM_000426.3):c.409G>A (p.A137T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689617" "0" "30" "6" "129513866" "129513866" "subst" "0.000263959" "02326" "LAMA2_000680" "g.129513866C>T" "" "" "" "LAMA2(NM_000426.3):c.1650C>T (p.G550=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689618" "0" "30" "6" "129581843" "129581843" "subst" "0.000955393" "02326" "LAMA2_000681" "g.129581843T>C" "" "" "" "LAMA2(NM_000426.3):c.2097-13T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689619" "0" "50" "6" "129601217" "129601217" "subst" "0.0019305" "01943" "LAMA2_000468" "g.129601217C>T" "" "" "" "LAMA2(NM_000426.3):c.2462C>T (p.T821M, p.(Thr821Met)), LAMA2(NM_000426.4):c.2462C>T (p.T821M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689620" "0" "50" "6" "129633984" "129633984" "subst" "8.14837E-6" "02327" "LAMA2_000682" "g.129633984G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689621" "0" "50" "6" "129670446" "129670446" "subst" "4.06319E-6" "01943" "LAMA2_000683" "g.129670446C>A" "" "" "" "LAMA2(NM_000426.3):c.4440C>A (p.F1480L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689622" "0" "30" "6" "129691141" "129691141" "subst" "0.000608084" "02326" "LAMA2_000684" "g.129691141G>T" "" "" "" "LAMA2(NM_000426.3):c.4959+6G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000689623" "0" "50" "6" "129828752" "129828752" "subst" "0" "01943" "LAMA2_000685" "g.129828752G>A" "" "" "" "LAMA2(NM_000426.3):c.8822G>A (p.G2941E), LAMA2(NM_000426.4):c.8822G>A (p.G2941E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000689624" "0" "30" "6" "129835746" "129835746" "subst" "0.000691467" "01943" "LAMA2_000272" "g.129835746T>C" "" "" "" "LAMA2(NM_000426.3):c.9211+6T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000696884" "1" "90" "6" "129777514" "129777514" "del" "0" "00006" "LAMA2_000686" "g.129777514del" "" "{PMID:Magri 2015:26404900}" "" "" "" "Germline" "" "" "0" "" "" "g.129456369del" "" "pathogenic (recessive)" "" "0000696931" "2" "90" "6" "129824422" "129824422" "subst" "0" "00006" "LAMA2_000687" "g.129824422C>G" "" "{PMID:Magri 2015:26404900}" "" "" "" "Germline" "" "" "0" "" "" "g.129503277C>G" "" "pathogenic (recessive)" "" "0000697599" "0" "70" "6" "129468200" "129468200" "subst" "0" "00006" "LAMA2_000671" "g.129468200A>G" "3/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129147055A>G" "" "likely pathogenic" "" "0000697600" "0" "70" "6" "129634066" "129634066" "subst" "0" "00006" "LAMA2_000691" "g.129634066T>C" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129312921T>C" "" "likely pathogenic" "" "0000697601" "0" "70" "6" "129635798" "129635798" "subst" "0" "00006" "LAMA2_000692" "g.129635798A>C" "2/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129314653A>C" "" "likely pathogenic" "" "0000697602" "0" "70" "6" "129419347" "129419355" "del" "0" "00006" "LAMA2_000688" "g.129419347_129419355del" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129098202_129098210del" "" "likely pathogenic" "" "0000697603" "0" "70" "6" "129499010" "129499010" "subst" "0" "00006" "LAMA2_000689" "g.129499010A>G" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129177865A>G" "" "likely pathogenic" "" "0000697604" "0" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic" "" "0000697605" "0" "70" "6" "129609205" "129609205" "dup" "0" "00006" "LAMA2_000690" "g.129609205dup" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129288060dup" "" "likely pathogenic" "" "0000697606" "0" "70" "6" "129634114" "129634114" "subst" "0" "00006" "LAMA2_000464" "g.129634114C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129312969C>T" "" "likely pathogenic" "" "0000697607" "0" "70" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "likely pathogenic" "" "0000697608" "0" "70" "6" "129674429" "129674429" "subst" "0" "00006" "LAMA2_000693" "g.129674429C>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129353284C>A" "" "likely pathogenic" "" "0000697609" "0" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic" "" "0000697610" "0" "70" "6" "129674503" "129674503" "subst" "0" "00006" "LAMA2_000694" "g.129674503G>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129353358G>T" "" "likely pathogenic" "" "0000697611" "0" "70" "6" "129714234" "129714235" "del" "0" "00006" "LAMA2_000695" "g.129714234_129714235del" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129393089_129393090del" "" "likely pathogenic" "" "0000697612" "0" "70" "6" "129714245" "129714245" "dup" "0" "00006" "LAMA2_000255" "g.129714245dup" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129393100dup" "" "likely pathogenic" "" "0000697613" "0" "70" "6" "129775350" "129775350" "subst" "0" "00006" "LAMA2_000696" "g.129775350G>C" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129454205G>C" "" "likely pathogenic" "" "0000697614" "0" "70" "6" "129785482" "129785482" "subst" "0.000114029" "00006" "LAMA2_000697" "g.129785482G>T" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129464337G>T" "" "likely pathogenic" "" "0000697615" "0" "70" "6" "129826451" "129826451" "subst" "0" "00006" "LAMA2_000698" "g.129826451T>A" "1/1001 cases" "{PMID:Topf 2020:32528171}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129505306T>A" "" "likely pathogenic" "" "0000704340" "0" "50" "6" "129687483" "129687483" "subst" "4.07219E-6" "00006" "LAMA2_000699" "g.129687483G>A" "" "{PMID:Isbister 2020:32931854}" "" "" "" "Germline" "" "" "0" "" "" "g.129366338G>A" "" "VUS" "ACMG" "0000708794" "0" "90" "6" "129419448" "129419448" "subst" "0" "03779" "LAMA2_000700" "g.129419448G>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "pathogenic" "" "0000710207" "1" "90" "6" "129511465" "129511465" "dup" "0" "00006" "LAMA2_000701" "g.129511465dup" "" "{PMID:Hong 2020:33333793}" "" "" "ACMG PVS1, PM2, PP3" "Germline" "" "" "0" "" "" "g.129190320dup" "" "pathogenic (recessive)" "" "0000710212" "2" "90" "6" "129781408" "129781408" "subst" "4.07485E-6" "00006" "LAMA2_000702" "g.129781408A>T" "" "{PMID:Hong 2020:33333793}" "" "" "ACMG PVS1, PM2, PP3" "Germline" "" "" "0" "" "" "g.129460263A>T" "" "pathogenic (recessive)" "" "0000720656" "0" "90" "6" "129419419" "129419419" "subst" "4.06114E-6" "02329" "LAMA2_000008" "g.129419419G>A" "" "" "" "LAMA2(NM_000426.4):c.498G>A (p.W166*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000720657" "0" "30" "6" "129465042" "129465042" "subst" "0" "01804" "LAMA2_000703" "g.129465042G>T" "" "" "" "LAMA2(NM_000426.3):c.640-4G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720658" "0" "30" "6" "129581874" "129581874" "subst" "0.000642115" "01943" "LAMA2_000704" "g.129581874T>G" "" "" "" "LAMA2(NM_000426.3):c.2115T>G (p.L705=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720659" "0" "50" "6" "129609198" "129609198" "subst" "0" "01943" "LAMA2_000705" "g.129609198G>A" "" "" "" "LAMA2(NM_000426.3):c.2744G>A (p.C915Y, p.(Cys915Tyr)), LAMA2(NM_000426.4):c.2744G>A (p.C915Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720660" "0" "90" "6" "129636970" "129636992" "del" "0" "02329" "LAMA2_000189" "g.129636970_129636992del" "" "" "" "LAMA2(NM_000426.3):c.3797_3819del (p.(Phe1267AspfsTer11)), LAMA2(NM_000426.4):c.3799_3821delTTCTCTACATATAATCCTCAAGT (p.F1267Dfs*11)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000720661" "0" "90" "6" "129714215" "129714215" "del" "1.63239E-5" "01943" "LAMA2_000441" "g.129714215del" "" "" "" "LAMA2(NM_000426.3):c.5260delG (p.(Val1754*)), LAMA2(NM_000426.3):c.5260delG (p.V1754*), LAMA2(NM_000426.4):c.5260delG (p.V1754*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000720662" "0" "90" "6" "129714215" "129714215" "del" "1.63239E-5" "02329" "LAMA2_000441" "g.129714215del" "" "" "" "LAMA2(NM_000426.3):c.5260delG (p.(Val1754*)), LAMA2(NM_000426.3):c.5260delG (p.V1754*), LAMA2(NM_000426.4):c.5260delG (p.V1754*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000720663" "0" "30" "6" "129722393" "129722393" "subst" "2.84717E-5" "01804" "LAMA2_000706" "g.129722393G>A" "" "" "" "LAMA2(NM_000426.3):c.5470G>A (p.(Gly1824Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720664" "0" "50" "6" "129774133" "129774133" "subst" "6.9574E-5" "02327" "LAMA2_000707" "g.129774133A>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000720665" "0" "30" "6" "129781404" "129781404" "subst" "0.000146712" "01943" "LAMA2_000708" "g.129781404C>T" "" "" "" "LAMA2(NM_000426.3):c.6927C>T (p.D2309=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000720666" "0" "90" "6" "129786405" "129786405" "del" "0" "02329" "LAMA2_000613" "g.129786405del" "" "" "" "LAMA2(NM_000426.4):c.7271delC (p.S2424Yfs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000720667" "0" "90" "6" "129826466" "129826466" "dup" "0" "02329" "LAMA2_000213" "g.129826466dup" "" "" "" "LAMA2(NM_000426.4):c.8669dupT (p.L2890Ffs*16)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000763208" "3" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "00006" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Anazi 2017:27431290}" "" "" "ACMG PVS1, PM2, PP1" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic" "ACMG" "0000763588" "3" "90" "6" "129636695" "129636695" "del" "0" "04047" "LAMA2_000142" "g.129636695del" "" "{PMID:Saat 2021:33963534}" "" "g.432353_432353delT" "" "Germline" "" "" "0" "" "" "g.129315550del" "" "pathogenic (recessive)" "" "0000786908" "1" "50" "6" "129371126" "129371126" "subst" "4.06065E-6" "00006" "LAMA2_000709" "g.129371126G>A" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs748303070" "0" "" "" "g.129049981G>A" "" "VUS" "" "0000786909" "1" "90" "6" "129371200" "129371200" "subst" "1.62429E-5" "00006" "LAMA2_000710" "g.129371200C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "rs868019991" "0" "" "" "g.129050055C>T" "" "pathogenic" "" "0000786910" "1" "70" "6" "129470122" "129470122" "subst" "0" "00006" "LAMA2_000712" "g.129470122A>G" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129148977A>G" "" "likely pathogenic" "" "0000786911" "3" "90" "6" "129498850" "129498850" "subst" "0" "00006" "LAMA2_000713" "g.129498850G>C" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129177705G>C" "" "pathogenic" "" "0000786912" "3" "70" "6" "129513965" "129513965" "subst" "0" "00006" "LAMA2_000714" "g.129513965C>G" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129192820C>G" "" "likely pathogenic" "" "0000786913" "3" "70" "6" "129608992" "129608992" "del" "0" "00006" "LAMA2_000715" "g.129608992del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129287847del" "" "likely pathogenic" "" "0000786914" "1" "70" "6" "129609207" "129609218" "del" "0" "00006" "LAMA2_000716" "g.129609207_129609218del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "no variant 2nd chromosome" "Germline" "" "" "0" "" "" "g.129288062_129288073del" "" "likely pathogenic" "" "0000786915" "0" "50" "6" "129618934" "129618934" "subst" "0" "00006" "LAMA2_000718" "g.129618934C>G" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129297789C>G" "" "VUS" "" "0000786916" "3" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic" "" "0000786917" "3" "90" "6" "129649444" "129649444" "subst" "4.06352E-6" "00006" "LAMA2_000219" "g.129649444C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "pathogenic" "" "0000786918" "1" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic" "" "0000786919" "1" "90" "6" "129807685" "129807685" "del" "0" "00006" "LAMA2_000722" "g.129807685del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129486540del" "" "pathogenic" "" "0000786920" "3" "90" "6" "129813219" "129813220" "del" "0" "00006" "LAMA2_000723" "g.129813219_129813220del" "" "{PMID:Ganapathy 2019:31069529}" "" "" "" "Germline" "" "" "0" "" "" "g.129492074_129492075del" "" "pathogenic" "" "0000787494" "2" "70" "6" "129380932" "129380933" "del" "0" "00000" "LAMA2_000711" "g.129380932_129380933del" "" "0" "" "c.286_287delAG" "" "Germline" "" "" "0" "" "" "g.129059787_129059788del" "" "likely pathogenic" "" "0000787495" "2" "90" "6" "129714315" "129714315" "subst" "0" "00000" "LAMA2_000721" "g.129714315G>A" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.129393170G>A" "" "pathogenic" "" "0000787496" "2" "50" "6" "129622017" "129622017" "subst" "0" "00000" "LAMA2_000719" "g.129622017G>A" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.129300872G>A" "" "VUS" "" "0000787499" "0" "70" "6" "129663524" "129663524" "subst" "1.22058E-5" "00000" "LAMA2_000208" "g.129663524C>T" "" "0" "" "" "" "Germline" "" "rs200923373" "0" "" "" "g.129342379C>T" "" "likely pathogenic" "" "0000787500" "2" "90" "6" "129828697" "129828697" "subst" "0" "00000" "LAMA2_000724" "g.129828697G>T" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.129507552G>T" "" "pathogenic" "" "0000787501" "2" "90" "6" "129826501" "129826501" "subst" "0" "00000" "LAMA2_000422" "g.129826501G>A" "" "0" "" "" "" "Germline" "" "" "0" "" "" "g.129505356G>A" "" "pathogenic" "" "0000787576" "1" "50" "6" "129618889" "129618889" "subst" "1.62487E-5" "00000" "LAMA2_000717" "g.129618889T>G" "" "0" "" "" "" "Germline" "" "rs763840955" "0" "" "" "g.129297744T>G" "{CV-RCV:000654716.1}" "VUS" "" "0000787577" "2" "50" "6" "129649469" "129649469" "subst" "2.03193E-5" "00000" "LAMA2_000720" "g.129649469G>A" "" "0" "" "" "" "Germline" "" "rs751858884" "0" "" "" "g.129328324G>A" "" "VUS" "" "0000788012" "0" "50" "6" "129634075" "129634075" "subst" "0.000186831" "01164" "LAMA2_000589" "g.129634075C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000790038" "1" "70" "6" "129799911" "129799914" "dup" "0" "00006" "LAMA2_000725" "g.129799911_129799914dup" "" "{PMID:Nguyen 2021:34011823}" "" "" "ACMG PM1 PM2 PM4; no genotypes reported" "Germline" "" "" "0" "" "" "g.129478766_129478769dup" "" "likely pathogenic" "" "0000791889" "0" "90" "6" "129807757" "129807757" "subst" "4.06851E-6" "03779" "LAMA2_000359" "g.129807757C>T" "" "" "" "" "" "CLASSIFICATION record" "" "rs727502851" "0" "" "" "" "" "pathogenic" "" "0000795625" "3" "70" "6" "129813631" "129813634" "del" "0" "00000" "LAMA2_000298" "g.129813631_129813634del" "" "{PMID:Nair 2018:30293248}" "" "NM_000426.3:c.8244+3_8244+6del;" "" "Unknown" "?" "" "0" "" "" "g.129492486_129492489del" "" "likely pathogenic" "" "0000802303" "0" "50" "6" "129371186" "129371186" "subst" "0.000133999" "02327" "LAMA2_000726" "g.129371186G>A" "" "" "" "LAMA2(NM_000426.4):c.236G>A (p.R79K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802304" "0" "50" "6" "129419363" "129419363" "subst" "0" "02327" "LAMA2_000727" "g.129419363C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802305" "0" "50" "6" "129674483" "129674483" "subst" "1.21863E-5" "01804" "LAMA2_000728" "g.129674483C>T" "" "" "" "LAMA2(NM_000426.3):c.4698C>T (p.(Arg1566=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802306" "0" "30" "6" "129714360" "129714360" "subst" "3.65785E-5" "01943" "LAMA2_000729" "g.129714360G>T" "" "" "" "LAMA2(NM_000426.3):c.5405G>T (p.R1802L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000802307" "0" "50" "6" "129794473" "129794473" "subst" "0.000118337" "01804" "LAMA2_000646" "g.129794473G>T" "" "" "" "LAMA2(NM_000426.3):c.7415G>T (p.G2472V, p.(Gly2472Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802308" "0" "50" "6" "129813063" "129813063" "subst" "0" "02327" "LAMA2_000730" "g.129813063T>C" "" "" "" "LAMA2(NM_000426.4):c.7916T>C (p.V2639A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000802309" "0" "50" "6" "129823804" "129823804" "subst" "4.06484E-6" "01943" "LAMA2_000618" "g.129823804G>C" "" "" "" "LAMA2(NM_000426.3):c.8245G>C (p.G2749R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000812916" "21" "90" "6" "129513971" "129513971" "del" "0" "04175" "LAMA2_000733" "g.129513971del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129192826del" "" "pathogenic (recessive)" "ACMG" "0000812919" "11" "90" "6" "129837376" "129837376" "subst" "4.06461E-6" "04175" "LAMA2_000078" "g.129837376C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129516231C>T" "" "pathogenic (recessive)" "ACMG" "0000815850" "1" "70" "6" "129637000" "129637000" "subst" "0" "00006" "LAMA2_000227" "g.129637000C>T" "" "{PMID:Nair 2018:30293248}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic" "" "0000815875" "2" "70" "6" "129486814" "129486814" "subst" "0" "00006" "LAMA2_000734" "g.129486814C>T" "" "{PMID:Nair 2018:30293248}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000819186" "3" "90" "6" "129609204" "129609204" "subst" "0" "00006" "LAMA2_000735" "g.129609204G>C" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "g.129288059G>C" "" "pathogenic (recessive)" "ACMG" "0000819274" "0" "50" "6" "129712638" "129712638" "subst" "0.000411536" "00006" "LAMA2_000519" "g.129712638G>C" "" "{PMID:Chakravorty 2020:33250842}" "" "" "" "Germline" "" "" "0" "" "" "" "" "VUS" "" "0000823840" "0" "50" "6" "129766970" "129766970" "subst" "0" "03501" "LAMA2_000739" "g.129766970A>C" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.129445825A>C" "" "VUS" "" "0000823843" "0" "70" "6" "129581890" "129581893" "dup" "0" "03501" "LAMA2_000737" "g.129581890_129581893dup" "" "{PMID:Karthikeyan 2024:39548682}" "" "c.2129_2130insCTAT" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.129260745_129260748dup" "" "likely pathogenic" "" "0000823847" "0" "50" "6" "129636730" "129636730" "subst" "0.000304566" "03501" "LAMA2_000738" "g.129636730A>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.129315585A>G" "" "VUS" "" "0000823866" "0" "50" "6" "129636730" "129636730" "subst" "0.000304566" "03501" "LAMA2_000738" "g.129636730A>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "Novel variant (2021)" "Germline/De novo (untested)" "" "" "0" "" "" "g.129315585A>G" "" "VUS" "" "0000823943" "0" "50" "6" "129601217" "129601217" "subst" "0.0019305" "03501" "LAMA2_000468" "g.129601217C>T" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129280072C>T" "" "VUS" "" "0000823944" "0" "70" "6" "129824274" "129824274" "subst" "3.25121E-5" "03501" "LAMA2_000740" "g.129824274C>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129503129C>G" "" "likely pathogenic" "" "0000823945" "0" "50" "6" "129636730" "129636730" "subst" "0.000304566" "03501" "LAMA2_000738" "g.129636730A>G" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129315585A>G" "" "VUS" "" "0000823965" "0" "50" "6" "129573307" "129573307" "subst" "1.626E-5" "03501" "LAMA2_000736" "g.129573307C>T" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129252162C>T" "" "VUS" "" "0000823992" "0" "50" "6" "129759787" "129759787" "subst" "0.000707723" "03501" "LAMA2_000604" "g.129759787G>A" "" "{PMID:Karthikeyan 2024:39548682}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129438642G>A" "" "VUS" "" "0000831317" "3" "50" "6" "129704300" "129704300" "subst" "0.000456763" "00006" "LAMA2_000518" "g.129704300G>A" "" "{PMID:Patel 2021:34925456}" "" "" "" "Germline" "" "rs373997222" "0" "" "" "g.129383155G>A" "" "VUS" "" "0000833044" "1" "70" "6" "129714401" "129714401" "subst" "0" "00006" "LAMA2_000742" "g.129714401G>A" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.129393256G>A" "" "likely pathogenic" "" "0000833046" "1" "70" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "likely pathogenic" "" "0000833076" "3" "70" "6" "129609038" "129609038" "subst" "0" "00006" "LAMA2_000022" "g.129609038T>C" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.129287893T>C" "" "likely pathogenic" "" "0000833129" "3" "70" "6" "129785499" "129785499" "subst" "9.77517E-5" "00006" "LAMA2_000485" "g.129785499C>T" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.129464354C>T" "" "likely pathogenic" "" "0000833144" "1" "70" "6" "129609038" "129609038" "subst" "0" "00006" "LAMA2_000022" "g.129609038T>C" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.129287893T>C" "" "likely pathogenic" "" "0000833197" "2" "70" "6" "129637186" "129637186" "subst" "0" "00006" "LAMA2_000741" "g.129637186G>T" "" "{PMID:Gonzalez-Quereda 2020:32403337}" "" "" "" "Germline" "" "" "0" "" "" "g.129316041G>T" "" "likely pathogenic" "" "0000851063" "0" "10" "6" "129571272" "129571272" "subst" "0.0138918" "02326" "LAMA2_000090" "g.129571272G>A" "" "" "" "LAMA2(NM_000426.3):c.1798G>A (p.(Gly600Arg), p.G600R), LAMA2(NM_000426.4):c.1798G>A (p.G600R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000851064" "0" "50" "6" "129618900" "129618900" "subst" "0" "01943" "LAMA2_000745" "g.129618900C>T" "" "" "" "LAMA2(NM_000426.3):c.2927C>T (p.S976L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851065" "0" "50" "6" "129635854" "129635854" "subst" "0" "01943" "LAMA2_000746" "g.129635854G>T" "" "" "" "LAMA2(NM_000426.3):c.3466G>T (p.D1156Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851066" "0" "90" "6" "129674307" "129674307" "subst" "0" "02327" "LAMA2_000273" "g.129674307A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000851067" "0" "30" "6" "129691141" "129691141" "subst" "0.000608084" "01943" "LAMA2_000684" "g.129691141G>T" "" "" "" "LAMA2(NM_000426.3):c.4959+6G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851068" "0" "50" "6" "129725102" "129725102" "subst" "0" "01943" "LAMA2_000750" "g.129725102C>G" "" "" "" "LAMA2(NM_000426.3):c.5863C>G (p.L1955V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000851069" "0" "30" "6" "129777477" "129777477" "subst" "0.000345894" "01943" "LAMA2_000529" "g.129777477A>C" "" "" "" "LAMA2(NM_000426.3):c.6708-3A>C (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000851070" "0" "50" "6" "129835567" "129835567" "subst" "0" "01943" "LAMA2_000537" "g.129835567A>C" "" "" "" "LAMA2(NM_000426.3):c.9038A>C (p.D3013A, p.(Asp3013Ala))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860147" "0" "90" "6" "129465226" "129465226" "subst" "0" "02327" "LAMA2_000743" "g.129465226G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000860148" "0" "30" "6" "129470110" "129470110" "del" "0" "01804" "LAMA2_000744" "g.129470110del" "" "" "" "LAMA2(NM_000426.3):c.910-14del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860149" "0" "50" "6" "129612764" "129612764" "subst" "0.000288451" "01804" "LAMA2_000632" "g.129612764C>T" "" "" "" "LAMA2(NM_000426.3):c.2755C>T (p.R919C, p.(Arg919Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860150" "0" "50" "6" "129637268" "129637268" "subst" "0.000186954" "01943" "LAMA2_000747" "g.129637268A>G" "" "" "" "LAMA2(NM_000426.3):c.4010A>G (p.H1337R), LAMA2(NM_000426.4):c.4010A>G (p.H1337R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860151" "0" "50" "6" "129637268" "129637268" "subst" "0.000186954" "02325" "LAMA2_000747" "g.129637268A>G" "" "" "" "LAMA2(NM_000426.3):c.4010A>G (p.H1337R), LAMA2(NM_000426.4):c.4010A>G (p.H1337R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860152" "0" "30" "6" "129674459" "129674459" "subst" "2.43718E-5" "01943" "LAMA2_000748" "g.129674459C>T" "" "" "" "LAMA2(NM_000426.3):c.4674C>T (p.D1558=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860153" "0" "30" "6" "129687449" "129687449" "subst" "6.1063E-5" "01804" "LAMA2_000596" "g.129687449G>A" "" "" "" "LAMA2(NM_000426.3):c.4803G>A (p.P1601=, p.(Pro1601=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860154" "0" "30" "6" "129712630" "129712630" "del" "0" "01804" "LAMA2_000196" "g.129712630del" "" "" "" "LAMA2(NM_000426.3):c.5072-6del (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860155" "0" "50" "6" "129723587" "129723587" "subst" "0" "01804" "LAMA2_000749" "g.129723587A>G" "" "" "" "LAMA2(NM_000426.3):c.5681A>G (p.(Glu1894Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860156" "0" "30" "6" "129759849" "129759849" "subst" "3.66664E-5" "01943" "LAMA2_000751" "g.129759849T>G" "" "" "" "LAMA2(NM_000426.3):c.6027T>G (p.N2009K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860157" "0" "30" "6" "129762036" "129762036" "subst" "0.000790153" "01943" "LAMA2_000526" "g.129762036A>G" "" "" "" "LAMA2(NM_000426.3):c.6161A>G (p.Q2054R, p.(Gln2054Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860158" "0" "30" "6" "129766882" "129766882" "subst" "8.14697E-6" "01943" "LAMA2_000752" "g.129766882C>T" "" "" "" "LAMA2(NM_000426.3):c.6345C>T (p.P2115=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860159" "0" "50" "6" "129785553" "129785553" "subst" "0.000366476" "01943" "LAMA2_000609" "g.129785553T>G" "" "" "" "LAMA2(NM_000426.3):c.7111T>G (p.F2371V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860160" "0" "30" "6" "129786444" "129786444" "subst" "0.000623626" "01804" "LAMA2_000533" "g.129786444T>A" "" "" "" "LAMA2(NM_000426.3):c.7300+10T>A (p.(=)), LAMA2(NM_000426.4):c.7300+10T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860161" "0" "30" "6" "129794402" "129794402" "subst" "0.000151062" "01804" "LAMA2_000753" "g.129794402T>C" "" "" "" "LAMA2(NM_000426.3):c.7344T>C (p.(Asn2448=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860162" "0" "50" "6" "129802475" "129802475" "subst" "0.000365925" "01804" "LAMA2_000754" "g.129802475G>A" "" "" "" "LAMA2(NM_000426.3):c.7640G>A (p.(Gly2547Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000860163" "0" "30" "6" "129813175" "129813175" "subst" "0.0120307" "01804" "LAMA2_000361" "g.129813175T>C" "" "" "" "LAMA2(NM_000426.3):c.8028T>C (p.(Asn2676=)), LAMA2(NM_000426.4):c.8028T>C (p.N2676=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860164" "0" "30" "6" "129813607" "129813607" "subst" "0.000276882" "01804" "LAMA2_000649" "g.129813607G>A" "" "" "" "LAMA2(NM_000426.3):c.8223G>A (p.(Thr2741=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000860165" "0" "30" "6" "129826383" "129826383" "subst" "0.000711209" "01804" "LAMA2_000130" "g.129826383T>C" "" "" "" "LAMA2(NM_000426.3):c.8586T>C (p.(Tyr2862=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000869853" "11" "70" "3" "129251616" "129251616" "subst" "0" "00000" "RHO_000144" "g.129251616G>T" "" "{PMID:Macke_1993:8317502}" "" "guanosine 4335-to thymidine, GT to TT at the donor splice junction of intron 7" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129532773G>T" "" "likely pathogenic (dominant)" "" "0000869897" "0" "70" "6" "129609172" "129609172" "del" "0" "03320" "LAMA2_000755" "g.129609172del" "" "" "" "2718delT" "" "Germline" "?" "" "0" "" "" "g.129288027del" "" "pathogenic" "ACMG" "0000870233" "11" "70" "3" "129247643" "129247643" "subst" "0" "00000" "RHO_000274" "g.129247643C>G" "" "{PMID:Oh 2000:10980774}" "" "RHO CCC to GCC, Pro23Ala" "heterozygous; no nucleotide annotation, extrapolated from protein and databases" "Germline" "yes" "" "0" "" "" "g.129528800C>G" "" "likely pathogenic (dominant)" "" "0000870581" "0" "70" "3" "129249760" "129249760" "subst" "0" "00000" "RHO_000001" "g.129249760C>T" "" "{PMID:Aleman 2008:18385078}" "" "RHO R135W" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129530917C>T" "" "likely pathogenic (dominant)" "" "0000870593" "0" "70" "3" "129247749" "129247749" "subst" "0" "00000" "RHO_000130" "g.129247749C>G" "" "{PMID:Aleman 2008:18385078}" "" "RHO T58R" "heterozygous" "Germline" "yes" "" "0" "" "" "g.129528906C>G" "" "likely pathogenic (dominant)" "" "0000873905" "0" "10" "6" "129687396" "129687396" "subst" "0.0195317" "00000" "LAMA2_000123" "g.129687396G>A" "" "{PMID:Bell 2011:21228398}" "" "LAMA2 6:129729089 (hg18) het CM030232" "non-causative, heterozygous" "Germline" "?" "" "0" "" "" "g.129366251G>A" "" "benign" "" "0000876270" "11" "90" "6" "129618935" "129618935" "subst" "0" "00006" "LAMA2_000027" "g.129618935C>T" "" "{PMID:Bruels 2022:35734998}" "" "" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "" "0000876271" "21" "90" "6" "129660161" "129663616" "dup" "0" "00006" "LAMA2_000756" "g.129660161_129663616dup" "" "{PMID:Bruels 2022:35734998}" "" "hg38 chr6:129,339,012–129,342,475dup" "" "Germline" "" "" "0" "" "" "g.129339016_129342471dup" "" "pathogenic (recessive)" "" "0000876272" "0" "90" "6" "129608991" "129608991" "subst" "0" "00006" "LAMA2_000184" "g.129608991G>C" "" "{PMID:Bruels 2022:35734998}" "" "" "variant confirmed with long-read sequencing, no variant 2nd chromosome detected" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000877943" "0" "70" "6" "129826353" "129826355" "del" "0" "01164" "LAMA2_000404" "g.129826353_129826355del" "" "" "" "" "ACMG: PM4, PM2_SUP, PM3, PP3" "Germline" "?" "" "0" "" "" "g.129505208_129505210del" "" "likely pathogenic (recessive)" "ACMG" "0000877944" "0" "50" "6" "129468105" "129468105" "subst" "0" "01164" "LAMA2_000757" "g.129468105A>G" "" "" "" "" "ACMG: PM3_SUP, PM2_SUP, PP3" "Germline" "?" "" "" "" "" "" "" "VUS (!)" "ACMG" "0000887032" "0" "50" "6" "129511389" "129511389" "subst" "4.0662E-6" "01804" "LAMA2_000758" "g.129511389G>A" "" "" "" "LAMA2(NM_000426.3):c.1507G>A (p.(Gly503Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887033" "0" "70" "6" "129601204" "129601204" "subst" "3.65791E-5" "01804" "LAMA2_000759" "g.129601204A>G" "" "" "" "LAMA2(NM_000426.3):c.2451-2A>G (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000887034" "0" "50" "6" "129609198" "129609198" "subst" "0" "01804" "LAMA2_000705" "g.129609198G>A" "" "" "" "LAMA2(NM_000426.3):c.2744G>A (p.C915Y, p.(Cys915Tyr)), LAMA2(NM_000426.4):c.2744G>A (p.C915Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000887035" "0" "30" "6" "129618854" "129618854" "subst" "6.09241E-5" "01804" "LAMA2_000760" "g.129618854G>A" "" "" "" "LAMA2(NM_000426.3):c.2881G>A (p.(Ala961Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887036" "0" "30" "6" "129670462" "129670462" "subst" "4.87555E-5" "02327" "LAMA2_000761" "g.129670462G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000887037" "0" "70" "6" "129714215" "129714215" "del" "1.63239E-5" "01804" "LAMA2_000441" "g.129714215del" "" "" "" "LAMA2(NM_000426.3):c.5260delG (p.(Val1754*)), LAMA2(NM_000426.3):c.5260delG (p.V1754*), LAMA2(NM_000426.4):c.5260delG (p.V1754*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000887038" "0" "50" "6" "129775417" "129775417" "subst" "2.03636E-5" "01804" "LAMA2_000762" "g.129775417C>T" "" "" "" "LAMA2(NM_000426.3):c.6691C>T (p.(Arg2231Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000905254" "11" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000905255" "11" "90" "6" "129470123" "129470123" "subst" "0" "00006" "LAMA2_000231" "g.129470123G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "pathogenic (recessive)" "ACMG" "0000905256" "11" "90" "6" "129712776" "129712776" "subst" "0" "00006" "LAMA2_000812" "g.129712776G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129391631G>T" "" "pathogenic (recessive)" "ACMG" "0000905257" "11" "90" "6" "129608991" "129609204" "del" "0" "00006" "LAMA2_000792" "g.(129601293_129608991)_(129609204_129612758)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex19" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905258" "11" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "00006" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "ACMG" "0000905259" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905260" "11" "50" "6" "129833556" "129833556" "subst" "0" "00006" "LAMA2_000833" "g.129833556G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129512411G>C" "" "VUS" "ACMG" "0000905261" "3" "50" "6" "129601217" "129601217" "subst" "0.0019305" "00006" "LAMA2_000468" "g.129601217C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129280072C>T" "" "VUS" "ACMG" "0000905262" "11" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "ACMG" "0000905263" "11" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905264" "11" "70" "6" "129573320" "129573320" "subst" "0" "00006" "LAMA2_000220" "g.129573320C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129252175C>A" "" "likely pathogenic (recessive)" "ACMG" "0000905265" "21" "90" "6" "129649547" "129649547" "subst" "0" "00006" "LAMA2_000806" "g.129649547C>A" "" "{PMID:Tan 2021:34281576}" "" "4031C>A (S1434*)" "" "Germline" "" "" "0" "" "" "g.129328402C>A" "" "pathogenic (recessive)" "ACMG" "0000905266" "3" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905267" "11" "90" "6" "129634110" "129634110" "subst" "0" "00006" "LAMA2_000798" "g.129634110C>A" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129312965C>A" "" "pathogenic (recessive)" "ACMG" "0000905268" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905269" "21" "70" "6" "129759872" "129759875" "del" "0" "00006" "LAMA2_000817" "g.129759872_129759875del" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129438727_129438730del" "" "likely pathogenic (recessive)" "ACMG" "0000905270" "11" "90" "6" "129714245" "129714245" "dup" "0" "00006" "LAMA2_000255" "g.129714245dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5284_5285insG" "" "Germline" "" "" "0" "" "" "g.129393100dup" "" "pathogenic (recessive)" "ACMG" "0000905271" "3" "90" "6" "129371233" "129371233" "subst" "0" "00006" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "ACMG" "0000905272" "11" "90" "6" "129813068" "129813068" "subst" "0" "00006" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "ACMG" "0000905273" "11" "90" "6" "129785433" "129785433" "subst" "0" "00006" "LAMA2_000469" "g.129785433A>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464288A>G" "" "pathogenic (recessive)" "ACMG" "0000905274" "11" "90" "6" "129634114" "129634114" "subst" "0" "00006" "LAMA2_000464" "g.129634114C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129312969C>T" "" "pathogenic (recessive)" "ACMG" "0000905275" "11" "90" "6" "129465223" "129465223" "subst" "0" "00006" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "ACMG" "0000905276" "3" "90" "6" "129380928" "129419561" "del" "0" "00006" "LAMA2_000478" "g.(129371234_129380928)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex3-4" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905277" "11" "90" "6" "129634149" "129634150" "del" "0" "00006" "LAMA2_000800" "g.129634149_129634150del" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129313004_129313005del" "" "pathogenic (recessive)" "ACMG" "0000905278" "11" "70" "6" "129704265" "129704265" "subst" "0" "00006" "LAMA2_000810" "g.129704265A>G" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129383120A>G" "" "likely pathogenic (recessive)" "ACMG" "0000905279" "11" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "ACMG" "0000905280" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905281" "11" "90" "6" "129419403" "129419406" "dup" "0" "00006" "LAMA2_000449" "g.129419403_129419406dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129098258_129098261dup" "" "pathogenic (recessive)" "ACMG" "0000905282" "11" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905283" "11" "70" "6" "129837355" "129837390" "dup" "0" "00006" "LAMA2_000835" "g.129837355_129837390dup" "" "{PMID:Tan 2021:34281576}" "" ".9232_9267dup (L3078Lfs*39)" "" "Germline" "" "" "0" "" "" "g.129516210_129516245dup" "" "likely pathogenic (recessive)" "ACMG" "0000905284" "11" "90" "6" "129813610" "129813610" "del" "0" "00006" "LAMA2_000828" "g.129813610del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.8224delC" "" "Germline" "" "" "0" "" "" "g.129492465del" "" "pathogenic (recessive)" "ACMG" "0000905285" "11" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905286" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905287" "11" "90" "6" "129514000" "129514000" "subst" "0" "00006" "LAMA2_000783" "g.129514000T>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129192855T>G" "" "pathogenic (recessive)" "ACMG" "0000905288" "11" "90" "6" "129813068" "129813068" "subst" "0" "00006" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "ACMG" "0000905289" "11" "90" "6" "129591893" "129591893" "del" "0" "00006" "LAMA2_000790" "g.129591893del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2447delA" "" "Germline" "" "" "0" "" "" "g.129270748del" "" "pathogenic (recessive)" "ACMG" "0000905290" "11" "90" "6" "129380930" "129380933" "del" "0" "00006" "LAMA2_000767" "g.129380930_129380933del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.284-2_c.285delAGAG" "" "Germline" "" "" "0" "" "" "g.129059785_129059788del" "" "pathogenic (recessive)" "ACMG" "0000905291" "11" "90" "6" "129781344" "129781470" "del" "0" "00006" "LAMA2_000480" "g.(129777640_129781344)_(129781470_129785434)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex49" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905292" "11" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905293" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905294" "11" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905295" "11" "50" "6" "129419390" "129419390" "subst" "0" "00006" "LAMA2_000772" "g.129419390T>C" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129098245T>C" "" "VUS" "ACMG" "0000905296" "11" "70" "6" "129486720" "129486821" "del" "0" "00006" "LAMA2_000777" "g.(129475829_129486720)_(129486821_129498850)del" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex9" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic (recessive)" "ACMG" "0000905297" "11" "90" "6" "129774230" "129774231" "del" "0" "00006" "LAMA2_000820" "g.129774230_129774231del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6526_-6527del" "" "Germline" "" "" "0" "" "" "g.129453085_129453086del" "" "pathogenic (recessive)" "ACMG" "0000905298" "11" "90" "6" "129612758" "129612866" "del" "0" "00006" "LAMA2_000793" "g.(129609204_129612758)_(129612866_129618829)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex20" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905299" "11" "90" "6" "129794441" "129794445" "del" "0" "00006" "LAMA2_000824" "g.129794441_129794445del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129473296_129473300del" "" "pathogenic (recessive)" "ACMG" "0000905300" "11" "90" "6" "129781344" "129813223" "del" "0" "00006" "LAMA2_000823" "g.(129777640_129781344)_(129813223_129813459)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex49-57" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905301" "11" "90" "6" "129670528" "129670528" "del" "0" "00006" "LAMA2_000809" "g.129670528del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.4520delA" "" "Germline" "" "" "0" "" "" "g.129349383del" "" "pathogenic (recessive)" "ACMG" "0000905302" "11" "90" "6" "129581965" "129581965" "subst" "0" "00006" "LAMA2_000788" "g.129581965G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129260820G>T" "" "pathogenic (recessive)" "ACMG" "0000905303" "3" "70" "6" "129636802" "129636808" "delins" "0" "00006" "LAMA2_000803" "g.129636802_129636808delinsAAAGAAGGA" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129315657_129315663delinsAAAGAAGGA" "" "likely pathogenic (recessive)" "ACMG" "0000905304" "3" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905305" "11" "50" "6" "129621874" "129621874" "subst" "8.12407E-6" "00006" "LAMA2_000796" "g.129621874G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129300729G>A" "" "VUS" "ACMG" "0000905306" "11" "70" "6" "129511462" "129511462" "subst" "0" "00006" "LAMA2_000132" "g.129511462G>A" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129190317G>A" "" "likely pathogenic (recessive)" "ACMG" "0000905307" "11" "70" "6" "129637316" "129637316" "subst" "0" "00006" "LAMA2_000805" "g.129637316G>A" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316171G>A" "" "likely pathogenic (recessive)" "ACMG" "0000905308" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905309" "11" "90" "6" "129498850" "129513999" "del" "0" "00006" "LAMA2_000448" "g.(129486821_129498850)_(129513999_129571256)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex10-12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905310" "11" "90" "6" "129813138" "129813138" "del" "0" "00006" "LAMA2_000479" "g.129813138del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.7991delG" "" "Germline" "" "" "0" "" "" "g.129491993del" "" "pathogenic (recessive)" "ACMG" "0000905311" "11" "90" "6" "129475775" "129475776" "del" "0" "00006" "LAMA2_000465" "g.129475775_129475776del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.1153_1154delAC" "" "Germline" "" "" "0" "" "" "g.129154630_129154631del" "" "pathogenic (recessive)" "ACMG" "0000905312" "11" "90" "6" "129601281" "129601284" "dup" "0" "00006" "LAMA2_000791" "g.129601281_129601284dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "c.2524_2525insCACG" "" "Germline" "" "" "0" "" "" "g.129280136_129280139dup" "" "pathogenic (recessive)" "ACMG" "0000905313" "11" "90" "6" "129714245" "129714245" "dup" "0" "00006" "LAMA2_000255" "g.129714245dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "c.5284_5285insG" "" "Germline" "" "" "0" "" "" "g.129393100dup" "" "pathogenic (recessive)" "ACMG" "0000905314" "11" "90" "6" "129807757" "129807757" "subst" "4.06851E-6" "00006" "LAMA2_000359" "g.129807757C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486612C>T" "" "pathogenic (recessive)" "ACMG" "0000905315" "11" "90" "6" "129591880" "129591881" "del" "0" "00006" "LAMA2_000789" "g.129591880_129591881del" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129270735_129270736del" "" "pathogenic (recessive)" "ACMG" "0000905316" "11" "90" "6" "129663524" "129663524" "subst" "1.22058E-5" "00006" "LAMA2_000208" "g.129663524C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129342379C>T" "" "pathogenic (recessive)" "ACMG" "0000905317" "11" "90" "6" "129465223" "129465223" "subst" "0" "00006" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "ACMG" "0000905318" "11" "50" "6" "129833556" "129833556" "subst" "0" "00006" "LAMA2_000833" "g.129833556G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129512411G>C" "" "VUS" "ACMG" "0000905319" "3" "90" "6" "129465045" "129465045" "subst" "0" "00006" "LAMA2_000467" "g.129465045G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129143900G>C" "" "pathogenic (recessive)" "ACMG" "0000905320" "11" "90" "6" "129833637" "129833637" "del" "0" "00006" "LAMA2_000452" "g.129833637del" "" "{PMID:Tan 2021:34281576}" "" "c.8987delA" "" "Germline" "" "" "0" "" "" "g.129512492del" "" "pathogenic (recessive)" "ACMG" "0000905321" "11" "90" "6" "129813138" "129813138" "del" "0" "00006" "LAMA2_000479" "g.129813138del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.7991delG" "" "Germline" "" "" "0" "" "" "g.129491993del" "" "pathogenic (recessive)" "ACMG" "0000905322" "11" "90" "6" "129823803" "129833639" "del" "0" "00006" "LAMA2_000446" "g.(129813629_129823803)_(129833639_129835517)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex59-63" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905323" "11" "50" "6" "129813631" "129813634" "del" "0" "00006" "LAMA2_000298" "g.129813631_129813634del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.8244+3_6delAAGT" "" "Germline" "" "" "0" "" "" "g.129492486_129492489del" "" "VUS" "ACMG" "0000905324" "11" "90" "6" "129371062" "129486821" "del" "0" "00006" "LAMA2_000765" "g.(129204503_129371062)_(129486821_129498850)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex2-9" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905325" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905326" "3" "90" "6" "129637213" "129637213" "subst" "0" "00006" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "ACMG" "0000905327" "11" "50" "6" "129511435" "129511435" "subst" "0" "00006" "LAMA2_000474" "g.129511435G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129190290G>A" "" "VUS" "ACMG" "0000905328" "11" "90" "6" "129618931" "129618931" "subst" "0" "00006" "LAMA2_000472" "g.129618931G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129297786G>A" "" "pathogenic (recessive)" "ACMG" "0000905329" "11" "90" "6" "129636608" "129636608" "subst" "2.03074E-5" "00006" "LAMA2_000475" "g.129636608T>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129315463T>A" "" "pathogenic (recessive)" "ACMG" "0000905330" "11" "90" "6" "129498850" "129513999" "dup" "0" "00006" "LAMA2_000778" "g.(129486821_129498850)_(129513999_129571256)dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex10-12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905331" "11" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "ACMG" "0000905332" "21" "90" "6" "129475749" "129475749" "del" "0" "00006" "LAMA2_000776" "g.129475749del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.1123delG" "" "Germline" "" "" "0" "" "" "g.129154604del" "" "pathogenic (recessive)" "ACMG" "0000905333" "21" "90" "6" "129371234" "129371234" "subst" "0" "00006" "LAMA2_000473" "g.129371234G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>C" "" "pathogenic (recessive)" "ACMG" "0000905334" "11" "90" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "pathogenic (recessive)" "ACMG" "0000905335" "11" "90" "6" "129637189" "129637189" "subst" "0" "00006" "LAMA2_000471" "g.129637189T>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316044T>G" "" "pathogenic (recessive)" "ACMG" "0000905336" "3" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905337" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905338" "11" "90" "6" "129371062" "129381042" "del" "0" "00006" "LAMA2_000460" "g.(129204503_129371062)_(129381042_129419317)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex2-3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905339" "11" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905340" "11" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905341" "11" "90" "6" "129371233" "129371233" "subst" "0" "00006" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "ACMG" "0000905342" "11" "90" "6" "129637317" "129637317" "subst" "0" "00006" "LAMA2_000456" "g.129637317G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316172G>A" "" "pathogenic (recessive)" "ACMG" "0000905343" "11" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905344" "3" "90" "6" "129465223" "129465223" "subst" "0" "00006" "LAMA2_000271" "g.129465223A>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129144078A>T" "" "pathogenic (recessive)" "ACMG" "0000905345" "11" "90" "6" "129774216" "129774218" "del" "0" "00006" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6513_6515delTTG" "" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "ACMG" "0000905346" "3" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905347" "11" "50" "6" "129824233" "129824233" "subst" "0" "00006" "LAMA2_000458" "g.129824233C>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129503088C>G" "" "VUS" "ACMG" "0000905348" "11" "90" "6" "129419403" "129419406" "dup" "0" "00006" "LAMA2_000449" "g.129419403_129419406dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129098258_129098261dup" "" "pathogenic (recessive)" "ACMG" "0000905349" "11" "90" "6" "129823803" "129833639" "del" "0" "00006" "LAMA2_000446" "g.(129813629_129823803)_(129833639_129835517)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex59-63" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905350" "11" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905351" "11" "90" "6" "129762145" "129762145" "subst" "0" "00006" "LAMA2_000444" "g.129762145T>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129441000T>C" "" "pathogenic (recessive)" "ACMG" "0000905352" "3" "50" "6" "129663485" "129663485" "subst" "0" "00006" "LAMA2_000477" "g.129663485C>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129342340C>G" "" "VUS" "ACMG" "0000905353" "11" "90" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000829" "g.129823802A>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>T" "" "pathogenic (recessive)" "ACMG" "0000905354" "21" "50" "6" "129419358" "129419358" "subst" "4.06108E-6" "00006" "LAMA2_000769" "g.129419358C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129098213C>A" "" "VUS" "ACMG" "0000905355" "11" "90" "6" "129837434" "129837434" "dup" "0" "00006" "LAMA2_000836" "g.129837434dup" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129516289dup" "" "pathogenic (recessive)" "ACMG" "0000905356" "0" "90" "6" "129828774" "129828775" "ins" "0" "00006" "LAMA2_000832" "g.129828774_129828775insAAGGCTC" "" "{PMID:Tan 2021:34281576}" "" "" "" "De novo" "" "" "0" "" "" "g.129507629_129507630insAAGGCTC" "" "pathogenic (recessive)" "ACMG" "0000905357" "11" "50" "6" "129419358" "129419358" "subst" "4.06108E-6" "00006" "LAMA2_000769" "g.129419358C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129098213C>A" "" "VUS" "ACMG" "0000905358" "11" "50" "6" "129468114" "129468114" "subst" "8.1477E-6" "00006" "LAMA2_000321" "g.129468114C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129146969C>T" "" "VUS" "ACMG" "0000905359" "0" "90" "6" "129813074" "129813074" "del" "0" "00006" "LAMA2_000826" "g.129813074del" "" "{PMID:Tan 2021:34281576}" "" "" "" "De novo" "" "" "0" "" "" "g.129491929del" "" "pathogenic (recessive)" "ACMG" "0000905360" "11" "90" "6" "129621992" "129621992" "del" "0" "00006" "LAMA2_000797" "g.129621992del" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129300847del" "" "pathogenic (recessive)" "ACMG" "0000905361" "11" "90" "6" "129486814" "129486814" "subst" "0" "00006" "LAMA2_000734" "g.129486814C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129165669C>T" "" "pathogenic (recessive)" "ACMG" "0000905362" "11" "90" "6" "129711227" "132942814" "del" "0" "00006" "LAMA2_000437" "g.(129710204_129711227)_(132942814_133179434)del" "" "{PMID:Ding 2016:26304763}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex36-65" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905363" "11" "70" "6" "129775360" "129775371" "del" "0" "00006" "LAMA2_000822" "g.129775360_129775371del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6628_6639del" "" "Germline" "" "" "0" "" "" "g.129454215_129454226del" "" "likely pathogenic (recessive)" "ACMG" "0000905364" "3" "50" "6" "129419358" "129419358" "subst" "0" "00006" "LAMA2_000278" "g.129419358C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129098213C>T" "" "VUS" "ACMG" "0000905365" "0" "50" "6" "129419364" "129419364" "subst" "0" "00006" "LAMA2_000770" "g.129419364G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "De novo" "" "" "0" "" "" "g.129098219G>A" "" "VUS" "ACMG" "0000905366" "11" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000905367" "11" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000905368" "11" "90" "6" "129712776" "129712776" "subst" "0" "00006" "LAMA2_000812" "g.129712776G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129391631G>T" "" "pathogenic (recessive)" "ACMG" "0000905369" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905370" "11" "50" "6" "129833556" "129833556" "subst" "0" "00006" "LAMA2_000833" "g.129833556G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129512411G>C" "" "VUS" "ACMG" "0000905371" "3" "50" "6" "129601217" "129601217" "subst" "0.0019305" "00006" "LAMA2_000468" "g.129601217C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129280072C>T" "" "VUS" "ACMG" "0000905372" "21" "90" "6" "129649547" "129649547" "subst" "0" "00006" "LAMA2_000806" "g.129649547C>A" "" "{PMID:Tan 2021:34281576}" "" "4032C>A (S1434*)" "" "Germline" "" "" "0" "" "" "g.129328402C>A" "" "pathogenic (recessive)" "ACMG" "0000905373" "11" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905374" "11" "90" "6" "129591893" "129591893" "del" "0" "00006" "LAMA2_000790" "g.129591893del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2447delA" "" "Germline" "" "" "0" "" "" "g.129270748del" "" "pathogenic (recessive)" "ACMG" "0000905375" "11" "90" "6" "129794441" "129794445" "del" "0" "00006" "LAMA2_000824" "g.129794441_129794445del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129473296_129473300del" "" "pathogenic (recessive)" "ACMG" "0000905376" "11" "90" "6" "129781344" "129813223" "del" "0" "00006" "LAMA2_000823" "g.(129777640_129781344)_(129813223_129813459)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex49-57" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905377" "11" "70" "6" "129637316" "129637316" "subst" "0" "00006" "LAMA2_000805" "g.129637316G>A" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316171G>A" "" "likely pathogenic (recessive)" "ACMG" "0000905378" "11" "90" "6" "129475775" "129475776" "del" "0" "00006" "LAMA2_000465" "g.129475775_129475776del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.1153_1154delAC" "" "Germline" "" "" "0" "" "" "g.129154630_129154631del" "" "pathogenic (recessive)" "ACMG" "0000905379" "11" "90" "6" "129636608" "129636608" "subst" "2.03074E-5" "00006" "LAMA2_000475" "g.129636608T>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129315463T>A" "" "pathogenic (recessive)" "ACMG" "0000905380" "21" "90" "6" "129371234" "129371234" "subst" "0" "00006" "LAMA2_000473" "g.129371234G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>C" "" "pathogenic (recessive)" "ACMG" "0000905381" "11" "90" "6" "129371062" "129381042" "del" "0" "00006" "LAMA2_000460" "g.(129204503_129371062)_(129381042_129419317)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex2-3" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905382" "11" "90" "6" "129711227" "132942814" "del" "0" "00006" "LAMA2_000437" "g.(129710204_129711227)_(132942814_133179434)del" "" "{PMID:Ding 2016:26304763}, {PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex36-65" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905383" "3" "50" "6" "129419358" "129419358" "subst" "0" "00006" "LAMA2_000278" "g.129419358C>T" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129098213C>T" "" "VUS" "ACMG" "0000905384" "21" "90" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "pathogenic (recessive)" "ACMG" "0000905385" "0" "90" "6" "129380928" "129419561" "del" "0" "00006" "LAMA2_000478" "g.(129371234_129380928)_(129419561_129465045)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex3-4" "" "De novo" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905386" "21" "90" "6" "129807617" "129807617" "subst" "4.07159E-6" "00006" "LAMA2_000825" "g.129807617A>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486472A>G" "" "pathogenic (recessive)" "ACMG" "0000905387" "21" "90" "6" "129634125" "129634125" "subst" "4.06081E-6" "00006" "LAMA2_000799" "g.129634125G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129312980G>A" "" "pathogenic (recessive)" "ACMG" "0000905388" "21" "90" "6" "129573286" "129573286" "subst" "0" "00006" "LAMA2_000786" "g.129573286G>T" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129252141G>T" "" "pathogenic (recessive)" "ACMG" "0000905389" "21" "90" "6" "129465045" "129465226" "del" "0" "00006" "LAMA2_000434" "g.(129419561_129465045)_(129465226_129468103)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex5" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905390" "21" "90" "6" "129663487" "129663613" "del" "0" "00006" "LAMA2_000808" "g.(129649558_129663487)_(129663613_129670442)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex30" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905391" "21" "90" "6" "129723468" "129723468" "subst" "0" "00006" "LAMA2_000813" "g.129723468G>A" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129402323G>A" "" "pathogenic (recessive)" "ACMG" "0000905392" "21" "90" "6" "129511404" "129511404" "subst" "0" "00006" "LAMA2_000779" "g.129511404C>T" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129190259C>T" "" "pathogenic (recessive)" "ACMG" "0000905393" "21" "90" "6" "129813068" "129813068" "subst" "0" "00006" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "ACMG" "0000905394" "11" "90" "6" "129723593" "129723593" "dup" "0" "00006" "LAMA2_000814" "g.129723593dup" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129402448dup" "" "pathogenic (recessive)" "ACMG" "0000905395" "21" "90" "6" "129649444" "129649444" "subst" "4.06352E-6" "00006" "LAMA2_000219" "g.129649444C>T" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "pathogenic (recessive)" "ACMG" "0000905396" "21" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00006" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "ACMG" "0000905397" "11" "50" "6" "129775310" "129775310" "subst" "0" "00006" "LAMA2_000821" "g.129775310T>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129454165T>C" "" "VUS" "ACMG" "0000905398" "21" "90" "6" "129371200" "129371200" "subst" "1.62429E-5" "00006" "LAMA2_000710" "g.129371200C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129050055C>T" "" "pathogenic (recessive)" "ACMG" "0000905399" "0" "70" "6" "129609205" "129609205" "dup" "0" "00006" "LAMA2_000690" "g.129609205dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2749+2_2749+3insT" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.129288060dup" "" "likely pathogenic (recessive)" "ACMG" "0000905400" "21" "50" "6" "129807767" "129807767" "subst" "0" "00006" "LAMA2_000470" "g.129807767G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486622G>C" "" "VUS" "ACMG" "0000905401" "21" "90" "6" "129470123" "129470123" "subst" "0" "00006" "LAMA2_000231" "g.129470123G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129148978G>T" "" "pathogenic (recessive)" "ACMG" "0000905402" "21" "90" "6" "129618975" "129618975" "dup" "0" "00006" "LAMA2_000795" "g.129618975dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.3001_3002insA" "" "Germline" "" "" "0" "" "" "g.129297830dup" "" "pathogenic (recessive)" "ACMG" "0000905403" "21" "50" "6" "129824266" "129824266" "subst" "0.000130053" "00006" "LAMA2_000830" "g.129824266A>C" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129503121A>C" "" "VUS" "ACMG" "0000905404" "21" "70" "6" "129511427" "129511427" "subst" "0" "00006" "LAMA2_000781" "g.129511427C>A" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129190282C>A" "" "likely pathogenic (recessive)" "ACMG" "0000905405" "21" "90" "6" "129371233" "129371233" "subst" "0" "00006" "LAMA2_000136" "g.129371233C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129050088C>T" "" "pathogenic (recessive)" "ACMG" "0000905406" "21" "50" "6" "129581936" "129581936" "subst" "0" "00006" "LAMA2_000328" "g.129581936G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129260791G>A" "" "VUS" "ACMG" "0000905407" "21" "50" "6" "129621874" "129621874" "subst" "8.12407E-6" "00006" "LAMA2_000796" "g.129621874G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129300729G>A" "" "VUS" "ACMG" "0000905408" "21" "90" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "pathogenic (recessive)" "ACMG" "0000905409" "21" "50" "6" "129468198" "129468211" "del" "0" "00006" "LAMA2_000774" "g.129468198_129468211del" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129147053_129147066del" "" "VUS" "ACMG" "0000905410" "21" "90" "6" "129612853" "129612853" "subst" "0" "00006" "LAMA2_000794" "g.129612853T>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129291708T>A" "" "pathogenic (recessive)" "ACMG" "0000905411" "21" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905412" "21" "90" "6" "129774169" "129774169" "subst" "0" "00006" "LAMA2_000421" "g.129774169C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129453024C>T" "" "pathogenic (recessive)" "ACMG" "0000905413" "21" "90" "6" "129813601" "129813601" "dup" "0" "00006" "LAMA2_000827" "g.129813601dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.8214_8215insT" "" "Germline" "" "" "0" "" "" "g.129492456dup" "" "pathogenic (recessive)" "ACMG" "0000905414" "21" "90" "6" "129712690" "129712697" "del" "0" "00006" "LAMA2_000811" "g.129712690_129712697del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5125_5132del" "" "Germline" "" "" "0" "" "" "g.129391545_129391552del" "" "pathogenic (recessive)" "ACMG" "0000905415" "21" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000905416" "21" "90" "6" "129637213" "129637213" "subst" "0" "00006" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "ACMG" "0000905417" "21" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905418" "21" "90" "6" "129573244" "129573247" "dup" "0" "00006" "LAMA2_000785" "g.129573244_129573247dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.1899_1900insATCA" "" "Germline" "" "" "0" "" "" "g.129252099_129252102dup" "" "pathogenic (recessive)" "ACMG" "0000905419" "21" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905420" "21" "90" "6" "129786288" "129786288" "subst" "0" "00006" "LAMA2_000555" "g.129786288A>G" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129465143A>G" "" "pathogenic (recessive)" "ACMG" "0000905421" "21" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905422" "21" "70" "6" "129636620" "129636620" "subst" "0" "00006" "LAMA2_000801" "g.129636620G>A" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129315475G>A" "" "likely pathogenic (recessive)" "ACMG" "0000905423" "21" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "ACMG" "0000905424" "21" "90" "6" "129774169" "129774169" "subst" "0" "00006" "LAMA2_000421" "g.129774169C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129453024C>T" "" "pathogenic (recessive)" "ACMG" "0000905425" "21" "90" "6" "129204446" "129204446" "dup" "0" "00006" "LAMA2_000764" "g.129204446dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.56dupG" "" "Germline" "" "" "0" "" "" "g.128883301dup" "" "pathogenic (recessive)" "ACMG" "0000905426" "21" "90" "6" "129774136" "129774136" "subst" "0" "00006" "LAMA2_000819" "g.129774136A>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129452991A>T" "" "pathogenic (recessive)" "ACMG" "0000905427" "21" "50" "6" "129573399" "129573401" "del" "0" "00006" "LAMA2_000787" "g.129573399_129573401del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2051_2053del" "" "Germline" "" "" "0" "" "" "g.129252254_129252256del" "" "VUS" "ACMG" "0000905428" "21" "90" "6" "129419384" "129419384" "subst" "0" "00006" "LAMA2_000771" "g.129419384G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129098239G>T" "" "pathogenic (recessive)" "ACMG" "0000905429" "21" "90" "6" "129555369" "129578909" "del" "0" "00006" "LAMA2_000784" "g.(129513999_129555369)_(129578909_129581855)del" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex13-14" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905430" "21" "90" "6" "129465045" "129465045" "subst" "0" "00006" "LAMA2_000467" "g.129465045G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129143900G>C" "" "pathogenic (recessive)" "ACMG" "0000905431" "21" "90" "6" "129774216" "129774218" "del" "0" "00006" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6513_6515delTTG" "" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "ACMG" "0000905432" "21" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000905433" "21" "90" "6" "129835630" "129835633" "dup" "0" "00006" "LAMA2_000077" "g.129835630_129835633dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129514485_129514488dup" "" "pathogenic (recessive)" "ACMG" "0000905434" "21" "50" "6" "129637075" "129637075" "subst" "0" "00006" "LAMA2_000804" "g.129637075C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129315930C>T" "" "VUS" "ACMG" "0000905435" "21" "90" "6" "129823823" "129823823" "subst" "0" "00006" "LAMA2_000466" "g.129823823C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129502678C>A" "" "pathogenic (recessive)" "ACMG" "0000905436" "21" "90" "6" "129781344" "129781470" "del" "0" "00006" "LAMA2_000480" "g.(129777640_129781344)_(129781470_129785434)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex49" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905437" "21" "90" "6" "129465045" "129475829" "dup" "0" "00006" "LAMA2_000773" "g.(129419561_129465045)_(129475829_129486720)dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "dup ex5-8" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905438" "21" "90" "6" "129636791" "129636791" "del" "0" "00006" "LAMA2_000802" "g.129636791del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.3725delA" "" "Germline" "" "" "0" "" "" "g.129315646del" "" "pathogenic (recessive)" "ACMG" "0000905439" "21" "90" "6" "129813138" "129813138" "del" "0" "00006" "LAMA2_000479" "g.129813138del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.7991delG" "" "Germline" "" "" "0" "" "" "g.129491993del" "" "pathogenic (recessive)" "ACMG" "0000905440" "21" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "ACMG" "0000905441" "21" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905442" "21" "90" "6" "129371062" "129513999" "del" "0" "00006" "LAMA2_000766" "g.(129204503_129371062)_(129513999_129571256)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex2-12" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905443" "21" "70" "6" "129621939" "129621939" "subst" "0" "00006" "LAMA2_000453" "g.129621939C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129300794C>A" "" "likely pathogenic (recessive)" "ACMG" "0000905444" "21" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "ACMG" "0000905445" "21" "50" "6" "129833556" "129833556" "subst" "0" "00006" "LAMA2_000833" "g.129833556G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129512411G>C" "" "VUS" "ACMG" "0000905446" "21" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "ACMG" "0000905447" "21" "50" "6" "129775310" "129775310" "subst" "0" "00006" "LAMA2_000821" "g.129775310T>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129454165T>C" "" "VUS" "ACMG" "0000905448" "21" "90" "6" "129609019" "129609019" "del" "0" "00006" "LAMA2_000455" "g.129609019del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "c.2565delC" "" "Germline" "" "" "0" "" "" "g.129287874del" "" "pathogenic (recessive)" "ACMG" "0000905449" "21" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905450" "21" "90" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "pathogenic (recessive)" "ACMG" "0000905451" "21" "90" "6" "129691062" "129691062" "del" "0" "00006" "LAMA2_000476" "g.129691062del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.4886delC" "" "Germline" "" "" "0" "" "" "g.129369917del" "" "pathogenic (recessive)" "ACMG" "0000905452" "21" "90" "6" "129470142" "129470142" "del" "0" "00006" "LAMA2_000775" "g.129470142del" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129148997del" "" "pathogenic (recessive)" "ACMG" "0000905453" "21" "90" "6" "129833560" "129833615" "del" "0" "00006" "LAMA2_000834" "g.129833560_129833615del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129512415_129512470del" "" "pathogenic (recessive)" "ACMG" "0000905454" "11" "90" "6" "129762082" "129762082" "subst" "0" "00006" "LAMA2_000223" "g.129762082C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129440937C>A" "" "pathogenic (recessive)" "ACMG" "0000905455" "11" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000905456" "21" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "ACMG" "0000905457" "21" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "00006" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "pathogenic (recessive)" "ACMG" "0000905458" "21" "90" "6" "129637213" "129637213" "subst" "0" "00006" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "ACMG" "0000905459" "21" "90" "6" "129704379" "129704379" "subst" "4.1587E-6" "00006" "LAMA2_000461" "g.129704379G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129383234G>A" "" "pathogenic (recessive)" "ACMG" "0000905460" "21" "90" "6" "129774216" "129774218" "del" "0" "00006" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6513_6515delTTG" "" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "ACMG" "0000905461" "21" "90" "6" "129813068" "129813068" "subst" "0" "00006" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "ACMG" "0000905462" "21" "90" "6" "129813068" "129813068" "subst" "0" "00006" "LAMA2_000451" "g.129813068G>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129491923G>T" "" "pathogenic (recessive)" "ACMG" "0000905463" "21" "90" "6" "129380974" "129380974" "subst" "4.0622E-6" "00006" "LAMA2_000463" "g.129380974G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129059829G>A" "" "pathogenic (recessive)" "ACMG" "0000905464" "21" "90" "6" "129725101" "129725101" "del" "0" "00006" "LAMA2_000815" "g.129725101del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5859delA" "" "Germline" "" "" "0" "" "" "g.129403956del" "" "pathogenic (recessive)" "ACMG" "0000905465" "21" "90" "6" "129637317" "129637317" "subst" "0" "00006" "LAMA2_000456" "g.129637317G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316172G>A" "" "pathogenic (recessive)" "ACMG" "0000905466" "21" "90" "6" "129618932" "129618932" "dup" "0" "00006" "LAMA2_000457" "g.129618932dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2959_-2960insT" "" "Germline" "" "" "0" "" "" "g.129297787dup" "" "pathogenic (recessive)" "ACMG" "0000905467" "21" "90" "6" "129748896" "129775434" "del" "0" "00006" "LAMA2_000816" "g.(129725105_129748896)_(129775434_129777479)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex41-47" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905468" "21" "90" "6" "129381008" "129381008" "subst" "0" "00006" "LAMA2_000447" "g.129381008C>G" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>G" "" "pathogenic (recessive)" "ACMG" "0000905469" "21" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000905470" "21" "90" "6" "129712720" "129712723" "del" "0" "00006" "LAMA2_000445" "g.129712720_129712723del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.5156_5159delAAGA" "" "Germline" "" "" "0" "" "" "g.129391575_129391578del" "" "pathogenic (recessive)" "ACMG" "0000905471" "21" "90" "6" "129649559" "129649559" "subst" "0" "00006" "LAMA2_000807" "g.129649559T>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129328414T>C" "" "pathogenic (recessive)" "ACMG" "0000905472" "11" "90" "6" "129465045" "129465045" "subst" "0" "00006" "LAMA2_000467" "g.129465045G>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129143900G>C" "" "pathogenic (recessive)" "ACMG" "0000905473" "21" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.2049_2050delAG" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000905474" "21" "90" "6" "129513948" "129513952" "del" "0" "00006" "LAMA2_000782" "g.129513948_129513952del" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129192803_129192807del" "" "pathogenic (recessive)" "ACMG" "0000905475" "21" "90" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "pathogenic (recessive)" "ACMG" "0000905476" "21" "90" "6" "129419317" "129419561" "del" "0" "00006" "LAMA2_000454" "g.(129381042_129419317)_(129419561_129465045)del" "" "{PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex4" "" "Germline" "" "" "0" "" "" "g.(129059897_129098172)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000905477" "21" "90" "6" "129828745" "129828745" "subst" "0" "00006" "LAMA2_000831" "g.129828745C>T" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129507600C>T" "" "pathogenic (recessive)" "ACMG" "0000905478" "21" "90" "6" "129823803" "129833639" "del" "0" "00006" "LAMA2_000446" "g.(129813629_129823803)_(129833639_129835517)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex59-63" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905479" "21" "50" "6" "129511426" "129511426" "subst" "0" "00006" "LAMA2_000780" "g.129511426G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129190281G>A" "" "VUS" "ACMG" "0000905480" "21" "50" "6" "129498902" "129498902" "subst" "0" "00006" "LAMA2_000436" "g.129498902G>C" "" "{PMID:Ding 2016:26304763}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129177757G>C" "" "VUS" "ACMG" "0000905481" "21" "50" "6" "129380977" "129380977" "subst" "0" "00006" "LAMA2_000768" "g.129380977A>C" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129059832A>C" "" "VUS" "ACMG" "0000905482" "21" "90" "6" "129762110" "129762110" "del" "0" "00006" "LAMA2_000818" "g.129762110del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6232delA" "" "Germline" "" "" "0" "" "" "g.129440965del" "" "pathogenic (recessive)" "ACMG" "0000905483" "21" "90" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "pathogenic (recessive)" "ACMG" "0000905484" "21" "90" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "pathogenic (recessive)" "ACMG" "0000905485" "21" "90" "6" "129807617" "129807617" "subst" "4.07159E-6" "00006" "LAMA2_000825" "g.129807617A>G" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486472A>G" "" "pathogenic (recessive)" "ACMG" "0000905486" "21" "90" "6" "129465045" "129465226" "del" "0" "00006" "LAMA2_000434" "g.(129419561_129465045)_(129465226_129468103)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex5" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905487" "21" "90" "6" "129663487" "129663613" "del" "0" "00006" "LAMA2_000808" "g.(129649558_129663487)_(129663613_129670442)del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "del ex30" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000905488" "11" "90" "6" "129723593" "129723593" "dup" "0" "00006" "LAMA2_000814" "g.129723593dup" "" "{PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129402448dup" "" "pathogenic (recessive)" "ACMG" "0000905489" "21" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00006" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "ACMG" "0000905490" "21" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000905491" "21" "90" "6" "129204446" "129204446" "dup" "0" "00006" "LAMA2_000764" "g.129204446dup" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.56dupG" "" "Germline" "" "" "0" "" "" "g.128883301dup" "" "pathogenic (recessive)" "ACMG" "0000905492" "21" "90" "6" "129774136" "129774136" "subst" "0" "00006" "LAMA2_000819" "g.129774136A>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129452991A>T" "" "pathogenic (recessive)" "ACMG" "0000905493" "21" "90" "6" "129774216" "129774218" "del" "0" "00006" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.6513_6515delTTG" "" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "ACMG" "0000905494" "21" "90" "6" "129823823" "129823823" "subst" "0" "00006" "LAMA2_000466" "g.129823823C>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129502678C>A" "" "pathogenic (recessive)" "ACMG" "0000905495" "21" "90" "6" "129691062" "129691062" "del" "0" "00006" "LAMA2_000476" "g.129691062del" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "c.4886delC" "" "Germline" "" "" "0" "" "" "g.129369917del" "" "pathogenic (recessive)" "ACMG" "0000905496" "11" "90" "6" "129807679" "129807679" "subst" "8.13848E-6" "00006" "LAMA2_000066" "g.129807679C>T" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}" "" "" "" "Germline" "" "" "0" "" "" "g.129486534C>T" "" "pathogenic (recessive)" "ACMG" "0000905497" "21" "90" "6" "129704379" "129704379" "subst" "4.1587E-6" "00006" "LAMA2_000461" "g.129704379G>A" "" "{PMID:Ge 2019:31066047}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129383234G>A" "" "pathogenic (recessive)" "ACMG" "0000905498" "21" "50" "6" "129498902" "129498902" "subst" "0" "00006" "LAMA2_000436" "g.129498902G>C" "" "{PMID:Ding 2016:26304763}, {PMID:Tan 2021:34281576}, possibly {PMID:Ge 2018:30301903}" "" "" "" "Germline" "" "" "0" "" "" "g.129177757G>C" "" "VUS" "ACMG" "0000906280" "1" "90" "6" "129774132" "129775434" "del" "0" "00006" "LAMA2_000846" "g.(129766967_129774132)_(129775434_129777479)del" "" "{PMID:Ge 2019:31066047}" "" "del ex46-47" "combination of variants not reported" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000906281" "1" "90" "6" "129674463" "129674469" "del" "0" "00006" "LAMA2_000843" "g.129674463_129674469del" "" "{PMID:Ge 2019:31066047}" "" "4676_4682del" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129353318_129353324del" "" "pathogenic (recessive)" "ACMG" "0000906282" "1" "90" "6" "129704280" "129704286" "del" "0" "00006" "LAMA2_000845" "g.129704280_129704286del" "" "{PMID:Ge 2019:31066047}" "" "4971_4977del" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129383135_129383141del" "" "pathogenic (recessive)" "ACMG" "0000906283" "1" "90" "6" "129419382" "129419382" "dup" "0" "00006" "LAMA2_000838" "g.129419382dup" "" "{PMID:Ge 2019:31066047}" "" "457_458insT" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129098237dup" "" "pathogenic (recessive)" "ACMG" "0000906284" "1" "50" "6" "129641781" "129641781" "subst" "0.000231681" "00006" "LAMA2_000842" "g.129641781A>T" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129320636A>T" "" "VUS" "ACMG" "0000906285" "1" "50" "6" "129691056" "129691056" "subst" "1.22176E-5" "00006" "LAMA2_000844" "g.129691056G>A" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129369911G>A" "" "VUS" "ACMG" "0000906286" "1" "50" "6" "129775312" "129775312" "subst" "0" "00006" "LAMA2_000847" "g.129775312G>C" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129454167G>C" "" "VUS" "ACMG" "0000906287" "1" "90" "6" "129722453" "129722453" "subst" "0.0104121" "00006" "LAMA2_000092" "g.129722453C>A" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129401308C>A" "" "pathogenic (recessive)" "ACMG" "0000906288" "1" "90" "6" "129591859" "129591859" "subst" "0" "00006" "LAMA2_000840" "g.129591859C>T" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129270714C>T" "" "pathogenic (recessive)" "ACMG" "0000906289" "1" "90" "6" "129781432" "129781432" "subst" "1.63043E-5" "00006" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "pathogenic (recessive)" "ACMG" "0000906290" "1" "90" "6" "129612853" "129612853" "subst" "0" "00006" "LAMA2_000794" "g.129612853T>A" "" "{PMID:Ge 2019:31066047}" "" "2844T>C (C948*)" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129291708T>A" "" "pathogenic (recessive)" "ACMG" "0000906291" "1" "90" "6" "129674430" "129674430" "subst" "8.12599E-6" "00006" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "pathogenic (recessive)" "ACMG" "0000906292" "1" "90" "6" "129813196" "129813196" "subst" "0" "00006" "LAMA2_000848" "g.129813196C>A" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129492051C>A" "" "pathogenic (recessive)" "ACMG" "0000906293" "1" "90" "6" "129837376" "129837376" "subst" "4.06461E-6" "00006" "LAMA2_000078" "g.129837376C>T" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129516231C>T" "" "pathogenic (recessive)" "ACMG" "0000906294" "1" "50" "6" "129468200" "129468200" "subst" "0" "00006" "LAMA2_000671" "g.129468200A>G" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129147055A>G" "" "VUS" "ACMG" "0000906295" "1" "70" "6" "129636905" "129636905" "subst" "4.06369E-6" "00006" "LAMA2_000841" "g.129636905A>G" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129315760A>G" "" "likely pathogenic (recessive)" "ACMG" "0000906296" "1" "90" "6" "129486720" "129486720" "subst" "0" "00006" "LAMA2_000839" "g.129486720G>T" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129165575G>T" "" "pathogenic (recessive)" "ACMG" "0000906297" "1" "90" "6" "129601200" "129601200" "subst" "1.21937E-5" "00006" "LAMA2_000432" "g.129601200A>G" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129280055A>G" "" "pathogenic (recessive)" "ACMG" "0000906298" "1" "90" "6" "129670530" "129670530" "subst" "0" "00006" "LAMA2_000442" "g.129670530G>A" "" "{PMID:Ge 2019:31066047}" "" "" "combination of variants not reported" "Germline" "" "" "0" "" "" "g.129349385G>A" "" "pathogenic (recessive)" "ACMG" "0000907877" "3" "90" "6" "129634203" "129634203" "del" "0" "00006" "LAMA2_000837" "g.129634203del" "" "{PMID:Rui 2022:36334577}" "" "3367delA" "authors established PBMC-derived induced pluripotent stem cell (NJUCMi001-A)" "Germline" "" "" "0" "" "" "g.129313058del" "" "pathogenic (recessive)" "" "0000909540" "0" "70" "6" "129371013" "129514048" "dup" "0" "01164" "LAMA2_000850" "g.(129204503_129371013)_(129514048_129571256)dup" "" "PubMed: Ge 2019, Tan 2021" "" "NGS del ex2-12" "ACMG: PVS1_STR, PM3, PM2_SUP" "Germline" "?" "" "0" "" "" "g.(128883358_129049868)_(129192903_129250111)dup" "" "likely pathogenic (recessive)" "ACMG" "0000909541" "0" "50" "6" "129637095" "129637095" "subst" "0" "01164" "LAMA2_000849" "g.129637095G>A" "" "" "" "" "ACMG: PVS1_STR, PM2_SUP (PM3 not taken since phase of other class 4 variant is unknown; last nucleotide in ex26; G>non-G at last base of exon if first 6 bases of the intron are not GTRRGT: PVS1_STR)" "Germline" "?" "" "0" "" "" "g.129315950G>A" "" "VUS (!)" "ACMG" "0000912402" "0" "30" "6" "129371205" "129371205" "subst" "0.000507581" "01804" "LAMA2_000497" "g.129371205C>T" "" "" "" "LAMA2(NM_000426.3):c.255C>T (p.I85=, p.(Ile85=)), LAMA2(NM_000426.4):c.255C>T (p.I85=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912403" "0" "30" "6" "129499023" "129499023" "subst" "0.000192368" "01804" "LAMA2_000851" "g.129499023A>G" "" "" "" "LAMA2(NM_000426.3):c.1467+12A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000912404" "0" "30" "6" "129601217" "129601217" "subst" "0.0019305" "01804" "LAMA2_000468" "g.129601217C>T" "" "" "" "LAMA2(NM_000426.3):c.2462C>T (p.T821M, p.(Thr821Met)), LAMA2(NM_000426.4):c.2462C>T (p.T821M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000917092" "3" "90" "6" "129634114" "129634114" "subst" "0" "00006" "LAMA2_000464" "g.129634114C>T" "" "{PMID:Cavdarli 2023:36575883}" "" "" "ACMG PVS1 PM2 PP5" "Germline" "" "rs376088608" "0" "" "" "g.129312969C>T" "" "pathogenic (recessive)" "ACMG" "0000917098" "3" "70" "6" "129465077" "129465077" "del" "0" "00006" "LAMA2_000852" "g.129465077del" "" "{PMID:Cavdarli 2023:36575883}" "" "671delG" "ACMG PVS1 PM2" "Germline" "" "" "0" "" "" "g.129143932del" "" "likely pathogenic (recessive)" "ACMG" "0000917099" "3" "70" "6" "129824419" "129824419" "del" "0" "00006" "LAMA2_000853" "g.129824419del" "" "{PMID:Cavdarli 2023:36575883}" "" "8541delG" "ACMG PVS1 PM2" "Germline" "" "" "0" "" "" "g.129503274del" "" "likely pathogenic (recessive)" "ACMG" "0000920787" "21" "70" "6" "129636608" "129636608" "subst" "2.03074E-5" "04483" "LAMA2_000475" "g.129636608T>A" "2/5" "{PMID:Tran 2023:37388928}" "" "" "" "Germline" "yes" "rs775278003" "0" "" "" "g.129315463T>A" "555549" "likely pathogenic (recessive)" "ACMG" "0000920788" "11" "90" "6" "129486817" "129486817" "subst" "1.63597E-5" "04483" "LAMA2_000265" "g.129486817C>T" "1/5" "{PMID:Tran 2023:37388928}" "" "" "" "Germline" "yes" "rs773209126" "0" "" "" "g.129165672C>T" "235805" "pathogenic (recessive)" "ACMG" "0000920789" "3" "70" "6" "129636608" "129636608" "subst" "2.03074E-5" "04483" "LAMA2_000475" "g.129636608T>A" "2/5" "{PMID:Tran 2023:37388928}" "" "" "" "Germline" "yes" "rs775278003" "0" "" "" "g.129315463T>A" "555549" "likely pathogenic (recessive)" "ACMG" "0000920790" "3" "90" "6" "129833629" "129833632" "dup" "0" "04483" "LAMA2_000854" "g.129833629_129833632dup" "" "{PMID:Tran 2023:37388928}" "" "8974_8975insTGAT" "" "Germline" "yes" "" "0" "" "" "g.129512484_129512487dup" "" "pathogenic (recessive)" "ACMG" "0000920791" "21" "70" "6" "129674507" "129674507" "subst" "4.06382E-6" "04483" "LAMA2_000855" "g.129674507G>A" "1/5" "{PMID:Tran 2023:37388928}" "" "" "" "Germline" "yes" "rs776050258" "0" "" "" "g.129353362G>A" "1028253" "likely pathogenic (recessive)" "ACMG" "0000920792" "11" "90" "6" "129786285" "129786291" "delins" "0" "04483" "LAMA2_000856" "g.129786285_129786291delinsT" "1/5" "{PMID:Tran 2023:37388928}" "" "" "" "Germline" "yes" "rs1554301854" "0" "" "" "g.129465140_129465146delinsT" "477503" "pathogenic (recessive)" "ACMG" "0000920793" "11" "90" "6" "129674429" "129674429" "subst" "0" "04483" "LAMA2_000693" "g.129674429C>A" "" "{PMID:Tran 2023:37388928}" "" "" "" "Germline" "yes" "" "0" "" "" "g.129353284C>A" "" "pathogenic (recessive)" "ACMG" "0000920794" "21" "90" "6" "129380928" "129381042" "del" "0" "04483" "LAMA2_000857" "g.(129371234_129380928)_(129381042_129419317)del" "" "{PMID:Tran 2023:37388928}" "" "129059784_129059896del" "" "Germline" "yes" "" "0" "" "" "g.(129050089_129059783)_(129059897_129098172)del" "" "pathogenic (recessive)" "ACMG" "0000927505" "11" "90" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Washington 2023:37038535}" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "likely pathogenic (recessive)" "" "0000927506" "21" "70" "6" "129813631" "129813634" "del" "0" "00006" "LAMA2_000298" "g.129813631_129813634del" "" "{PMID:Washington 2023:37038535}" "" "" "" "Germline" "" "" "0" "" "" "g.129492486_129492489del" "" "pathogenic (recessive)" "" "0000929146" "0" "50" "6" "129419358" "129419358" "subst" "0.000194932" "02327" "LAMA2_000858" "g.129419358C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929147" "0" "30" "6" "129498947" "129498947" "subst" "0.00144678" "02326" "LAMA2_000323" "g.129498947C>G" "" "" "" "LAMA2(NM_000426.3):c.1403C>G (p.A468G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929148" "0" "30" "6" "129591876" "129591876" "subst" "0.0004473" "02326" "LAMA2_000859" "g.129591876A>C" "" "" "" "LAMA2(NM_000426.3):c.2430A>C (p.P810=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929149" "0" "30" "6" "129619003" "129619003" "subst" "4.89704E-5" "01804" "LAMA2_000860" "g.129619003C>A" "" "" "" "LAMA2(NM_000426.3):c.3030C>A (p.(Gly1010=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000931956" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931957" "1" "70" "6" "129634066" "129634066" "subst" "0" "00006" "LAMA2_000691" "g.129634066T>C" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129312921T>C" "" "likely pathogenic (recessive)" "ACMG" "0000931958" "1" "90" "6" "129802416" "129802416" "subst" "0" "00006" "LAMA2_000876" "g.129802416C>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129481271C>A" "" "pathogenic (recessive)" "ACMG" "0000931959" "1" "90" "6" "129573394" "129573404" "del" "0" "00006" "LAMA2_000864" "g.129573394_129573404del" "" "{PMID:Camelo 2023:37182895}" "" "2049_2059del" "" "Germline" "" "" "0" "" "" "g.129252249_129252259del" "" "pathogenic (recessive)" "ACMG" "0000931960" "3" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931961" "3" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931962" "3" "70" "6" "129704250" "129704250" "subst" "0" "00006" "LAMA2_000304" "g.129704250C>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129383105C>A" "" "likely pathogenic (recessive)" "ACMG" "0000931963" "1" "90" "6" "129573394" "129573404" "del" "0" "00006" "LAMA2_000864" "g.129573394_129573404del" "" "{PMID:Camelo 2023:37182895}" "" "2049_2059del" "" "Germline" "" "" "0" "" "" "g.129252249_129252259del" "" "pathogenic (recessive)" "ACMG" "0000931964" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000931965" "1" "90" "6" "129634066" "129634066" "subst" "0" "00006" "LAMA2_000691" "g.129634066T>C" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129312921T>C" "" "pathogenic (recessive)" "ACMG" "0000931966" "1" "90" "6" "129573394" "129573404" "del" "0" "00006" "LAMA2_000864" "g.129573394_129573404del" "" "{PMID:Camelo 2023:37182895}" "" "2049_2059del" "" "Germline" "" "" "0" "" "" "g.129252249_129252259del" "" "pathogenic (recessive)" "ACMG" "0000931967" "1" "70" "6" "129674321" "129674322" "del" "0" "00006" "LAMA2_000869" "g.129674321_129674322del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129353176_129353177del" "" "likely pathogenic (recessive)" "ACMG" "0000931968" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000931969" "3" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931970" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000931971" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931972" "3" "70" "6" "129826353" "129826355" "del" "0" "00006" "LAMA2_000404" "g.129826353_129826355del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129505208_129505210del" "" "likely pathogenic (recessive)" "ACMG" "0000931973" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000931974" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000931975" "3" "90" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "pathogenic (recessive)" "ACMG" "0000931976" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000931977" "1" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000931978" "1" "90" "6" "129807618" "129807768" "del" "0" "00006" "LAMA2_000877" "g.(129802585_129807618)_(129807768_129813045)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex56" "" "Germline" "" "" "0" "" "" "g.(129481440_129486473)_(129486623_129491900)del" "" "pathogenic (recessive)" "ACMG" "0000931979" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931980" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000931981" "1" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "ACMG" "0000931982" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000931983" "3" "90" "6" "129807618" "129807768" "del" "0" "00006" "LAMA2_000877" "g.(129802585_129807618)_(129807768_129813045)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex56" "" "Germline" "" "" "0" "" "" "g.(129481440_129486473)_(129486623_129491900)del" "" "pathogenic (recessive)" "ACMG" "0000931984" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931985" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931986" "1" "90" "6" "129634203" "129634203" "dup" "0" "00006" "LAMA2_000483" "g.129634203dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129313058dup" "" "pathogenic (recessive)" "ACMG" "0000931987" "1" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00006" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "ACMG" "0000931988" "1" "90" "6" "129687385" "129687385" "dup" "0" "00006" "LAMA2_000134" "g.129687385dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "ACMG" "0000931989" "1" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000931990" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000931991" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931992" "1" "90" "6" "129663524" "129663524" "subst" "1.22058E-5" "00006" "LAMA2_000208" "g.129663524C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129342379C>T" "" "pathogenic (recessive)" "ACMG" "0000931993" "1" "90" "6" "129601216" "129601216" "subst" "4.06405E-6" "00006" "LAMA2_000866" "g.129601216A>G" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>G" "" "pathogenic (recessive)" "ACMG" "0000931994" "3" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "ACMG" "0000931995" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931996" "1" "90" "6" "129486769" "129486769" "del" "0" "00006" "LAMA2_000862" "g.129486769del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000931997" "1" "90" "6" "129381008" "129381008" "subst" "8.12552E-6" "00006" "LAMA2_000152" "g.129381008C>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129059863C>A" "" "pathogenic (recessive)" "ACMG" "0000931998" "3" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000931999" "1" "90" "6" "129601244" "129601247" "del" "0" "00006" "LAMA2_000867" "g.129601244_129601247del" "" "{PMID:Camelo 2023:37182895}" "" "2486_2489del" "" "Germline" "" "" "0" "" "" "g.129280099_129280102del" "" "pathogenic (recessive)" "ACMG" "0000932000" "3" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000932001" "1" "90" "6" "129573394" "129573404" "del" "0" "00006" "LAMA2_000864" "g.129573394_129573404del" "" "{PMID:Camelo 2023:37182895}" "" "2049_2059del" "" "Germline" "" "" "0" "" "" "g.129252249_129252259del" "" "pathogenic (recessive)" "ACMG" "0000932002" "1" "90" "6" "129687385" "129687385" "dup" "0" "00006" "LAMA2_000134" "g.129687385dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "ACMG" "0000932003" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000932004" "1" "90" "6" "129573394" "129573404" "del" "0" "00006" "LAMA2_000864" "g.129573394_129573404del" "" "{PMID:Camelo 2023:37182895}" "" "2049_2059del" "" "Germline" "" "" "0" "" "" "g.129252249_129252259del" "" "pathogenic (recessive)" "ACMG" "0000932005" "3" "90" "6" "129687385" "129687385" "dup" "0" "00006" "LAMA2_000134" "g.129687385dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "ACMG" "0000932006" "1" "90" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "pathogenic (recessive)" "ACMG" "0000932007" "1" "90" "6" "129828705" "129828705" "del" "0" "00006" "LAMA2_000879" "g.129828705del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129507560del" "" "pathogenic (recessive)" "ACMG" "0000932008" "2" "90" "6" "129687386" "129687387" "ins" "0" "00006" "LAMA2_000870" "g.129687386_129687387insG" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129366241_129366242insG" "" "pathogenic (recessive)" "ACMG" "0000932009" "2" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "" "pathogenic (recessive)" "ACMG" "0000932010" "2" "90" "6" "129601216" "129601216" "subst" "0" "00006" "LAMA2_000297" "g.129601216A>C" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>C" "" "pathogenic (recessive)" "ACMG" "0000932011" "2" "70" "6" "129704250" "129704250" "subst" "0" "00006" "LAMA2_000304" "g.129704250C>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129383105C>A" "" "likely pathogenic (recessive)" "ACMG" "0000932012" "2" "90" "6" "129475751" "129475751" "dup" "0" "00006" "LAMA2_000861" "g.129475751dup" "" "{PMID:Camelo 2023:37182895}" "" "1128_1129insG" "" "Germline" "" "" "0" "" "" "g.129154606dup" "" "pathogenic (recessive)" "ACMG" "0000932013" "2" "90" "6" "129371062" "129486821" "del" "0" "00006" "LAMA2_000765" "g.(129204503_129371062)_(129486821_129498850)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex2-9" "" "Germline" "" "" "0" "" "" "" "" "pathogenic (recessive)" "ACMG" "0000932014" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "ACMG" "0000932015" "2" "90" "6" "129511472" "129511472" "delins" "0" "00006" "LAMA2_000863" "g.129511472delinsN[35]" "" "{PMID:Camelo 2023:37182895}" "" "1590delins32" "" "Germline" "" "" "0" "" "" "g.129190327delinsN[35]" "" "pathogenic (recessive)" "ACMG" "0000932016" "2" "70" "6" "129641801" "129641801" "subst" "4.06666E-6" "00006" "LAMA2_000868" "g.129641801G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129320656G>A" "" "likely pathogenic (recessive)" "ACMG" "0000932017" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "ACMG" "0000932018" "2" "50" "6" "129723557" "129723557" "subst" "4.06686E-6" "00006" "LAMA2_000874" "g.129723557G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129402412G>A" "" "VUS" "ACMG" "0000932019" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000932020" "2" "70" "6" "129704250" "129704250" "subst" "0" "00006" "LAMA2_000304" "g.129704250C>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129383105C>A" "" "likely pathogenic (recessive)" "ACMG" "0000932021" "2" "90" "6" "129807618" "129807768" "del" "0" "00006" "LAMA2_000877" "g.(129802585_129807618)_(129807768_129813045)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex56" "" "Germline" "" "" "0" "" "" "g.(129481440_129486473)_(129486623_129491900)del" "" "pathogenic (recessive)" "ACMG" "0000932022" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000932023" "2" "90" "6" "129581855" "129581968" "del" "0" "00006" "LAMA2_000865" "g.(129573441_129581855)_(129581968_129588250)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex15" "" "Germline" "" "" "0" "" "" "g.(129252296_129260710)_(129260823_129267105)del" "" "pathogenic (recessive)" "ACMG" "0000932024" "2" "90" "6" "129571328" "129571335" "dup" "0" "00006" "LAMA2_000015" "g.129571328_129571335dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129250183_129250190dup" "" "pathogenic (recessive)" "ACMG" "0000932025" "2" "90" "6" "129722368" "129722486" "dup" "0" "00006" "LAMA2_000872" "g.(129714401_129722368)_(129722486_129723468)dup" "" "{PMID:Camelo 2023:37182895}" "" "117bp dup (ex38)" "" "Germline" "" "" "0" "" "" "g.(129393256_129401223)_(129401341_129402323)dup" "" "pathogenic (recessive)" "ACMG" "0000932026" "2" "90" "6" "129762066" "129762066" "del" "0" "00006" "LAMA2_000875" "g.129762066del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129440921del" "" "pathogenic (recessive)" "ACMG" "0000932027" "2" "90" "6" "129381036" "129381036" "subst" "0" "00006" "LAMA2_000262" "g.129381036C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129059891C>T" "" "pathogenic (recessive)" "ACMG" "0000932028" "2" "90" "6" "129687386" "129687387" "ins" "0" "00006" "LAMA2_000870" "g.129687386_129687387insG" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129366241_129366242insG" "" "pathogenic (recessive)" "ACMG" "0000932029" "2" "90" "6" "129813629" "129813629" "subst" "4.07428E-6" "00006" "LAMA2_000150" "g.129813629G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129492484G>A" "" "pathogenic (recessive)" "ACMG" "0000932030" "2" "90" "6" "129835697" "129835698" "dup" "0" "00006" "LAMA2_000880" "g.129835697_129835698dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129514552_129514553dup" "" "pathogenic (recessive)" "ACMG" "0000932031" "2" "90" "6" "129687385" "129687385" "dup" "0" "00006" "LAMA2_000134" "g.129687385dup" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129366240dup" "" "pathogenic (recessive)" "ACMG" "0000932032" "2" "90" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "pathogenic (recessive)" "ACMG" "0000932033" "2" "90" "6" "129601216" "129601216" "subst" "4.06405E-6" "00006" "LAMA2_000866" "g.129601216A>G" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129280071A>G" "" "pathogenic (recessive)" "ACMG" "0000932034" "2" "90" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "pathogenic (recessive)" "ACMG" "0000932035" "2" "70" "6" "129826353" "129826355" "del" "0" "00006" "LAMA2_000404" "g.129826353_129826355del" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129505208_129505210del" "" "likely pathogenic (recessive)" "ACMG" "0000932036" "2" "90" "6" "129837346" "129837346" "subst" "0" "00006" "LAMA2_000881" "g.129837346C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129516201C>T" "" "pathogenic (recessive)" "ACMG" "0000932037" "2" "70" "6" "129723484" "129723484" "subst" "0" "00006" "LAMA2_000873" "g.129723484C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129402339C>T" "" "likely pathogenic (recessive)" "ACMG" "0000932038" "2" "90" "6" "129807618" "129807768" "del" "0" "00006" "LAMA2_000877" "g.(129802585_129807618)_(129807768_129813045)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex56" "" "Germline" "" "" "0" "" "" "g.(129481440_129486473)_(129486623_129491900)del" "" "pathogenic (recessive)" "ACMG" "0000932039" "2" "90" "6" "129691064" "129691064" "subst" "0" "00006" "LAMA2_000871" "g.129691064G>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129369919G>T" "" "pathogenic (recessive)" "ACMG" "0000932040" "2" "90" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "pathogenic (recessive)" "ACMG" "0000932041" "2" "50" "6" "129813548" "129813548" "subst" "0" "00006" "LAMA2_000878" "g.129813548G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129492403G>A" "" "VUS" "ACMG" "0000932042" "2" "90" "6" "129573394" "129573404" "del" "0" "00006" "LAMA2_000864" "g.129573394_129573404del" "" "{PMID:Camelo 2023:37182895}" "" "2049_2059del" "" "Germline" "" "" "0" "" "" "g.129252249_129252259del" "" "pathogenic (recessive)" "ACMG" "0000932043" "2" "90" "6" "129634066" "129634066" "subst" "0" "00006" "LAMA2_000691" "g.129634066T>C" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129312921T>C" "" "pathogenic (recessive)" "ACMG" "0000932044" "2" "90" "6" "129380928" "129419561" "del" "0" "00006" "LAMA2_000478" "g.(129371234_129380928)_(129419561_129465045)del" "" "{PMID:Camelo 2023:37182895}" "" "del ex3-4" "" "Germline" "" "" "0" "" "" "g.(129050089_129059783)_(129098416_129143900)del" "" "pathogenic (recessive)" "ACMG" "0000932045" "2" "90" "6" "129670529" "129670529" "subst" "4.06402E-6" "00006" "LAMA2_000277" "g.129670529G>A" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129349384G>A" "" "pathogenic (recessive)" "ACMG" "0000932046" "2" "90" "6" "129637213" "129637213" "subst" "0" "00006" "LAMA2_000459" "g.129637213C>T" "" "{PMID:Camelo 2023:37182895}" "" "" "" "Germline" "" "" "0" "" "" "g.129316068C>T" "" "pathogenic (recessive)" "ACMG" "0000933950" "0" "90" "6" "129748945" "129748945" "subst" "0" "00006" "LAMA2_000209" "g.129748945C>T" "" "{PMID:Tavakoli 2023:37350320}" "" "" "LAMA2 carrier" "Germline/De novo (untested)" "" "" "0" "" "" "g.129427800C>T" "" "pathogenic (recessive)" "" "0000933954" "0" "90" "6" "129794435" "129794435" "dup" "0" "00006" "LAMA2_000060" "g.129794435dup" "" "{PMID:Tavakoli 2023:37350320}" "" "" "carrier" "Germline/De novo (untested)" "" "" "0" "" "" "g.129473290dup" "" "pathogenic" "" "0000936097" "3" "90" "6" "129634114" "129634114" "subst" "0" "00006" "LAMA2_000464" "g.129634114C>T" "" "{PMID:Cavdarli 2023:36575883}" "" "" "ACMG PVS1 PM2 PP5" "Germline" "" "rs376088608" "0" "" "" "g.129312969C>T" "" "pathogenic (recessive)" "ACMG" "0000936103" "3" "70" "6" "129465077" "129465077" "del" "0" "00006" "LAMA2_000852" "g.129465077del" "" "{PMID:Cavdarli 2023:36575883}" "" "c.671delG" "ACMG PVS1 PM2" "Germline" "" "" "0" "" "" "g.129143932del" "" "likely pathogenic (recessive)" "ACMG" "0000936104" "3" "70" "6" "129824419" "129824419" "del" "0" "00006" "LAMA2_000853" "g.129824419del" "" "{PMID:Cavdarli 2023:36575883}" "" "c.8541delG" "ACMG PVS1 PM2" "Germline" "" "" "0" "" "" "g.129503274del" "" "likely pathogenic (recessive)" "ACMG" "0000945935" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Saito 2023:37933889}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000945936" "1" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Saito 2023:37933889}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000945937" "1" "90" "6" "129775429" "129775429" "dup" "0" "00006" "LAMA2_000883" "g.129775429dup" "" "{PMID:Saito 2023:37933889}" "" "" "" "Germline" "" "" "0" "" "" "g.129454284dup" "" "pathogenic (recessive)" "ACMG" "0000945938" "2" "90" "6" "129663524" "129663524" "subst" "1.22058E-5" "00006" "LAMA2_000208" "g.129663524C>T" "" "{PMID:Saito 2023:37933889}" "" "" "" "Germline" "" "" "0" "" "" "g.129342379C>T" "" "pathogenic (recessive)" "ACMG" "0000945939" "2" "90" "6" "129774216" "129774218" "del" "0" "00006" "LAMA2_000429" "g.129774216_129774218del" "" "{PMID:Saito 2023:37933889}" "" "6703dupT" "" "Germline" "" "" "0" "" "" "g.129453071_129453073del" "" "pathogenic (recessive)" "ACMG" "0000945940" "2" "90" "6" "129712635" "129722486" "del" "0" "00006" "LAMA2_000882" "g.(129704379_129712635)_(129722486_129723468)del" "" "{PMID:Saito 2023:37933889}" "" "del ex36-38" "" "Germline" "" "" "0" "" "" "g.(129383234_129391490)_(129401341_129402323)del" "" "pathogenic (recessive)" "ACMG" "0000946049" "0" "50" "6" "129714215" "129714215" "del" "1.63239E-5" "00006" "LAMA2_000441" "g.129714215del" "" "{PMID:Westra 2019:31127727}" "" "" "no variant 2nd chromosome after targeted sequencing; no segregation analysis; functional test preformed" "Germline/De novo (untested)" "" "" "0" "" "" "g.129393070del" "" "VUS" "" "0000946136" "3" "50" "6" "129588296" "129588296" "subst" "0" "00006" "LAMA2_000548" "g.129588296G>A" "" "{PMID:Westra 2019:31127727}" "" "" "functional test needed" "Germline/De novo (untested)" "" "" "0" "" "" "g.129267151G>A" "" "VUS" "" "0000946137" "3" "50" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Westra 2019:31127727}" "" "" "functional test performed; no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.129401345G>C" "" "VUS" "" "0000946178" "0" "50" "6" "129714215" "129714215" "del" "1.63239E-5" "00006" "LAMA2_000441" "g.129714215del" "" "{PMID:Westra 2019:31127727}" "" "" "no variant 2nd chromosome after targeted sequencing; no segregation analysis" "Germline/De novo (untested)" "" "" "0" "" "" "g.129393070del" "" "VUS" "" "0000948639" "0" "50" "6" "129371186" "129371186" "subst" "0.000133999" "02329" "LAMA2_000726" "g.129371186G>A" "" "" "" "LAMA2(NM_000426.4):c.236G>A (p.R79K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948640" "0" "70" "6" "129609198" "129609198" "subst" "0" "02329" "LAMA2_000705" "g.129609198G>A" "" "" "" "LAMA2(NM_000426.3):c.2744G>A (p.C915Y, p.(Cys915Tyr)), LAMA2(NM_000426.4):c.2744G>A (p.C915Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0000948641" "0" "90" "6" "129714215" "129714215" "del" "1.63239E-5" "02325" "LAMA2_000441" "g.129714215del" "" "" "" "LAMA2(NM_000426.3):c.5260delG (p.(Val1754*)), LAMA2(NM_000426.3):c.5260delG (p.V1754*), LAMA2(NM_000426.4):c.5260delG (p.V1754*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000948642" "0" "50" "6" "129762011" "129762011" "subst" "4.07272E-5" "02325" "LAMA2_000605" "g.129762011G>A" "" "" "" "LAMA2(NM_000426.3):c.6136G>A (p.D2046N), LAMA2(NM_000426.4):c.6136G>A (p.D2046N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948643" "0" "30" "6" "129777560" "129777560" "subst" "0.000862216" "02326" "LAMA2_000531" "g.129777560C>T" "" "" "" "LAMA2(NM_000426.3):c.6788C>T (p.(Thr2263Met), p.T2263M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948644" "0" "50" "6" "129786365" "129786365" "subst" "2.45054E-5" "02325" "LAMA2_000611" "g.129786365G>A" "" "" "" "LAMA2(NM_000426.3):c.7231G>A (p.V2411I), LAMA2(NM_000426.4):c.7231G>A (p.V2411I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948645" "0" "50" "6" "129813063" "129813063" "subst" "0" "02329" "LAMA2_000730" "g.129813063T>C" "" "" "" "LAMA2(NM_000426.4):c.7916T>C (p.V2639A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948646" "0" "30" "6" "129813453" "129813453" "subst" "4.07418E-6" "01804" "LAMA2_000884" "g.129813453C>G" "" "" "" "LAMA2(NM_000426.3):c.8076-7C>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000948647" "0" "50" "6" "129828752" "129828752" "subst" "0" "02325" "LAMA2_000685" "g.129828752G>A" "" "" "" "LAMA2(NM_000426.3):c.8822G>A (p.G2941E), LAMA2(NM_000426.4):c.8822G>A (p.G2941E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000948648" "0" "50" "6" "129835537" "129835537" "subst" "4.47296E-5" "02325" "LAMA2_000885" "g.129835537A>G" "" "" "" "LAMA2(NM_000426.4):c.9008A>G (p.N3003S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000955468" "11" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000955469" "21" "90" "6" "129704299" "129704303" "del" "0" "03652" "LAMA2_000886" "g.129704299_129704303del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129383154_129383158del" "" "pathogenic (recessive)" "ACMG" "0000955470" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000955471" "11" "90" "6" "129704299" "129704303" "del" "0" "03652" "LAMA2_000886" "g.129704299_129704303del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129383154_129383158del" "" "pathogenic (recessive)" "ACMG" "0000955472" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000955473" "10" "90" "6" "129704299" "129704303" "del" "0" "03652" "LAMA2_000886" "g.129704299_129704303del" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129383154_129383158del" "" "pathogenic (recessive)" "ACMG" "0000957310" "3" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000957344" "3" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000957345" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000957346" "11" "90" "6" "129762020" "129762020" "subst" "0" "03652" "LAMA2_000887" "g.129762020A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129440875A>T" "" "pathogenic (recessive)" "ACMG" "0000957347" "3" "90" "6" "129762020" "129762020" "subst" "0" "03652" "LAMA2_000887" "g.129762020A>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.129440875A>T" "" "pathogenic (recessive)" "ACMG" "0000957348" "21" "90" "6" "129465058" "129465059" "del" "0" "03652" "LAMA2_000419" "g.129465058_129465059del" "" "" "" "" "" "Germline" "" "rs2114958680" "" "" "" "g.129143913_129143914del" "" "pathogenic (recessive)" "ACMG" "0000957349" "11" "90" "6" "129486802" "129486802" "subst" "0" "03652" "LAMA2_000888" "g.129486802G>T" "" "" "" "" "" "Germline" "" "rs1583169151" "" "" "" "g.129165657G>T" "" "pathogenic (recessive)" "ACMG" "0000957351" "21" "90" "6" "129419358" "129419358" "subst" "0" "03652" "LAMA2_000278" "g.129419358C>T" "" "" "" "" "" "Germline" "" "rs143680577" "" "" "" "g.129098213C>T" "" "likely pathogenic (recessive)" "ACMG" "0000957352" "11" "90" "6" "129635860" "129635860" "subst" "0" "03652" "LAMA2_000181" "g.129635860A>T" "" "" "" "" "" "Germline" "" "" "" "" "" "g.129314715A>T" "" "likely pathogenic (recessive)" "ACMG" "0000957353" "21" "90" "6" "129573393" "129573394" "del" "0" "03652" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "rs202247790" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000957354" "11" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000957355" "11" "90" "6" "129573393" "129573394" "del" "0" "03652" "LAMA2_000018" "g.129573393_129573394del" "" "" "" "" "" "Germline" "" "rs202247790" "" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0000957356" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000957357" "11" "90" "6" "129486769" "129486769" "del" "0" "03652" "LAMA2_000862" "g.129486769del" "" "" "" "" "" "Germline" "" "rs1185229314" "" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000957358" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000957359" "11" "90" "6" "129486769" "129486769" "del" "0" "03652" "LAMA2_000862" "g.129486769del" "" "" "" "" "" "Germline" "" "rs1185229314" "" "" "" "g.129165624del" "" "pathogenic (recessive)" "ACMG" "0000957360" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000963813" "0" "30" "6" "129513837" "129513837" "subst" "0.00164999" "01804" "LAMA2_000674" "g.129513837A>G" "" "" "" "LAMA2(NM_000426.3):c.1621A>G (p.S541G, p.(Ser541Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963816" "0" "30" "6" "129704272" "129704272" "subst" "2.86324E-5" "01804" "LAMA2_000890" "g.129704272C>T" "" "" "" "LAMA2(NM_000426.3):c.4965C>T (p.(Thr1655=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000963821" "0" "50" "6" "129786384" "129786384" "subst" "0.000171501" "02327" "LAMA2_000668" "g.129786384A>G" "" "" "" "LAMA2(NM_000426.3):c.7250A>G (p.H2417R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000963825" "0" "50" "6" "129833555" "129833555" "subst" "8.53777E-5" "02327" "LAMA2_000892" "g.129833555C>T" "" "" "" "LAMA2(NM_000426.3):c.8905C>T (p.(Arg2969Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000971626" "3" "90" "6" "129618928" "129618928" "subst" "0" "00435" "LAMA2_000893" "g.129618928T>G" "" "" "" "" "" "Germline" "yes" "" "0" "" "" "g.129297783T>G" "" "VUS" "" "0000976958" "0" "30" "6" "129514008" "129514008" "subst" "0.000598572" "01804" "LAMA2_000217" "g.129514008C>T" "" "" "" "LAMA2(NM_000426.4):c.1782+10C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976959" "0" "30" "6" "129588232" "129588232" "subst" "0" "01804" "LAMA2_000894" "g.129588232A>G" "" "" "" "LAMA2(NM_000426.3):c.2209-19A>G (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976960" "0" "50" "6" "129609093" "129609093" "subst" "8.12301E-6" "01804" "LAMA2_000895" "g.129609093A>G" "" "" "" "LAMA2(NM_000426.4):c.2639A>G (p.(Asp880Gly))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976961" "0" "90" "6" "129618874" "129618874" "subst" "8.12381E-6" "01804" "LAMA2_000025" "g.129618874C>A" "" "" "" "LAMA2(NM_000426.3):c.2901C>A (p.(Cys967Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000976962" "0" "50" "6" "129636759" "129636759" "subst" "2.43653E-5" "01804" "LAMA2_000896" "g.129636759C>A" "" "" "" "LAMA2(NM_000426.4):c.3694C>A (p.(Pro1232Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976963" "0" "50" "6" "129748957" "129748957" "subst" "1.21946E-5" "02325" "LAMA2_000897" "g.129748957A>T" "" "" "" "LAMA2(NM_000426.4):c.5926A>T (p.R1976W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976964" "0" "50" "6" "129762148" "129762148" "subst" "0.000688694" "01804" "LAMA2_000898" "g.129762148G>C" "" "" "" "LAMA2(NM_000426.4):c.6268+5G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976965" "0" "90" "6" "129766967" "129766967" "subst" "0" "01804" "LAMA2_000242" "g.129766967G>T" "" "" "" "LAMA2(NM_000426.3):c.6429+1G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000976966" "0" "30" "6" "129774128" "129774128" "dup" "0" "01804" "LAMA2_000640" "g.129774128dup" "" "" "" "LAMA2(NM_000426.4):c.6430-5dup" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000976967" "0" "50" "6" "129775418" "129775418" "subst" "0.00011812" "02325" "LAMA2_000899" "g.129775418G>A" "" "" "" "LAMA2(NM_000426.4):c.6692G>A (p.R2231H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976968" "0" "50" "6" "129785469" "129785469" "subst" "0" "01804" "LAMA2_000900" "g.129785469T>C" "" "" "" "LAMA2(NM_000426.4):c.7027T>C (p.(Phe2343Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976969" "0" "50" "6" "129799911" "129799911" "subst" "2.44234E-5" "01804" "LAMA2_000901" "g.129799911C>T" "" "" "" "LAMA2(NM_000426.3):c.7525C>T (p.(Leu2509Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976970" "0" "50" "6" "129807758" "129807758" "subst" "4.06855E-6" "01804" "LAMA2_000902" "g.129807758G>A" "" "" "" "LAMA2(NM_000426.4):c.7889G>A (p.(Arg2630Gln))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976971" "0" "50" "6" "129813486" "129813486" "subst" "0" "01804" "LAMA2_000903" "g.129813486C>T" "" "" "" "LAMA2(NM_000426.4):c.8102C>T (p.(Ser2701Phe))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976972" "0" "50" "6" "129828707" "129828707" "subst" "0" "01804" "LAMA2_000904" "g.129828707C>T" "" "" "" "LAMA2(NM_000426.4):c.8777C>T (p.(Thr2926Ile))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000976973" "0" "50" "6" "129835746" "129835746" "subst" "0.000691467" "01804" "LAMA2_000272" "g.129835746T>C" "" "" "" "LAMA2(NM_000426.3):c.9211+6T>C (p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000984943" "21" "90" "6" "129373836" "129454303" "del" "0" "03652" "LAMA2_000905" "g.129373836_129454303del" "" "" "" "" "Deletion of 80.5 Kb involving exons 3 and 4 of the LAMA2 gene characterized by Sanger sequencing.\r\nNC_000006.12(NM_000426.4):c.283+2603_640-10743del\r\nNP_000417.3:" "Germline" "" "" "0" "" "" "g.129052691_129133158del" "" "pathogenic (recessive)" "ACMG" "0000984944" "11" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000984949" "11" "90" "6" "129373836" "129454303" "del" "0" "03652" "LAMA2_000905" "g.129373836_129454303del" "" "" "" "" "Deletion of 80.5 Kb involving exon 3 and 4 of the LAMA2 gene characterized by Sanger Sequencing. NC_000006.12(NM_000426.4):c.283+2603_640-10743del\r\nNP_000417.3:p.(Gln95Hisfs*14)" "Germline" "" "" "0" "" "" "g.129052691_129133158del" "" "pathogenic (recessive)" "ACMG" "0000984950" "21" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000029" "g.129621928C>T" "" "" "" "" "" "Germline" "" "rs145420388" "" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0000989211" "3" "70" "6" "129826366" "129826366" "subst" "0" "01164" "LAMA2_000906" "g.129826366C>T" "" "" "" "" "ACMG: PVS1, PS4_SUP, PM2_SUP" "Germline" "?" "" "" "" "" "g.129505221C>T" "VCV003234980.1" "pathogenic (recessive)" "ACMG" "0000989253" "3" "70" "6" "129826366" "129826366" "subst" "0" "01164" "LAMA2_000906" "g.129826366C>T" "" "" "" "" "ACMG PVS1, PS4_SUP, PM2_SUP" "Germline" "?" "" "0" "" "" "g.129505221C>T" "SCV005042811.1" "pathogenic (recessive)" "ACMG" "0000995330" "0" "90" "6" "129470153" "129470154" "del" "2.84474E-5" "01804" "LAMA2_000216" "g.129470153_129470154del" "" "" "" "LAMA2(NM_000426.3):c.939_940del (p.(Cys314TrpfsTer3))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000995331" "0" "30" "6" "129636992" "129636992" "subst" "0" "01804" "LAMA2_000907" "g.129636992T>A" "" "" "" "LAMA2(NM_000426.3):c.3821T>A (p.(Val1274Glu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995332" "0" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "01804" "LAMA2_000033" "g.129637234C>T" "" "" "" "LAMA2(NM_000426.3):c.3976C>T (p.(Arg1326Ter))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000995333" "0" "30" "6" "129674425" "129674425" "subst" "3.65678E-5" "01804" "LAMA2_000424" "g.129674425C>T" "" "" "" "LAMA2(NM_000426.3):c.4640C>T (p.(Thr1547Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000995334" "0" "50" "6" "129828766" "129828766" "subst" "0.0001219" "01804" "LAMA2_000732" "g.129828766G>A" "" "" "" "LAMA2(NM_000426.3):c.8836G>A (p.(Gly2946Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000995335" "0" "50" "6" "129833555" "129833555" "subst" "8.53777E-5" "01804" "LAMA2_000892" "g.129833555C>T" "" "" "" "LAMA2(NM_000426.3):c.8905C>T (p.(Arg2969Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001014173" "0" "30" "6" "129691111" "129691111" "subst" "0.00086766" "02326" "LAMA2_000517" "g.129691111C>A" "" "" "" "LAMA2(NM_000426.3):c.4935C>A (p.T1645=, p.(=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001017267" "1" "90" "6" "129637234" "129637234" "subst" "5.69018E-5" "00006" "LAMA2_000033" "g.129637234C>T" "" "{PMID:Lord 2024:39243181}" "" "" "" "Germline" "" "" "0" "" "" "g.129316089C>T" "{CV:92956}" "pathogenic (recessive)" "" "0001017268" "2" "50" "6" "129796515" "129796515" "dup" "0" "00006" "LAMA2_000908" "g.129796515dup" "" "{PMID:Lord 2024:39243181}" "" "" "no effect on splicing detected (ex53 in case and controls)" "Germline" "" "" "0" "" "" "g.129796515dup" "" "VUS" "" "0001021227" "3" "90" "6" "129748969" "129748969" "del" "0" "00006" "LAMA2_000909" "g.129748969del" "" "{PMID:Mao 2025:39815277}" "" "" "ACMG PVS1, PM2, PP1, PM3_P" "Germline" "" "" "0" "" "" "g.129427824del" "" "pathogenic (recessive)" "ACMG" "0001025170" "0" "50" "6" "129419334" "129419334" "subst" "0" "02329" "LAMA2_000910" "g.129419334A>G" "" "" "" "LAMA2(NM_000426.4):c.413A>G (p.Y138C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001029525" "1" "70" "6" "129637000" "129637000" "subst" "0" "00006" "LAMA2_000227" "g.129637000C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic (recessive)" "" "0001029526" "1" "70" "6" "129714377" "129714377" "subst" "0" "00006" "LAMA2_000929" "g.129714377C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PM3, PP4" "Germline" "" "" "0" "" "" "g.129393232C>T" "" "likely pathogenic (recessive)" "" "0001029527" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029528" "3" "70" "6" "129781470" "129781470" "subst" "0" "00006" "LAMA2_000936" "g.129781470G>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129460325G>T" "" "likely pathogenic (recessive)" "" "0001029529" "1" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029530" "1" "70" "6" "129637306" "129637306" "subst" "1.22104E-5" "00006" "LAMA2_000034" "g.129637306C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129316161C>T" "" "likely pathogenic (recessive)" "" "0001029531" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029532" "1" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029533" "3" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029534" "1" "70" "6" "129204393" "129204393" "dup" "0" "00006" "LAMA2_000911" "g.129204393dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.128883248dup" "" "likely pathogenic (recessive)" "" "0001029535" "1" "70" "6" "129634114" "129634114" "subst" "0" "00006" "LAMA2_000464" "g.129634114C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129312969C>T" "" "likely pathogenic (recessive)" "" "0001029536" "1" "70" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "likely pathogenic (recessive)" "" "0001029537" "1" "70" "6" "129813045" "129813629" "del" "0" "00006" "LAMA2_000943" "g.(129807768_129813045)_(129813629_129823803)del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "del ex57-58" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.(129486623_129491900)_(129492484_129502658)del" "" "likely pathogenic (recessive)" "" "0001029538" "3" "70" "6" "129781432" "129781432" "subst" "1.63043E-5" "00006" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "likely pathogenic (recessive)" "" "0001029539" "1" "70" "6" "129371234" "129371234" "subst" "1.21842E-5" "00006" "LAMA2_000000" "g.129371234G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>A" "" "likely pathogenic (recessive)" "" "0001029540" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029541" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029542" "3" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029543" "1" "70" "6" "129674430" "129674430" "subst" "8.12599E-6" "00006" "LAMA2_000041" "g.129674430C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129353285C>T" "" "likely pathogenic (recessive)" "" "0001029544" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029545" "1" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029546" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029547" "1" "70" "6" "129637314" "129637314" "dup" "0" "00006" "LAMA2_000925" "g.129637314dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129316169dup" "" "likely pathogenic (recessive)" "" "0001029548" "3" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029549" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029550" "3" "70" "6" "129712776" "129712776" "subst" "0" "00006" "LAMA2_000812" "g.129712776G>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391631G>T" "" "likely pathogenic (recessive)" "" "0001029551" "3" "70" "6" "129704379" "129704379" "subst" "4.1587E-6" "00006" "LAMA2_000461" "g.129704379G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129383234G>A" "" "likely pathogenic (recessive)" "" "0001029552" "1" "70" "6" "129513971" "129513971" "del" "0" "00006" "LAMA2_000733" "g.129513971del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129192826del" "" "likely pathogenic (recessive)" "" "0001029553" "1" "70" "6" "129371234" "129371234" "subst" "1.21842E-5" "00006" "LAMA2_000000" "g.129371234G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>A" "" "likely pathogenic (recessive)" "" "0001029554" "3" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029555" "1" "70" "6" "129486817" "129486817" "subst" "1.63597E-5" "00006" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "likely pathogenic (recessive)" "" "0001029556" "3" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029557" "3" "70" "6" "129581943" "129581944" "del" "0" "00006" "LAMA2_000921" "g.129581943_129581944del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129260798_129260799del" "" "likely pathogenic (recessive)" "" "0001029558" "1" "70" "6" "129774177" "129774177" "subst" "0" "00006" "LAMA2_000933" "g.129774177C>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129453032C>A" "" "likely pathogenic (recessive)" "" "0001029559" "3" "70" "6" "129837358" "129837361" "dup" "0" "00006" "LAMA2_000192" "g.129837358_129837361dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129516213_129516216dup" "" "likely pathogenic (recessive)" "" "0001029560" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029561" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029562" "1" "70" "6" "129573238" "129573239" "del" "0" "00006" "LAMA2_000918" "g.129573238_129573239del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129252093_129252094del" "" "likely pathogenic (recessive)" "" "0001029563" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029564" "1" "70" "6" "129785433" "129785433" "subst" "1.62934E-5" "00006" "LAMA2_000036" "g.129785433A>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464288A>C" "" "likely pathogenic (recessive)" "" "0001029565" "3" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029566" "1" "70" "6" "129636970" "129636992" "del" "0" "00006" "LAMA2_000189" "g.129636970_129636992del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129315825_129315847del" "" "likely pathogenic (recessive)" "" "0001029567" "1" "70" "6" "129781432" "129781432" "subst" "1.63043E-5" "00006" "LAMA2_000056" "g.129781432C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129460287C>T" "" "likely pathogenic (recessive)" "" "0001029568" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029569" "1" "70" "6" "129799906" "129799906" "del" "0" "00006" "LAMA2_000940" "g.129799906del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PM3, PP4" "Germline" "" "" "0" "" "" "g.129478761del" "" "likely pathogenic (recessive)" "" "0001029570" "3" "70" "6" "129774169" "129774169" "subst" "0" "00006" "LAMA2_000421" "g.129774169C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129453024C>T" "" "likely pathogenic (recessive)" "" "0001029571" "1" "70" "6" "129724964" "129724964" "subst" "4.0701E-6" "00006" "LAMA2_000931" "g.129724964A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129403819A>G" "" "likely pathogenic (recessive)" "" "0001029572" "1" "70" "6" "129712752" "129712752" "del" "0" "00006" "LAMA2_000927" "g.129712752del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PM3" "Germline" "" "" "0" "" "" "g.129391607del" "" "likely pathogenic (recessive)" "" "0001029573" "1" "70" "6" "129722490" "129722490" "subst" "2.04232E-5" "00006" "LAMA2_000049" "g.129722490G>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129401345G>C" "" "likely pathogenic (recessive)" "" "0001029574" "1" "70" "6" "129636634" "129636634" "del" "0" "00006" "LAMA2_000922" "g.129636634del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PM3, PP4" "Germline" "" "" "0" "" "" "g.129315489del" "" "likely pathogenic (recessive)" "" "0001029575" "1" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029576" "3" "70" "6" "129674491" "129674491" "subst" "0" "00006" "LAMA2_000926" "g.129674491G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129353346G>A" "" "likely pathogenic (recessive)" "" "0001029577" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029578" "1" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029579" "3" "70" "6" "129573237" "129573241" "del" "0" "00006" "LAMA2_000017" "g.129573237_129573241del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252092_129252096del" "" "likely pathogenic (recessive)" "" "0001029580" "1" "70" "6" "129636709" "129636709" "del" "0" "00006" "LAMA2_000923" "g.129636709del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129315564del" "" "likely pathogenic (recessive)" "" "0001029581" "1" "70" "6" "129637000" "129637000" "subst" "0" "00006" "LAMA2_000227" "g.129637000C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic (recessive)" "" "0001029582" "1" "70" "6" "129618935" "129618935" "subst" "0" "00006" "LAMA2_000027" "g.129618935C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129297790C>T" "" "likely pathogenic (recessive)" "" "0001029583" "3" "70" "6" "129794498" "129794498" "subst" "0" "00006" "LAMA2_000939" "g.129794498G>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129473353G>T" "" "likely pathogenic (recessive)" "" "0001029584" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029585" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029586" "1" "70" "6" "129637000" "129637000" "subst" "0" "00006" "LAMA2_000227" "g.129637000C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic (recessive)" "" "0001029587" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029588" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029589" "3" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029590" "1" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029591" "1" "70" "6" "129712799" "129712799" "subst" "8.14518E-6" "00006" "LAMA2_000148" "g.129712799G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391654G>A" "" "likely pathogenic (recessive)" "" "0001029592" "1" "70" "6" "129649501" "129649504" "dup" "0" "00006" "LAMA2_000041" "g.129649501_129649504dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129328356_129328359dup" "" "likely pathogenic (recessive)" "" "0001029593" "1" "70" "6" "129794435" "129794435" "dup" "0" "00006" "LAMA2_000060" "g.129794435dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129473290dup" "" "likely pathogenic (recessive)" "" "0001029594" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029595" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029596" "1" "70" "6" "129204496" "129204496" "subst" "0" "00006" "LAMA2_000913" "g.129204496C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.128883351C>T" "" "likely pathogenic (recessive)" "" "0001029597" "1" "70" "6" "129371234" "129371234" "subst" "1.21842E-5" "00006" "LAMA2_000000" "g.129371234G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129050089G>A" "" "likely pathogenic (recessive)" "" "0001029598" "3" "70" "6" "129511404" "129511404" "subst" "0" "00006" "LAMA2_000779" "g.129511404C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129190259C>T" "" "likely pathogenic (recessive)" "" "0001029599" "3" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029600" "3" "70" "6" "129837358" "129837361" "dup" "0" "00006" "LAMA2_000192" "g.129837358_129837361dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129516213_129516216dup" "" "likely pathogenic (recessive)" "" "0001029601" "3" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029602" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029603" "3" "70" "6" "129621928" "129621928" "subst" "4.06128E-6" "00006" "LAMA2_000029" "g.129621928C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129300783C>T" "" "likely pathogenic (recessive)" "" "0001029604" "3" "70" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "likely pathogenic (recessive)" "" "0001029605" "1" "70" "6" "129581855" "129581855" "subst" "4.06448E-6" "00006" "LAMA2_000919" "g.129581855G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129260710G>A" "" "likely pathogenic (recessive)" "" "0001029606" "3" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029607" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029608" "1" "70" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "likely pathogenic (recessive)" "" "0001029609" "1" "70" "6" "129371122" "129371122" "subst" "0" "00006" "LAMA2_000915" "g.129371122T>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PP3, PM3, PP4" "Germline" "" "" "0" "" "" "g.129049977T>C" "" "likely pathogenic (recessive)" "" "0001029610" "1" "70" "6" "129486817" "129486817" "subst" "1.63597E-5" "00006" "LAMA2_000265" "g.129486817C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129165672C>T" "" "likely pathogenic (recessive)" "" "0001029611" "1" "70" "6" "129581925" "129581925" "subst" "0" "00006" "LAMA2_000920" "g.129581925A>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PP3, PM3, PP4" "Germline" "" "" "0" "" "" "g.129260780A>T" "" "likely pathogenic (recessive)" "" "0001029612" "1" "70" "6" "129371113" "129371113" "subst" "0" "00006" "LAMA2_000914" "g.129371113A>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PP3, PM3, PP4" "Germline" "" "" "0" "" "" "g.129049968A>C" "" "likely pathogenic (recessive)" "" "0001029613" "1" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029614" "3" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029615" "2" "70" "6" "129799906" "129799906" "del" "0" "00006" "LAMA2_000357" "g.129799906del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478761del" "" "likely pathogenic (recessive)" "" "0001029616" "2" "70" "6" "129802536" "129802536" "delins" "0" "00006" "LAMA2_000941" "g.129802536delinsGTGTCCCTAGGTGTCCCTA" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "c.7701delTinsGTGTCCCTAGGTGTCCCTA" "ACMG PM2, PVS1, PM3, PP4" "Germline" "" "" "0" "" "" "g.129481391delinsGTGTCCCTAGGTGTCCCTA" "" "likely pathogenic (recessive)" "" "0001029617" "2" "70" "6" "129649444" "129649444" "subst" "4.06352E-6" "00006" "LAMA2_000219" "g.129649444C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "likely pathogenic (recessive)" "" "0001029618" "2" "70" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "likely pathogenic (recessive)" "" "0001029619" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029620" "2" "70" "6" "129785433" "129785433" "subst" "1.62934E-5" "00006" "LAMA2_000036" "g.129785433A>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464288A>C" "" "likely pathogenic (recessive)" "" "0001029621" "2" "70" "6" "129807757" "129807757" "subst" "4.06851E-6" "00006" "LAMA2_000359" "g.129807757C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129486612C>T" "" "likely pathogenic (recessive)" "" "0001029622" "2" "70" "6" "129674450" "129674450" "dup" "0" "00006" "LAMA2_000143" "g.129674450dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353305dup" "" "likely pathogenic (recessive)" "" "0001029623" "2" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029624" "2" "70" "6" "129835668" "129835668" "subst" "0" "00006" "LAMA2_000945" "g.129835668G>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129514523G>T" "" "likely pathogenic (recessive)" "" "0001029625" "2" "70" "6" "129785516" "129785516" "subst" "2.44345E-5" "00006" "LAMA2_000059" "g.129785516C>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464371C>A" "" "likely pathogenic (recessive)" "" "0001029626" "2" "70" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "likely pathogenic (recessive)" "" "0001029627" "2" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029628" "2" "70" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "likely pathogenic (recessive)" "" "0001029629" "2" "70" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "likely pathogenic (recessive)" "" "0001029630" "2" "70" "6" "129588272" "129588272" "subst" "4.06865E-6" "00006" "LAMA2_000020" "g.129588272C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129267127C>T" "" "likely pathogenic (recessive)" "" "0001029631" "2" "70" "6" "129204469" "129204469" "subst" "0" "00006" "LAMA2_000912" "g.129204469C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.128883324C>T" "" "likely pathogenic (recessive)" "" "0001029632" "2" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029633" "2" "70" "6" "129649444" "129649444" "subst" "4.06352E-6" "00006" "LAMA2_000219" "g.129649444C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129328299C>T" "" "likely pathogenic (recessive)" "" "0001029634" "2" "70" "6" "129612867" "129612867" "subst" "0" "00006" "LAMA2_000027" "g.129612867T>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129291722T>A" "" "likely pathogenic (recessive)" "" "0001029635" "2" "70" "6" "129837376" "129837376" "subst" "4.06461E-6" "00006" "LAMA2_000078" "g.129837376C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129516231C>T" "" "likely pathogenic (recessive)" "" "0001029636" "2" "70" "6" "129799906" "129799906" "del" "0" "00006" "LAMA2_000357" "g.129799906del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478761del" "" "likely pathogenic (recessive)" "" "0001029637" "2" "70" "6" "129637000" "129637000" "subst" "0" "00006" "LAMA2_000227" "g.129637000C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129315855C>T" "" "likely pathogenic (recessive)" "" "0001029638" "2" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029639" "2" "70" "6" "129785434" "129785434" "subst" "0" "00006" "LAMA2_000937" "g.129785434G>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129464289G>C" "" "likely pathogenic (recessive)" "" "0001029640" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029641" "2" "70" "6" "129712680" "129712680" "subst" "2.4431E-5" "00006" "LAMA2_000044" "g.129712680C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129391535C>T" "" "likely pathogenic (recessive)" "" "0001029642" "2" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029643" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029644" "2" "70" "6" "129813631" "129813634" "del" "0" "00006" "LAMA2_000298" "g.129813631_129813634del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129492486_129492489del" "" "likely pathogenic (recessive)" "" "0001029645" "2" "70" "6" "129786399" "129786399" "subst" "0" "00006" "LAMA2_000938" "g.129786399G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129465254G>A" "" "likely pathogenic (recessive)" "" "0001029646" "2" "70" "6" "129722399" "129722399" "subst" "2.84706E-5" "00006" "LAMA2_000046" "g.129722399C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129401254C>T" "" "likely pathogenic (recessive)" "" "0001029647" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029648" "2" "70" "6" "129781470" "129781470" "subst" "0" "00006" "LAMA2_000936" "g.129781470G>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129460325G>T" "" "likely pathogenic (recessive)" "" "0001029649" "2" "70" "6" "129573228" "129573441" "del" "0" "00006" "LAMA2_000917" "g.(129571359_129573228)_(129573441_129581855)del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "del ex14" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.(129250214_129252083)_(129252296_129260710)del" "" "likely pathogenic (recessive)" "" "0001029650" "2" "70" "6" "129204286" "129204503" "del" "0" "00006" "LAMA2_000763" "g.(?_129204286)_(129204503_129371062)del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "del ex1" "" "Germline" "" "" "0" "" "" "g.(?_128883141)_(128883358_129049917)del" "" "likely pathogenic (recessive)" "" "0001029651" "2" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029652" "2" "70" "6" "129573228" "129573441" "del" "0" "00006" "LAMA2_000917" "g.(129571359_129573228)_(129573441_129581855)del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "del ex14" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.(129250214_129252083)_(129252296_129260710)del" "" "likely pathogenic (recessive)" "" "0001029653" "2" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029654" "2" "70" "6" "129714188" "129714188" "subst" "0" "00006" "LAMA2_000928" "g.129714188A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PM3, PP4" "Germline" "" "" "0" "" "" "g.129393043A>G" "" "likely pathogenic (recessive)" "" "0001029655" "2" "70" "6" "129774169" "129774169" "subst" "0" "00006" "LAMA2_000421" "g.129774169C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129453024C>T" "" "likely pathogenic (recessive)" "" "0001029656" "2" "70" "6" "129723612" "129723612" "del" "0" "00006" "LAMA2_000930" "g.129723612del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1" "Germline" "" "" "0" "" "" "g.129402467del" "" "likely pathogenic (recessive)" "" "0001029657" "2" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029658" "2" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029659" "2" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029660" "2" "70" "6" "129714401" "129714401" "subst" "0" "00006" "LAMA2_000742" "g.129714401G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129393256G>A" "" "likely pathogenic (recessive)" "" "0001029661" "2" "70" "6" "129774263" "129774263" "delins" "0" "00006" "LAMA2_000934" "g.129774263delinsTGCCA" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129453118delinsTGCCA" "" "likely pathogenic (recessive)" "" "0001029662" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029663" "2" "70" "6" "129802567" "129802567" "subst" "5.28305E-5" "00006" "LAMA2_000146" "g.129802567C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129481422C>T" "" "likely pathogenic (recessive)" "" "0001029664" "2" "70" "6" "129799906" "129799906" "del" "0" "00006" "LAMA2_000357" "g.129799906del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478761del" "" "likely pathogenic (recessive)" "" "0001029665" "2" "70" "6" "129470172" "129470172" "subst" "0" "00006" "LAMA2_000916" "g.129470172C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129149027C>T" "" "likely pathogenic (recessive)" "" "0001029666" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029667" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029668" "2" "70" "6" "129674477" "129674480" "dup" "0" "00006" "LAMA2_000143" "g.129674477_129674480dup" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129353332_129353335dup" "" "likely pathogenic (recessive)" "" "0001029669" "2" "70" "6" "129785589" "129785589" "subst" "1.62966E-5" "00006" "LAMA2_000082" "g.129785589C>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464444C>T" "" "likely pathogenic (recessive)" "" "0001029670" "2" "70" "6" "129823802" "129823802" "subst" "0" "00006" "LAMA2_000204" "g.129823802A>G" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129502657A>G" "" "likely pathogenic (recessive)" "" "0001029671" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029672" "2" "70" "6" "129799922" "129799922" "del" "0" "00006" "LAMA2_000357" "g.129799922del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129478777del" "" "likely pathogenic (recessive)" "" "0001029673" "2" "70" "6" "129785433" "129785433" "subst" "1.62934E-5" "00006" "LAMA2_000036" "g.129785433A>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129464288A>C" "" "likely pathogenic (recessive)" "" "0001029674" "2" "70" "6" "129636905" "129636905" "subst" "1.62547E-5" "00006" "LAMA2_000924" "g.129636905A>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129315760A>T" "" "likely pathogenic (recessive)" "" "0001029675" "2" "70" "6" "129724965" "129725105" "del" "0" "00006" "LAMA2_000932" "g.(129723633_129724965)_(129725105_129748896)del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "del ex40" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.(129402488_129403820)_(129403960_129427751)del" "" "likely pathogenic (recessive)" "" "0001029676" "2" "70" "6" "129371113" "129371113" "subst" "0" "00006" "LAMA2_000914" "g.129371113A>C" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PP3, PM3, PP4" "Germline" "" "" "0" "" "" "g.129049968A>C" "" "likely pathogenic (recessive)" "" "0001029677" "2" "70" "6" "129807683" "129807683" "del" "0" "00006" "LAMA2_000942" "g.129807683del" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129486538del" "" "likely pathogenic (recessive)" "" "0001029678" "2" "70" "6" "129826496" "129826497" "ins" "0" "00006" "LAMA2_000944" "g.129826496_129826497insGTAAATTCT" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129505351_129505352insGTAAATTCT" "" "likely pathogenic (recessive)" "" "0001029679" "2" "70" "6" "129777493" "129777493" "subst" "0" "00006" "LAMA2_000935" "g.129777493G>T" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "ACMG PM2, PVS1, PP4" "Germline" "" "" "0" "" "" "g.129456348G>T" "" "likely pathogenic (recessive)" "" "0001029680" "0" "30" "6" "129635800" "129635800" "subst" "0.0648408" "00006" "LAMA2_000064" "g.129635800G>A" "" "{PMID:Chausova 2025:39941024}, {DOI:Chausova 2025:10.3390/ijms26031257}" "" "" "" "Germline" "" "" "0" "" "" "g.129314655G>A" "" "benign" "" "0001035456" "0" "50" "6" "129371227" "129371227" "subst" "1.21827E-5" "01804" "LAMA2_000542" "g.129371227C>A" "" "" "" "LAMA2(NM_000426.4):c.277C>A (p.(Pro93Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035457" "0" "50" "6" "129380925" "129380925" "subst" "2.43835E-5" "02325" "LAMA2_000946" "g.129380925A>G" "" "" "" "LAMA2(NM_000426.4):c.284-4A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035458" "0" "50" "6" "129419400" "129419400" "subst" "5.68537E-5" "01804" "LAMA2_000627" "g.129419400A>T" "" "" "" "LAMA2(NM_000426.4):c.479A>T (p.(Asp160Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035459" "0" "50" "6" "129468114" "129468114" "subst" "8.1477E-6" "01804" "LAMA2_000321" "g.129468114C>T" "" "" "" "LAMA2(NM_000426.4):c.830C>T (p.(Ser277Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035460" "0" "50" "6" "129601267" "129601267" "subst" "4.47136E-5" "01804" "LAMA2_000947" "g.129601267G>A" "" "" "" "LAMA2(NM_000426.4):c.2512G>A (p.(Gly838Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035461" "0" "30" "6" "129618850" "129618850" "subst" "9.34185E-5" "01804" "LAMA2_000512" "g.129618850A>G" "" "" "" "LAMA2(NM_000426.3):c.2877A>G (p.Q959=, p.(Gln959=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001035462" "0" "50" "6" "129691074" "129691074" "subst" "4.07169E-6" "01804" "LAMA2_000948" "g.129691074T>C" "" "" "" "LAMA2(NM_000426.3):c.4898T>C (p.(Ile1633Thr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035463" "0" "50" "6" "129722453" "129722453" "subst" "0.000460315" "01804" "LAMA2_000949" "g.129722453C>T" "" "" "" "LAMA2(NM_000426.3):c.5530C>T (p.(Arg1844Cys))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035464" "0" "50" "6" "129794381" "129794381" "subst" "0" "01804" "LAMA2_000950" "g.129794381A>G" "" "" "" "LAMA2(NM_000426.4):c.7323A>G (p.(Ile2441Met))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035465" "0" "50" "6" "129799912" "129799912" "subst" "0" "01804" "LAMA2_000951" "g.129799912T>C" "" "" "" "LAMA2(NM_000426.4):c.7526T>C (p.(Leu2509Pro))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001035467" "0" "30" "6" "129826434" "129826434" "subst" "5.6899E-5" "01804" "LAMA2_000952" "g.129826434G>C" "" "" "" "LAMA2(NM_000426.3):c.8637G>C (p.(Leu2879=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001046052" "0" "30" "6" "129670493" "129670493" "subst" "0.00370939" "02326" "LAMA2_000333" "g.129670493C>T" "" "" "" "LAMA2(NM_000426.3):c.4487C>T (p.A1496V, p.(Ala1496Val))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001047072" "3" "90" "6" "129621928" "129621928" "subst" "4.06128E-6" "03652" "LAMA2_000027" "g.129621928C>T" "" "" "" "" "both parents heterozygous carriers of the variant" "Germline" "" "rs145420388" "0" "" "" "g.129300783C>T" "" "pathogenic (recessive)" "ACMG" "0001047958" "3" "90" "6" "129468134" "129468134" "subst" "0" "00006" "LAMA2_000290" "g.129468134G>A" "" "{PMID:Rini 2025:40870035}, {DOI:Rini 20251: 10.3390/genes16080987}" "" "" "" "Germline" "" "" "0" "" "" "g.129146989G>A" "" "pathogenic (recessive)" "" "0001047959" "3" "90" "6" "129468134" "129468134" "subst" "0" "00006" "LAMA2_000290" "g.129468134G>A" "" "{PMID:Rini 2025:40870035}, {DOI:Rini 20251: 10.3390/genes16080987}" "" "" "" "Germline" "" "" "0" "" "" "g.129146989G>A" "" "pathogenic (recessive)" "" "0001047960" "3" "90" "6" "129571267" "129571269" "del" "0" "00006" "LAMA2_000014" "g.129571267_129571269del" "" "{PMID:Rini 2025:40870035}, {DOI:Rini 20251: 10.3390/genes16080987}" "" "" "" "Germline" "" "" "0" "" "" "g.129250122_129250124del" "" "pathogenic (recessive)" "" "0001049531" "11" "50" "6" "129813132" "129813132" "subst" "7.31434E-5" "00006" "LAMA2_000953" "g.129813132T>C" "" "{PMID:Hollink 2016:26607181}" "" "" "" "Germline" "" "" "0" "" "" "g.129491987T>C" "" "VUS" "" "0001049532" "21" "50" "6" "129704276" "129704276" "subst" "0.000163477" "00006" "LAMA2_000954" "g.129704276G>A" "" "{PMID:Hollink 2016:26607181}" "" "" "" "Germline" "" "" "0" "" "" "g.129383131G>A" "" "VUS" "" "0001052482" "0" "30" "6" "129381009" "129381009" "subst" "0" "01804" "LAMA2_000955" "g.129381009C>T" "" "" "" "LAMA2(NM_000426.4):c.364C>T (p.(His122Tyr))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001052483" "0" "50" "6" "129573334" "129573334" "subst" "0" "01804" "LAMA2_000956" "g.129573334G>A" "" "" "" "LAMA2(NM_000426.4):c.1990G>A (p.(Gly664Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052484" "0" "50" "6" "129781357" "129781357" "subst" "0" "01804" "LAMA2_000957" "g.129781357G>T" "" "" "" "LAMA2(NM_000426.4):c.6880G>T (p.(Val2294Leu))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052485" "0" "50" "6" "129785554" "129785554" "subst" "1.62886E-5" "01804" "LAMA2_000958" "g.129785554T>C" "" "" "" "LAMA2(NM_000426.4):c.7112T>C (p.(Phe2371Ser))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052486" "0" "50" "6" "129802537" "129802537" "subst" "0" "01804" "LAMA2_000959" "g.129802537G>A" "" "" "" "LAMA2(NM_000426.4):c.7702G>A (p.(Gly2568Arg))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052487" "0" "50" "6" "129813132" "129813132" "subst" "7.31434E-5" "02327" "LAMA2_000953" "g.129813132T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052488" "0" "50" "6" "129824419" "129824419" "del" "0" "01804" "LAMA2_000853" "g.129824419del" "" "" "" "LAMA2(NM_000426.4):c.8541del (p.(Trp2847Cysfs*6))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001052489" "0" "70" "6" "129826343" "129826343" "subst" "0" "01804" "LAMA2_000620" "g.129826343A>G" "" "" "" "LAMA2(NM_000426.3):c.8548-2A>G, LAMA2(NM_000426.4):c.8548-2A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely pathogenic" "" "0001057963" "0" "50" "6" "129511444" "129511444" "subst" "4.06742E-5" "00006" "LAMA2_000964" "g.129511444C>T" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs369760070" "0" "" "" "g.129190299C>T" "{CV:477443}" "VUS" "" "0001057966" "0" "50" "6" "129419331" "129419331" "subst" "8.12427E-6" "00006" "LAMA2_000963" "g.129419331C>T" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs138964034" "0" "" "" "g.129098186C>T" "{CV:583039}" "VUS" "" "0001057968" "0" "50" "6" "129371201" "129371201" "subst" "2.43645E-5" "00006" "LAMA2_000962" "g.129371201G>C" "" "{PMID:Ayala-Ramirez 2025:41066171}" "" "" "" "Germline" "" "rs148607737" "0" "" "" "g.129050056G>C" "{CV:543835}" "VUS" "" "0001058025" "21" "90" "6" "129573393" "129573394" "del" "0" "00006" "LAMA2_000018" "g.129573393_129573394del" "" "{PMID:Nejati 2025:41188926}" "" "" "ACMG PVS1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.129252248_129252249del" "" "pathogenic (recessive)" "ACMG" "0001058027" "11" "90" "6" "129618828" "129618828" "subst" "4.06197E-6" "00006" "LAMA2_000960" "g.129618828A>G" "" "{PMID:Nejati 2025:41188926}" "" "" "ACMG PVS1, PM2, PM3, PP5" "Germline" "" "" "0" "" "" "g.129297683A>G" "" "pathogenic (recessive)" "ACMG" "0001058028" "3" "90" "6" "129637196" "129637197" "del" "0" "00006" "LAMA2_000961" "g.129637196_129637197del" "" "{PMID:Nouri 2022:35989179}" "" "3936_3937delAT" "ACMG PVS1, PM2, PP3" "Germline" "" "" "0" "" "" "g.129316051_129316052del" "" "pathogenic (recessive)" "ACMG" "0001058847" "0" "90" "6" "129807757" "129807757" "subst" "4.06851E-6" "00006" "LAMA2_000359" "g.129807757C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.129486612C>T" "" "pathogenic" "" "0001058848" "0" "70" "6" "129419358" "129419358" "subst" "0" "00006" "LAMA2_000278" "g.129419358C>T" "" "{PMID:Retterer 2016:26633542}" "" "" "variants reported seperately, unknown if mono-allelic or bi-allelic" "Unknown" "" "" "0" "" "" "g.129098213C>T" "" "likely pathogenic" "" "0001060869" "0" "50" "6" "129670493" "129670493" "subst" "0.00370939" "00006" "LAMA2_000333" "g.129670493C>T" "" "{PMID:Horbacz 2025:41210864}" "" "" "ACMG PM1, PP3; not in 142 controls" "Germline/De novo (untested)" "" "" "0" "" "" "g.129349348C>T" "" "VUS" "ACMG" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes LAMA2 ## Count = 2855 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000001131" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001132" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001133" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001134" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001135" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001136" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001137" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001138" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001140" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001141" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001142" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001144" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000001147" "00000065" "50" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000001148" "00000065" "50" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000063227" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(=)" "p.(=)" "56" "0000063228" "00000065" "10" "3038" "-156" "3038" "-156" "c.3038-156A>G" "r.(=)" "p.(=)" "21i" "0000063229" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000063230" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000063231" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.(=)" "p.(=)" "3" "0000063232" "00000065" "10" "1306" "93" "1306" "93" "c.1306+93T>C" "r.(=)" "p.(=)" "9i" "0000063233" "00000065" "50" "4861" "-55" "4861" "-55" "c.4861-55A>G" "r.(=)" "p.(=)" "33i" "0000063235" "00000065" "10" "3174" "38" "3174" "38" "c.3174+38A>G" "r.(=)" "p.(=)" "22i" "0000063236" "00000065" "70" "396" "1" "396" "1" "c.396+1G>A" "r.spl?" "p.?" "3i" "0000063237" "00000065" "10" "9211" "74" "9211" "74" "c.9211+74G>A" "r.(=)" "p.(=)" "64i" "0000063238" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(=)" "p.(=)" "23i" "0000063239" "00000065" "10" "3174" "240" "3174" "240" "c.3174+240A>G" "r.(=)" "p.(=)" "22i" "0000063240" "00000065" "10" "6708" "-98" "6708" "-98" "c.6708-98C>T" "r.(=)" "p.(=)" "47i" "0000063241" "00000065" "10" "6707" "37" "6707" "37" "c.6707+37T>C" "r.(=)" "p.(=)" "47i" "0000063242" "00000065" "10" "8076" "-24" "8076" "-24" "c.8076-24dup" "r.(=)" "p.(=)" "57i" "0000063243" "00000065" "10" "6993" "-44" "6993" "-44" "c.6993-44T>C" "r.(=)" "p.(=)" "49i" "0000063244" "00000065" "30" "284" "-85" "284" "-85" "c.284-85A>G" "r.(=)" "p.(=)" "2i" "0000063245" "00000065" "50" "4436" "180" "4436" "180" "c.4436+180T>C" "r.(=)" "p.(=)" "30i" "0000063246" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000063247" "00000065" "50" "4312" "-19" "4312" "-17" "c.4312-19_4312-17del" "r.(=)" "p.(=)" "29i" "0000063248" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(=)" "p.(=)" "56" "0000063249" "00000065" "10" "6993" "-153" "6993" "-153" "c.6993-153G>A" "r.(=)" "p.(=)" "49i" "0000063250" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(=)" "p.(=)" "43" "0000063252" "00000065" "50" "284" "-86" "284" "-85" "c.284-86_284-85insG" "r.(=)" "p.(=)" "2i" "0000084571" "00000065" "90" "4523" "0" "4523" "0" "c.4523G>C" "r.(?)" "p.(Arg1508Thr)" "31" "0000084575" "00000065" "50" "4860" "0" "4860" "0" "c.4860G>A" "r.(spl?)" "p.(Phe1573Serfs*49)" "33" "0000084576" "00000065" "90" "7691" "0" "7691" "0" "c.7691T>C" "r.(?)" "p.(Leu2564Pro)" "55" "0000084580" "00000065" "90" "2556" "0" "2556" "0" "c.2556del" "r.(?)" "p.(Phe852Leufs*36)" "19" "0000084587" "00000065" "90" "2556" "0" "2556" "0" "c.2556del" "r.(?)" "p.(Phe852Leufs*36)" "19" "0000084590" "00000065" "90" "2538" "-1" "2538" "-1" "c.2538-1G>C" "r.spl?" "p.?" "18i" "0000084592" "00000065" "90" "7898" "1" "7898" "1" "c.7898+1G>A" "r.spl?" "p.?" "56i" "0000084614" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000084616" "00000065" "90" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085*)" "65" "0000084620" "00000065" "90" "6919" "0" "6920" "0" "c.6919_6920del" "r.(?)" "p.(Tyr2307Leufs*2)" "49" "0000084624" "00000065" "90" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000084625" "00000065" "90" "8931" "0" "8933" "0" "c.8931_8933del" "r.(?)" "p.(Leu2978del)" "63" "0000146005" "00000065" "70" "611" "0" "611" "0" "c.611C>T" "r.(?)" "p.(Ser204Phe)" "4" "0000146006" "00000065" "70" "4533" "0" "4533" "0" "c.4533del" "r.(?)" "p.(Gly1512Alafs*83)" "32" "0000165300" "00000065" "50" "4860" "5" "4860" "5" "c.4860+5G>A?" "r.[4718_4860del, 4718_4959del, 4718_5071del]" "p.[Phe1573Serfs*49, Phe1573Cysfs*16, Phe1573_Ala1691delinsSer]" "33i" "0000165301" "00000065" "90" "0" "0" "0" "0" "c.?" "r.8076_8244del" "p.Pro2693_His2748delfs*12" "58" "0000165303" "00000065" "90" "0" "0" "0" "0" "c.?" "r.0" "p.0" "1" "0000165304" "00000065" "90" "0" "0" "0" "0" "c.?" "r.0" "p.0" "1" "0000165305" "00000065" "90" "112" "3" "112" "3" "c.112+3A>G" "r.(spl?)" "p.?" "1i" "0000165307" "00000065" "50" "1206" "2" "1206" "2" "c.1206+2T>G" "r.spl?" "p.?" "8i" "0000165308" "00000065" "90" "1207" "-1" "1207" "-1" "c.1207-1G>C" "r.spl?" "p.?" "8i" "0000165310" "00000065" "90" "1377" "0" "1377" "0" "c.1377del" "r.(?)" "p.(Tyr460Thrfs*15)" "10" "0000165312" "00000065" "90" "1580" "0" "1580" "0" "c.1580G>A" "r.1580g>a" "p.Cys527Tyr" "11" "0000165313" "00000065" "50" "0" "0" "0" "0" "c.?" "r.0" "p.0" "_1_65_" "0000165314" "00000065" "90" "1793" "0" "1795" "0" "c.1793_1795del" "r.(?)" "p.(Val598del)" "13" "0000165316" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000165318" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165321" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165322" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165323" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165324" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165325" "00000065" "50" "2178" "0" "2178" "0" "c.2178C>A" "r.(?)" "p.(Cys726*)" "15" "0000165326" "00000065" "90" "2907" "0" "2907" "0" "c.2907C>A" "r.(?)" "p.(Cys969*)" "21" "0000165327" "00000065" "90" "2907" "0" "2907" "0" "c.2907C>A" "r.(?)" "p.(Cys969*)" "21" "0000165328" "00000065" "50" "257" "0" "257" "0" "c.257G>A" "r.(?)" "p.(Cys86Tyr)" "2" "0000165329" "00000065" "90" "2750" "-1" "2750" "-1" "c.2750-1G>A" "r.spl?" "p.?" "19i" "0000165330" "00000065" "90" "2954" "0" "2954" "0" "c.2954G>A" "r.(?)" "p.(Cys985Tyr)" "21" "0000165331" "00000065" "90" "2" "0" "2" "0" "c.2T>C" "r.2u>c" "p.0?" "1" "0000165332" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165333" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165334" "00000065" "50" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000165335" "00000065" "50" "4059" "-2" "4059" "-2" "c.4059-2A>G" "r.spl?" "p.?" "27i" "0000165336" "00000065" "90" "4280" "0" "4280" "0" "c.4280del" "r.(?)" "p.(Ser1427Thrfs*47)" "29" "0000165337" "00000065" "90" "4309" "0" "4309" "0" "c.4309C>T" "r.(?)" "p.(Gln1437*)" "29" "0000165338" "00000065" "90" "4375" "0" "4375" "0" "c.4375del" "r.(?)" "p.(Val1459Serfs*15)" "30" "0000165339" "00000065" "90" "4690" "0" "4690" "0" "c.4690C>T" "r.(?)" "p.(His1564Tyr)" "32" "0000165340" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000165341" "00000065" "90" "5487" "0" "5488" "0" "c.5487_5488del" "r.(?)" "p.(?)" "38" "0000165342" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>A" "r.[=,5446_5562del,5562_5563ins[gugaa;5562+6_5562+11]]" "p.[=,Lys1816_Asp1854del,Tyr1855Valfs*24]" "38i" "0000165343" "00000065" "50" "5562" "5" "5562" "5" "c.5562+5G>C" "r.5446_5562del" "p.Lys1816_Asp1854del" "38i" "0000165344" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.[5446_5562del, 5562_5563ins[gugac;5562+6_5562+11]]" "p.[Lys1816_Asp1854del,Tyr1855Valfs*24]" "38i" "0000165345" "00000065" "90" "5865" "1" "5865" "1" "c.5865+1del" "r.5865del" "p.Ala1956Glnfs*8" "40" "0000165346" "00000065" "90" "628" "0" "628" "0" "c.628G>T" "r.628g>u" "p.Glu210*" "4" "0000165347" "00000065" "90" "6919" "0" "6920" "0" "c.6919_6920del" "r.6919_6920del" "p.Tyr2307Leufs*2" "49" "0000165348" "00000065" "90" "6948" "0" "6948" "0" "c.6948G>A" "r.6948g>a" "p.Trp2316*" "49" "0000165349" "00000065" "90" "6955" "0" "6955" "0" "c.6955C>T" "r.6955c>u" "p.Arg2319*" "49" "0000165350" "00000065" "50" "7071" "0" "7071" "0" "c.7071G>A" "r.(?)" "p.(Trp2357*)" "50" "0000165351" "00000065" "90" "7377" "0" "7377" "0" "c.7377dup" "r.(?)" "p.(Leu2460Serfs*2)" "52" "0000165352" "00000065" "90" "7435" "0" "7436" "0" "c.7435_7436del" "r.7435_7436del" "p.Leu2479fs*21" "52" "0000165353" "00000065" "90" "0" "0" "0" "0" "c.?" "r.7750_7898del" "p.Ala2584Hisfs*8" "55i" "0000165354" "00000065" "90" "0" "0" "0" "0" "c.?" "r.7750_7898del" "p.Ala2584Hisfs*8" "55i" "0000165355" "00000065" "50" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000165356" "00000065" "90" "2450" "5" "2450" "11" "c.2450+5_2450+11del" "r.2323_2450del" "p.Asn775Leufs*2" "17i" "0000165357" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000165358" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.8007del" "p.Gln2670Asnfs*58" "57" "0000165359" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000165360" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000165361" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.8076_8244del" "p.Pro2693Valfs*12" "58i" "0000165362" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.8076_8244del" "p.Pro2693Valfs*12" "58i" "0000165363" "00000065" "90" "82" "0" "82" "0" "c.82C>T" "r.82c>u" "p.Gln28*" "1" "0000165364" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.9101_9104dup" "p.His3035Glnfs*5" "64" "0000165365" "00000065" "90" "0" "0" "0" "0" "c.?" "r.0" "p.0" "1" "0000165366" "00000065" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(Gln557*)" "12" "0000165367" "00000065" "90" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(Gln557*)" "12" "0000165368" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000165369" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000165370" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165371" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165372" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.[2302c>u, 2209_2322del]" "p.[Arg744*, Ser737_Leu774del]" "16" "0000165373" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.[2302c>u, 2209_2322del]" "p.[Arg744*, Ser737_Leu774del]" "16" "0000165374" "00000065" "90" "2369" "0" "2369" "0" "c.2369del" "r.2369del" "p.Pro790Leufs*35" "17" "0000165375" "00000065" "90" "2369" "0" "2369" "0" "c.2369del" "r.2369del" "p.Pro790Leufs*35" "17" "0000165376" "00000065" "90" "283" "0" "283" "0" "c.283C>T" "r.283c>u" "p.Gln95*" "2" "0000165377" "00000065" "90" "283" "0" "283" "0" "c.283C>T" "r.283c>u" "p.Gln95*" "2" "0000165378" "00000065" "90" "2962" "0" "2962" "0" "c.2962C>T" "r.(?)" "p.(Gln988*)" "21" "0000165379" "00000065" "90" "2962" "0" "2962" "0" "c.2962C>T" "r.(?)" "p.(Gln988*)" "21" "0000165380" "00000065" "90" "2986" "0" "2986" "0" "c.2986T>C" "r.(?)" "p.(Cys996Arg)" "21" "0000165381" "00000065" "90" "2986" "0" "2986" "0" "c.2986T>C" "r.(?)" "p.(Cys996Arg)" "21" "0000165382" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165383" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165384" "00000065" "90" "3122" "0" "3122" "0" "c.3122del" "r.(?)" "p.(Cys1041Phefs*34)" "22" "0000165385" "00000065" "90" "3122" "0" "3122" "0" "c.3122del" "r.(?)" "p.(Cys1041Phefs*34)" "22" "0000165386" "00000065" "10" "1491" "0" "1491" "0" "c.1491T>C" "r.1491u>c" "p.=" "11" "0000165387" "00000065" "90" "3718" "0" "3718" "0" "c.3718C>T" "r.3718c>u" "p.Gln1240*" "25" "0000165388" "00000065" "90" "3718" "0" "3718" "0" "c.3718C>T" "r.3718c>u" "p.Gln1240*" "25" "0000165389" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000165390" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000165391" "00000065" "90" "4524" "-2" "4524" "-2" "c.4524-2A>T" "r.4524_4717del" "p.Arg1509Serfs*5" "31i" "0000165392" "00000065" "90" "4524" "-2" "4524" "-2" "c.4524-2A>T" "r.4524_4717del" "p.Arg1509Serfs*5" "31i" "0000165393" "00000065" "90" "4638" "0" "4638" "0" "c.4638C>A" "r.(?)" "p.(Cys1546*)" "32" "0000165394" "00000065" "90" "4638" "0" "4638" "0" "c.4638C>A" "r.(?)" "p.(Cys1546*)" "32" "0000165395" "00000065" "90" "4861" "0" "4861" "0" "c.4861del" "r.4861del" "p.His1621Thrfs*20" "34" "0000165396" "00000065" "90" "4861" "0" "4861" "0" "c.4861del" "r.4861del" "p.His1621Thrfs*20" "34" "0000165397" "00000065" "90" "500" "0" "500" "0" "c.500A>C" "r.(?)" "p.(Gln167Pro)" "4" "0000165398" "00000065" "90" "500" "0" "500" "0" "c.500A>C" "r.(?)" "p.(Gln167Pro)" "4" "0000165399" "00000065" "90" "6955" "0" "6955" "0" "c.6955C>T" "r.6955c>u" "p.Arg2319*" "49" "0000165400" "00000065" "90" "6955" "0" "6955" "0" "c.6955C>T" "r.6955c>u" "p.Arg2319*" "49" "0000165401" "00000065" "90" "6995" "0" "6995" "0" "c.6995del" "r.6995del" "p.Pro2332Leufs*46" "50" "0000165402" "00000065" "90" "6995" "0" "6995" "0" "c.6995del" "r.6995del" "p.Pro2332Leufs*46" "50" "0000165403" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165404" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165405" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165406" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165407" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.7750_7898del" "p.Ala2584Hisfs*8" "55i_56i" "0000165408" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.7750_7898del" "p.Ala2584Hisfs*8" "55i_56i" "0000165409" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165410" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165411" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000165412" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000165413" "00000065" "90" "8075" "1" "8075" "2" "c.8075+1_8075+2del" "r.8074_8075del" "p.Val2692Profs*14" "57i" "0000165414" "00000065" "90" "8075" "1" "8075" "2" "c.8075+1_8075+2del" "r.8074_8075del" "p.Val2692Profs*14" "57i" "0000165415" "00000065" "90" "8265" "0" "8265" "0" "c.8265del" "r.(?)" "p.(Glu2756Asnfs*5)" "59" "0000165416" "00000065" "90" "8265" "0" "8265" "0" "c.8265del" "r.(?)" "p.(Glu2756Asnfs*5)" "59" "0000165417" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.9101_9104dup" "p.His3035Glnfs*5" "64" "0000165418" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.9101_9104dup" "p.His3035Glnfs*5" "64" "0000165419" "00000065" "90" "951" "0" "952" "0" "c.951_952dup" "r.951_952dup" "p.Cys318Serfs*20" "7" "0000165420" "00000065" "90" "951" "0" "952" "0" "c.951_952dup" "r.951_952dup" "p.Cys318Serfs*20" "7" "0000165421" "00000065" "50" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165422" "00000065" "50" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(=)" "p.(=)" "64i" "0000165423" "00000065" "50" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165424" "00000065" "50" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(=)" "p.(=)" "64i" "0000165425" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000165426" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000165427" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165428" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165429" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165430" "00000065" "10" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165431" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000165432" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165433" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165434" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165435" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165436" "00000065" "90" "8265" "0" "8265" "0" "c.8265del" "r.(?)" "p.(Glu2756Asnfs*5)" "59" "0000165437" "00000065" "90" "8265" "0" "8265" "0" "c.8265del" "r.(?)" "p.(Glu2756Asnfs*5)" "59" "0000165438" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000165439" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165440" "00000065" "10" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165441" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000165442" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000165443" "00000065" "90" "498" "0" "498" "0" "c.498G>A" "r.498g>a" "p.Trp166*" "4" "0000165444" "00000065" "90" "7658" "0" "7658" "0" "c.7658del" "r.7658del" "p.Ser2553Tyrfs*35" "55" "0000165445" "00000065" "90" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085*)" "65" "0000165446" "00000065" "90" "7691" "0" "7691" "0" "c.7691T>C" "r.(?)" "p.(Leu2564Pro)" "55" "0000165447" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165448" "00000065" "90" "4312" "-1" "4312" "-1" "c.4312-1G>C" "r.[=, 4312_4380del]" "p.[=, Asn1438_Lys1460del]" "29i" "0000165449" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000165450" "00000065" "90" "112" "1" "113" "-1" "c.(112+1_113-1)?" "r.[112_113ins112+1_112+75{?}]" "p.(fs*)" "1i" "0000165451" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.1893_1897del" "p.Asp631Glufs*8" "14" "0000165452" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165453" "00000065" "90" "6867" "1" "6867" "1" "c.6867+1G>A" "r.spl?" "p.?" "48i" "0000165454" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.[4645c>u, 4580_4717del]" "p.[Arg1549*, Cys1527_Val1572del]" "32" "0000165455" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.7147c>u" "p.Arg2383*" "50" "0000165456" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165457" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165458" "00000065" "90" "1490" "0" "1491" "0" "c.1490_1491del" "r.(?)" "p.(Cys497*)" "11" "0000165459" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000165460" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000165461" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165462" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165463" "00000065" "90" "6867" "1" "6867" "1" "c.6867+1G>A" "r.spl?" "p.?" "48i" "0000165464" "00000065" "90" "3623" "0" "3645" "0" "c.3623_3645del" "r.3623_3645del" "p.Lys1208Argfs*27" "25" "0000165465" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165466" "00000065" "90" "7074" "0" "7074" "0" "c.7074C>A" "r.7074c>a" "p.Tyr2358*" "50" "0000165467" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165468" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.7760c>u" "p.Val2587Ala" "56" "0000165469" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.7830g>c" "p.=" "56" "0000165470" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.1893_1897del" "p.Asp631Glufs*8" "14" "0000165471" "00000065" "10" "3099" "0" "3099" "0" "c.3099T>A" "r.3099u>a" "p.=" "22" "0000165472" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.7760c>u" "p.Val2587Ala" "56" "0000165473" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.7830g>c" "p.=" "56" "0000165474" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.7845g>a" "p.=" "56" "0000165475" "00000065" "90" "3215" "0" "3215" "0" "c.3215del" "r.3215delg" "p.Cys1072Serfs*3" "23" "0000165476" "00000065" "90" "3175" "-1" "7898" "1" "c.(3174+1_3175-1)_(7898+1_7899-1)del" "r.(del?)" "p.(fs*?)" "22i_56i" "0000165477" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581Profs*5)" "33" "0000165478" "00000065" "90" "7490" "0" "7493" "0" "c.7490_7493dup" "r.(?)" "p.(Asp2498Glufs*4)" "54" "0000165479" "00000065" "90" "3832" "0" "3832" "0" "c.3832G>T" "r.(?)" "p.(Gly1278Cys)" "26" "0000165480" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000165481" "00000065" "90" "825" "0" "825" "0" "c.825del" "r.(?)" "p.(Tyr276Thrfs*61)" "6" "0000165482" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000165483" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566Cysfs*13)" "32" "0000165484" "00000065" "90" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000165485" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165486" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.8076_8244del" "p.Pro2693Valfs*12" "58i" "0000165487" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121*)" "3" "0000165488" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165489" "00000065" "90" "4318" "0" "4318" "0" "c.4318C>T" "r.(?)" "p.(Gln1440*)" "30" "0000165490" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581Profs*5)" "33" "0000165491" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165492" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165493" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.7750_7898del" "p.Ala2584Hisfs*8" "55i_56i" "0000165495" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.1854_1861dup" "p.Leu621Hisfs*7" "13" "0000165496" "00000065" "10" "3174" "38" "3174" "38" "c.3174+38A>G" "r.(=)" "p.(=)" "22i" "0000165497" "00000065" "10" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(=)" "38" "0000165498" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000165499" "00000065" "10" "5727" "-24" "5727" "-21" "c.5727-24_5727-21delinsACTG" "r.(=)" "p.(=)" "39i" "0000165500" "00000065" "10" "6707" "37" "6707" "37" "c.6707+37T>C" "r.(=)" "p.(=)" "47i" "0000165501" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165502" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165503" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165504" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.5072_5234del" "p.Val1765Serfs*21" "36i" "0000165505" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165506" "00000065" "90" "8776" "0" "8792" "0" "c.8776_8792del" "r.(?)" "p.(Thr2926Trpfs*14)" "62" "0000165507" "00000065" "10" "1076" "0" "1076" "0" "c.1076T>C" "r.1076u>c" "p.Val359Ala" "8" "0000165508" "00000065" "10" "1182" "0" "1182" "0" "c.1182T>A" "r.1182u>a" "p.=" "8" "0000165509" "00000065" "50" "9487" "0" "9487" "0" "c.*118T>C" "r.*118u>c" "p.=" "65" "0000165510" "00000065" "10" "1419" "0" "1419" "0" "c.1419G>A" "r.1419g>a" "p.=" "10" "0000165511" "00000065" "10" "1491" "0" "1491" "0" "c.1491T>C" "r.1491u>c" "p.=" "11" "0000165512" "00000065" "10" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(=)" "11" "0000165513" "00000065" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(=)" "2" "0000165514" "00000065" "10" "1634" "0" "1634" "0" "c.1634T>A" "r.1634u>a" "p.Leu545Gln" "12" "0000165515" "00000065" "10" "1634" "0" "1634" "0" "c.1634T>A" "r.1634u>a" "p.Leu545Gln" "12" "0000165516" "00000065" "10" "1798" "0" "1798" "0" "c.1798G>A" "r.1798g>a" "p.Gly600Arg" "13" "0000165517" "00000065" "10" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "13" "0000165518" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.1856g>a" "p.Arg619His" "13" "0000165519" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.1856g>a" "p.Arg619His" "13" "0000165520" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000165521" "00000065" "10" "2054" "0" "2054" "0" "c.2054T>C" "r.2054u>c" "p.Leu685Pro" "14" "0000165522" "00000065" "10" "2208" "42" "2208" "42" "c.2208+42C>T" "r.(=)" "p.(=)" "15i" "0000165523" "00000065" "10" "2235" "0" "2235" "0" "c.2235T>A" "r.2235u>a" "p.=" "16" "0000165524" "00000065" "10" "2295" "0" "2295" "0" "c.2295C>A" "r.2295c>a" "p.=" "16" "0000165525" "00000065" "10" "2550" "0" "2550" "0" "c.2550C>G" "r.2550c>g" "p.=" "19" "0000165526" "00000065" "10" "2576" "0" "2576" "0" "c.2576G>T" "r.2576g>u" "p.Gly859Val" "19" "0000165527" "00000065" "50" "2584" "0" "2584" "0" "c.2584T>C" "r.(?)" "p.(Cys862Arg)" "19" "0000165528" "00000065" "90" "2584" "0" "2584" "0" "c.2584T>C" "r.2584u>c" "p.Cys862Arg" "19" "0000165529" "00000065" "50" "0" "0" "0" "0" "c.?" "r.0" "p.0" "_1_65_" "0000165530" "00000065" "10" "2631" "0" "2631" "0" "c.2631C>G" "r.2631c>g" "p.=" "19" "0000165531" "00000065" "10" "2756" "0" "2756" "0" "c.2756G>T" "r.2756g>u" "p.Arg919Leu" "20" "0000165532" "00000065" "10" "2756" "0" "2756" "0" "c.2756G>T" "r.2756g>u" "p.Arg919Leu" "20" "0000165533" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.2799a>g" "p.=" "20" "0000165534" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165536" "00000065" "90" "283" "1" "283" "1" "c.(283+1G>A)" "r.spl?" "p.(Val78_Gln132del)" "2i" "0000165537" "00000065" "10" "1306" "93" "1306" "93" "c.1306+93T>C" "r.(=)" "p.(=)" "9i" "0000165538" "00000065" "10" "284" "-131" "284" "-131" "c.284-131C>T" "r.(=)" "p.(=)" "2i" "0000165539" "00000065" "10" "284" "-85" "284" "-85" "c.284-85delinsGG" "r.(=)" "p.(=)" "2i" "0000165540" "00000065" "10" "3037" "140" "3037" "140" "c.3037+140G>A" "r.(=)" "p.(=)" "21i" "0000165541" "00000065" "10" "3038" "-156" "3038" "-156" "c.3038-156A>G" "r.(=)" "p.(=)" "21i" "0000165542" "00000065" "10" "3038" "-295" "3038" "-295" "c.3038-295A>G" "r.(=)" "p.(=)" "21i" "0000165543" "00000065" "10" "3039" "0" "3039" "0" "c.3039T>G" "r.3039u>g" "p.=" "22" "0000165544" "00000065" "10" "3099" "0" "3099" "0" "c.3099T>A" "r.3099u>a" "p.=" "22" "0000165545" "00000065" "10" "3135" "0" "3135" "0" "c.3135A>G" "r.(?)" "p.(=)" "22" "0000165546" "00000065" "10" "3174" "38" "3174" "38" "c.3174+38A>G" "r.(=)" "p.(=)" "22i" "0000165547" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(=)" "p.(=)" "23i" "0000165548" "00000065" "10" "3556" "-189" "3556" "-189" "c.3556-189C>G" "r.(=)" "p.(=)" "24i" "0000165549" "00000065" "10" "3719" "0" "3719" "0" "c.3719A>T" "r.3719a>u" "p.Gln1240Leu" "25" "0000165550" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.381c>a" "p.=" "3" "0000165551" "00000065" "10" "3930" "0" "3930" "0" "c.3930A>G" "r.33930a>g" "p.=" "27" "0000165552" "00000065" "10" "411" "0" "411" "0" "c.411G>A" "r.411g>a" "p.=" "4" "0000165553" "00000065" "10" "4177" "-73" "4177" "-73" "c.4177-73C>T" "r.(=)" "p.(=)" "28i" "0000165554" "00000065" "10" "4312" "-217" "4312" "-217" "c.4312-217T>C" "r.(=)" "p.(=)" "29i" "0000165555" "00000065" "10" "4407" "0" "4407" "0" "c.4407T>C" "r.4407u>c" "p.=" "30" "0000165556" "00000065" "10" "4446" "0" "4446" "0" "c.4446C>T" "r.4446c>u" "p.=" "31" "0000165557" "00000065" "10" "4524" "-247" "4524" "-247" "c.4524-247A>G" "r.(=)" "p.(=)" "31i" "0000165558" "00000065" "93" "4750" "0" "4750" "0" "c.4750G>A" "r.4750g>a" "p.Gly1584Ser" "33" "0000165559" "00000065" "10" "4861" "-55" "4861" "-55" "c.4861-55A>G" "r.(=)" "p.(=)" "33i" "0000165560" "00000065" "10" "4956" "0" "4956" "0" "c.4956C>G" "r.4956c>g" "p.=" "34" "0000165561" "00000065" "10" "4956" "0" "4956" "0" "c.4956C>G" "r.(?)" "p.(=)" "34" "0000165562" "00000065" "10" "5382" "0" "5382" "0" "c.5382A>T" "r.5382a>u" "p.=" "37" "0000165563" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.5502g>a" "p.=" "38" "0000165564" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000165565" "00000065" "10" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165566" "00000065" "10" "5714" "0" "5714" "0" "c.5714C>G" "r.5714c>g" "p.Ala1905Gly" "39" "0000165567" "00000065" "10" "5727" "-24" "5727" "-21" "c.5727-24_5727-21delinsACTG" "r.(=)" "p.(=)" "39i" "0000165568" "00000065" "10" "5865" "175" "5865" "175" "c.5865+175A>C" "r.(=)" "p.(=)" "40i" "0000165569" "00000065" "10" "6153" "0" "6153" "0" "c.6153A>T" "r.6153a>u" "p.=" "43" "0000165570" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.6237g>a" "p.=" "43" "0000165571" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(?)" "43" "0000165572" "00000065" "10" "6268" "77" "6268" "77" "c.6268+77C>T" "r.(=)" "p.(=)" "43i" "0000165573" "00000065" "10" "6450" "0" "6450" "0" "c.6450A>T" "r.6450a>u" "p.=" "46" "0000165574" "00000065" "10" "6459" "0" "6459" "0" "c.6459C>T" "r.6459c>u" "p.=" "46" "0000165575" "00000065" "10" "6707" "37" "6707" "37" "c.6707+37T>C" "r.(=)" "p.(=)" "47i" "0000165576" "00000065" "10" "6708" "-98" "6708" "-98" "c.6708-98C>T" "r.(=)" "p.(=)" "47i" "0000165577" "00000065" "10" "6868" "-153" "6868" "-153" "c.6868-153C>A" "r.(=)" "p.(=)" "48i" "0000165578" "00000065" "10" "6993" "-44" "6993" "-44" "c.6993-44T>C" "r.(=)" "p.(=)" "49i" "0000165579" "00000065" "10" "7395" "0" "7395" "0" "c.7395T>C" "r.7395u>c" "p.=" "52" "0000165580" "00000065" "10" "7614" "0" "7614" "0" "c.7614G>A" "r.7614g>a" "p.=" "55" "0000165581" "00000065" "10" "7620" "0" "7620" "0" "c.7620C>G" "r.(?)" "p.(?)" "55" "0000165582" "00000065" "10" "7661" "0" "7661" "0" "c.7661T>C" "r.7661u>c" "p.Phe2554Ser" "55" "0000165583" "00000065" "10" "7750" "-136" "7750" "-136" "c.7750-136C>G" "r.(=)" "p.(=)" "55i" "0000165584" "00000065" "10" "7756" "0" "7756" "0" "c.7756T>C" "r.7756u>c" "p.Tyr2586His" "56" "0000165585" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.7760c>u" "p.Val2587Ala" "56" "0000165586" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000165587" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566Cysfs*13)" "32" "0000165588" "00000065" "90" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000165589" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.7830g>c" "p.=" "56" "0000165590" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000165591" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000165592" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000165593" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.7830g>c" "p.=" "56" "0000165594" "00000065" "10" "7840" "0" "7840" "0" "c.7840G>A" "r.7840g>a" "p.Glu2614Lys" "56" "0000165595" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.7845g>a" "p.=" "56" "0000165596" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(?)" "56" "0000165597" "00000065" "10" "7898" "102" "7898" "102" "c.7898+102C>A" "r.(=)" "p.(=)" "56i" "0000165598" "00000065" "10" "7906" "0" "7906" "0" "c.7906A>G" "r.7906a>g" "p.Thr2636Ala" "57" "0000165599" "00000065" "10" "7906" "0" "7906" "0" "c.7906A>G" "r.7906a>g" "p.Thr2636Ala" "57" "0000165600" "00000065" "10" "7929" "0" "7929" "0" "c.7929A>G" "r.7929a>g" "p.=" "57" "0000165601" "00000065" "10" "8076" "-24" "8076" "-24" "c.8076-24dup" "r.(=)" "p.(=)" "57i" "0000165602" "00000065" "10" "8124" "0" "8124" "0" "c.8124T>A" "r.8124u>a" "p.=" "58" "0000165603" "00000065" "10" "819" "197" "819" "197" "c.819+197G>A" "r.(=)" "p.(=)" "5i" "0000165604" "00000065" "10" "8245" "-159" "8245" "-159" "c.8245-159A>G" "r.(=)" "p.(=)" "58i" "0000165605" "00000065" "10" "846" "0" "846" "0" "c.846A>T" "r.846a>u" "p.=" "6" "0000165606" "00000065" "10" "8586" "0" "8586" "0" "c.8586T>C" "r.8586u>c" "p.=" "61" "0000165607" "00000065" "10" "8925" "0" "8925" "0" "c.8925A>T" "r.8925a>u" "p.=" "63" "0000165608" "00000065" "10" "909" "95" "909" "95" "c.909+95A>T" "r.(=)" "p.(=)" "6i" "0000165609" "00000065" "10" "9211" "74" "9211" "74" "c.9211+74G>A" "r.(=)" "p.(=)" "64i" "0000165610" "00000065" "10" "9431" "0" "9434" "0" "c.*62_*65dup" "r.*62_*65dup" "p.=" "65" "0000165611" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165612" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.2049_2050del" "p.Arg683Serfs*21" "14" "0000165613" "00000065" "10" "981" "0" "981" "0" "c.981G>A" "r.981g>a" "p.=" "7" "0000165614" "00000065" "10" "5466" "0" "5466" "0" "c.5466A>G" "r.5466a>g" "p.=" "38" "0000165615" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000165616" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000165617" "00000065" "90" "3472" "0" "3472" "0" "c.3472A>T" "r.(?)" "p.(Lys1158*)" "24" "0000165618" "00000065" "50" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000165619" "00000065" "90" "1177" "0" "1177" "0" "c.1177T>G" "r.(?)" "p.(Cys393Gly)" "8" "0000165620" "00000065" "50" "2749" "1" "2749" "1" "c.2749+1G>A" "r.spl?" "p.?" "19i" "0000165621" "00000065" "50" "2538" "-1" "2538" "-1" "c.2538-1G>C" "r.spl?" "p.?" "18i" "0000165622" "00000065" "10" "2857" "-48" "2857" "-48" "c.2857-48C>G" "r.(=)" "p.(?)" "20i" "0000165623" "00000065" "90" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000165624" "00000065" "90" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000165625" "00000065" "50" "1884" "0" "1884" "0" "c.1884G>A" "r.(spl?)" "p.(Glu628=)" "13" "0000165626" "00000065" "50" "1884" "0" "1884" "0" "c.1884G>A" "r.(spl?)" "p.(Glu628=)" "13" "0000165627" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165628" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165629" "00000065" "10" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(=)" "p.(=)" "22i" "0000165630" "00000065" "90" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165631" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165632" "00000065" "90" "5006" "0" "5006" "0" "c.5006del" "r.(?)" "p.(Glu1669Glyfs*24)" "35" "0000165633" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165634" "00000065" "90" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267Aspfs*11)" "26" "0000165635" "00000065" "50" "35" "0" "35" "0" "c.35T>G" "r.(?)" "p.(Leu12Arg)" "1" "0000165636" "00000065" "70" "7297" "0" "7297" "0" "c.7297C>T" "r.(?)" "p.(Gln2433*)" "51" "0000165637" "00000065" "90" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000165638" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165639" "00000065" "90" "6993" "-2" "6993" "-2" "c.6993-2A>C" "r.spl?" "p.?" "49i" "0000165640" "00000065" "50" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165641" "00000065" "70" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080Asnfs*26)" "65" "0000165642" "00000065" "70" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080Asnfs*26)" "65" "0000165643" "00000065" "10" "3099" "0" "3099" "0" "c.3099T>A" "r.3099u>a" "p.=" "22" "0000165644" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.6237g>a" "p.=" "43" "0000165645" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.Val2587Ala" "56" "0000165646" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000165647" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.=" "56" "0000165648" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000165649" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000165650" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165651" "00000065" "90" "4312" "-1" "4312" "-1" "c.4312-1G>C" "r.[=, 4312_4380del]" "p.[=, Asn1438_Lys1460del]" "29i" "0000165652" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.[2302c>u, 2209_2322del]" "p.[Arg744*, Ser737_Leu774del]" "16" "0000165653" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.[2302c>u, 2209_2322del]" "p.[Arg744*, Ser737_Leu774del]" "16" "0000165654" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165655" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165666" "00000065" "70" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000165667" "00000065" "90" "5259" "0" "5259" "0" "c.5259del" "r.(?)" "p.(Val1754*)" "37" "0000165668" "00000065" "50" "5259" "0" "5259" "0" "c.5259del" "r.(?)" "p.(Val1754*)" "37" "0000165669" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165670" "00000065" "50" "5072" "-6" "5072" "-6" "c.5072-6del" "r.(=)" "p.(=)" "35i" "0000165671" "00000065" "90" "4941" "0" "4941" "0" "c.4941del" "r.(?)" "p.(Met1647Ilefs*5)" "34" "0000165672" "00000065" "30" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(=)" "p.(=)" "22i" "0000165673" "00000065" "70" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165674" "00000065" "30" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(=)" "p.(=)" "22i" "0000165675" "00000065" "70" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165676" "00000065" "70" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000165677" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000165678" "00000065" "30" "3174" "22" "3174" "23" "c.3174+22_3174+23insAT" "r.(=)" "p.(=)" "22i" "0000165679" "00000065" "30" "3174" "22" "3174" "23" "c.3174+22_3174+23insAT" "r.(=)" "p.(=)" "22i" "0000165680" "00000065" "30" "6085" "1" "6085" "1" "c.6085+?del" "r.(=)" "p.(=)" "42i" "0000165681" "00000065" "30" "6085" "1" "6085" "1" "c.6085+?del" "r.(=)" "p.(=)" "42i" "0000165682" "00000065" "70" "5182" "0" "5182" "0" "c.5182del" "r.(?)" "p.(Leu1728*)" "36" "0000165683" "00000065" "70" "5182" "0" "5182" "0" "c.5182del" "r.(?)" "p.(Leu1728*)" "36" "0000165684" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165685" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165686" "00000065" "10" "7681" "0" "7681" "0" "c.7681G>A" "r.(?)" "p.(Gly2561Ser)" "55" "0000165687" "00000065" "10" "7681" "0" "7681" "0" "c.7681G>A" "r.(?)" "p.(Gly2561Ser)" "55" "0000165688" "00000065" "70" "1326" "0" "1326" "0" "c.1326T>G" "r.(?)" "p.(Cys442Trp)" "10" "0000165689" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165690" "00000065" "70" "94" "0" "94" "0" "c.94C>T" "r.(?)" "p.(Gln32*)" "1" "0000165691" "00000065" "70" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl?" "p.?" "58i" "0000165692" "00000065" "30" "1884" "50" "1884" "50" "c.1884+50A>C" "r.(=)" "p.(=)" "13i" "0000165693" "00000065" "30" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(=)" "p.(=)" "22i" "0000165694" "00000065" "70" "5998" "0" "5998" "0" "c.5998del" "r.(?)" "p.(Thr2000Profs*3)" "42" "0000165695" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383*)" "50" "0000165696" "00000065" "90" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000165697" "00000065" "90" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000165698" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165699" "00000065" "70" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450*)" "30" "0000165700" "00000065" "70" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000165701" "00000065" "70" "396" "1" "396" "1" "c.396+1G>T" "r.spl?" "p.?" "3i" "0000165702" "00000065" "90" "498" "0" "498" "0" "c.498G>A" "r.(?)" "p.(Trp166*)" "4" "0000165703" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165704" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165705" "00000065" "50" "745" "0" "745" "0" "c.745C>T" "r.(?)" "p.(Arg249Cys)" "5" "0000165706" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.(?)" "p.(His3035Glnfs*5)" "64" "0000165707" "00000065" "50" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165708" "00000065" "70" "8669" "0" "8669" "0" "c.8669dup" "r.(?)" "p.(Leu2890Phefs*16)" "61" "0000165709" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000165710" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165711" "00000065" "90" "2962" "0" "2962" "0" "c.2962C>T" "r.(?)" "p.(Gln988*)" "21" "0000165712" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165713" "00000065" "70" "6266" "0" "6266" "0" "c.6266del" "r.(?)" "p.(Asn2089Thrfs*14)" "43" "0000165714" "00000065" "70" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000165715" "00000065" "50" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165716" "00000065" "70" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165717" "00000065" "50" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(spl?)" "p.(=)" "64i" "0000165718" "00000065" "70" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000165719" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165720" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.(?)" "p.(=)" "3" "0000165721" "00000065" "10" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(=)" "11" "0000165722" "00000065" "50" "1782" "10" "1782" "10" "c.1782+10C>T" "r.(?)" "p.(=)" "12i" "0000165723" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000165724" "00000065" "10" "3037" "49" "3037" "49" "c.3037+49G>A" "r.(?)" "p.(=)" "21i" "0000165725" "00000065" "30" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(?)" "p.(=)" "22i" "0000165726" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(?)" "p.(=)" "23i" "0000165727" "00000065" "30" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(=)" "38" "0000165728" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000165729" "00000065" "10" "5727" "-24" "5727" "-21" "c.5727-24_5727-21delinsACTG" "r.(?)" "p.(=)" "39i" "0000165730" "00000065" "10" "6993" "-44" "6993" "-44" "c.6993-44T>C" "r.(?)" "p.(=)" "49i" "0000165731" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala" "56" "0000165732" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000165733" "00000065" "70" "8858" "-8" "8858" "-8" "c.8858-8T>G" "r.(spl?)" "p.(=)" "62i" "0000165734" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744*)" "16" "0000165735" "00000065" "70" "5325" "0" "5325" "0" "c.5325dup" "r.(?)" "p.(Leu1776Thrfs*3)" "37" "0000165736" "00000065" "70" "47" "0" "47" "0" "c.47del" "r.(?)" "p.(Gly16Alafs*29)" "1" "0000165737" "00000065" "70" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000165738" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165739" "00000065" "70" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl?" "p.?" "6i" "0000165740" "00000065" "70" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl?" "p.?" "6i" "0000165741" "00000065" "70" "164" "0" "164" "0" "c.164del" "r.(?)" "p.(Asn55Metfs*16)" "2" "0000165742" "00000065" "70" "6588" "0" "6588" "0" "c.6588dup" "r.(?)" "p.(Ile2197Tyrfs*5)" "47" "0000165743" "00000065" "70" "7571" "0" "7571" "0" "c.7571A>T" "r.(?)^r.(spl?)" "p.(Glu2524Val)^p.?" "54" "0000165744" "00000065" "70" "8244" "1" "8244" "1" "c.8244+1G>C" "r.spl?" "p.?" "58i" "0000165745" "00000065" "70" "5072" "-1454" "5154" "0" "c.5072-1454_5154delinsAGATTGCC" "r.spl?" "p.?" "35i_36" "0000165746" "00000065" "70" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000165747" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165748" "00000065" "30" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(spl?)" "p.(=)" "64i" "0000165749" "00000065" "70" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277*)" "26" "0000165750" "00000065" "50" "7451" "37" "7451" "37" "c.7451+37A>G" "r.(spl?)" "p.(=)" "52i" "0000165751" "00000065" "50" "4654" "0" "4654" "0" "c.4654G>A" "r.(?)" "p.(Ala1552Thr)" "32" "0000165752" "00000065" "50" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000165753" "00000065" "70" "3338" "0" "3345" "0" "c.3338_3345dup" "r.(?)" "p.(Thr1116Glnfs*26)" "23" "0000165754" "00000065" "70" "6207" "0" "6207" "0" "c.6207C>A" "r.(?)" "p.(Tyr2069*)" "43" "0000165755" "00000065" "70" "396" "1" "396" "1" "c.396+1G>T" "r.spl?" "p.?" "3i" "0000165756" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566Cysfs*13)" "32" "0000165757" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165758" "00000065" "30" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "13" "0000165759" "00000065" "30" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(=)" "p.(=)" "22i" "0000165760" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165761" "00000065" "70" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165762" "00000065" "70" "8665" "0" "8665" "0" "c.8665G>A" "r.(?)" "p.(Gly2889Arg)" "61" "0000165763" "00000065" "70" "8665" "0" "8665" "0" "c.8665G>A" "r.(?)" "p.(Gly2889Arg)" "61" "0000165764" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165765" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165766" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165767" "00000065" "70" "8357" "1" "8357" "1" "c.8357+1G>A" "r.spl?" "p.?" "59i" "0000165768" "00000065" "70" "1976" "0" "1976" "0" "c.1976C>A" "r.(?)" "p.(Ser659*)" "14" "0000165769" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165770" "00000065" "30" "6706" "0" "6706" "0" "c.6706A>C" "r.(?)" "p.(=)" "47" "0000165771" "00000065" "70" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400*)" "29" "0000165772" "00000065" "90" "3215" "0" "3215" "0" "c.3215del" "r.(?)" "p.(Cys1072Serfs*3)" "23" "0000165773" "00000065" "30" "4312" "-19" "4312" "-17" "c.4312-19_4312-17del" "r.(?)" "p.(?)" "29i" "0000165774" "00000065" "50" "2370" "0" "2370" "0" "c.2370T>A" "r.(?)^(spl?)" "p.(790=)^p.(?)" "17" "0000165775" "00000065" "50" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165776" "00000065" "70" "8669" "0" "8669" "0" "c.8669dup" "r.(?)" "p.(Leu2890Phefs*16)" "61" "0000165777" "00000065" "70" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000165778" "00000065" "70" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000165779" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000165780" "00000065" "70" "2383" "0" "2383" "0" "c.2383G>T" "r.(?)" "p.(Glu795*)" "17" "0000165781" "00000065" "70" "4761" "0" "4761" "0" "c.4761dup" "r.(?)" "p.(Arg1588Serfs*20)" "33" "0000165782" "00000065" "30" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165783" "00000065" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273Lys)" "5" "0000165784" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165785" "00000065" "50" "6548" "0" "6548" "0" "c.6548T>G" "r.(?)" "p.(Leu2183Arg)" "46" "0000165786" "00000065" "50" "6548" "0" "6548" "0" "c.6548T>G" "r.(?)" "p.(Leu2183Arg)" "46" "0000165787" "00000065" "30" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165788" "00000065" "70" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000165789" "00000065" "70" "6429" "1" "6429" "1" "c.6429+1G>T" "r.spl?" "p.?" "45i" "0000165790" "00000065" "30" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(spl?)" "p.(=)" "64i" "0000165791" "00000065" "70" "4049" "0" "4049" "0" "c.4049del" "r.(?)" "p.(Arg1350Hisfs*12)" "27" "0000165792" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165793" "00000065" "90" "1307" "-2" "1307" "-2" "c.1307-2A>G" "r.spl?" "p.?" "9i" "0000165794" "00000065" "90" "6993" "0" "6999" "0" "c.6993_6999del" "r.(?)" "p.(Ser2331Argfs*45)" "50" "0000165795" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165796" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165797" "00000065" "90" "3651" "0" "3651" "0" "c.3651del" "r.(?)" "p.(Ile1217Metfs*7)" "25" "0000165798" "00000065" "90" "3651" "0" "3651" "0" "c.3651del" "r.(?)" "p.(Ile1217Metfs*7)" "25" "0000165799" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165800" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165801" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000165802" "00000065" "90" "8988" "1" "8988" "1" "c.8988+1G>A" "r.spl?" "p.?" "63i" "0000165803" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000165804" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000165805" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165806" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165807" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165808" "00000065" "90" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(spl?)" "p.(=)" "64i" "0000165809" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165810" "00000065" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "_1_65_" "0000165811" "00000065" "90" "2556" "0" "2556" "0" "c.2556del" "r.(?)" "p.(Phe852Leufs*36)" "19" "0000165812" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000165813" "00000065" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "_1_65_" "0000165814" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165815" "00000065" "90" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267Aspfs*11)" "26" "0000165816" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.(?)" "p.(Asp631Glufs*8)" "14" "0000165817" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.(?)" "p.(Asp631Glufs*8)" "14" "0000165818" "00000065" "90" "2208" "2" "2208" "2" "c.2208+2T>C" "r.spl?" "p.?" "15i" "0000165819" "00000065" "90" "2208" "2" "2208" "2" "c.2208+2T>C" "r.spl?" "p.?" "15i" "0000165820" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000165821" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000165822" "00000065" "90" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267Aspfs*11)" "26" "0000165823" "00000065" "90" "470" "0" "470" "0" "c.470C>T" "r.(?)" "p.(Ser157Phe)" "4" "0000165824" "00000065" "90" "2556" "0" "2556" "0" "c.2556del" "r.(?)" "p.(Phe852Leufs*36)" "19" "0000165825" "00000065" "90" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000165826" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165827" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165828" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165829" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165830" "00000065" "90" "283" "1" "283" "1" "c.283+1G>A" "r.spl?" "p.?" "2i" "0000165831" "00000065" "90" "391" "0" "391" "0" "c.391C>T" "r.(?)" "p.(Gln131*)" "3" "0000165832" "00000065" "90" "3768" "0" "3771" "0" "c.3768_3771dup" "r.(?)" "p.(Tyr1258Asnfs*15)" "26" "0000165833" "00000065" "90" "3768" "0" "3771" "0" "c.3768_3771dup" "r.(?)" "p.(Tyr1258Asnfs*15)" "26" "0000165834" "00000065" "90" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080Asnfs*26)" "65" "0000165835" "00000065" "90" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080Asnfs*26)" "65" "0000165836" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165837" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165838" "00000065" "90" "112" "1" "112" "1" "c.112+1G>A" "r.spl?" "p.?" "1i" "0000165839" "00000065" "90" "7439" "1" "7439" "1" "c.7439+1G>A" "r.spl?" "p.?" "52i" "0000165840" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165841" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165842" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165843" "00000065" "90" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000165844" "00000065" "90" "2538" "-1" "2538" "-1" "c.2538-1G>C" "r.spl?" "p.?" "18i" "0000165845" "00000065" "90" "5654" "0" "5654" "0" "c.5654del" "r.(?)" "p.(Lys1885Serfs*16)" "39" "0000165846" "00000065" "50" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165847" "00000065" "50" "9211" "6" "9211" "6" "c.9211+6T>C" "r.=" "p.=" "64i" "0000165848" "00000065" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "_1_65_" "0000165849" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000165850" "00000065" "90" "5550" "0" "5562" "8" "c.5550_5562+8delinsG" "r.spl?" "p.?" "38" "0000165851" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.(?)" "p.(Asp631Glufs*8)" "14" "0000165852" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.(?)" "p.(Asp631Glufs*8)" "14" "0000165854" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "9" "0000165855" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165856" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165857" "00000065" "90" "3294" "0" "3294" "0" "c.3294del" "r.(?)" "p.(Trp1098*)" "23" "0000165858" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165859" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165860" "00000065" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "_1_65_" "0000165861" "00000065" "90" "4035" "0" "4035" "0" "c.4035T>G" "r.(?)" "p.(Tyr1345*)" "27" "0000165862" "00000065" "90" "4035" "0" "4035" "0" "c.4035T>G" "r.(?)" "p.(Tyr1345*)" "27" "0000165863" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000165864" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000165865" "00000065" "90" "2450" "1" "2450" "1" "c.2450+1G>C" "r.spl?" "p.?" "17i" "0000165866" "00000065" "90" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000165867" "00000065" "90" "2178" "0" "2178" "0" "c.2178C>A" "r.(?)" "p.(Cys726*)" "15" "0000165868" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000165869" "00000065" "90" "4852" "0" "4852" "0" "c.4852G>T" "r.(?)" "p.(Glu1618*)" "33" "0000165870" "00000065" "90" "4852" "0" "4852" "0" "c.4852G>T" "r.(?)" "p.(Glu1618*)" "33" "0000165871" "00000065" "90" "1207" "-1" "1207" "-1" "c.1207-1G>A" "r.spl?" "p.?" "8i" "0000165872" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165873" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165874" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165875" "00000065" "90" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000165876" "00000065" "90" "1207" "-1" "1207" "-1" "c.1207-1G>A" "r.spl?" "p.?" "8i" "0000165877" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165878" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165879" "00000065" "90" "5290" "0" "5290" "0" "c.5290dup" "r.(?)" "p.(Glu1764Glyfs*3)" "37" "0000165880" "00000065" "90" "5290" "0" "5290" "0" "c.5290dup" "r.(?)" "p.(Glu1764Glyfs*3)" "37" "0000165881" "00000065" "90" "4775" "0" "4775" "0" "c.4775dup" "r.(?)" "p.(Met1592Ilefs*16)" "33" "0000165882" "00000065" "90" "5325" "0" "5325" "0" "c.5325dup" "r.(?)" "p.(Leu1776Thrfs*3)" "37" "0000165883" "00000065" "90" "0" "0" "0" "0" "c.?" "r.?" "p.?" "_1_65_" "0000165884" "00000065" "90" "7898" "1" "7898" "1" "c.7898+1G>T" "r.spl?" "p.?" "56i" "0000165885" "00000065" "90" "7898" "1" "7898" "1" "c.7898+1G>T" "r.spl?" "p.?" "56i" "0000165886" "00000065" "50" "855" "0" "855" "0" "c.855G>T" "r.(spl?)" "p.(Gly285=)" "6" "0000165887" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000165888" "00000065" "50" "1177" "0" "1177" "0" "c.1177T>G" "r.(?)" "p.(Cys393Gly)" "8" "0000165889" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165891" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165892" "00000065" "50" "6708" "-16" "6708" "-16" "c.6708-16A>G" "r.(spl?)" "p.(=)" "47i" "0000165893" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165894" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165895" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165896" "00000065" "50" "4523" "0" "4523" "0" "c.4523G>A" "r.(?)^r.(spl?)" "p.(Arg1508Lys)^p.?" "31" "0000165897" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165898" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165899" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165900" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165901" "00000065" "70" "2017" "0" "2017" "0" "c.2017G>T" "r.(?)" "p.(Glu673*)" "14" "0000165902" "00000065" "70" "2023" "0" "2024" "0" "c.2023_2024del" "r.(?)" "p.(Met675Aspfs*29)" "14" "0000165903" "00000065" "90" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000165904" "00000065" "90" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000165905" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000165906" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000165907" "00000065" "70" "283" "2" "283" "2" "c.283+2del" "r.spl?" "p.?" "2i" "0000165908" "00000065" "50" "1609" "-41" "1609" "-7" "c.1609-41_1609-7inv" "r.(spl?)" "p.(=)" "11i" "0000165909" "00000065" "90" "3154" "0" "3154" "0" "c.3154A>G" "r.(?)" "p.(Ser1052Gly)" "22" "0000165910" "00000065" "50" "2054" "0" "2054" "0" "c.2054T>C" "r.(?)" "p.(Leu685Pro)" "14" "0000165911" "00000065" "50" "4960" "-17" "4960" "-17" "c.4960-17C>A" "r.(spl?)" "p.(=)" "34i" "0000165912" "00000065" "70" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165913" "00000065" "70" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.?" "26i" "0000165914" "00000065" "70" "991" "0" "991" "0" "c.991A>T" "r.(?)" "p.(Arg331*)" "7" "0000165915" "00000065" "90" "5325" "0" "5325" "0" "c.5325dup" "r.(?)" "p.(Leu1776Thrfs*3)" "37" "0000165916" "00000065" "50" "1027" "3" "1027" "3" "c.1027+3A>G" "r.(spl?)" "p.?" "7i" "0000165917" "00000065" "50" "1206" "11" "1206" "11" "c.1206+11C>T" "r.(spl?)" "p.(=)" "8i" "0000165918" "00000065" "70" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000165919" "00000065" "90" "5259" "0" "5259" "0" "c.5259del" "r.(?)" "p.(Val1754*)" "37" "0000165920" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383*)" "50" "0000165921" "00000065" "70" "6617" "0" "6617" "0" "c.6617del" "r.(?)" "p.(Phe2206Serfs*12)" "47" "0000165922" "00000065" "50" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Ser146Phe)" "4" "0000165923" "00000065" "70" "1823" "0" "1824" "0" "c.1823_1824del" "r.(?)" "p.(Tyr608*)" "13" "0000165924" "00000065" "70" "1823" "0" "1824" "0" "c.1823_1824del" "r.(?)" "p.(Tyr608*)" "13" "0000165925" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165926" "00000065" "70" "8669" "0" "8669" "0" "c.8669dup" "r.(?)" "p.(Leu2890Phefs*16)" "61" "0000165927" "00000065" "90" "2556" "0" "2556" "0" "c.2556del" "r.(?)" "p.(Phe852Leufs*36)" "19" "0000165928" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000165929" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000165930" "00000065" "70" "9095" "0" "9095" "0" "c.9095dup" "r.(?)" "p.(Ile3033Aspfs*6)" "64" "0000165931" "00000065" "70" "7898" "732" "48651" "0" "c.7898+732_*219{0}" "r.?" "p.?" "56i_65_" "0000165933" "00000065" "70" "639" "2" "639" "2" "c.639+2T>A" "r.spl?" "p.?" "4i" "0000165934" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165935" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165936" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000165937" "00000065" "70" "396" "1" "396" "1" "c.396+1G>T" "r.spl?" "p.?" "3i" "0000165938" "00000065" "70" "6690" "0" "6690" "0" "c.6690C>A" "r.(?)" "p.(Tyr2230*)" "47" "0000165939" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165940" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165941" "00000065" "70" "7491" "0" "7491" "0" "c.7491del" "r.(?)" "p.(Asp2498Ilefs*49)" "54" "0000165942" "00000065" "50" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.(spl?)" "p.?" "58i" "0000165943" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165944" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165945" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000165946" "00000065" "50" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000165947" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000165948" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000165949" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165950" "00000065" "50" "4523" "0" "4523" "0" "c.4523G>A" "r.(?)" "p.(Arg1508Lys)" "31" "0000165951" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165952" "00000065" "90" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000165953" "00000065" "70" "3560" "0" "3569" "0" "c.3560_3569del" "r.(?)" "p.(Thr1187Metfs*9)" "25" "0000165954" "00000065" "90" "3560" "0" "3569" "0" "c.3560_3569del" "r.(?)" "p.(Thr1187Metfs*9)" "25" "0000165955" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.3412g>a" "p.Val1138Met" "24" "0000165956" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000165957" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(=)" "56" "0000165958" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000165959" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000165960" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(=)" "56" "0000165961" "00000065" "90" "8075" "1" "8075" "2" "c.8075+1_8075+2del" "r.8074_8075del" "p.Val2692Profs*14" "57i" "0000165962" "00000065" "90" "8075" "1" "8075" "2" "c.8075+1_8075+2del" "r.8074_8075del" "p.Val2692Profs*14" "57i" "0000165963" "00000065" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(=)" "2" "0000165964" "00000065" "90" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267Aspfs*11)" "26" "0000165965" "00000065" "90" "4524" "-2" "4524" "-2" "c.4524-2A>G" "r.4524_4717del" "p.Arg1509Serfs*5" "31i" "0000165966" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165967" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165968" "00000065" "90" "1798" "0" "1800" "0" "c.1798_1800del" "r.(?)" "p.(Gly600del)" "13" "0000165969" "00000065" "90" "8613" "0" "8613" "0" "c.8613dup" "r.(?)" "p.(Ser2872Glnfs*34)" "61" "0000165970" "00000065" "90" "412" "0" "412" "0" "c.412T>C" "r.(?)" "p.(Tyr138His)" "4" "0000165971" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000165972" "00000065" "90" "6993" "-2" "6993" "-2" "c.6993-2A>C" "r.spl?" "p.?" "49i" "0000165973" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000165974" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000165975" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165976" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000165977" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000165978" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000165979" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000165980" "00000065" "90" "8443" "0" "8450" "0" "c.8443_8450del" "r.(?)" "p.(Thr2815Alafs*11)" "60" "0000165981" "00000065" "90" "8443" "0" "8450" "0" "c.8443_8450del" "r.(?)" "p.(Thr2815Alafs*11)" "60" "0000165982" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000165983" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.(?)" "p.(His3035Glnfs*5)" "64" "0000165984" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000165985" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.(?)" "p.(His3035Glnfs*5)" "64" "0000165986" "00000065" "10" "1307" "-115" "1307" "-115" "c.1307-115A>C" "r.(=)" "p.(=)" "9i" "0000165987" "00000065" "10" "1468" "-122" "1468" "-122" "c.1468-122G>A" "r.(=)" "p.(=)" "10i" "0000165988" "00000065" "10" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(=)" "p.(=)" "22i" "0000165989" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000165990" "00000065" "10" "7749" "80" "7749" "80" "c.7749+80C>T" "r.(=)" "p.(=)" "55i" "0000165991" "00000065" "10" "7749" "132" "7749" "132" "c.7749+132A>T" "r.(=)" "p.(=)" "55i" "0000165992" "00000065" "10" "7750" "-87" "7750" "-87" "c.7750-87C>T" "r.(=)" "p.(=)" "55i" "0000165993" "00000065" "10" "7898" "178" "7898" "178" "c.7898+178C>T" "r.(=)" "p.(=)" "56i" "0000165994" "00000065" "10" "8245" "-193" "8245" "-193" "c.8245-193T>C" "r.(=)" "p.(=)" "58i" "0000165995" "00000065" "90" "5071" "1" "5072" "-1" "c.(5071+1_5072-1)ins(?)" "r.5071_5072ins(?)" "p.fs*" "35i" "0000165997" "00000065" "90" "247" "0" "247" "0" "c.(247T>C)" "r.(247u>c)" "p.Cys83Arg" "2" "0000165998" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000165999" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000166000" "00000065" "90" "640" "-1" "1782" "1" "c.(639+1_640-1)_(1782+1_1873-1)dup" "r.(dup?)" "p.(dup?)" "4i_12i" "0000166001" "00000065" "10" "4956" "0" "4956" "0" "c.4956C>G" "r.(?)" "p.(=)" "34" "0000166002" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000166003" "00000065" "10" "6279" "0" "6279" "0" "c.6279C>T" "r.0" "p.(Ala2093=)" "45" "0000166004" "00000065" "90" "1783" "-19594" "5445" "1681" "c.1783-19594_5445+1681del" "r.(del)" "p.(del)" "12i_37i" "0000166005" "00000065" "90" "850" "0" "850" "0" "c.850G>A" "r.(?)" "p.(Gly284Arg)" "6" "0000166006" "00000065" "90" "850" "0" "850" "0" "c.850G>A" "r.(?)" "p.(Gly284Arg)" "6" "0000166007" "00000065" "90" "728" "0" "728" "0" "c.728T>C" "r.(?)" "p.(Leu243Pro)" "5" "0000166008" "00000065" "90" "4860" "2" "4860" "2" "c.4860+2delinsGGCC" "r.4718_4860del" "p.Phe1573Serfs*49" "33i" "0000166009" "00000065" "90" "728" "0" "728" "0" "c.728T>C" "r.(?)" "p.(Leu243Pro)" "5" "0000166010" "00000065" "90" "4860" "2" "4860" "2" "c.4860+2delinsGGCC" "r.4718_4860del" "p.Phe1573Serfs*49" "33i" "0000166011" "00000065" "90" "397" "-13" "398" "0" "c.397-13_398del" "r.(?)" "p.(Val133Argfs*5)" "3i_4" "0000166012" "00000065" "90" "7431" "0" "7431" "0" "c.7431A>T" "r.(?)" "p.(Arg2477Ser)" "52" "0000166013" "00000065" "90" "454" "0" "454" "0" "c.454T>G" "r.(?)" "p.(Trp152Gly)" "4" "0000166014" "00000065" "90" "454" "0" "454" "0" "c.454T>G" "r.(?)" "p.(Trp152Gly)" "4" "0000166015" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166016" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166017" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166018" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166019" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166020" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166021" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166022" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166023" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166024" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166025" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166026" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166027" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166028" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166029" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166030" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166031" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166032" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166033" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166034" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166035" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166036" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166037" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166038" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166039" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166040" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166041" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166042" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166043" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166044" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166045" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166046" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166047" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166048" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166049" "00000065" "90" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000166050" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166051" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.1856g>a" "p.Arg619His" "13" "0000166052" "00000065" "90" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273*)" "5" "0000166053" "00000065" "90" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273*)" "5" "0000166054" "00000065" "70" "4002" "0" "4002" "0" "c.4002T>G" "r.(?)" "p.(Tyr1334*)" "27" "0000166055" "00000065" "90" "7658" "0" "7658" "0" "c.7658del" "r.(?)" "p.(Ser2553Tyrfs*35)" "55" "0000166056" "00000065" "50" "112" "0" "112" "0" "c.112G>A" "r.(?)^r.(spl?)" "p.(Gly38Ser)^p.?" "1" "0000166057" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000166062" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000166064" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000166065" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000166067" "00000065" "90" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000166068" "00000065" "70" "2538" "-1" "2538" "-1" "c.2538-1G>A" "r.spl?" "p.?" "18i" "0000166069" "00000065" "70" "3735" "2" "3735" "2" "c.3735+2T>A" "r.spl?" "p.?" "25i" "0000166070" "00000065" "90" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000166071" "00000065" "70" "7572" "1" "7572" "1" "c.7572+1G>A" "r.spl?" "p.?" "54i" "0000166072" "00000065" "90" "7658" "0" "7658" "0" "c.7658del" "r.(?)" "p.(Ser2553Tyrfs*35)" "55" "0000166073" "00000065" "50" "1326" "0" "1326" "0" "c.1326T>G" "r.(?)" "p.(Cys442Trp)" "10" "0000166075" "00000065" "50" "-17" "0" "-17" "0" "c.-17del" "r.(?)" "p.(=)" "1" "0000166076" "00000065" "50" "112" "1" "112" "1" "c.112+1G>A" "r.spl?" "p.?" "1i" "0000166077" "00000065" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(=)" "2" "0000166078" "00000065" "50" "184" "0" "184" "0" "c.184G>T" "r.(?)" "p.(Gly62*)" "2" "0000166079" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.(?)" "p.(=)" "3" "0000166080" "00000065" "10" "397" "-15" "397" "-15" "c.397-15G>A" "r.(?)" "p.(=)" "3i" "0000166081" "00000065" "50" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Thr178Met)" "4" "0000166082" "00000065" "10" "640" "-26" "640" "-26" "c.640-26G>A" "r.(?)" "p.(=)" "4i" "0000166083" "00000065" "50" "675" "0" "675" "0" "c.675C>T" "r.(?)" "p.(=)" "5" "0000166084" "00000065" "50" "713" "0" "713" "0" "c.713C>A" "r.(?)" "p.(Ala238Asp)" "5" "0000166085" "00000065" "50" "830" "0" "830" "0" "c.830C>T" "r.(?)" "p.(Ser277Leu)" "6" "0000166086" "00000065" "90" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000166087" "00000065" "10" "1206" "11" "1206" "11" "c.1206+11C>T" "r.(?)" "p.(=)" "8i" "0000166088" "00000065" "10" "1403" "0" "1403" "0" "c.1403C>G" "r.(?)" "p.(Ala468Gly)" "10" "0000166089" "00000065" "10" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(=)" "11" "0000166090" "00000065" "10" "1533" "0" "1533" "0" "c.1533T>C" "r.(?)" "p.(=)" "11" "0000166091" "00000065" "90" "1612" "0" "1612" "0" "c.1612C>T" "r.(?)" "p.(Gln538*)" "12" "0000166092" "00000065" "50" "1701" "0" "1701" "0" "c.1701C>T" "r.(?)" "p.(=)" "12" "0000166093" "00000065" "10" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "13" "0000166094" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000166095" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000166096" "00000065" "50" "2084" "0" "2084" "0" "c.2084A>T" "r.(?)" "p.(Asp695Val)" "14" "0000166097" "00000065" "50" "2177" "0" "2177" "0" "c.2177G>A" "r.(?)" "p.(Cys726Tyr)" "15" "0000166098" "00000065" "10" "2749" "34" "2749" "34" "c.2749+34T>C" "r.(?)" "p.(=)" "19i" "0000166099" "00000065" "10" "2756" "0" "2756" "0" "c.2756G>T" "r.(?)" "p.(Arg919Leu)" "20" "0000166100" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000166101" "00000065" "10" "2857" "-39" "2857" "-39" "c.2857-39T>C" "r.(?)" "p.(=)" "20i" "0000166102" "00000065" "10" "3037" "49" "3037" "49" "c.3037+49G>A" "r.(?)" "p.(=)" "21i" "0000166103" "00000065" "50" "3154" "0" "3154" "0" "c.3154A>G" "r.(?)" "p.(Ser1052Gly)" "22" "0000166104" "00000065" "10" "3174" "38" "3174" "38" "c.3174+38A>G" "r.(?)" "p.(=)" "22i" "0000166105" "00000065" "50" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(?)" "p.(=)" "22i" "0000166106" "00000065" "90" "3215" "0" "3215" "0" "c.3215del" "r.(?)" "p.(Cys1072Serfs*3)" "23" "0000166107" "00000065" "90" "3237" "0" "3237" "0" "c.3237C>A" "r.(?)" "p.(Cys1079*)" "23" "0000166108" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(?)" "p.(=)" "23i" "0000166109" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000166110" "00000065" "10" "3613" "0" "3613" "0" "c.3613A>G" "r.(?)" "p.(Thr1205Ala)" "25" "0000166111" "00000065" "50" "3623" "0" "3645" "0" "c.3623_3645del" "r.(?)" "p.(Lys1208Argfs*27)" "25" "0000166112" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000166113" "00000065" "50" "4312" "-19" "4312" "-17" "c.4312-19_4312-17del" "r.(?)" "p.(=)" "29i" "0000166114" "00000065" "50" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "31" "0000166115" "00000065" "10" "4523" "19" "4523" "19" "c.4523+19C>T" "r.(?)" "p.(=)" "31i" "0000166116" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000166117" "00000065" "93" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000166118" "00000065" "10" "4956" "0" "4956" "0" "c.4956C>G" "r.(?)" "p.(=)" "34" "0000166119" "00000065" "50" "4960" "-17" "4960" "-17" "c.4960-17C>A" "r.(?)" "p.(=)" "34i" "0000166120" "00000065" "10" "5071" "18" "5071" "18" "c.5071+18A>G" "r.(?)" "p.(=)" "35i" "0000166121" "00000065" "50" "5072" "-6" "5072" "-6" "c.5072-6del" "r.(?)" "p.(=)" "35i" "0000166122" "00000065" "50" "5247" "0" "5247" "0" "c.5247C>T" "r.(?)" "p.(=)" "37" "0000166123" "00000065" "50" "5280" "0" "5280" "0" "c.5280G>A" "r.(?)" "p.(=)" "37" "0000166124" "00000065" "10" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(=)" "38" "0000166125" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000166126" "00000065" "10" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000166127" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000166128" "00000065" "50" "5614" "0" "5614" "0" "c.5614G>T" "r.(?)" "p.(Asp1872Tyr)" "39" "0000166129" "00000065" "90" "5706" "0" "5712" "0" "c.5706_5712del" "r.(?)" "p.(Asp1902Glufs*60)" "39" "0000166130" "00000065" "10" "5726" "39" "5726" "39" "c.5726+39T>C" "r.(?)" "p.(=)" "39i" "0000166131" "00000065" "10" "5727" "-24" "5727" "-21" "c.5727-24_5727-21delinsACTG" "r.(?)" "p.(=)" "39i" "0000166132" "00000065" "10" "5727" "-24" "5727" "-24" "c.5727-24T>A" "r.(?)" "p.(=)" "39i" "0000166133" "00000065" "10" "5727" "-22" "5727" "-22" "c.5727-22C>T" "r.(?)" "p.(=)" "39i" "0000166134" "00000065" "10" "5727" "-21" "5727" "-21" "c.5727-21T>G" "r.(?)" "p.(=)" "39i" "0000166135" "00000065" "90" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000166136" "00000065" "10" "5968" "28" "5968" "28" "c.5968+28T>A" "r.(?)" "p.(=)" "41i" "0000166137" "00000065" "50" "6011" "0" "6011" "0" "c.6011del" "r.(?)" "p.(Asn2004Metfs*10)" "42" "0000166138" "00000065" "90" "6038" "0" "6038" "0" "c.6038del" "r.(?)" "p.(Leu2013*)" "42" "0000166139" "00000065" "10" "6086" "-40" "6086" "-40" "c.6086-40C>G" "r.(?)" "p.(=)" "42i" "0000166140" "00000065" "10" "6150" "0" "6150" "0" "c.6150T>C" "r.(?)" "p.(=)" "43" "0000166141" "00000065" "10" "6167" "0" "6167" "0" "c.6167C>A" "r.(?)" "p.(Thr2056Lys)" "43" "0000166142" "00000065" "10" "6234" "0" "6234" "0" "c.6234A>G" "r.(?)" "p.(=)" "43" "0000166143" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000166144" "00000065" "10" "6274" "4" "6274" "4" "c.6274+4C>T" "r.(?)" "p.?" "44i" "0000166145" "00000065" "10" "6274" "24" "6274" "24" "c.6274+24C>T" "r.(?)" "p.(=)" "44i" "0000166146" "00000065" "10" "6274" "47" "6274" "47" "c.6274+47A>T" "r.(?)" "p.(=)" "44i" "0000166147" "00000065" "50" "6322" "0" "6322" "0" "c.6322C>T" "r.(?)" "p.(Arg2108Trp)" "45" "0000166148" "00000065" "90" "6617" "0" "6617" "0" "c.6617del" "r.(?)" "p.(Phe2206Serfs*12)" "47" "0000166149" "00000065" "90" "6690" "0" "6690" "0" "c.6690C>A" "r.(?)" "p.(Tyr2230*)" "47" "0000166150" "00000065" "10" "6707" "37" "6707" "37" "c.6707+37T>C" "r.(?)" "p.(=)" "47i" "0000166151" "00000065" "50" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319*)" "49" "0000166152" "00000065" "10" "6993" "-44" "6993" "-44" "c.6993-44T>C" "r.(?)" "p.(=)" "49i" "0000166153" "00000065" "50" "7440" "-20" "7440" "-20" "c.7440-20del" "r.(?)" "p.(=)" "52i" "0000166154" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513Ilefs*34)" "54" "0000166155" "00000065" "50" "7572" "0" "7572" "0" "c.7572G>A" "r.(?)" "p.(=)" "54" "0000166156" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000166157" "00000065" "10" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000166158" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000166159" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000166160" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(=)" "56" "0000166161" "00000065" "90" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630*)" "56" "0000166162" "00000065" "10" "7906" "0" "7906" "0" "c.7906A>G" "r.(?)" "p.(Thr2636Ala)" "57" "0000166163" "00000065" "50" "7965" "0" "7965" "0" "c.7965C>A" "r.(?)" "p.(=)" "57" "0000166164" "00000065" "10" "8028" "0" "8028" "0" "c.8028T>C" "r.(?)" "p.(=)" "57" "0000166165" "00000065" "10" "8124" "0" "8124" "0" "c.8124T>A" "r.(?)" "p.(=)" "58" "0000166166" "00000065" "90" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.(spl?)" "p.?" "58i" "0000166167" "00000065" "50" "8282" "0" "8282" "0" "c.8282T>C" "r.(?)" "p.(Ile2761Thr)" "59" "0000166168" "00000065" "10" "8528" "0" "8528" "0" "c.8528A>G" "r.(?)" "p.(Asn2843Ser)" "60" "0000166169" "00000065" "30" "8548" "-10" "8548" "-10" "c.8548-10T>C" "r.(?)" "p.(=)" "60i" "0000166170" "00000065" "50" "8586" "0" "8586" "0" "c.8586T>C" "r.(?)" "p.(=)" "61" "0000166171" "00000065" "10" "8691" "0" "8691" "0" "c.8691A>G" "r.(?)" "p.(=)" "61" "0000166172" "00000065" "90" "8748" "0" "8748" "0" "c.8748del" "r.(?)" "p.(Glu2917Argfs*48)" "62" "0000166173" "00000065" "50" "8857" "44" "8857" "44" "c.8857+44C>T" "r.(?)" "p.(=)" "62i" "0000166174" "00000065" "50" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(spl?)" "p.(=)" "64i" "0000166175" "00000065" "10" "9211" "25" "9211" "25" "c.9211+25A>C" "r.(?)" "p.(=)" "64i" "0000166176" "00000065" "10" "9212" "-15" "9212" "-15" "c.9212-15C>A" "r.(?)" "p.(=)" "64i" "0000166177" "00000065" "50" "9212" "-1" "9212" "-1" "c.9212-1G>A" "r.spl?" "p.?" "64i" "0000166178" "00000065" "50" "9252" "0" "9252" "0" "c.9252C>G" "r.(?)" "p.(Phe3084Leu)" "65" "0000166179" "00000065" "90" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000166180" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000166181" "00000065" "50" "4523" "0" "4523" "0" "c.4523G>A" "r.(spl?)" "p.(Arg1508Lys)^p.?" "31" "0000166182" "00000065" "50" "1547" "0" "1547" "0" "c.1547A>G" "r.(spl?)" "p.(Asp516Gly)^p.?" "11" "0000166183" "00000065" "70" "8748" "0" "8748" "0" "c.8748del" "r.(?)" "p.(Glu2917Argfs*48)" "62" "0000166184" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121*)" "3" "0000166185" "00000065" "90" "5132" "0" "5132" "0" "c.5132del" "r.(?)" "p.(Glu1711Glyfs*14)" "36" "0000166186" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000166187" "00000065" "90" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400*)" "29" "0000166188" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000166189" "00000065" "90" "2875" "0" "2875" "0" "c.2875C>T" "r.(?)" "p.(Gln959*)" "21" "0000166190" "00000065" "90" "283" "1" "283" "1" "c.283+1G>A" "r.spl?" "p.?" "2i" "0000166191" "00000065" "90" "4261" "0" "4261" "0" "c.4261C>T" "r.(?)" "p.(Gln1421*)" "29" "0000166192" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000166193" "00000065" "90" "4049" "0" "4049" "0" "c.4049del" "r.(?)" "p.(Arg1350Hisfs*12)" "27" "0000166194" "00000065" "90" "112" "1" "112" "1" "c.112+1G>A" "r.spl?" "p.?" "1i" "0000166195" "00000065" "70" "524" "0" "534" "0" "c.524_534dup" "r.(?)" "p.(Leu179Serfs*3)" "4" "0000166196" "00000065" "70" "7862" "0" "7862" "0" "c.7862G>T" "r.(spl?)" "p.(Gly2621Val)^p.?" "56" "0000166197" "00000065" "70" "7691" "0" "7691" "0" "c.7691T>C" "r.(?)" "p.(Leu2564Pro)" "55" "0000166198" "00000065" "70" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085*)" "65" "0000166199" "00000065" "70" "8665" "0" "8665" "0" "c.8665G>A" "r.(?)" "p.(Gly2889Arg)" "61" "0000166200" "00000065" "70" "6430" "-2" "6430" "-2" "c.6430-2A>G" "r.spl" "p.?" "45i" "0000166254" "00000065" "90" "2322" "259" "2450" "2037" "c.2322+259_2450+2037del" "r.(?)" "p.(Asn775Leufs*2)" "16i_17i" "0000166255" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000166256" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000166257" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000166258" "00000065" "90" "284" "-1" "1306" "1" "c.(283+1_284-1)_(1306+1_1307-1)del" "r.(del?)" "p.(fs*?)" "2i_10i" "0000166259" "00000065" "90" "4059" "-1" "4311" "1" "c.(4058+1_4059-1)_(4311+1_4312-1)dup" "r.4059_4311dup" "p.(fs*?)" "27i_29i" "0000166260" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166261" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl?" "p.?" "36i" "0000166262" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166263" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166264" "00000065" "90" "3235" "0" "3235" "0" "c.3235T>G" "r.(?)" "p.(Cys1079Gly)" "23" "0000166265" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166266" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166267" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166268" "00000065" "90" "8613" "0" "8613" "0" "c.8613dup" "r.(?)" "p.(Ser2872Glnfs*34)" "61" "0000166269" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000166270" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000166271" "00000065" "70" "6708" "-1" "6708" "-1" "c.6708-1G>T" "r.spl?" "p.?" "47i" "0000166272" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000166273" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000166274" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000166275" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000166276" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000166277" "00000065" "70" "3235" "0" "3235" "0" "c.3235T>G" "r.(?)" "p.(Cys1079Gly)" "23" "0000166278" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000166279" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000166280" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000166281" "00000065" "70" "812" "0" "812" "0" "c.812C>T" "r.812c>u" "p.Thr271Ile" "5" "0000166282" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.2461a>c" "p.Thr821Pro" "18" "0000166284" "00000065" "90" "8988" "1" "8988" "1" "c.8988+1G>A" "r.spl?" "p.?" "63i" "0000166285" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.8076_8244del" "p.Pro2693Valfs*12" "58i" "0000166286" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121*)" "3" "0000166287" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000166288" "00000065" "70" "396" "1" "396" "1" "c.396+1G>T" "r.spl?" "p.?" "3i" "0000166289" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000166290" "00000065" "90" "497" "0" "497" "0" "c.497G>A" "r.(?)" "p.(Trp166*)" "4" "0000166291" "00000065" "70" "284" "-4685" "397" "-148" "c.284-4685_397-148delinsA" "r.(284_396del)" "p.(fs*?)" "2i_3i" "0000166292" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000166293" "00000065" "70" "819" "2" "819" "2" "c.819+2T>C" "r.[640_819del,640_1027del]" "p.[Ile214_Arg273del,Ile214Hisfs*22]" "5i" "0000166294" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000166295" "00000065" "70" "819" "2" "819" "2" "c.819+2T>C" "r.spl?" "p.?" "5i" "0000166296" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000166297" "00000065" "70" "8556" "0" "8558" "0" "c.8556_8558del" "r.(?)" "p.(Ile2852del)" "61" "0000166298" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.5072_5234del" "p.Val1765Serfs*21" "36i" "0000167010" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.2461a>c" "p.Thr821Pro" "18" "0000167011" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.5072_5234del" "p.Val1765Serfs*21" "36i" "0000167012" "00000065" "90" "3520" "0" "3520" "0" "c.3520C>T" "r.(?)" "p.(Gln1174*)" "24" "0000167013" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000167014" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000167015" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000167017" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000167018" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000167019" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000167092" "00000065" "90" "5263" "0" "5263" "0" "c.5263A>T" "r.(?)" "p.(Lys1755*)" "37" "0000167095" "00000065" "90" "6501" "0" "6501" "0" "c.6501C>G" "r.(?)" "p.(Tyr2167*)" "46" "0000167096" "00000065" "70" "2450" "4" "2450" "4" "c.2450+4A>G" "r.(spl?)" "p.?" "17i" "0000167097" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.8076_8244del" "p.Pro2693Valfs*12" "58i" "0000167098" "00000065" "90" "6979" "0" "6979" "0" "c.6979G>T" "r.(?)" "p.(Gly2327*)" "49" "0000167101" "00000065" "90" "7490" "0" "7493" "0" "c.7490_7493dup" "r.(?)" "p.(Asp2498Glufs*4)" "54" "0000167128" "00000065" "90" "2350" "0" "2350" "0" "c.2350dup" "r.(?)" "p.(Tyr784Leufs*3)" "17" "0000167129" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566Cysfs*13)" "32" "0000167130" "00000065" "70" "819" "2" "819" "2" "c.819+2T>C" "r.spl?" "p.?" "5i" "0000167131" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000167134" "00000065" "70" "6430" "-2" "6430" "-2" "c.6430-2A>G" "r.spl?" "p.?" "45i" "0000167146" "00000065" "90" "1122" "0" "1122" "0" "c.1122del" "r.(?)" "p.(Gly376Valfs*13)" "8" "0000167147" "00000065" "90" "2749" "1" "2749" "1" "c.2749+1G>A" "r.spl?" "p.?" "19i" "0000167148" "00000065" "90" "830" "0" "830" "0" "c.830C>T" "r.(?)" "p.(Ser277Leu)" "6" "0000167149" "00000065" "90" "7137" "0" "7137" "0" "c.7137T>A" "r.(?)" "p.(Tyr2379*)" "50" "0000167150" "00000065" "90" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400*)" "29" "0000167151" "00000065" "90" "8541" "0" "8541" "0" "c.8541G>A" "r.(?)" "p.(Trp2847*)" "60" "0000167152" "00000065" "70" "2089" "0" "2089" "0" "c.2089A>G" "r.(?)" "p.(Ile697Val)" "14" "0000167153" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000167160" "00000065" "90" "3388" "0" "3409" "0" "c.3388_3409dup" "r.(?)" "p.(Lys1137Thrfs*8)" "23" "0000167161" "00000065" "90" "1122" "0" "1122" "0" "c.1122del" "r.(?)" "p.(Gly376Valfs*13)" "8" "0000167162" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl?" "p.?" "58i" "0000167164" "00000065" "90" "8541" "0" "8541" "0" "c.8541G>A" "r.(?)" "p.(Trp2847*)" "60" "0000167166" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383*)" "50" "0000167168" "00000065" "90" "3154" "0" "3154" "0" "c.3154A>G" "r.(spl?)" "p.(Ser1052Gly)^p.?" "22" "0000167169" "00000065" "90" "6617" "0" "6617" "0" "c.6617del" "r.(?)" "p.(Phe2206Serfs*12)" "47" "0000167171" "00000065" "90" "652" "0" "653" "0" "c.652_653del" "r.(?)" "p.(Leu218Asnfs*9)" "5" "0000167172" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744*)" "16" "0000167173" "00000065" "90" "1580" "0" "1580" "0" "c.1580G>A" "r.(?)" "p.(Cys527Tyr)" "11" "0000167181" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000167182" "00000065" "90" "1580" "0" "1580" "0" "c.1580G>A" "r.(?)" "p.(Cys527Tyr)" "11" "0000167183" "00000065" "90" "4516" "0" "4516" "0" "c.4516T>A" "r.(?)" "p.(Cys1506Ser)" "31" "0000167184" "00000065" "90" "6466" "0" "6466" "0" "c.6466C>T" "r.(?)" "p.(Arg2156*)" "46" "0000167185" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000167186" "00000065" "90" "8703" "1" "8703" "1" "c.8703+1G>A" "r.spl?" "p.?" "61i" "0000167187" "00000065" "00" "2217" "0" "2217" "0" "c.2217G>T" "r.(?)" "p.(Trp739Cys)" "16" "0000167188" "00000065" "70" "4640" "0" "4640" "0" "c.4640C>T" "r.(?)" "p.(Thr1547Met)" "32" "0000167189" "00000065" "90" "624" "0" "624" "0" "c.624del" "r.(?)" "p.(Leu209*)" "4" "0000167190" "00000065" "90" "2209" "-3" "2209" "-2" "c.2209-3_2209-2del" "r.spl?" "p.?" "15i" "0000167191" "00000065" "90" "8654" "0" "8654" "0" "c.8654T>C" "r.(?)" "p.(Leu2885Pro)" "61" "0000167192" "00000065" "90" "2945" "0" "2945" "0" "c.2945dup" "r.(?)" "p.(Ser982Argfs*16)" "21" "0000167193" "00000065" "90" "2945" "0" "2945" "0" "c.2945dup" "r.(?)" "p.(Ser982Argfs*16)" "21" "0000167194" "00000065" "90" "8654" "0" "8654" "0" "c.8654T>C" "r.(?)" "p.(Leu2885Pro)" "61" "0000167195" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000167196" "00000065" "90" "4311" "0" "4311" "0" "c.4311G>A" "r.4311_4312ins4311+1_4311+89" "p.(Asn1438Valfs*4)" "29" "0000167197" "00000065" "95" "8989" "-12" "8989" "-12" "c.8989-12C>G" "r.(=)" "p.(=)" "63i" "0000167198" "00000065" "90" "2451" "-6" "2451" "-6" "c.2451-6A>G" "r.(spl?)" "p.(=)" "17i" "0000167199" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000167200" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "9" "0000167201" "00000065" "90" "4771" "0" "4771" "0" "c.(4771C>T)" "r.(?)" "p.(Gln1591*)" "33" "0000167202" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000167203" "00000065" "90" "640" "-1" "819" "1" "c.(639+1_640-1)_(819+1_820-1)del" "r.(del)" "p.(del?)" "4i_5i" "0000167204" "00000065" "90" "640" "-1" "819" "1" "c.(639+1_640-1)_(819+1_820-1)del" "r.(del)" "p.(del?)" "4i_5i" "0000167205" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000167206" "00000065" "90" "4397" "0" "4397" "0" "c.4397G>A" "r.(?)" "p.(Cys1466Tyr)" "30" "0000167219" "00000065" "90" "391" "0" "391" "0" "c.391C>T" "r.(?)" "p.(Gln131*)" "3" "0000167220" "00000065" "50" "595" "0" "595" "0" "c.595T>A" "r.(?)" "p.(Cys199Ser)" "4" "0000167221" "00000065" "75" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "31" "0000168324" "00000065" "90" "4405" "0" "4405" "0" "c.4405T>C" "r.(?)" "p.(Cys1469Arg)" "30" "0000168325" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000168326" "00000065" "90" "4936" "0" "4936" "0" "c.4936G>T" "r.(?)" "p.(Glu1646*)" "34" "0000168327" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744*)" "16" "0000168461" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000168462" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000168463" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000168464" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000168697" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000168698" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000168699" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000168700" "00000065" "90" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754*)" "37" "0000168701" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000168702" "00000065" "90" "1027" "3" "1027" "3" "c.1027+3A>G" "r.(spl?)" "p.?" "7i" "0000168703" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000168704" "00000065" "90" "4523" "1" "4523" "1" "c.4523+1G>A" "r.spl?" "p.?" "31i" "0000168705" "00000065" "90" "2962" "0" "2962" "0" "c.2962C>T" "r.(?)" "p.(Gln988*)" "21" "0000168706" "00000065" "90" "454" "0" "454" "0" "c.454T>G" "r.(?)" "p.(Trp152Gly)" "4" "0000168707" "00000065" "90" "35" "0" "35" "0" "c.35T>G" "r.(?)" "p.(Leu12Arg)" "1" "0000168708" "00000065" "90" "3758" "0" "3758" "0" "c.3758T>G" "r.(?)" "p.(Leu1253Arg)" "26" "0000168709" "00000065" "90" "7431" "0" "7431" "0" "c.7431A>T" "r.(?)" "p.(Arg2477Ser)" "52" "0000168710" "00000065" "90" "397" "-13" "398" "0" "c.397-13_398del" "r.(?)" "p.(Val133Argfs*5)" "3i_4" "0000168741" "00000065" "90" "6268" "2" "6268" "2" "c.6268+2T>C" "r.spl?" "p.?" "43i" "0000168742" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719Argfs*5)" "36" "0000168743" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383*)" "50" "0000168744" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000168745" "00000065" "90" "8245" "-1" "8988" "1" "c.(8244+1_8245-1)_(8988+1_8989-1)del" "r.(del?)" "p.(del?)" "58i_63i" "0000168746" "00000065" "90" "363" "0" "363" "0" "c.363C>G" "r.(?)" "p.(Tyr121*)" "3" "0000168747" "00000065" "90" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273*)" "5" "0000168748" "00000065" "90" "1307" "-1" "1782" "1" "c.(1306+1_1307-1)_(1782+1_1783-1)del" "r.(del?)" "p.(fs*?)" "9i_12i" "0000168749" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.(?)" "p.(His3035Glnfs*5)" "64" "0000168750" "00000065" "90" "482" "0" "485" "0" "c.482_485dup" "r.(?)" "p.(Glu162Aspfs*2)" "4" "0000168751" "00000065" "90" "5866" "-1" "6867" "1" "c.(5865+1_5866-1)_(6867+1_6868-1)del" "r.(del)" "p.(del?)" "40i_48i" "0000168752" "00000065" "90" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Gln95*)" "2" "0000168753" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641*)" "57" "0000168754" "00000065" "90" "8987" "0" "8987" "0" "c.8987del" "r.(?)" "p.(Lys2996Serfs*2)" "63" "0000168755" "00000065" "90" "3096" "0" "3096" "0" "c.3096C>A" "r.(?)" "p.(Cys1032*)" "22" "0000168756" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.(del?)" "p.(del?)" "3i_4i" "0000168757" "00000065" "90" "2565" "0" "2565" "0" "c.2565del" "r.(?)" "p.(Ser856Leufs*32)" "19" "0000168758" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000168759" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121*)" "3" "0000168760" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000168761" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121*)" "3" "0000168762" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000168763" "00000065" "90" "4058" "1" "4058" "1" "c.4058+1G>A" "r.spl?" "p.?" "27i" "0000168764" "00000065" "90" "2959" "0" "2959" "0" "c.2959dup" "r.(?)" "p.(Cys987Leufs*11)" "21" "0000168765" "00000065" "90" "8358" "-3" "8358" "-3" "c.8358-3C>G" "r.(spl?)" "p.?" "59i" "0000168766" "00000065" "90" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319*)" "27" "0000168767" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.(del?)" "p.(del?)" "3i_4i" "0000168768" "00000065" "90" "113" "-1" "396" "1" "c.(112+1_113-1)_(396+1_397-1)del" "r.(del?)" "p.(fs*?)" "1i_3i" "0000168769" "00000065" "90" "5071" "1" "5071" "1" "c.5071+1G>A" "r.spl?" "p.?" "35i" "0000168770" "00000065" "90" "113" "-1" "396" "1" "c.(112+1_113-1)_(396+1_397-1)del" "r.(del?)" "p.(fs*?)" "1i_3i" "0000168771" "00000065" "90" "5071" "1" "5071" "1" "c.5071+1G>A" "r.spl?" "p.?" "35i" "0000168833" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.(del?)" "p.(del?)" "3i_4i" "0000168834" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.(del?)" "p.(del?)" "3i_4i" "0000168835" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000168836" "00000065" "90" "8858" "-1" "8988" "1" "c.(8857+1_8858-1)_(8988+1_8989-1)del" "r.(del?)" "p.(fs*?)" "62i_63i" "0000168837" "00000065" "90" "4058" "1" "4058" "1" "c.4058+1G>A" "r.3925_4058del" "p.(Lys1309Aspfs*2)" "27i" "0000168838" "00000065" "90" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Trp110*)" "3" "0000168839" "00000065" "90" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095*)" "23" "0000168840" "00000065" "90" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl?" "p.?" "6i" "0000168841" "00000065" "90" "1153" "0" "1154" "0" "c.1153_1154del" "r.(?)" "p.(Thr385Cysfs*10)" "8" "0000168842" "00000065" "90" "8264" "0" "8264" "0" "c.8264C>A" "r.(?)" "p.(Ser2755*)" "59" "0000168843" "00000065" "90" "640" "-1" "640" "-1" "c.640-1G>C" "r.spl?" "p.?" "4i" "0000168844" "00000065" "90" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "18" "0000168845" "00000065" "90" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "18" "0000168846" "00000065" "90" "6993" "-2" "6993" "-2" "c.6993-2A>G" "r.spl?" "p.?" "49i" "0000168847" "00000065" "90" "7898" "0" "7898" "0" "c.7898G>C" "r.(?)" "p.(Gly2633Ala)" "56" "0000168848" "00000065" "90" "1976" "0" "1976" "0" "c.1976C>A" "r.(?)" "p.(Ser659*)" "14" "0000168849" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641*)" "57" "0000168850" "00000065" "90" "3931" "0" "3931" "0" "c.3931T>G" "r.(?)" "p.(Trp1311Gly)" "27" "0000168851" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "9" "0000168868" "00000065" "90" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319*)" "27" "0000168870" "00000065" "90" "2958" "0" "2958" "0" "c.2958G>A" "r.(?)" "p.(Trp986*)" "21" "0000168871" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000168872" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000168873" "00000065" "90" "283" "1" "283" "1" "c.283+1G>C" "r.spl?" "p.?" "2i" "0000168874" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000168875" "00000065" "90" "283" "1" "283" "1" "c.283+1G>C" "r.spl?" "p.?" "2i" "0000168876" "00000065" "90" "1553" "0" "1553" "0" "c.1553G>A" "r.(?)" "p.(Cys518Tyr)" "11" "0000168877" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719Argfs*5)" "36" "0000168878" "00000065" "90" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.3556_3556ins3556-11_3556-1" "p.Val1186Thrfs*4" "24i" "0000168879" "00000065" "90" "4886" "0" "4886" "0" "c.4886del" "r.(?)" "p.(Pro1629Glnfs*12)" "34" "0000168883" "00000065" "90" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.3556_3556ins3556-11_3556-1" "p.Val1186Thrfs*4" "24i" "0000168884" "00000065" "90" "4886" "0" "4886" "0" "c.4886del" "r.(?)" "p.(Pro1629Glnfs*12)" "34" "0000168885" "00000065" "90" "4312" "-3" "4312" "-3" "c.4312-3C>G" "r.(spl?)" "p.?" "29i" "0000168886" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744*)" "16" "0000168887" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000168888" "00000065" "90" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.(spl?)" "p.?" "58i" "0000168889" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000168892" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641*)" "57" "0000168893" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.(del?)" "p.(del?)" "3i_4i" "0000168894" "00000065" "90" "284" "-1" "639" "1" "c.(283+1_284-1)_(639+1_640-1)del" "r.(del)" "p.?" "2i_4i" "0000168897" "00000065" "90" "7991" "0" "7991" "0" "c.7991del" "r.(?)" "p.(Gly2664Valfs*64)" "57" "0000168898" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000169070" "00000065" "90" "6868" "-1" "6992" "1" "c.(6867+1_6868-1)_(6992+1_6993-1)del" "r.(del?)" "p.(fs*?)" "48i_49i" "0000169132" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169133" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169134" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169135" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169136" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581Profs*5)" "33" "0000169175" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169176" "00000065" "50" "32" "0" "32" "0" "c.32T>C" "r.(?)" "p.(Leu11Pro)" "1" "0000169177" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169178" "00000065" "90" "3372" "0" "3372" "0" "c.3372dup" "r.(?)" "p.(Cys1125Metfs*4)" "23" "0000169179" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000169180" "00000065" "50" "6707" "0" "6707" "0" "c.6707G>A" "r.(?)^r.(spl?)" "p.(Arg2236Lys)^p.(?)" "47" "0000169181" "00000065" "90" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000169182" "00000065" "70" "2450" "4" "2450" "4" "c.2450+4A>G" "r.(spl?)" "p.?" "17i" "0000169183" "00000065" "50" "7057" "0" "7057" "0" "c.7057C>T" "r.(?)" "p.(Arg2353Cys)" "50" "0000169184" "00000065" "90" "8725" "0" "8725" "0" "c.8725T>C" "r.(?)" "p.(Cys2909Arg)" "62" "0000169185" "00000065" "90" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319*)" "49" "0000169186" "00000065" "90" "1084" "0" "1085" "0" "c.1084_1085insTT" "r.(?)" "p.(Arg362Ilefs*4)" "8" "0000169187" "00000065" "90" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl?" "p.?" "6i" "0000169206" "00000065" "00" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754*)" "37" "0000170962" "00000065" "90" "713" "0" "713" "0" "c.713C>A" "r.(?)" "p.(Ala238Asp)" "5" "0000177865" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000177956" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000178986" "00000065" "70" "8586" "0" "8586" "0" "c.8586T>G" "r.(?)" "p.(Tyr2862*)" "61" "0000178987" "00000065" "70" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319*)" "49" "0000178988" "00000065" "70" "8947" "0" "8947" "0" "c.8947C>T" "r.(?)" "p.(Gln2983*)" "63" "0000178989" "00000065" "30" "3556" "-15" "3556" "-15" "c.3556-15T>G" "r.(=)" "p.(=)" "24i" "0000178990" "00000065" "70" "7898" "2" "7898" "2" "c.7898+2T>G" "r.spl?" "p.(?)" "56i" "0000178991" "00000065" "70" "7898" "2" "7898" "2" "c.7898+2T>G" "r.spl?" "p.?" "56i" "0000178992" "00000065" "70" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000178993" "00000065" "70" "3924" "2" "3924" "2" "c.3924+2T>C" "r.3736_3924del" "p.Leu1246_Glu1308del" "26i" "0000178994" "00000065" "70" "5134" "0" "5153" "0" "c.5134_5153del" "r.(?)" "p.(Arg1712Glufs*4)" "36" "0000178996" "00000065" "70" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000178997" "00000065" "70" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000178998" "00000065" "10" "2736" "0" "2736" "0" "c.2736G>A" "r.(=)" "p.(=)" "19" "0000179000" "00000065" "70" "7572" "1" "7572" "1" "c.7572+1G>A" "r.spl?" "p.(?)" "54i" "0000179001" "00000065" "50" "245" "0" "245" "0" "c.245A>T" "r.(?)" "p.(Gln82Leu)" "2" "0000179002" "00000065" "70" "8244" "2" "8244" "2" "c.8244+2dup" "r.spl?" "p.(?)" "58i" "0000179003" "00000065" "70" "8244" "2" "8244" "2" "c.8244+2dup" "r.spl?" "p.(?)" "58i" "0000221903" "00000065" "70" "5050" "0" "5050" "0" "c.5050G>T" "r.(?)" "p.(Glu1684*)" "35" "0000221904" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000221960" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000221964" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000221965" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000221997" "00000065" "70" "396" "1" "396" "1" "c.396+1G>T" "r.spl?" "p.?" "3i" "0000221998" "00000065" "90" "6501" "0" "6501" "0" "c.6501C>A" "r.(?)" "p.(Tyr2167*)" "46" "0000222028" "00000065" "90" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000222029" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "38i" "0000222030" "00000065" "90" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000222031" "00000065" "90" "7658" "0" "7658" "0" "c.7658del" "r.(?)" "p.(Ser2553Tyrfs*35)" "55" "0000222032" "00000065" "90" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000222033" "00000065" "70" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000222034" "00000065" "70" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000222035" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "9" "0000222036" "00000065" "70" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000222037" "00000065" "70" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000222038" "00000065" "90" "2538" "-1" "2538" "-1" "c.2538-1G>A" "r.spl?" "p.?" "18i" "0000222040" "00000065" "90" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000222041" "00000065" "70" "6429" "1" "6429" "1" "c.6429+1G>T" "r.spl?" "p.?" "45i" "0000222051" "00000065" "90" "9095" "0" "9095" "0" "c.9095dup" "r.(?)" "p.(Ile3033Aspfs*6)" "64" "0000222059" "00000065" "50" "4860" "0" "4860" "0" "c.4860G>A" "r.(spl?)" "p.(?)" "33" "0000222316" "00000065" "50" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000246447" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(Gln933=)" "20" "0000246451" "00000065" "10" "7906" "0" "7906" "0" "c.7906A>G" "r.(?)" "p.(Thr2636Ala)" "57" "0000246455" "00000065" "10" "6269" "-840" "6269" "-840" "c.6269-840A>G" "r.(=)" "p.(=)" "43i" "0000246476" "00000065" "10" "8528" "0" "8528" "0" "c.8528A>G" "r.(?)" "p.(Asn2843Ser)" "60" "0000248364" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(Gln933=)" "20" "0000248418" "00000065" "10" "7906" "0" "7906" "0" "c.7906A>G" "r.(?)" "p.(Thr2636Ala)" "57" "0000252766" "00000065" "50" "7431" "0" "7431" "0" "c.7431A>T" "r.(?)" "p.(Arg2477Ser)" "52" "0000254937" "00000065" "30" "2877" "0" "2877" "0" "c.2877A>G" "r.(?)" "p.(Gln959=)" "21" "0000256684" "00000065" "50" "2132" "0" "2132" "0" "c.2132A>G" "r.(?)" "p.(Tyr711Cys)" "15" "0000278632" "00000065" "30" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(Cys497=)" "11" "0000278633" "00000065" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Ile52=)" "2" "0000278634" "00000065" "30" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "13" "0000278635" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000278636" "00000065" "10" "2451" "-19" "2451" "-19" "c.2451-19C>T" "r.(=)" "p.(=)" "17i" "0000278637" "00000065" "10" "255" "0" "255" "0" "c.255C>T" "r.(?)" "p.(Ile85=)" "2" "0000278638" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(=)" "p.(=)" "23i" "0000278639" "00000065" "30" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000278640" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.(?)" "p.(Thr127=)" "3" "0000278641" "00000065" "30" "4523" "19" "4523" "19" "c.4523+19C>T" "r.(=)" "p.(=)" "31i" "0000278642" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000278643" "00000065" "10" "4956" "0" "4956" "0" "c.4956C>G" "r.(?)" "p.(Thr1652=)" "34" "0000278644" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(Glu1834=)" "38" "0000278645" "00000065" "10" "5727" "-21" "5727" "-21" "c.5727-21T>G" "r.(=)" "p.(=)" "39i" "0000278646" "00000065" "30" "6030" "0" "6030" "0" "c.6030G>T" "r.(?)" "p.(Gly2010=)" "42" "0000278647" "00000065" "10" "6167" "0" "6167" "0" "c.6167C>A" "r.(?)" "p.(Thr2056Lys)" "43" "0000278648" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(Thr2079=)" "43" "0000278649" "00000065" "30" "7300" "10" "7300" "10" "c.7300+10T>A" "r.(=)" "p.(=)" "51i" "0000278650" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(Val2610=)" "56" "0000278651" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(Pro2615=)" "56" "0000278652" "00000065" "10" "8028" "0" "8028" "0" "c.8028T>C" "r.(?)" "p.(Asn2676=)" "57" "0000278653" "00000065" "10" "8548" "-10" "8548" "-10" "c.8548-10T>C" "r.(=)" "p.(=)" "60i" "0000281971" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Ter)" "9" "0000281972" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000281973" "00000065" "30" "2217" "0" "2217" "0" "c.2217G>T" "r.(?)" "p.(Trp739Cys)" "16" "0000281974" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(=)" "p.(=)" "23i" "0000281975" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000281976" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.(?)" "p.(Thr127=)" "3" "0000281977" "00000065" "10" "4523" "19" "4523" "19" "c.4523+19C>T" "r.(=)" "p.(=)" "31i" "0000281978" "00000065" "30" "4993" "0" "4993" "0" "c.4993G>A" "r.(?)" "p.(Gly1665Arg)" "35" "0000281979" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(Glu1834=)" "38" "0000281980" "00000065" "50" "553" "0" "553" "0" "c.553C>T" "r.(?)" "p.(Arg185Cys)" "4" "0000281981" "00000065" "30" "5969" "-5" "5969" "-5" "c.5969-5C>T" "r.spl?" "p.?" "41i" "0000281982" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(Val2610=)" "56" "0000281983" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(Pro2615=)" "56" "0000281984" "00000065" "30" "8755" "0" "8755" "0" "c.8755C>T" "r.(?)" "p.(Pro2919Ser)" "62" "0000285865" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000285866" "00000065" "10" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000285867" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "36" "0000285868" "00000065" "30" "6945" "0" "6945" "0" "c.6945G>T" "r.(?)" "p.(Leu2315Phe)" "49" "0000285869" "00000065" "90" "7572" "1" "7572" "1" "c.7572+1G>A" "r.spl?" "p.?" "54i" "0000285870" "00000065" "90" "8857" "1" "8857" "1" "c.8857+1G>A" "r.spl?" "p.?" "62i" "0000285871" "00000065" "30" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(=)" "p.(=)" "64i" "0000290649" "00000065" "10" "1586" "0" "1586" "0" "c.1586G>A" "r.(?)" "p.(Ser529Asn)" "11" "0000290650" "00000065" "30" "1634" "0" "1634" "0" "c.1634T>A" "r.(?)" "p.(Leu545Gln)" "12" "0000290651" "00000065" "30" "1645" "0" "1645" "0" "c.1645C>T" "r.(?)" "p.(Pro549Ser)" "12" "0000290652" "00000065" "10" "1701" "0" "1701" "0" "c.1701C>T" "r.(?)" "p.(Ile567=)" "12" "0000290653" "00000065" "30" "2476" "0" "2476" "0" "c.2476C>T" "r.(?)" "p.(Arg826Trp)" "18" "0000290654" "00000065" "30" "255" "0" "255" "0" "c.255C>T" "r.(?)" "p.(Ile85=)" "2" "0000290655" "00000065" "30" "2637" "0" "2637" "0" "c.2637T>C" "r.(?)" "p.(Cys879=)" "19" "0000290656" "00000065" "30" "2767" "0" "2767" "0" "c.2767G>A" "r.(?)" "p.(Gly923Ser)" "20" "0000290657" "00000065" "30" "3144" "0" "3144" "0" "c.3144C>T" "r.(?)" "p.(Thr1048=)" "22" "0000290658" "00000065" "30" "411" "0" "411" "0" "c.411G>A" "r.(?)" "p.(Ala137=)" "4" "0000290659" "00000065" "30" "4222" "0" "4222" "0" "c.4222C>G" "r.(?)" "p.(Arg1408Gly)" "29" "0000290660" "00000065" "10" "4437" "-5" "4437" "-5" "c.4437-5T>A" "r.spl?" "p.?" "30i" "0000290661" "00000065" "30" "4470" "0" "4470" "0" "c.4470C>T" "r.(?)" "p.(Asp1490=)" "31" "0000290662" "00000065" "50" "4909" "0" "4909" "0" "c.4909G>A" "r.(?)" "p.(Glu1637Lys)" "34" "0000290663" "00000065" "50" "4930" "0" "4930" "0" "c.4930G>A" "r.(?)" "p.(Val1644Met)" "34" "0000290664" "00000065" "10" "4935" "0" "4935" "0" "c.4935C>A" "r.(?)" "p.(Thr1645=)" "34" "0000290665" "00000065" "10" "5247" "0" "5247" "0" "c.5247C>T" "r.(?)" "p.(Ala1749=)" "37" "0000290666" "00000065" "30" "5280" "0" "5280" "0" "c.5280G>A" "r.(?)" "p.(Glu1760=)" "37" "0000290667" "00000065" "50" "5633" "0" "5633" "0" "c.5633C>T" "r.(?)" "p.(Ser1878Phe)" "39" "0000290668" "00000065" "50" "5692" "0" "5692" "0" "c.5692G>T" "r.(?)" "p.(Ala1898Ser)" "39" "0000290669" "00000065" "30" "6002" "0" "6002" "0" "c.6002G>A" "r.(?)" "p.(Arg2001Lys)" "42" "0000290670" "00000065" "10" "6150" "0" "6150" "0" "c.6150T>C" "r.(?)" "p.(Asp2050=)" "43" "0000290671" "00000065" "10" "675" "0" "675" "0" "c.675C>T" "r.(?)" "p.(Ala225=)" "5" "0000290672" "00000065" "50" "7118" "0" "7118" "0" "c.7118C>T" "r.(?)" "p.(Ser2373Leu)" "50" "0000290673" "00000065" "50" "7424" "0" "7424" "0" "c.7424C>T" "r.(?)" "p.(Thr2475Met)" "52" "0000290674" "00000065" "10" "8755" "0" "8755" "0" "c.8755C>T" "r.(?)" "p.(Pro2919Ser)" "62" "0000290675" "00000065" "10" "9123" "0" "9123" "0" "c.9123C>T" "r.(?)" "p.(Val3041=)" "64" "0000331180" "00000065" "50" "397" "-6" "397" "-6" "c.397-6C>T" "r.(=)" "p.(=)" "3i" "0000331181" "00000065" "30" "411" "0" "411" "0" "c.411G>A" "r.(?)" "p.(Ala137=)" "4" "0000331182" "00000065" "50" "922" "0" "922" "0" "c.922G>A" "r.(?)" "p.(Glu308Lys)" "7" "0000331186" "00000065" "30" "2476" "0" "2476" "0" "c.2476C>T" "r.(?)" "p.(Arg826Trp)" "18" "0000331187" "00000065" "30" "2670" "0" "2670" "0" "c.2670A>C" "r.(?)" "p.(Lys890Asn)" "19" "0000331189" "00000065" "50" "2770" "0" "2770" "0" "c.2770G>T" "r.(?)" "p.(Gly924Cys)" "20" "0000331191" "00000065" "30" "3556" "-15" "3556" "-15" "c.3556-15T>G" "r.(=)" "p.(=)" "" "0000331192" "00000065" "50" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267AspfsTer11)" "26" "0000331195" "00000065" "50" "4935" "0" "4935" "0" "c.4935C>A" "r.(?)" "p.(Thr1645=)" "" "0000331197" "00000065" "30" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000331198" "00000065" "30" "5969" "-8" "5969" "-8" "c.5969-8A>T" "r.(=)" "p.(=)" "41i" "0000331199" "00000065" "30" "6161" "0" "6161" "0" "c.6161A>G" "r.(?)" "p.(Gln2054Arg)" "43" "0000331200" "00000065" "50" "6461" "0" "6461" "0" "c.6461G>A" "r.(?)" "p.(Cys2154Tyr)" "46" "0000331202" "00000065" "30" "6708" "-3" "6708" "-3" "c.6708-3A>C" "r.spl?" "p.?" "47i" "0000331203" "00000065" "50" "6781" "0" "6781" "0" "c.6781C>T" "r.(?)" "p.(His2261Tyr)" "48" "0000331204" "00000065" "50" "6788" "0" "6788" "0" "c.6788C>T" "r.(?)" "p.(Thr2263Met)" "48" "0000331207" "00000065" "50" "7006" "0" "7006" "0" "c.7006G>C" "r.(?)" "p.(Asp2336His)" "" "0000331210" "00000065" "30" "8528" "0" "8528" "0" "c.8528A>G" "r.(?)" "p.(Asn2843Ser)" "60" "0000331211" "00000065" "30" "8548" "-10" "8548" "-10" "c.8548-10T>C" "r.(=)" "p.(=)" "60i" "0000331212" "00000065" "30" "8774" "0" "8774" "0" "c.8774C>T" "r.(?)" "p.(Pro2925Leu)" "62" "0000331213" "00000065" "30" "9038" "0" "9038" "0" "c.9038A>C" "r.(?)" "p.(Asp3013Ala)" "64" "0000331215" "00000065" "30" "9212" "-15" "9212" "-15" "c.9212-15C>A" "r.(=)" "p.(=)" "64i" "0000337127" "00000065" "90" "640" "-1" "640" "-1" "c.640-1G>T" "r.spl?" "p.?" "4i" "0000337128" "00000065" "10" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(=)" "p.(=)" "23i" "0000337129" "00000065" "30" "3556" "-15" "3556" "-15" "c.3556-15T>G" "r.(=)" "p.(=)" "24i" "0000337130" "00000065" "10" "4523" "19" "4523" "19" "c.4523+19C>T" "r.(=)" "p.(=)" "31i" "0000337131" "00000065" "10" "6274" "4" "6274" "4" "c.6274+4C>T" "r.spl?" "p.?" "44i" "0000337133" "00000065" "10" "8548" "-10" "8548" "-10" "c.8548-10T>C" "r.(=)" "p.(=)" "60i" "0000337134" "00000065" "30" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(=)" "p.(=)" "64i" "0000337135" "00000065" "10" "9212" "-15" "9212" "-15" "c.9212-15C>A" "r.(=)" "p.(=)" "64i" "0000337136" "00000065" "10" "9426" "0" "9426" "0" "c.*57A>C" "r.(=)" "p.(=)" "65" "0000337137" "00000065" "10" "9487" "0" "9487" "0" "c.*118T>C" "r.(=)" "p.(=)" "65" "0000339381" "00000065" "10" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(Ile52=)" "2" "0000339382" "00000065" "10" "381" "0" "381" "0" "c.381C>A" "r.(?)" "p.(Thr127=)" "3" "0000339385" "00000065" "10" "1701" "0" "1701" "0" "c.1701C>T" "r.(?)" "p.(Ile567=)" "12" "0000339386" "00000065" "10" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(Gln933=)" "20" "0000339387" "00000065" "30" "2874" "0" "2874" "0" "c.2874A>G" "r.(?)" "p.(Leu958=)" "21" "0000339388" "00000065" "10" "4956" "0" "4956" "0" "c.4956C>G" "r.(?)" "p.(Thr1652=)" "34" "0000339389" "00000065" "10" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(Glu1822=)" "38" "0000339390" "00000065" "10" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(Glu1834=)" "38" "0000339391" "00000065" "10" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(Thr2079=)" "43" "0000339392" "00000065" "10" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(Val2610=)" "56" "0000339393" "00000065" "10" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(Pro2615=)" "56" "0000339394" "00000065" "10" "8028" "0" "8028" "0" "c.8028T>C" "r.(?)" "p.(Asn2676=)" "57" "0000340783" "00000065" "10" "8124" "0" "8124" "0" "c.8124T>A" "r.(?)" "p.(Gly2708=)" "58" "0000341480" "00000065" "50" "149" "0" "149" "0" "c.149C>T" "r.(?)" "p.(Ala50Val)" "2" "0000341852" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "27" "0000341871" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000341981" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549Ter)" "32" "0000342115" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826Ter)" "38" "0000342123" "00000065" "10" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "38" "0000342404" "00000065" "10" "7431" "0" "7431" "0" "c.7431A>T" "r.(?)" "p.(Arg2477Ser)" "52" "0000342458" "00000065" "90" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630Ter)" "56" "0000342893" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Ter)" "9" "0000343175" "00000065" "10" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000344393" "00000065" "50" "1330" "0" "1330" "0" "c.1330T>C" "r.(?)" "p.(Cys444Arg)" "10" "0000344408" "00000065" "10" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(Cys497=)" "11" "0000344647" "00000065" "30" "6161" "0" "6161" "0" "c.6161A>G" "r.(?)" "p.(Gln2054Arg)" "43" "0000344655" "00000065" "90" "6310" "0" "6310" "0" "c.6310C>T" "r.(?)" "p.(Gln2104Ter)" "45" "0000344764" "00000065" "90" "94" "0" "94" "0" "c.94C>T" "r.(?)" "p.(Gln32Ter)" "1" "0000345754" "00000065" "30" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000346260" "00000065" "50" "2254" "0" "2254" "0" "c.2254G>A" "r.(?)" "p.(Gly752Ser)" "16" "0000347283" "00000065" "50" "2054" "0" "2054" "0" "c.2054T>C" "r.(?)" "p.(Leu685Pro)" "14" "0000348823" "00000065" "50" "611" "0" "611" "0" "c.611C>T" "r.(?)" "p.(Ser204Phe)" "4" "0000349356" "00000065" "10" "6167" "0" "6167" "0" "c.6167C>A" "r.(?)" "p.(Thr2056Lys)" "43" "0000349396" "00000065" "10" "7906" "0" "7906" "0" "c.7906A>G" "r.(?)" "p.(Thr2636Ala)" "57" "0000349673" "00000065" "90" "327" "0" "327" "0" "c.327G>A" "r.(?)" "p.(Trp109Ter)" "3" "0000349700" "00000065" "90" "4688" "0" "4688" "0" "c.4688G>A" "r.(?)" "p.(Trp1563Ter)" "32" "0000349760" "00000065" "90" "8541" "0" "8541" "0" "c.8541G>A" "r.(?)" "p.(Trp2847Ter)" "60" "0000349975" "00000065" "90" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Tyr203Ter)" "4" "0000350247" "00000065" "10" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "24" "0000350353" "00000065" "90" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "37" "0000350879" "00000065" "10" "5071" "18" "5071" "18" "c.5071+18A>G" "r.(=)" "p.(=)" "35i" "0000350881" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "58i" "0000369877" "00000065" "50" "6706" "0" "6706" "0" "c.6706A>G" "r.(?)" "p.(Arg2236Gly)" "47" "0000369941" "00000065" "99" "283" "1" "283" "1" "c.(283+1G>A)" "r.spl" "p.(Val78_Gln132del)" "2i" "0000369942" "00000065" "99" "3718" "0" "3718" "0" "c.3718C>T" "r.(?)" "p.(Gln1240*)" "25" "0000369943" "00000065" "99" "4524" "-2" "4524" "-2" "c.4524-2A>T" "r.spl" "p.(Arg1509Serfs*5)" "31i" "0000369944" "00000065" "99" "2" "0" "2" "0" "c.2T>C" "r.(?)" "p.0?" "1" "0000369945" "00000065" "99" "82" "0" "82" "0" "c.82C>T" "r.(?)" "p.(Gln28*)" "1" "0000369946" "00000065" "99" "7490" "0" "7493" "0" "c.7490_7493dup" "r.(?)" "p.(Asp2498Glufs*4)" "54" "0000369948" "00000065" "55" "257" "0" "257" "0" "c.257G>A" "r.(?)" "p.(Cys86Tyr)" "2" "0000369949" "00000065" "99" "498" "0" "498" "0" "c.498G>A" "r.(?)" "p.(Trp166*)" "4" "0000369950" "00000065" "99" "628" "0" "628" "0" "c.628G>T" "r.(?)" "p.(Glu210*)" "4" "0000369951" "00000065" "99" "951" "0" "952" "0" "c.951_952dup" "r.(?)" "p.(Cys318Serfs*20)" "7" "0000369952" "00000065" "77" "1206" "2" "1206" "2" "c.1206+2T>G" "r.spl" "p.?" "8i" "0000369953" "00000065" "99" "1377" "0" "1377" "0" "c.1377del" "r.(?)" "p.(Tyr460Thrfs*15)" "10" "0000369954" "00000065" "99" "1490" "0" "1491" "0" "c.1490_1491del" "r.(?)" "p.(Cys497*)" "11" "0000369955" "00000065" "99" "1793" "0" "1795" "0" "c.1793_1795del" "r.(?)" "p.(Val598del)" "13" "0000369956" "00000065" "99" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621Hisfs*7)" "13" "0000369957" "00000065" "11" "1856" "0" "1856" "0" "c.1856G>A" "r.(?)" "p.(Arg619His)" "13" "0000369958" "00000065" "99" "1893" "0" "1897" "0" "c.1893_1897del" "r.(?)" "p.(Asp631Glufs*8)" "14" "0000369959" "00000065" "99" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000369960" "00000065" "99" "2178" "0" "2178" "0" "c.2178C>A" "r.(?)" "p.(Cys726*)" "15" "0000369961" "00000065" "99" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.[Arg744*, Ser737_Leu774del]" "16" "0000369962" "00000065" "99" "2369" "0" "2369" "0" "c.2369del" "r.(?)" "p.(Pro790Leufs*35)" "17" "0000369963" "00000065" "99" "2584" "0" "2584" "0" "c.2584T>C" "r.(?)" "p.(Cys862Arg)" "19" "0000369964" "00000065" "99" "2750" "-1" "2750" "-1" "c.2750-1G>A" "r.spl" "p.?" "19i" "0000369965" "00000065" "11" "2799" "0" "2799" "0" "c.2799A>G" "r.(?)" "p.(=)" "20" "0000369966" "00000065" "99" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "21" "0000369967" "00000065" "99" "2954" "0" "2954" "0" "c.2954G>A" "r.(?)" "p.(Cys985Tyr)" "21" "0000369968" "00000065" "99" "2962" "0" "2962" "0" "c.2962C>T" "r.(?)" "p.(Gln988*)" "21" "0000369969" "00000065" "99" "2986" "0" "2986" "0" "c.2986T>C" "r.(?)" "p.(Cys996Arg)" "21" "0000369970" "00000065" "99" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000369971" "00000065" "99" "3122" "0" "3122" "0" "c.3122del" "r.(?)" "p.(Cys1041Phefs*34)" "22" "0000369972" "00000065" "99" "3623" "0" "3645" "0" "c.3623_3645del" "r.(?)" "p.(Lys1208Argfs*27)" "25" "0000369973" "00000065" "77" "3924" "2" "3924" "2" "c.3924+2T>C" "r.spl?" "p.(Leu1246_Glu1308del)" "26i" "0000369974" "00000065" "99" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "27" "0000369975" "00000065" "99" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350*)" "27" "0000369976" "00000065" "77" "4059" "-2" "4059" "-2" "c.4059-2A>G" "r.spl" "p.?" "27i" "0000369977" "00000065" "99" "6993" "-2" "6993" "-2" "c.6993-2A>C" "r.spl" "p.?" "49i" "0000369978" "00000065" "99" "4309" "0" "4309" "0" "c.4309C>T" "r.(?)" "p.(Gln1437*)" "29" "0000369979" "00000065" "99" "4312" "-1" "4312" "-1" "c.4312-1G>C" "r.spl" "p.[=, Asn1438_Lys1460del]" "29i" "0000369980" "00000065" "99" "4638" "0" "4638" "0" "c.4638C>A" "r.(?)" "p.(Cys1546*)" "32" "0000369981" "00000065" "99" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.[Arg1549*, Cys1527_Val1572del]" "32" "0000369982" "00000065" "99" "4690" "0" "4690" "0" "c.4690C>T" "r.(?)" "p.(His1564Tyr)" "32" "0000369983" "00000065" "77" "4860" "5" "4860" "5" "c.4860+5G>A?" "r.(?)" "p.[Phe1573Serfs*49, Phe1573Cysfs*16, Phe1573_Ala1691delinsSer]" "33i" "0000369984" "00000065" "99" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "36" "0000369985" "00000065" "11" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(=)" "38" "0000369986" "00000065" "99" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826*)" "38" "0000369987" "00000065" "99" "5487" "0" "5488" "0" "c.5487_5488del" "r.(?)" "p.(Asn1830Hisfs*7)" "38" "0000369988" "00000065" "11" "5502" "0" "5502" "0" "c.5502G>A" "r.(?)" "p.(=)" "38" "0000369989" "00000065" "77" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.[Lys1816_Asp1854del, Tyr1855Valfs*24]" "38i" "0000369990" "00000065" "99" "5654" "0" "5654" "0" "c.5654del" "r.(?)" "p.(Lys1885Serfs*16)" "39" "0000369991" "00000065" "99" "5865" "1" "5865" "1" "c.5865+1del" "r.(?)" "p.(Ala1956Glnfs*8)" "40" "0000369992" "00000065" "11" "6237" "0" "6237" "0" "c.6237G>A" "r.(?)" "p.(=)" "43" "0000369993" "00000065" "99" "6867" "1" "6867" "1" "c.6867+1G>A" "r.spl" "p.?" "48i" "0000369994" "00000065" "99" "6919" "0" "6920" "0" "c.6919_6920del" "r.(?)" "p.(Tyr2307Leufs*2)" "49" "0000369995" "00000065" "99" "6948" "0" "6948" "0" "c.6948G>A" "r.(?)" "p.(Trp2316*)" "49" "0000369996" "00000065" "99" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319*)" "49" "0000369997" "00000065" "99" "6995" "0" "6995" "0" "c.6995del" "r.(?)" "p.(Pro2332Leufs*46)" "50" "0000369998" "00000065" "77" "7071" "0" "7071" "0" "c.7071G>A" "r.(?)" "p.(Trp2357*)" "50" "0000369999" "00000065" "99" "7074" "0" "7074" "0" "c.7074C>A" "r.(?)" "p.(Tyr2358*)" "50" "0000370000" "00000065" "99" "7377" "0" "7377" "0" "c.7377dup" "r.(?)" "p.(Leu2460Serfs*2)" "52" "0000370001" "00000065" "99" "7435" "0" "7436" "0" "c.7435_7436del" "r.(?)" "p.(Leu2479fs*21)" "52" "0000370002" "00000065" "99" "7658" "0" "7658" "0" "c.7658del" "r.(?)" "p.(Ser2553Tyrfs*35)" "55" "0000370003" "00000065" "77" "7691" "0" "7691" "0" "c.7691T>C" "r.(?)" "p.(Leu2564Pro)" "55" "0000370004" "00000065" "11" "3412" "0" "3412" "0" "c.3412G>A" "r.spl?" "p.(Val1138Met)" "24" "0000370005" "00000065" "11" "7760" "0" "7760" "0" "c.7760T>C" "r.(?)" "p.(Val2587Ala)" "56" "0000370006" "00000065" "99" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604*)" "56" "0000370007" "00000065" "11" "7830" "0" "7830" "0" "c.7830G>C" "r.(?)" "p.(=)" "56" "0000370008" "00000065" "99" "7881" "0" "7881" "0" "c.7881T>G" "r.(?)" "p.(His2627Gln)" "56" "0000370009" "00000065" "11" "7906" "0" "7906" "0" "c.7906A>G" "r.(?)" "p.(Thr2636Ala)" "57" "0000370010" "00000065" "99" "8265" "0" "8265" "0" "c.8265del" "r.(?)" "p.(Glu2756Asnfs*5)" "59" "0000370011" "00000065" "33" "9431" "0" "9434" "0" "c.*62_*65dup" "r.(?)" "p.(=)" "65" "0000370012" "00000065" "33" "8691" "0" "8691" "0" "c.8691A>G" "r.(?)" "p.(=)" "61" "0000370013" "00000065" "77" "283" "2" "283" "2" "c.283+2del" "r.spl" "p.?" "2i" "0000370014" "00000065" "11" "8245" "-159" "8245" "-159" "c.8245-159A>G" "r.(?)" "p.(=)" "58i" "0000370015" "00000065" "11" "9211" "74" "9211" "74" "c.9211+74G>A" "r.(?)" "p.(=)" "64i" "0000370016" "00000065" "11" "9487" "0" "9487" "0" "c.*118T>C" "r.(?)" "p.(=)" "65" "0000370017" "00000065" "99" "9101" "0" "9104" "0" "c.9101_9104dup" "r.(?)" "p.(His3035Glnfs*5)" "64" "0000370018" "00000065" "99" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085*)" "65" "0000370019" "00000065" "99" "640" "-1" "1782" "1" "c.(639+1_640-1)_(1782+1_1873-1)dup" "r.spl" "p.?" "4i_12i" "0000370020" "00000065" "99" "1798" "0" "1800" "0" "c.1798_1800del" "r.(?)" "p.(Gly600del)" "13" "0000370021" "00000065" "99" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383*), p.Arg2383*" "50" "0000370022" "00000065" "11" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(=)" "11" "0000370023" "00000065" "99" "112" "3" "112" "3" "c.112+3A>G" "r.spl?" "p.?" "1i" "0000370024" "00000065" "99" "1207" "-1" "1207" "-1" "c.1207-1G>C" "r.spl" "p.?" "8i" "0000370025" "00000065" "99" "4280" "0" "4280" "0" "c.4280del" "r.(?)" "p.(Ser1427Thrfs*47)" "29" "0000370026" "00000065" "11" "1634" "0" "1634" "0" "c.1634T>A" "r.(?)" "p.(Leu545Gln)" "12" "0000370027" "00000065" "33" "2756" "0" "2756" "0" "c.2756G>T" "r.(?)" "p.(Arg919Leu)" "20" "0000370028" "00000065" "11" "7845" "0" "7845" "0" "c.7845G>A" "r.(?)" "p.(=)" "56" "0000370029" "00000065" "11" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "13" "0000370030" "00000065" "11" "4956" "0" "4956" "0" "c.4956C>G" "r.(?)" "p.(=)" "34" "0000370031" "00000065" "33" "7620" "0" "7620" "0" "c.7620C>G" "r.(?)" "p.(=)" "55" "0000370032" "00000065" "11" "981" "0" "981" "0" "c.981G>A" "r.(?)" "p.(=)" "7" "0000370033" "00000065" "11" "1182" "0" "1182" "0" "c.1182T>A" "r.(?)" "p.(=)" "8" "0000370034" "00000065" "33" "2235" "0" "2235" "0" "c.2235T>A" "r.(?)" "p.(=)" "16" "0000370035" "00000065" "33" "2295" "0" "2295" "0" "c.2295C>A" "r.(?)" "p.(=)" "16" "0000370036" "00000065" "33" "2550" "0" "2550" "0" "c.2550C>G" "r.(?)" "p.(=)" "19" "0000370037" "00000065" "33" "2631" "0" "2631" "0" "c.2631C>G" "r.(?)" "p.(=)" "19" "0000370038" "00000065" "33" "3039" "0" "3039" "0" "c.3039T>G" "r.(?)" "p.(=)" "22" "0000370039" "00000065" "33" "3099" "0" "3099" "0" "c.3099T>A" "r.(?)" "p.(=)" "22" "0000370040" "00000065" "33" "6153" "0" "6153" "0" "c.6153A>T" "r.(?)" "p.(=)" "43" "0000370041" "00000065" "33" "6459" "0" "6459" "0" "c.6459C>T" "r.(?)" "p.(=)" "46" "0000370042" "00000065" "33" "7395" "0" "7395" "0" "c.7395T>C" "r.(?)" "p.=" "52" "0000370043" "00000065" "33" "7614" "0" "7614" "0" "c.7614G>A" "r.(?)" "p.(=)" "55" "0000370044" "00000065" "55" "7840" "0" "7840" "0" "c.7840G>A" "r.(?)" "p.(Glu2614Lys)" "56" "0000370045" "00000065" "55" "7756" "0" "7756" "0" "c.7756T>C" "r.(?)" "p.(Tyr2586His)" "56" "0000370046" "00000065" "99" "3175" "-1" "7898" "1" "c.(3174+1_3175-1)_(7898+1_7899-1)del" "r.spl" "p.?" "22i_56i" "0000370047" "00000065" "99" "3215" "0" "3215" "0" "c.3215del" "r.(?)" "p.(Cys1072Serfs*3)" "23" "0000370048" "00000065" "11" "381" "0" "381" "0" "c.381C>A" "r.(?)" "p.(=)" "3" "0000370049" "00000065" "33" "411" "0" "411" "0" "c.411G>A" "r.(?)" "p.(=)" "4" "0000370050" "00000065" "11" "846" "0" "846" "0" "c.846A>T" "r.(?)" "p.(=)" "6" "0000370051" "00000065" "11" "1076" "0" "1076" "0" "c.1076T>C" "r.(?)" "p.(Val359Ala)" "8" "0000370052" "00000065" "11" "1419" "0" "1419" "0" "c.1419G>A" "r.(?)" "p.(=)" "10" "0000370053" "00000065" "55" "2054" "0" "2054" "0" "c.2054T>C" "r.(?)" "p.(Leu685Pro)" "14" "0000370054" "00000065" "33" "2576" "0" "2576" "0" "c.2576G>T" "r.(?)" "p.(Gly859Val)" "19" "0000370055" "00000065" "99" "5006" "0" "5006" "0" "c.5006del" "r.(?)" "p.(Glu1669Glyfs*24)" "35" "0000370056" "00000065" "55" "1884" "0" "1884" "0" "c.1884G>A" "r.(?)" "p.(Glu628=)" "13" "0000370057" "00000065" "33" "3719" "0" "3719" "0" "c.3719A>T" "r.(?)" "p.(Gln1240Leu)" "25" "0000370058" "00000065" "33" "3930" "0" "3930" "0" "c.3930A>G" "r.(?)" "p.(=)" "27" "0000370059" "00000065" "33" "4407" "0" "4407" "0" "c.4407T>C" "r.(?)" "p.(=)" "30" "0000370060" "00000065" "33" "4446" "0" "4446" "0" "c.4446C>T" "r.(?)" "p.(=)" "31" "0000370061" "00000065" "33" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "33" "0000370062" "00000065" "33" "5382" "0" "5382" "0" "c.5382A>T" "r.(?)" "p.(=)" "37" "0000370063" "00000065" "33" "5714" "0" "5714" "0" "c.5714C>G" "r.(?)" "p.(Ala1905Gly)" "39" "0000370064" "00000065" "33" "6450" "0" "6450" "0" "c.6450A>T" "r.(?)" "p.(=)" "46" "0000370065" "00000065" "33" "7661" "0" "7661" "0" "c.7661T>C" "r.(?)" "p.(Phe2554Ser)" "55" "0000370066" "00000065" "33" "7929" "0" "7929" "0" "c.7929A>G" "r.(?)" "p.=" "57" "0000370067" "00000065" "33" "8124" "0" "8124" "0" "c.8124T>A" "r.(?)" "p.(=)" "58" "0000370068" "00000065" "33" "8586" "0" "8586" "0" "c.8586T>C" "r.(?)" "p.(=)" "61" "0000370069" "00000065" "33" "8925" "0" "8925" "0" "c.8925A>T" "r.(?)" "p.(=)" "63" "0000370070" "00000065" "99" "1580" "0" "1580" "0" "c.1580G>A" "r.(?)" "p.(Cys527Tyr)" "11" "0000370071" "00000065" "99" "5562" "5" "5562" "5" "c.5562+5G>A" "r.spl" "p.[=, Lys1816_Asp1854del, Tyr1855Valfs*24]" "38i" "0000370072" "00000065" "99" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581Profs*5)" "33" "0000370073" "00000065" "99" "3832" "0" "3832" "0" "c.3832G>T" "r.(?)" "p.(Ala1278Ser)" "26" "0000370074" "00000065" "99" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Gln95*)" "2" "0000370075" "00000065" "99" "1669" "0" "1669" "0" "c.1669C>T" "r.(?)" "p.(Gln557*)" "12" "0000370076" "00000065" "99" "825" "0" "825" "0" "c.825del" "r.(?)" "p.(Tyr276Thrfs*61)" "6" "0000370077" "00000065" "99" "4861" "0" "4861" "0" "c.4861del" "r.(?)" "p.(His1621Thrfs*20)" "34" "0000370078" "00000065" "99" "8007" "0" "8007" "0" "c.8007del" "r.(?)" "p.(Gln2670Asnfs*58)" "57" "0000370079" "00000065" "99" "4375" "0" "4375" "0" "c.4375del" "r.(?)" "p.(Val1459Serfs*15)" "30" "0000370080" "00000065" "99" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "25" "0000370081" "00000065" "99" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566Cysfs*13)" "32" "0000370082" "00000065" "99" "500" "0" "500" "0" "c.500A>C" "r.(?)" "p.(Gln167Pro)" "4" "0000370083" "00000065" "99" "8075" "1" "8075" "2" "c.8075+1_8075+2del" "r.spl" "p.(Val2692Profs*14)" "57i" "0000370084" "00000065" "99" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578*)" "55" "0000370085" "00000065" "99" "4318" "0" "4318" "0" "c.4318C>T" "r.(?)" "p.(Gln1440*)" "30" "0000370086" "00000065" "99" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "36i" "0000370087" "00000065" "99" "7750" "-1713" "7899" "-2154" "c.7750-1713_7899-2154del" "r.(?)" "p.(Ala2584Hisfs*8)" "55i_56i" "0000370088" "00000065" "99" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl" "p.?" "58i" "0000370089" "00000065" "99" "8776" "0" "8792" "0" "c.8776_8792del" "r.(?)" "p.(Thr2926Trpfs*14)" "62" "0000370090" "00000065" "99" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121*)" "3" "0000370091" "00000065" "11" "156" "0" "156" "0" "c.156C>T" "r.(?)" "p.(=)" "2" "0000370092" "00000065" "11" "284" "-131" "284" "-131" "c.284-131C>T" "r.(?)" "p.(=)" "2i" "0000370093" "00000065" "11" "284" "-85" "284" "-85" "c.284-85delinsGG" "r.(?)" "p.(=)" "2i" "0000370094" "00000065" "11" "819" "197" "819" "197" "c.819+197G>A" "r.(?)" "p.(=)" "5i" "0000370095" "00000065" "11" "909" "95" "909" "95" "c.909+95A>T" "r.(?)" "p.(=)" "6i" "0000370096" "00000065" "11" "1306" "93" "1306" "93" "c.1306+93T>C" "r.(?)" "p.(=)" "9i" "0000370097" "00000065" "11" "2208" "42" "2208" "42" "c.2208+42C>T" "r.(?)" "p.(=)" "15i" "0000370098" "00000065" "11" "3037" "140" "3037" "140" "c.3037+140G>A" "r.(?)" "p.(=)" "21i" "0000370099" "00000065" "11" "3038" "-295" "3038" "-295" "c.3038-295A>G" "r.(?)" "p.(=)" "21i" "0000370100" "00000065" "11" "3038" "-156" "3038" "-156" "c.3038-156A>G" "r.(?)" "p.(=)" "21i" "0000370101" "00000065" "33" "3135" "0" "3135" "0" "c.3135A>G" "r.(?)" "p.(=)" "22" "0000370102" "00000065" "11" "3174" "38" "3174" "38" "c.3174+38A>G" "r.(?)" "p.(=)" "22i" "0000370103" "00000065" "11" "3411" "13" "3411" "13" "c.3411+13G>A" "r.(?)" "p.(=)" "23i" "0000370104" "00000065" "11" "3556" "-189" "3556" "-189" "c.3556-189C>G" "r.(?)" "p.(=)" "24i" "0000370105" "00000065" "33" "4177" "-73" "4177" "-73" "c.4177-73C>T" "r.(?)" "p.(=)" "28i" "0000370106" "00000065" "11" "4312" "-217" "4312" "-217" "c.4312-217T>C" "r.(?)" "p.(=)" "29i" "0000370107" "00000065" "33" "4524" "-247" "4524" "-247" "c.4524-247A>G" "r.(?)" "p.(=)" "31i" "0000370108" "00000065" "33" "4861" "-55" "4861" "-55" "c.4861-55A>G" "r.(?)" "p.(=)" "33i" "0000370109" "00000065" "11" "5727" "-24" "5727" "-21" "c.5727-24_5727-21delinsACTG" "r.(?)" "p.(=)" "39i" "0000370110" "00000065" "33" "5865" "175" "5865" "175" "c.5865+175A>C" "r.(?)" "p.(=)" "40i" "0000370111" "00000065" "33" "6268" "77" "6268" "77" "c.6268+77C>T" "r.(?)" "p.(=)" "43i" "0000370112" "00000065" "11" "6707" "37" "6707" "37" "c.6707+37T>C" "r.(?)" "p.(=)" "47i" "0000370113" "00000065" "11" "6708" "-98" "6708" "-98" "c.6708-98C>T" "r.(?)" "p.(=)" "47i" "0000370114" "00000065" "11" "6868" "-153" "6868" "-153" "c.6868-153C>A" "r.(?)" "p.(=)" "48i" "0000370115" "00000065" "11" "6993" "-44" "6993" "-44" "c.6993-44T>C" "r.(?)" "p.(=)" "49i" "0000370116" "00000065" "11" "7750" "-136" "7750" "-136" "c.7750-136C>G" "r.(?)" "p.(=)" "55i" "0000370117" "00000065" "11" "7898" "102" "7898" "102" "c.7898+102C>A" "r.(?)" "p.(=)" "56i" "0000370118" "00000065" "33" "8076" "-24" "8076" "-24" "c.8076-24dup" "r.(?)" "p.(=)" "57i" "0000370119" "00000065" "77" "3472" "0" "3472" "0" "c.3472A>T" "r.(?)" "p.(Lys1158*)" "24" "0000370120" "00000065" "99" "1762" "0" "1762" "0" "c.1762del" "r.(?)" "p.(Ala588Leufs*11)" "12" "0000370121" "00000065" "99" "2450" "5" "2450" "11" "c.2450+5_2450+11del" "r.spl?" "p.?" "17i" "0000370122" "00000065" "99" "2538" "-1" "2538" "-1" "c.2538-1G>C" "r.spl" "p.?" "18i" "0000370123" "00000065" "55" "2857" "-48" "2857" "-48" "c.2857-48C>G" "r.(?)" "p.(?)" "20i" "0000370124" "00000065" "77" "2749" "1" "2749" "1" "c.2749+1G>A" "r.spl" "p.?" "19i" "0000370125" "00000065" "99" "1177" "0" "1177" "0" "c.1177T>G" "r.(?)" "p.(Cys393Gly)" "8" "0000370126" "00000065" "11" "3175" "-32" "3175" "-31" "c.3175-32_3175-31del" "r.(?)" "p.(=)" "22i" "0000370127" "00000065" "99" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267Aspfs*11)" "26" "0000370128" "00000065" "99" "35" "0" "35" "0" "c.35T>G" "r.(?)" "p.(Leu12Arg)" "1" "0000370129" "00000065" "77" "7297" "0" "7297" "0" "c.7297C>T" "r.(?)" "p.(Gln2433*)" "51" "0000370130" "00000065" "99" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080Asnfs*26)" "65" "0000370131" "00000065" "99" "412" "0" "412" "0" "c.412T>C" "r.(?)" "p.(Tyr138His)" "4" "0000370132" "00000065" "99" "8613" "0" "8613" "0" "c.8613dup" "r.(?)" "p.(Ser2872Glnfs*34)" "61" "0000370133" "00000065" "99" "5259" "0" "5259" "0" "c.5259del" "r.(?)" "p.(Val1754*)" "37" "0000370134" "00000065" "55" "5072" "-6" "5072" "-6" "c.5072-6del" "r.(?)" "p.(=)" "35i" "0000370135" "00000065" "77" "4941" "0" "4941" "0" "c.4941del" "r.(?)" "p.(Met1647Ilefs*5)" "34" "0000370136" "00000065" "99" "6488" "0" "6488" "0" "c.6488del" "r.(?)" "p.(Lys2163Argfs*12)" "46" "0000370137" "00000065" "11" "3174" "22" "3174" "23" "c.3174+22_3174+23insAT" "r.(?)" "p.(=)" "22i" "0000370138" "00000065" "77" "5182" "0" "5182" "0" "c.5182del" "r.(?)" "p.(Leu1728*)" "36" "0000370139" "00000065" "33" "7681" "0" "7681" "0" "c.7681G>A" "r.(?)" "p.(Gly2561Ser)" "55" "0000370140" "00000065" "55" "1326" "0" "1326" "0" "c.1326T>G" "r.(?)" "p.(Cys442Trp)" "10" "0000370141" "00000065" "99" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "58i" "0000370142" "00000065" "77" "94" "0" "94" "0" "c.94C>T" "r.(?)" "p.(Gln32*)" "1" "0000370143" "00000065" "77" "5998" "0" "5998" "0" "c.5998del" "r.(?)" "p.(Thr2000Profs*3)" "42" "0000370144" "00000065" "55" "1884" "50" "1884" "50" "c.1884+50A>C" "r.(?)" "p.(=)" "13i" "0000370145" "00000065" "99" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450*)" "30" "0000370146" "00000065" "99" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000370147" "00000065" "99" "396" "1" "396" "1" "c.396+1G>T" "r.spl" "p.?" "3i" "0000370148" "00000065" "55" "745" "0" "745" "0" "c.745C>T" "r.(?)" "p.(Arg249Cys)" "5" "0000370149" "00000065" "33" "4312" "-19" "4312" "-17" "c.4312-19_4312-17del" "r.(?)" "p.(=)" "29i" "0000370150" "00000065" "99" "8669" "0" "8669" "0" "c.8669dup" "r.(?)" "p.(Leu2890Phefs*16)" "61" "0000370151" "00000065" "55" "6706" "0" "6706" "0" "c.6706A>C" "r.(?)" "p.(=)" "47" "0000370152" "00000065" "99" "6266" "0" "6266" "0" "c.6266del" "r.(?)" "p.(Asn2089Thrfs*14)" "43" "0000370153" "00000065" "99" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "7" "0000370154" "00000065" "55" "1782" "10" "1782" "10" "c.1782+10C>T" "r.(?)" "p.(=)" "12i" "0000370155" "00000065" "11" "3037" "49" "3037" "49" "c.3037+49G>A" "r.(?)" "p.(=)" "21i" "0000370156" "00000065" "99" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400*)" "29" "0000370157" "00000065" "99" "1976" "0" "1976" "0" "c.1976C>A" "r.(?)" "p.(Ser659*)" "14" "0000370158" "00000065" "99" "8357" "1" "8357" "1" "c.8357+1G>A" "r.spl" "p.?" "59i" "0000370159" "00000065" "77" "8665" "0" "8665" "0" "c.8665G>A" "r.(?)" "p.(Gly2889Arg)" "61" "0000370160" "00000065" "77" "6207" "0" "6207" "0" "c.6207C>A" "r.(?)" "p.(Tyr2069*)" "43" "0000370161" "00000065" "77" "3338" "0" "3345" "0" "c.3338_3345dup" "r.(?)" "p.(Thr1116Glnfs*26)" "23" "0000370162" "00000065" "55" "7451" "37" "7451" "37" "c.7451+37A>G" "r.(?)" "p.(=)" "52i" "0000370163" "00000065" "55" "4654" "0" "4654" "0" "c.4654G>A" "r.(?)" "p.(Ala1552Thr)" "32" "0000370164" "00000065" "77" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277*)" "26" "0000370165" "00000065" "55" "8858" "-8" "8858" "-8" "c.8858-8T>G" "r.(?)" "p.(=)" "62i" "0000370166" "00000065" "99" "5325" "0" "5325" "0" "c.5325dup" "r.(?)" "p.(Leu1776Thrfs*3)" "37" "0000370167" "00000065" "99" "47" "0" "47" "0" "c.47del" "r.(?)" "p.(Gly16Alafs*29)" "1" "0000370168" "00000065" "77" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl" "p.?" "6i" "0000370169" "00000065" "77" "164" "0" "164" "0" "c.164del" "r.(?)" "p.(Asn55Metfs*16)" "2" "0000370170" "00000065" "77" "6588" "0" "6588" "0" "c.6588dup" "r.(?)" "p.(Ile2197Tyrfs*5)" "47" "0000370171" "00000065" "55" "7571" "0" "7571" "0" "c.7571A>T" "r.(?)" "p.(Glu2524Val)" "54" "0000370172" "00000065" "77" "8244" "1" "8244" "1" "c.8244+1G>C" "r.spl" "p.?" "58i" "0000370173" "00000065" "77" "5072" "-1454" "5154" "0" "c.5072-1454_5154delinsAGATTGCC" "r.spl" "p.?" "35i_36" "0000370174" "00000065" "55" "2370" "0" "2370" "0" "c.2370T>A" "r.(?)" "p.(=)" "17" "0000370175" "00000065" "77" "2383" "0" "2383" "0" "c.2383G>T" "r.(?)" "p.(Glu795*)" "17" "0000370176" "00000065" "77" "4761" "0" "4761" "0" "c.4761dup" "r.(?)" "p.(Arg1588Serfs*20)" "33" "0000370177" "00000065" "55" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273Lys)" "5" "0000370178" "00000065" "55" "6548" "0" "6548" "0" "c.6548T>G" "r.(?)" "p.(Leu2183Arg)" "46" "0000370179" "00000065" "77" "6429" "1" "6429" "1" "c.6429+1G>T" "r.(?)" "p.?" "45i" "0000370180" "00000065" "99" "4049" "0" "4049" "0" "c.4049del" "r.(?)" "p.(Arg1350Hisfs*12)" "27" "0000370181" "00000065" "99" "8988" "1" "8988" "1" "c.8988+1G>A" "r.spl" "p.?" "63i" "0000370182" "00000065" "99" "1027" "3" "1027" "3" "c.1027+3A>G" "r.spl?" "p.?" "7i" "0000370183" "00000065" "99" "7898" "1" "7898" "1" "c.7898+1G>T" "r.spl" "p.?" "56i" "0000370184" "00000065" "99" "2556" "0" "2556" "0" "c.2556del" "r.(?)" "p.(Phe852Leufs*36)" "19" "0000370185" "00000065" "99" "3294" "0" "3294" "0" "c.3294del" "r.(?)" "p.(Trp1098*)" "23" "0000370186" "00000065" "99" "3651" "0" "3651" "0" "c.3651del" "r.(?)" "p.(Ile1217Metfs*7)" "25" "0000370187" "00000065" "99" "3768" "0" "3771" "0" "c.3768_3771dup" "r.(?)" "p.(Tyr1258Asnfs*15)" "26" "0000370188" "00000065" "99" "7439" "1" "7439" "1" "c.7439+1G>A" "r.spl" "p.?" "52i" "0000370189" "00000065" "99" "4035" "0" "4035" "0" "c.4035T>G" "r.(?)" "p.(Tyr1345*)" "27" "0000370190" "00000065" "99" "4775" "0" "4775" "0" "c.4775dup" "r.(?)" "p.(Met1592Ilefs*16)" "33" "0000370191" "00000065" "99" "4852" "0" "4852" "0" "c.4852G>T" "r.(?)" "p.(Glu1618*)" "33" "0000370192" "00000065" "99" "5290" "0" "5290" "0" "c.5290dup" "r.(?)" "p.(Glu1764Glyfs*3)" "37" "0000370193" "00000065" "99" "5550" "0" "5562" "8" "c.5550_5562+8delinsG" "r.spl" "p.?" "38" "0000370194" "00000065" "99" "1783" "-19594" "5445" "1681" "c.1783-19594_5445+1681del" "r.(?)" "p.?" "12i_37i" "0000370195" "00000065" "99" "6993" "0" "6999" "0" "c.6993_6999del" "r.(?)" "p.(Ser2331Argfs*45)" "50" "0000370196" "00000065" "99" "2450" "1" "2450" "1" "c.2450+1G>C" "r.spl" "p.?" "17i" "0000370197" "00000065" "99" "112" "1" "112" "1" "c.112+1G>A" "r.spl" "p.?" "1i" "0000370198" "00000065" "99" "283" "1" "283" "1" "c.283+1G>A" "r.spl" "p.?" "2i" "0000370199" "00000065" "99" "391" "0" "391" "0" "c.391C>T" "r.(?)" "p.(Gln131*)" "3" "0000370200" "00000065" "99" "470" "0" "470" "0" "c.470C>T" "r.(?)" "p.(Ser157Phe)" "4" "0000370201" "00000065" "99" "1207" "-1" "1207" "-1" "c.1207-1G>A" "r.spl" "p.?" "8i" "0000370202" "00000065" "99" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "9" "0000370203" "00000065" "99" "1307" "-2" "1307" "-2" "c.1307-2A>G" "r.spl" "p.?" "9i" "0000370204" "00000065" "99" "2208" "2" "2208" "2" "c.2208+2T>C" "r.spl?" "p.?" "15i" "0000370205" "00000065" "55" "855" "0" "855" "0" "c.855G>T" "r.(?)" "p.(Gly285=)" "6" "0000370206" "00000065" "11" "1206" "11" "1206" "11" "c.1206+11C>T" "r.(?)" "p.(=)" "8i" "0000370207" "00000065" "55" "6708" "-16" "6708" "-16" "c.6708-16A>G" "r.(?)" "p.(=)" "47i" "0000370208" "00000065" "99" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273*)" "5" "0000370209" "00000065" "55" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(?)" "p.(=)" "64i" "0000370210" "00000065" "99" "4524" "-2" "4524" "-2" "c.4524-2A>G" "r.spl" "p.(Arg1509Serfs*5)" "31i" "0000370211" "00000065" "77" "639" "2" "639" "2" "c.639+2T>A" "r.spl" "p.?" "4i" "0000370212" "00000065" "77" "6690" "0" "6690" "0" "c.6690C>A" "r.(?)" "p.(Tyr2230*)" "47" "0000370213" "00000065" "77" "1823" "0" "1824" "0" "c.1823_1824del" "r.(?)" "p.(Tyr608*)" "13" "0000370214" "00000065" "99" "4523" "0" "4523" "0" "c.4523G>A" "r.spl?" "p.(Arg1508Lys)" "31" "0000370215" "00000065" "55" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Ser146Phe)" "4" "0000370216" "00000065" "99" "8443" "0" "8450" "0" "c.8443_8450del" "r.(?)" "p.(Thr2815Alafs*11)" "60" "0000370217" "00000065" "11" "1307" "-115" "1307" "-115" "c.1307-115A>C" "r.(?)" "p.(=)" "9i" "0000370218" "00000065" "11" "1468" "-122" "1468" "-122" "c.1468-122G>A" "r.(?)" "p.(=)" "10i" "0000370219" "00000065" "77" "9095" "0" "9095" "0" "c.9095dup" "r.(?)" "p.(Ile3033Aspfs*6)" "64" "0000370220" "00000065" "33" "7749" "80" "7749" "80" "c.7749+80C>T" "r.(?)" "p.(=)" "55i" "0000370221" "00000065" "33" "7749" "132" "7749" "132" "c.7749+132A>T" "r.(?)" "p.(=)" "55i" "0000370222" "00000065" "33" "7750" "-87" "7750" "-87" "c.7750-87C>T" "r.(?)" "p.(=)" "55i" "0000370223" "00000065" "33" "7898" "178" "7898" "178" "c.7898+178C>T" "r.(?)" "p.(=)" "56i" "0000370224" "00000065" "33" "8245" "-193" "8245" "-193" "c.8245-193T>C" "r.(?)" "p.(=)" "58i" "0000370225" "00000065" "99" "2907" "0" "2907" "0" "c.2907C>A" "r.(?)" "p.(Cys969*)" "21" "0000370226" "00000065" "99" "850" "0" "850" "0" "c.850G>A" "r.(?)" "p.(Gly284Arg)" "6" "0000370227" "00000065" "99" "728" "0" "728" "0" "c.728T>C" "r.(?)" "p.(Leu243Pro)" "5" "0000370228" "00000065" "99" "4860" "2" "4860" "2" "c.4860+2delinsGGCC" "r.spl" "p.(Phe1573Serfs*49)" "33i" "0000370229" "00000065" "99" "7431" "0" "7431" "0" "c.7431A>T" "r.(?)" "p.(Arg2477Ser)" "52" "0000370230" "00000065" "99" "397" "-13" "398" "0" "c.397-13_398del" "r.(?)" "p.(Val133Argfs*5)" "3i_4" "0000370231" "00000065" "99" "454" "0" "454" "0" "c.454T>G" "r.(?)" "p.(Trp152Gly)" "4" "0000370232" "00000065" "77" "7491" "0" "7491" "0" "c.7491del" "r.(?)" "p.(Asp2498Ilefs*49)" "54" "0000370233" "00000065" "99" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "18" "0000370234" "00000065" "99" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.spl" "p.?" "58i" "0000370235" "00000065" "77" "2017" "0" "2017" "0" "c.2017G>T" "r.(?)" "p.(Glu673*)" "14" "0000370236" "00000065" "77" "2023" "0" "2024" "0" "c.2023_2024del" "r.(?)" "p.(Met675Aspfs*29)" "14" "0000370237" "00000065" "55" "1609" "-41" "1609" "-7" "c.1609-41_1609-7inv" "r.(?)" "p.(=)" "11i" "0000370238" "00000065" "77" "3154" "0" "3154" "0" "c.3154A>G" "r.(?)" "p.(Ser1052Gly)" "22" "0000370239" "00000065" "55" "4960" "-17" "4960" "-17" "c.4960-17C>A" "r.(?)" "p.(=)" "34i" "0000370240" "00000065" "77" "991" "0" "991" "0" "c.991A>T" "r.(?)" "p.(Arg331*)" "7" "0000370241" "00000065" "99" "6617" "0" "6617" "0" "c.6617del" "r.(?)" "p.(Phe2206Serfs*12)" "47" "0000370242" "00000065" "99" "3560" "0" "3569" "0" "c.3560_3569del" "r.(?)" "p.(Thr1187Metfs*9)" "25" "0000370243" "00000065" "99" "4002" "0" "4002" "0" "c.4002T>G" "r.(?)" "p.(Tyr1334*)" "27" "0000370244" "00000065" "55" "112" "0" "112" "0" "c.112G>A" "r.spl?" "p.(Gly38Ser)" "1" "0000370245" "00000065" "77" "2538" "-1" "2538" "-1" "c.2538-1G>A" "r.spl" "p.?" "18i" "0000370246" "00000065" "77" "3735" "2" "3735" "2" "c.3735+2T>A" "r.spl" "p.?" "25i" "0000370247" "00000065" "99" "7572" "1" "7572" "1" "c.7572+1G>A" "r.spl" "p.?" "54i" "0000370248" "00000065" "55" "-17" "0" "-17" "0" "c.-17del" "r.(?)" "p.(=)" "1" "0000370249" "00000065" "77" "184" "0" "184" "0" "c.184G>T" "r.(?)" "p.(Gly62*)" "2" "0000370250" "00000065" "11" "397" "-15" "397" "-15" "c.397-15G>A" "r.(?)" "p.(=)" "3i" "0000370251" "00000065" "55" "533" "0" "533" "0" "c.533C>T" "r.(?)" "p.(Thr178Met)" "4" "0000370252" "00000065" "11" "640" "-26" "640" "-26" "c.640-26G>A" "r.(?)" "p.(=)" "4i" "0000370253" "00000065" "55" "675" "0" "675" "0" "c.675C>T" "r.(?)" "p.(=)" "5" "0000370254" "00000065" "99" "713" "0" "713" "0" "c.713C>A" "r.(?)" "p.(Ala238Asp)" "5" "0000370255" "00000065" "99" "830" "0" "830" "0" "c.830C>T" "r.(?)" "p.(Ser277Leu)" "6" "0000370256" "00000065" "55" "1403" "0" "1403" "0" "c.1403C>G" "r.(?)" "p.(Ala468Gly)" "10" "0000370257" "00000065" "33" "1533" "0" "1533" "0" "c.1533T>C" "r.(?)" "p.(=)" "11" "0000370258" "00000065" "77" "1612" "0" "1612" "0" "c.1612C>T" "r.(?)" "p.(Gln538*)" "12" "0000370259" "00000065" "55" "1701" "0" "1701" "0" "c.1701C>T" "r.(?)" "p.(=)" "12" "0000370260" "00000065" "55" "2084" "0" "2084" "0" "c.2084A>T" "r.(?)" "p.(Asp695Val)" "14" "0000370261" "00000065" "55" "2177" "0" "2177" "0" "c.2177G>A" "r.(?)" "p.(Cys726Tyr)" "15" "0000370262" "00000065" "11" "2749" "34" "2749" "34" "c.2749+34T>C" "r.(?)" "p.(=)" "19i" "0000370263" "00000065" "33" "2857" "-39" "2857" "-39" "c.2857-39T>C" "r.(?)" "p.(=)" "20i" "0000370264" "00000065" "77" "3237" "0" "3237" "0" "c.3237C>A" "r.(?)" "p.(Cys1079*)" "23" "0000370265" "00000065" "33" "3613" "0" "3613" "0" "c.3613A>G" "r.(?)" "p.(Thr1205Ala)" "25" "0000370266" "00000065" "77" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "31" "0000370267" "00000065" "33" "4523" "19" "4523" "19" "c.4523+19C>T" "r.(?)" "p.(=)" "31i" "0000370268" "00000065" "33" "5071" "18" "5071" "18" "c.5071+18A>G" "r.(?)" "p.(=)" "35i" "0000370269" "00000065" "55" "5247" "0" "5247" "0" "c.5247C>T" "r.(?)" "p.(=)" "37" "0000370270" "00000065" "55" "5280" "0" "5280" "0" "c.5280G>A" "r.(?)" "p.(=)" "37" "0000370271" "00000065" "55" "5614" "0" "5614" "0" "c.5614G>T" "r.(?)" "p.(Asp1872Tyr)" "39" "0000370272" "00000065" "77" "5706" "0" "5712" "0" "c.5706_5712del" "r.(?)" "p.(Asp1902Glufs*60)" "39" "0000370273" "00000065" "33" "5726" "39" "5726" "39" "c.5726+39T>C" "r.(?)" "p.(=)" "39i" "0000370274" "00000065" "11" "5727" "-24" "5727" "-24" "c.5727-24T>A" "r.(?)" "p.(=)" "39i" "0000370275" "00000065" "11" "5727" "-22" "5727" "-22" "c.5727-22C>T" "r.(?)" "p.(=)" "39i" "0000370276" "00000065" "11" "5727" "-21" "5727" "-21" "c.5727-21T>G" "r.(?)" "p.(=)" "39i" "0000370277" "00000065" "33" "5968" "28" "5968" "28" "c.5968+28T>A" "r.(?)" "p.(=)" "41i" "0000370278" "00000065" "77" "6011" "0" "6011" "0" "c.6011del" "r.(?)" "p.(Asn2004Metfs*10)" "42" "0000370279" "00000065" "77" "6038" "0" "6038" "0" "c.6038del" "r.(?)" "p.(Leu2013*)" "42" "0000370280" "00000065" "33" "6086" "-40" "6086" "-40" "c.6086-40C>G" "r.(?)" "p.(=)" "42i" "0000370281" "00000065" "33" "6150" "0" "6150" "0" "c.6150T>C" "r.(?)" "p.(=)" "43" "0000370282" "00000065" "33" "6167" "0" "6167" "0" "c.6167C>A" "r.(?)" "p.(Thr2056Lys)" "43" "0000370283" "00000065" "33" "6234" "0" "6234" "0" "c.6234A>G" "r.(?)" "p.(=)" "43" "0000370284" "00000065" "33" "6274" "4" "6274" "4" "c.6274+4C>T" "r.spl?" "p.?" "44i" "0000370285" "00000065" "33" "6274" "24" "6274" "24" "c.6274+24C>T" "r.(?)" "p.(=)" "44i" "0000370286" "00000065" "33" "6274" "47" "6274" "47" "c.6274+47A>T" "r.(?)" "p.(=)" "44i" "0000370287" "00000065" "55" "6322" "0" "6322" "0" "c.6322C>T" "r.(?)" "p.(Arg2108Trp)" "45" "0000370288" "00000065" "55" "7440" "-20" "7440" "-20" "c.7440-20del" "r.(?)" "p.(=)" "52i" "0000370289" "00000065" "77" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513Ilefs*34)" "54" "0000370290" "00000065" "55" "7572" "0" "7572" "0" "c.7572G>A" "r.(?)" "p.(=)" "54" "0000370291" "00000065" "99" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630*)" "56" "0000370292" "00000065" "55" "7965" "0" "7965" "0" "c.7965C>A" "r.(?)" "p.(=)" "57" "0000370293" "00000065" "33" "8028" "0" "8028" "0" "c.8028T>C" "r.(?)" "p.(=)" "57" "0000370294" "00000065" "55" "8282" "0" "8282" "0" "c.8282T>C" "r.(?)" "p.(Ile2761Thr)" "59" "0000370295" "00000065" "33" "8528" "0" "8528" "0" "c.8528A>G" "r.(?)" "p.(Asn2843Ser)" "60" "0000370296" "00000065" "11" "8548" "-10" "8548" "-10" "c.8548-10T>C" "r.(?)" "p.(=)" "60i" "0000370297" "00000065" "77" "8748" "0" "8748" "0" "c.8748del" "r.(?)" "p.(Glu2917Argfs*48)" "62" "0000370298" "00000065" "55" "8857" "44" "8857" "44" "c.8857+44C>T" "r.(?)" "p.(=)" "62i" "0000370299" "00000065" "55" "9211" "25" "9211" "25" "c.9211+25A>C" "r.(?)" "p.(=)" "64i" "0000370300" "00000065" "33" "9212" "-15" "9212" "-15" "c.9212-15C>A" "r.(?)" "p.(=)" "64i" "0000370301" "00000065" "77" "9212" "-1" "9212" "-1" "c.9212-1G>A" "r.spl" "p.?" "64i" "0000370302" "00000065" "55" "9252" "0" "9252" "0" "c.9252C>G" "r.(?)" "p.(Phe3084Leu)" "65" "0000370303" "00000065" "55" "1547" "0" "1547" "0" "c.1547A>G" "r.(?)" "p.(Asp516Gly)" "11" "0000370304" "00000065" "99" "5132" "0" "5132" "0" "c.5132del" "r.(?)" "p.(Glu1711Glyfs*14)" "36" "0000370305" "00000065" "99" "2875" "0" "2875" "0" "c.2875C>T" "r.(?)" "p.(Pro959Ser)" "21" "0000370306" "00000065" "99" "4261" "0" "4261" "0" "c.4261C>T" "r.(?)" "p.(Gln1421*)" "29" "0000370307" "00000065" "99" "524" "0" "534" "0" "c.524_534dup" "r.(?)" "p.(Leu179Serfs*3)" "4" "0000370308" "00000065" "77" "7862" "0" "7862" "0" "c.7862G>T" "r.(?)" "p.(Gly2621Val)" "56" "0000370309" "00000065" "77" "6430" "-2" "6430" "-2" "c.6430-2A>G" "r.(?)" "p.?" "45i" "0000370310" "00000065" "33" "284" "-86" "284" "-85" "c.284-86_284-85insG" "r.(?)" "p.(=)" "2i" "0000370311" "00000065" "33" "284" "-85" "284" "-85" "c.284-85A>G" "r.(?)" "p.(=)" "2i" "0000370312" "00000065" "77" "396" "1" "396" "1" "c.396+1G>A" "r.spl" "p.?" "3i" "0000370313" "00000065" "11" "3174" "240" "3174" "240" "c.3174+240A>G" "r.(?)" "p.(=)" "22i" "0000370314" "00000065" "55" "4436" "180" "4436" "180" "c.4436+180T>C" "r.(?)" "p.(=)" "30i" "0000370315" "00000065" "11" "6993" "-153" "6993" "-153" "c.6993-153G>A" "r.(?)" "p.(=)" "49i" "0000370316" "00000065" "55" "4860" "0" "4860" "0" "c.4860G>A" "r.(?)" "p.(Lys1620=)" "33" "0000370317" "00000065" "99" "7898" "1" "7898" "1" "c.7898+1G>A" "r.spl" "p.?" "56i" "0000370318" "00000065" "99" "8931" "0" "8933" "0" "c.8931_8933del" "r.(?)" "p.(Leu2978del)" "63" "0000370319" "00000065" "77" "611" "0" "611" "0" "c.611C>T" "r.(?)" "p.(Ser204Phe)" "4" "0000370320" "00000065" "77" "4533" "0" "4533" "0" "c.4533del" "r.(?)" "p.(Gly1512Alafs*83)" "32" "0000370321" "00000065" "99" "8586" "0" "8586" "0" "c.8586T>G" "r.(?)" "p.(Tyr2862*)" "61" "0000370322" "00000065" "99" "4523" "0" "4523" "0" "c.4523G>C" "r.spl?" "p.(Arg1508Thr)" "31" "0000370323" "00000065" "99" "2322" "259" "2450" "2037" "c.2322+259_2450+2037del" "r.spl" "p.(Asn775Leufs*2)" "16i_17i" "0000370324" "00000065" "99" "284" "-1" "1306" "1" "c.(283+1_284-1)_(1306+1_1307-1)del" "r.spl" "p.?" "2i_10i" "0000370325" "00000065" "99" "4059" "-1" "4311" "1" "c.(4058+1_4059-1)_(4311+1_4312-1)dup" "r.spl" "p.?" "27i_29i" "0000370326" "00000065" "99" "3235" "0" "3235" "0" "c.3235T>G" "r.(?)" "p.(Cys1079Gly)" "23" "0000370327" "00000065" "77" "6708" "-1" "6708" "-1" "c.6708-1G>T" "r.spl" "p.?" "47i" "0000370328" "00000065" "77" "812" "0" "812" "0" "c.812C>T" "r.(?)" "p.(Thr271Ile)" "5" "0000370329" "00000065" "99" "497" "0" "497" "0" "c.497G>A" "r.(?)" "p.(Trp166*)" "4" "0000370330" "00000065" "77" "284" "-4685" "397" "-148" "c.284-4685_397-148delinsA" "r.(284_396del)" "p.(fs*)" "2i_3i" "0000370331" "00000065" "99" "819" "2" "819" "2" "c.819+2T>C" "r.spl?" "p.[Ile214_Arg273del,Ile214Hisfs*22]" "5i" "0000370332" "00000065" "77" "8556" "0" "8558" "0" "c.8556_8558del" "r.(?)" "p.(Ile2852del)" "61" "0000370333" "00000065" "99" "3520" "0" "3520" "0" "c.3520C>T" "r.(?)" "p.(Gln1174*)" "24" "0000370334" "00000065" "99" "5263" "0" "5263" "0" "c.5263A>T" "r.(?)" "p.(Lys1755*)" "37" "0000370335" "00000065" "99" "6501" "0" "6501" "0" "c.6501C>G" "r.(?)" "p.(Tyr2167*)" "46" "0000370336" "00000065" "77" "2450" "4" "2450" "4" "c.2450+4A>G" "r.spl?" "p.?" "17i" "0000370337" "00000065" "99" "6979" "0" "6979" "0" "c.6979G>T" "r.(?)" "p.(Gly2327*)" "49" "0000370338" "00000065" "99" "2350" "0" "2350" "0" "c.2350dup" "r.(?)" "p.(Tyr784Leufs*3)" "17" "0000370339" "00000065" "77" "7898" "732" "48651" "0" "c.7898+732_*219{0}" "r.(?)" "p.?" "56i_65_" "0000370340" "00000065" "99" "247" "0" "247" "0" "c.(247T>C)" "r.(?)" "p.(Cys83Arg)" "2" "0000370341" "00000065" "99" "1122" "0" "1122" "0" "c.1122del" "r.(?)" "p.(Gly376Valfs*13)" "8" "0000370342" "00000065" "99" "7137" "0" "7137" "0" "c.7137T>A" "r.(?)" "p.(Tyr2379*)" "50" "0000370343" "00000065" "99" "8541" "0" "8541" "0" "c.8541G>A" "r.(?)" "p.(Trp2847*)" "60" "0000370344" "00000065" "77" "2089" "0" "2089" "0" "c.2089A>G" "r.(?)" "p.(Ile697Val)" "14" "0000370346" "00000065" "99" "652" "0" "653" "0" "c.652_653del" "r.(?)" "p.(Leu218Asnfs*9)" "5" "0000370347" "00000065" "99" "4516" "0" "4516" "0" "c.4516T>A" "r.(?)" "p.(Cys1506Ser)" "31" "0000370348" "00000065" "99" "6466" "0" "6466" "0" "c.6466C>T" "r.(?)" "p.(Arg2156*)" "46" "0000370349" "00000065" "99" "8703" "1" "8703" "1" "c.8703+1G>A" "r.spl" "p.?" "61i" "0000370350" "00000065" "55" "2217" "0" "2217" "0" "c.2217G>T" "r.(?)" "p.(Trp739Cys)" "16" "0000370351" "00000065" "55" "4640" "0" "4640" "0" "c.4640C>T" "r.(?)" "p.(Thr1547Met)" "32" "0000370352" "00000065" "99" "624" "0" "624" "0" "c.624del" "r.(?)" "p.(Leu209*)" "4" "0000370353" "00000065" "99" "2209" "-3" "2209" "-2" "c.2209-3_2209-2del" "r.spl" "p.?" "15i" "0000370354" "00000065" "99" "8654" "0" "8654" "0" "c.8654T>C" "r.(?)" "p.(Leu2885Pro)" "61" "0000370355" "00000065" "99" "2945" "0" "2945" "0" "c.2945dup" "r.(?)" "p.(Ser982Argfs*16)" "21" "0000370356" "00000065" "99" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000370357" "00000065" "99" "4311" "0" "4311" "0" "c.4311G>A" "r.(?)" "p.(Asn1438Valfs*4)" "29" "0000370358" "00000065" "55" "8989" "-12" "8989" "-12" "c.8989-12C>G" "r.(?)" "p.(=)" "63i" "0000370359" "00000065" "99" "2451" "-6" "2451" "-6" "c.2451-6A>G" "r.(?)" "p.(=)" "17i" "0000370360" "00000065" "99" "4771" "0" "4771" "0" "c.(4771C>T)" "r.(?)" "p.(Gln1591*)" "33" "0000370361" "00000065" "99" "640" "-1" "819" "1" "c.(639+1_640-1)_(819+1_820-1)del" "r.spl" "p.?" "4i_5i" "0000370362" "00000065" "99" "4397" "0" "4397" "0" "c.4397G>A" "r.(?)" "p.(Cys1466Tyr)" "30" "0000370363" "00000065" "99" "1358" "0" "1358" "0" "c.1358G>C" "r.(?)" "p.(Cys453Ser)" "10" "0000370364" "00000065" "99" "5072" "-1408" "1637097" "0" "c.(5072-2432_5072-1409)_*219{0}" "r.(?)" "p.?" "35i_65_" "0000370365" "00000065" "55" "595" "0" "595" "0" "c.595T>A" "r.(?)" "p.(Cys199Ser)" "4" "0000370366" "00000065" "99" "4405" "0" "4405" "0" "c.4405T>C" "r.(?)" "p.(Cys1469Arg)" "30" "0000370367" "00000065" "99" "4936" "0" "4936" "0" "c.4936G>T" "r.(?)" "p.(Glu1646*)" "34" "0000370368" "00000065" "99" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754*)" "37" "0000370369" "00000065" "99" "4523" "1" "4523" "1" "c.4523+1G>A" "r.spl" "p.?" "31i" "0000370370" "00000065" "99" "3758" "0" "3758" "0" "c.3758T>G" "r.(?)" "p.(Leu1253Arg)" "26" "0000370371" "00000065" "99" "6268" "2" "6268" "2" "c.6268+2T>C" "r.spl?" "p.?" "43i" "0000370372" "00000065" "99" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719Argfs*5)" "36" "0000370373" "00000065" "99" "8245" "-1" "8988" "1" "c.(8244+1_8245-1)_(8988+1_8989-1)del" "r.spl" "p.?" "58i_63i" "0000370374" "00000065" "99" "363" "0" "363" "0" "c.363C>G" "r.(?)" "p.(Tyr121*)" "3" "0000370375" "00000065" "99" "1307" "-1" "1782" "1" "c.(1306+1_1307-1)_(1782+1_1783-1)del" "r.spl" "p.?" "9i_12i" "0000370376" "00000065" "99" "482" "0" "485" "0" "c.482_485dup" "r.(?)" "p.(Glu162Aspfs*2)" "4" "0000370377" "00000065" "99" "5866" "-1" "6867" "1" "c.(5865+1_5866-1)_(6867+1_6868-1)del" "r.spl" "p.?" "40i_48i" "0000370378" "00000065" "99" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641*)" "57" "0000370379" "00000065" "99" "8987" "0" "8987" "0" "c.8987del" "r.(?)" "p.(Lys2996Serfs*2)" "63" "0000370380" "00000065" "99" "3096" "0" "3096" "0" "c.3096C>A" "r.(?)" "p.(Cys1032*)" "22" "0000370381" "00000065" "99" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.spl" "p.?" "3i_4i" "0000370382" "00000065" "99" "2565" "0" "2565" "0" "c.2565del" "r.(?)" "p.(Ser856Leufs*32)" "19" "0000370383" "00000065" "99" "4058" "1" "4058" "1" "c.4058+1G>A" "r.spl" "p.?" "27i" "0000370384" "00000065" "99" "2959" "0" "2959" "0" "c.2959dup" "r.(?)" "p.(Cys987Leufs*11)" "21" "0000370385" "00000065" "99" "8358" "-3" "8358" "-3" "c.8358-3C>G" "r.spl?" "p.?" "59i" "0000370386" "00000065" "99" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319*)" "27" "0000370387" "00000065" "99" "113" "-1" "396" "1" "c.(112+1_113-1)_(396+1_397-1)del" "r.spl" "p.?" "1i_3i" "0000370388" "00000065" "99" "5071" "1" "5071" "1" "c.5071+1G>A" "r.spl" "p.?" "35i" "0000370389" "00000065" "99" "8858" "-1" "8988" "1" "c.(8857+1_8858-1)_(8988+1_8989-1)del" "r.spl" "p.?" "62i_63i" "0000370390" "00000065" "99" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Trp110*)" "3" "0000370391" "00000065" "99" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095*)" "23" "0000370392" "00000065" "99" "1153" "0" "1154" "0" "c.1153_1154del" "r.(?)" "p.(Thr385Cysfs*10)" "8" "0000370393" "00000065" "99" "8264" "0" "8264" "0" "c.8264C>A" "r.(?)" "p.(Ser2755*)" "59" "0000370394" "00000065" "99" "640" "-1" "640" "-1" "c.640-1G>C" "r.spl" "p.?" "4i" "0000370395" "00000065" "99" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "18" "0000370396" "00000065" "99" "6993" "-2" "6993" "-2" "c.6993-2A>G" "r.spl" "p.?" "49i" "0000370397" "00000065" "99" "7898" "0" "7898" "0" "c.7898G>C" "r.spl?" "p.(Gly2633Ala)" "56" "0000370398" "00000065" "99" "3931" "0" "3931" "0" "c.3931T>G" "r.(?)" "p.(Trp1311Gly)" "27" "0000370399" "00000065" "99" "2958" "0" "2958" "0" "c.2958G>A" "r.(?)" "p.(Trp986*)" "21" "0000370400" "00000065" "99" "283" "1" "283" "1" "c.283+1G>C" "r.spl" "p.?" "2i" "0000370401" "00000065" "99" "1553" "0" "1553" "0" "c.1553G>A" "r.(?)" "p.(Cys518Tyr)" "11" "0000370402" "00000065" "99" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.(?)" "p.(Val1186Thrfs*4)" "24i" "0000370403" "00000065" "99" "4886" "0" "4886" "0" "c.4886del" "r.(?)" "p.(Pro1629Glnfs*12)" "34" "0000370404" "00000065" "99" "4312" "-3" "4312" "-3" "c.4312-3C>G" "r.spl?" "p.?" "29i" "0000370405" "00000065" "99" "284" "-1" "639" "1" "c.(283+1_284-1)_(639+1_640-1)del" "r.spl" "p.?" "2i_4i" "0000370406" "00000065" "99" "7991" "0" "7991" "0" "c.7991del" "r.(?)" "p.(Gly2664Valfs*64)" "57" "0000370407" "00000065" "99" "6868" "-1" "6992" "1" "c.(6867+1_6868-1)_(6992+1_6993-1)del" "r.spl" "p.?" "48i_49i" "0000370408" "00000065" "55" "32" "0" "32" "0" "c.32T>C" "r.(?)" "p.(Leu11Pro)" "1" "0000370409" "00000065" "77" "3372" "0" "3372" "0" "c.3372dup" "r.(?)" "p.(Cys1125Metfs*4)" "23" "0000370410" "00000065" "55" "6707" "0" "6707" "0" "c.6707G>A" "r.(?)" "p.(Arg2236Lys)" "47" "0000370411" "00000065" "55" "7057" "0" "7057" "0" "c.7057C>T" "r.(?)" "p.(Arg2353Cys)" "50" "0000370412" "00000065" "99" "8725" "0" "8725" "0" "c.8725T>C" "r.(?)" "p.(Cys2909Arg)" "62" "0000370413" "00000065" "99" "1084" "0" "1085" "0" "c.1084_1085insTT" "r.(?)" "p.(Arg362Ilefs*4)" "8" "0000370414" "00000065" "99" "8947" "0" "8947" "0" "c.8947C>T" "r.(?)" "p.(Gln2983*)" "63" "0000370415" "00000065" "11" "3556" "-15" "3556" "-15" "c.3556-15T>G" "r.(?)" "p.(=)" "24i" "0000370416" "00000065" "77" "7898" "2" "7898" "2" "c.7898+2T>G" "r.spl" "p.?" "56i" "0000370417" "00000065" "55" "245" "0" "245" "0" "c.245A>T" "r.(?)" "p.(Gln82Leu)" "2" "0000370418" "00000065" "77" "8244" "2" "8244" "2" "c.8244+2dup" "r.spl" "p.?" "58i" "0000370419" "00000065" "55" "2736" "0" "2736" "0" "c.2736G>A" "r.(?)" "p.(=)" "19" "0000370420" "00000065" "99" "5134" "0" "5153" "0" "c.5134_5153del" "r.(?)" "p.(Arg1712Glufs*4)" "36" "0000370421" "00000065" "99" "5050" "0" "5050" "0" "c.5050G>T" "r.(?)" "p.(Glu1684*)" "35" "0000370422" "00000065" "99" "6501" "0" "6501" "0" "c.6501C>A" "r.(?)" "p.(Tyr2167*)" "46" "0000370423" "00000065" "33" "255" "0" "255" "0" "c.255C>T" "r.(?)" "p.(=)" "2" "0000370424" "00000065" "55" "397" "-6" "397" "-6" "c.397-6C>T" "r.(?)" "p.(=)" "3i" "0000370425" "00000065" "55" "553" "0" "553" "0" "c.553C>T" "r.(?)" "p.(Arg185Cys)" "4" "0000370426" "00000065" "55" "922" "0" "922" "0" "c.922G>A" "r.(?)" "p.(Glu308Lys)" "7" "0000370427" "00000065" "55" "1586" "0" "1586" "0" "c.1586G>A" "r.(?)" "p.(Ser529Asn)" "11" "0000370428" "00000065" "55" "1645" "0" "1645" "0" "c.1645C>T" "r.(?)" "p.(Pro549Ser)" "12" "0000370429" "00000065" "55" "1884" "16" "1884" "16" "c.1884+16C>T" "r.(?)" "p.(=)" "13i" "0000370430" "00000065" "55" "2132" "0" "2132" "0" "c.2132A>G" "r.(?)" "p.(Tyr711Cys)" "15" "0000370431" "00000065" "11" "2451" "-19" "2451" "-19" "c.2451-19C>T" "r.(?)" "p.(=)" "17i" "0000370432" "00000065" "33" "2476" "0" "2476" "0" "c.2476C>T" "r.(?)" "p.(Arg826Trp)" "18" "0000370433" "00000065" "55" "2637" "0" "2637" "0" "c.2637T>C" "r.(?)" "p.(=)" "19" "0000370434" "00000065" "55" "2670" "0" "2670" "0" "c.2670A>C" "r.(?)" "p.(Lys890Asn)" "19" "0000370435" "00000065" "55" "2767" "0" "2767" "0" "c.2767G>A" "r.(?)" "p.(Gly923Ser)" "20" "0000370436" "00000065" "55" "2770" "0" "2770" "0" "c.2770G>T" "r.(?)" "p.(Gly924Cys)" "20" "0000370437" "00000065" "55" "2857" "-13" "2857" "-13" "c.2857-13C>T" "r.(?)" "p.(=)" "20i" "0000370438" "00000065" "55" "2877" "0" "2877" "0" "c.2877A>G" "r.(?)" "p.(=)" "21" "0000370439" "00000065" "55" "3144" "0" "3144" "0" "c.3144C>T" "r.(?)" "p.(=)" "22" "0000370440" "00000065" "55" "4470" "0" "4470" "0" "c.4470C>T" "r.(?)" "p.(=)" "31" "0000370441" "00000065" "55" "4762" "0" "4762" "0" "c.4762C>T" "r.(?)" "p.(Arg1588Cys)" "33" "0000370442" "00000065" "55" "4935" "0" "4935" "0" "c.4935C>A" "r.(?)" "p.(=)" "34" "0000370443" "00000065" "55" "4993" "0" "4993" "0" "c.4993G>A" "r.(?)" "p.(Gly1665Arg)" "35" "0000370444" "00000065" "55" "5074" "0" "5074" "0" "c.5074G>C" "r.(?)" "p.(Val1692Leu)" "36" "0000370445" "00000065" "55" "5633" "0" "5633" "0" "c.5633C>T" "r.(?)" "p.(Ser1878Phe)" "39" "0000370446" "00000065" "55" "5692" "0" "5692" "0" "c.5692G>T" "r.(?)" "p.(Ala1898Ser)" "39" "0000370447" "00000065" "55" "5969" "-8" "5969" "-8" "c.5969-8A>T" "r.(?)" "p.(=)" "41i" "0000370448" "00000065" "55" "5969" "-5" "5969" "-5" "c.5969-5C>T" "r.(?)" "p.?" "41i" "0000370449" "00000065" "55" "6002" "0" "6002" "0" "c.6002G>A" "r.(?)" "p.(Arg2001Lys)" "42" "0000370450" "00000065" "55" "6030" "0" "6030" "0" "c.6030G>T" "r.(?)" "p.(=)" "42" "0000370451" "00000065" "33" "6161" "0" "6161" "0" "c.6161A>G" "r.(?)" "p.(Gln2054Arg)" "43" "0000370452" "00000065" "55" "6461" "0" "6461" "0" "c.6461G>A" "r.(?)" "p.(Cys2154Tyr)" "46" "0000370453" "00000065" "55" "6506" "0" "6506" "0" "c.6506A>G" "r.(?)" "p.(Asn2169Ser)" "46" "0000370454" "00000065" "55" "6708" "-3" "6708" "-3" "c.6708-3A>C" "r.(?)" "p.?" "47i" "0000370455" "00000065" "55" "6781" "0" "6781" "0" "c.6781C>T" "r.(?)" "p.(His2261Tyr)" "48" "0000370456" "00000065" "55" "6788" "0" "6788" "0" "c.6788C>T" "r.(?)" "p.(Thr2263Met)" "48" "0000370457" "00000065" "55" "6965" "0" "6967" "0" "c.6965_6967del" "r.(?)" "p.(Val2321del)" "49" "0000370458" "00000065" "55" "7300" "10" "7300" "10" "c.7300+10T>A" "r.(?)" "p.(=)" "51i" "0000370459" "00000065" "55" "8755" "0" "8755" "0" "c.8755C>T" "r.(?)" "p.(Pro2919Ser)" "62" "0000370460" "00000065" "55" "8774" "0" "8774" "0" "c.8774C>T" "r.(?)" "p.(Pro2925Leu)" "62" "0000370461" "00000065" "77" "8857" "1" "8857" "1" "c.8857+1G>A" "r.spl" "p.?" "62i" "0000370462" "00000065" "55" "9038" "0" "9038" "0" "c.9038A>C" "r.(?)" "p.(Asp3013Ala)" "64" "0000370463" "00000065" "55" "9123" "0" "9123" "0" "c.9123C>T" "r.(?)" "p.(=)" "64" "0000370464" "00000065" "99" "67" "0" "71" "0" "c.67_71del" "r.(?)" "p.(Gln23Alafs*25)" "1" "0000370465" "00000065" "55" "112" "0" "112" "0" "c.112G>T" "r.spl?" "p.(Gly38Cys)" "1" "0000370466" "00000065" "55" "149" "0" "149" "0" "c.149C>T" "r.(?)" "p.(Ala50Val)" "2" "0000370467" "00000065" "55" "277" "0" "277" "0" "c.277C>A" "r.(?)" "p.(Pro93Thr)" "2" "0000370468" "00000065" "99" "327" "0" "327" "0" "c.327G>A" "r.(?)" "p.(Trp109*)" "3" "0000370469" "00000065" "99" "609" "0" "609" "0" "c.609C>A" "r.(?)" "p.(Tyr203*)" "4" "0000370470" "00000065" "99" "640" "-1" "640" "-1" "c.640-1G>T" "r.spl" "p.?" "4i" "0000370471" "00000065" "55" "1330" "0" "1330" "0" "c.1330T>C" "r.(?)" "p.(Cys444Arg)" "10" "0000370472" "00000065" "77" "1741" "0" "1741" "0" "c.1741del" "r.(?)" "p.(Ser581Alafs*18)" "12" "0000370473" "00000065" "55" "2254" "0" "2254" "0" "c.2254G>A" "r.(?)" "p.(Gly752Ser)" "16" "0000370474" "00000065" "55" "2874" "0" "2874" "0" "c.2874A>G" "r.(?)" "p.(=)" "21" "0000370475" "00000065" "77" "3626" "0" "3626" "0" "c.3626del" "r.(?)" "p.(Gly1209Alafs*15)" "25" "0000370476" "00000065" "99" "4688" "0" "4688" "0" "c.4688G>A" "r.(?)" "p.(Trp1563*)" "32" "0000370477" "00000065" "77" "6310" "0" "6310" "0" "c.6310C>T" "r.(?)" "p.(Gln2104*)" "45" "0000370478" "00000065" "77" "6714" "0" "6714" "0" "c.6714dup" "r.(?)" "p.(Arg2239Glufs*54)" "48" "0000370479" "00000065" "77" "7156" "-2" "7156" "-2" "c.7156-2A>G" "r.spl" "p.?" "50i" "0000370480" "00000065" "55" "9426" "0" "9426" "0" "c.*57A>C" "r.(?)" "p.(=)" "65" "0000370481" "00000065" "55" "4222" "0" "4222" "0" "c.4222C>G" "r.(?)" "p.(Arg1408Gly)" "29" "0000370482" "00000065" "55" "4437" "-5" "4437" "-5" "c.4437-5T>A" "r.(?)" "p.?" "30i" "0000370483" "00000065" "55" "4909" "0" "4909" "0" "c.4909G>A" "r.(?)" "p.(Glu1637Lys)" "34" "0000370484" "00000065" "55" "4930" "0" "4930" "0" "c.4930G>A" "r.(?)" "p.(Val1644Met)" "34" "0000370485" "00000065" "33" "6269" "-840" "6269" "-840" "c.6269-840A>G" "r.(?)" "p.(=)" "43i" "0000370486" "00000065" "55" "6945" "0" "6945" "0" "c.6945G>T" "r.(?)" "p.(Leu2315Phe)" "49" "0000370487" "00000065" "55" "7118" "0" "7118" "0" "c.7118C>T" "r.(?)" "p.(Ser2373Leu)" "50" "0000370488" "00000065" "55" "7424" "0" "7424" "0" "c.7424C>T" "r.(?)" "p.(Thr2475Met)" "52" "0000403761" "00000065" "90" "1793" "0" "1795" "0" "c.1793_1795del" "r.(?)" "p.(Val598del)" "" "0000408395" "00000065" "90" "2839" "0" "7749" "1" "c.(2749+1_2839)_(7749+1_7750-1)dup" "r.2750_7749dup" "p.Ala2584fs" "20i_55i" "0000408396" "00000065" "90" "5374" "0" "5374" "0" "c.5374G>T" "r.(?)" "p.(Glu1792*)" "37" "0000408397" "00000065" "90" "1783" "-18481" "5445" "668" "c.(1782+1_1783-18481)_(5445+668_5446-1)del" "r.?" "p.(Leu595_Glu1815del)" "12i_37i" "0000408398" "00000065" "70" "6599" "0" "6599" "0" "c.6599G>A" "r.(?)" "p.(Arg2200His)" "47" "0000408399" "00000065" "90" "1783" "-15888" "2097" "-2947" "c.(1782+1_1783-15888)_(2097-2947_2097-1)del" "r.(?)" "p.(Leu595Valfs*5)" "12i_14i" "0000408400" "00000065" "90" "4312" "-1" "4312" "-1" "c.4312-1G>A" "r.spl" "p.?" "29i" "0000408401" "00000065" "90" "397" "-1" "1782" "26207" "c.(396+1_397-1)_(1782+26207_1783-1)dup" "r.397_1782dup" "p.Val133_Lys594dup" "3i_12i" "0000408402" "00000065" "90" "6429" "3" "6429" "3" "c.6429+3A>C" "r.[6275_6429del,6269_6429del]" "p.[Ile2092fs,Lys2090fs]" "45i" "0000439723" "00000065" "90" "1964" "0" "1964" "0" "c.1964T>C" "r.(1964u>c)" "p.(Leu655Pro)" "14" "0000439724" "00000065" "90" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.(=)" "p.(=)" "" "0000440017" "00000065" "50" "3466" "0" "3466" "0" "c.3466G>A" "r.(?)" "p.Asp1156Asn" "" "0000440077" "00000065" "70" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.Arg3085*" "" "0000527110" "00000065" "30" "13" "0" "13" "0" "c.13G>A" "r.(?)" "p.(Ala5Thr)" "" "0000527111" "00000065" "90" "54" "0" "64" "0" "c.54_64del" "r.(?)" "p.(Gly19AlafsTer27)" "" "0000527112" "00000065" "30" "74" "0" "74" "0" "c.74C>T" "r.(?)" "p.(Pro25Leu)" "" "0000527115" "00000065" "50" "922" "0" "922" "0" "c.922G>A" "r.(?)" "p.(Glu308Lys)" "" "0000527116" "00000065" "30" "1308" "0" "1308" "0" "c.1308T>G" "r.(?)" "p.(Gly436=)" "" "0000527117" "00000065" "30" "1308" "0" "1308" "0" "c.1308T>G" "r.(?)" "p.(Gly436=)" "" "0000527118" "00000065" "30" "1308" "0" "1308" "0" "c.1308T>G" "r.(?)" "p.(Gly436=)" "" "0000527119" "00000065" "30" "1400" "0" "1400" "0" "c.1400A>G" "r.(?)" "p.(Lys467Arg)" "" "0000527120" "00000065" "30" "1491" "0" "1491" "0" "c.1491T>C" "r.(?)" "p.(Cys497=)" "" "0000527121" "00000065" "30" "1533" "0" "1533" "0" "c.1533T>C" "r.(?)" "p.(Asn511=)" "" "0000527122" "00000065" "30" "1634" "0" "1634" "0" "c.1634T>A" "r.(?)" "p.(Leu545Gln)" "" "0000527123" "00000065" "30" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "" "0000527124" "00000065" "30" "1930" "0" "1930" "0" "c.1930C>G" "r.(?)" "p.(His644Asp)" "" "0000527125" "00000065" "30" "1947" "0" "1947" "0" "c.1947T>C" "r.(?)" "p.(His649=)" "" "0000527126" "00000065" "30" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "" "0000527128" "00000065" "50" "2735" "0" "2735" "0" "c.2735C>T" "r.(?)" "p.(Ala912Val)" "" "0000527129" "00000065" "10" "2756" "0" "2756" "0" "c.2756G>T" "r.(?)" "p.(Arg919Leu)" "" "0000527131" "00000065" "50" "2993" "0" "2993" "0" "c.2993G>T" "r.(?)" "p.(Arg998Leu)" "" "0000527132" "00000065" "30" "3217" "0" "3217" "0" "c.3217A>G" "r.(?)" "p.(Asn1073Asp)" "" "0000527133" "00000065" "30" "3231" "0" "3231" "0" "c.3231C>G" "r.(?)" "p.(Gly1077=)" "" "0000527136" "00000065" "30" "3296" "0" "3296" "0" "c.3296A>G" "r.(?)" "p.(Asn1099Ser)" "" "0000527138" "00000065" "50" "3706" "0" "3706" "0" "c.3706A>G" "r.(?)" "p.(Lys1236Glu)" "" "0000527140" "00000065" "50" "3977" "0" "3977" "0" "c.3977G>A" "r.(?)" "p.(Arg1326Gln)" "" "0000527141" "00000065" "30" "3988" "0" "3988" "0" "c.3988T>C" "r.(?)" "p.(Leu1330=)" "" "0000527142" "00000065" "30" "4050" "0" "4050" "0" "c.4050A>G" "r.(?)" "p.(Arg1350=)" "" "0000527143" "00000065" "30" "4437" "-5" "4437" "-5" "c.4437-5T>A" "r.spl?" "p.?" "" "0000527144" "00000065" "30" "4470" "0" "4470" "0" "c.4470C>T" "r.(?)" "p.(Asp1490=)" "" "0000527145" "00000065" "10" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "" "0000527146" "00000065" "30" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "" "0000527147" "00000065" "30" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "" "0000527148" "00000065" "30" "4696" "0" "4696" "0" "c.4696C>T" "r.(?)" "p.(Arg1566Cys)" "" "0000527149" "00000065" "30" "4803" "0" "4803" "0" "c.4803G>A" "r.(?)" "p.(Pro1601=)" "" "0000527151" "00000065" "30" "5074" "0" "5074" "0" "c.5074G>C" "r.(?)" "p.(Val1692Leu)" "" "0000527152" "00000065" "30" "5105" "0" "5105" "0" "c.5105C>G" "r.(?)" "p.(Thr1702Ser)" "" "0000527155" "00000065" "10" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(Glu1822=)" "" "0000527156" "00000065" "10" "5466" "0" "5466" "0" "c.5466A>G" "r.(?)" "p.(Glu1822=)" "" "0000527157" "00000065" "50" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "" "0000527158" "00000065" "30" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "" "0000527159" "00000065" "30" "5531" "0" "5531" "0" "c.5531G>A" "r.(?)" "p.(Arg1844His)" "" "0000527160" "00000065" "30" "5531" "0" "5531" "0" "c.5531G>A" "r.(?)" "p.(Arg1844His)" "" "0000527161" "00000065" "30" "5655" "0" "5655" "0" "c.5655G>T" "r.(?)" "p.(Lys1885Asn)" "" "0000527162" "00000065" "50" "5722" "0" "5722" "0" "c.5722G>A" "r.(?)" "p.(Asp1908Asn)" "" "0000527163" "00000065" "30" "5835" "0" "5835" "0" "c.5835C>G" "r.(?)" "p.(Ala1945=)" "" "0000527165" "00000065" "30" "6136" "0" "6136" "0" "c.6136G>A" "r.(?)" "p.(Asp2046Asn)" "" "0000527166" "00000065" "30" "6450" "0" "6450" "0" "c.6450A>T" "r.(?)" "p.(Ser2150=)" "" "0000527167" "00000065" "50" "6566" "0" "6566" "0" "c.6566C>A" "r.(?)" "p.(Ala2189Asp)" "" "0000527168" "00000065" "50" "6832" "0" "6832" "0" "c.6832A>G" "r.(?)" "p.(Met2278Val)" "" "0000527170" "00000065" "90" "7155" "1" "7155" "1" "c.7155+1G>A" "r.spl?" "p.?" "" "0000527171" "00000065" "30" "7231" "0" "7231" "0" "c.7231G>A" "r.(?)" "p.(Val2411Ile)" "" "0000527174" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0000527175" "00000065" "10" "7760" "0" "7760" "0" "c.7760=" "r.(=)" "p.(Val2587=)" "" "0000527176" "00000065" "10" "7760" "0" "7760" "0" "c.7760=" "r.(=)" "p.(Val2587=)" "" "0000527177" "00000065" "30" "7794" "0" "7794" "0" "c.7794T>C" "r.(?)" "p.(His2598=)" "" "0000527178" "00000065" "10" "8124" "0" "8124" "0" "c.8124T>A" "r.(?)" "p.(Gly2708=)" "" "0000527179" "00000065" "30" "8124" "0" "8124" "0" "c.8124T>A" "r.(?)" "p.(Gly2708=)" "" "0000527180" "00000065" "30" "8168" "0" "8168" "0" "c.8168C>G" "r.(?)" "p.(Ala2723Gly)" "" "0000527181" "00000065" "50" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl?" "p.?" "" "0000527183" "00000065" "30" "8520" "0" "8520" "0" "c.8520C>A" "r.(?)" "p.(Thr2840=)" "" "0000527184" "00000065" "70" "8548" "-2" "8548" "-2" "c.8548-2A>G" "r.spl?" "p.?" "" "0000527187" "00000065" "30" "8691" "0" "8691" "0" "c.8691A>G" "r.(?)" "p.(Arg2897=)" "" "0000527188" "00000065" "30" "8728" "0" "8728" "0" "c.8728G>A" "r.(?)" "p.(Val2910Ile)" "" "0000527189" "00000065" "50" "8982" "0" "8982" "0" "c.8982T>A" "r.(?)" "p.(Asp2994Glu)" "" "0000527190" "00000065" "30" "8982" "0" "8982" "0" "c.8982T>C" "r.(?)" "p.(Asp2994=)" "" "0000527191" "00000065" "10" "9212" "-15" "9212" "-15" "c.9212-15C>A" "r.(=)" "p.(=)" "" "0000527192" "00000065" "10" "9212" "-15" "9212" "-15" "c.9212-15C>A" "r.(=)" "p.(=)" "" "0000597311" "00000065" "90" "164" "0" "164" "0" "c.164del" "r.(?)" "p.(Asn55Metfs*16)" "" "0000609983" "00000065" "30" "306" "0" "306" "0" "c.306T>A" "r.(?)" "p.(Ala102=)" "" "0000609984" "00000065" "50" "408" "0" "408" "0" "c.408C>G" "r.(?)" "p.(Ile136Met)" "" "0000609985" "00000065" "50" "479" "0" "479" "0" "c.479A>T" "r.(?)" "p.(Asp160Val)" "" "0000609986" "00000065" "50" "521" "0" "521" "0" "c.521C>T" "r.(?)" "p.(Thr174Met)" "" "0000609987" "00000065" "30" "747" "0" "747" "0" "c.747C>T" "r.(?)" "p.(Arg249=)" "" "0000609989" "00000065" "50" "1814" "0" "1814" "0" "c.1814C>T" "r.(?)" "p.(Thr605Ile)" "" "0000609990" "00000065" "30" "2132" "0" "2132" "0" "c.2132A>G" "r.(?)" "p.(Tyr711Cys)" "" "0000609991" "00000065" "50" "2237" "0" "2237" "0" "c.2237A>G" "r.(?)" "p.(Asn746Ser)" "" "0000609992" "00000065" "30" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "" "0000609993" "00000065" "30" "3144" "0" "3144" "0" "c.3144C>T" "r.(?)" "p.(Thr1048=)" "" "0000609994" "00000065" "30" "3153" "0" "3153" "0" "c.3153C>T" "r.(?)" "p.(His1051=)" "" "0000609995" "00000065" "30" "3163" "0" "3163" "0" "c.3163A>G" "r.(?)" "p.(Thr1055Ala)" "" "0000609996" "00000065" "50" "3350" "0" "3350" "0" "c.3350C>T" "r.(?)" "p.(Thr1117Ile)" "" "0000609997" "00000065" "30" "4222" "0" "4222" "0" "c.4222C>G" "r.(?)" "p.(Arg1408Gly)" "" "0000609998" "00000065" "30" "4717" "4" "4717" "4" "c.4717+4C>T" "r.spl?" "p.?" "" "0000609999" "00000065" "50" "5692" "0" "5692" "0" "c.5692G>T" "r.(?)" "p.(Ala1898Ser)" "" "0000610000" "00000065" "30" "5969" "-5" "5969" "-5" "c.5969-5C>T" "r.spl?" "p.?" "" "0000610001" "00000065" "30" "6430" "-5" "6430" "-5" "c.6430-5dup" "r.spl?" "p.?" "" "0000610002" "00000065" "30" "6649" "0" "6649" "0" "c.6649G>A" "r.(?)" "p.(Val2217Ile)" "" "0000610004" "00000065" "50" "7119" "0" "7119" "0" "c.7119G>A" "r.(?)" "p.(Ser2373=)" "" "0000610005" "00000065" "30" "7356" "0" "7356" "0" "c.7356G>A" "r.(?)" "p.(Ser2452=)" "" "0000610006" "00000065" "50" "7414" "0" "7414" "0" "c.7414G>T" "r.(?)" "p.(Gly2472Cys)" "" "0000610007" "00000065" "50" "7415" "0" "7415" "0" "c.7415G>T" "r.(?)" "p.(Gly2472Val)" "" "0000610008" "00000065" "30" "8223" "0" "8223" "0" "c.8223G>A" "r.(?)" "p.(Thr2741=)" "" "0000610009" "00000065" "50" "8467" "0" "8467" "0" "c.8467C>T" "r.(?)" "p.(Pro2823Ser)" "" "0000610010" "00000065" "50" "8524" "0" "8524" "0" "c.8524A>G" "r.(?)" "p.(Ile2842Val)" "" "0000610013" "00000065" "30" "8671" "0" "8671" "0" "c.8671C>G" "r.(?)" "p.(Pro2891Ala)" "" "0000610014" "00000065" "30" "8728" "0" "8728" "0" "c.8728G>A" "r.(?)" "p.(Val2910Ile)" "" "0000610015" "00000065" "50" "8842" "0" "8842" "0" "c.8842G>A" "r.(?)" "p.(Gly2948Ser)" "" "0000610016" "00000065" "30" "9217" "0" "9217" "0" "c.9217C>T" "r.(?)" "p.(Leu3073Phe)" "" "0000621628" "00000065" "50" "2755" "0" "2755" "0" "c.2755C>T" "r.(?)" "p.(Arg919Cys)" "" "0000621629" "00000065" "30" "4201" "0" "4201" "0" "c.4201C>T" "r.(?)" "p.(Leu1401=)" "" "0000621630" "00000065" "30" "4349" "0" "4349" "0" "c.4349G>A" "r.(?)" "p.(Arg1450Gln)" "" "0000621632" "00000065" "30" "5469" "0" "5469" "0" "c.5469C>T" "r.(?)" "p.(Ser1823=)" "" "0000621633" "00000065" "50" "7537" "0" "7537" "0" "c.7537G>A" "r.(?)" "p.(Asp2513Asn)" "" "0000621634" "00000065" "30" "8222" "0" "8222" "0" "c.8222C>T" "r.(?)" "p.(Thr2741Met)" "" "0000624863" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000624864" "00000065" "70" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549*)" "32" "0000624865" "00000065" "70" "3718" "0" "3718" "0" "c.3718C>T" "r.(?)" "p.(Gln1240*)" "25" "0000624866" "00000065" "70" "6706" "0" "6706" "0" "c.6706A>G" "r.(?)" "p.(Arg2236Gly)" "47" "0000629483" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706*)" "" "0000629484" "00000065" "90" "8703" "1" "8703" "1" "c.8703+1G>A" "r.spl" "p.?" "" "0000645191" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000645192" "00000065" "90" "1672" "0" "1672" "0" "c.1672C>T" "r.(?)" "p.(Gln558*)" "12i_13i" "0000645193" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000645194" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000646779" "00000065" "50" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "" "0000646798" "00000065" "50" "9145" "0" "9145" "0" "c.9145C>G" "r.(?)" "p.(Gln3049Glu)" "" "0000646811" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "" "0000647129" "00000065" "70" "2208" "1" "2208" "1" "c.2208+1G>A" "r.(?)" "p.(?)" "" "0000647130" "00000065" "50" "8715" "0" "8715" "0" "c.8715C>A" "r.(?)" "p.(Ser2905Arg)" "" "0000651826" "00000065" "90" "184" "0" "184" "0" "c.184G>T" "r.(?)" "p.(Gly62*)" "" "0000651827" "00000065" "50" "1085" "0" "1085" "0" "c.1085G>T" "r.(?)" "p.(Arg362Ile)" "" "0000651829" "00000065" "50" "2217" "0" "2217" "0" "c.2217G>T" "r.(?)" "p.(Trp739Cys)" "" "0000651831" "00000065" "50" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "" "0000651832" "00000065" "30" "2857" "-39" "2857" "-39" "c.2857-39T>C" "r.(=)" "p.(=)" "" "0000651833" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "" "0000651834" "00000065" "50" "4060" "0" "4060" "0" "c.4060A>G" "r.(?)" "p.(Ile1354Val)" "" "0000651835" "00000065" "10" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "" "0000651836" "00000065" "50" "6206" "0" "6206" "0" "c.6206A>G" "r.(?)" "p.(Tyr2069Cys)" "" "0000651837" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383*)" "" "0000653295" "00000065" "90" "6011" "0" "6011" "0" "c.6011del" "r.(?)" "p.(Asn2004Metfs*10)" "" "0000653526" "00000065" "70" "1208" "0" "1208" "0" "c.1208del" "r.(?)" "p.(Val403Aspfs*20)" "" "0000655477" "00000065" "50" "946" "0" "946" "0" "c.946G>A" "r.(?)" "p.(Asp316Asn)" "" "0000655478" "00000065" "30" "3000" "0" "3000" "0" "c.3000C>G" "r.(?)" "p.(Ala1000=)" "" "0000655479" "00000065" "50" "3532" "0" "3532" "0" "c.3532G>A" "r.(?)" "p.(Ala1178Thr)" "" "0000655480" "00000065" "50" "7250" "0" "7250" "0" "c.7250A>G" "r.(?)" "p.(His2417Arg)" "" "0000666082" "00000065" "70" "2208" "4" "2208" "19" "c.2208+4_2208+19del" "r.spl?" "p.?" "" "0000666083" "00000065" "70" "7521" "0" "7521" "0" "c.7521dup" "r.(?)" "p.(Ile2508Tyrfs*4)" "" "0000668313" "00000065" "70" "909" "7" "909" "7" "c.909+7A>G" "r.spl?" "p.(?)" "6i" "0000668314" "00000065" "70" "1467" "2" "1467" "2" "c.1467+2T>C" "r.spl" "p.?" "10i" "0000668315" "00000065" "50" "909" "7" "909" "7" "c.909+7A>G" "r.spl?" "p.(?)" "6i" "0000668316" "00000065" "90" "1853" "0" "1854" "0" "c.1853_1854insACGTGTTC" "r.(1853_1854insacguguuc)" "p.(Leu621Hisfs*7)" "13" "0000668634" "00000065" "50" "909" "7" "909" "7" "c.909+7A>G" "r.spl?" "p.(?)" "6i" "0000668635" "00000065" "50" "909" "7" "909" "7" "c.909+7A>G" "r.spl?" "p.(?)" "6i" "0000669871" "00000065" "50" "2217" "0" "2217" "0" "c.2217G>T" "r.(?)" "p.(Trp739Cys)" "" "0000669872" "00000065" "30" "2857" "-39" "2857" "-39" "c.2857-39T>C" "r.(=)" "p.(=)" "" "0000670735" "00000065" "90" "1084" "0" "1085" "0" "c.1084_1085insTT" "r.(?)" "p.(Arg362Ilefs*4)" "" "0000670753" "00000065" "90" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl" "p.?" "" "0000677615" "00000065" "30" "1621" "0" "1621" "0" "c.1621A>G" "r.(?)" "p.(Ser541Gly)" "" "0000677616" "00000065" "90" "1782" "1" "1782" "1" "c.1782+1G>A" "r.spl?" "p.?" "" "0000677617" "00000065" "30" "2121" "0" "2121" "0" "c.2121C>T" "r.(?)" "p.(Ser707=)" "" "0000677618" "00000065" "90" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450Ter)" "" "0000683559" "00000065" "70" "2096" "0" "2096" "0" "c.2096G>T" "r.(?)" "p.(Arg699Met)" "" "0000686206" "00000065" "70" "1793" "0" "1795" "0" "c.1793_1795del" "r.(?)" "p.(Val598del)" "" "0000686207" "00000065" "50" "528" "0" "528" "0" "c.528C>G" "r.(?)" "p.(Cys176Trp)" "" "0000689616" "00000065" "50" "409" "0" "409" "0" "c.409G>A" "r.(?)" "p.(Ala137Thr)" "" "0000689617" "00000065" "30" "1650" "0" "1650" "0" "c.1650C>T" "r.(?)" "p.(Gly550=)" "" "0000689618" "00000065" "30" "2097" "-13" "2097" "-13" "c.2097-13T>C" "r.(=)" "p.(=)" "" "0000689619" "00000065" "50" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "" "0000689620" "00000065" "50" "3175" "-22" "3175" "-22" "c.3175-22G>A" "r.(=)" "p.(=)" "" "0000689621" "00000065" "50" "4440" "0" "4440" "0" "c.4440C>A" "r.(?)" "p.(Phe1480Leu)" "" "0000689622" "00000065" "30" "4959" "6" "4959" "6" "c.4959+6G>T" "r.(=)" "p.(=)" "" "0000689623" "00000065" "50" "8822" "0" "8822" "0" "c.8822G>A" "r.(?)" "p.(Gly2941Glu)" "" "0000689624" "00000065" "30" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(=)" "p.(=)" "" "0000696884" "00000065" "90" "6742" "0" "6742" "0" "c.6742del" "r.(?)" "p.(Leu2248Trpfs*24)" "48" "0000696931" "00000065" "90" "8544" "0" "8544" "0" "c.8544C>G" "r.(?)" "p.(His2848Gln)" "60" "0000697599" "00000065" "70" "909" "7" "909" "7" "c.909+7A>G" "r.spl?" "p.?" "" "0000697600" "00000065" "70" "3235" "0" "3235" "0" "c.3235T>C" "r.(?)" "p.(Cys1079Arg)" "" "0000697601" "00000065" "70" "3412" "-2" "3412" "-2" "c.3412-2A>C" "r.spl" "p.?" "" "0000697602" "00000065" "70" "426" "0" "434" "0" "c.426_434del" "r.(?)" "p.(Lys142_Ala144del)" "" "0000697603" "00000065" "70" "1466" "0" "1466" "0" "c.1466A>G" "r.(?)" "p.(Lys489Arg)" "" "0000697604" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "" "0000697605" "00000065" "70" "2749" "2" "2749" "2" "c.2749+2dup" "r.spl?" "p.?" "" "0000697606" "00000065" "70" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095*)" "" "0000697607" "00000065" "70" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "" "0000697608" "00000065" "70" "4644" "0" "4644" "0" "c.4644C>A" "r.(?)" "p.(Cys1548*)" "" "0000697609" "00000065" "70" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566Cysfs*13)" "" "0000697610" "00000065" "70" "4717" "1" "4717" "1" "c.4717+1G>T" "r.spl" "p.?" "" "0000697611" "00000065" "70" "5279" "0" "5280" "0" "c.5279_5280del" "r.(?)" "p.(Glu1760Valfs*6)" "" "0000697612" "00000065" "70" "5290" "0" "5290" "0" "c.5290dup" "r.(?)" "p.(Glu1764Glyfs*3)" "" "0000697613" "00000065" "70" "6624" "0" "6624" "0" "c.6624G>C" "r.(?)" "p.(Trp2208Cys)" "" "0000697614" "00000065" "70" "7040" "0" "7040" "0" "c.7040G>T" "r.(?)" "p.(Gly2347Val)" "" "0000697615" "00000065" "70" "8654" "0" "8654" "0" "c.8654T>A" "r.(?)" "p.(Leu2885Gln)" "" "0000704340" "00000065" "50" "4837" "0" "4837" "0" "c.4837G>A" "r.(?)" "p.(Glu1613Lys)" "" "0000708794" "00000065" "90" "527" "0" "527" "0" "c.527G>A" "r.(?)" "p.(Cys176Tyr)" "" "0000710207" "00000065" "90" "1583" "0" "1583" "0" "c.1583dup" "r.(?)" "p.(Ser529Glufs*19)" "" "0000710212" "00000065" "90" "6931" "0" "6931" "0" "c.6931A>T" "r.(?)" "p.(Lys2311*)" "" "0000720656" "00000065" "90" "498" "0" "498" "0" "c.498G>A" "r.(?)" "p.(Trp166Ter)" "" "0000720657" "00000065" "30" "640" "-4" "640" "-4" "c.640-4G>T" "r.spl?" "p.?" "" "0000720658" "00000065" "30" "2115" "0" "2115" "0" "c.2115T>G" "r.(?)" "p.(Leu705=)" "" "0000720659" "00000065" "50" "2744" "0" "2744" "0" "c.2744G>A" "r.(?)" "p.(Cys915Tyr)" "" "0000720660" "00000065" "90" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267AspfsTer11)" "" "0000720661" "00000065" "90" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "" "0000720662" "00000065" "90" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "" "0000720663" "00000065" "30" "5470" "0" "5470" "0" "c.5470G>A" "r.(?)" "p.(Gly1824Ser)" "" "0000720664" "00000065" "50" "6430" "0" "6430" "0" "c.6430A>C" "r.(?)" "p.(Ile2144Leu)" "" "0000720665" "00000065" "30" "6927" "0" "6927" "0" "c.6927C>T" "r.(?)" "p.(Asp2309=)" "" "0000720666" "00000065" "90" "7271" "0" "7271" "0" "c.7271del" "r.(?)" "p.(Ser2424TyrfsTer16)" "" "0000720667" "00000065" "90" "8669" "0" "8669" "0" "c.8669dup" "r.(?)" "p.(Leu2890PhefsTer16)" "" "0000763208" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "" "0000763588" "00000065" "90" "3630" "0" "3630" "0" "c.3630del" "r.(?)" "p.(Ile1210Metfs*14)" "" "0000786908" "00000065" "50" "176" "0" "176" "0" "c.176G>A" "r.(?)" "p.(Gly59Glu)" "2" "0000786909" "00000065" "90" "250" "0" "250" "0" "c.250C>T" "r.(?)" "p.(Arg84Ter)" "2" "0000786910" "00000065" "70" "910" "-2" "910" "-2" "c.910-2A>G" "r.spl" "p.?" "6i" "0000786911" "00000065" "90" "1307" "-1" "1307" "-1" "c.1307-1G>C" "r.spl" "p.?" "7i" "0000786912" "00000065" "70" "1749" "0" "1749" "0" "c.1749C>G" "r.(?)" "p.(Tyr583Ter)" "12" "0000786913" "00000065" "70" "2538" "0" "2538" "0" "c.2538del" "r.(?)" "p.(Arg846SerfsTer42)" "19" "0000786914" "00000065" "70" "2749" "4" "2749" "15" "c.2749+4_2749+15del" "r.spl" "p.?" "19" "0000786915" "00000065" "50" "2961" "0" "2961" "0" "c.2961C>G" "r.(?)" "p.(Cys987Trp)" "21" "0000786916" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000786917" "00000065" "90" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400Ter)" "29" "0000786918" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000786919" "00000065" "90" "7816" "0" "7816" "0" "c.7816del" "r.(?)" "p.(Met2606Ter)" "56" "0000786920" "00000065" "90" "8072" "0" "8073" "0" "c.8072_8073del" "r.(?)" "p.(Ser2691CysfsTer15)" "57" "0000787494" "00000065" "70" "287" "0" "288" "0" "c.287_288del" "r.(?)" "p.(Arg96ThrfsTer8)" "3" "0000787495" "00000065" "90" "5360" "0" "5360" "0" "c.5360G>A" "r.(?)" "p.(Trp1787Ter)" "37" "0000787496" "00000065" "50" "3174" "0" "3174" "0" "c.3174G>A" "r.spl" "p.?" "22" "0000787499" "00000065" "70" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450Ter)" "30" "0000787500" "00000065" "90" "8767" "0" "8767" "0" "c.8767G>T" "r.(?)" "p.(Glu2923Ter)" "62" "0000787501" "00000065" "90" "8703" "1" "8703" "1" "c.8703+1G>A" "r.spl" "p.?" "61i" "0000787576" "00000065" "50" "2916" "0" "2916" "0" "c.2916T>G" "r.(?)" "p.(Phe972Leu)" "21" "0000787577" "00000065" "50" "4223" "0" "4223" "0" "c.4223G>A" "r.(?)" "p.(Arg1408His)" "29" "0000788012" "00000065" "50" "3244" "0" "3244" "0" "c.3244C>T" "r.(?)" "p.(His1082Tyr)" "" "0000790038" "00000065" "70" "7525" "0" "7528" "0" "c.7525_7528dup" "r.(?)" "p.(Ser2510ThrfsTer3)" "" "0000791889" "00000065" "90" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630Ter)" "" "0000795625" "00000065" "70" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.spl?" "p.(?)" "" "0000802303" "00000065" "50" "236" "0" "236" "0" "c.236G>A" "r.(?)" "p.(Arg79Lys)" "" "0000802304" "00000065" "50" "442" "0" "442" "0" "c.442C>G" "r.(?)" "p.(Arg148Gly)" "" "0000802305" "00000065" "50" "4698" "0" "4698" "0" "c.4698C>T" "r.(?)" "p.(Arg1566=)" "" "0000802306" "00000065" "30" "5405" "0" "5405" "0" "c.5405G>T" "r.(?)" "p.(Arg1802Leu)" "" "0000802307" "00000065" "50" "7415" "0" "7415" "0" "c.7415G>T" "r.(?)" "p.(Gly2472Val)" "" "0000802308" "00000065" "50" "7916" "0" "7916" "0" "c.7916T>C" "r.(?)" "p.(Val2639Ala)" "" "0000802309" "00000065" "50" "8245" "0" "8245" "0" "c.8245G>C" "r.(?)" "p.(Gly2749Arg)" "" "0000812916" "00000065" "90" "1755" "0" "1755" "0" "c.1755del" "r.(?)" "p.(Ser585Argfs*14)" "12" "0000812919" "00000065" "90" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085*)" "" "0000815850" "00000065" "70" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277Ter)" "" "0000815875" "00000065" "70" "1300" "0" "1300" "0" "c.1300C>T" "r.(?)" "p.(Arg434*)" "" "0000819186" "00000065" "90" "2749" "1" "2749" "1" "c.2749+1G>C" "r.spl" "p.?" "" "0000819274" "00000065" "50" "5074" "0" "5074" "0" "c.5074G>C" "r.(?)" "p.(Val1692Leu)" "" "0000823840" "00000065" "50" "6429" "4" "6429" "4" "c.6429+4A>C" "r.spl" "p.?" "45i" "0000823843" "00000065" "70" "2131" "0" "2134" "0" "c.2131_2134dup" "r.(?)" "p.(Pro712LeufsTer4)" "15" "0000823847" "00000065" "50" "3665" "0" "3665" "0" "c.3665A>G" "r.(?)" "p.(Asp1222Gly)" "25" "0000823866" "00000065" "50" "3665" "0" "3665" "0" "c.3665A>G" "r.(?)" "p.(Asp1222Gly)" "25" "0000823943" "00000065" "50" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "18" "0000823944" "00000065" "70" "8396" "0" "8396" "0" "c.8396C>G" "r.(?)" "p.(Ser2799Cys)" "60" "0000823945" "00000065" "50" "3665" "0" "3665" "0" "c.3665A>G" "r.(?)" "p.(Asp1222Gly)" "25" "0000823965" "00000065" "50" "1963" "0" "1963" "0" "c.1963C>T" "r.(?)" "p.(Leu655Phe)" "14" "0000823992" "00000065" "50" "5969" "-4" "5969" "-4" "c.5969-4G>A" "r.spl" "p.?" "41i" "0000831317" "00000065" "50" "4993" "0" "4993" "0" "c.4993G>A" "r.(?)" "p.(Gly1665Arg)" "35" "0000833044" "00000065" "70" "5445" "1" "5445" "1" "c.5445+1G>A" "r.spl" "p.?" "" "0000833046" "00000065" "70" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000833076" "00000065" "70" "2584" "0" "2584" "0" "c.2584T>C" "r.(?)" "p.(Cys862Arg)" "" "0000833129" "00000065" "70" "7057" "0" "7057" "0" "c.7057C>T" "r.(?)" "p.(Arg2353Cys)" "" "0000833144" "00000065" "70" "2584" "0" "2584" "0" "c.2584T>C" "r.(?)" "p.(Cys862Arg)" "" "0000833197" "00000065" "70" "3928" "0" "3928" "0" "c.3928G>T" "r.(?)" "p.(Glu1310Ter)" "" "0000851063" "00000065" "10" "1798" "0" "1798" "0" "c.1798G>A" "r.(?)" "p.(Gly600Arg)" "" "0000851064" "00000065" "50" "2927" "0" "2927" "0" "c.2927C>T" "r.(?)" "p.(Ser976Leu)" "" "0000851065" "00000065" "50" "3466" "0" "3466" "0" "c.3466G>T" "r.(?)" "p.(Asp1156Tyr)" "" "0000851066" "00000065" "90" "4524" "-2" "4524" "-2" "c.4524-2A>G" "r.spl?" "p.?" "" "0000851067" "00000065" "30" "4959" "6" "4959" "6" "c.4959+6G>T" "r.(=)" "p.(=)" "" "0000851068" "00000065" "50" "5863" "0" "5863" "0" "c.5863C>G" "r.(?)" "p.(Leu1955Val)" "" "0000851069" "00000065" "30" "6708" "-3" "6708" "-3" "c.6708-3A>C" "r.spl?" "p.?" "" "0000851070" "00000065" "50" "9038" "0" "9038" "0" "c.9038A>C" "r.(?)" "p.(Asp3013Ala)" "" "0000860147" "00000065" "90" "819" "1" "819" "1" "c.819+1G>A" "r.spl?" "p.?" "" "0000860148" "00000065" "30" "910" "-14" "910" "-14" "c.910-14del" "r.(=)" "p.(=)" "" "0000860149" "00000065" "50" "2755" "0" "2755" "0" "c.2755C>T" "r.(?)" "p.(Arg919Cys)" "" "0000860150" "00000065" "50" "4010" "0" "4010" "0" "c.4010A>G" "r.(?)" "p.(His1337Arg)" "" "0000860151" "00000065" "50" "4010" "0" "4010" "0" "c.4010A>G" "r.(?)" "p.(His1337Arg)" "" "0000860152" "00000065" "30" "4674" "0" "4674" "0" "c.4674C>T" "r.(?)" "p.(Asp1558=)" "" "0000860153" "00000065" "30" "4803" "0" "4803" "0" "c.4803G>A" "r.(?)" "p.(Pro1601=)" "" "0000860154" "00000065" "30" "5072" "-6" "5072" "-6" "c.5072-6del" "r.(=)" "p.(=)" "" "0000860155" "00000065" "50" "5681" "0" "5681" "0" "c.5681A>G" "r.(?)" "p.(Glu1894Gly)" "" "0000860156" "00000065" "30" "6027" "0" "6027" "0" "c.6027T>G" "r.(?)" "p.(Asn2009Lys)" "" "0000860157" "00000065" "30" "6161" "0" "6161" "0" "c.6161A>G" "r.(?)" "p.(Gln2054Arg)" "" "0000860158" "00000065" "30" "6345" "0" "6345" "0" "c.6345C>T" "r.(?)" "p.(Pro2115=)" "" "0000860159" "00000065" "50" "7111" "0" "7111" "0" "c.7111T>G" "r.(?)" "p.(Phe2371Val)" "" "0000860160" "00000065" "30" "7300" "10" "7300" "10" "c.7300+10T>A" "r.(=)" "p.(=)" "" "0000860161" "00000065" "30" "7344" "0" "7344" "0" "c.7344T>C" "r.(?)" "p.(Asn2448=)" "" "0000860162" "00000065" "50" "7640" "0" "7640" "0" "c.7640G>A" "r.(?)" "p.(Gly2547Glu)" "" "0000860163" "00000065" "30" "8028" "0" "8028" "0" "c.8028T>C" "r.(?)" "p.(Asn2676=)" "" "0000860164" "00000065" "30" "8223" "0" "8223" "0" "c.8223G>A" "r.(?)" "p.(Thr2741=)" "" "0000860165" "00000065" "30" "8586" "0" "8586" "0" "c.8586T>C" "r.(?)" "p.(Tyr2862=)" "" "0000869853" "00000065" "70" "112" "47114" "112" "47114" "c.112+47114G>T" "r.(=)" "p.(=)" "" "0000869897" "00000065" "70" "2718" "0" "2718" "0" "c.2718del" "r.(?)" "p.(Phe906Leufs*169)" "" "0000870233" "00000065" "70" "112" "43141" "112" "43141" "c.112+43141C>G" "" "" "" "0000870581" "00000065" "70" "112" "45258" "112" "45258" "c.112+45258C>T" "" "" "" "0000870593" "00000065" "70" "112" "43247" "112" "43247" "c.112+43247C>G" "" "" "" "0000873905" "00000065" "10" "4750" "0" "4750" "0" "c.4750G>A" "r.(?)" "p.(Gly1584Ser)" "" "0000876270" "00000065" "90" "2962" "0" "2962" "0" "c.2962C>T" "r.(?)" "p.(Gln988*)" "" "0000876271" "00000065" "90" "4312" "-3327" "4436" "4" "c.4312-3327_4436+4dup" "r.?" "p.?" "29i_30i" "0000876272" "00000065" "90" "2538" "-1" "2538" "-1" "c.2538-1G>C" "r.spl" "p.?" "" "0000877943" "00000065" "70" "8556" "0" "8558" "0" "c.8556_8558del" "r.(?)" "p.(Ile2852del)" "" "0000877944" "00000065" "50" "821" "0" "821" "0" "c.821A>G" "r.(?)" "p.(Tyr274Cys)" "" "0000887032" "00000065" "50" "1507" "0" "1507" "0" "c.1507G>A" "r.(?)" "p.(Gly503Ser)" "" "0000887033" "00000065" "70" "2451" "-2" "2451" "-2" "c.2451-2A>G" "r.spl?" "p.?" "" "0000887034" "00000065" "50" "2744" "0" "2744" "0" "c.2744G>A" "r.(?)" "p.(Cys915Tyr)" "" "0000887035" "00000065" "30" "2881" "0" "2881" "0" "c.2881G>A" "r.(?)" "p.(Ala961Thr)" "" "0000887036" "00000065" "30" "4456" "0" "4456" "0" "c.4456G>A" "r.(?)" "p.(Ala1486Thr)" "" "0000887037" "00000065" "70" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "" "0000887038" "00000065" "50" "6691" "0" "6691" "0" "c.6691C>T" "r.(?)" "p.(Arg2231Cys)" "" "0000905254" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Ter)" "56" "0000905255" "00000065" "90" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl" "p.?" "6i" "0000905256" "00000065" "90" "5212" "0" "5212" "0" "c.5212G>T" "r.(?)" "p.(Glu1738Ter)" "36" "0000905257" "00000065" "90" "2538" "-1" "2749" "1" "c.(2537+1_2538-1)_(2749+1_2750-1)del" "r.?" "p.?" "18i_19i" "0000905258" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Ter)" "9" "0000905259" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905260" "00000065" "50" "8906" "0" "8906" "0" "c.8906G>C" "r.(?)" "p.(Arg2969Pro)" "63" "0000905261" "00000065" "50" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "18" "0000905262" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000905263" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905264" "00000065" "70" "1976" "0" "1976" "0" "c.1976C>A" "r.(?)" "p.(Ser659Ter)" "14" "0000905265" "00000065" "90" "4301" "0" "4301" "0" "c.4301C>A" "r.(?)" "p.(Ser1434Ter)" "29" "0000905266" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905267" "00000065" "90" "3279" "0" "3279" "0" "c.3279C>A" "r.(?)" "p.(Cys1093Ter)" "23" "0000905268" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905269" "00000065" "70" "6050" "0" "6053" "0" "c.6050_6053del" "r.(?)" "p.(Asn2017ThrfsTer48)" "42" "0000905270" "00000065" "90" "5290" "0" "5290" "0" "c.5290dup" "r.(?)" "p.(Glu1764GlyfsTer3)" "37" "0000905271" "00000065" "90" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Gln95Ter)" "2" "0000905272" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641Ter)" "57" "0000905273" "00000065" "90" "6993" "-2" "6993" "-2" "c.6993-2A>G" "r.spl" "p.?" "49i" "0000905274" "00000065" "90" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095Ter)" "23" "0000905275" "00000065" "90" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273Ter)" "5" "0000905276" "00000065" "90" "284" "-1" "639" "1" "c.(283+1_284-1)_(639+1_640-1)del" "r.?" "p.?" "2i_4i" "0000905277" "00000065" "90" "3318" "0" "3319" "0" "c.3318_3319del" "r.(?)" "p.(Cys1106Ter)" "23" "0000905278" "00000065" "70" "4960" "-2" "4960" "-2" "c.4960-2A>G" "r.spl" "p.?" "34i" "0000905279" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744Ter)" "16" "0000905280" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905281" "00000065" "90" "482" "0" "485" "0" "c.482_485dup" "r.(?)" "p.(Glu162AspfsTer2)" "4" "0000905282" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905283" "00000065" "70" "9232" "0" "9267" "0" "c.9232_9267dup" "r.(?)" "p.(Leu3078_Arg3089dup)" "65" "0000905284" "00000065" "90" "8226" "0" "8226" "0" "c.8226del" "r.(?)" "p.(Thr2743ProfsTer4)" "57" "0000905285" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905286" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905287" "00000065" "90" "1782" "2" "1782" "2" "c.1782+2T>G" "r.spl" "p.?" "12" "0000905288" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641Ter)" "57" "0000905289" "00000065" "90" "2447" "0" "2447" "0" "c.2447del" "r.(?)" "p.(Asn816IlefsTer9)" "17" "0000905290" "00000065" "90" "285" "0" "288" "0" "c.285_288del" "r.(?)" "p.(Gln95HisfsTer29)" "3" "0000905291" "00000065" "90" "6868" "-1" "6992" "1" "c.(6867+1_6868-1)_(6992+1_6993-1)del" "r.?" "p.?" "48i_49i" "0000905292" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905293" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905294" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905295" "00000065" "50" "469" "0" "469" "0" "c.469T>C" "r.(?)" "p.(Ser157Pro)" "4" "0000905296" "00000065" "70" "1207" "-1" "1306" "1" "c.(1206+1_1207-1)_(1306+1_1307-1)del" "r.?" "p.?" "8i_9i" "0000905297" "00000065" "90" "6527" "0" "6528" "0" "c.6527_6528del" "r.(?)" "p.(Thr2176SerfsTer4)" "46" "0000905298" "00000065" "90" "2750" "-1" "2856" "1" "c.(2749+1_2750-1)_(2856+1_2857-1)del" "r.?" "p.?" "19i_20i" "0000905299" "00000065" "90" "7383" "0" "7387" "0" "c.7383_7387del" "r.(?)" "p.(Asp2461GlufsTer4)" "52" "0000905300" "00000065" "90" "6868" "-1" "8075" "1" "c.(6867+1_6868-1)_(8075+1_8076-1)del" "r.?" "p.?" "48i_57i" "0000905301" "00000065" "90" "4522" "0" "4522" "0" "c.4522del" "r.(?)" "p.(Arg1508GlyfsTer87)" "31" "0000905302" "00000065" "90" "2206" "0" "2206" "0" "c.2206G>T" "r.(?)" "p.(Glu736Ter)" "15" "0000905303" "00000065" "70" "3735" "2" "3735" "8" "c.3735+2_3735+8delinsAAAGAAGGA" "r.spl" "p.?" "25i" "0000905304" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905305" "00000065" "50" "3038" "-7" "3038" "-7" "c.3038-7G>A" "r.spl" "p.?" "21i" "0000905306" "00000065" "70" "1580" "0" "1580" "0" "c.1580G>A" "r.(?)" "p.(Cys527Tyr)" "11" "0000905307" "00000065" "70" "4058" "0" "4058" "0" "c.4058G>A" "r.spl" "p.?" "27" "0000905308" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905309" "00000065" "90" "1307" "-1" "1782" "1" "c.(1306+1_1307-1)_(1782+1_1783-1)del" "r.?" "p.?" "9i_12i" "0000905310" "00000065" "90" "7991" "0" "7991" "0" "c.7991del" "r.(?)" "p.(Gly2664ValfsTer64)" "57" "0000905311" "00000065" "90" "1153" "0" "1154" "0" "c.1153_1154del" "r.(?)" "p.(Thr385CysfsTer10)" "8" "0000905312" "00000065" "90" "2526" "0" "2529" "0" "c.2526_2529dup" "r.(?)" "p.(Cys844ThrfsTer3)" "18" "0000905313" "00000065" "90" "5290" "0" "5290" "0" "c.5290dup" "r.(?)" "p.(Glu1764GlyfsTer3)" "37" "0000905314" "00000065" "90" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630Ter)" "56" "0000905315" "00000065" "90" "2434" "0" "2435" "0" "c.2434_2435del" "r.(?)" "p.(Asn812TyrfsTer5)" "17" "0000905316" "00000065" "90" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450Ter)" "30" "0000905317" "00000065" "90" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273Ter)" "5" "0000905318" "00000065" "50" "8906" "0" "8906" "0" "c.8906G>C" "r.(?)" "p.(Arg2969Pro)" "63" "0000905319" "00000065" "90" "640" "-1" "640" "-1" "c.640-1G>C" "r.spl" "p.?" "4i" "0000905320" "00000065" "90" "8987" "0" "8987" "0" "c.8987del" "r.(?)" "p.(Lys2996SerfsTer2)" "63" "0000905321" "00000065" "90" "7991" "0" "7991" "0" "c.7991del" "r.(?)" "p.(Gly2664ValfsTer64)" "57" "0000905322" "00000065" "90" "8245" "-1" "8988" "1" "c.(8244+1_8245-1)_(8988+1_8989-1)del" "r.?" "p.?" "58i_63i" "0000905323" "00000065" "50" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.spl" "p.?" "58i" "0000905324" "00000065" "90" "113" "-1" "1306" "1" "c.(112+1_113-1)_(1306+1_1307-1)del" "r.?" "p.?" "1i_9i" "0000905325" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905326" "00000065" "90" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319Ter)" "27" "0000905327" "00000065" "50" "1553" "0" "1553" "0" "c.1553G>A" "r.(?)" "p.(Cys518Tyr)" "11" "0000905328" "00000065" "90" "2958" "0" "2958" "0" "c.2958G>A" "r.(?)" "p.(Trp986Ter)" "21" "0000905329" "00000065" "90" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.(3555_3556ins3556-11_3556-1)" "p.(Val1186ThtfsTer4)" "23" "0000905330" "00000065" "90" "1307" "-1" "1782" "1" "c.(1306+1_1307-1)_(1782+1_1783-1)dup" "r.?" "p.?" "9i_12i" "0000905331" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000905332" "00000065" "90" "1127" "0" "1127" "0" "c.1127del" "r.(?)" "p.(Gly376ValfsTer13)" "8" "0000905333" "00000065" "90" "283" "1" "283" "1" "c.283+1G>C" "r.spl" "p.?" "2i" "0000905334" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744Ter)" "16" "0000905335" "00000065" "90" "3931" "0" "3931" "0" "c.3931T>G" "r.(?)" "p.(Trp1311Gly)" "27" "0000905336" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905337" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905338" "00000065" "90" "113" "-1" "396" "1" "c.(112+1_113-1)_(396+1_397-1)del" "r.?" "p.?" "1i_3i" "0000905339" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905340" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905341" "00000065" "90" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Gln95Ter)" "2" "0000905342" "00000065" "90" "4058" "1" "4058" "1" "c.4058+1G>A" "r.spl" "p.?" "27i" "0000905343" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905344" "00000065" "90" "817" "0" "817" "0" "c.817A>T" "r.(?)" "p.(Arg273Ter)" "5" "0000905345" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000905346" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905347" "00000065" "50" "8358" "-3" "8358" "-3" "c.8358-3C>G" "r.spl" "p.?" "59i" "0000905348" "00000065" "90" "482" "0" "485" "0" "c.482_485dup" "r.(?)" "p.(Glu162AspfsTer2)" "4" "0000905349" "00000065" "90" "8245" "-1" "8988" "1" "c.(8244+1_8245-1)_(8988+1_8989-1)del" "r.?" "p.?" "58i_63i" "0000905350" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905351" "00000065" "90" "6268" "2" "6268" "2" "c.6268+2T>C" "r.spl" "p.?" "43i" "0000905352" "00000065" "50" "4312" "-3" "4312" "-3" "c.4312-3C>G" "r.spl" "p.?" "29i" "0000905353" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>T" "r.spl" "p.?" "58i" "0000905354" "00000065" "50" "437" "0" "437" "0" "c.437C>A" "r.(?)" "p.(Ser146Tyr)" "4" "0000905355" "00000065" "90" "9311" "0" "9311" "0" "c.9311dup" "r.(?)" "p.(Asn3104LysfsTer38)" "65" "0000905356" "00000065" "90" "8844" "0" "8845" "0" "c.8844_8845insAAGGCTC" "r.(?)" "p.(Phe2949LysfsTer21)" "62" "0000905357" "00000065" "50" "437" "0" "437" "0" "c.437C>A" "r.(?)" "p.(Ser146Tyr)" "4" "0000905358" "00000065" "50" "830" "0" "830" "0" "c.830C>T" "r.(?)" "p.(Ser277Leu)" "5" "0000905359" "00000065" "90" "7927" "0" "7927" "0" "c.7927del" "r.(?)" "p.(Arg2643GlufsTer7)" "56" "0000905360" "00000065" "90" "3149" "0" "3149" "0" "c.3149del" "r.(?)" "p.(Gly1050AlafsTer25)" "22" "0000905361" "00000065" "90" "1300" "0" "1300" "0" "c.1300C>T" "r.(?)" "p.(Arg434Ter)" "9" "0000905362" "00000065" "90" "0" "0" "0" "0" "c.(5072-2432_5072-1409)_*219{0}" "r.?" "p.?" "35i_65_" "0000905363" "00000065" "70" "6634" "0" "6645" "0" "c.6634_6645del" "r.(?)" "p.(Ser2212_Gly2215del)" "47" "0000905364" "00000065" "50" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Ser146Phe)" "4" "0000905365" "00000065" "50" "443" "0" "443" "0" "c.443G>A" "r.(?)" "p.(Arg148Gln)" "4" "0000905366" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Ter)" "56" "0000905367" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Ter)" "56" "0000905368" "00000065" "90" "5212" "0" "5212" "0" "c.5212G>T" "r.(?)" "p.(Glu1738Ter)" "36" "0000905369" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905370" "00000065" "50" "8906" "0" "8906" "0" "c.8906G>C" "r.(?)" "p.(Arg2969Pro)" "63" "0000905371" "00000065" "50" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "18" "0000905372" "00000065" "90" "4301" "0" "4301" "0" "c.4301C>A" "r.(?)" "p.(Ser1434Ter)" "29" "0000905373" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905374" "00000065" "90" "2447" "0" "2447" "0" "c.2447del" "r.(?)" "p.(Asn816IlefsTer9)" "17" "0000905375" "00000065" "90" "7383" "0" "7387" "0" "c.7383_7387del" "r.(?)" "p.(Asp2461GlufsTer4)" "52" "0000905376" "00000065" "90" "6868" "-1" "8075" "1" "c.(6867+1_6868-1)_(8075+1_8076-1)del" "r.?" "p.?" "48i_57i" "0000905377" "00000065" "70" "4058" "0" "4058" "0" "c.4058G>A" "r.spl" "p.?" "27" "0000905378" "00000065" "90" "1153" "0" "1154" "0" "c.1153_1154del" "r.(?)" "p.(Thr385CysfsTer10)" "8" "0000905379" "00000065" "90" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.(3555_3556ins3556-11_3556-1)" "p.(Val1186ThtfsTer4)" "23" "0000905380" "00000065" "90" "283" "1" "283" "1" "c.283+1G>C" "r.spl" "p.?" "2i" "0000905381" "00000065" "90" "113" "-1" "396" "1" "c.(112+1_113-1)_(396+1_397-1)del" "r.?" "p.?" "1i_3i" "0000905382" "00000065" "90" "0" "0" "0" "0" "c.(5072-2432_5072-1409)_*219{0}" "r.?" "p.?" "35i_65_" "0000905383" "00000065" "50" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Ser146Phe)" "4" "0000905384" "00000065" "90" "" "0" "" "0" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0000905385" "00000065" "90" "284" "-1" "639" "1" "c.(283+1_284-1)_(639+1_640-1)del" "r.?" "p.?" "2i_4i" "0000905386" "00000065" "90" "7750" "-2" "7750" "-2" "c.7750-2A>G" "r.spl" "p.?" "55i" "0000905387" "00000065" "90" "3294" "0" "3294" "0" "c.3294G>A" "r.(?)" "p.(Trp1098Ter)" "23" "0000905388" "00000065" "90" "1942" "0" "1942" "0" "c.1942G>T" "r.(?)" "p.(Glu648Ter)" "14" "0000905389" "00000065" "90" "640" "-1" "819" "1" "c.(639+1_640-1)_(819+1_820-1)del" "r.?" "p.?" "4i_5i" "0000905390" "00000065" "90" "4312" "-1" "4436" "1" "c.(4311+1_4312-1)_(4436+1_4437-1)del" "r.?" "p.?" "29i_30i" "0000905391" "00000065" "90" "5563" "-1" "5563" "-1" "c.5563-1G>A" "r.spl" "p.?" "38i" "0000905392" "00000065" "90" "1522" "0" "1522" "0" "c.1522C>T" "r.(?)" "p.(Gln508Ter)" "11" "0000905393" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641Ter)" "57" "0000905394" "00000065" "90" "5687" "0" "5687" "0" "c.5687dup" "r.(?)" "p.(His1896GlnfsTer7)" "39" "0000905395" "00000065" "90" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400Ter)" "29" "0000905396" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121Ter)" "3" "0000905397" "00000065" "50" "6584" "0" "6584" "0" "c.6584T>C" "r.(?)" "p.(Leu2195Pro)" "47" "0000905398" "00000065" "90" "250" "0" "250" "0" "c.250C>T" "r.(?)" "p.(Arg84Ter)" "2" "0000905399" "00000065" "70" "2749" "2" "2749" "2" "c.2749+2dup" "r.spl" "p.?" "19i" "0000905400" "00000065" "50" "7898" "0" "7898" "0" "c.7898G>C" "r.spl" "p.?" "56" "0000905401" "00000065" "90" "910" "-1" "910" "-1" "c.910-1G>T" "r.spl" "p.?" "6i" "0000905402" "00000065" "90" "3002" "0" "3002" "0" "c.3002dup" "r.(?)" "p.(His1001GlnfsTer15)" "21" "0000905403" "00000065" "50" "8388" "0" "8388" "0" "c.8388A>C" "r.(?)" "p.(Glu2796Asp)" "60" "0000905404" "00000065" "70" "1545" "0" "1545" "0" "c.1545C>A" "r.(?)" "p.(Cys515Ter)" "11" "0000905405" "00000065" "90" "283" "0" "283" "0" "c.283C>T" "r.(?)" "p.(Gln95Ter)" "2" "0000905406" "00000065" "50" "2177" "0" "2177" "0" "c.2177G>A" "r.(?)" "p.(Cys726Tyr)" "15" "0000905407" "00000065" "50" "3038" "-7" "3038" "-7" "c.3038-7G>A" "r.spl" "p.?" "21i" "0000905408" "00000065" "90" "" "0" "" "0" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0000905409" "00000065" "50" "909" "5" "909" "18" "c.909+5_909+18del" "r.spl" "p.?" "6i" "0000905410" "00000065" "90" "2844" "0" "2844" "0" "c.2844T>A" "r.(?)" "p.(Cys948Ter)" "20" "0000905411" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905412" "00000065" "90" "6466" "0" "6466" "0" "c.6466C>T" "r.(?)" "p.(Arg2156Ter)" "46" "0000905413" "00000065" "90" "8217" "0" "8217" "0" "c.8217dup" "r.(?)" "p.(Pro2740SerfsTer40)" "58" "0000905414" "00000065" "90" "5126" "0" "5133" "0" "c.5126_5133del" "r.(?)" "p.(Ala1709GlufsTer11)" "36" "0000905415" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "27" "0000905416" "00000065" "90" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319Ter)" "27" "0000905417" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905418" "00000065" "90" "1900" "0" "1903" "0" "c.1900_1903dup" "r.(?)" "p.(Ser635AsnfsTer7)" "14" "0000905419" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905420" "00000065" "90" "7156" "-2" "7156" "-2" "c.7156-2A>G" "r.spl" "p.?" "50i" "0000905421" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905422" "00000065" "70" "3556" "-1" "3556" "-1" "c.3556-1G>A" "r.spl" "p.?" "24i" "0000905423" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826Ter)" "38" "0000905424" "00000065" "90" "6466" "0" "6466" "0" "c.6466C>T" "r.(?)" "p.(Arg2156Ter)" "46" "0000905425" "00000065" "90" "56" "0" "56" "0" "c.56dup" "r.(?)" "p.(Val20ArgfsTer30)" "1" "0000905426" "00000065" "90" "6433" "0" "6433" "0" "c.6433A>T" "r.(?)" "p.(Lys2145Ter)" "46" "0000905427" "00000065" "50" "2055" "0" "2057" "0" "c.2055_2057del" "r.(?)" "p.(Leu686del)" "14" "0000905428" "00000065" "90" "463" "0" "463" "0" "c.463G>T" "r.(?)" "p.(Glu155Ter)" "4" "0000905429" "00000065" "90" "1783" "-1" "2097" "-2947" "c.(1782+1_1783-1)_(2097-2947_2097-1)del" "r.?" "p.?" "12i_14i" "0000905430" "00000065" "90" "640" "-1" "640" "-1" "c.640-1G>C" "r.spl" "p.?" "4i" "0000905431" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000905432" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "50" "0000905433" "00000065" "90" "9101" "0" "9104" "0" "c.9101_9104dup" "r.(?)" "p.(His3035GlnfsTer5)" "64" "0000905434" "00000065" "50" "3904" "0" "3904" "0" "c.3904C>T" "r.(?)" "p.(His1302Tyr)" "26" "0000905435" "00000065" "90" "8264" "0" "8264" "0" "c.8264C>A" "r.(?)" "p.(Ser2755Ter)" "59" "0000905436" "00000065" "90" "6868" "-1" "6992" "1" "c.(6867+1_6868-1)_(6992+1_6993-1)del" "r.?" "p.?" "48i_49i" "0000905437" "00000065" "90" "640" "-1" "1206" "1" "c.(639+1_640-1)_(1206+1_1207-1)dup" "r.?" "p.?" "4i_8i" "0000905438" "00000065" "90" "3726" "0" "3726" "0" "c.3726del" "r.(?)" "p.(Gly1243GlufsTer4)" "25" "0000905439" "00000065" "90" "7991" "0" "7991" "0" "c.7991del" "r.(?)" "p.(Gly2664ValfsTer64)" "57" "0000905440" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000905441" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905442" "00000065" "90" "" "0" "" "0" "c.(112+1_113-1)_(1782+1_1783-1))del" "r.?" "p.?" "1i_12i" "0000905443" "00000065" "70" "3096" "0" "3096" "0" "c.3096C>A" "r.(?)" "p.(Cys1032Ter)" "22" "0000905444" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826Ter)" "38" "0000905445" "00000065" "50" "8906" "0" "8906" "0" "c.8906G>C" "r.(?)" "p.(Arg2969Pro)" "63" "0000905446" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "55" "0000905447" "00000065" "50" "6584" "0" "6584" "0" "c.6584T>C" "r.(?)" "p.(Leu2195Pro)" "47" "0000905448" "00000065" "90" "2565" "0" "2565" "0" "c.2565del" "r.(?)" "p.(Ser856LeufsTer32)" "19" "0000905449" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905450" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826Ter)" "38" "0000905451" "00000065" "90" "4886" "0" "4886" "0" "c.4886del" "r.(?)" "p.(Pro1629GlnfsTer12)" "34" "0000905452" "00000065" "90" "928" "0" "928" "0" "c.928del" "r.(?)" "p.(Glu310SerfsTer27)" "7" "0000905453" "00000065" "90" "8910" "0" "8965" "0" "c.8910_8965del" "r.(?)" "p.(Thr2971TyrfsTer2)" "63" "0000905454" "00000065" "90" "6207" "0" "6207" "0" "c.6207C>A" "r.(?)" "p.(Tyr2069Ter)" "43" "0000905455" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Ter)" "56" "0000905456" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000905457" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Ter)" "9" "0000905458" "00000065" "90" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319Ter)" "27" "0000905459" "00000065" "90" "5071" "1" "5071" "1" "c.5071+1G>A" "r.spl" "p.?" "35i" "0000905460" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000905461" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641Ter)" "57" "0000905462" "00000065" "90" "7921" "0" "7921" "0" "c.7921G>T" "r.(?)" "p.(Glu2641Ter)" "57" "0000905463" "00000065" "90" "329" "0" "329" "0" "c.329G>A" "r.(?)" "p.(Trp110Ter)" "3" "0000905464" "00000065" "90" "5862" "0" "5862" "0" "c.5862del" "r.(?)" "p.(Lys1954AsnfsTer10)" "40" "0000905465" "00000065" "90" "4058" "1" "4058" "1" "c.4058+1G>A" "r.spl" "p.?" "27i" "0000905466" "00000065" "90" "2959" "0" "2959" "0" "c.2959dup" "r.(?)" "p.(Cys987LeufsTer11)" "21" "0000905467" "00000065" "90" "5866" "-1" "6707" "1" "c.(5865+1_5866-1)_(6707+1_6708-1)del" "r.?" "p.?" "40i_47i" "0000905468" "00000065" "90" "363" "0" "363" "0" "c.363C>G" "r.(?)" "p.(Tyr121Ter)" "3" "0000905469" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Ter)" "56" "0000905470" "00000065" "90" "5156" "0" "5159" "0" "c.5156_5159del" "r.(?)" "p.(Lys1719ArgfsTer5)" "36" "0000905471" "00000065" "90" "4311" "2" "4311" "2" "c.4311+2T>C" "r.spl" "p.?" "29i" "0000905472" "00000065" "90" "640" "-1" "640" "-1" "c.640-1G>C" "r.spl" "p.?" "4i" "0000905473" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "14" "0000905474" "00000065" "90" "1732" "0" "1736" "0" "c.1732_1736del" "r.(?)" "p.(Leu578AlafsTer30)" "12" "0000905475" "00000065" "90" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "27" "0000905476" "00000065" "90" "397" "-1" "639" "1" "c.(396+1_397-1)_(639+1_640-1)del" "r.?" "p.?" "3i_4i" "0000905477" "00000065" "90" "8815" "0" "8815" "0" "c.8815C>T" "r.(?)" "p.(Gln2939Ter)" "61" "0000905478" "00000065" "90" "8245" "-1" "8988" "1" "c.(8244+1_8245-1)_(8988+1_8989-1)del" "r.?" "p.?" "58i_63i" "0000905479" "00000065" "50" "1544" "0" "1544" "0" "c.1544G>A" "r.(?)" "p.(Cys515Tyr)" "11" "0000905480" "00000065" "50" "1358" "0" "1358" "0" "c.1358G>C" "r.(?)" "p.(Cys453Ser)" "10" "0000905481" "00000065" "50" "332" "0" "332" "0" "c.332A>C" "r.(?)" "p.(Gln111Pro)" "3" "0000905482" "00000065" "90" "6235" "0" "6235" "0" "c.6235del" "r.(?)" "p.(Thr2079ArgfsTer24)" "43" "0000905483" "00000065" "90" "" "0" "" "0" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0000905484" "00000065" "90" "" "0" "" "0" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0000905485" "00000065" "90" "7750" "-2" "7750" "-2" "c.7750-2A>G" "r.spl" "p.?" "55i" "0000905486" "00000065" "90" "640" "-1" "819" "1" "c.(639+1_640-1)_(819+1_820-1)del" "r.?" "p.?" "4i_5i" "0000905487" "00000065" "90" "4312" "-1" "4436" "1" "c.(4311+1_4312-1)_(4436+1_4437-1)del" "r.?" "p.?" "29i_30i" "0000905488" "00000065" "90" "5687" "0" "5687" "0" "c.5687dup" "r.(?)" "p.(His1896GlnfsTer7)" "39" "0000905489" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121Ter)" "3" "0000905490" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "27" "0000905491" "00000065" "90" "56" "0" "56" "0" "c.56dup" "r.(?)" "p.(Val20ArgfsTer30)" "1" "0000905492" "00000065" "90" "6433" "0" "6433" "0" "c.6433A>T" "r.(?)" "p.(Lys2145Ter)" "46" "0000905493" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "46" "0000905494" "00000065" "90" "8264" "0" "8264" "0" "c.8264C>A" "r.(?)" "p.(Ser2755Ter)" "59" "0000905495" "00000065" "90" "4886" "0" "4886" "0" "c.4886del" "r.(?)" "p.(Pro1629GlnfsTer12)" "34" "0000905496" "00000065" "90" "7810" "0" "7810" "0" "c.7810C>T" "r.(?)" "p.(Arg2604Ter)" "56" "0000905497" "00000065" "90" "5071" "1" "5071" "1" "c.5071+1G>A" "r.spl" "p.?" "35i" "0000905498" "00000065" "50" "1358" "0" "1358" "0" "c.1358G>C" "r.(?)" "p.(Cys453Ser)" "10" "0000906280" "00000065" "90" "6430" "-1" "6707" "1" "c.(6429+1_6430-1)_(6707+1_6708-1)del" "r.?" "p.?" "45i_47i" "0000906281" "00000065" "90" "4678" "0" "4684" "0" "c.4678_4684del" "r.(?)" "p.(Cys1560ThrfsTer33)" "" "0000906282" "00000065" "90" "4973" "0" "4979" "0" "c.4973_4979del" "r.(?)" "p.(Thr1658MetfsTer33)" "" "0000906283" "00000065" "90" "461" "0" "461" "0" "c.461dup" "r.(?)" "p.(Leu154PhefsTer6)" "" "0000906284" "00000065" "50" "4157" "0" "4157" "0" "c.4157A>T" "r.(?)" "p.(Tyr1386Phe)" "" "0000906285" "00000065" "50" "4880" "0" "4880" "0" "c.4880G>A" "r.(?)" "p.(Arg1627Gln)" "" "0000906286" "00000065" "50" "6586" "0" "6586" "0" "c.6586G>C" "r.(?)" "p.(Ala2196Pro)" "" "0000906287" "00000065" "90" "5530" "0" "5530" "0" "c.5530C>A" "r.(?)" "p.(Arg1844Ser)" "" "0000906288" "00000065" "90" "2413" "0" "2413" "0" "c.2413C>T" "r.(?)" "p.(Gln805Ter)" "" "0000906289" "00000065" "90" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319Ter)" "" "0000906290" "00000065" "90" "2844" "0" "2844" "0" "c.2844T>A" "r.(?)" "p.(Cys948Ter)" "" "0000906291" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Arg1549Ter)" "" "0000906292" "00000065" "90" "8049" "0" "8049" "0" "c.8049C>A" "r.(?)" "p.(Cys2683Ter)" "" "0000906293" "00000065" "90" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085Ter)" "" "0000906294" "00000065" "50" "909" "7" "909" "7" "c.909+7A>G" "r.spl" "p.?" "" "0000906295" "00000065" "70" "3736" "-2" "3736" "-2" "c.3736-2A>G" "r.spl" "p.?" "" "0000906296" "00000065" "90" "1207" "-1" "1207" "-1" "c.1207-1G>T" "r.spl" "p.?" "" "0000906297" "00000065" "90" "2451" "-6" "2451" "-6" "c.2451-6A>G" "r.spl" "p.?" "" "0000906298" "00000065" "90" "4523" "1" "4523" "1" "c.4523+1G>A" "r.spl" "p.?" "" "0000907877" "00000065" "90" "3372" "0" "3372" "0" "c.3372del" "r.(?)" "p.(Lys1124Asnfs*15)" "23" "0000909540" "00000065" "70" "113" "-50" "1782" "50" "c.(112+1_113-50)_(1782+50_1783-1)dup" "r.?" "p.?" "1i_12i" "0000909541" "00000065" "50" "3924" "0" "3924" "0" "c.3924G>A" "r.spl?" "p.(?)" "26i" "0000912402" "00000065" "30" "255" "0" "255" "0" "c.255C>T" "r.(?)" "p.(Ile85=)" "" "0000912403" "00000065" "30" "1467" "12" "1467" "12" "c.1467+12A>G" "r.(=)" "p.(=)" "" "0000912404" "00000065" "30" "2462" "0" "2462" "0" "c.2462C>T" "r.(?)" "p.(Thr821Met)" "" "0000917092" "00000065" "90" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095Ter)" "" "0000917098" "00000065" "70" "671" "0" "671" "0" "c.671del" "r.(?)" "p.(Ser224MetfsTer10)" "" "0000917099" "00000065" "70" "8541" "0" "8541" "0" "c.8541del" "r.(?)" "p.(Trp2847CysfsTer6)" "" "0000920787" "00000065" "70" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.(3555_3556ins3556-11_3556-1)" "p.(Val1186Thrfs*4)" "" "0000920788" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435*)" "9" "0000920789" "00000065" "70" "3556" "-13" "3556" "-13" "c.3556-13T>A" "r.(3555_3556ins3556-11_3556-1)" "p.(Val1186Thrfs*4)" "24i" "0000920790" "00000065" "90" "8979" "0" "8982" "0" "c.8979_8982dup" "r.(?)" "p.(Glu2995*)" "63" "0000920791" "00000065" "70" "4717" "5" "4717" "5" "c.4717+5G>A" "r.spl?" "p.?" "" "0000920792" "00000065" "90" "7156" "-5" "7157" "0" "c.7156-5_7157delinsT" "r.spl" "p.?" "50i_51" "0000920793" "00000065" "90" "4644" "0" "4644" "0" "c.4644C>A" "r.(?)" "p.(Cys1548*)" "32" "0000920794" "00000065" "90" "284" "-1" "396" "1" "c.(283+1_284-1)_(396+1_397-1)del" "r.(284_396el)" "p.(Gln95fs)" "2i_3i" "0000927505" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.5562_5563ins[gugac;5562+6_5562+11]" "p.Tyr1855Leufs*5" "38i" "0000927506" "00000065" "70" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.8076_8244del" "p.Pro2693Valfs*12" "58i" "0000929146" "00000065" "50" "437" "0" "437" "0" "c.437C>G" "r.(?)" "p.(Ser146Cys)" "" "0000929147" "00000065" "30" "1403" "0" "1403" "0" "c.1403C>G" "r.(?)" "p.(Ala468Gly)" "" "0000929148" "00000065" "30" "2430" "0" "2430" "0" "c.2430A>C" "r.(?)" "p.(=)" "" "0000929149" "00000065" "30" "3030" "0" "3030" "0" "c.3030C>A" "r.(?)" "p.(=)" "" "0000931956" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931957" "00000065" "70" "3235" "0" "3235" "0" "c.3235T>C" "r.(?)" "p.(Cys1079Arg)" "" "0000931958" "00000065" "90" "7581" "0" "7581" "0" "c.7581C>A" "r.(?)" "p.(Tyr2527Ter)" "" "0000931959" "00000065" "90" "2050" "0" "2060" "0" "c.2050_2060del" "r.(?)" "p.(Val684AsnfsTer17)" "" "0000931960" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931961" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931962" "00000065" "70" "4960" "-17" "4960" "-17" "c.4960-17C>A" "r.spl" "p.?" "" "0000931963" "00000065" "90" "2050" "0" "2060" "0" "c.2050_2060del" "r.(?)" "p.(Val684AsnfsTer17)" "" "0000931964" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000931965" "00000065" "90" "3235" "0" "3235" "0" "c.3235T>C" "r.(?)" "p.(Cys1079Arg)" "" "0000931966" "00000065" "90" "2050" "0" "2060" "0" "c.2050_2060del" "r.(?)" "p.(Val684AsnfsTer17)" "" "0000931967" "00000065" "70" "4536" "0" "4537" "0" "c.4536_4537del" "r.(?)" "p.(Thr1514TrpfsTer14)" "" "0000931968" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029Ter)" "" "0000931969" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931970" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000931971" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931972" "00000065" "70" "8556" "0" "8558" "0" "c.8556_8558del" "r.(?)" "p.(Ile2852del)" "" "0000931973" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000931974" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029Ter)" "" "0000931975" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0000931976" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000931977" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029Ter)" "" "0000931978" "00000065" "90" "7750" "-1" "7898" "1" "c.(7749+1_7750-1)_(7898+1_7899-1)del" "r.?" "p.?" "55i_56i" "0000931979" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931980" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000931981" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl" "p.?" "" "0000931982" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000931983" "00000065" "90" "7750" "-1" "7898" "1" "c.(7749+1_7750-1)_(7898+1_7899-1)del" "r.?" "p.?" "55i_56i" "0000931984" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931985" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931986" "00000065" "90" "3372" "0" "3372" "0" "c.3372dup" "r.(?)" "p.(Cys1125MetfsTer4)" "" "0000931987" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121Ter)" "" "0000931988" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581ProfsTer5)" "" "0000931989" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000931990" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000931991" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931992" "00000065" "90" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450Ter)" "" "0000931993" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>G" "r.(?)" "p.(Thr821Ala)" "" "0000931994" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl" "p.?" "" "0000931995" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931996" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419LeufsTer4)" "" "0000931997" "00000065" "90" "363" "0" "363" "0" "c.363C>A" "r.(?)" "p.(Tyr121Ter)" "" "0000931998" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000931999" "00000065" "90" "2489" "0" "2492" "0" "c.2489_2492del" "r.(?)" "p.(Leu830SerfsTer57)" "" "0000932000" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000932001" "00000065" "90" "2050" "0" "2060" "0" "c.2050_2060del" "r.(?)" "p.(Val684AsnfsTer17)" "" "0000932002" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581ProfsTer5)" "" "0000932003" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000932004" "00000065" "90" "2050" "0" "2060" "0" "c.2050_2060del" "r.(?)" "p.(Val684AsnfsTer17)" "" "0000932005" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581ProfsTer5)" "" "0000932006" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "" "0000932007" "00000065" "90" "8775" "0" "8775" "0" "c.8775del" "r.(?)" "p.(Thr2926ProfsTer39)" "" "0000932008" "00000065" "90" "4740" "0" "4741" "0" "c.4740_4741insG" "r.(?)" "p.(Leu1581AlafsTer5)" "" "0000932009" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000932010" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>C" "r.(?)" "p.(Thr821Pro)" "" "0000932011" "00000065" "70" "4960" "-17" "4960" "-17" "c.4960-17C>A" "r.spl" "p.?" "" "0000932012" "00000065" "90" "1129" "0" "1129" "0" "c.1129dup" "p.(Tyr2527Ter)" "p.(Val377GlyfsTer4)" "" "0000932013" "00000065" "90" "" "0" "" "0" "c.(112+1_113-1)__(1306+1_1307-1)del" "r.?" "p.?" "1i_9i" "0000932014" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl" "p.?" "" "0000932015" "00000065" "90" "1590" "0" "1590" "0" "c.1590delinsN[35]" "r.?" "p.(Tyr531Glyfs*27)" "11" "0000932016" "00000065" "70" "4176" "1" "4176" "1" "c.4176+1G>A" "r.spl" "p.?" "" "0000932017" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl" "p.?" "" "0000932018" "00000065" "50" "5651" "0" "5651" "0" "c.5651G>A" "r.(?)" "p.(Arg1884Lys)" "" "0000932019" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000932020" "00000065" "70" "4960" "-17" "4960" "-17" "c.4960-17C>A" "r.spl" "p.?" "" "0000932021" "00000065" "90" "7750" "-1" "7898" "1" "c.(7749+1_7750-1)_(7898+1_7899-1)del" "r.?" "p.?" "55i_56i" "0000932022" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000932023" "00000065" "90" "2097" "-1" "2208" "1" "c.(2096+1_2097-1)_(2208+1_2209-1)del" "r.?" "p.?" "14i_15i" "0000932024" "00000065" "90" "1854" "0" "1861" "0" "c.1854_1861dup" "r.(?)" "p.(Leu621HisfsTer7)" "" "0000932025" "00000065" "90" "5446" "-1" "5562" "1" "c.(5445+1_5446-1)_(5562+1_5563-1)dup" "r.?" "p.?" "37i_38i" "0000932026" "00000065" "90" "6191" "0" "6191" "0" "c.6191del" "r.(?)" "p.(Gly2064AlafsTer2)" "" "0000932027" "00000065" "90" "391" "0" "391" "0" "c.391C>T" "r.(?)" "p.(Gln131Ter)" "" "0000932028" "00000065" "90" "4740" "0" "4741" "0" "c.4740_4741insG" "r.(?)" "p.(Leu1581AlafsTer5)" "" "0000932029" "00000065" "90" "8244" "1" "8244" "1" "c.8244+1G>A" "r.spl" "p.?" "" "0000932030" "00000065" "90" "9168" "0" "9169" "0" "c.9168_9169dup" "r.(?)" "p.(Ser3057TyrfsTer23)" "" "0000932031" "00000065" "90" "4739" "0" "4739" "0" "c.4739dup" "r.(?)" "p.(Leu1581ProfsTer5)" "" "0000932032" "00000065" "90" "" "0" "" "0" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0000932033" "00000065" "90" "2461" "0" "2461" "0" "c.2461A>G" "r.(?)" "p.(Thr821Ala)" "" "0000932034" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0000932035" "00000065" "70" "8556" "0" "8558" "0" "c.8556_8558del" "r.(?)" "p.(Ile2852del)" "" "0000932036" "00000065" "90" "9223" "0" "9223" "0" "c.9223C>T" "r.(?)" "p.(Gln3075Ter)" "" "0000932037" "00000065" "70" "5578" "0" "5578" "0" "c.5578C>T" "r.(?)" "p.(Gln1860Ter)" "" "0000932038" "00000065" "90" "7750" "-1" "7898" "1" "c.(7749+1_7750-1)_(7898+1_7899-1)del" "r.?" "p.?" "55i_56i" "0000932039" "00000065" "90" "4888" "0" "4888" "0" "c.4888G>T" "r.(?)" "p.(Glu1630Ter)" "" "0000932040" "00000065" "90" "" "0" "" "0" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0000932041" "00000065" "50" "8164" "0" "8164" "0" "c.8164G>A" "r.(?)" "p.(Ala2722Thr)" "" "0000932042" "00000065" "90" "2050" "0" "2060" "0" "c.2050_2060del" "r.(?)" "p.(Val684AsnfsTer17)" "" "0000932043" "00000065" "90" "3235" "0" "3235" "0" "c.3235T>C" "r.(?)" "p.(Cys1079Arg)" "" "0000932044" "00000065" "90" "" "0" "" "0" "c.(283+1_284-1)__(639+1_640-1)del" "r.?" "p.?" "2i_4i" "0000932045" "00000065" "90" "4523" "0" "4523" "0" "c.4523G>A" "r.(?)" "p.(Arg1508Lys)" "" "0000932046" "00000065" "90" "3955" "0" "3955" "0" "c.3955C>T" "r.(?)" "p.(Arg1319Ter)" "" "0000933950" "00000065" "90" "5914" "0" "5914" "0" "c.5914C>T" "r.(?)" "p.(Gln1972*)" "41" "0000933954" "00000065" "90" "7377" "0" "7377" "0" "c.7377dup" "r.(?)" "p.(Leu2460Serfs*2)" "" "0000936097" "00000065" "90" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095Ter)" "" "0000936103" "00000065" "70" "671" "0" "671" "0" "c.671del" "r.(?)" "p.(Ser224MetfsTer10)" "" "0000936104" "00000065" "70" "8541" "0" "8541" "0" "c.8541del" "r.(?)" "p.(Trp2847CysfsTer6)" "" "0000945935" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "" "0000945936" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "" "0000945937" "00000065" "90" "6703" "0" "6703" "0" "c.6703dup" "r.(?)" "p.(Ser2235PhefsTer58)" "" "0000945938" "00000065" "90" "4348" "0" "4348" "0" "c.4348C>T" "r.(?)" "p.(Arg1450*)" "" "0000945939" "00000065" "90" "6513" "0" "6515" "0" "c.6513_6515del" "r.(?)" "p.(Val2172del)" "" "0000945940" "00000065" "90" "5072" "-1" "5562" "1" "c.(5071+1_5072-1)_(5562+1_5563-1)del" "r.(5072_5562del)" "p.(Ala1691Valfs*3)" "35i_38i" "0000946049" "00000065" "50" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "" "0000946136" "00000065" "50" "2254" "0" "2254" "0" "c.2254G>A" "r.(?)" "p.(Gly752Ser)" "" "0000946137" "00000065" "50" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "" "0000946178" "00000065" "50" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "" "0000948639" "00000065" "50" "236" "0" "236" "0" "c.236G>A" "r.(?)" "p.(Arg79Lys)" "" "0000948640" "00000065" "70" "2744" "0" "2744" "0" "c.2744G>A" "r.(?)" "p.(Cys915Tyr)" "" "0000948641" "00000065" "90" "5260" "0" "5260" "0" "c.5260del" "r.(?)" "p.(Val1754Ter)" "" "0000948642" "00000065" "50" "6136" "0" "6136" "0" "c.6136G>A" "r.(?)" "p.(Asp2046Asn)" "" "0000948643" "00000065" "30" "6788" "0" "6788" "0" "c.6788C>T" "r.(?)" "p.(Thr2263Met)" "" "0000948644" "00000065" "50" "7231" "0" "7231" "0" "c.7231G>A" "r.(?)" "p.(Val2411Ile)" "" "0000948645" "00000065" "50" "7916" "0" "7916" "0" "c.7916T>C" "r.(?)" "p.(Val2639Ala)" "" "0000948646" "00000065" "30" "8076" "-7" "8076" "-7" "c.8076-7C>G" "r.(=)" "p.(=)" "" "0000948647" "00000065" "50" "8822" "0" "8822" "0" "c.8822G>A" "r.(?)" "p.(Gly2941Glu)" "" "0000948648" "00000065" "50" "9008" "0" "9008" "0" "c.9008A>G" "r.(?)" "p.(Asn3003Ser)" "" "0000955468" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000955469" "00000065" "90" "4992" "0" "4996" "0" "c.4992_4996del" "r.(?)" "p.(Gln1666Cysfs*2)" "35" "0000955470" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000955471" "00000065" "90" "4992" "0" "4996" "0" "c.4992_4996del" "r.(?)" "p.(Gln1666Cysfs*2)" "35" "0000955472" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000955473" "00000065" "90" "4992" "0" "4996" "0" "c.4992_4996del" "r.(?)" "p.(Gln1666Cysfs*2)" "35" "0000957310" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000957344" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000957345" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000957346" "00000065" "90" "6145" "0" "6145" "0" "c.6145A>T" "r.(?)" "p.(Lys2049*)" "43" "0000957347" "00000065" "90" "6145" "0" "6145" "0" "c.6145A>T" "r.(?)" "p.(Lys2049*)" "43" "0000957348" "00000065" "90" "652" "0" "653" "0" "c.652_653del" "r.(?)" "p.(Leu218Asnfs*9)" "5" "0000957349" "00000065" "90" "1288" "0" "1288" "0" "c.1288G>T" "r.(?)" "p.(Glu430*)" "9" "0000957351" "00000065" "90" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Ser146Phe)" "4" "0000957352" "00000065" "90" "3472" "0" "3472" "0" "c.3472A>T" "r.(?)" "p.(Lys1158*)" "24" "0000957353" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000957354" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000957355" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683Serfs*21)" "14" "0000957356" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000957357" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419Leufs*4)" "9" "0000957358" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000957359" "00000065" "90" "1255" "0" "1255" "0" "c.1255del" "r.(?)" "p.(Ile419Leufs*4)" "9" "0000957360" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000963813" "00000065" "30" "1621" "0" "1621" "0" "c.1621A>G" "r.(?)" "p.(Ser541Gly)" "" "0000963816" "00000065" "30" "4965" "0" "4965" "0" "c.4965C>T" "r.(?)" "p.(=)" "" "0000963821" "00000065" "50" "7250" "0" "7250" "0" "c.7250A>G" "r.(?)" "p.(His2417Arg)" "" "0000963825" "00000065" "50" "8905" "0" "8905" "0" "c.8905C>T" "r.(?)" "p.(Arg2969Cys)" "" "0000971626" "00000065" "90" "2955" "0" "2955" "0" "c.2955T>G" "r.(?)" "p.(Cys985Trp)" "21" "0000976958" "00000065" "30" "1782" "10" "1782" "10" "c.1782+10C>T" "r.(=)" "p.(=)" "" "0000976959" "00000065" "30" "2209" "-19" "2209" "-19" "c.2209-19A>G" "r.(=)" "p.(=)" "" "0000976960" "00000065" "50" "2639" "0" "2639" "0" "c.2639A>G" "r.(?)" "p.(Asp880Gly)" "" "0000976961" "00000065" "90" "2901" "0" "2901" "0" "c.2901C>A" "r.(?)" "p.(Cys967*)" "" "0000976962" "00000065" "50" "3694" "0" "3694" "0" "c.3694C>A" "r.(?)" "p.(Pro1232Thr)" "" "0000976963" "00000065" "50" "5926" "0" "5926" "0" "c.5926A>T" "r.(?)" "p.(Arg1976Trp)" "" "0000976964" "00000065" "50" "6268" "5" "6268" "5" "c.6268+5G>C" "r.spl?" "p.?" "" "0000976965" "00000065" "90" "6429" "1" "6429" "1" "c.6429+1G>T" "r.spl?" "p.?" "" "0000976966" "00000065" "30" "6430" "-5" "6430" "-5" "c.6430-5dup" "r.spl?" "p.?" "" "0000976967" "00000065" "50" "6692" "0" "6692" "0" "c.6692G>A" "r.(?)" "p.(Arg2231His)" "" "0000976968" "00000065" "50" "7027" "0" "7027" "0" "c.7027T>C" "r.(?)" "p.(Phe2343Leu)" "" "0000976969" "00000065" "50" "7525" "0" "7525" "0" "c.7525C>T" "r.(?)" "p.(Leu2509Phe)" "" "0000976970" "00000065" "50" "7889" "0" "7889" "0" "c.7889G>A" "r.(?)" "p.(Arg2630Gln)" "" "0000976971" "00000065" "50" "8102" "0" "8102" "0" "c.8102C>T" "r.(?)" "p.(Ser2701Phe)" "" "0000976972" "00000065" "50" "8777" "0" "8777" "0" "c.8777C>T" "r.(?)" "p.(Thr2926Ile)" "" "0000976973" "00000065" "50" "9211" "6" "9211" "6" "c.9211+6T>C" "r.(=)" "p.(=)" "" "0000984943" "00000065" "90" "283" "2603" "640" "-10743" "c.283+2603_640-10743del" "r.?" "p.(Gln95Hisfs*14)" "2i_4i" "0000984944" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000984949" "00000065" "90" "283" "2603" "640" "-10743" "c.283+2603_640-10743del" "r.?" "p.(Gln95Hisfs*14)" "2i_4i" "0000984950" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0000989211" "00000065" "70" "8569" "0" "8569" "0" "c.8569C>T" "r.(?)" "p.(Gln2857*)" "" "0000989253" "00000065" "70" "8569" "0" "8569" "0" "c.8569C>T" "r.(?)" "p.(Gln2857*)" "61" "0000995330" "00000065" "90" "939" "0" "940" "0" "c.939_940del" "r.(?)" "p.(Cys314Trpfs*3)" "" "0000995331" "00000065" "30" "3821" "0" "3821" "0" "c.3821T>A" "r.(?)" "p.(Val1274Glu)" "" "0000995332" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326Ter)" "" "0000995333" "00000065" "30" "4640" "0" "4640" "0" "c.4640C>T" "r.(?)" "p.(Thr1547Met)" "" "0000995334" "00000065" "50" "8836" "0" "8836" "0" "c.8836G>A" "r.(?)" "p.(Gly2946Arg)" "" "0000995335" "00000065" "50" "8905" "0" "8905" "0" "c.8905C>T" "r.(?)" "p.(Arg2969Cys)" "" "0001014173" "00000065" "30" "4935" "0" "4935" "0" "c.4935C>A" "r.(?)" "p.(Thr1645=)" "" "0001017267" "00000065" "90" "3976" "0" "3976" "0" "c.3976C>T" "r.(?)" "p.(Arg1326*)" "" "0001017268" "00000065" "50" "7440" "-20" "7440" "-20" "c.7440-20dup" "r.(?)" "p.(=)" "52i" "0001021227" "00000065" "90" "5938" "0" "5938" "0" "c.5938del" "r.(?)" "p.(Glu1980LysfsTer5)" "41" "0001025170" "00000065" "50" "413" "0" "413" "0" "c.413A>G" "r.(?)" "p.(Tyr138Cys)" "" "0001029525" "00000065" "70" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277Ter)" "" "0001029526" "00000065" "70" "5422" "0" "5422" "0" "c.5422C>T" "r.(?)" "p.(Gln1808Ter)" "" "0001029527" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029528" "00000065" "70" "6992" "1" "6992" "1" "c.6992+1G>T" "r.spl" "p.?" "" "0001029529" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029530" "00000065" "70" "4048" "0" "4048" "0" "c.4048C>T" "r.(?)" "p.(Arg1350Ter)" "" "0001029531" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029532" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029533" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029534" "00000065" "70" "3" "0" "3" "0" "c.3dup" "r.(?)" "p.(Pro2AlafsTer48)" "" "0001029535" "00000065" "70" "3283" "0" "3283" "0" "c.3283C>T" "r.(?)" "p.(Arg1095Ter)" "" "0001029536" "00000065" "70" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0001029537" "00000065" "70" "7899" "-1" "8244" "1" "c.(7898+1_7899-1)_(8244+1_8245-1)del" "r.?" "p.?" "56i_58i" "0001029538" "00000065" "70" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319Ter)" "" "0001029539" "00000065" "70" "283" "1" "283" "1" "c.283+1G>A" "r.spl" "p.?" "" "0001029540" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029541" "00000065" "70" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029542" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029543" "00000065" "70" "4665" "0" "4665" "0" "c.4665dup" "r.(?)" "p.(Arg1549Ter)" "" "0001029544" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029545" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029546" "00000065" "70" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029547" "00000065" "70" "" "0" "" "0" "с.4056dup" "r.(?)" "p.(Arg1353GlnfsTer4)" "" "0001029548" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029549" "00000065" "70" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029550" "00000065" "70" "5212" "0" "5212" "0" "c.5212G>T" "r.(?)" "p.(Glu1738Ter)" "" "0001029551" "00000065" "70" "5071" "1" "5071" "1" "c.5071+1G>A" "r.spl" "p.?" "" "0001029552" "00000065" "70" "1755" "0" "1755" "0" "c.1755del" "r.(?)" "p.(Ser585ArgfsTer14)" "" "0001029553" "00000065" "70" "283" "1" "283" "1" "c.283+1G>A" "r.spl" "p.?" "" "0001029554" "00000065" "70" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029555" "00000065" "70" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Ter)" "" "0001029556" "00000065" "70" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029557" "00000065" "70" "2184" "0" "2185" "0" "c.2184_2185del" "r.(?)" "p.(Gly729ValfsTer7)" "" "0001029558" "00000065" "70" "6474" "0" "6474" "0" "c.6474C>A" "r.(?)" "p.(Tyr2158Ter)" "" "0001029559" "00000065" "70" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080AsnfsTer26)" "" "0001029560" "00000065" "70" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029561" "00000065" "70" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029562" "00000065" "70" "1894" "0" "1895" "0" "c.1894_1895del" "r.(?)" "p.(Leu632GlufsTer8)" "" "0001029563" "00000065" "70" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029564" "00000065" "70" "6993" "-2" "6993" "-2" "c.6993-2A>C" "r.spl" "p.?" "" "0001029565" "00000065" "70" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029566" "00000065" "70" "3799" "0" "3821" "0" "c.3799_3821del" "r.(?)" "p.(Phe1267AspfsTer11)" "" "0001029567" "00000065" "70" "6955" "0" "6955" "0" "c.6955C>T" "r.(?)" "p.(Arg2319Ter)" "" "0001029568" "00000065" "70" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029569" "00000065" "70" "7520" "0" "7520" "0" "c.7520del" "r.(?)" "p.(Asn2507IlefsTer40)" "" "0001029570" "00000065" "70" "6466" "0" "6466" "0" "c.6466C>T" "r.(?)" "p.(Arg2156Ter)" "" "0001029571" "00000065" "70" "5727" "-2" "5727" "-2" "c.5727-2A>G" "r.spl" "p.?" "" "0001029572" "00000065" "90" "5188" "0" "5188" "0" "c.5188del" "r.(?)" "p.(Arg1730GlyfsTer4)" "" "0001029573" "00000065" "90" "5562" "5" "5562" "5" "c.5562+5G>C" "r.spl?" "p.?" "" "0001029574" "00000065" "90" "3569" "0" "3569" "0" "c.3569del" "r.(?)" "p.(Ala1190ValfsTer9)" "" "0001029575" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029576" "00000065" "90" "4706" "0" "4706" "0" "c.4706G>A" "r.(?)" "p.(Trp1569Ter)" "" "0001029577" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029578" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029579" "00000065" "90" "1893" "0" "1897" "0" "c.1893_1897del" "r.(?)" "p.(Asp631GlufsTer8)" "" "0001029580" "00000065" "90" "3644" "0" "3644" "0" "c.3644del" "r.(?)" "p.(Pro1215GlnfsTer9)" "" "0001029581" "00000065" "90" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277Ter)" "" "0001029582" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Gln988Ter)" "" "0001029583" "00000065" "90" "7439" "1" "7439" "1" "c.7439+1G>T" "r.spl" "p.?" "" "0001029584" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029585" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029586" "00000065" "90" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277Ter)" "" "0001029587" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029588" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029589" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029590" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029591" "00000065" "90" "5234" "1" "5234" "1" "c.5234+1G>A" "r.spl" "p.?" "" "0001029592" "00000065" "90" "4645" "0" "4645" "0" "c.4645C>T" "r.(?)" "p.(Cys1420SerfsTer5)" "" "0001029593" "00000065" "90" "7377" "0" "7377" "0" "c.7377dup" "r.(?)" "p.(Leu2460SerfsTer2)" "" "0001029594" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029595" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029596" "00000065" "90" "106" "0" "106" "0" "c.106C>T" "r.(?)" "p.(Gln36Ter)" "" "0001029597" "00000065" "90" "2856" "2" "2856" "2" "c.2856+2T>A" "r.spl" "p.?" "" "0001029598" "00000065" "90" "1522" "0" "1522" "0" "c.1522C>T" "r.(?)" "p.(Gln508Ter)" "" "0001029599" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029600" "00000065" "90" "9235" "0" "9238" "0" "c.9235_9238dup" "r.(?)" "p.(Thr3080AsnfsTer26)" "" "0001029601" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029602" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029603" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029Ter)" "" "0001029604" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "" "0001029605" "00000065" "90" "2097" "-1" "2097" "-1" "c.2097-1G>A" "r.spl" "p.?" "" "0001029606" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029607" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029608" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(?)" "p.(Arg683SerfsTer21)" "" "0001029609" "00000065" "90" "172" "0" "172" "0" "c.172T>C" "r.(?)" "p.(Cys58Arg)" "" "0001029610" "00000065" "90" "1303" "0" "1303" "0" "c.1303C>T" "r.(?)" "p.(Arg435Ter)" "" "0001029611" "00000065" "90" "2166" "0" "2166" "0" "c.2166A>T" "r.(?)" "p.(Glu722Asp)" "" "0001029612" "00000065" "90" "163" "0" "163" "0" "c.163A>C" "r.(?)" "p.(Asn55His)" "" "0001029613" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029614" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029615" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asn2507IlefsTer40)" "" "0001029616" "00000065" "90" "7701" "0" "7701" "0" "c.7701delinsGTGTCCCTAGGTGTCCCTA" "r.(?)" "p.(Ser2567delinsArgCysProTer)" "" "0001029617" "00000065" "90" "4255" "0" "4258" "0" "c.4255_4258dup" "r.(?)" "p.(Arg1400Ter)" "" "0001029618" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0001029619" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029620" "00000065" "90" "6993" "-2" "6993" "-2" "c.6993-2A>C" "r.spl" "p.?" "" "0001029621" "00000065" "90" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630Ter)" "" "0001029622" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Lys1556GlufsTer3)" "" "0001029623" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029624" "00000065" "90" "9139" "0" "9139" "0" "c.9139G>T" "r.(?)" "p.(Glu3047Ter)" "" "0001029625" "00000065" "90" "7074" "0" "7074" "0" "c.7074C>A" "r.(?)" "p.(Tyr2358Ter)" "" "0001029626" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0001029627" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029628" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0001029629" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "" "0001029630" "00000065" "90" "2230" "0" "2230" "0" "c.2230C>T" "r.(?)" "p.(Arg744Ter)" "" "0001029631" "00000065" "90" "" "0" "" "0" "с.79C>T" "r.(?)" "p.(Gln27Ter)" "" "0001029632" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029633" "00000065" "90" "4198" "0" "4198" "0" "c.4198C>T" "r.(?)" "p.(Arg1400Ter)" "" "0001029634" "00000065" "90" "2962" "0" "2962" "0" "c.2962C>T" "r.spl" "p.?" "" "0001029635" "00000065" "90" "9253" "0" "9253" "0" "c.9253C>T" "r.(?)" "p.(Arg3085Ter)" "" "0001029636" "00000065" "90" "7520" "0" "7520" "0" "c.7520del" "r.(?)" "p.(Asn2507IlefsTer40)" "" "0001029637" "00000065" "90" "3829" "0" "3829" "0" "c.3829C>T" "r.(?)" "p.(Arg1277Ter)" "" "0001029638" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029639" "00000065" "90" "6993" "-1" "6993" "-1" "c.6993-1G>C" "r.spl" "p.?" "" "0001029640" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029641" "00000065" "90" "5116" "0" "5116" "0" "c.5116C>T" "r.(?)" "p.(Arg1706Ter)" "" "0001029642" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029643" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029644" "00000065" "90" "8244" "3" "8244" "6" "c.8244+3_8244+6del" "r.spl" "p.?" "" "0001029645" "00000065" "90" "7265" "0" "7265" "0" "c.7265G>A" "r.(?)" "p.(Trp2422Ter)" "" "0001029646" "00000065" "90" "5476" "0" "5476" "0" "c.5476C>T" "r.(?)" "p.(Arg1826Ter)" "" "0001029647" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029648" "00000065" "90" "6992" "1" "6992" "1" "c.6992+1G>T" "r.spl" "p.?" "" "0001029649" "00000065" "90" "1885" "-1" "2096" "1" "c.(1884+1_1885-1)_(2096+1_2097-1)del" "r.?" "p.?" "13i_14i" "0001029650" "00000065" "90" "-105" "0" "112" "1" "c.(?_-105)_(112+1_113-1)del" "r.0?" "p.0?" "_1_1i" "0001029651" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029652" "00000065" "90" "1885" "-1" "2096" "1" "c.(1884+1_1885-1)_(2096+1_2097-1)del" "r.?" "p.?" "13i_14i" "0001029653" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029654" "00000065" "90" "5235" "-2" "5235" "-2" "c.5235-2A>G" "r.spl" "p.?" "" "0001029655" "00000065" "90" "6466" "0" "6466" "0" "c.6466C>T" "r.(?)" "p.(Arg2156Ter)" "" "0001029656" "00000065" "90" "5706" "0" "5706" "0" "c.5706del" "r.(?)" "p.(Ser1903HisfsTer61)" "" "0001029657" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029658" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029659" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029660" "00000065" "90" "5445" "1" "5445" "1" "c.5445+1G>A" "r.spl" "p.?" "" "0001029661" "00000065" "90" "6560" "0" "6560" "0" "c.6560delinsTGCCA" "r.(?)" "p.(Gly2187ValfsTer8)" "" "0001029662" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029663" "00000065" "90" "7732" "0" "7732" "0" "c.7732C>T" "r.(?)" "p.(Arg2578Ter)" "" "0001029664" "00000065" "90" "7520" "0" "7520" "0" "c.7520del" "r.(?)" "p.(Asn2507IlefsTer40)" "" "0001029665" "00000065" "90" "958" "0" "958" "0" "c.958C>T" "r.(?)" "p.(Gln320Ter)" "" "0001029666" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029667" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029668" "00000065" "90" "4692" "0" "4695" "0" "c.4692_4695dup" "r.(?)" "p.(Arg1566CysfsTer13)" "" "0001029669" "00000065" "90" "7147" "0" "7147" "0" "c.7147C>T" "r.(?)" "p.(Arg2383Ter)" "" "0001029670" "00000065" "90" "8245" "-2" "8245" "-2" "c.8245-2A>G" "r.spl" "p.?" "" "0001029671" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029672" "00000065" "90" "7536" "0" "7536" "0" "c.7536del" "r.(?)" "p.(Asp2513IlefsTer34)" "" "0001029673" "00000065" "90" "6993" "-2" "6993" "-2" "c.6993-2A>C" "r.spl" "p.?" "" "0001029674" "00000065" "90" "3736" "-2" "3736" "-2" "c.3736-2A>T" "r.spl" "p.?" "" "0001029675" "00000065" "90" "5727" "-1" "5865" "1" "c.(5726+1_5727-1)_(5865+1_5866-1)del" "r.?" "p.?" "39i_40i" "0001029676" "00000065" "90" "163" "0" "163" "0" "c.163A>C" "r.(?)" "p.(Asn55His)" "" "0001029677" "00000065" "90" "7814" "0" "7814" "0" "c.7814del" "r.(?)" "p.(Thr2605LysfsTer2)" "" "0001029678" "00000065" "90" "8699" "0" "8700" "0" "c.8699_8700insGTAAATTCT" "r.(?)" "p.(Pro2901Ter)" "" "0001029679" "00000065" "90" "6721" "0" "6721" "0" "c.6721G>T" "r.(?)" "p.(Gly2241Ter)" "" "0001029680" "00000065" "30" "3412" "0" "3412" "0" "c.3412G>A" "r.(?)" "p.(Val1138Met)" "" "0001035456" "00000065" "50" "277" "0" "277" "0" "c.277C>A" "r.(?)" "p.(Pro93Thr)" "" "0001035457" "00000065" "50" "284" "-4" "284" "-4" "c.284-4A>G" "r.spl?" "p.?" "" "0001035458" "00000065" "50" "479" "0" "479" "0" "c.479A>T" "r.(?)" "p.(Asp160Val)" "" "0001035459" "00000065" "50" "830" "0" "830" "0" "c.830C>T" "r.(?)" "p.(Ser277Leu)" "" "0001035460" "00000065" "50" "2512" "0" "2512" "0" "c.2512G>A" "r.(?)" "p.(Gly838Arg)" "" "0001035461" "00000065" "30" "2877" "0" "2877" "0" "c.2877A>G" "r.(?)" "p.(Gln959=)" "" "0001035462" "00000065" "50" "4898" "0" "4898" "0" "c.4898T>C" "r.(?)" "p.(Ile1633Thr)" "" "0001035463" "00000065" "50" "5530" "0" "5530" "0" "c.5530C>T" "r.(?)" "p.(Arg1844Cys)" "" "0001035464" "00000065" "50" "7323" "0" "7323" "0" "c.7323A>G" "r.(?)" "p.(Ile2441Met)" "" "0001035465" "00000065" "50" "7526" "0" "7526" "0" "c.7526T>C" "r.(?)" "p.(Leu2509Pro)" "" "0001035467" "00000065" "30" "8637" "0" "8637" "0" "c.8637G>C" "r.(?)" "p.(=)" "" "0001046052" "00000065" "30" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "" "0001047072" "00000065" "90" "3085" "0" "3085" "0" "c.3085C>T" "r.(?)" "p.(Arg1029*)" "22" "0001047958" "00000065" "90" "850" "0" "850" "0" "c.850G>A" "r.(?)" "p.(Gly284Arg)" "" "0001047959" "00000065" "90" "850" "0" "850" "0" "c.850G>A" "r.(?)" "p.(Gly284Arg)" "" "0001047960" "00000065" "90" "1793" "0" "1795" "0" "c.1793_1795del" "r.(?)" "p.(Val598del)" "" "0001049531" "00000065" "50" "7985" "0" "7985" "0" "c.7985T>C" "r.(?)" "p.(Val2662Ala)" "" "0001049532" "00000065" "50" "4969" "0" "4969" "0" "c.4969G>A" "r.(?)" "p.(Val1657Met)" "" "0001052482" "00000065" "30" "364" "0" "364" "0" "c.364C>T" "r.(?)" "p.(His122Tyr)" "" "0001052483" "00000065" "50" "1990" "0" "1990" "0" "c.1990G>A" "r.(?)" "p.(Gly664Ser)" "" "0001052484" "00000065" "50" "6880" "0" "6880" "0" "c.6880G>T" "r.(?)" "p.(Val2294Leu)" "" "0001052485" "00000065" "50" "7112" "0" "7112" "0" "c.7112T>C" "r.(?)" "p.(Phe2371Ser)" "" "0001052486" "00000065" "50" "7702" "0" "7702" "0" "c.7702G>A" "r.(?)" "p.(Gly2568Arg)" "" "0001052487" "00000065" "50" "7985" "0" "7985" "0" "c.7985T>C" "r.(?)" "p.(Val2662Ala)" "" "0001052488" "00000065" "50" "8541" "0" "8541" "0" "c.8541del" "r.(?)" "p.(Trp2847Cysfs*6)" "" "0001052489" "00000065" "70" "8548" "-2" "8548" "-2" "c.8548-2A>G" "r.spl?" "p.?" "" "0001057963" "00000065" "50" "1562" "0" "1562" "0" "c.1562C>T" "r.(?)" "p.(Ser521Leu)" "" "0001057966" "00000065" "50" "410" "0" "410" "0" "c.410C>T" "r.(?)" "p.(Ala137Val)" "" "0001057968" "00000065" "50" "251" "0" "251" "0" "c.251G>C" "r.(?)" "p.(Arg84Pro)" "" "0001058025" "00000065" "90" "2049" "0" "2050" "0" "c.2049_2050del" "r.(2049_2050del)" "p.(Arg683Serfs*21)" "" "0001058027" "00000065" "90" "2857" "-2" "2857" "-2" "c.2857-2A>G" "r.spl" "p.?" "" "0001058028" "00000065" "90" "3938" "0" "3939" "0" "c.3938_3939del" "r.(3938_3939del)" "p.(Tyr1313Leufs*4)" "" "0001058847" "00000065" "90" "7888" "0" "7888" "0" "c.7888C>T" "r.(?)" "p.(Arg2630Ter)" "" "0001058848" "00000065" "70" "437" "0" "437" "0" "c.437C>T" "r.(?)" "p.(Ser146Phe)" "" "0001060869" "00000065" "50" "4487" "0" "4487" "0" "c.4487C>T" "r.(?)" "p.(Ala1496Val)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 1918 "{{screeningid}}" "{{variantid}}" "0000000012" "0000001135" "0000000017" "0000001144" "0000000018" "0000177865" "0000000036" "0000001134" "0000000039" "0000001138" "0000000040" "0000177956" "0000000048" "0000001132" "0000000049" "0000001147" "0000000054" "0000001136" "0000000057" "0000001133" "0000000069" "0000001148" "0000000071" "0000001137" "0000000075" "0000001131" "0000000090" "0000001140" "0000000092" "0000001142" "0000000099" "0000001141" "0000000100" "0000222316" "0000036102" "0000063227" "0000036103" "0000063228" "0000036104" "0000063229" "0000036105" "0000063230" "0000036106" "0000063231" "0000036107" "0000063232" "0000036108" "0000063233" "0000036110" "0000063235" "0000036111" "0000063236" "0000036112" "0000063237" "0000036113" "0000063238" "0000036114" "0000063239" "0000036115" "0000063240" "0000036116" "0000063241" "0000036117" "0000063242" "0000036118" "0000063243" "0000036119" "0000063244" "0000036120" "0000063245" "0000036121" "0000063246" "0000036122" "0000063247" "0000036123" "0000063248" "0000036124" "0000063249" "0000036125" "0000063250" "0000036127" "0000063252" "0000054621" "0000084571" "0000054621" "0000084614" "0000054625" "0000084575" "0000054626" "0000084576" "0000054626" "0000084616" "0000054630" "0000084580" "0000054630" "0000084620" "0000054637" "0000084587" "0000054637" "0000084624" "0000054640" "0000084590" "0000054642" "0000084592" "0000054642" "0000084625" "0000088335" "0000146005" "0000088335" "0000146006" "0000102565" "0000165300" "0000102566" "0000165301" "0000102567" "0000165303" "0000102567" "0000165304" "0000102568" "0000165305" "0000102569" "0000165307" "0000102570" "0000165308" "0000102571" "0000165310" "0000102572" "0000165312" "0000102572" "0000165313" "0000102573" "0000165314" "0000102574" "0000165316" "0000102575" "0000165318" "0000102576" "0000165321" "0000102576" "0000165322" "0000102577" "0000165323" "0000102577" "0000165324" "0000102578" "0000165325" "0000102579" "0000165326" "0000102579" "0000165327" "0000102580" "0000165328" "0000102581" "0000165329" "0000102582" "0000165330" "0000102583" "0000165331" "0000102584" "0000165332" "0000102585" "0000165333" "0000102586" "0000165334" "0000102587" "0000165335" "0000102588" "0000165336" "0000102589" "0000165337" "0000102590" "0000165338" "0000102591" "0000165339" "0000102592" "0000165340" "0000102593" "0000165341" "0000102594" "0000165342" "0000102595" "0000165343" "0000102596" "0000165344" "0000102597" "0000165345" "0000102598" "0000165346" "0000102599" "0000165347" "0000102600" "0000165348" "0000102601" "0000165349" "0000102602" "0000165350" "0000102603" "0000165351" "0000102604" "0000165352" "0000102605" "0000165353" "0000102605" "0000165354" "0000102606" "0000165355" "0000102607" "0000165356" "0000102607" "0000165357" "0000102607" "0000165358" "0000102607" "0000165359" "0000102607" "0000165360" "0000102608" "0000165361" "0000102608" "0000165362" "0000102609" "0000165363" "0000102610" "0000165364" "0000102610" "0000165365" "0000102611" "0000165366" "0000102611" "0000165367" "0000102612" "0000165368" "0000102612" "0000165369" "0000102613" "0000165370" "0000102613" "0000165371" "0000102614" "0000165372" "0000102614" "0000165373" "0000102615" "0000165374" "0000102615" "0000165375" "0000102616" "0000165376" "0000102616" "0000165377" "0000102617" "0000165378" "0000102617" "0000165379" "0000102618" "0000165380" "0000102618" "0000165381" "0000102619" "0000165382" "0000102619" "0000165383" "0000102620" "0000165384" "0000102620" "0000165385" "0000102621" "0000165386" "0000102621" "0000165387" "0000102621" "0000165388" "0000102622" "0000165389" "0000102622" "0000165390" "0000102623" "0000165391" "0000102623" "0000165392" "0000102624" "0000165393" "0000102624" "0000165394" "0000102625" "0000165395" "0000102625" "0000165396" "0000102626" "0000165397" "0000102626" "0000165398" "0000102627" "0000165399" "0000102627" "0000165400" "0000102628" "0000165401" "0000102628" "0000165402" "0000102629" "0000165403" "0000102629" "0000165404" "0000102630" "0000165405" "0000102630" "0000165406" "0000102631" "0000165407" "0000102631" "0000165408" "0000102632" "0000165409" "0000102632" "0000165410" "0000102633" "0000165411" "0000102633" "0000165412" "0000102634" "0000165413" "0000102634" "0000165414" "0000102635" "0000165415" "0000102635" "0000165416" "0000102636" "0000165417" "0000102636" "0000165418" "0000102637" "0000165419" "0000102637" "0000165420" "0000102638" "0000165421" "0000102638" "0000165422" "0000102638" "0000165423" "0000102638" "0000165424" "0000102639" "0000165425" "0000102639" "0000165426" "0000102640" "0000165427" "0000102640" "0000165428" "0000102641" "0000165429" "0000102641" "0000165430" "0000102641" "0000165431" "0000102642" "0000165432" "0000102642" "0000165433" "0000102643" "0000165434" "0000102643" "0000165435" "0000102644" "0000165436" "0000102644" "0000165437" "0000102645" "0000165438" "0000102645" "0000165439" "0000102645" "0000165440" "0000102645" "0000165441" "0000102645" "0000165442" "0000102646" "0000165443" "0000102646" "0000165444" "0000102647" "0000165445" "0000102647" "0000165446" "0000102648" "0000165447" "0000102648" "0000165448" "0000102649" "0000165449" "0000102650" "0000165450" "0000102650" "0000165451" "0000102651" "0000165452" "0000102651" "0000165453" "0000102652" "0000165454" "0000102652" "0000165455" "0000102653" "0000165456" "0000102653" "0000165457" "0000102653" "0000165458" "0000102653" "0000165459" "0000102653" "0000165460" "0000102654" "0000165461" "0000102654" "0000165462" "0000102654" "0000165463" "0000102655" "0000165464" "0000102655" "0000165465" "0000102656" "0000165466" "0000102656" "0000165467" "0000102657" "0000165468" "0000102657" "0000165469" "0000102657" "0000165470" "0000102658" "0000165471" "0000102658" "0000165472" "0000102658" "0000165473" "0000102658" "0000165474" "0000102658" "0000165475" "0000102658" "0000165476" "0000102659" "0000165477" "0000102659" "0000165478" "0000102660" "0000165479" "0000102660" "0000165480" "0000102661" "0000165481" "0000102661" "0000165482" "0000102662" "0000165483" "0000102662" "0000165484" "0000102663" "0000165485" "0000102663" "0000165486" "0000102664" "0000165487" "0000102664" "0000165488" "0000102665" "0000165489" "0000102665" "0000165490" "0000102666" "0000165491" "0000102666" "0000165492" "0000102667" "0000165493" "0000102667" "0000165495" "0000102667" "0000165496" "0000102667" "0000165497" "0000102667" "0000165498" "0000102667" "0000165499" "0000102667" "0000165500" "0000102668" "0000165501" "0000102668" "0000165502" "0000102669" "0000165503" "0000102669" "0000165504" "0000102670" "0000165505" "0000102670" "0000165506" "0000102671" "0000165507" "0000102672" "0000165508" "0000102673" "0000165509" "0000102674" "0000165510" "0000102675" "0000165511" "0000102676" "0000165512" "0000102677" "0000165513" "0000102678" "0000165514" "0000102679" "0000165515" "0000102680" "0000165516" "0000102681" "0000165517" "0000102682" "0000165518" "0000102683" "0000165519" "0000102684" "0000165520" "0000102685" "0000165521" "0000102686" "0000165522" "0000102687" "0000165523" "0000102688" "0000165524" "0000102689" "0000165525" "0000102690" "0000165526" "0000102691" "0000165527" "0000102692" "0000165528" "0000102692" "0000165529" "0000102693" "0000165530" "0000102694" "0000165531" "0000102695" "0000165532" "0000102696" "0000165533" "0000102697" "0000165534" "0000102698" "0000165536" "0000102699" "0000165537" "0000102700" "0000165538" "0000102701" "0000165539" "0000102702" "0000165540" "0000102703" "0000165541" "0000102704" "0000165542" "0000102705" "0000165543" "0000102706" "0000165544" "0000102707" "0000165545" "0000102708" "0000165546" "0000102709" "0000165547" "0000102710" "0000165548" "0000102711" "0000165549" "0000102712" "0000165550" "0000102713" "0000165551" "0000102714" "0000165552" "0000102715" "0000165553" "0000102716" "0000165554" "0000102717" "0000165555" "0000102718" "0000165556" "0000102719" "0000165557" "0000102720" "0000165558" "0000102721" "0000165559" "0000102722" "0000165560" "0000102723" "0000165561" "0000102724" "0000165562" "0000102725" "0000165563" "0000102726" "0000165564" "0000102727" "0000165565" "0000102728" "0000165566" "0000102729" "0000165567" "0000102730" "0000165568" "0000102731" "0000165569" "0000102732" "0000165570" "0000102733" "0000165571" "0000102734" "0000165572" "0000102735" "0000165573" "0000102736" "0000165574" "0000102737" "0000165575" "0000102738" "0000165576" "0000102739" "0000165577" "0000102740" "0000165578" "0000102741" "0000165579" "0000102742" "0000165580" "0000102743" "0000165581" "0000102744" "0000165582" "0000102745" "0000165583" "0000102746" "0000165584" "0000102747" "0000165585" "0000102748" "0000165586" "0000102749" "0000165587" "0000102749" "0000165588" "0000102750" "0000165589" "0000102751" "0000165590" "0000102751" "0000165591" "0000102752" "0000165592" "0000102753" "0000165593" "0000102754" "0000165594" "0000102755" "0000165595" "0000102756" "0000165596" "0000102757" "0000165597" "0000102758" "0000165598" "0000102759" "0000165599" "0000102760" "0000165600" "0000102761" "0000165601" "0000102762" "0000165602" "0000102763" "0000165603" "0000102764" "0000165604" "0000102765" "0000165605" "0000102766" "0000165606" "0000102767" "0000165607" "0000102768" "0000165608" "0000102769" "0000165609" "0000102770" "0000165610" "0000102771" "0000165611" "0000102771" "0000165612" "0000102772" "0000165613" "0000102773" "0000165614" "0000102774" "0000165615" "0000102774" "0000165616" "0000102775" "0000165617" "0000102776" "0000165618" "0000102777" "0000165619" "0000102777" "0000165620" "0000102778" "0000165621" "0000102778" "0000165622" "0000102779" "0000165623" "0000102779" "0000165624" "0000102780" "0000165625" "0000102780" "0000165626" "0000102781" "0000165627" "0000102781" "0000165628" "0000102782" "0000165629" "0000102782" "0000165630" "0000102783" "0000165631" "0000102783" "0000165632" "0000102784" "0000165633" "0000102784" "0000165634" "0000102785" "0000165635" "0000102785" "0000165636" "0000102786" "0000165637" "0000102786" "0000165638" "0000102786" "0000165639" "0000102787" "0000165640" "0000102788" "0000165641" "0000102788" "0000165642" "0000102789" "0000165643" "0000102789" "0000165644" "0000102789" "0000165645" "0000102789" "0000165646" "0000102789" "0000165647" "0000102790" "0000165648" "0000102790" "0000165649" "0000102791" "0000165650" "0000102791" "0000165651" "0000102792" "0000165652" "0000102792" "0000165653" "0000102793" "0000165654" "0000102793" "0000165655" "0000102800" "0000165666" "0000102801" "0000165667" "0000102802" "0000165668" "0000102803" "0000165669" "0000102803" "0000165670" "0000102804" "0000165671" "0000102805" "0000165672" "0000102805" "0000165673" "0000102805" "0000165674" "0000102805" "0000165675" "0000102806" "0000165676" "0000102806" "0000165677" "0000102807" "0000165678" "0000102807" "0000165679" "0000102808" "0000165680" "0000102808" "0000165681" "0000102809" "0000165682" "0000102809" "0000165683" "0000102810" "0000165684" "0000102810" "0000165685" "0000102810" "0000165686" "0000102810" "0000165687" "0000102811" "0000165688" "0000102811" "0000165689" "0000102812" "0000165690" "0000102812" "0000165691" "0000102813" "0000165692" "0000102813" "0000165693" "0000102813" "0000165694" "0000102813" "0000165695" "0000102814" "0000165696" "0000102814" "0000165697" "0000102815" "0000165698" "0000102815" "0000165699" "0000102816" "0000165700" "0000102817" "0000165701" "0000102817" "0000165702" "0000102818" "0000165703" "0000102818" "0000165704" "0000102819" "0000165705" "0000102819" "0000165706" "0000102820" "0000165707" "0000102820" "0000165708" "0000102821" "0000165709" "0000102821" "0000165710" "0000102822" "0000165711" "0000102822" "0000165712" "0000102822" "0000165713" "0000102823" "0000165714" "0000102823" "0000165715" "0000102823" "0000165716" "0000102823" "0000165717" "0000102824" "0000165718" "0000102824" "0000165719" "0000102825" "0000165720" "0000102825" "0000165721" "0000102825" "0000165722" "0000102825" "0000165723" "0000102825" "0000165724" "0000102825" "0000165725" "0000102825" "0000165726" "0000102825" "0000165727" "0000102825" "0000165728" "0000102825" "0000165729" "0000102825" "0000165730" "0000102825" "0000165731" "0000102825" "0000165732" "0000102825" "0000165733" "0000102826" "0000165734" "0000102826" "0000165735" "0000102827" "0000165736" "0000102827" "0000165737" "0000102827" "0000165738" "0000102828" "0000165739" "0000102828" "0000165740" "0000102829" "0000165741" "0000102830" "0000165742" "0000102830" "0000165743" "0000102831" "0000165744" "0000102832" "0000165745" "0000102833" "0000165746" "0000102833" "0000165747" "0000102833" "0000165748" "0000102834" "0000165749" "0000102834" "0000165750" "0000102834" "0000165751" "0000102835" "0000165752" "0000102836" "0000165753" "0000102836" "0000165754" "0000102837" "0000165755" "0000102838" "0000165756" "0000102838" "0000165757" "0000102839" "0000165758" "0000102839" "0000165759" "0000102839" "0000165760" "0000102839" "0000165761" "0000102840" "0000165762" "0000102840" "0000165763" "0000102841" "0000165764" "0000102841" "0000165765" "0000102842" "0000165766" "0000102842" "0000165767" "0000102843" "0000165768" "0000102843" "0000165769" "0000102844" "0000165770" "0000102844" "0000165771" "0000102845" "0000165772" "0000102845" "0000165773" "0000102846" "0000165774" "0000102846" "0000165775" "0000102846" "0000165776" "0000102847" "0000165777" "0000102847" "0000165778" "0000102848" "0000165779" "0000102848" "0000165780" "0000102848" "0000165781" "0000102849" "0000165782" "0000102849" "0000165783" "0000102849" "0000165784" "0000102850" "0000165785" "0000102850" "0000165786" "0000102851" "0000165787" "0000102851" "0000165788" "0000102851" "0000165789" "0000102852" "0000165790" "0000102852" "0000165791" "0000102852" "0000165792" "0000102853" "0000165793" "0000102853" "0000165794" "0000102854" "0000165795" "0000102854" "0000165796" "0000102855" "0000165797" "0000102855" "0000165798" "0000102856" "0000165799" "0000102856" "0000165800" "0000102857" "0000165801" "0000102857" "0000165802" "0000102858" "0000165803" "0000102858" "0000165804" "0000102859" "0000165805" "0000102859" "0000165806" "0000102860" "0000165807" "0000102860" "0000165808" "0000102860" "0000165809" "0000102861" "0000165810" "0000102862" "0000165811" "0000102862" "0000165812" "0000102863" "0000165813" "0000102864" "0000165814" "0000102864" "0000165815" "0000102865" "0000165816" "0000102865" "0000165817" "0000102866" "0000165818" "0000102866" "0000165819" "0000102867" "0000165820" "0000102867" "0000165821" "0000102868" "0000165822" "0000102868" "0000165823" "0000102869" "0000165824" "0000102869" "0000165825" "0000102870" "0000165826" "0000102870" "0000165827" "0000102871" "0000165828" "0000102871" "0000165829" "0000102872" "0000165830" "0000102872" "0000165831" "0000102873" "0000165832" "0000102873" "0000165833" "0000102874" "0000165834" "0000102874" "0000165835" "0000102875" "0000165836" "0000102875" "0000165837" "0000102876" "0000165838" "0000102876" "0000165839" "0000102877" "0000165840" "0000102877" "0000165841" "0000102878" "0000165842" "0000102878" "0000165843" "0000102879" "0000165844" "0000102880" "0000165845" "0000102880" "0000165846" "0000102880" "0000165847" "0000102881" "0000165848" "0000102882" "0000165849" "0000102882" "0000165850" "0000102883" "0000165851" "0000102883" "0000165852" "0000102885" "0000165854" "0000102885" "0000165855" "0000102886" "0000165856" "0000102886" "0000165857" "0000102887" "0000165858" "0000102887" "0000165859" "0000102888" "0000165860" "0000102889" "0000165861" "0000102889" "0000165862" "0000102890" "0000165863" "0000102890" "0000165864" "0000102891" "0000165865" "0000102891" "0000165866" "0000102892" "0000165867" "0000102892" "0000165868" "0000102893" "0000165869" "0000102893" "0000165870" "0000102894" "0000165871" "0000102895" "0000165872" "0000102895" "0000165873" "0000102896" "0000165874" "0000102896" "0000165875" "0000102897" "0000165876" "0000102898" "0000165877" "0000102898" "0000165878" "0000102899" "0000165879" "0000102899" "0000165880" "0000102900" "0000165881" "0000102900" "0000165882" "0000102901" "0000165883" "0000102902" "0000165884" "0000102902" "0000165885" "0000102903" "0000165886" "0000102903" "0000165887" "0000102904" "0000165888" "0000102904" "0000165889" "0000102906" "0000165891" "0000102906" "0000165892" "0000102907" "0000165893" "0000102907" "0000165894" "0000102908" "0000165895" "0000102908" "0000165896" "0000102909" "0000165897" "0000102909" "0000165898" "0000102910" "0000165899" "0000102910" "0000165900" "0000102911" "0000165901" "0000102911" "0000165902" "0000102912" "0000165903" "0000102912" "0000165904" "0000102913" "0000165905" "0000102913" "0000165906" "0000102914" "0000165907" "0000102914" "0000165908" "0000102915" "0000165909" "0000102916" "0000165910" "0000102916" "0000165911" "0000102917" "0000165912" "0000102917" "0000165913" "0000102918" "0000165914" "0000102918" "0000165915" "0000102919" "0000165916" "0000102919" "0000165917" "0000102919" "0000165918" "0000102920" "0000165919" "0000102920" "0000165920" "0000102921" "0000165921" "0000102921" "0000165922" "0000102922" "0000165923" "0000102922" "0000165924" "0000102923" "0000165925" "0000102923" "0000165926" "0000102924" "0000165927" "0000102924" "0000165928" "0000102925" "0000165929" "0000102925" "0000165930" "0000102926" "0000165931" "0000102927" "0000165933" "0000102927" "0000165934" "0000102928" "0000165935" "0000102928" "0000165936" "0000102929" "0000165937" "0000102929" "0000165938" "0000102930" "0000165939" "0000102930" "0000165940" "0000102931" "0000165941" "0000102931" "0000165942" "0000102932" "0000165943" "0000102932" "0000165944" "0000102933" "0000165945" "0000102933" "0000165946" "0000102934" "0000165947" "0000102934" "0000165948" "0000102935" "0000165949" "0000102935" "0000165950" "0000102936" "0000165951" "0000102936" "0000165952" "0000102937" "0000165953" "0000102937" "0000165954" "0000102938" "0000165955" "0000102939" "0000165956" "0000102940" "0000165957" "0000102941" "0000165958" "0000102942" "0000165959" "0000102942" "0000165960" "0000102943" "0000165961" "0000102943" "0000165962" "0000102944" "0000165963" "0000102945" "0000165964" "0000102945" "0000165965" "0000102946" "0000165966" "0000102946" "0000165967" "0000102947" "0000165968" "0000102948" "0000165969" "0000102948" "0000165970" "0000102949" "0000165971" "0000102949" "0000165972" "0000102950" "0000165973" "0000102950" "0000165974" "0000102951" "0000165975" "0000102951" "0000165976" "0000102952" "0000165977" "0000102953" "0000165978" "0000102953" "0000165979" "0000102954" "0000165980" "0000102954" "0000165981" "0000102955" "0000165982" "0000102955" "0000165983" "0000102955" "0000165984" "0000102955" "0000165985" "0000102956" "0000165986" "0000102957" "0000165987" "0000102958" "0000165988" "0000102959" "0000165989" "0000102960" "0000165990" "0000102961" "0000165991" "0000102962" "0000165992" "0000102963" "0000165993" "0000102964" "0000165994" "0000102965" "0000165995" "0000102966" "0000165997" "0000102967" "0000165998" "0000102967" "0000165999" "0000102968" "0000166000" "0000102969" "0000166001" "0000102969" "0000166002" "0000102969" "0000166003" "0000102969" "0000166004" "0000102970" "0000166005" "0000102970" "0000166006" "0000102971" "0000166007" "0000102971" "0000166008" "0000102972" "0000166009" "0000102972" "0000166010" "0000102973" "0000166011" "0000102973" "0000166012" "0000102974" "0000166013" "0000102974" "0000166014" "0000102975" "0000166015" "0000102975" "0000166016" "0000102975" "0000166017" "0000102975" "0000166018" "0000102976" "0000166019" "0000102976" "0000166020" "0000102976" "0000166021" "0000102976" "0000166022" "0000102977" "0000166023" "0000102977" "0000166024" "0000102977" "0000166025" "0000102977" "0000166026" "0000102978" "0000166027" "0000102978" "0000166028" "0000102978" "0000166029" "0000102978" "0000166030" "0000102979" "0000166031" "0000102979" "0000166032" "0000102979" "0000166033" "0000102979" "0000166034" "0000102980" "0000166035" "0000102980" "0000166036" "0000102980" "0000166037" "0000102980" "0000166038" "0000102981" "0000166039" "0000102981" "0000166040" "0000102981" "0000166041" "0000102981" "0000166042" "0000102982" "0000166043" "0000102982" "0000166044" "0000102982" "0000166045" "0000102982" "0000166046" "0000102983" "0000166047" "0000102983" "0000166048" "0000102983" "0000166049" "0000102983" "0000166050" "0000102984" "0000166051" "0000102985" "0000166052" "0000102985" "0000166053" "0000102986" "0000166054" "0000102986" "0000166055" "0000102987" "0000166056" "0000102988" "0000166057" "0000102992" "0000166062" "0000102994" "0000166064" "0000102995" "0000166065" "0000102997" "0000166067" "0000102998" "0000166068" "0000102998" "0000166069" "0000102999" "0000166070" "0000102999" "0000166071" "0000103000" "0000166072" "0000103000" "0000166073" "0000103002" "0000166075" "0000103003" "0000166076" "0000103004" "0000166077" "0000103005" "0000166078" "0000103006" "0000166079" "0000103007" "0000166080" "0000103008" "0000166081" "0000103009" "0000166082" "0000103010" "0000166083" "0000103011" "0000166084" "0000103012" "0000166085" "0000103013" "0000166086" "0000103014" "0000166087" "0000103015" "0000166088" "0000103016" "0000166089" "0000103017" "0000166090" "0000103018" "0000166091" "0000103019" "0000166092" "0000103020" "0000166093" "0000103021" "0000166094" "0000103022" "0000166095" "0000103023" "0000166096" "0000103024" "0000166097" "0000103025" "0000166098" "0000103026" "0000166099" "0000103027" "0000166100" "0000103028" "0000166101" "0000103029" "0000166102" "0000103030" "0000166103" "0000103031" "0000166104" "0000103032" "0000166105" "0000103033" "0000166106" "0000103034" "0000166107" "0000103035" "0000166108" "0000103036" "0000166109" "0000103037" "0000166110" "0000103038" "0000166111" "0000103039" "0000166112" "0000103040" "0000166113" "0000103041" "0000166114" "0000103042" "0000166115" "0000103043" "0000166116" "0000103044" "0000166117" "0000103045" "0000166118" "0000103046" "0000166119" "0000103047" "0000166120" "0000103048" "0000166121" "0000103049" "0000166122" "0000103050" "0000166123" "0000103051" "0000166124" "0000103052" "0000166125" "0000103053" "0000166126" "0000103054" "0000166127" "0000103055" "0000166128" "0000103056" "0000166129" "0000103057" "0000166130" "0000103058" "0000166131" "0000103059" "0000166132" "0000103060" "0000166133" "0000103061" "0000166134" "0000103062" "0000166135" "0000103063" "0000166136" "0000103064" "0000166137" "0000103065" "0000166138" "0000103066" "0000166139" "0000103067" "0000166140" "0000103068" "0000166141" "0000103069" "0000166142" "0000103070" "0000166143" "0000103071" "0000166144" "0000103072" "0000166145" "0000103073" "0000166146" "0000103074" "0000166147" "0000103075" "0000166148" "0000103076" "0000166149" "0000103077" "0000166150" "0000103078" "0000166151" "0000103079" "0000166152" "0000103080" "0000166153" "0000103081" "0000166154" "0000103082" "0000166155" "0000103083" "0000166156" "0000103084" "0000166157" "0000103085" "0000166158" "0000103086" "0000166159" "0000103087" "0000166160" "0000103088" "0000166161" "0000103089" "0000166162" "0000103090" "0000166163" "0000103091" "0000166164" "0000103092" "0000166165" "0000103093" "0000166166" "0000103094" "0000166167" "0000103095" "0000166168" "0000103096" "0000166169" "0000103097" "0000166170" "0000103098" "0000166171" "0000103099" "0000166172" "0000103100" "0000166173" "0000103101" "0000166174" "0000103102" "0000166175" "0000103103" "0000166176" "0000103104" "0000166177" "0000103105" "0000166178" "0000103106" "0000166179" "0000103106" "0000166180" "0000103107" "0000166181" "0000103108" "0000166182" "0000103108" "0000166183" "0000103109" "0000166184" "0000103109" "0000166185" "0000103110" "0000166186" "0000103110" "0000166187" "0000103111" "0000166188" "0000103112" "0000166189" "0000103113" "0000166190" "0000103113" "0000166191" "0000103114" "0000166192" "0000103114" "0000166193" "0000103115" "0000166194" "0000103115" "0000166195" "0000103116" "0000166196" "0000103117" "0000166197" "0000103117" "0000166198" "0000103118" "0000166199" "0000103119" "0000166200" "0000103163" "0000166254" "0000103164" "0000166255" "0000103165" "0000166256" "0000103166" "0000166257" "0000103166" "0000166258" "0000103167" "0000166259" "0000103168" "0000166260" "0000103168" "0000166261" "0000103169" "0000166262" "0000103170" "0000166263" "0000103170" "0000166264" "0000103171" "0000166265" "0000103172" "0000166266" "0000103172" "0000166269" "0000103173" "0000166267" "0000103173" "0000166268" "0000103174" "0000166270" "0000103175" "0000166271" "0000103175" "0000166272" "0000103176" "0000166273" "0000103176" "0000166274" "0000103177" "0000166275" "0000103177" "0000166276" "0000103178" "0000166277" "0000103178" "0000166278" "0000103179" "0000166279" "0000103179" "0000166280" "0000103180" "0000166281" "0000103180" "0000166282" "0000103183" "0000166284" "0000103183" "0000166285" "0000103184" "0000166286" "0000103184" "0000166287" "0000103185" "0000166288" "0000103185" "0000166289" "0000103186" "0000166290" "0000103186" "0000166291" "0000103187" "0000166292" "0000103188" "0000166293" "0000103188" "0000166294" "0000103189" "0000166295" "0000103189" "0000166296" "0000103190" "0000166297" "0000103190" "0000166298" "0000103579" "0000167010" "0000103579" "0000167011" "0000103580" "0000167012" "0000103580" "0000167013" "0000103581" "0000167014" "0000103582" "0000167015" "0000103584" "0000167017" "0000103584" "0000221960" "0000103585" "0000167018" "0000103585" "0000167019" "0000103643" "0000167092" "0000103643" "0000167095" "0000103645" "0000167096" "0000103645" "0000167097" "0000103646" "0000167098" "0000103648" "0000167101" "0000103660" "0000167128" "0000103660" "0000167129" "0000103661" "0000167130" "0000103661" "0000167131" "0000103665" "0000167134" "0000103675" "0000167146" "0000103675" "0000167147" "0000103676" "0000167148" "0000103676" "0000167149" "0000103677" "0000167150" "0000103677" "0000167151" "0000103678" "0000167152" "0000103678" "0000167153" "0000103683" "0000167160" "0000103684" "0000167161" "0000103684" "0000167162" "0000103685" "0000167164" "0000103687" "0000167166" "0000103689" "0000167168" "0000103689" "0000167169" "0000103690" "0000167171" "0000103690" "0000167172" "0000103691" "0000167173" "0000103699" "0000167181" "0000103699" "0000167182" "0000103700" "0000167183" "0000103700" "0000167184" "0000103701" "0000167185" "0000103701" "0000167186" "0000103702" "0000167187" "0000103702" "0000167188" "0000103703" "0000167189" "0000103703" "0000167190" "0000103704" "0000167191" "0000103704" "0000167192" "0000103705" "0000167193" "0000103705" "0000167194" "0000103706" "0000167195" "0000103706" "0000167196" "0000103707" "0000167197" "0000103707" "0000167198" "0000103708" "0000167199" "0000103708" "0000167200" "0000103709" "0000167201" "0000103710" "0000167202" "0000103710" "0000167203" "0000103711" "0000167204" "0000103711" "0000167205" "0000103712" "0000167206" "0000103723" "0000167219" "0000103723" "0000167220" "0000103723" "0000167221" "0000103781" "0000168324" "0000103781" "0000168325" "0000103782" "0000168326" "0000103783" "0000168327" "0000103917" "0000168461" "0000103917" "0000168462" "0000103918" "0000168463" "0000103918" "0000168464" "0000104087" "0000168697" "0000104087" "0000168698" "0000104088" "0000168699" "0000104088" "0000168700" "0000104089" "0000168701" "0000104089" "0000168702" "0000104090" "0000168703" "0000104090" "0000168704" "0000104091" "0000168705" "0000104092" "0000168706" "0000104093" "0000168707" "0000104093" "0000168708" "0000104094" "0000168709" "0000104094" "0000168710" "0000104111" "0000168741" "0000104111" "0000168742" "0000104112" "0000168743" "0000104112" "0000168744" "0000104113" "0000168745" "0000104113" "0000168746" "0000104114" "0000168747" "0000104115" "0000168748" "0000104115" "0000168749" "0000104116" "0000168750" "0000104116" "0000168751" "0000104117" "0000168752" "0000104117" "0000168753" "0000104118" "0000168754" "0000104118" "0000168755" "0000104119" "0000168756" "0000104119" "0000168757" "0000104120" "0000168758" "0000104120" "0000168759" "0000104121" "0000168760" "0000104121" "0000168761" "0000104122" "0000168762" "0000104122" "0000168763" "0000104123" "0000168764" "0000104123" "0000168765" "0000104124" "0000168766" "0000104124" "0000168767" "0000104125" "0000168768" "0000104125" "0000168769" "0000104126" "0000168770" "0000104126" "0000168771" "0000104183" "0000168833" "0000104184" "0000168834" "0000104185" "0000168835" "0000104185" "0000168836" "0000104186" "0000168837" "0000104186" "0000168838" "0000104187" "0000168839" "0000104187" "0000168840" "0000104188" "0000168841" "0000104188" "0000168842" "0000104189" "0000168843" "0000104190" "0000168844" "0000104191" "0000168845" "0000104192" "0000168846" "0000104192" "0000168847" "0000104193" "0000168848" "0000104193" "0000168849" "0000104194" "0000168850" "0000104194" "0000168851" "0000104211" "0000168868" "0000104213" "0000168870" "0000104213" "0000168871" "0000104214" "0000168872" "0000104214" "0000168873" "0000104215" "0000168874" "0000104215" "0000168875" "0000104216" "0000168876" "0000104216" "0000168877" "0000104217" "0000168878" "0000104217" "0000168879" "0000104218" "0000168883" "0000104218" "0000168884" "0000104222" "0000168885" "0000104223" "0000168886" "0000104223" "0000168887" "0000104225" "0000168888" "0000104225" "0000168889" "0000104228" "0000168892" "0000104228" "0000168893" "0000104229" "0000168894" "0000104232" "0000168897" "0000104232" "0000168898" "0000104377" "0000169070" "0000104407" "0000169132" "0000104408" "0000169133" "0000104409" "0000169134" "0000104410" "0000169135" "0000104410" "0000169136" "0000104438" "0000169175" "0000104438" "0000169176" "0000104439" "0000169177" "0000104439" "0000169178" "0000104440" "0000169179" "0000104440" "0000169180" "0000104441" "0000169181" "0000104441" "0000169182" "0000104441" "0000169183" "0000104442" "0000169184" "0000104442" "0000169185" "0000104443" "0000169186" "0000104444" "0000169187" "0000104465" "0000169206" "0000105516" "0000170962" "0000111837" "0000178986" "0000111838" "0000178987" "0000111838" "0000178988" "0000111838" "0000178989" "0000111839" "0000178990" "0000111839" "0000178991" "0000111840" "0000178992" "0000111840" "0000178993" "0000111841" "0000178994" "0000111842" "0000178996" "0000111842" "0000178997" "0000111842" "0000178998" "0000111844" "0000179000" "0000111844" "0000179001" "0000111845" "0000179002" "0000111845" "0000179003" "0000132719" "0000221903" "0000132719" "0000221904" "0000132781" "0000221964" "0000132781" "0000221965" "0000132815" "0000221997" "0000132815" "0000221998" "0000132846" "0000222028" "0000132846" "0000222029" "0000132847" "0000222030" "0000132847" "0000222031" "0000132848" "0000222032" "0000132849" "0000222033" "0000132850" "0000222034" "0000132850" "0000222035" "0000132851" "0000222036" "0000132852" "0000222037" "0000132853" "0000222038" "0000132854" "0000222040" "0000132855" "0000222041" "0000132865" "0000222051" "0000132865" "0000222059" "0000166014" "0000369877" "0000166014" "0000403761" "0000184352" "0000408395" "0000184353" "0000408396" "0000184354" "0000408397" "0000184355" "0000408398" "0000184356" "0000408399" "0000184357" "0000408400" "0000184358" "0000408401" "0000184359" "0000408402" "0000209572" "0000439723" "0000209572" "0000439724" "0000209804" "0000440017" "0000209849" "0000440077" "0000266605" "0000597311" "0000271021" "0000624863" "0000271021" "0000624864" "0000271022" "0000624865" "0000271022" "0000624866" "0000275468" "0000629483" "0000275468" "0000629484" "0000289268" "0000645191" "0000289268" "0000645193" "0000289269" "0000645192" "0000289269" "0000645194" "0000290138" "0000646811" "0000290155" "0000646779" "0000290174" "0000646798" "0000290461" "0000647129" "0000290461" "0000647130" "0000295137" "0000651826" "0000295138" "0000651827" "0000295140" "0000651829" "0000295142" "0000651831" "0000295143" "0000651832" "0000295144" "0000651833" "0000295145" "0000651834" "0000295146" "0000651835" "0000295147" "0000651836" "0000295148" "0000651837" "0000296606" "0000653295" "0000296813" "0000653526" "0000302735" "0000666082" "0000302735" "0000666083" "0000304778" "0000668313" "0000304778" "0000668314" "0000304779" "0000668315" "0000304779" "0000668316" "0000305069" "0000668634" "0000305070" "0000668635" "0000306183" "0000669871" "0000306184" "0000669872" "0000306918" "0000670735" "0000306936" "0000670753" "0000309096" "0000683559" "0000311032" "0000686206" "0000311032" "0000686207" "0000314939" "0000696884" "0000314939" "0000696931" "0000315510" "0000697599" "0000315511" "0000697600" "0000315512" "0000697601" "0000315513" "0000697602" "0000315514" "0000697603" "0000315515" "0000697604" "0000315516" "0000697605" "0000315517" "0000697606" "0000315518" "0000697607" "0000315519" "0000697608" "0000315520" "0000697609" "0000315521" "0000697610" "0000315522" "0000697611" "0000315523" "0000697612" "0000315524" "0000697613" "0000315525" "0000697614" "0000315526" "0000697615" "0000321482" "0000704340" "0000326622" "0000710207" "0000326622" "0000710212" "0000362834" "0000763208" "0000363145" "0000763588" "0000375557" "0000786908" "0000375557" "0000787494" "0000375558" "0000786909" "0000375558" "0000787495" "0000375559" "0000786910" "0000375559" "0000787496" "0000375560" "0000786911" "0000375561" "0000786912" "0000375562" "0000786913" "0000375563" "0000786914" "0000375564" "0000786915" "0000375564" "0000787499" "0000375565" "0000786916" "0000375566" "0000786917" "0000375567" "0000786918" "0000375567" "0000787500" "0000375568" "0000786919" "0000375568" "0000787501" "0000375569" "0000786920" "0000375895" "0000787576" "0000375895" "0000787577" "0000376409" "0000788012" "0000377633" "0000790038" "0000381991" "0000795625" "0000385787" "0000812916" "0000385787" "0000812919" "0000387716" "0000815850" "0000387716" "0000815875" "0000389915" "0000819186" "0000389933" "0000819274" "0000393177" "0000823840" "0000393178" "0000823943" "0000393180" "0000823843" "0000393180" "0000823944" "0000393182" "0000823945" "0000393182" "0000823992" "0000393184" "0000823847" "0000393203" "0000823866" "0000393239" "0000823965" "0000399011" "0000831317" "0000400237" "0000833044" "0000400239" "0000833046" "0000400269" "0000833076" "0000400322" "0000833129" "0000400337" "0000833144" "0000400337" "0000833197" "0000412506" "0000869853" "0000412553" "0000869897" "0000412859" "0000870233" "0000413156" "0000870581" "0000413168" "0000870593" "0000415985" "0000873905" "0000416824" "0000876270" "0000416824" "0000876271" "0000416825" "0000876272" "0000418188" "0000877943" "0000418188" "0000877944" "0000427801" "0000905254" "0000427801" "0000905384" "0000427802" "0000905255" "0000427802" "0000905385" "0000427803" "0000905256" "0000427803" "0000905386" "0000427804" "0000905257" "0000427804" "0000905387" "0000427805" "0000905258" "0000427805" "0000905388" "0000427806" "0000905259" "0000427806" "0000905389" "0000427807" "0000905260" "0000427807" "0000905390" "0000427808" "0000905261" "0000427809" "0000905262" "0000427809" "0000905391" "0000427810" "0000905263" "0000427810" "0000905392" "0000427811" "0000905264" "0000427811" "0000905393" "0000427812" "0000905265" "0000427812" "0000905394" "0000427813" "0000905266" "0000427814" "0000905267" "0000427814" "0000905395" "0000427815" "0000905268" "0000427815" "0000905396" "0000427816" "0000905269" "0000427816" "0000905397" "0000427817" "0000905270" "0000427817" "0000905398" "0000427818" "0000905271" "0000427819" "0000905272" "0000427819" "0000905399" "0000427820" "0000905273" "0000427820" "0000905400" "0000427821" "0000905274" "0000427821" "0000905401" "0000427822" "0000905275" "0000427822" "0000905402" "0000427823" "0000905276" "0000427824" "0000905277" "0000427824" "0000905403" "0000427825" "0000905278" "0000427825" "0000905404" "0000427826" "0000905279" "0000427826" "0000905405" "0000427827" "0000905280" "0000427827" "0000905406" "0000427828" "0000905281" "0000427828" "0000905407" "0000427829" "0000905282" "0000427829" "0000905408" "0000427830" "0000905283" "0000427830" "0000905409" "0000427831" "0000905284" "0000427831" "0000905410" "0000427832" "0000905285" "0000427832" "0000905411" "0000427833" "0000905286" "0000427833" "0000905412" "0000427834" "0000905287" "0000427834" "0000905413" "0000427835" "0000905288" "0000427835" "0000905414" "0000427836" "0000905289" "0000427836" "0000905415" "0000427837" "0000905290" "0000427837" "0000905416" "0000427838" "0000905291" "0000427838" "0000905417" "0000427839" "0000905292" "0000427839" "0000905418" "0000427840" "0000905293" "0000427840" "0000905419" "0000427841" "0000905294" "0000427841" "0000905420" "0000427842" "0000905295" "0000427842" "0000905421" "0000427843" "0000905296" "0000427843" "0000905422" "0000427844" "0000905297" "0000427844" "0000905423" "0000427845" "0000905298" "0000427845" "0000905424" "0000427846" "0000905299" "0000427846" "0000905425" "0000427847" "0000905300" "0000427847" "0000905426" "0000427848" "0000905301" "0000427848" "0000905427" "0000427849" "0000905302" "0000427849" "0000905428" "0000427850" "0000905303" "0000427851" "0000905304" "0000427852" "0000905305" "0000427852" "0000905429" "0000427853" "0000905306" "0000427853" "0000905430" "0000427854" "0000905307" "0000427854" "0000905431" "0000427855" "0000905308" "0000427855" "0000905432" "0000427856" "0000905309" "0000427856" "0000905433" "0000427857" "0000905310" "0000427857" "0000905434" "0000427858" "0000905311" "0000427858" "0000905435" "0000427859" "0000905312" "0000427859" "0000905436" "0000427860" "0000905313" "0000427860" "0000905437" "0000427861" "0000905314" "0000427861" "0000905438" "0000427862" "0000905315" "0000427862" "0000905439" "0000427863" "0000905316" "0000427863" "0000905440" "0000427864" "0000905317" "0000427864" "0000905441" "0000427865" "0000905318" "0000427865" "0000905442" "0000427866" "0000905319" "0000427867" "0000905320" "0000427867" "0000905443" "0000427868" "0000905321" "0000427868" "0000905444" "0000427869" "0000905322" "0000427869" "0000905445" "0000427870" "0000905323" "0000427870" "0000905446" "0000427871" "0000905324" "0000427871" "0000905447" "0000427872" "0000905325" "0000427872" "0000905448" "0000427873" "0000905326" "0000427874" "0000905327" "0000427874" "0000905449" "0000427875" "0000905328" "0000427875" "0000905450" "0000427876" "0000905329" "0000427876" "0000905451" "0000427877" "0000905330" "0000427877" "0000905452" "0000427878" "0000905331" "0000427878" "0000905453" "0000427879" "0000905332" "0000427879" "0000905454" "0000427880" "0000905333" "0000427880" "0000905455" "0000427881" "0000905334" "0000427881" "0000905456" "0000427882" "0000905335" "0000427882" "0000905457" "0000427883" "0000905336" "0000427884" "0000905337" "0000427884" "0000905458" "0000427885" "0000905338" "0000427885" "0000905459" "0000427886" "0000905339" "0000427886" "0000905460" "0000427887" "0000905340" "0000427887" "0000905461" "0000427888" "0000905341" "0000427888" "0000905462" "0000427889" "0000905342" "0000427889" "0000905463" "0000427890" "0000905343" "0000427890" "0000905464" "0000427891" "0000905344" "0000427892" "0000905345" "0000427892" "0000905465" "0000427893" "0000905346" "0000427894" "0000905347" "0000427894" "0000905466" "0000427895" "0000905348" "0000427895" "0000905467" "0000427896" "0000905349" "0000427896" "0000905468" "0000427897" "0000905350" "0000427897" "0000905469" "0000427898" "0000905351" "0000427898" "0000905470" "0000427899" "0000905352" "0000427900" "0000905353" "0000427900" "0000905471" "0000427901" "0000905354" "0000427901" "0000905472" "0000427902" "0000905355" "0000427902" "0000905473" "0000427903" "0000905356" "0000427903" "0000905474" "0000427904" "0000905357" "0000427904" "0000905475" "0000427905" "0000905358" "0000427905" "0000905476" "0000427906" "0000905359" "0000427906" "0000905477" "0000427907" "0000905360" "0000427907" "0000905478" "0000427908" "0000905361" "0000427908" "0000905479" "0000427909" "0000905362" "0000427909" "0000905480" "0000427910" "0000905363" "0000427910" "0000905481" "0000427911" "0000905364" "0000427912" "0000905365" "0000427912" "0000905482" "0000427913" "0000905366" "0000427913" "0000905483" "0000427914" "0000905367" "0000427914" "0000905484" "0000427915" "0000905368" "0000427915" "0000905485" "0000427916" "0000905369" "0000427916" "0000905486" "0000427917" "0000905370" "0000427917" "0000905487" "0000427918" "0000905371" "0000427919" "0000905372" "0000427919" "0000905488" "0000427920" "0000905373" "0000427920" "0000905489" "0000427921" "0000905374" "0000427921" "0000905490" "0000427922" "0000905375" "0000427922" "0000905491" "0000427923" "0000905376" "0000427923" "0000905492" "0000427924" "0000905377" "0000427924" "0000905493" "0000427925" "0000905378" "0000427925" "0000905494" "0000427926" "0000905379" "0000427926" "0000905495" "0000427927" "0000905380" "0000427927" "0000905496" "0000427928" "0000905381" "0000427928" "0000905497" "0000427929" "0000905382" "0000427929" "0000905498" "0000427930" "0000905383" "0000428466" "0000906280" "0000428467" "0000906281" "0000428468" "0000906282" "0000428469" "0000906283" "0000428470" "0000906284" "0000428471" "0000906285" "0000428472" "0000906286" "0000428473" "0000906287" "0000428474" "0000906288" "0000428475" "0000906289" "0000428476" "0000906290" "0000428477" "0000906291" "0000428478" "0000906292" "0000428479" "0000906293" "0000428480" "0000906294" "0000428481" "0000906295" "0000428482" "0000906296" "0000428483" "0000906297" "0000428484" "0000906298" "0000428491" "0000907877" "0000429881" "0000909540" "0000429881" "0000909541" "0000431802" "0000917092" "0000431808" "0000917098" "0000431809" "0000917099" "0000434890" "0000920787" "0000434890" "0000920788" "0000434891" "0000920789" "0000434892" "0000920790" "0000434893" "0000920791" "0000434893" "0000920792" "0000434894" "0000920793" "0000434894" "0000920794" "0000436513" "0000927505" "0000436513" "0000927506" "0000437160" "0000931956" "0000437160" "0000932008" "0000437161" "0000931957" "0000437161" "0000932009" "0000437162" "0000931958" "0000437163" "0000931959" "0000437163" "0000932010" "0000437164" "0000931960" "0000437165" "0000931961" "0000437166" "0000931962" "0000437167" "0000931963" "0000437167" "0000932011" "0000437168" "0000931964" "0000437168" "0000932012" "0000437169" "0000931965" "0000437169" "0000932013" "0000437170" "0000931966" "0000437170" "0000932014" "0000437171" "0000931967" "0000437171" "0000932015" "0000437172" "0000931968" "0000437172" "0000932016" "0000437173" "0000931969" "0000437174" "0000931970" "0000437174" "0000932017" "0000437175" "0000931971" "0000437175" "0000932018" "0000437176" "0000931972" "0000437177" "0000931973" "0000437177" "0000932019" "0000437178" "0000931974" "0000437178" "0000932020" "0000437179" "0000931975" "0000437180" "0000931976" "0000437180" "0000932021" "0000437181" "0000931977" "0000437181" "0000932022" "0000437182" "0000931978" "0000437182" "0000932023" "0000437183" "0000931979" "0000437183" "0000932024" "0000437184" "0000931980" "0000437184" "0000932025" "0000437185" "0000931981" "0000437185" "0000932026" "0000437186" "0000931982" "0000437186" "0000932027" "0000437187" "0000931983" "0000437188" "0000931984" "0000437188" "0000932028" "0000437189" "0000931985" "0000437189" "0000932029" "0000437190" "0000931986" "0000437190" "0000932030" "0000437191" "0000931987" "0000437191" "0000932031" "0000437192" "0000931988" "0000437192" "0000932032" "0000437193" "0000931989" "0000437193" "0000932033" "0000437194" "0000931990" "0000437194" "0000932034" "0000437195" "0000931991" "0000437195" "0000932035" "0000437196" "0000931992" "0000437196" "0000932036" "0000437197" "0000931993" "0000437197" "0000932037" "0000437198" "0000931994" "0000437199" "0000931995" "0000437199" "0000932038" "0000437200" "0000931996" "0000437200" "0000932039" "0000437201" "0000931997" "0000437202" "0000931998" "0000437203" "0000931999" "0000437203" "0000932040" "0000437204" "0000932000" "0000437205" "0000932001" "0000437205" "0000932041" "0000437206" "0000932002" "0000437206" "0000932042" "0000437207" "0000932003" "0000437207" "0000932043" "0000437208" "0000932004" "0000437208" "0000932044" "0000437209" "0000932005" "0000437210" "0000932006" "0000437210" "0000932045" "0000437211" "0000932007" "0000437211" "0000932046" "0000438327" "0000933950" "0000438331" "0000933954" "0000439953" "0000936097" "0000439959" "0000936103" "0000439960" "0000936104" "0000444092" "0000945935" "0000444092" "0000945938" "0000444093" "0000945936" "0000444093" "0000945939" "0000444094" "0000945937" "0000444094" "0000945940" "0000444192" "0000946049" "0000444197" "0000946178" "0000444280" "0000946136" "0000444281" "0000946137" "0000447019" "0000955468" "0000447019" "0000955469" "0000447020" "0000955470" "0000447020" "0000955471" "0000447021" "0000955472" "0000447021" "0000955473" "0000447939" "0000957310" "0000447970" "0000957344" "0000447971" "0000957345" "0000447971" "0000957346" "0000447972" "0000957347" "0000447973" "0000957348" "0000447973" "0000957349" "0000447975" "0000957351" "0000447975" "0000957352" "0000447976" "0000957353" "0000447976" "0000957354" "0000447977" "0000957355" "0000447977" "0000957356" "0000447978" "0000957357" "0000447978" "0000957358" "0000447979" "0000957359" "0000447979" "0000957360" "0000449997" "0000971626" "0000451158" "0000984943" "0000451158" "0000984944" "0000451160" "0000984949" "0000451160" "0000984950" "0000454406" "0000989211" "0000454442" "0000989253" "0000459286" "0001017267" "0000459286" "0001017268" "0000461858" "0001021227" "0000465824" "0001029525" "0000465824" "0001029615" "0000465825" "0001029526" "0000465825" "0001029616" "0000465826" "0001029527" "0000465826" "0001029617" "0000465827" "0001029528" "0000465828" "0001029529" "0000465828" "0001029618" "0000465829" "0001029530" "0000465829" "0001029619" "0000465830" "0001029531" "0000465830" "0001029620" "0000465831" "0001029532" "0000465831" "0001029621" "0000465832" "0001029533" "0000465833" "0001029534" "0000465833" "0001029622" "0000465834" "0001029535" "0000465834" "0001029623" "0000465835" "0001029536" "0000465835" "0001029624" "0000465836" "0001029537" "0000465836" "0001029625" "0000465836" "0001029680" "0000465837" "0001029538" "0000465838" "0001029539" "0000465838" "0001029626" "0000465839" "0001029540" "0000465839" "0001029627" "0000465840" "0001029541" "0000465840" "0001029628" "0000465841" "0001029542" "0000465842" "0001029543" "0000465842" "0001029629" "0000465843" "0001029544" "0000465843" "0001029630" "0000465844" "0001029545" "0000465844" "0001029631" "0000465845" "0001029546" "0000465845" "0001029632" "0000465846" "0001029547" "0000465846" "0001029633" "0000465847" "0001029548" "0000465848" "0001029549" "0000465848" "0001029634" "0000465849" "0001029550" "0000465850" "0001029551" "0000465851" "0001029552" "0000465851" "0001029635" "0000465852" "0001029553" "0000465852" "0001029636" "0000465853" "0001029554" "0000465854" "0001029555" "0000465854" "0001029637" "0000465855" "0001029556" "0000465856" "0001029557" "0000465857" "0001029558" "0000465857" "0001029638" "0000465858" "0001029559" "0000465859" "0001029560" "0000465859" "0001029639" "0000465860" "0001029561" "0000465860" "0001029640" "0000465861" "0001029562" "0000465861" "0001029641" "0000465862" "0001029563" "0000465862" "0001029642" "0000465863" "0001029564" "0000465863" "0001029643" "0000465864" "0001029565" "0000465865" "0001029566" "0000465865" "0001029644" "0000465866" "0001029567" "0000465866" "0001029645" "0000465867" "0001029568" "0000465867" "0001029646" "0000465868" "0001029569" "0000465868" "0001029647" "0000465869" "0001029570" "0000465870" "0001029571" "0000465870" "0001029648" "0000465871" "0001029572" "0000465871" "0001029649" "0000465872" "0001029573" "0000465872" "0001029650" "0000465873" "0001029574" "0000465873" "0001029651" "0000465874" "0001029575" "0000465874" "0001029652" "0000465875" "0001029576" "0000465876" "0001029577" "0000465876" "0001029653" "0000465877" "0001029578" "0000465877" "0001029654" "0000465878" "0001029579" "0000465879" "0001029580" "0000465879" "0001029655" "0000465880" "0001029581" "0000465880" "0001029656" "0000465881" "0001029582" "0000465881" "0001029657" "0000465882" "0001029583" "0000465883" "0001029584" "0000465883" "0001029658" "0000465884" "0001029585" "0000465884" "0001029659" "0000465885" "0001029586" "0000465885" "0001029660" "0000465886" "0001029587" "0000465886" "0001029661" "0000465887" "0001029588" "0000465887" "0001029662" "0000465888" "0001029589" "0000465889" "0001029590" "0000465889" "0001029663" "0000465890" "0001029591" "0000465890" "0001029664" "0000465891" "0001029592" "0000465891" "0001029665" "0000465892" "0001029593" "0000465892" "0001029666" "0000465893" "0001029594" "0000465893" "0001029667" "0000465894" "0001029595" "0000465894" "0001029668" "0000465895" "0001029596" "0000465895" "0001029669" "0000465896" "0001029597" "0000465896" "0001029670" "0000465897" "0001029598" "0000465898" "0001029599" "0000465899" "0001029600" "0000465900" "0001029601" "0000465901" "0001029602" "0000465901" "0001029671" "0000465902" "0001029603" "0000465903" "0001029604" "0000465904" "0001029605" "0000465904" "0001029672" "0000465905" "0001029606" "0000465906" "0001029607" "0000465906" "0001029673" "0000465907" "0001029608" "0000465907" "0001029674" "0000465908" "0001029609" "0000465908" "0001029675" "0000465909" "0001029610" "0000465909" "0001029676" "0000465910" "0001029611" "0000465910" "0001029677" "0000465911" "0001029612" "0000465911" "0001029678" "0000465912" "0001029613" "0000465912" "0001029679" "0000465913" "0001029614" "0000467745" "0001047072" "0000468229" "0001047958" "0000468230" "0001047959" "0000468231" "0001047960" "0000469272" "0001049531" "0000469272" "0001049532" "0000469904" "0001057963" "0000469908" "0001057966" "0000469909" "0001057968" "0000469945" "0001058025" "0000469945" "0001058027" "0000469947" "0001058028" "0000470725" "0001058847" "0000470726" "0001058848" "0000472324" "0001060869"