### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = LAMP2) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "LAMP2" "lysosomal-associated membrane protein 2" "X" "q24-q25" "unknown" "NC_000023.10" "UD_132118265866" "" "https://www.LOVD.nl/LAMP2" "" "1" "6501" "3920" "309060" "1" "1" "1" "1" "This database is one of the gene variant databases from the \"Leiden Muscular Dystrophy pages\" (LMDp)." "" "g" "https://databases.lovd.nl/shared/refseq/LAMP2_codingDNA.html" "1" "" "This database is one of the gene variant databases from the \"Leiden Muscular Dystrophy pages\" (LMDp)." "-1" "" "-1" "00000" "2009-03-06 00:00:00" "00006" "2024-01-11 14:51:05" "00006" "2026-04-20 14:19:32" ## Transcripts ## Do not remove or alter this header ## ## Count = 2 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00000468" "LAMP2" "transcript variant C" "001" "NM_001122606.1" "" "NP_001116078.1" "" "" "" "-180" "3572" "1236" "119560003" "119603204" "00000" "2012-09-13 12:19:29" "" "" "00025774" "LAMP2" "transcript variant A" "002" "NM_002294.2" "" "NP_002285.1" "" "" "" "-180" "6408" "1233" "119603204" "119560003" "00006" "2022-12-18 12:32:33" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 11 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00139" "ID" "intellectual disability (ID)" "" "" "" "" "" "00084" "2013-06-04 18:18:07" "00006" "2015-02-09 10:02:49" "00187" "MRX;IDX" "mental retardation, X-linked (MRX, intellectual disability (IDX))" "" "" "" "X-linked" "" "00006" "2013-09-05 15:56:47" "00006" "2018-12-18 09:23:21" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "00244" "MYOP" "myopathy (MYOP)" "" "" "" "" "" "00006" "2013-10-12 23:00:55" "00006" "2019-06-19 11:52:31" "00351" "CMH" "cardiomyopathy, hypertrophic (CMH)" "" "" "" "" "" "00006" "2014-03-13 16:15:54" "00006" "2015-03-06 17:16:01" "00352" "CMD" "cardiomyopathy, dilated (CMD)" "" "" "" "" "" "00006" "2014-03-13 16:16:15" "00006" "2015-03-06 17:18:25" "01157" "CHTE" "Hypothyroidism, central, testicular enlargement (CHTE)" "XLR" "300888" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "02145" "Danon;GSD2B" "Danon disease (glycogen storage disease, type IIb (GSD-2B))" "XLD" "300257" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "04172" "CM" "cardiomyopathy (CM)" "" "" "" "" "" "00006" "2015-01-20 15:34:26" "00006" "2016-03-20 12:15:43" "04214" "-" "retinal disease" "" "" "" "" "" "00006" "2015-02-27 19:48:07" "00001" "2023-03-09 14:26:26" "05121" "MD" "dystrophy, muscular (MD)" "" "" "" "" "" "00006" "2016-01-24 01:27:29" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 2 "{{geneid}}" "{{diseaseid}}" "LAMP2" "00139" "LAMP2" "02145" ## Individuals ## Do not remove or alter this header ## ## Count = 142 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00000208" "" "" "" "1" "" "00037" "{PMID:Sun 2011:23143598}, {DOI:Sun 2011:10.1038/ng.2453}" "" "M" "no" "Netherlands" "" "0" "" "" "" "" "00056438" "" "" "" "1" "" "01502" "" "" "M" "?" "Spain" "" "0" "" "" "" "" "00088085" "" "" "" "5" "" "00006" "{PMID:Alroy 2010:21070164}, {DOI:Alroy 2010:10.3109/01913123.2010.499024}" "2-generation family, 5 affecteds, (3F, 2M)" "F;M" "" "United States" "" "0" "" "" "" "" "00088086" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088087" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088088" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088089" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088090" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088091" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088092" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088093" "" "" "" "1" "" "00006" "{PMID:Cheng 2012:22108829}, {DOI:Cheng 2012:10.1093/eurheartj/ehr420}" "" "M" "no" "China" "" "0" "" "" "" "" "00088094" "" "" "" "1" "" "00006" "{PMID:Cheng 2012:22108829}, {DOI:Cheng 2012:10.1093/eurheartj/ehr420}" "" "M" "" "China" "" "0" "" "" "" "" "00088095" "" "" "" "1" "" "00006" "{PMID:Cheng 2012:22108829}, {DOI:Cheng 2012:10.1093/eurheartj/ehr420}" "" "M" "no" "China" "" "0" "" "" "" "" "00088096" "" "" "" "1" "" "00006" "{PMID:Fidzianska 2013:23504560}, {DOI:Fidzianska 2013:10.1055/s-0033-1336017}" "isolated case and unaffected non-carrier sister" "M" "no" "Poland" "" "0" "" "" "" "" "00088097" "" "" "" "3" "" "00006" "{PMID:He 2014:23955649}, {DOI:He 2014:10.1007/s00059-013-3900-5}" "2-generation family, 1 affected, unaffected heterozygous carrier mother/sister" "M" "no" "China" "" "0" "" "" "China" "" "00088098" "" "" "" "1" "" "00006" "{PMID:Kim 2010:20513107}, {DOI:Kim 2010:10.1002/mus.21614}" "2-generation family, 1 affected, unaffected non-carrier parents/sibs" "F" "no" "Korea, South (Republic)" "" "0" "" "" "" "" "00088099" "" "" "" "1" "" "00006" "{PMID:Regelsberger 2009:19588270}, {DOI:Regelsberger 2009:10.1007/s10545-009-1097-9}" "2-generation family, 1 affected, unaffected non-carrier parents/sib" "M" "no" "Austria" "" "0" "" "" "" "" "00088100" "" "" "" "1" "" "00006" "{PMID:Tada 2010:20439808}, {DOI:Tada 2010:10.1161/CIR.0b013e3181de7097}" "isolated case" "M" "no" "Japan" "" "0" "" "" "" "" "00088101" "" "" "" "4" "" "00006" "{PMID:Tolb 2010:20117447}, {DOI:Tolb 2010:10.1016/j.jacc.2009.11.019}" "4-generation family, 4 affecteds (2F, 2M)" "F;M" "no" "United States" "" "0" "" "" "" "" "00088102" "" "" "" "1" "" "00006" "{PMID:Yang 2010:20173215}, {DOI:Yang 2010:10.1161/CIRCGENETICS.109.901785}" "" "M" "" "United States" "" "0" "" "" "white" "" "00088103" "" "" "" "1" "" "00006" "{PMID:Yang 2010:20173215}, {DOI:Yang 2010:10.1161/CIRCGENETICS.109.901785}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "" "United States" "" "0" "" "" "white" "" "00088104" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088105" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088106" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088107" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088108" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088109" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088110" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088111" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088112" "" "" "" "1" "" "00006" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "United States" "" "0" "" "" "" "" "00088113" "" "" "" "13" "" "00006" "{PMID:Taylor 2007:17899313}, {DOI:Taylor 2007:10.1007/s10038-007-0184-8}" "5-generation family, >13 affecteds" "F;M" "no" "United States" "" "0" "" "" "" "" "00088151" "" "" "" "1" "" "00006" "{PMID:Yang 2010:20173215}, {DOI:Yang 2010:10.1161/CIRCGENETICS.109.901785}" "" "M" "" "United States" "" "0" "" "" "" "" "00088152" "" "" "" "3" "" "00006" "{PMID:Fanin 2006:16565504}, {DOI:Fanin 2006:10.2353/ajpath.2006.050646}" "2-generation family, 3 affecteds (2F, M)" "M" "no" "Italy" "" "0" "" "" "" "" "00088153" "" "" "" "4" "" "00006" "{PMID:Fanin 2006:16565504}, {DOI:Fanin 2006:10.2353/ajpath.2006.050646}" "3-generation family, 4 affecteds (3F, M)" "M" "no" "Italy" "" "0" "" "" "" "" "00088154" "" "" "" "8" "" "00006" "{PMID:Fanin 2006:16565504}, {DOI:Fanin 2006:10.2353/ajpath.2006.050646}, {PMID:Miani 2012:22074992}, {DOI:Miani 2012:10.1016/j.amjcard.2011.09.024}" "4-generation family, 8 affecteds (6F, 2M), 4 women died suddenly" "M" "no" "Italy" "" "0" "" "" "" "" "00088155" "" "" "" "2" "" "00006" "{PMID:Majer 2014:23716275}, {DOI:Majer 2014:10.1007/s10545-013-9617-z}" "3-generation family, 2 affected brothers" "M" "no" "Czech Republic" "" "0" "" "" "" "" "00088156" "" "" "" "6" "" "00006" "{PMID:Yang 2005:16144992}, {DOI:Yang 2005:10.1161/CIRCULATIONAHA.105.546481}" "4-generation family, 6 affecteds *3F, 3M)" "F;M" "no" "United States" "" "0" "" "" "" "" "00088157" "" "" "" "2" "" "00006" "{PMID:Yang 2005:16144992}, {DOI:Yang 2005:10.1161/CIRCULATIONAHA.105.546481}" "2-generation family, affected mother/son" "F;M" "no" "United States" "" "0" "" "" "" "" "00088158" "" "" "" "7" "" "00006" "{PMID:Schorderet 2007:17296900}, {DOI:Schorderet 2007:10.1001/archopht.125.2.231}" "3-generation family, 7 affecteds (3F, 4M)" "F;M" "no" "Switzerland" "" "0" "" "" "" "" "00088159" "" "" "" "3" "" "00006" "{PMID:Sabourdy 2009:19373884}, {DOI:Sabourdy 2009:10.1002/mus.21252}" "3-generation family, 3 affecteds (F, 2M) mother and 2 sons" "F;M" "" "Greece" "" "0" "" "" "" "" "00088160" "" "" "" "1" "" "00006" "{PMID:Sabourdy 2009:19373884}, {DOI:Sabourdy 2009:10.1002/mus.21252}" "" "M" "no" "Greece" "" "0" "" "" "" "" "00088161" "" "" "" "4" "" "00006" "{PMID:Cottinet 2011:21161685}, {DOI:Cottinet 2011:0.1007/s10545-010-9251-y}" "2-generation family, affected mother and 3 sons" "F;M" "" "France" "" "0" "" "" "" "" "00088162" "" "" "" "1" "" "00006" "{PMID:Bui 2008:18282207}, {DOI:Bui 2008:10.1111/j.1399-3046.2007.00874.x}" "" "M" "no" "United States" "" "0" "" "" "Mexican" "" "00088163" "" "" "" "3" "" "00006" "{PMID:Nadeau 2008:18004770}, {DOI:Nadeau 2008:10.1002/mus.20930}" "4-generation family, affected grandmother, father and daughter" "F;M" "no" "Canada" "" "0" "" "" "" "" "00088164" "" "" "" "1" "" "00006" "{PMID:Iascone 2008:20960602}" "" "M" "no" "Italy" "" "0" "" "" "" "" "00088165" "" "" "" "2" "" "00006" "{PMID:Takahashi 2002:12112061}, {DOI:Takahashi 2002:10.1002/ana.10235}" "2-generation family, affected brother/daughter" "F;M" "no" "Japan" "" "0" "" "" "" "" "00088166" "" "" "" "1" "" "00006" "{PMID:Hong 2012:22541782}, {DOI:Hong 2012:10.5414/NP300465}" "" "M" "no" "China" "" "0" "" "" "" "" "00088167" "" "" "" "1" "" "00006" "{PMID:Hong 2012:22541782}, {DOI:Hong 2012:10.5414/NP300465}" "" "M" "no" "China" "" "0" "" "" "" "" "00088956" "" "" "" "1" "" "00006" "{PMID:Viéitez 2008:18386377}" "" "" "" "Spain" "" "0" "" "" "" "" "00088957" "" "" "" "4" "" "00006" "{PMID:Tunon 2008:18061453}" "2-generation family, 4 affecteds (2F, 2M)" "F;M" "" "Spain" "" "0" "" "" "" "" "00088958" "" "" "" "5" "" "00006" "{PMID:Thiadens 2012:22290069}, {PMID:van der Kooi 2008:1841359}" "4-generation family, 5 affecteds (F, 4M)" "F;M" "" "Netherlands" "" "0" "" "" "" "" "00088959" "" "" "" "1" "" "00006" "{PMID:D’Souza 2014:25228319}" "" "" "" "United States" "" "0" "" "" "" "" "00088960" "" "" "" "1" "" "00006" "{PMID:D’Souza 2014:25228319}" "" "" "" "United States" "" "0" "" "" "" "" "00088961" "" "" "" "1" "" "00006" "{PMID:D’Souza 2014:25228319}" "" "" "" "United States" "" "0" "" "" "" "" "00088962" "" "" "" "1" "" "00006" "{PMID:D’Souza 2014:25228319}" "" "" "" "United States" "" "0" "" "" "" "" "00088963" "" "" "" "1" "" "00006" "{PMID:D’Souza 2014:25228319}" "" "" "" "United States" "" "0" "" "" "" "" "00088964" "" "" "" "1" "" "00006" "{PMID:D’Souza 2014:25228319}" "" "" "" "United States" "" "0" "" "" "" "" "00088965" "" "" "" "1" "" "00006" "{PMID:Lacoste-Collin 2002:12398843}" "" "M" "" "France" "" "0" "" "" "white" "" "00088966" "" "" "" "1" "" "00006" "{PMID:Burusnukul 2008:18555174}" "" "" "" "United States" "" "0" "" "" "" "" "00088969" "" "" "" "1" "" "00006" "{PMID:Bertini 2005:16217705}" "2-generation family, unaffected non-carrier mother" "M" "" "Italy" "" "0" "" "" "" "" "00088970" "" "" "" "1" "" "00006" "{PMID:Bertini 2005:16217705}" "2-generation family, heterozygous carrier mother" "M" "" "Italy" "" "0" "" "" "" "" "00088971" "" "" "" "78" "" "00006" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "" "00088972" "" "" "" "1" "" "00006" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "" "00088973" "" "" "" "1" "" "00006" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "" "00088974" "" "" "" "12" "" "00006" "{PMID:Tarpey 2009:19377476}" "" "M" "" "" "" "0" "for details contact Lucy Raymond (flr24 @ cam.ac.uk)" "" "" "" "00088975" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "" "00088976" "" "" "" "1" "" "00430" "from website {DBsub-Emory}" "" "" "" "(United States)" "" "0" "" "" "" "" "00088983" "" "" "" "1" "" "00052" "{PMID:Echaniz-Laguna 2006:16372318}" "" "" "" "Italy" "" "0" "" "" "Sardinia" "" "00088984" "" "" "" "1" "" "00052" "{PMID:Di Blasi 2008:18990578}" "3-generation family, 1 affected, 2 uncles mother’s side died suddenly (35y/40y, one pes cavus)" "M" "no" "Italy" "" "0" "" "" "" "" "00088985" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Japan" "" "0" "" "" "" "" "00088986" "" "" "" "2" "" "00052" "{PMID:Balmer 2005:15889279}" "2-generation family, affected boy and mother" "M" "no" "Switzerland" "16y" "0" "" "" "" "" "00088987" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Greece" "" "0" "" "" "" "" "00088988" "" "" "" "1" "" "00052" "{PMID:Lacoste-Collin 2002:12398843}" "" "M" "" "France" "" "0" "" "" "white, French" "" "00088989" "" "" "" "1" "" "00052" "{PMID:Di Blasi 2008:18990578}" "" "" "" "Italy" "" "0" "" "" "" "" "00088990" "" "" "" "1" "" "00052" "{PMID:Arad 2005:15673802}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" "" "0" "" "" "white; black; Hispanic" "" "00088991" "" "" "" "1" "" "00052" "{PMID:Charron 2004:15253947}" "" "" "" "France" "" "0" "" "" "" "" "00088992" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Japan" "" "0" "" "" "" "" "00088993" "" "" "" "1" "" "00052" "{PMID:Lobrinus 2005:15792868}" "" "" "" "Switzerland" "" "0" "" "" "" "" "00088994" "" "" "" "1" "" "00052" "{PMID:Charron 2004:15253947}" "" "" "" "France" "" "0" "" "" "" "" "00088995" "" "" "" "1" "" "00052" "{PMID:Dougu 2009:19057086}" "" "" "" "Japan" "" "0" "" "" "" "" "00088996" "" "" "" "1" "" "00052" "{PMID:Arad 2005:15673802}" "2-generation family, 1 affected, carrier mother" "M" "no" "" "" "0" "" "" "white; black; Hispanic" "" "00088997" "" "" "" "1" "" "00052" "{PMID:Arad 2005:15673802}" "2-generation family, 1 affected, unaffected non-carrier parents" "M" "no" "" "" "0" "" "" "white; black; Hispanic" "" "00088998" "" "" "" "1" "" "00052" "{PMID:Sabroudy 2009:19373884}" "" "" "" "Greece" "" "0" "" "" "" "" "00088999" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Japan" "" "0" "" "" "" "" "00089000" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Japan" "" "0" "" "" "" "" "00089001" "" "" "" "3" "" "00052" "{PMID:Arad 2005:15673802}" "3-generation family, 3 affecteds (F, 2M), 6 unaffected carrier females" "F;M" "" "" "" "0" "" "" "white; black; Hispanic" "" "00089002" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Japan" "" "0" "" "" "" "" "00089003" "" "" "" "1" "" "00052" "{PMID:Arad 2005:15673802}" "" "M" "no" "" "" "0" "" "" "white; black; Hispanic" "" "00089005" "" "" "" "1" "" "00052" "{PMID:Di Blasi 2008:18990578}" "" "" "" "Italy" "" "0" "" "" "" "" "00089006" "" "" "" "1" "" "00052" "{PMID:Arad 2005:15673802}" "" "M" "" "" "" "0" "" "" "white; black; Hispanic" "" "00089007" "" "" "" "1" "" "00052" "{PMID:Bertini 2005:16217705}" "" "" "" "United States" "" "0" "" "" "" "" "00089008" "" "" "" "1" "" "00052" "{PMID:Sabroudy 2009:19373884}" "" "" "" "Greece" "" "0" "" "" "" "" "00089009" "" "" "" "1" "" "00052" "{PMID:Horvath 2003:14598234}" "" "" "" "Germany" "" "0" "" "" "" "" "00089010" "" "" "" "1" "" "00052" "{PMID:Musumeci 2005:15907287}" "" "M" "" "Italy" "" "0" "" "" "Italian" "" "00089011" "" "" "" "1" "" "00052" "{PMID:Nishino 2000:10972294}" "" "M" "" "Italy" "" "0" "" "" "" "" "00089012" "" "" "" "3" "" "01834" "" "3-generation family, affected mother, daughter (II2, 56y) and grandson (III2, 40y)" "M" "no" "Austria" "" "0" "" "" "" "" "00089021" "" "" "" "2" "" "00006" "{PMID:Arad 2005:15673802}" "affected mother/son" "F;M" "" "" "" "0" "" "" "" "" "00108624" "" "" "" "1" "" "01401" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "F" "" "Italy" "" "0" "" "" "" "Pat241" "00108628" "" "" "" "1" "" "01401" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "F" "" "Italy" "" "0" "" "" "" "Pat748" "00108634" "" "" "" "1" "" "01401" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "F" "" "Italy" "" "0" "" "" "" "Pat890" "00108654" "" "" "" "1" "" "01401" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "" "" "Italy" "" "0" "" "" "" "HCM" "00206819" "" "" "" "1" "" "01807" "" "" "M" "" "" "" "0" "" "" "" "" "00211195" "" "" "" "1" "" "03148" "" "" "M" "no" "Italy" ">43y" "0" "" "heart transplant" "" "" "00228216" "" "" "" "2" "" "02588" "{PMID:Gourzi 2018:29753918}" "proband and affected twin sister (38y), father (38y) died from multiple organ and end-stage heart failure" "F" "?" "Greece" "" "0" "" "implantable cardioverter-defibrillator" "" "29753918-proband-fam" "00240132" "" "" "" "3" "" "00006" "{PMID:Fanin 2015:25091525}" "2-generation family, affected mother/2 sons" "F;M" "" "Italy" "" "0" "" "" "" "Family" "00294934" "" "" "" "1" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00294935" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00295231" "" "" "" "3" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00305332" "" "" "" "2" "" "03575" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "analysis 2794 individuals (India)" "" "" "India" "" "0" "" "" "" "" "00316244" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316245" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316246" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316247" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316248" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316249" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316250" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316251" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316252" "" "" "" "2" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00316253" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United Kingdom (Great Britain)" "" "0" "" "" "" "" "00317104" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317105" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317106" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317107" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317108" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317109" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317110" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317111" "" "" "" "2" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317112" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317749" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00317750" "" "" "" "1" "" "00006" "{PMID:Walsh 2017:27532257}" "" "" "" "United States" "" "0" "" "" "" "" "00376397" "" "" "" "1" "" "00006" "{PMID:Nguyen 2021:34011823}" "" "" "" "Viet Nam" "" "0" "" "" "" "Pat016" "00376408" "" "" "" "1" "" "00006" "{PMID:Nguyen 2021:34011823}" "" "" "" "Viet Nam" "" "0" "" "" "" "Pat082" "00415288" "" "" "" "1" "" "00000" "{PMID:Alfares 2018:30202406}" "" "M" "" "" "" "0" "" "" "" "1_XL" "00427993" "" "" "" "2" "" "00006" "{PMID:Bournazos 2022:34906502}" "family, 2 affected (patient and sibling), mother germline mosaic" "" "" "Australia" "" "0" "" "" "" "A079" "00445381" "" "" "" "2" "" "00006" "{PMID:Shalata 2023:37628591}" "2-generation family, affected father/daughter (3 first trimester miscarriages)" "F" "" "Israel" "" "0" "" "" "" "FamPat2" "00445382" "" "" "00445381" "1" "" "00006" "{PMID:Shalata 2023:37628591}" "father" "M" "" "Israel" "" "0" "" "" "" "FamPat1" "00453128" "" "" "" "1" "" "02515" "Fusco 2042, submitted" "" "M" "" "Italy" "" "0" "" "" "white" "Fam73Pat115" "00454846" "" "" "" "1" "" "04100" "-" "-" "F" "no" "China" ">14y" "" "-" "metoprolol" "Asia" "-" "00454847" "" "" "" "1" "" "04100" "-" "-" "F" "no" "China" ">07y" "0" "-" "metoprolol" "Asia" "-" "00454848" "" "" "" "1" "" "04100" "-" "-" "M" "no" "(China)" "02y03m" "0" "-" "-" "Asia" "-" "00454849" "" "" "" "1" "" "04100" "-" "-" "M" "no" "China" ">10y" "" "-" "metoprolol" "Asia" "" "00476906" "" "" "" "1" "" "00006" "{PMID:Alhammad 2024:39232665}" "" "" "" "Saudi Arabia" "" "0" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 142 "{{individualid}}" "{{diseaseid}}" "00000208" "01157" "00056438" "02145" "00088085" "02145" "00088086" "02145" "00088087" "02145" "00088088" "02145" "00088089" "02145" "00088090" "02145" "00088091" "02145" "00088092" "02145" "00088093" "02145" "00088094" "02145" "00088095" "02145" "00088096" "02145" "00088097" "02145" "00088098" "02145" "00088099" "02145" "00088100" "02145" "00088101" "02145" "00088102" "02145" "00088103" "02145" "00088104" "02145" "00088105" "02145" "00088106" "02145" "00088107" "02145" "00088108" "02145" "00088109" "02145" "00088110" "02145" "00088111" "02145" "00088112" "02145" "00088113" "02145" "00088151" "02145" "00088152" "02145" "00088153" "02145" "00088154" "02145" "00088155" "02145" "00088156" "02145" "00088157" "02145" "00088158" "02145" "00088159" "02145" "00088160" "02145" "00088161" "02145" "00088162" "02145" "00088163" "02145" "00088164" "02145" "00088165" "02145" "00088166" "02145" "00088167" "02145" "00088956" "02145" "00088957" "02145" "00088958" "02145" "00088959" "02145" "00088960" "02145" "00088961" "02145" "00088962" "02145" "00088963" "02145" "00088964" "02145" "00088965" "02145" "00088966" "02145" "00088969" "02145" "00088970" "02145" "00088971" "00187" "00088972" "00187" "00088973" "00187" "00088974" "00187" "00088975" "00198" "00088976" "00198" "00088983" "02145" "00088984" "02145" "00088985" "02145" "00088986" "02145" "00088987" "02145" "00088988" "02145" "00088989" "02145" "00088990" "00351" "00088991" "00351" "00088992" "02145" "00088993" "02145" "00088994" "00351" "00088995" "00351" "00088996" "00351" "00088997" "00351" "00088998" "02145" "00088999" "02145" "00089000" "02145" "00089001" "00351" "00089002" "02145" "00089003" "00351" "00089005" "02145" "00089006" "00351" "00089007" "02145" "00089008" "02145" "00089009" "02145" "00089010" "02145" "00089011" "02145" "00089012" "04172" "00089021" "02145" "00108624" "00351" "00108628" "00351" "00108634" "00351" "00108654" "00351" "00206819" "00198" "00211195" "02145" "00228216" "00352" "00240132" "05121" "00294934" "00198" "00294935" "00198" "00295231" "00198" "00305332" "00198" "00316244" "04172" "00316245" "04172" "00316246" "04172" "00316247" "04172" "00316248" "04172" "00316249" "04172" "00316250" "04172" "00316251" "04172" "00316252" "04172" "00316253" "04172" "00317104" "04172" "00317105" "04172" "00317106" "04172" "00317107" "04172" "00317108" "04172" "00317109" "04172" "00317110" "04172" "00317111" "04172" "00317112" "04172" "00317749" "04172" "00317750" "04172" "00376397" "00352" "00376408" "00352" "00415288" "04214" "00427993" "00198" "00445381" "02145" "00445382" "02145" "00453128" "04172" "00454846" "02145" "00454847" "02145" "00454848" "02145" "00454849" "02145" "00476906" "00244" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00139, 00187, 00198, 00244, 00351, 00352, 01157, 02145, 04172, 04214, 05121 ## Count = 138 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Birth/Gestational_age_wk}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000038983" "01157" "00000208" "00006" "Familial, X-linked recessive" "" "central hypothyroidism (FT4 0.50-0.99of lower limit normal), no prolactin deficiency, age sonographic determination testicular volume 17.64y, testicular volume right/left 21/20 (7.3–16ml)" "" "" "3w" "" "" "" "" "" "" "" "" "" "0000043057" "02145" "00056438" "01502" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067591" "02145" "00088085" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067592" "02145" "00088086" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067593" "02145" "00088087" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067594" "02145" "00088088" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067595" "02145" "00088089" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067596" "02145" "00088090" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067597" "02145" "00088091" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067598" "02145" "00088092" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067599" "02145" "00088093" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067600" "02145" "00088094" "00006" "Unknown" "" "see paper;..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067601" "02145" "00088095" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067602" "02145" "00088096" "00006" "Unknown" "19y" "see paper; progressive exertional dyspnea, fatigue, abdominal discomfort, motor/mental development normal, general health good, physical function allowed sports involvement, throbbing precordium, systolic murmur left hemithorax, hepatomegaly, ...; mother died at 46y (dilated cardiomyopathy)" "" "" "" "" "" "" "" "" "" "" "" "" "0000067603" "02145" "00088097" "00006" "Familial, X-linked" "" "see paper; 14y- admitted to hospital for recurrent episodes of presyncope and severe chest pain on exertion, ..." "10y" "" "" "chest pain, palpitations on exertion" "" "" "" "" "" "" "" "" "0000067604" "02145" "00088098" "00006" "Isolated (sporadic)" "" "see paper; 13y-unexplained elevation of serum creatinine kinase, proximal weakness, Gower sign, no exertional\r\ndyspnea, no cardiac murmur, no hepatomegaly, no muscle atrophy,\r\nno hypotonia, normal muscle tone, ..." "12y" "" "" "incidentally detected high level liver enzymes (ALT, AST)/total bilirubin" "" "" "" "" "" "" "" "" "0000067605" "02145" "00088099" "00006" "Isolated (sporadic)" "14y" "see paper; skeletal myopathy, mental retardation, ophthalmic manifestations, massive hypertrophic obstructive cardiomyopathy necessitating heart transplantation, ..." "<09y" "" "" "" "" "" "" "" "" "" "" "" "0000067606" "02145" "00088100" "00006" "Unknown" "" "see paper; 21y-admitted to hospital with\r\nexertional dyspnea, ..." "14y" "" "" "Danon\'s disease" "" "" "" "" "" "" "" "" "0000067607" "02145" "00088101" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067608" "02145" "00088102" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067609" "02145" "00088103" "00006" "Isolated (sporadic)" "" "see paper;, ..., skeletal muscle weakness,\r\nhigh creatine kinase level, ..." "12y" "" "" "gastrointestinal" "" "" "" "" "" "" "" "" "0000067610" "02145" "00088104" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067611" "02145" "00088105" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067612" "02145" "00088106" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067613" "02145" "00088107" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067614" "02145" "00088108" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067615" "02145" "00088109" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067616" "02145" "00088110" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067617" "02145" "00088111" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067618" "02145" "00088112" "00006" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000067619" "02145" "00088113" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067624" "02145" "00088151" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067625" "02145" "00088152" "00006" "Familial, X-linked dominant" "" "see paper; ..., easy fatigability, anorexia, abdominal pain, progressive diffuse muscle hypotrophy , Wolff-Parkinson-White (WPW) syndrome, heart failure, several syncopal episodes, elevated creatine kinase" "" "" "" "" "" "" "" "" "" "" "" "" "0000067626" "02145" "00088153" "00006" "Familial, X-linked dominant" "" "see paper; ..., 9y-scleral jaundice, abnormal hepatic laboratory tests, liver biopsy chronic hepatitis with normal serology, 18y-electrocardiography\r\nrevealed WPW syndrome; 22y-exertion dyspnea, difficulty climbing stairs, several syncopal episodes; ..." "09y" "" "" "" "" "" "" "" "" "" "" "" "0000067627" "02145" "00088154" "00006" "Familial, X-linked dominant" "" "see paper; ..., 12y-subclinical\r\njaundice, viral hepatitis excluded (serology; 18y-easy fatigability after mild effort; 19y-ECG revealed bradycardia, WPW syndrome; 22y-very low aerobic resistance (tread-mill test); 27y-chest X-ray mild cardiomegaly; women have no raised CK" "" "" "" "" "" "" "" "" "" "" "" "" "0000067628" "02145" "00088155" "00006" "Familial, X-linked" "" "see paper; ..., infancy mild hypotonia, global developmental delay, elevated serum CK levels, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067629" "02145" "00088156" "00006" "Familial, X-linked dominant" "" "see paper; ..., presented with HCM as teenager, progressed to dilated\r\ncardiomyopathy/heart failure, skeletal myopathy, Wolff-Parkinson-White syndrome; teenage carrier sister has HCM, no skeletal myopathy/WPW, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067630" "02145" "00088157" "00006" "Familial, X-linked dominant" "" "see paper; ..., presented with HCM, Wolff-Parkinson-White syndrome, skeletal myopathy as teenager; carrier mother developed DCM during 40s, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067631" "02145" "00088158" "00006" "Familial, X-linked dominant" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "" "" "" "0000067632" "02145" "00088159" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067633" "02145" "00088160" "00006" "Unknown" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067634" "02145" "00088161" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067635" "02145" "00088162" "00006" "Unknown" "" "see paper; ..., severe skeletal muscular weakness, respiratory failure, history of two OHTs (1st severe HCM, 2nd allograft rejection, myopathy, ..." "01y" "" "" "heart murmur" "" "" "" "" "" "" "" "" "0000067636" "02145" "00088163" "00006" "Familial, X-linked dominant" "" "see paper; ...," "" "" "" "" "" "" "" "" "" "" "" "" "0000067637" "02145" "00088164" "00006" "Isolated (sporadic)" "" "12y-HCM; 14y-acute episode heart failure, ECG concentric hypertrophy dilated left ventricle with moderate\r\nsystolic dysfunction, neurological/EMG normal, increased levels serum creatine kinase (638 U/l); 15y orthotopic heart transplantation" "" "" "12y" "" "" "" "" "" "" "" "" "" "0000067638" "02145" "00088165" "00006" "Familial, X-linked dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000067639" "02145" "00088166" "00006" "Unknown" "" "severe hypertrophic cardiomyopathy, Wolff-Parkinson-White syndrome, proximal muscle weakness, chronic painless diarrhea, muscle biopsy autophagic vacuolar myopathy, IHC LAMP2 absence" "" "" "" "" "" "" "" "" "" "" "" "" "0000067640" "02145" "00088167" "00006" "Unknown" "" "limb-girdle muscle weakness, mild left ventricular diastolic dysfunction, sub-clinical neuropathy, muscle biopsy autophagic vacuolar myopathy, IHC LAMP2 smear" "" "" "" "" "" "" "" "" "" "" "" "" "0000068360" "02145" "00088956" "00006" "Unknown" "" "glycogen storage disease, type IIb" "" "" "" "" "" "" "" "" "" "" "" "" "0000068361" "02145" "00088957" "00006" "Familial, autosomal dominant" "" "variable clinical presentations, including cardiomyopathy, skeletal muscle pathology, hepatopathy, abnormal mitochondria/LAMP2 immunohistochemistry" "" "" "" "" "" "" "" "" "" "" "" "" "0000068362" "02145" "00088958" "00006" "Familial, autosomal dominant" "" "Danon disease, cone-rod dystrophy (CRD), visual acuity deteriorated progressively, color vision severely disturbed; ERG reduced photopic/scotopic responses, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068363" "02145" "00088959" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068364" "02145" "00088960" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068365" "02145" "00088961" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068366" "02145" "00088962" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068367" "02145" "00088963" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068368" "02145" "00088964" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068369" "02145" "00088965" "00006" "Unknown" "" "see paper; cardiomyopathy, mental retardation, myopathy, vacuolar myopathy without acid a-glucosidase deficiency, diffuse chorio-capillary ocular atrophy, successful heart transplantation, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068370" "02145" "00088966" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000068373" "02145" "00088969" "00006" "Isolated (sporadic)" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068374" "02145" "00088970" "00006" "Familial, X-linked" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068375" "00187" "00088971" "00006" "Unknown" "" "mental retardation, X-linked (MRX)" "" "" "" "" "" "" "" "" "" "" "" "" "0000068376" "00187" "00088972" "00006" "Unknown" "" "mental retardation, X-linked (MRX)" "" "" "" "" "" "" "" "" "" "" "" "" "0000068377" "00187" "00088973" "00006" "Unknown" "" "mental retardation, X-linked (MRX)" "" "" "" "" "" "" "" "" "" "" "" "" "0000068378" "00187" "00088974" "00006" "Unknown" "" "mental retardation, X-linked (MRX)" "" "" "" "" "" "" "" "" "" "" "" "" "0000068379" "00198" "00088975" "00430" "Unknown" "" "?" "" "" "" "" "" "" "" "" "" "" "" "" "0000068380" "00198" "00088976" "00430" "Unknown" "" "?" "" "" "" "" "" "" "" "" "" "" "" "" "0000068387" "02145" "00088983" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068388" "02145" "00088984" "00006" "Familial" "" "Danon disease, hyperCKemia, hypertrophic cardiomyopathy, no muscle weakness, slight mental impairment; muscle biopsy autophagic vacuoles with sarcolemmal features and glycogen storage" "" "" "" "" "" "" "" "" "" "" "" "" "0000068389" "02145" "00088985" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068390" "02145" "00088986" "00006" "Familial" "" "Danon disease, see paper; progressive hypertrophic cardiomyopathy, death at 16y (before planned heart transplantation); mother developed severe dilated cardiomyopathy, 46y died of complications" "02y06m" "" "" "mild left ventricular hypertrophy, mild myopathy" "" "" "" "" "" "" "" "" "0000068391" "02145" "00088987" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068392" "02145" "00088988" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068393" "02145" "00088989" "00052" "Familial" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068394" "00351" "00088990" "00006" "Isolated (sporadic)" "" "see paper; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068395" "00351" "00088991" "00052" "Unknown" "" "cardiomyopathy, hypertrophic" "" "" "" "" "" "" "" "" "" "" "" "" "0000068396" "02145" "00088992" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068397" "02145" "00088993" "00052" "Familial" "" "Danon disease; cardiomyopathy, hypertrophic (HCM)" "" "" "" "" "" "" "" "" "" "" "" "" "0000068398" "00351" "00088994" "00052" "Unknown" "" "cardiomyopathy, hypertrophic" "" "" "" "" "" "" "" "" "" "" "" "" "0000068399" "00351" "00088995" "00052" "Familial" "" "cardiomyopathy, hypertrophic" "" "" "" "" "" "" "" "" "" "" "" "" "0000068400" "00351" "00088996" "00006" "Unknown" "" "see paper; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068401" "00351" "00088997" "00006" "Isolated (sporadic)" "" "see paper, hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068402" "02145" "00088998" "00052" "Familial" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068403" "02145" "00088999" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068404" "02145" "00089000" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068405" "00351" "00089001" "00006" "Familial, X-linked" "" "see paper; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068406" "02145" "00089002" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068407" "00351" "00089003" "00006" "Isolated (sporadic)" "" "see paper; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068409" "02145" "00089005" "00052" "Familial" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068410" "00351" "00089006" "00006" "Isolated (sporadic)" "" "see paper; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000068411" "02145" "00089007" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068412" "02145" "00089008" "00052" "Familial" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068413" "02145" "00089009" "00052" "Familial" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068414" "02145" "00089010" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068415" "02145" "00089011" "00052" "Unknown" "" "Danon disease" "" "" "" "" "" "" "" "" "" "" "" "" "0000068416" "04172" "00089012" "01834" "Familial, X-linked dominant" "" "cardiomyopathy, mild" "" "" "" "" "" "" "" "" "" "" "" "" "0000068423" "02145" "00089021" "00006" "Familial, X-linked" "" "see paper; hypertrophic cardiomyopathy, ..." "" "" "" "" "" "" "" "" "" "" "" "" "0000086098" "00351" "00108624" "01401" "Isolated (sporadic)" "" "no fam.history of hypertrophic cardiomyopathy; no fam.history of sudden cardiac death; no automatic implantable cardioverter defibrillator; heart transplantation; left ventricular wall thickness (mm) <15b; left ventricular ejection fraction 0.44" "17y" "" "" "" "" "" "" "" "" "" "" "" "0000086102" "00351" "00108628" "01401" "Familial" "" "fam.history of hypertrophic cardiomyopathy; fam.history of sudden cardiac death; automatic implantable cardioverter defibrillator; non-sustained ventricular tachycardia, atrial fibrillation, Wolff-Parkinson-White syndrome; left ventricular wall thickness (mm) 17; left ventricular ejection fraction 0.60" "16y" "" "" "" "" "" "" "" "" "" "" "" "0000086108" "00351" "00108634" "01401" "Familial" "" "no fam.history of hypertrophic cardiomyopathy; no fam.history of sudden cardiac death; no automatic implantable cardioverter defibrillator; Aortic root enlargement, history of hypertension; intermittent left bundle branch block; left ventricular wall thickness (mm) <15a; left ventricular ejection fraction ˜0.50" "72y" "" "" "" "" "" "" "" "" "" "" "" "0000086128" "00351" "00108654" "01401" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "" "" "0000154608" "00198" "00206819" "01807" "Unknown" "" "Global developmental delay (HP:0001263); Abnormality of the liver (HP:0001392); Muscular hypotonia (HP:0001252); Hepatosplenomegaly (HP:0001433)" "" "" "" "" "" "" "" "" "" "" "" "" "0000159677" "02145" "00211195" "03148" "Familial, X-linked" "" "" "" "" "" "" "" "" "" "" "" "Danon disease" "Danon disease" "" "0000172147" "00352" "00228216" "02588" "Unknown" "36y" "regional left ventricular wall motion abnormality (HP:0012667); left ventricular dysfunction (HP:0005162); severely reduced ejection fraction (HP:0012666); pulmonary arterial hypertension (HP:0002092); left bundle branch block (HP:0011713); right bundle branch block (HP:0011712); conjugated hyperbilirubinemia (HP:0002908); right ventricular failure (HP:0001708); left ventricular dysfunction (HP:0005162); increased lactate dehydrogenase activity (HP:0025435); impaired glucose tolerance (HP:0040270); hepatomegaly (HP:0002240); abnormal liver parenchyma morphology (HP:0030146); abnormal cardiomyocyte morphology (HP:0031331); interstitial cardiac fibrosis (HP:0031329); atrial fibrillation (HP:0005110); left ventricular hypertrophy (HP:0001712)" "" "" "36y" "" "" "" "" "" "" "" "" "" "0000180286" "05121" "00240132" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "" "EDMD-4" "" "" "0000239990" "04172" "00316244" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239991" "04172" "00316245" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239992" "04172" "00316246" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239993" "04172" "00316247" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239994" "04172" "00316248" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239995" "04172" "00316249" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239996" "04172" "00316250" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239997" "04172" "00316251" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239998" "04172" "00316252" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000239999" "04172" "00316253" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240850" "04172" "00317104" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240851" "04172" "00317105" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240852" "04172" "00317106" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240853" "04172" "00317107" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240854" "04172" "00317108" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240855" "04172" "00317109" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240856" "04172" "00317110" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240857" "04172" "00317111" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000240858" "04172" "00317112" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "hypertrophic cardiomyopathy" "" "0000241495" "04172" "00317749" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000241496" "04172" "00317750" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000271605" "00352" "00376397" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000271616" "00352" "00376408" "00006" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "dilated cardiomyopathy" "" "0000307086" "04214" "00415288" "00000" "Familial, X-linked" "" "OMIM: 300257; developmental delay, cardiomyopathy, seizure disorder, elevated liver enzymes, and cpk" "" "" "" "" "" "" "" "" "" "Danon disease" "" "" "0000318939" "00198" "00427993" "00006" "Familial, X-linked dominant" "02y" "severe concentric hypertrophic cardiomyopathy, proximal muscle weakness" "" "" "" "" "" "" "" "" "" "Danon disease" "" "" "0000334617" "02145" "00445381" "00006" "Familial, X-linked dominant" "03y" "see paper; ..., visual impairment secondary to retinitis pigmentosa; uneventful spontaneous pregnancy/delivery; <14m-normal development; 18m-heart murmur, ECG asymptomatic WPW" "" "" "" "" "" "" "" "" "" "Danon disease" "Danon disease" "" "0000334619" "02145" "00445382" "00006" "Unknown" "42y" "see paper; ..., full-time job as storekeeper; 13y-heart palpitations, ECG Wolf–Parkinson–White pattern; 18y-increased echogenicity, borderline increase antero-septal wall thickness; 25y-progressive visual impairment with increased severity dark hours, ERG revealed rods/cones dystrophy; no psychiatric/gastrointestinal/pulmonary complaints; 27y-pacemaker; 42y-atrial fibrillation" "" "" "" "" "" "" "" "" "" "Danon disease" "Danon disease" "" "0000341774" "04172" "00453128" "02515" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "" "cardiomyopathy" "" "0000343456" "02145" "00454846" "04100" "Familial, X-linked dominant" "14y" "The ECG revealed premature atrial beats, premature ventricular beats, and ST-T changes. Echocardiography showed marked thickening of the septum and posterior wall of the left ventricle,reduced wall motion and diastolic dysfunction." "14y" "" "14y" "precordial discomfort" "-" "" "" "" "" "Danon disease" "Danon disease" "" "0000343508" "02145" "00454847" "04100" "Familial, X-linked" ">07y" "Cardiac enzymes were abnormal, ECG showed incomplete right bundle branch block, high voltage in the left ventricle, ST-T changes in extensive leads, and cardiac ultrasound showed a slight thickening of the left ventricle and septum, and uncoordinated ventricular wall motion." ">07y" "" ">07y" ">7y" "-" "" "" "" "" "Danon disease" "myocarditis" "" "0000343510" "02145" "00454848" "04100" "Familial, X-linked" "00y04m" "shortness of breath" "00y04m" "" "00y04m" "" "-" "" "" "" "" "Danon disease" "Danon disease" "" "0000343511" "02145" "00454849" "04100" "Familial, X-linked" ">10y" "heart murmur" ">10y" "" ">10y" ">10y" "-" "" "" "" "" "Danon disease" "Danon disease" "" "0000361581" "00244" "00476906" "00006" "Familial, X-linked dominant" "" "not specified" "" "" "" "" "" "" "" "" "" "" "myopathy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 142 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000000209" "00000208" "1" "00037" "00001" "2012-09-13 12:02:03" "" "" "SEQ-NG-I" "DNA" "" "" "0000056398" "00056438" "1" "01502" "01502" "2016-01-07 14:20:13" "" "" "SEQ" "DNA" "" "" "0000088225" "00088085" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088226" "00088086" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088227" "00088087" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088228" "00088088" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088229" "00088089" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088230" "00088090" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088231" "00088091" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088232" "00088092" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088233" "00088093" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088234" "00088094" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088235" "00088095" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088236" "00088096" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088237" "00088097" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088238" "00088098" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088239" "00088099" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088240" "00088100" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088241" "00088101" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088242" "00088102" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088243" "00088103" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088244" "00088104" "1" "00006" "00006" "2016-11-17 21:57:59" "" "" "SEQ" "DNA" "" "" "0000088245" "00088105" "1" "00006" "00006" "2016-11-17 22:13:39" "" "" "SEQ" "DNA" "" "" "0000088246" "00088106" "1" "00006" "00006" "2016-11-17 22:19:31" "" "" "SEQ" "DNA" "" "" "0000088247" "00088107" "1" "00006" "00006" "2016-11-17 22:24:11" "" "" "SEQ" "DNA" "" "" "0000088248" "00088108" "1" "00006" "00006" "2016-11-17 22:26:22" "" "" "SEQ" "DNA" "" "" "0000088249" "00088109" "1" "00006" "00006" "2016-11-17 22:32:47" "" "" "SEQ" "DNA" "" "" "0000088250" "00088110" "1" "00006" "00006" "2016-11-17 22:41:07" "" "" "SEQ" "DNA" "" "" "0000088251" "00088111" "1" "00006" "00006" "2016-11-17 22:44:09" "" "" "SEQ" "DNA" "" "" "0000088252" "00088112" "1" "00006" "00006" "2016-11-17 22:47:16" "" "" "SEQ" "DNA" "" "" "0000088253" "00088113" "1" "00006" "00006" "2016-11-17 23:34:14" "" "" "SEQ" "DNA" "" "" "0000088291" "00088151" "1" "00006" "00006" "2016-11-18 20:02:07" "" "" "PCR;SEQ" "DNA" "" "" "0000088292" "00088152" "1" "00006" "00006" "2016-11-18 22:25:07" "00006" "2016-11-18 22:37:20" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000088293" "00088153" "1" "00006" "00006" "2016-11-18 22:34:37" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000088294" "00088154" "1" "00006" "00006" "2016-11-18 22:41:58" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000088295" "00088155" "1" "00006" "00006" "2016-11-18 23:10:15" "00006" "2016-11-18 23:39:43" "PCRq;RT-PCR;SEQ" "DNA;RNA" "" "" "0000088296" "00088156" "1" "00006" "00006" "2016-11-19 18:51:45" "" "" "SEQ" "DNA" "" "" "0000088297" "00088157" "1" "00006" "00006" "2016-11-19 18:56:21" "" "" "SEQ" "DNA" "" "" "0000088298" "00088158" "1" "00006" "00006" "2016-11-19 19:09:22" "" "" "SEQ" "DNA" "" "" "0000088299" "00088159" "1" "00006" "00006" "2016-11-19 19:21:13" "00006" "2016-11-19 19:30:31" "SEQ" "DNA" "" "" "0000088300" "00088160" "1" "00006" "00006" "2016-11-19 19:23:33" "00006" "2016-11-19 19:29:05" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000088301" "00088161" "1" "00006" "00006" "2016-11-19 19:49:02" "" "" "SEQ" "DNA" "" "" "0000088302" "00088162" "1" "00006" "00006" "2016-11-19 20:35:32" "" "" "SEQ" "DNA" "" "" "0000088303" "00088163" "1" "00006" "00006" "2016-11-19 20:46:47" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000088304" "00088164" "1" "00006" "00006" "2016-11-19 20:57:49" "" "" "SEQ" "DNA" "" "" "0000088305" "00088165" "1" "00006" "00006" "2016-11-19 21:11:06" "" "" "SEQ" "DNA" "" "" "0000088306" "00088166" "1" "00006" "00006" "2016-11-19 21:21:07" "" "" "SEQ" "DNA" "" "" "0000088307" "00088167" "1" "00006" "00006" "2016-11-19 21:23:44" "" "" "SEQ" "DNA" "" "" "0000089100" "00088956" "1" "00006" "00006" "2016-11-26 21:19:11" "" "" "SEQ" "DNA" "" "" "0000089101" "00088957" "1" "00006" "00006" "2016-11-26 21:27:45" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000089102" "00088958" "1" "00006" "00006" "2016-11-26 21:37:49" "" "" "SEQ" "DNA" "" "" "0000089103" "00088959" "1" "00006" "00006" "2016-11-26 21:53:36" "" "" "SEQ" "DNA" "" "" "0000089104" "00088960" "1" "00006" "00006" "2016-11-26 21:56:24" "" "" "SEQ" "DNA" "" "" "0000089105" "00088961" "1" "00006" "00006" "2016-11-26 21:58:50" "" "" "SEQ" "DNA" "" "" "0000089106" "00088962" "1" "00006" "00006" "2016-11-26 22:01:01" "" "" "SEQ" "DNA" "" "" "0000089107" "00088963" "1" "00006" "00006" "2016-11-26 22:03:17" "" "" "SEQ" "DNA" "" "" "0000089108" "00088964" "1" "00006" "00006" "2016-11-26 22:06:21" "" "" "SEQ" "DNA" "" "" "0000089109" "00088965" "1" "00006" "00006" "2016-11-26 22:13:48" "" "" "SEQ" "DNA" "" "" "0000089110" "00088966" "1" "00006" "00006" "2016-11-26 22:26:10" "" "" "SEQ" "DNA" "" "" "0000089114" "00088969" "1" "00006" "00006" "2016-11-27 11:25:03" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000089115" "00088970" "1" "00006" "00006" "2016-11-27 11:29:51" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000089116" "00088971" "1" "00006" "00006" "2009-05-08 12:40:34" "00006" "2012-11-02 20:42:49" "SEQ" "DNA" "" "" "0000089117" "00088972" "1" "00006" "00006" "2009-05-08 12:40:34" "00006" "2012-11-02 20:42:49" "SEQ" "DNA" "" "" "0000089118" "00088973" "1" "00006" "00006" "2009-05-08 12:40:34" "00006" "2012-11-02 20:42:49" "SEQ" "DNA" "" "" "0000089119" "00088974" "1" "00006" "00006" "2009-05-08 12:40:34" "00006" "2012-11-02 20:42:49" "SEQ" "DNA" "" "" "0000089120" "00088975" "1" "00430" "00006" "2012-10-26 14:14:45" "" "" "SEQ" "DNA" "" "" "0000089121" "00088976" "1" "00430" "00006" "2012-10-26 14:14:45" "" "" "SEQ" "DNA" "" "" "0000089128" "00088983" "1" "00052" "00006" "2011-08-11 10:45:26" "00006" "2011-10-28 15:09:38" "IHC;PCR;SEQ;Western" "DNA" "" "" "0000089129" "00088984" "1" "00052" "00006" "2011-10-31 09:48:18" "00006" "2016-11-27 14:28:41" "BESS;PCRm;RT-PCR;SEQ" "DNA;RNA" "" "" "0000089130" "00088985" "1" "00052" "00006" "2011-08-11 10:21:41" "00006" "2011-10-28 14:57:45" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089131" "00088986" "1" "00052" "00006" "2011-08-11 15:41:11" "00006" "2011-10-28 15:10:39" "IHC;PCR;Southern;SSCA" "DNA" "" "" "0000089132" "00088987" "1" "00052" "00006" "2011-08-11 10:29:13" "00006" "2011-10-28 14:52:23" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089133" "00088988" "1" "00052" "00006" "2011-08-11 10:41:21" "00006" "2011-10-28 15:11:30" "IHC;PCR;SEQ" "DNA" "" "" "0000089134" "00088989" "1" "00052" "00006" "2011-08-11 10:03:26" "00006" "2011-11-21 14:27:01" "BESS;PCRm;RT-PCR;SEQ" "DNA" "" "" "0000089135" "00088990" "1" "00052" "00006" "2011-08-11 14:40:30" "00006" "2011-10-28 15:07:04" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089136" "00088991" "1" "00052" "00006" "2011-08-11 13:27:48" "00006" "2011-11-21 14:34:32" "IHC;SEQ" "DNA" "" "" "0000089137" "00088992" "1" "00052" "00006" "2011-08-11 10:21:41" "00006" "2011-10-28 14:52:51" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089138" "00088993" "1" "00052" "00006" "2011-08-11 15:15:18" "00006" "2011-10-31 09:49:32" "IHC;PCR;SEQ" "DNA" "" "" "0000089139" "00088994" "1" "00052" "00006" "2011-08-11 13:27:48" "00006" "2011-10-31 09:51:44" "IHC;SEQ" "DNA" "" "" "0000089140" "00088995" "1" "00052" "00006" "2011-08-11 14:38:06" "00006" "2011-10-31 09:55:49" "PCR;SEQ" "DNA" "" "" "0000089141" "00088996" "1" "00052" "00006" "2011-08-11 14:40:30" "00006" "2016-11-27 15:17:12" "IHC;PCR;RT-PCR;SEQ;Western" "DNA;RNA" "" "" "0000089142" "00088997" "1" "00052" "00006" "2011-08-11 14:40:30" "00006" "2016-11-27 15:11:44" "IHC;PCR;RT-PCR;SEQ;Western" "DNA;RNA" "" "" "0000089143" "00088998" "1" "00052" "00006" "2011-08-11 15:43:00" "00006" "2011-10-31 09:38:54" "IHC;PCR;RT-PCR;SEQ" "DNA" "" "" "0000089144" "00088999" "1" "00052" "00006" "2011-08-11 10:29:13" "00006" "2011-10-28 14:57:15" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089145" "00089000" "1" "00052" "00006" "2011-08-11 10:29:13" "00006" "2011-10-28 14:56:57" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089146" "00089001" "1" "00052" "00006" "2011-08-11 14:40:30" "00006" "2016-11-27 15:21:57" "IHC;PCR;RT-PCR;SEQ;Western" "DNA;RNA" "" "" "0000089147" "00089002" "1" "00052" "00006" "2011-08-11 10:21:41" "00006" "2011-10-28 14:54:01" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089148" "00089003" "1" "00052" "00006" "2011-08-11 14:40:30" "00006" "2016-11-27 15:25:56" "IHC;PCR;RT-PCR;SEQ;Western" "DNA;RNA" "" "" "0000089150" "00089005" "1" "00052" "00006" "2011-08-11 10:03:26" "00006" "2011-11-21 14:31:21" "BESS;PCRm;RT-PCR;SEQ" "DNA" "" "" "0000089151" "00089006" "1" "00052" "00006" "2011-08-11 14:40:30" "00006" "2011-10-28 15:06:16" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089152" "00089007" "1" "00052" "00006" "2011-08-11 10:25:05" "00006" "2011-10-31 10:02:23" "IHC;RT-PCR;SEQ" "DNA;RNA" "" "" "0000089153" "00089008" "1" "00052" "00006" "2011-08-11 15:43:00" "00006" "2011-10-31 09:39:16" "IHC;PCR;RT-PCR;SEQ" "DNA" "" "" "0000089154" "00089009" "1" "00052" "00006" "2011-08-11 11:09:09" "00006" "2011-10-31 10:03:05" "PCR;SEQ" "DNA" "" "" "0000089155" "00089010" "1" "00052" "00006" "2011-08-11 15:59:19" "00006" "2011-10-31 10:03:40" "IHC;PCR;SEQ;Western" "DNA" "" "" "0000089156" "00089011" "1" "00052" "00006" "2011-08-11 10:21:41" "00006" "2011-10-28 14:53:47" "IHC;PCR;RT-PCR;SEQ;Western" "DNA" "" "" "0000089157" "00089012" "1" "01834" "00006" "2015-10-29 00:48:12" "00006" "2015-10-29 09:27:58" "SEQ" "DNA" "" "" "0000089166" "00089021" "1" "00006" "00006" "2016-11-27 15:32:52" "" "" "SEQ" "DNA" "" "" "0000109089" "00108624" "1" "01401" "00006" "2017-07-28 12:12:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000109093" "00108628" "1" "01401" "00006" "2017-07-28 12:12:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000109099" "00108634" "1" "01401" "00006" "2017-07-28 12:12:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000109119" "00108654" "1" "01401" "00006" "2017-07-28 12:12:32" "" "" "SEQ-NG-I" "DNA" "" "" "0000207853" "00206819" "1" "01807" "01807" "2018-11-14 14:33:30" "" "" "SEQ" "DNA" "" "" "0000212271" "00211195" "1" "03148" "03148" "2019-01-04 11:35:27" "" "" "SEQ" "DNA;RNA;protein" "blood" "" "0000229305" "00228216" "1" "02588" "02588" "2019-03-20 18:17:01" "" "" "SEQ;SEQ-NG-I" "DNA" "blood" "" "0000241235" "00240132" "1" "00006" "00006" "2019-06-11 14:50:54" "" "" "SEQ" "DNA" "" "" "0000296102" "00294934" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296103" "00294935" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000296399" "00295231" "1" "03575" "00006" "2020-03-11 19:30:02" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000306461" "00305332" "1" "03575" "00006" "2020-06-24 11:55:42" "" "" "arraySNP" "DNA" "" "Infinium Global Screening Array v1.0" "0000317426" "00316244" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317427" "00316245" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317428" "00316246" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317429" "00316247" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317430" "00316248" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317431" "00316249" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317432" "00316250" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317433" "00316251" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317434" "00316252" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000317435" "00316253" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318286" "00317104" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318287" "00317105" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318288" "00317106" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318289" "00317107" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318290" "00317108" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318291" "00317109" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318292" "00317110" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318293" "00317111" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318294" "00317112" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318931" "00317749" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000318932" "00317750" "1" "00006" "00006" "2020-11-03 19:57:35" "" "" "SEQ;SEQ-NG" "DNA" "" "cardiomyopathy gene panel" "0000377602" "00376397" "1" "00006" "00006" "2021-06-22 13:15:11" "" "" "SEQ-NG" "DNA" "" "58-gene panel" "0000377613" "00376408" "1" "00006" "00006" "2021-06-22 13:15:11" "" "" "SEQ-NG" "DNA" "" "58-gene panel" "0000416570" "00415288" "1" "00000" "03840" "2022-08-10 20:39:58" "" "" "SEQ-NG" "DNA" "" "exome sequencing done at a commercial CAPaccredited laboratory" "0000429406" "00427993" "1" "00006" "00006" "2022-12-19 13:11:26" "" "" "RT-PCR;SEQ;SEQ-NG-RNA" "DNA;RNA" "whole blood" "duo WES" "0000446952" "00445381" "1" "00006" "00006" "2024-01-11 14:45:57" "00006" "2024-01-11 20:39:36" "arrayCGH;SEQ;SEQ-NG" "DNA" "" "WES" "0000446954" "00445382" "1" "00006" "00006" "2024-01-11 19:48:34" "" "" "arrayCGH;PCR" "DNA" "" "" "0000454739" "00453128" "1" "02515" "00006" "2024-08-16 15:35:20" "" "" "SEQ-NG" "DNA" "blood" "" "0000456457" "00454846" "1" "04100" "04100" "2024-09-29 15:43:57" "" "" "SEQ" "DNA" "blood" "WES" "0000456523" "00454847" "1" "04100" "04100" "2024-09-30 11:51:46" "" "" "SEQ" "RNA" "blood" "WES" "0000456525" "00454848" "1" "04100" "04100" "2024-09-30 12:05:28" "" "" "SEQ" "RNA" "blood" "WES" "0000456526" "00454849" "1" "04100" "04100" "2024-09-30 12:12:33" "" "" "SEQ" "RNA" "blood" "WES" "0000478550" "00476906" "1" "00006" "00006" "2026-04-20 14:19:26" "" "" "SEQ;SEQ-NG" "DNA" "" "WES" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 129 "{{screeningid}}" "{{geneid}}" "0000056398" "LAMP2" "0000088225" "LAMP2" "0000088226" "LAMP2" "0000088227" "LAMP2" "0000088228" "LAMP2" "0000088229" "LAMP2" "0000088230" "LAMP2" "0000088231" "LAMP2" "0000088232" "LAMP2" "0000088233" "LAMP2" "0000088234" "LAMP2" "0000088235" "LAMP2" "0000088236" "LAMP2" "0000088237" "LAMP2" "0000088238" "LAMP2" "0000088239" "LAMP2" "0000088240" "LAMP2" "0000088241" "LAMP2" "0000088242" "LAMP2" "0000088243" "LAMP2" "0000088244" "LAMP2" "0000088245" "LAMP2" "0000088246" "LAMP2" "0000088247" "LAMP2" "0000088248" "LAMP2" "0000088249" "LAMP2" "0000088250" "LAMP2" "0000088251" "LAMP2" "0000088252" "LAMP2" "0000088253" "LAMP2" "0000088291" "LAMP2" "0000088292" "LAMP2" "0000088293" "LAMP2" "0000088294" "LAMP2" "0000088295" "LAMP2" "0000088296" "LAMP2" "0000088297" "LAMP2" "0000088298" "LAMP2" "0000088299" "GLA" "0000088299" "LAMP2" "0000088300" "LAMP2" "0000088301" "LAMP2" "0000088302" "LAMP2" "0000088303" "LAMP2" "0000088304" "LAMP2" "0000088305" "LAMP2" "0000088306" "LAMP2" "0000088307" "LAMP2" "0000089100" "LAMP2" "0000089101" "LAMP2" "0000089102" "LAMP2" "0000089103" "LAMP2" "0000089104" "LAMP2" "0000089105" "LAMP2" "0000089106" "LAMP2" "0000089107" "LAMP2" "0000089108" "LAMP2" "0000089109" "LAMP2" "0000089110" "LAMP2" "0000089114" "LAMP2" "0000089115" "LAMP2" "0000089116" "LAMP2" "0000089117" "LAMP2" "0000089118" "LAMP2" "0000089119" "LAMP2" "0000089120" "LAMP2" "0000089121" "LAMP2" "0000089128" "LAMP2" "0000089129" "LAMP2" "0000089130" "LAMP2" "0000089131" "LAMP2" "0000089132" "LAMP2" "0000089133" "LAMP2" "0000089134" "LAMP2" "0000089135" "LAMP2" "0000089136" "LAMP2" "0000089137" "LAMP2" "0000089138" "LAMP2" "0000089139" "LAMP2" "0000089140" "LAMP2" "0000089141" "LAMP2" "0000089142" "LAMP2" "0000089143" "LAMP2" "0000089144" "LAMP2" "0000089145" "LAMP2" "0000089146" "LAMP2" "0000089147" "LAMP2" "0000089148" "LAMP2" "0000089150" "LAMP2" "0000089151" "LAMP2" "0000089152" "LAMP2" "0000089153" "LAMP2" "0000089154" "LAMP2" "0000089155" "LAMP2" "0000089156" "LAMP2" "0000089157" "LAMP2" "0000089166" "LAMP2" "0000229305" "LAMP2" "0000241235" "LAMP2" "0000241235" "SYNE1" "0000317426" "LAMP2" "0000317427" "LAMP2" "0000317428" "LAMP2" "0000317429" "LAMP2" "0000317430" "LAMP2" "0000317431" "LAMP2" "0000317432" "LAMP2" "0000317433" "LAMP2" "0000317434" "LAMP2" "0000317435" "LAMP2" "0000318286" "LAMP2" "0000318287" "LAMP2" "0000318288" "LAMP2" "0000318289" "LAMP2" "0000318290" "LAMP2" "0000318291" "LAMP2" "0000318292" "LAMP2" "0000318293" "LAMP2" "0000318294" "LAMP2" "0000318931" "LAMP2" "0000318932" "LAMP2" "0000377602" "LAMP2" "0000377613" "LAMP2" "0000416570" "LAMP2" "0000446954" "LAMP2" "0000456457" "LAMP2" "0000456523" "LAMP2" "0000456525" "LAMP2" "0000456526" "LAMP2" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 311 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000002135" "0" "30" "X" "119571281" "119571281" "dup" "0" "00037" "LAMP2_000032" "g.119571281dup" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.120437426dup" "" "likely benign" "" "0000086640" "0" "70" "X" "119575603" "119575603" "dup" "0" "01502" "LAMP2_000033" "g.119575603dup" "" "" "" "1074_1075insC" "" "Unknown" "" "" "0" "" "" "g.120441748dup" "" "likely pathogenic" "" "0000141557" "1" "90" "X" "119602960" "119602960" "subst" "0" "00006" "LAMP2_000078" "g.119602960C>T" "" "{PMID:Alroy 2010:21070164}, {DOI:Alroy 2010:10.3109/01913123.2010.499024}" "" "" "" "Germline" "yes" "" "0" "" "" "g.120469105C>T" "" "pathogenic" "" "0000141558" "1" "70" "X" "119603055" "119603063" "del" "0" "00006" "LAMP2_000034" "g.119603055_119603063del" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "-30_-22delCGCCGCCGT" "" "Germline" "" "" "0" "" "" "g.120469200_120469208del" "" "likely pathogenic" "" "0000141559" "1" "90" "X" "119602960" "119603024" "" "0" "00006" "LAMP2_000035" "g.(119590625_119602960)_(119603024_?)del" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "c.1-?+64+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000141560" "1" "90" "X" "119590505" "119590505" "subst" "0" "00006" "LAMP2_000036" "g.119590505C>T" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120456650C>T" "" "pathogenic" "" "0000141561" "1" "90" "X" "119589362" "119589362" "subst" "0" "00006" "LAMP2_000037" "g.119589362G>A" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120455507G>A" "" "pathogenic" "" "0000141562" "1" "90" "X" "119582874" "119582874" "subst" "0" "00006" "LAMP2_000040" "g.119582874C>T" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120449019C>T" "" "pathogenic" "" "0000141563" "1" "90" "X" "119576518" "119576518" "subst" "0" "00006" "LAMP2_000041" "g.119576518C>G" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120442663C>G" "" "pathogenic" "" "0000141564" "1" "90" "X" "119573102" "119573105" "delins" "0" "00006" "LAMP2_000055" "g.119573102_119573105delinsATTGGGACCAGC" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "NM_013995.2:c.1137_1140delTATAinsGCTGGTCCCAAT" "" "Germline" "" "" "0" "" "" "g.120439247_120439250delinsATTGGGACCAGC" "" "pathogenic" "" "0000141565" "0" "90" "X" "119589352" "119589353" "del" "0" "00006" "LAMP2_000050" "g.119589352_119589353del" "" "{PMID:Cheng 2012:22108829}, {DOI:Cheng 2012:10.1093/eurheartj/ehr420}" "" "257_258delCC" "" "Germline" "" "" "0" "" "" "g.120455497_120455498del" "" "pathogenic" "" "0000141566" "0" "90" "X" "119589289" "119589292" "dup" "0" "00006" "LAMP2_000051" "g.119589289_119589292dup" "" "{PMID:Cheng 2012:22108829}, {DOI:Cheng 2012:10.1093/eurheartj/ehr420}" "" "320_321insCATC" "" "Germline" "" "" "0" "" "" "g.120455434_120455437dup" "" "pathogenic" "" "0000141567" "0" "90" "X" "119580216" "119580216" "dup" "0" "00006" "LAMP2_000052" "g.119580216dup" "" "{PMID:Cheng 2012:22108829}, {DOI:Cheng 2012:10.1093/eurheartj/ehr420}" "" "808_809insG" "" "Germline" "" "" "0" "" "" "g.120446361dup" "" "pathogenic" "" "0000141568" "0" "90" "X" "119590552" "119590552" "subst" "0" "00006" "LAMP2_000049" "g.119590552C>T" "" "{PMID:Fidzianska 2013:23504560}, {DOI:Fidzianska 2013:10.1055/s-0033-1336017}" "" "" "" "Germline" "" "" "0" "" "" "g.120456697C>T" "" "pathogenic" "" "0000141569" "1" "90" "X" "119589419" "119589420" "del" "0" "00006" "LAMP2_000046" "g.119589419_119589420del" "" "{PMID:He 2014:23955649}, {DOI:He 2014:10.1007/s00059-013-3900-5}" "" "189_190delTG" "" "Germline" "" "" "0" "" "" "g.120455564_120455565del" "" "pathogenic" "" "0000141570" "0" "90" "X" "119589371" "119589371" "del" "0" "00006" "LAMP2_000047" "g.119589371del" "" "{PMID:Kim 2010:20513107}, {DOI:Kim 2010:10.1002/mus.21614}" "" "238-241delG" "not in 100 controls" "De novo" "-" "" "0" "" "" "g.120455516del" "" "pathogenic" "" "0000141571" "0" "90" "X" "119590510" "119590510" "del" "0" "00006" "LAMP2_000044" "g.119590510del" "" "{PMID:Regelsberger 2009:19588270}, {DOI:Regelsberger 2009:10.1007/s10545-009-1097-9}" "" "" "" "De novo" "-" "" "0" "" "" "g.120456655del" "" "pathogenic" "" "0000141572" "0" "90" "X" "119589322" "119589323" "del" "0" "00006" "LAMP2_000048" "g.119589322_119589323del" "" "{PMID:Tada 2010:20439808}, {DOI:Tada 2010:10.1161/CIR.0b013e3181de7097}" "" "" "" "Germline" "" "" "0" "" "" "g.120455467_120455468del" "" "pathogenic" "" "0000141573" "1" "90" "X" "119589316" "119589316" "subst" "0" "00006" "LAMP2_000054" "g.119589316C>T" "" "{PMID:Tolb 2010:20117447}, {DOI:Tolb 2010:10.1016/j.jacc.2009.11.019}" "" "G293A" "" "Germline" "" "" "0" "" "" "g.120455461C>T" "" "pathogenic" "" "0000141574" "0" "90" "X" "119594113" "119627904" "del" "0" "00006" "LAMP2_000053" "g.119594113_119627904del" "" "{PMID:Yang 2010:20173215}, {DOI:Yang 2010:10.1161/CIRCGENETICS.109.901785}" "" "" "34.4 kb deletion of exon 1" "Germline" "" "" "0" "" "" "g.120460258_120494049del" "" "pathogenic" "" "0000141575" "1" "90" "X" "119556000" "119582984" "" "0" "00006" "LAMP2_000039" "g.(119554000_119556000)_(119582984_119589211)del" "" "{PMID:Yang 2010:20173215}, {DOI:Yang 2010:10.1161/CIRCGENETICS.109.901785}" "" "del ex4-10" "58 kb deletion, break point sequence shown, but not found in reference sequence" "De novo" "-" "" "0" "" "" "" "" "pathogenic" "" "0000141576" "1" "90" "X" "119576505" "119576505" "subst" "0" "00006" "LAMP2_000042" "g.119576505G>A" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120442650G>A" "" "pathogenic" "" "0000141577" "0" "90" "X" "119602960" "119602960" "subst" "0" "00006" "LAMP2_000078" "g.119602960C>T" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120469105C>T" "" "pathogenic" "" "0000141578" "1" "90" "X" "119589362" "119589362" "subst" "0" "00006" "LAMP2_000037" "g.119589362G>A" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120455507G>A" "" "pathogenic" "" "0000141579" "1" "90" "X" "119589315" "119589315" "subst" "0" "00006" "LAMP2_000038" "g.119589315C>T" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120455460C>T" "" "pathogenic" "" "0000141580" "1" "90" "X" "119589315" "119589315" "subst" "0" "00006" "LAMP2_000038" "g.119589315C>T" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120455460C>T" "" "pathogenic" "" "0000141581" "1" "90" "X" "119562338" "119582984" "" "0" "00006" "LAMP2_000039" "g.(?_119562338)_(119582984_119589211)del" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "NM_002294.2:c.398-?_1233+?del" "" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000141582" "1" "90" "X" "119576505" "119576505" "subst" "0" "00006" "LAMP2_000042" "g.119576505G>A" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120442650G>A" "" "pathogenic" "" "0000141583" "1" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000141584" "1" "90" "X" "119575598" "119575598" "del" "0" "00006" "LAMP2_000043" "g.119575598del" "" "{PMID:Boucek 2011:21415759}, {DOI:Boucek 2011:10.1097/GIM.0b013e31820ad795}" "" "" "" "Germline" "" "" "0" "" "" "g.120441743del" "" "pathogenic" "" "0000141585" "1" "90" "X" "119575598" "119575598" "del" "0" "00006" "LAMP2_000043" "g.119575598del" "" "{PMID:Taylor 2007:17899313}, {DOI:Taylor 2007:10.1007/s10038-007-0184-8}, {PMID:Alroy 2010:21070164}" "" "NM_002294.1:c.delA1219" "not in >300 control chromosomes" "Germline" "yes" "" "0" "" "" "g.120441743del" "" "pathogenic" "" "0000141623" "11" "10" "X" "119590533" "119590533" "subst" "0.389509" "00006" "LAMP2_000001" "g.119590533T>A" "" "{PMID:Regelsberger 2009:19588270}, {DOI:Regelsberger 2009:10.1007/s10545-009-1097-9}" "" "A156T" "" "Germline" "" "" "0" "" "" "g.120456678T>A" "" "benign" "" "0000141624" "0" "90" "X" "119550000" "119582984" "" "0" "00006" "LAMP2_000039" "g.(119548000_119550000)_(119582984_119589211)del" "" "{PMID:Yang 2010:20173215}, {DOI:Yang 2010:10.1161/CIRCGENETICS.109.901785}" "" "del ex4-10" "58 kb deletion" "Germline" "" "" "0" "" "" "" "" "pathogenic" "" "0000141625" "21" "90" "X" "119580229" "119580229" "dup" "0" "00006" "LAMP2_000056" "g.119580229dup" "" "{PMID:Fanin 2006:16565504}, {DOI:Fanin 2006:10.2353/ajpath.2006.050646}" "" "796–797insC" "LAMP2 mRNA level 0.65" "Germline" "yes" "" "0" "" "" "g.120446374dup" "" "pathogenic" "" "0000141626" "21" "90" "X" "119581736" "119581757" "del" "0" "00006" "LAMP2_000057" "g.119581736_119581757del" "" "{PMID:Fanin 2006:16565504}, {DOI:Fanin 2006:10.2353/ajpath.2006.050646}" "" "" "LAMP2 mRNA level 0.43" "Germline" "yes" "" "0" "" "" "g.120447881_120447902del" "" "pathogenic" "" "0000141627" "21" "90" "X" "119589315" "119589315" "subst" "0" "00006" "LAMP2_000038" "g.119589315C>T" "" "{PMID:Fanin 2006:16565504}, {DOI:Fanin 2006:10.2353/ajpath.2006.050646}" "" "" "LAMP2 mRNA level 0.21" "Germline" "yes" "" "0" "" "" "g.120455460C>T" "" "pathogenic" "" "0000141628" "21" "90" "X" "119581008" "119587411" "dup" "0" "00006" "LAMP2_000058" "g.119581008_119587411dup" "" "{PMID:Majer 2014:23716275}, {DOI:Majer 2014:10.1007/s10545-013-9617-z}" "" "g.15815_22218dup6404" "somatic mosaicism in mother" "Germline" "" "" "0" "" "" "g.120447153_120453556dup" "" "pathogenic" "" "0000141629" "21" "90" "X" "119575603" "119575603" "subst" "0" "00006" "LAMP2_000059" "g.119575603G>A" "" "{PMID:Yang 2005:16144992}, {DOI:Yang 2005:10.1161/CIRCULATIONAHA.105.546481}" "" "" "" "Germline" "yes" "" "0" "" "" "g.120441748G>A" "" "pathogenic" "" "0000141630" "21" "90" "X" "119582914" "119582914" "subst" "0" "00006" "LAMP2_000060" "g.119582914A>C" "" "{PMID:Yang 2005:16144992}, {DOI:Yang 2005:10.1161/CIRCULATIONAHA.105.546481}" "" "" "" "Germline" "" "" "0" "" "" "g.120449059A>C" "" "pathogenic" "" "0000141631" "21" "90" "X" "119582911" "119582911" "subst" "0" "00006" "LAMP2_000061" "g.119582911G>Y" "" "{PMID:Schorderet 2007:17296900}, {DOI:Schorderet 2007:10.1001/archopht.125.2.231}" "" "S157X" "Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message." "Germline" "yes" "" "0" "" "" "g.120449056G>Y" "" "pathogenic" "" "0000141632" "21" "90" "X" "119581721" "119581721" "del" "0" "00006" "LAMP2_000015" "g.119581721del" "" "{PMID:Sabourdy 2009:19373884}, {DOI:Sabourdy 2009:10.1002/mus.21252}" "" "" "not in 101 chromosomes" "Germline" "" "" "0" "" "" "g.120447866del" "" "pathogenic" "" "0000141633" "0" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Sabourdy 2009:19373884}, {DOI:Sabourdy 2009:10.1002/mus.21252}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000141635" "21" "90" "X" "119580160" "119580160" "del" "0" "00006" "LAMP2_000063" "g.119580160del" "" "{PMID:Cottinet 2011:21161685}, {DOI:Cottinet 2011:0.1007/s10545-010-9251-y}" "-HphI" "IVS6+1delG" "" "Germline" "yes" "" "0" "" "" "g.120446305del" "" "pathogenic" "" "0000141636" "0" "90" "X" "119580156" "119580159" "del" "0" "00006" "LAMP2_000018" "g.119580156_119580159del" "" "{PMID:Bui 2008:18282207}, {DOI:Bui 2008:10.1111/j.1399-3046.2007.00874.x}" "" "IVS6+3_+6delGAGT" "" "Germline" "" "" "0" "" "" "g.120446301_120446304del" "" "pathogenic" "" "0000141637" "21" "90" "X" "119576520" "119576520" "subst" "0" "00006" "LAMP2_000064" "g.119576520G>T" "" "{PMID:Nadeau 2008:18004770}, {DOI:Nadeau 2008:10.1002/mus.20930}" "" "" "" "Germline" "yes" "" "0" "" "" "g.120442665G>T" "" "pathogenic" "" "0000141638" "0" "90" "X" "119576505" "119576505" "subst" "0" "00006" "LAMP2_000042" "g.119576505G>A" "" "{PMID:Iascone 2008:20960602}" "" "" "" "De novo" "-" "" "0" "" "" "g.120442650G>A" "" "pathogenic" "" "0000141639" "21" "90" "X" "119576502" "119576502" "dup" "0" "00006" "LAMP2_000065" "g.119576502dup" "" "{PMID:Takahashi 2002:12112061}, {DOI:Takahashi 2002:10.1002/ana.10235}, {OMIM:309060:0007}" "" "883insT" "germline mosaicism in mother" "De novo" "" "" "0" "" "" "g.120442647dup" "" "pathogenic" "" "0000141640" "0" "90" "X" "119576490" "119576490" "subst" "0" "00006" "LAMP2_000066" "g.119576490C>A" "" "{PMID:Hong 2012:22541782}, {DOI:Hong 2012:10.5414/NP300465}" "" "E298X" "" "Germline" "" "" "0" "" "" "g.120442635C>A" "" "pathogenic" "" "0000141641" "0" "90" "X" "119573038" "119573038" "subst" "0" "00006" "LAMP2_000067" "g.119573038T>A" "" "{PMID:Hong 2012:22541782}, {DOI:Hong 2012:10.5414/NP300465}" "" "9B K402X" "" "Germline" "" "" "0" "" "" "g.120439183T>A" "" "pathogenic" "" "0000147005" "0" "90" "X" "119575603" "119575603" "dup" "0" "00006" "LAMP2_000033" "g.119575603dup" "" "{PMID:Viéitez 2008:18386377}" "" "codon 358 insC" "" "Germline" "" "" "0" "" "" "g.120441748dup" "" "pathogenic" "" "0000147006" "21" "90" "X" "119575583" "119575583" "subst" "0" "00006" "LAMP2_000069" "g.119575583A>T" "" "{PMID:Tunon 2008:18061453}" "" "" "" "Germline" "yes" "" "0" "" "" "g.120441728A>T" "" "pathogenic" "" "0000147007" "1" "90" "X" "119573092" "119573092" "subst" "0" "00006" "LAMP2_000070" "g.119573092C>G" "" "{PMID:Thiadens 2012:22290069}" "" "" "" "Germline" "yes" "" "0" "" "" "g.120439237C>G" "" "pathogenic" "" "0000147008" "0" "90" "X" "119589420" "119589426" "del" "0" "00006" "LAMP2_000071" "g.119589420_119589426del" "" "{PMID:D’Souza 2014:25228319}" "" "184-190delAAAACTG" "" "Germline" "" "" "0" "" "" "g.120455565_120455571del" "" "pathogenic" "" "0000147009" "0" "90" "X" "119582977" "119582977" "dup" "0" "00006" "LAMP2_000072" "g.119582977dup" "" "{PMID:D’Souza 2014:25228319}" "" "405-406insT" "" "Germline" "" "" "0" "" "" "g.120449122dup" "" "pathogenic" "" "0000147010" "0" "90" "X" "119581700" "119581700" "subst" "0" "00006" "LAMP2_000073" "g.119581700T>C" "" "{PMID:D’Souza 2014:25228319}" "" "" "" "Germline" "" "" "0" "" "" "g.120447845T>C" "" "pathogenic" "" "0000147011" "0" "90" "X" "119575592" "119575592" "subst" "0" "00006" "LAMP2_000074" "g.119575592A>C" "" "{PMID:D’Souza 2014:25228319}" "" "" "" "Germline" "" "" "0" "" "" "g.120441737A>C" "" "pathogenic" "" "0000147012" "0" "90" "X" "119573041" "119573041" "subst" "5.59691E-5" "00006" "LAMP2_000075" "g.119573041T>C" "" "{PMID:D’Souza 2014:25228319}" "" "" "" "Germline" "" "" "0" "" "" "g.120439186T>C" "" "pathogenic" "" "0000147013" "0" "90" "X" "119602969" "119602969" "subst" "0" "00006" "LAMP2_000076" "g.119602969A>C" "" "{PMID:D’Souza 2014:25228319}" "" "" "" "Germline" "" "" "0" "" "" "g.120469114A>C" "" "pathogenic" "" "0000147014" "0" "90" "X" "119576485" "119576508" "del" "0" "00006" "LAMP2_000021" "g.119576485_119576508del" "" "{PMID:Lacoste-Collin 2002:12398843}" "Eco57I-" "c.874-897delAACCGATTTTATCTGAAGGAAGTG" "" "Germline" "" "" "0" "" "" "g.120442630_120442653del" "" "pathogenic" "" "0000147015" "0" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Burusnukul 2008:18555174}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000147018" "0" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Bertini 2005:16217705}" "" "" "" "De novo" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000147019" "21" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Bertini 2005:16217705}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000147020" "20" "50" "X" "119590533" "119590533" "subst" "0.389509" "00006" "LAMP2_000001" "g.119590533T>A" "78/208 cases" "{PMID:Tarpey 2009:19377476}" "" "V52V" "recurrent, found 78 times" "Germline" "" "rs12097" "0" "" "" "g.120456678T>A" "" "VUS" "" "0000147021" "20" "50" "X" "119589310" "119589310" "subst" "5.03474E-5" "00006" "LAMP2_000002" "g.119589310G>A" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.120455455G>A" "" "VUS" "" "0000147022" "20" "50" "X" "119582862" "119582862" "subst" "1.1202E-5" "00006" "LAMP2_000003" "g.119582862T>C" "1/208 cases" "{PMID:Tarpey 2009:19377476}" "" "V173V" "found once, nonrecurrent change" "Germline" "" "" "0" "" "" "g.120449007T>C" "" "VUS" "" "0000147023" "20" "50" "X" "119576455" "119576455" "subst" "0.0270762" "00006" "LAMP2_000004" "g.119576455G>A" "12/208 cases" "{PMID:Tarpey 2009:19377476}" "" "S309S" "recurrent, found 12 times" "Germline" "" "rs73219144" "0" "" "" "g.120442600G>A" "" "VUS" "" "0000147024" "0" "10" "X" "119590533" "119590533" "subst" "0.389509" "00430" "LAMP2_000001" "g.119590533T>A" "" "from website {DBsub-Emory}" "" "" "" "Germline" "" "rs12097" "0" "" "" "g.120456678T>A" "" "benign" "" "0000147025" "0" "90" "X" "119581854" "119581861" "del" "0" "00430" "LAMP2_000006" "g.119581854_119581861del" "" "from website {DBsub-Emory}" "" "579_586delAACTTCAA" "" "Germline" "" "" "0" "" "" "g.120447999_120448006del" "" "pathogenic" "" "0000147032" "0" "90" "X" "119590586" "119590587" "del" "0" "00052" "LAMP2_000026" "g.119590586_119590587del" "2/a family" "{PMID:Echaniz-Laguna 2006:16372318}" "" "102_103delAG" "" "Germline" "" "" "0" "" "" "g.120456731_120456732del" "" "pathogenic" "" "0000147033" "21" "90" "X" "119575584" "119575584" "subst" "0" "00052" "LAMP2_000027" "g.119575584C>G" "" "{PMID:Di Blasi 2008:18990578}" "" "IVS8+1G>C" "" "Germline" "" "" "0" "" "" "g.120441729C>G" "" "pathogenic" "" "0000147034" "0" "90" "X" "119573144" "119573145" "del" "0" "00052" "LAMP2_000028" "g.119573144_119573145del" "1/11 cases" "{PMID:Nishino 2000:10972294}, {OMIM:309060:0001}" "" "1097delAA" "not in 54 controls" "Germline" "" "" "0" "" "" "g.120439289_120439290del" "" "pathogenic" "" "0000147035" "20" "90" "X" "119590551" "119590551" "subst" "0" "00052" "LAMP2_000029" "g.119590551C>T" "" "{PMID:Balmer 2005:15889279}" "" "" "" "Germline" "yes" "" "0" "" "" "g.120456696C>T" "" "pathogenic" "" "0000147036" "0" "90" "X" "119603011" "119603011" "del" "0" "00052" "LAMP2_000030" "g.119603011del" "1/11 cases" "{PMID:Nishino 2000:10972294}, {OMIM309060:0006}" "" "" "not in 54 controls" "Germline" "" "" "0" "" "" "g.120469156del" "" "pathogenic" "" "0000147037" "0" "10" "X" "119590533" "119590533" "subst" "0.389509" "00052" "LAMP2_000001" "g.119590533T>A" "1" "{PMID:Lacoste-Collin 2002:12398843}" "" "" "" "Germline" "" "rs12097" "0" "" "" "g.120456678T>A" "" "benign" "" "0000147038" "0" "30" "X" "119590533" "119590533" "subst" "0.389509" "00052" "LAMP2_000001" "g.119590533T>A" "" "{PMID:Di Blasi 2008:18990578}" "" "" "" "Germline" "" "rs12097" "0" "" "" "g.120456678T>A" "" "likely benign" "" "0000147039" "0" "90" "X" "119589282" "119589282" "subst" "0" "00052" "LAMP2_000007" "g.119589282A>T" "1/75 cases" "{PMID:Arad 2005:15673802}" "" "Y109Ter" "not in 180 controls" "De novo" "" "" "0" "" "" "g.120455427A>T" "" "pathogenic (recessive)" "" "0000147040" "0" "90" "X" "119602989" "119602995" "del" "0" "00052" "LAMP2_000008" "g.119602989_119602995del" "1/50" "{PMID:Charron 2004:15253947}, {OMIM309060:0008}" "" "173_179del" "patient mother carried variant" "Germline" "" "" "0" "" "" "g.120469134_120469140del" "" "pathogenic" "" "0000147041" "0" "90" "X" "119582941" "119582941" "subst" "0" "00052" "LAMP2_000009" "g.119582941A>T" "1/11 cases" "{PMID:Nishino 2000:10972294}, {OMIM:309060:0002}" "" "" "not in 54 controls" "Germline" "" "rs137852527" "0" "" "" "g.120449086A>T" "" "pathogenic" "" "0000147042" "0" "90" "X" "119582911" "119582911" "subst" "0" "00052" "LAMP2_000010" "g.119582911G>C" "3/a family" "{PMID:Lobrinus 2005:15792868}" "" "605C>G" "not in 100 chromosomes" "Germline" "" "" "0" "" "" "g.120449056G>C" "" "pathogenic" "" "0000147043" "0" "90" "X" "119582861" "119582861" "subst" "0" "00052" "LAMP2_000011" "g.119582861G>A" "1/50" "{PMID:Charron 2004:15253947}, {OMIM309060:0009}" "" "657C>T" "patient mother did not carry variant" "De novo" "" "" "0" "" "" "g.120449006G>A" "" "pathogenic" "" "0000147044" "0" "90" "X" "119581866" "119581866" "del" "0" "00052" "LAMP2_000012" "g.119581866del" "3/a family" "{PMID:Dougu 2009:19057086}" "" "" "" "De novo" "" "" "0" "" "" "g.120448011del" "" "pathogenic" "" "0000147045" "21" "90" "X" "119602960" "119602960" "subst" "0" "00052" "LAMP2_000013" "g.119602960C>A" "1/75 cases" "{PMID:Arad 2005:15673802}" "" "IVS1+1G>T" "RNA new cryptic splice site that excised 21 amino acids after initiation codon; not in 180 controls" "Germline" "" "" "0" "" "" "g.120469105C>A" "" "pathogenic" "" "0000147046" "0" "90" "X" "119590626" "119590626" "subst" "0" "00052" "LAMP2_000014" "g.119590626T>C" "1/75 cases" "{PMID:Arad 2005:15673802}" "" "IVS1-2A>G" "not in 180 controls" "De novo" "" "" "0" "" "" "g.120456771T>C" "" "pathogenic" "" "0000147047" "0" "90" "X" "119581721" "119581721" "del" "0" "00052" "LAMP2_000015" "g.119581721del" "2/a family" "{PMID:Sabroudy 2009:19373884}" "HhaI" "" "not in 63 controls" "De novo" "" "" "0" "" "" "g.120447866del" "" "pathogenic" "" "0000147048" "0" "90" "X" "119581695" "119581695" "subst" "0" "00052" "LAMP2_000016" "g.119581695C>T" "3/11 cases" "{PMID:Nishino 2000:10972294}, {OMIM:309060:0005}" "" "" "not in 54 controls" "Germline" "" "" "0" "" "" "g.120447840C>T" "" "pathogenic" "" "0000147049" "0" "90" "X" "119580279" "119580288" "del" "0" "00052" "LAMP2_000017" "g.119580279_119580288del" "1/11 cases" "{PMID:Nishino 2000:10972294}" "" "" "not in 54 controls" "Germline" "" "" "0" "" "" "g.120446424_120446433del" "" "pathogenic" "" "0000147050" "21" "90" "X" "119580156" "119580159" "del" "0" "00052" "LAMP2_000018" "g.119580156_119580159del" "1/75 cases" "{PMID:Arad 2005:15673802}" "" "IVS6+1_4delGTGA" "RNA excised 41 codons; not in 180 controls" "Germline" "yes" "" "0" "" "" "g.120446301_120446304del" "" "pathogenic" "" "0000147051" "0" "90" "X" "119580155" "119580155" "subst" "0" "00052" "LAMP2_000019" "g.119580155C>G" "1/11 cases" "{PMID:Nishino 2000:10972294}, {OMIM:309060:0003}" "" "" "not in 54 controls" "Germline" "" "" "0" "" "" "g.120446300C>G" "" "pathogenic" "" "0000147052" "0" "90" "X" "119576519" "119576519" "subst" "0" "00052" "LAMP2_000020" "g.119576519T>C" "1/75 cases" "{PMID:Arad 2005:15673802}" "" "IVS6-2A>G" "no variant RNA was detected; not in 180 controls" "De novo" "" "" "0" "" "" "g.120442664T>C" "" "pathogenic" "" "0000147054" "0" "30" "X" "119576455" "119576455" "subst" "0.0270762" "00052" "LAMP2_000004" "g.119576455G>A" "" "{PMID:Di Blasi 2008:18990578}" "" "" "" "Germline" "" "rs73219144" "0" "" "" "g.120442600G>A" "" "likely benign" "" "0000147055" "0" "90" "X" "119576454" "119576454" "subst" "0" "00052" "LAMP2_000022" "g.119576454C>T" "1/75 cases" "{PMID:Arad 2005:15673802}, {OMIM:309060:0010}" "" "" "affected RNA processing; not in 180 controls" "De novo" "" "rs104894858" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000147056" "0" "70" "X" "119576454" "119576454" "subst" "0" "00052" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Bertini 2005:16217705}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "likely pathogenic" "" "0000147057" "0" "90" "X" "119576454" "119576454" "subst" "0" "00052" "LAMP2_000022" "g.119576454C>T" "1/a family" "{PMID:Sabroudy 2009:19373884}" "" "" "" "De novo" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000147058" "0" "70" "X" "119575750" "119575750" "subst" "0" "00052" "LAMP2_000023" "g.119575750C>T" "2" "{PMID:Horvath 2003:14598234}" "" "" "not in 100 controls" "Germline" "" "" "0" "" "" "g.120441895C>T" "" "likely pathogenic" "" "0000147059" "0" "90" "X" "119575717" "119575717" "subst" "0" "00052" "LAMP2_000024" "g.119575717A>G" "1" "{PMID:Musumeci 2005:15907287}, {OMIM:309060:0011}" "" "" "not in 100 controls" "Germline" "" "rs104894859" "0" "" "" "g.120441862A>G" "" "pathogenic" "" "0000147060" "0" "90" "X" "119575704" "119575704" "delins" "0" "00052" "LAMP2_000025" "g.119575704delinsTT" "1/11 cases" "{PMID:Nishino 2000:10972294}, {OMIM:309060:0004}" "" "" "not in 54 controls" "Germline" "" "" "0" "" "" "g.120441849delinsTT" "" "pathogenic" "" "0000147061" "21" "30" "X" "119590533" "119590533" "subst" "0.389509" "01834" "LAMP2_000001" "g.119590533T>A" "" "" "" "V52V" "" "Germline" "" "rs12097" "0" "" "" "g.120456678T>A" "" "likely benign" "" "0000147062" "21" "50" "X" "119581851" "119581851" "subst" "0.000335636" "01834" "LAMP2_000031" "g.119581851T>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.120447996T>A" "" "VUS" "" "0000147063" "21" "77" "X" "119590626" "119590626" "subst" "0" "01834" "LAMP2_000014" "g.119590626T>C" "" "{PMID:Cetin 2016:26748608}, {DOI:Cetin 2016:10.1111/cge.12724}" "" "IVS1-2A>G" "4 transcripts detected: (1) full length transcript, (2) transcript with cryptic splice site in exon 2, (3) exon 2 - skipped transcript (frameshift) and (4) exon 1+2 skipped transcript" "Germline" "yes" "rs397516743" "0" "" "" "g.120456771T>C" "" "likely pathogenic" "" "0000147064" "0" "90" "X" "119570263" "119570263" "subst" "0" "00006" "LAMP2_000005" "g.119570263T>C" "0.00-0.10" "" "" "" "" "Germline" "" "rs3827478" "0" "" "" "g.120436408T>C" "" "pathogenic" "" "0000147077" "21" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Arad 2005:15673802}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000175168" "1" "90" "X" "119581776" "119581776" "subst" "0.00149915" "01401" "LAMP2_000080" "g.119581776C>T" "" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "" "" "Germline" "" "" "0" "" "" "g.120447921C>T" "" "pathogenic" "" "0000175187" "1" "90" "X" "119581695" "119581695" "subst" "0" "01401" "LAMP2_000079" "g.119581695C>A" "reads 0.5" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "" "" "Germline" "" "" "0" "" "" "g.120447840C>A" "" "pathogenic" "" "0000175194" "1" "90" "X" "119576454" "119576454" "subst" "0" "01401" "LAMP2_000022" "g.119576454C>T" "reads 0.49" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000175211" "1" "70" "X" "119589370" "119589370" "subst" "0" "01401" "LAMP2_000081" "g.119589370C>A" "reads 0.49" "{PMID:Cecconi 2016:27600940}, {DOI:Cecconi 2016:10.3892/ijmm.2016.2732}" "" "" "NCBI reference KU508440" "Germline" "" "" "0" "" "" "g.120455515C>A" "" "likely pathogenic" "" "0000247722" "0" "10" "X" "119580269" "119580269" "subst" "0.00102983" "02330" "LAMP2_000099" "g.119580269A>C" "" "" "" "LAMP2(NM_002294.2):c.755T>G (p.I252S), LAMP2(NM_002294.3):c.755T>G (p.I252S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446414A>C" "" "benign" "" "0000247731" "0" "10" "X" "119590604" "119590604" "subst" "2.92524E-5" "02330" "LAMP2_000116" "g.119590604A>G" "" "" "" "LAMP2(NM_002294.2):c.85T>C (p.L29=), LAMP2(NM_002294.3):c.85T>C (p.L29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456749A>G" "" "benign" "" "0000247744" "0" "10" "X" "119575754" "119575754" "subst" "6.72126E-5" "02330" "LAMP2_000095" "g.119575754A>G" "" "" "" "LAMP2(NM_002294.2):c.929-5T>C, LAMP2(NM_002294.3):c.929-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441899A>G" "" "benign" "" "0000247799" "0" "30" "X" "119590637" "119590637" "subst" "2.27747E-5" "02330" "LAMP2_000118" "g.119590637A>T" "" "" "" "LAMP2(NM_002294.3):c.65-13T>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456782A>T" "" "likely benign" "" "0000247884" "0" "30" "X" "119580269" "119580269" "subst" "0.00102983" "02325" "LAMP2_000099" "g.119580269A>C" "" "" "" "LAMP2(NM_002294.2):c.755T>G (p.I252S), LAMP2(NM_002294.3):c.755T>G (p.I252S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446414A>C" "" "likely benign" "" "0000249622" "0" "90" "X" "119580217" "119580217" "del" "0" "02325" "LAMP2_000098" "g.119580217del" "" "" "" "LAMP2(NM_002294.3):c.807delT (p.A270Lfs*13)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446362del" "" "pathogenic" "" "0000249824" "0" "50" "X" "119589340" "119589340" "subst" "0" "02325" "LAMP2_000110" "g.119589340A>T" "" "" "" "LAMP2(NM_002294.3):c.269T>A (p.V90E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455485A>T" "" "VUS" "" "0000250723" "0" "30" "X" "119580269" "119580269" "subst" "0.00102983" "02326" "LAMP2_000099" "g.119580269A>C" "" "" "" "LAMP2(NM_002294.2):c.755T>G (p.I252S), LAMP2(NM_002294.3):c.755T>G (p.I252S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446414A>C" "" "likely benign" "" "0000252821" "0" "50" "X" "119582991" "119582991" "del" "0" "02326" "LAMP2_000105" "g.119582991del" "" "" "" "LAMP2(NM_002294.2):c.398-5delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120449136del" "" "VUS" "" "0000253075" "0" "10" "X" "119580269" "119580269" "subst" "0.00102983" "01943" "LAMP2_000099" "g.119580269A>C" "" "" "" "LAMP2(NM_002294.2):c.755T>G (p.I252S), LAMP2(NM_002294.3):c.755T>G (p.I252S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446414A>C" "" "benign" "" "0000253716" "0" "10" "X" "119565269" "119565269" "subst" "0.000118981" "01943" "LAMP2_000089" "g.119565269A>G" "" "" "" "LAMP2(NM_001122606.1):c.1094-2788T>C (p.(=)), LAMP2(NM_002294.2):c.1142T>C (p.V381A), LAMP2(NM_002294.3):c.1142T>C (p.V381A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120431414A>G" "" "benign" "" "0000254405" "0" "30" "X" "119565220" "119565220" "subst" "7.36177E-5" "01943" "LAMP2_000088" "g.119565220A>G" "" "" "" "LAMP2(NM_002294.2):c.1191T>C (p.F397=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120431365A>G" "" "likely benign" "" "0000255169" "0" "30" "X" "119562384" "119562384" "subst" "0.000133554" "01943" "LAMP2_000082" "g.119562384A>G" "" "" "" "LAMP2(NM_001122606.1):c.1191T>C (p.Y397=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120428529A>G" "" "likely benign" "" "0000255340" "0" "30" "X" "119582988" "119582988" "subst" "5.67714E-6" "01943" "LAMP2_000106" "g.119582988A>G" "" "" "" "LAMP2(NM_002294.2):c.398-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120449133A>G" "" "likely benign" "" "0000255659" "0" "90" "X" "119590564" "119590564" "del" "0" "01943" "LAMP2_000113" "g.119590564del" "" "" "" "LAMP2(NM_002294.2):c.127delT (p.Y43Mfs*6)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456709del" "" "pathogenic" "" "0000278729" "0" "10" "X" "119603055" "119603063" "del" "0" "02330" "LAMP2_000034" "g.119603055_119603063del" "" "" "" "LAMP2(NM_002294.3):c.-23_-15delGTCGCCGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120469200_120469208del" "" "benign" "" "0000278730" "0" "30" "X" "119562500" "119562500" "subst" "0" "02330" "LAMP2_000086" "g.119562500C>T" "" "" "" "LAMP2(NM_001122606.1):c.1094-19G>A, LAMP2(NM_002294.3):c.*2678G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120428645C>T" "" "likely benign" "" "0000278731" "0" "10" "X" "119573169" "119573169" "subst" "0.000202222" "02330" "LAMP2_000091" "g.119573169G>A" "" "" "" "LAMP2(NM_002294.3):c.1093+2416C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120439314G>A" "" "benign" "" "0000278732" "0" "10" "X" "119573135" "119573135" "subst" "9.52781E-5" "02330" "LAMP2_000090" "g.119573135C>T" "" "" "" "LAMP2(NM_013995.2):c.1107G>A (p.S369=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120439280C>T" "" "benign" "" "0000278733" "0" "10" "X" "119562432" "119562432" "subst" "0.00994123" "02330" "LAMP2_000085" "g.119562432T>C" "" "" "" "LAMP2(NM_001122606.1):c.1143A>G (p.A381=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120428577T>C" "" "benign" "" "0000278734" "0" "30" "X" "119590571" "119590574" "del" "0" "02330" "LAMP2_000114" "g.119590571_119590574del" "" "" "" "LAMP2(NM_002294.3):c.115_118delGCCA (p.A39Lfs*9)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456716_120456719del" "" "likely benign" "" "0000278735" "0" "10" "X" "119590533" "119590533" "subst" "0.389509" "02330" "LAMP2_000001" "g.119590533T>A" "" "" "" "LAMP2(NM_002294.2):c.156A>T (p.V52=), LAMP2(NM_002294.3):c.156A>T (p.V52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456678T>A" "" "benign" "" "0000278736" "0" "10" "X" "119589270" "119589270" "subst" "0.00074406" "02330" "LAMP2_000109" "g.119589270G>A" "" "" "" "LAMP2(NM_002294.2):c.339C>T (p.S113=), LAMP2(NM_002294.3):c.339C>T (p.S113=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455415G>A" "" "benign" "" "0000278737" "0" "10" "X" "119589237" "119589237" "subst" "0" "02330" "LAMP2_000108" "g.119589237T>C" "" "" "" "LAMP2(NM_002294.3):c.372A>G (p.T124=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455382T>C" "" "benign" "" "0000278738" "0" "10" "X" "119589197" "119589197" "del" "0" "02330" "LAMP2_000107" "g.119589197del" "" "" "" "LAMP2(NM_002294.3):c.397+16delG" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455342del" "" "benign" "" "0000278739" "0" "10" "X" "119602983" "119602983" "subst" "2.81346E-5" "02330" "LAMP2_000119" "g.119602983G>A" "" "" "" "LAMP2(NM_002294.2):c.42C>T (p.L14=), LAMP2(NM_002294.3):c.42C>T (p.L14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120469128G>A" "" "benign" "" "0000278740" "0" "10" "X" "119582877" "119582877" "subst" "0.000117609" "02330" "LAMP2_000104" "g.119582877G>A" "" "" "" "LAMP2(NM_002294.2):c.504C>T (p.Y168=), LAMP2(NM_002294.3):c.504C>T (p.Y168=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120449022G>A" "" "benign" "" "0000278741" "0" "10" "X" "119581846" "119581846" "subst" "0.00025173" "02330" "LAMP2_000103" "g.119581846C>T" "" "" "" "LAMP2(NM_002294.2):c.591G>A (p.V197=), LAMP2(NM_002294.3):c.591G>A (p.V197=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447991C>T" "" "benign" "" "0000278742" "0" "10" "X" "119581776" "119581776" "subst" "0.00149915" "02330" "LAMP2_000080" "g.119581776C>T" "" "" "" "LAMP2(NM_001122606.1):c.661G>A (p.(Gly221Arg), p.G221R), LAMP2(NM_002294.2):c.661G>A (p.G221R), LAMP2(NM_002294.3):c.661G>A (p.G221R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447921C>T" "" "benign" "" "0000278743" "0" "30" "X" "119581723" "119581723" "subst" "0" "02330" "LAMP2_000102" "g.119581723C>A" "" "" "" "LAMP2(NM_002294.3):c.714G>T (p.G238=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447868C>A" "" "likely benign" "" "0000278744" "0" "10" "X" "119581685" "119581685" "subst" "0.00102447" "02330" "LAMP2_000101" "g.119581685G>A" "" "" "" "LAMP2(NM_002294.2):c.741+11C>T, LAMP2(NM_002294.3):c.741+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447830G>A" "" "benign" "" "0000278745" "0" "10" "X" "119580297" "119580299" "del" "0" "02330" "LAMP2_000100" "g.119580297_119580299del" "" "" "" "LAMP2(NM_002294.2):c.742-10_742-8delTCT, LAMP2(NM_002294.3):c.742-10_742-8delTCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446442_120446444del" "" "benign" "" "0000278746" "0" "10" "X" "119576455" "119576455" "subst" "0.0270762" "02330" "LAMP2_000004" "g.119576455G>A" "" "" "" "LAMP2(NM_002294.2):c.927C>T (p.S309=), LAMP2(NM_002294.3):c.927C>T (p.S309=, p.(Ser309=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120442600G>A" "" "benign" "" "0000278748" "0" "30" "X" "119603016" "119603016" "subst" "1.12351E-5" "02330" "LAMP2_000120" "g.119603016G>A" "" "" "" "LAMP2(NM_002294.3):c.9C>T (p.C3=, p.(Cys3=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120469161G>A" "" "likely benign" "" "0000282104" "0" "10" "X" "119603055" "119603063" "del" "0" "02325" "LAMP2_000034" "g.119603055_119603063del" "" "" "" "LAMP2(NM_002294.3):c.-23_-15delGTCGCCGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120469200_120469208del" "" "benign" "" "0000282105" "0" "50" "X" "119575611" "119575611" "subst" "1.67883E-5" "02325" "LAMP2_000093" "g.119575611T>C" "" "" "" "LAMP2(NM_002294.3):c.1067A>G (p.N356S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441756T>C" "" "VUS" "" "0000282106" "0" "50" "X" "119575587" "119575587" "subst" "3.92163E-5" "02325" "LAMP2_000092" "g.119575587G>A" "" "" "" "LAMP2(NM_002294.2):c.1091C>T (p.T364I), LAMP2(NM_002294.3):c.1091C>T (p.T364I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441732G>A" "" "VUS" "" "0000282107" "0" "30" "X" "119589400" "119589400" "subst" "0" "02325" "LAMP2_000111" "g.119589400C>A" "" "" "" "LAMP2(NM_002294.3):c.209G>T (p.G70V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455545C>A" "" "likely benign" "" "0000282108" "0" "30" "X" "119589270" "119589270" "subst" "0.00074406" "02325" "LAMP2_000109" "g.119589270G>A" "" "" "" "LAMP2(NM_002294.2):c.339C>T (p.S113=), LAMP2(NM_002294.3):c.339C>T (p.S113=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455415G>A" "" "likely benign" "" "0000282109" "0" "30" "X" "119581776" "119581776" "subst" "0.00149915" "02325" "LAMP2_000080" "g.119581776C>T" "" "" "" "LAMP2(NM_001122606.1):c.661G>A (p.(Gly221Arg), p.G221R), LAMP2(NM_002294.2):c.661G>A (p.G221R), LAMP2(NM_002294.3):c.661G>A (p.G221R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447921C>T" "" "likely benign" "" "0000282110" "0" "30" "X" "119590615" "119590615" "subst" "0.000381125" "02325" "LAMP2_000117" "g.119590615C>T" "" "" "" "LAMP2(NM_002294.3):c.74G>A (p.R25Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456760C>T" "" "likely benign" "" "0000282111" "0" "30" "X" "119576455" "119576455" "subst" "0.0270762" "02325" "LAMP2_000004" "g.119576455G>A" "" "" "" "LAMP2(NM_002294.2):c.927C>T (p.S309=), LAMP2(NM_002294.3):c.927C>T (p.S309=, p.(Ser309=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120442600G>A" "" "likely benign" "" "0000282112" "0" "90" "X" "119575712" "119575712" "dup" "0" "02325" "LAMP2_000094" "g.119575712dup" "" "" "" "LAMP2(NM_002294.3):c.965delAinsAT (p.A323Cfs*27)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441857dup" "" "pathogenic" "" "0000285908" "0" "50" "X" "119575587" "119575587" "subst" "3.92163E-5" "02326" "LAMP2_000092" "g.119575587G>A" "" "" "" "LAMP2(NM_002294.2):c.1091C>T (p.T364I), LAMP2(NM_002294.3):c.1091C>T (p.T364I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441732G>A" "" "VUS" "" "0000285909" "0" "30" "X" "119589270" "119589270" "subst" "0.00074406" "02326" "LAMP2_000109" "g.119589270G>A" "" "" "" "LAMP2(NM_002294.2):c.339C>T (p.S113=), LAMP2(NM_002294.3):c.339C>T (p.S113=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455415G>A" "" "likely benign" "" "0000285910" "0" "30" "X" "119581776" "119581776" "subst" "0.00149915" "02326" "LAMP2_000080" "g.119581776C>T" "" "" "" "LAMP2(NM_001122606.1):c.661G>A (p.(Gly221Arg), p.G221R), LAMP2(NM_002294.2):c.661G>A (p.G221R), LAMP2(NM_002294.3):c.661G>A (p.G221R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447921C>T" "" "likely benign" "" "0000285911" "0" "10" "X" "119576455" "119576455" "subst" "0.0270762" "02326" "LAMP2_000004" "g.119576455G>A" "" "" "" "LAMP2(NM_002294.2):c.927C>T (p.S309=), LAMP2(NM_002294.3):c.927C>T (p.S309=, p.(Ser309=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120442600G>A" "" "benign" "" "0000285912" "0" "90" "X" "119576454" "119576454" "subst" "0" "02326" "LAMP2_000022" "g.119576454C>T" "" "" "" "LAMP2(NM_002294.2):c.928G>A (p.V310I), LAMP2(NM_002294.3):c.928G>A (p.V310I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000285913" "0" "70" "X" "119575750" "119575750" "subst" "0" "02326" "LAMP2_000023" "g.119575750C>T" "" "" "" "LAMP2(NM_002294.2):c.929-1G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441895C>T" "" "likely pathogenic" "" "0000290845" "0" "30" "X" "119562500" "119562500" "subst" "0" "01943" "LAMP2_000086" "g.119562500C>T" "" "" "" "LAMP2(NM_001122606.1):c.1094-19G>A, LAMP2(NM_002294.3):c.*2678G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120428645C>T" "" "likely benign" "" "0000290846" "0" "50" "X" "119575587" "119575587" "subst" "3.92163E-5" "01943" "LAMP2_000092" "g.119575587G>A" "" "" "" "LAMP2(NM_002294.2):c.1091C>T (p.T364I), LAMP2(NM_002294.3):c.1091C>T (p.T364I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441732G>A" "" "VUS" "" "0000290847" "0" "50" "X" "119590577" "119590577" "subst" "0" "01943" "LAMP2_000115" "g.119590577T>A" "" "" "" "LAMP2(NM_002294.2):c.112A>T (p.N38Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456722T>A" "" "VUS" "" "0000290848" "0" "10" "X" "119562432" "119562432" "subst" "0.00994123" "01943" "LAMP2_000085" "g.119562432T>C" "" "" "" "LAMP2(NM_001122606.1):c.1143A>G (p.A381=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120428577T>C" "" "benign" "" "0000290849" "0" "30" "X" "119562423" "119562423" "subst" "6.2588E-6" "01943" "LAMP2_000084" "g.119562423C>G" "" "" "" "LAMP2(NM_001122606.1):c.1152G>C (p.V384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120428568C>G" "" "likely benign" "" "0000290850" "0" "10" "X" "119590533" "119590533" "subst" "0.389509" "01943" "LAMP2_000001" "g.119590533T>A" "" "" "" "LAMP2(NM_002294.2):c.156A>T (p.V52=), LAMP2(NM_002294.3):c.156A>T (p.V52=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120456678T>A" "" "benign" "" "0000290851" "0" "10" "X" "119589421" "119589421" "subst" "5.6013E-6" "01943" "LAMP2_000112" "g.119589421G>A" "" "" "" "LAMP2(NM_001122606.1):c.188C>T (p.(Thr63Ile)), LAMP2(NM_002294.2):c.188C>T (p.T63I), LAMP2(NM_002294.3):c.188C>T (p.T63I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455566G>A" "" "benign" "" "0000290852" "0" "30" "X" "119589270" "119589270" "subst" "0.00074406" "01943" "LAMP2_000109" "g.119589270G>A" "" "" "" "LAMP2(NM_002294.2):c.339C>T (p.S113=), LAMP2(NM_002294.3):c.339C>T (p.S113=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455415G>A" "" "likely benign" "" "0000290853" "0" "30" "X" "119581846" "119581846" "subst" "0.00025173" "01943" "LAMP2_000103" "g.119581846C>T" "" "" "" "LAMP2(NM_002294.2):c.591G>A (p.V197=), LAMP2(NM_002294.3):c.591G>A (p.V197=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447991C>T" "" "likely benign" "" "0000290854" "0" "30" "X" "119581776" "119581776" "subst" "0.00149915" "01943" "LAMP2_000080" "g.119581776C>T" "" "" "" "LAMP2(NM_001122606.1):c.661G>A (p.(Gly221Arg), p.G221R), LAMP2(NM_002294.2):c.661G>A (p.G221R), LAMP2(NM_002294.3):c.661G>A (p.G221R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447921C>T" "" "likely benign" "" "0000290855" "0" "50" "X" "119580206" "119580206" "subst" "0" "01943" "LAMP2_000097" "g.119580206C>T" "" "" "" "LAMP2(NM_002294.2):c.818G>A (p.R273K), LAMP2(NM_002294.3):c.818G>A (p.R273K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120446351C>T" "" "VUS" "" "0000335362" "0" "50" "X" "119565200" "119565200" "subst" "5.66178E-6" "01804" "LAMP2_000087" "g.119565200T>A" "" "" "" "LAMP2(NM_002294.2):c.1211A>T (p.(His404Leu)), LAMP2(NM_002294.3):c.1211A>T (p.H404L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120431345T>A" "" "VUS" "" "0000335363" "0" "50" "X" "119565269" "119565269" "subst" "0.000118981" "01804" "LAMP2_000089" "g.119565269A>G" "" "" "" "LAMP2(NM_001122606.1):c.1094-2788T>C (p.(=)), LAMP2(NM_002294.2):c.1142T>C (p.V381A), LAMP2(NM_002294.3):c.1142T>C (p.V381A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120431414A>G" "" "VUS" "" "0000335366" "0" "30" "X" "119581776" "119581776" "subst" "0.00149915" "01804" "LAMP2_000080" "g.119581776C>T" "" "" "" "LAMP2(NM_001122606.1):c.661G>A (p.(Gly221Arg), p.G221R), LAMP2(NM_002294.2):c.661G>A (p.G221R), LAMP2(NM_002294.3):c.661G>A (p.G221R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120447921C>T" "" "likely benign" "" "0000335367" "0" "50" "X" "119589421" "119589421" "subst" "5.6013E-6" "01804" "LAMP2_000112" "g.119589421G>A" "" "" "" "LAMP2(NM_001122606.1):c.188C>T (p.(Thr63Ile)), LAMP2(NM_002294.2):c.188C>T (p.T63I), LAMP2(NM_002294.3):c.188C>T (p.T63I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120455566G>A" "" "VUS" "" "0000350858" "0" "30" "X" "119575754" "119575754" "subst" "6.72126E-5" "02327" "LAMP2_000095" "g.119575754A>G" "" "" "" "LAMP2(NM_002294.2):c.929-5T>C, LAMP2(NM_002294.3):c.929-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.120441899A>G" "" "likely benign" "" "0000437560" "20" "90" "X" "119582894" "119582894" "del" "0" "01807" "LAMP2_000122" "g.119582894del" "" "" "" "487delG" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.120449039del" "" "pathogenic" "" "0000443919" "21" "90" "X" "119580209" "119580209" "subst" "0" "03148" "LAMP2_000123" "g.119580209A>G" "" "" "" "" "not found in 2000000 controls" "Germline" "yes" "" "0" "" "" "g.120446354A>G" "" "pathogenic" "" "0000470483" "10" "90" "X" "119576454" "119576454" "subst" "0" "02588" "LAMP2_000022" "g.119576454C>T" "" "{PMID:Gourzi 2018:29753918}" "" "" "" "Germline" "yes" "rs104894858" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000487095" "21" "10" "X" "119581776" "119581776" "" "0" "00006" "LAMP2_000124" "g.119581776C>M" "" "{PMID:Fanin 2015:25091525}" "" "G221R" "" "Germline" "" "" "0" "" "" "" "" "benign" "" "0000573251" "0" "30" "X" "119562407" "119562407" "subst" "5.49373E-5" "02330" "LAMP2_000083" "g.119562407T>C" "" "" "" "LAMP2(NM_001122606.1):c.1168A>G (p.I390V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120428552T>C" "" "likely benign" "" "0000573252" "0" "30" "X" "119562407" "119562407" "subst" "5.49373E-5" "01943" "LAMP2_000083" "g.119562407T>C" "" "" "" "LAMP2(NM_001122606.1):c.1168A>G (p.I390V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120428552T>C" "" "likely benign" "" "0000573253" "0" "30" "X" "119562407" "119562407" "subst" "5.49373E-5" "02326" "LAMP2_000083" "g.119562407T>C" "" "" "" "LAMP2(NM_001122606.1):c.1168A>G (p.I390V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120428552T>C" "" "likely benign" "" "0000573255" "0" "30" "X" "119565336" "119565336" "subst" "0" "02327" "LAMP2_000125" "g.119565336C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120431481C>T" "" "likely benign" "" "0000573256" "0" "30" "X" "119571073" "119571073" "subst" "0" "02327" "LAMP2_000126" "g.119571073G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120437218G>A" "" "likely benign" "" "0000573257" "0" "50" "X" "119572129" "119572129" "subst" "0" "02327" "LAMP2_000127" "g.119572129G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120438274G>A" "" "VUS" "" "0000573258" "0" "10" "X" "119573071" "119573071" "subst" "0.00389129" "02330" "LAMP2_000128" "g.119573071C>T" "" "" "" "LAMP2(NM_013995.2):c.1171G>A (p.V391I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120439216C>T" "" "benign" "" "0000573259" "0" "10" "X" "119573071" "119573071" "subst" "0.00389129" "01943" "LAMP2_000128" "g.119573071C>T" "" "" "" "LAMP2(NM_013995.2):c.1171G>A (p.V391I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120439216C>T" "" "benign" "" "0000573261" "0" "30" "X" "119573071" "119573071" "subst" "0.00389129" "02325" "LAMP2_000128" "g.119573071C>T" "" "" "" "LAMP2(NM_013995.2):c.1171G>A (p.V391I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120439216C>T" "" "likely benign" "" "0000573262" "0" "30" "X" "119573071" "119573071" "subst" "0.00389129" "02326" "LAMP2_000128" "g.119573071C>T" "" "" "" "LAMP2(NM_013995.2):c.1171G>A (p.V391I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120439216C>T" "" "likely benign" "" "0000573263" "0" "50" "X" "119575587" "119575587" "subst" "3.92163E-5" "02330" "LAMP2_000092" "g.119575587G>A" "" "" "" "LAMP2(NM_002294.2):c.1091C>T (p.T364I), LAMP2(NM_002294.3):c.1091C>T (p.T364I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120441732G>A" "" "VUS" "" "0000573264" "0" "70" "X" "119575659" "119575662" "del" "0" "02327" "LAMP2_000129" "g.119575659_119575662del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120441804_120441807del" "" "likely pathogenic" "" "0000573265" "0" "90" "X" "119576454" "119576454" "subst" "0" "02327" "LAMP2_000022" "g.119576454C>T" "" "" "" "LAMP2(NM_002294.2):c.928G>A (p.V310I), LAMP2(NM_002294.3):c.928G>A (p.V310I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442599C>T" "" "pathogenic" "" "0000573266" "0" "10" "X" "119576455" "119576455" "subst" "0.0270762" "01943" "LAMP2_000004" "g.119576455G>A" "" "" "" "LAMP2(NM_002294.2):c.927C>T (p.S309=), LAMP2(NM_002294.3):c.927C>T (p.S309=, p.(Ser309=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442600G>A" "" "benign" "" "0000573267" "0" "10" "X" "119576455" "119576455" "subst" "0.0270762" "01804" "LAMP2_000004" "g.119576455G>A" "" "" "" "LAMP2(NM_002294.2):c.927C>T (p.S309=), LAMP2(NM_002294.3):c.927C>T (p.S309=, p.(Ser309=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442600G>A" "" "benign" "" "0000573268" "0" "10" "X" "119576455" "119576455" "subst" "0.0270762" "02327" "LAMP2_000004" "g.119576455G>A" "" "" "" "LAMP2(NM_002294.2):c.927C>T (p.S309=), LAMP2(NM_002294.3):c.927C>T (p.S309=, p.(Ser309=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442600G>A" "" "benign" "" "0000573269" "0" "30" "X" "119576529" "119576529" "del" "0" "02325" "LAMP2_000130" "g.119576529del" "" "" "" "LAMP2(NM_002294.3):c.865-8delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442674del" "" "likely benign" "" "0000573270" "0" "30" "X" "119580146" "119580147" "ins" "0" "02327" "LAMP2_000131" "g.119580146_119580147insT" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446291_120446292insT" "" "likely benign" "" "0000573271" "0" "50" "X" "119580206" "119580206" "subst" "0" "02330" "LAMP2_000097" "g.119580206C>T" "" "" "" "LAMP2(NM_002294.2):c.818G>A (p.R273K), LAMP2(NM_002294.3):c.818G>A (p.R273K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446351C>T" "" "VUS" "" "0000573272" "0" "50" "X" "119580246" "119580246" "subst" "2.23865E-5" "02330" "LAMP2_000132" "g.119580246G>A" "" "" "" "LAMP2(NM_002294.2):c.778C>T (p.H260Y), LAMP2(NM_002294.3):c.778C>T (p.H260Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446391G>A" "" "VUS" "" "0000573273" "0" "30" "X" "119580246" "119580246" "subst" "2.23865E-5" "01943" "LAMP2_000132" "g.119580246G>A" "" "" "" "LAMP2(NM_002294.2):c.778C>T (p.H260Y), LAMP2(NM_002294.3):c.778C>T (p.H260Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446391G>A" "" "likely benign" "" "0000573274" "0" "50" "X" "119580246" "119580246" "subst" "2.23865E-5" "02325" "LAMP2_000132" "g.119580246G>A" "" "" "" "LAMP2(NM_002294.2):c.778C>T (p.H260Y), LAMP2(NM_002294.3):c.778C>T (p.H260Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446391G>A" "" "VUS" "" "0000573275" "0" "50" "X" "119580246" "119580246" "subst" "2.23865E-5" "02326" "LAMP2_000132" "g.119580246G>A" "" "" "" "LAMP2(NM_002294.2):c.778C>T (p.H260Y), LAMP2(NM_002294.3):c.778C>T (p.H260Y)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446391G>A" "" "VUS" "" "0000573276" "0" "30" "X" "119580298" "119580298" "subst" "0" "02327" "LAMP2_000133" "g.119580298A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446443A>G" "" "likely benign" "" "0000573277" "0" "30" "X" "119581851" "119581851" "subst" "0.000335636" "02330" "LAMP2_000031" "g.119581851T>A" "" "" "" "LAMP2(NM_002294.2):c.586A>T (p.T196S), LAMP2(NM_002294.3):c.586A>T (p.T196S), LAMP2(NM_013995.2):c.586A>T (p.T196S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120447996T>A" "" "likely benign" "" "0000573278" "0" "30" "X" "119581851" "119581851" "subst" "0.000335636" "01943" "LAMP2_000031" "g.119581851T>A" "" "" "" "LAMP2(NM_002294.2):c.586A>T (p.T196S), LAMP2(NM_002294.3):c.586A>T (p.T196S), LAMP2(NM_013995.2):c.586A>T (p.T196S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120447996T>A" "" "likely benign" "" "0000573280" "0" "30" "X" "119581851" "119581851" "subst" "0.000335636" "02325" "LAMP2_000031" "g.119581851T>A" "" "" "" "LAMP2(NM_002294.2):c.586A>T (p.T196S), LAMP2(NM_002294.3):c.586A>T (p.T196S), LAMP2(NM_013995.2):c.586A>T (p.T196S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120447996T>A" "" "likely benign" "" "0000573281" "0" "30" "X" "119581851" "119581851" "subst" "0.000335636" "02326" "LAMP2_000031" "g.119581851T>A" "" "" "" "LAMP2(NM_002294.2):c.586A>T (p.T196S), LAMP2(NM_002294.3):c.586A>T (p.T196S), LAMP2(NM_013995.2):c.586A>T (p.T196S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120447996T>A" "" "likely benign" "" "0000573282" "0" "90" "X" "119581881" "119581881" "subst" "0" "02325" "LAMP2_000134" "g.119581881C>G" "" "" "" "LAMP2(NM_002294.3):c.557-1G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120448026C>G" "" "pathogenic" "" "0000573283" "0" "30" "X" "119582928" "119582928" "subst" "1.12308E-5" "02330" "LAMP2_000135" "g.119582928A>G" "" "" "" "LAMP2(NM_002294.3):c.453T>C (p.F151=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120449073A>G" "" "likely benign" "" "0000573284" "0" "50" "X" "119582959" "119582959" "subst" "0" "02330" "LAMP2_000136" "g.119582959A>G" "" "" "" "LAMP2(NM_002294.3):c.422T>C (p.L141S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120449104A>G" "" "VUS" "" "0000573285" "0" "30" "X" "119582987" "119582987" "subst" "0" "02327" "LAMP2_000137" "g.119582987T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120449132T>C" "" "likely benign" "" "0000573286" "0" "30" "X" "119582988" "119582988" "subst" "5.67714E-6" "02327" "LAMP2_000106" "g.119582988A>G" "" "" "" "LAMP2(NM_002294.2):c.398-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120449133A>G" "" "likely benign" "" "0000573287" "0" "10" "X" "119589224" "119589224" "subst" "0.000134351" "01943" "LAMP2_000138" "g.119589224C>T" "" "" "" "LAMP2(NM_002294.2):c.385G>A (p.A129T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120455369C>T" "" "benign" "" "0000573288" "0" "30" "X" "119589251" "119589251" "subst" "0" "02327" "LAMP2_000139" "g.119589251T>C" "" "" "" "LAMP2(NM_002294.2):c.358A>G (p.T120A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120455396T>C" "" "likely benign" "" "0000573289" "0" "30" "X" "119589270" "119589270" "subst" "0.00074406" "02327" "LAMP2_000109" "g.119589270G>A" "" "" "" "LAMP2(NM_002294.2):c.339C>T (p.S113=), LAMP2(NM_002294.3):c.339C>T (p.S113=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120455415G>A" "" "likely benign" "" "0000573290" "0" "50" "X" "119589421" "119589421" "subst" "5.6013E-6" "02330" "LAMP2_000112" "g.119589421G>A" "" "" "" "LAMP2(NM_001122606.1):c.188C>T (p.(Thr63Ile)), LAMP2(NM_002294.2):c.188C>T (p.T63I), LAMP2(NM_002294.3):c.188C>T (p.T63I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120455566G>A" "" "VUS" "" "0000573291" "0" "30" "X" "119590532" "119590532" "subst" "0.000106681" "02326" "LAMP2_000140" "g.119590532G>A" "" "" "" "LAMP2(NM_002294.2):c.157C>T (p.R53C), LAMP2(NM_002294.3):c.157C>T (p.R53C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120456677G>A" "" "likely benign" "" "0000573293" "0" "50" "X" "119590616" "119590616" "subst" "0" "02326" "LAMP2_000142" "g.119590616G>A" "" "" "" "LAMP2(NM_002294.2):c.73C>T (p.R25W), LAMP2(NM_002294.3):c.73C>T (p.R25W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120456761G>A" "" "VUS" "" "0000573294" "0" "30" "X" "119590644" "119590644" "subst" "8.28713E-6" "02325" "LAMP2_000143" "g.119590644T>A" "" "" "" "LAMP2(NM_002294.3):c.65-20A>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120456789T>A" "" "likely benign" "" "0000573295" "0" "30" "X" "119602983" "119602983" "subst" "2.81346E-5" "02326" "LAMP2_000119" "g.119602983G>A" "" "" "" "LAMP2(NM_002294.2):c.42C>T (p.L14=), LAMP2(NM_002294.3):c.42C>T (p.L14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120469128G>A" "" "likely benign" "" "0000573296" "0" "50" "X" "119603021" "119603021" "subst" "0" "02327" "LAMP2_000144" "g.119603021C>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120469166C>G" "" "VUS" "" "0000573297" "0" "30" "X" "119603028" "119603028" "subst" "0.000213762" "02325" "LAMP2_000145" "g.119603028C>G" "" "" "" "LAMP2(NM_002294.3):c.-4G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120469173C>G" "" "likely benign" "" "0000573298" "0" "10" "X" "119603055" "119603063" "del" "0" "02327" "LAMP2_000034" "g.119603055_119603063del" "" "" "" "LAMP2(NM_002294.3):c.-23_-15delGTCGCCGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120469200_120469208del" "" "benign" "" "0000573299" "0" "10" "X" "119603055" "119603063" "dup" "0" "02330" "LAMP2_000146" "g.119603055_119603063dup" "" "" "" "LAMP2(NM_002294.3):c.-23_-15dupGTCGCCGCC" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120469200_120469208dup" "" "benign" "" "0000618943" "0" "10" "X" "119562432" "119562432" "subst" "0.00994123" "02327" "LAMP2_000085" "g.119562432T>C" "" "" "" "LAMP2(NM_001122606.1):c.1143A>G (p.A381=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120428577T>C" "" "benign" "" "0000618944" "0" "30" "X" "119562500" "119562500" "subst" "0" "02327" "LAMP2_000086" "g.119562500C>T" "" "" "" "LAMP2(NM_001122606.1):c.1094-19G>A, LAMP2(NM_002294.3):c.*2678G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120428645C>T" "" "likely benign" "" "0000618945" "0" "30" "X" "119565269" "119565269" "subst" "0.000118981" "02327" "LAMP2_000089" "g.119565269A>G" "" "" "" "LAMP2(NM_001122606.1):c.1094-2788T>C (p.(=)), LAMP2(NM_002294.2):c.1142T>C (p.V381A), LAMP2(NM_002294.3):c.1142T>C (p.V381A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120431414A>G" "" "likely benign" "" "0000618946" "0" "30" "X" "119565295" "119565297" "del" "0" "02327" "LAMP2_000147" "g.119565295_119565297del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120431440_120431442del" "" "likely benign" "" "0000618948" "0" "30" "X" "119575587" "119575587" "subst" "3.92163E-5" "02327" "LAMP2_000092" "g.119575587G>A" "" "" "" "LAMP2(NM_002294.2):c.1091C>T (p.T364I), LAMP2(NM_002294.3):c.1091C>T (p.T364I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120441732G>A" "" "likely benign" "" "0000618949" "0" "30" "X" "119575754" "119575754" "subst" "6.72126E-5" "01943" "LAMP2_000095" "g.119575754A>G" "" "" "" "LAMP2(NM_002294.2):c.929-5T>C, LAMP2(NM_002294.3):c.929-5T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120441899A>G" "" "likely benign" "" "0000618950" "0" "90" "X" "119576454" "119576454" "subst" "0" "02325" "LAMP2_000022" "g.119576454C>T" "" "" "" "LAMP2(NM_002294.2):c.928G>A (p.V310I), LAMP2(NM_002294.3):c.928G>A (p.V310I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442599C>T" "" "pathogenic" "" "0000618951" "0" "30" "X" "119580253" "119580253" "subst" "1.11928E-5" "02327" "LAMP2_000149" "g.119580253A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120446398A>G" "" "likely benign" "" "0000618953" "0" "10" "X" "119581776" "119581776" "subst" "0.00149915" "02327" "LAMP2_000080" "g.119581776C>T" "" "" "" "LAMP2(NM_001122606.1):c.661G>A (p.(Gly221Arg), p.G221R), LAMP2(NM_002294.2):c.661G>A (p.G221R), LAMP2(NM_002294.3):c.661G>A (p.G221R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120447921C>T" "" "benign" "" "0000618955" "0" "10" "X" "119581875" "119581875" "subst" "0" "02330" "LAMP2_000150" "g.119581875G>A" "" "" "" "LAMP2(NM_002294.3):c.562C>T (p.L188=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120448020G>A" "" "benign" "" "0000624400" "0" "30" "X" "119576475" "119576475" "subst" "5.60073E-6" "01943" "LAMP2_000148" "g.119576475T>C" "" "" "" "LAMP2(NM_002294.2):c.907A>G (p.M303V), LAMP2(NM_002294.3):c.907A>G (p.M303V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120442620T>C" "" "likely benign" "" "0000652791" "1" "90" "X" "119576454" "119576454" "subst" "0" "03575" "LAMP2_000022" "g.119576454C>T" "1/2789 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "1 heterozygous, no homozygous; {DB:CLININrs104894858}" "Germline" "" "rs104894858" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000652792" "1" "70" "X" "119590501" "119590501" "subst" "0" "03575" "LAMP2_000151" "g.119590501C>T" "2/2767 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 heterozygous, no homozygous; {DB:CLININrs730880479}" "Germline" "" "rs730880479" "0" "" "" "g.120456646C>T" "" "likely pathogenic" "" "0000653088" "1" "90" "X" "119576505" "119576505" "subst" "0" "03575" "LAMP2_000042" "g.119576505G>A" "3/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "3 heterozygous; {DB:CLININrs727503118}" "Germline" "" "rs727503118" "0" "" "" "g.120442650G>A" "" "pathogenic" "" "0000659063" "0" "50" "X" "119565269" "119565269" "subst" "0.000118981" "02330" "LAMP2_000089" "g.119565269A>G" "" "" "" "LAMP2(NM_001122606.1):c.1094-2788T>C (p.(=)), LAMP2(NM_002294.2):c.1142T>C (p.V381A), LAMP2(NM_002294.3):c.1142T>C (p.V381A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.120431414A>G" "" "VUS" "" "0000670149" "0" "90" "X" "119576505" "119576505" "subst" "0" "03575" "LAMP2_000042" "g.119576505G>A" "2/2795 individuals" "{PMID:Narang 2020:32906206}, {DOI:Narang 2020:10.1002/humu.24102}" "" "" "2 homozygous; {DB:CLININrs727503118}" "Germline" "" "rs727503118" "0" "" "" "g.120442650G>A" "" "pathogenic" "" "0000682053" "0" "30" "X" "119562442" "119562442" "subst" "0" "02327" "LAMP2_000152" "g.119562442A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682054" "0" "10" "X" "119576529" "119576529" "del" "0" "02330" "LAMP2_000130" "g.119576529del" "" "" "" "LAMP2(NM_002294.3):c.865-8delT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000682055" "0" "30" "X" "119589342" "119589342" "subst" "0" "02326" "LAMP2_000153" "g.119589342T>G" "" "" "" "LAMP2(NM_002294.2):c.267A>C (p.A89=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000682056" "0" "50" "X" "119589421" "119589421" "subst" "5.6013E-6" "02326" "LAMP2_000112" "g.119589421G>A" "" "" "" "LAMP2(NM_001122606.1):c.188C>T (p.(Thr63Ile)), LAMP2(NM_002294.2):c.188C>T (p.T63I), LAMP2(NM_002294.3):c.188C>T (p.T63I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000693311" "0" "50" "X" "119590616" "119590616" "subst" "0" "02330" "LAMP2_000142" "g.119590616G>A" "" "" "" "LAMP2(NM_002294.2):c.73C>T (p.R25W), LAMP2(NM_002294.3):c.73C>T (p.R25W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000700032" "0" "90" "X" "119602997" "119602997" "del" "0" "00006" "LAMP2_000168" "g.119602997del" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120469142del" "" "pathogenic" "" "0000700033" "0" "90" "X" "119590566" "119590566" "del" "0" "00006" "LAMP2_000167" "g.119590566del" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120456711del" "" "pathogenic" "" "0000700034" "0" "90" "X" "119589389" "119589390" "del" "0" "00006" "LAMP2_000165" "g.119589389_119589390del" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120455534_120455535del" "" "pathogenic" "" "0000700035" "0" "90" "X" "119589340" "119589344" "del" "0" "00006" "LAMP2_000164" "g.119589340_119589344del" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120455485_120455489del" "" "pathogenic" "" "0000700036" "0" "50" "X" "119582864" "119582864" "subst" "2.8006E-5" "00006" "LAMP2_000161" "g.119582864C>T" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120449009C>T" "" "VUS" "" "0000700037" "0" "90" "X" "119580229" "119580229" "subst" "0" "00006" "LAMP2_000160" "g.119580229G>T" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120446374G>T" "" "pathogenic" "" "0000700038" "0" "90" "X" "119576505" "119576505" "subst" "0" "00006" "LAMP2_000042" "g.119576505G>A" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120442650G>A" "" "pathogenic" "" "0000700039" "0" "90" "X" "119575751" "119575751" "subst" "0" "00006" "LAMP2_000156" "g.119575751T>C" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120441896T>C" "" "pathogenic" "" "0000700040" "0" "90" "X" "119575710" "119575710" "del" "0" "00006" "LAMP2_000155" "g.119575710del" "2/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120441855del" "" "pathogenic" "" "0000700041" "0" "70" "X" "119575620" "119575620" "subst" "0" "00006" "LAMP2_000154" "g.119575620T>G" "1/839 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120441765T>G" "" "likely pathogenic" "" "0000700892" "0" "50" "X" "119602969" "119602969" "subst" "0" "00006" "LAMP2_000076" "g.119602969A>C" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour pathogenic" "Germline" "" "" "0" "" "" "g.120469114A>C" "" "VUS" "" "0000700893" "0" "90" "X" "119590561" "119590562" "dup" "0" "00006" "LAMP2_000166" "g.119590561_119590562dup" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "128_129dupAT" "" "Germline" "" "" "0" "" "" "g.120456706_120456707dup" "" "pathogenic" "" "0000700894" "0" "70" "X" "119590505" "119590505" "subst" "0" "00006" "LAMP2_000036" "g.119590505C>T" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120456650C>T" "" "likely pathogenic" "" "0000700895" "0" "50" "X" "119589238" "119589238" "subst" "0" "00006" "LAMP2_000163" "g.119589238G>A" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour benign" "Germline" "" "" "0" "" "" "g.120455383G>A" "" "VUS" "" "0000700896" "0" "50" "X" "119582864" "119582864" "subst" "2.8006E-5" "00006" "LAMP2_000161" "g.119582864C>T" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "VUS favour benign" "Germline" "" "" "0" "" "" "g.120449009C>T" "" "VUS" "" "0000700897" "0" "50" "X" "119580200" "119580200" "subst" "1.11912E-5" "00006" "LAMP2_000159" "g.119580200T>C" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120446345T>C" "" "VUS" "" "0000700898" "0" "90" "X" "119580159" "119580159" "subst" "0" "00006" "LAMP2_000157" "g.119580159C>A" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120446304C>A" "" "pathogenic" "" "0000700899" "0" "90" "X" "119576454" "119576454" "subst" "0" "00006" "LAMP2_000022" "g.119576454C>T" "2/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120442599C>T" "" "pathogenic" "" "0000700900" "0" "70" "X" "119575750" "119575750" "subst" "0" "00006" "LAMP2_000023" "g.119575750C>T" "1/2451 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120441895C>T" "" "likely pathogenic" "" "0000701537" "0" "50" "X" "119582909" "119582909" "subst" "3.36421E-5" "00006" "LAMP2_000162" "g.119582909T>C" "1/223 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120449054T>C" "" "VUS" "" "0000701538" "0" "50" "X" "119580182" "119580182" "subst" "0" "00006" "LAMP2_000158" "g.119580182T>C" "1/223 cases" "{PMID:Walsh 2017:27532257}" "" "" "" "Germline" "" "" "0" "" "" "g.120446327T>C" "" "VUS" "" "0000728372" "0" "50" "X" "119565200" "119565200" "subst" "5.66178E-6" "02330" "LAMP2_000087" "g.119565200T>A" "" "" "" "LAMP2(NM_002294.2):c.1211A>T (p.(His404Leu)), LAMP2(NM_002294.3):c.1211A>T (p.H404L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000728373" "0" "30" "X" "119590532" "119590532" "subst" "0.000106681" "02330" "LAMP2_000140" "g.119590532G>A" "" "" "" "LAMP2(NM_002294.2):c.157C>T (p.R53C), LAMP2(NM_002294.3):c.157C>T (p.R53C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000790007" "1" "90" "X" "119590550" "119590550" "subst" "0" "00006" "LAMP2_000169" "g.119590550G>A" "" "{PMID:Nguyen 2021:34011823}" "" "" "ACMG PVS1 PM1 PM2 PP3; no genotypes reported" "Germline" "" "" "0" "" "" "g.120456695G>A" "" "pathogenic" "" "0000790018" "1" "70" "X" "119602975" "119602992" "del" "0" "00006" "LAMP2_000170" "g.119602975_119602992del" "" "{PMID:Nguyen 2021:34011823}" "" "" "ACMG PVS1 PM2; no genotypes reported" "Germline" "" "" "0" "" "" "g.120469120_120469137del" "" "likely pathogenic" "" "0000809826" "0" "30" "X" "119581848" "119581848" "subst" "5.59425E-6" "01943" "LAMP2_000171" "g.119581848C>G" "" "" "" "LAMP2(NM_002294.2):c.589G>C (p.V197L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809827" "0" "50" "X" "119582932" "119582932" "subst" "5.61687E-6" "02330" "LAMP2_000172" "g.119582932A>T" "" "" "" "LAMP2(NM_002294.3):c.449T>A (p.L150H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809828" "0" "50" "X" "119589251" "119589251" "subst" "0" "01943" "LAMP2_000139" "g.119589251T>C" "" "" "" "LAMP2(NM_002294.2):c.358A>G (p.T120A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000809829" "0" "10" "X" "119589396" "119589396" "subst" "5.59632E-6" "02330" "LAMP2_000173" "g.119589396A>G" "" "" "" "LAMP2(NM_002294.3):c.213T>C (p.T71=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000809830" "0" "30" "X" "119602976" "119602976" "subst" "1.12568E-5" "02326" "LAMP2_000174" "g.119602976C>T" "" "" "" "LAMP2(NM_002294.2):c.49G>A (p.V17I)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000809831" "0" "10" "X" "119603028" "119603028" "subst" "0.000213762" "02330" "LAMP2_000145" "g.119603028C>G" "" "" "" "LAMP2(NM_002294.3):c.-4G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000856308" "0" "30" "X" "119562423" "119562423" "subst" "6.2588E-6" "02327" "LAMP2_000084" "g.119562423C>G" "" "" "" "LAMP2(NM_001122606.1):c.1152G>C (p.V384=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856309" "0" "30" "X" "119581685" "119581685" "subst" "0.00102447" "02326" "LAMP2_000101" "g.119581685G>A" "" "" "" "LAMP2(NM_002294.2):c.741+11C>T, LAMP2(NM_002294.3):c.741+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000856311" "0" "50" "X" "119590523" "119590523" "subst" "0" "02327" "LAMP2_000175" "g.119590523T>C" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000856312" "0" "30" "X" "119602983" "119602983" "subst" "2.81346E-5" "02327" "LAMP2_000119" "g.119602983G>A" "" "" "" "LAMP2(NM_002294.2):c.42C>T (p.L14=), LAMP2(NM_002294.3):c.42C>T (p.L14=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000874698" "20" "70" "X" "119581768" "119581768" "subst" "0" "00000" "LAMP2_000176" "g.119581768A>C" "frequency in 1500 in-house samples: 0" "{PMID:Alfares 2018:30202406}" "" "LAMP2, NM_001122606.1, c.669T>G, p.Tyr223*" "hemizygous" "Unknown" "?" "" "0" "" "" "g.120447913A>C" "" "likely pathogenic" "ACMG" "0000895898" "0" "30" "X" "119580297" "119580299" "del" "0" "02326" "LAMP2_000100" "g.119580297_119580299del" "" "" "" "LAMP2(NM_002294.2):c.742-10_742-8delTCT, LAMP2(NM_002294.3):c.742-10_742-8delTCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895899" "0" "30" "X" "119582864" "119582864" "subst" "2.8006E-5" "02327" "LAMP2_000161" "g.119582864C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895900" "0" "50" "X" "119589237" "119589239" "del" "0" "02326" "LAMP2_000177" "g.119589237_119589239del" "" "" "" "LAMP2(NM_002294.2):c.373_375delACA (p.T125del)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895901" "0" "50" "X" "119590497" "119590497" "subst" "7.00948E-6" "02330" "LAMP2_000178" "g.119590497T>C" "" "" "" "LAMP2(NM_002294.3):c.183+9A>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000895902" "0" "30" "X" "119590532" "119590532" "subst" "0.000106681" "02327" "LAMP2_000140" "g.119590532G>A" "" "" "" "LAMP2(NM_002294.2):c.157C>T (p.R53C), LAMP2(NM_002294.3):c.157C>T (p.R53C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000895903" "0" "10" "X" "119590646" "119590648" "del" "0" "02330" "LAMP2_000179" "g.119590646_119590648del" "" "" "" "LAMP2(NM_002294.3):c.65-20_65-18delATT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000908879" "21" "90" "X" "119576451" "119576451" "subst" "0" "00006" "LAMP2_000180" "g.119576451T>A" "" "{PMID:Bournazos 2022:34906502}" "" "" "mother germline mosaicism" "De novo" "" "" "0" "" "" "g.120442596T>A" "" "pathogenic (dominant)" "" "0000915592" "0" "30" "X" "119581846" "119581846" "subst" "0.00025173" "02326" "LAMP2_000103" "g.119581846C>T" "" "" "" "LAMP2(NM_002294.2):c.591G>A (p.V197=), LAMP2(NM_002294.3):c.591G>A (p.V197=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915593" "0" "30" "X" "119582877" "119582877" "subst" "0.000117609" "02326" "LAMP2_000104" "g.119582877G>A" "" "" "" "LAMP2(NM_002294.2):c.504C>T (p.Y168=), LAMP2(NM_002294.3):c.504C>T (p.Y168=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000915594" "0" "90" "X" "119589405" "119589405" "del" "0" "02326" "LAMP2_000181" "g.119589405del" "" "" "" "LAMP2(NM_002294.2):c.205delC (p.H69Mfs*4)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000927248" "0" "30" "X" "119590604" "119590604" "subst" "2.92524E-5" "02326" "LAMP2_000116" "g.119590604A>G" "" "" "" "LAMP2(NM_002294.2):c.85T>C (p.L29=), LAMP2(NM_002294.3):c.85T>C (p.L29=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000927670" "0" "70" "X" "119580242" "119580242" "del" "0" "03779" "LAMP2_000182" "g.119580242del" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000931333" "0" "10" "X" "119602950" "119602950" "subst" "0" "02330" "LAMP2_000183" "g.119602950C>G" "" "" "" "LAMP2(NM_002294.3):c.64+11G>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000951670" "0" "50" "X" "119576475" "119576475" "subst" "5.60073E-6" "02330" "LAMP2_000148" "g.119576475T>C" "" "" "" "LAMP2(NM_002294.2):c.907A>G (p.M303V), LAMP2(NM_002294.3):c.907A>G (p.M303V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000955389" "11" "90" "X" "119513013" "119623579" "del" "0" "00006" "LAMP2_000185" "g.(?_119513013)_(119623579_?)del" "" "{PMID:Shalata 2023:37628591}" "" "" "" "Germline" "yes" "" "0" "X-inactivation paternal/maternal expression AR gene 35/65" "hg19 Xq24(119513013_119623579)x0" "g.(?_120379158)_(120489724_?)del" "" "pathogenic (dominant)" "" "0000955391" "0" "90" "X" "119513013" "119623579" "del" "0" "00006" "LAMP2_000185" "g.(?_119513013)_(119623579_?)del" "" "{PMID:Shalata 2023:37628591}" "" "" "" "Germline/De novo (untested)" "" "" "0" "" "hg19 Xq24(119513013_119623579)x0" "g.(?_120379158)_(120489724_?)del" "" "pathogenic" "" "0000959822" "0" "50" "X" "119575296" "119575296" "subst" "0" "03779" "LAMP2_000186" "g.119575296G>A" "" "" "" "" "" "CLASSIFICATION record" "" "" "0" "" "" "" "" "VUS" "" "0000970677" "0" "30" "X" "119565269" "119565269" "subst" "0.000118981" "02325" "LAMP2_000089" "g.119565269A>G" "" "" "" "LAMP2(NM_001122606.1):c.1094-2788T>C (p.(=)), LAMP2(NM_002294.2):c.1142T>C (p.V381A), LAMP2(NM_002294.3):c.1142T>C (p.V381A)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984420" "0" "30" "X" "119580289" "119580291" "del" "0" "02325" "LAMP2_000187" "g.119580289_119580291del" "" "" "" "LAMP2(NM_002294.3):c.742-7_742-5delCCT" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000984421" "0" "10" "X" "119590615" "119590615" "subst" "0.000381125" "02330" "LAMP2_000117" "g.119590615C>T" "" "" "" "LAMP2(NM_002294.3):c.74G>A (p.R25Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000984422" "0" "30" "X" "119603016" "119603016" "subst" "1.12351E-5" "01804" "LAMP2_000120" "g.119603016G>A" "" "" "" "LAMP2(NM_002294.3):c.9C>T (p.C3=, p.(Cys3=))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000989640" "0" "50" "X" "119603015" "119603015" "subst" "0" "02515" "LAMP2_000188" "g.119603015A>G" "" "Fusco 2042, submitted" "" "NM_002294:c.10T>C" "variant definitively linked to disease" "Germline" "" "rs1375151119" "0" "" "" "g.120469160A>G" "" "VUS" "" "0001006388" "0" "10" "X" "119562384" "119562384" "subst" "0.000133554" "02330" "LAMP2_000082" "g.119562384A>G" "" "" "" "LAMP2(NM_001122606.1):c.1191T>C (p.Y397=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001006389" "0" "30" "X" "119589224" "119589224" "subst" "0.000134351" "02326" "LAMP2_000138" "g.119589224C>T" "" "" "" "LAMP2(NM_002294.2):c.385G>A (p.A129T)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001010193" "0" "70" "X" "119576518" "119576518" "subst" "0" "04100" "LAMP2_000041" "g.119576518C>G" "" "" "" "119576518G>C" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.120442663C>G" "" "pathogenic" "ACMG" "0001010208" "0" "90" "X" "119209864" "119582983" "del" "0" "04100" "LAMP2_000190" "g.(?_119209864)_(119582983_?)del" "" "" "" "g.119209864_119582983del" "description varaint correct ??" "De novo" "" "" "0" "" "" "g.(?_120076009)_(120449128_?)del" "" "pathogenic" "ACMG" "0001010210" "20" "90" "X" "119575710" "119575710" "del" "0" "04100" "LAMP2_000155" "g.119575710del" "" "" "" "119575705del" "" "Germline/De novo (untested)" "" "" "0" "" "" "g.120441855del" "" "pathogenic" "ACMG" "0001010211" "0" "90" "X" "119582914" "119582914" "subst" "0" "04100" "LAMP2_000189" "g.119582914A>G" "" "" "" "119582914T>C" "" "De novo" "" "" "0" "" "" "g.120449059A>G" "" "pathogenic" "ACMG" "0001012939" "0" "90" "X" "119576505" "119576505" "subst" "0" "03779" "LAMP2_000042" "g.119576505G>A" "" "" "" "" "" "CLASSIFICATION record" "" "rs727503118" "0" "" "" "" "" "pathogenic" "" "0001058192" "0" "90" "X" "119576518" "119576518" "subst" "0" "03779" "LAMP2_000191" "g.119576518C>T" "" "" "" "" "" "Unknown" "" "" "0" "" "" "" "" "pathogenic" "" "0001067769" "0" "50" "X" "119560627" "119560627" "subst" "0" "02325" "LAMP2_000192" "g.119560627G>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067770" "0" "50" "X" "119565218" "119565218" "subst" "0" "02325" "LAMP2_000193" "g.119565218A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067771" "0" "50" "X" "119571751" "119571751" "subst" "0" "02325" "LAMP2_000194" "g.119571751C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001067772" "0" "30" "X" "119572580" "119572586" "del" "0" "02325" "LAMP2_000195" "g.119572580_119572586del" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0001074281" "0" "70" "X" "119581695" "119581695" "subst" "0" "00006" "LAMP2_000016" "g.119581695C>T" "" "{PMID:Alhammad 2024:39232665}" "" "" "" "Germline" "" "" "0" "" "" "g.120447840C>T" "" "likely pathogenic (recessive)" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes LAMP2 ## Count = 583 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000002135" "00025774" "30" "1093" "4304" "1093" "4304" "c.1093+4304dup" "r.(=)" "p.(=)" "" "0000002135" "00000468" "30" "1093" "4317" "1093" "4317" "c.1093+4317dup" "r.(=)" "p.(=)" "8i" "0000086640" "00025774" "70" "1075" "0" "1075" "0" "c.1075dup" "r.(?)" "p.(Gln359Profs*14)" "" "0000086640" "00000468" "70" "1075" "0" "1075" "0" "c.1075dup" "r.(?)" "p.(Gln359Profs*8)" "8" "0000141557" "00025774" "90" "64" "1" "64" "1" "c.64+1G>A" "r.spl?" "p.?" "" "0000141557" "00000468" "90" "64" "1" "64" "1" "c.64+1G>A" "r.spl" "p.?" "1i" "0000141558" "00025774" "70" "-39" "0" "-31" "0" "c.-39_-31del" "r.(=)" "p.(=)" "" "0000141558" "00000468" "70" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "1" "0000141559" "00000468" "90" "1" "0" "64" "1" "c.(?_1)_(64+1_65-1)del" "r.0?" "p.0?" "_1_1i" "0000141560" "00025774" "90" "183" "1" "183" "1" "c.183+1G>A" "r.spl?" "p.?" "" "0000141560" "00000468" "90" "183" "1" "183" "1" "c.183+1G>A" "r.spl" "p.?" "2i" "0000141561" "00025774" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Gln83*)" "" "0000141561" "00000468" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Gln83*)" "3" "0000141562" "00025774" "90" "507" "0" "507" "0" "c.507G>A" "r.(?)" "p.(Trp169*)" "" "0000141562" "00000468" "90" "507" "0" "507" "0" "c.507G>A" "r.(?)" "p.(Trp169*)" "4" "0000141563" "00025774" "90" "865" "-1" "865" "-1" "c.865-1G>C" "r.spl?" "p.?" "" "0000141563" "00000468" "90" "865" "-1" "865" "-1" "c.865-1G>C" "r.spl" "p.?" "6i" "0000141564" "00025774" "90" "1093" "2480" "1093" "2483" "c.1093+2480_1093+2483delinsGCTGGTCCCAAT" "r.(=)" "p.(=)" "" "0000141564" "00000468" "90" "1093" "2480" "1093" "2483" "c.1093+2480_1093+2483delinsGCTGGTCCCAAT" "r.(=)" "p.(=)" "9b" "0000141565" "00025774" "90" "256" "0" "257" "0" "c.256_257del" "r.(?)" "p.(Pro86Glnfs*26)" "" "0000141565" "00000468" "90" "257" "0" "258" "0" "c.257_258del" "r.(?)" "p.(Pro86Glnfs*26)" "3" "0000141566" "00025774" "90" "317" "0" "320" "0" "c.317_320dup" "r.(?)" "p.(Thr108Ilefs*6)" "" "0000141566" "00000468" "90" "317" "0" "320" "0" "c.317_320dup" "r.(?)" "p.(Thr108Ilefs*6)" "3" "0000141567" "00025774" "90" "808" "0" "808" "0" "c.808dup" "r.(?)" "p.(Ala270Glyfs*4)" "" "0000141567" "00000468" "90" "808" "0" "808" "0" "c.808dup" "r.(?)" "p.(Ala270Glyfs*4)" "6" "0000141568" "00025774" "90" "137" "0" "137" "0" "c.137G>A" "r.(?)" "p.(Trp46*)" "" "0000141568" "00000468" "90" "137" "0" "137" "0" "c.137G>A" "r.(?)" "p.(Trp46*)" "2" "0000141569" "00025774" "90" "189" "0" "190" "0" "c.189_190del" "r.(?)" "p.(Val64Asnfs*11)" "" "0000141569" "00000468" "90" "190" "0" "191" "0" "c.190_191del" "r.(?)" "p.(Val64Asnfs*11)" "3" "0000141570" "00025774" "90" "238" "0" "238" "0" "c.238del" "r.(?)" "p.(Asp81Metfs*8)" "" "0000141570" "00000468" "90" "241" "0" "241" "0" "c.241del" "r.(?)" "p.(Asp81Metfs*8)" "3" "0000141571" "00025774" "90" "179" "0" "179" "0" "c.179del" "r.(?)" "p.(Thr60Ilefs*5)" "" "0000141571" "00000468" "90" "179" "0" "179" "0" "c.179del" "r.(?)" "p.(Thr60Ilefs*5)" "2" "0000141572" "00025774" "90" "286" "0" "287" "0" "c.286_287del" "r.(?)" "p.(Ser97Leufs*15)" "" "0000141572" "00000468" "90" "288" "0" "289" "0" "c.288_289del" "r.(?)" "p.(Ser97Leufs*15)" "3" "0000141573" "00025774" "90" "293" "0" "293" "0" "c.293G>A" "r.(?)" "p.(Trp98*)" "" "0000141573" "00000468" "90" "293" "0" "293" "0" "c.293G>A" "r.(?)" "p.(Trp98*)" "3" "0000141574" "00025774" "90" "-24880" "0" "65" "-3489" "c.-24880_65-3489del" "r.(=)" "p.(=)" "" "0000141574" "00000468" "90" "-24864" "0" "65" "-3473" "c.-24864_65-3473del" "r.0?" "p.0?" "_1_1i" "0000141575" "00000468" "90" "398" "-1" "1237" "0" "c.(397+1_398-1)_(*1_?)del" "r.?" "p.0" "3i_9_" "0000141576" "00025774" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000141576" "00000468" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "7" "0000141577" "00025774" "90" "64" "1" "64" "1" "c.64+1G>A" "r.spl?" "p.?" "" "0000141577" "00000468" "90" "64" "1" "64" "1" "c.64+1G>A" "r.spl" "p.?" "1i" "0000141578" "00025774" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Gln83*)" "" "0000141578" "00000468" "90" "247" "0" "247" "0" "c.247C>T" "r.(?)" "p.(Gln83*)" "3" "0000141579" "00025774" "90" "294" "0" "294" "0" "c.294G>A" "r.(?)" "p.(Trp98*)" "" "0000141579" "00000468" "90" "294" "0" "294" "0" "c.294G>A" "r.(?)" "p.(Trp98*)" "3" "0000141580" "00025774" "90" "294" "0" "294" "0" "c.294G>A" "r.(?)" "p.(Trp98*)" "" "0000141580" "00000468" "90" "294" "0" "294" "0" "c.294G>A" "r.(?)" "p.(Trp98*)" "3" "0000141581" "00000468" "90" "398" "-1" "1237" "0" "c.(397+1_398-1)_(*1_?)del" "r.?" "p.?" "3i_9_" "0000141582" "00025774" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000141582" "00000468" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "7" "0000141583" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000141583" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.spl" "p.(Val310Ile)" "7" "0000141584" "00025774" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Lys361Serfs*19)" "" "0000141584" "00000468" "90" "1082" "0" "1082" "0" "c.1082del" "r.(?)" "p.(Lys361Serfs*30)" "8" "0000141585" "00025774" "90" "1080" "0" "1080" "0" "c.1080del" "r.(?)" "p.(Lys361Serfs*19)" "" "0000141585" "00000468" "90" "1082" "0" "1082" "0" "c.1082del" "r.(?)" "p.(Lys361Serfs*30)" "8" "0000141623" "00025774" "10" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000141623" "00000468" "10" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(Val52=)" "2" "0000141624" "00000468" "90" "398" "-1" "1237" "0" "c.(397+1_398-1)_(*1_?)del" "r.?" "p.?" "3i_9_" "0000141625" "00025774" "90" "795" "0" "795" "0" "c.795dup" "r.(?)" "p.(Arg266Profs*8)" "" "0000141625" "00000468" "90" "796" "0" "796" "0" "c.796dup" "r.796dup" "p.Arg266Profs*8" "6" "0000141626" "00025774" "90" "680" "0" "701" "0" "c.680_701del" "r.(?)" "p.(Asn227Argfs*8)" "" "0000141626" "00000468" "90" "680" "0" "701" "0" "c.680_701del" "r.680_701del" "p.Asn227Argfs*8" "5" "0000141627" "00025774" "90" "294" "0" "294" "0" "c.294G>A" "r.(?)" "p.(Trp98*)" "" "0000141627" "00000468" "90" "294" "0" "294" "0" "c.294G>A" "r.294g>a" "p.Trp98*" "3" "0000141628" "00025774" "90" "397" "1801" "741" "688" "c.397+1801_741+688dup" "r.?" "p.?" "" "0000141628" "00000468" "90" "397" "1822" "742" "-705" "c.397+1822_742-705dup" "r.[=, 398_741dup, 398_741dup;1093_1094ins1093+2437_1093+2614, 1093_1094ins1093+2437_1093+2654]" "p.?" "3i_5i" "0000141629" "00025774" "90" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359*)" "" "0000141629" "00000468" "90" "1075" "0" "1075" "0" "c.1075C>T" "r.(?)" "p.(Gln359*)" "8" "0000141630" "00025774" "90" "467" "0" "467" "0" "c.467T>G" "r.(?)" "p.(Leu156*)" "" "0000141630" "00000468" "90" "467" "0" "467" "0" "c.467T>G" "r.(?)" "p.(Leu156*)" "4" "0000141631" "00025774" "90" "470" "0" "470" "0" "c.470C>R" "" "" "" "0000141631" "00000468" "90" "470" "0" "470" "0" "c.470C>R" "r.(?)" "p.(Ser157*)" "4" "0000141632" "00025774" "90" "716" "0" "716" "0" "c.716del" "r.(?)" "p.(Leu239Argfs*3)" "" "0000141632" "00000468" "90" "716" "0" "716" "0" "c.716del" "r.(?)" "p.(Leu239Argfs*3)" "5" "0000141633" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000141633" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.865_928del" "p.Lys289Phefs*36" "7" "0000141635" "00025774" "90" "864" "0" "864" "0" "c.864del" "r.spl?" "p.?" "" "0000141635" "00000468" "90" "864" "1" "864" "1" "c.864+1del" "r.spl" "p.?" "6i" "0000141636" "00025774" "90" "864" "1" "864" "4" "c.864+1_864+4del" "r.spl?" "p.?" "" "0000141636" "00000468" "90" "864" "3" "864" "6" "c.864+3_864+6del" "r.spl?" "p.?" "6i" "0000141637" "00025774" "90" "865" "-3" "865" "-3" "c.865-3C>A" "r.spl?" "p.?" "" "0000141637" "00000468" "90" "865" "-3" "865" "-3" "c.865-3C>A" "r.865_928del" "p.0" "6i" "0000141638" "00025774" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000141638" "00000468" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "7" "0000141639" "00025774" "90" "880" "0" "880" "0" "c.880dup" "r.(?)" "p.(Tyr295Leufs*13)" "" "0000141639" "00000468" "90" "883" "0" "883" "0" "c.883dup" "r.(?)" "p.(Tyr295Leufs*13)" "7" "0000141640" "00025774" "90" "892" "0" "892" "0" "c.892G>T" "r.(?)" "p.(Glu298*)" "" "0000141640" "00000468" "90" "892" "0" "892" "0" "c.892G>T" "r.(?)" "p.(Glu298*)" "7" "0000141641" "00025774" "90" "1093" "2547" "1093" "2547" "c.1093+2547A>T" "r.(=)" "p.(=)" "" "0000141641" "00000468" "90" "1093" "2547" "1093" "2547" "c.1093+2547A>T" "r.(=)" "p.(=)" "9b" "0000147005" "00025774" "90" "1075" "0" "1075" "0" "c.1075dup" "r.(?)" "p.(Gln359Profs*14)" "" "0000147005" "00000468" "90" "1075" "0" "1075" "0" "c.1075dup" "r.(?)" "p.(Gln359Profs*8)" "8" "0000147006" "00025774" "90" "1093" "2" "1093" "2" "c.1093+2T>A" "r.spl?" "p.?" "" "0000147006" "00000468" "00" "1093" "2" "1093" "2" "c.1093+2T>A" "r.spl?" "p.?" "" "0000147007" "00025774" "90" "1093" "2493" "1093" "2493" "c.1093+2493G>C" "r.(=)" "p.(=)" "" "0000147007" "00000468" "00" "1093" "2493" "1093" "2493" "c.1093+2493G>C" "r.(=)" "p.(=)" "" "0000147008" "00025774" "90" "184" "-1" "189" "0" "c.184-1_189del" "r.?" "p.?" "" "0000147008" "00000468" "00" "184" "0" "190" "0" "c.184_190del" "r.(?)" "p.(Lys62*)" "" "0000147009" "00025774" "90" "404" "0" "404" "0" "c.404dup" "r.(?)" "p.(Thr136Tyrfs*3)" "" "0000147009" "00000468" "00" "405" "0" "405" "0" "c.405dup" "r.(?)" "p.(Thr136Tyrfs*3)" "" "0000147010" "00025774" "90" "737" "0" "737" "0" "c.737A>G" "r.(?)" "p.(Asp246Gly)" "" "0000147010" "00000468" "00" "737" "0" "737" "0" "c.737A>G" "r.(?)" "p.(Asp246Gly)" "" "0000147011" "00025774" "90" "1086" "0" "1086" "0" "c.1086T>G" "r.(?)" "p.(Tyr362*)" "" "0000147011" "00000468" "00" "1086" "0" "1086" "0" "c.1086T>G" "r.(?)" "p.(Tyr362*)" "" "0000147012" "00025774" "90" "1093" "2544" "1093" "2544" "c.1093+2544A>G" "r.(=)" "p.(=)" "" "0000147012" "00000468" "00" "1093" "2544" "1093" "2544" "c.1093+2544A>G" "r.(=)" "p.(=)" "" "0000147013" "00025774" "90" "56" "0" "56" "0" "c.56T>G" "r.(?)" "p.(Leu19Arg)" "" "0000147013" "00000468" "00" "56" "0" "56" "0" "c.56T>G" "r.(?)" "p.(Leu19Arg)" "" "0000147014" "00025774" "90" "874" "0" "897" "0" "c.874_897del" "r.(?)" "p.(Arg293_Asn300del)" "" "0000147014" "00000468" "00" "877" "0" "900" "0" "c.877_900del" "r.877_900del" "p.Arg293_Asn300del" "7" "0000147015" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147015" "00000468" "00" "928" "0" "928" "0" "c.928G>A" "r.(spl?)" "p.(Val310Ile)" "" "0000147018" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147018" "00000468" "00" "928" "0" "928" "0" "c.928G>A" "r.865_928del" "p.Lys289Phefs*36" "7" "0000147019" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147019" "00000468" "00" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147020" "00025774" "50" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147020" "00000468" "00" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147021" "00025774" "50" "299" "0" "299" "0" "c.299C>T" "r.(?)" "p.(Ala100Val)" "" "0000147021" "00000468" "00" "299" "0" "299" "0" "c.299C>T" "r.(?)" "p.(Ala100Val)" "" "0000147022" "00025774" "50" "519" "0" "519" "0" "c.519A>G" "r.(=)" "p.(=)" "" "0000147022" "00000468" "00" "519" "0" "519" "0" "c.519A>G" "r.(=)" "p.(=)" "" "0000147023" "00025774" "50" "927" "0" "927" "0" "c.927C>T" "r.(=)" "p.(=)" "" "0000147023" "00000468" "00" "927" "0" "927" "0" "c.927C>T" "r.(=)" "p.(=)" "" "0000147024" "00025774" "10" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147024" "00000468" "00" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147025" "00025774" "90" "576" "0" "583" "0" "c.576_583del" "r.(?)" "p.(Lys193Asnfs*31)" "" "0000147025" "00000468" "00" "579" "0" "586" "0" "c.579_586del" "r.(?)" "p.(Lys193Asnfs*31)" "" "0000147032" "00025774" "90" "102" "0" "103" "0" "c.102_103del" "r.(?)" "p.(Asp35Phefs*20)" "" "0000147032" "00000468" "00" "103" "0" "104" "0" "c.103_104del" "r.(?)" "p.(Asp35Phefs*20)" "" "0000147033" "00025774" "90" "1093" "1" "1093" "1" "c.1093+1G>C" "r.spl?" "p.?" "" "0000147033" "00000468" "00" "1093" "1" "1093" "1" "c.1093+1G>C" "r.[929_1093+2436del, 1079_1093del]" "p.?" "8i" "0000147034" "00025774" "90" "1093" "2440" "1093" "2441" "c.1093+2440_1093+2441del" "r.(=)" "p.(=)" "" "0000147034" "00000468" "00" "1093" "2440" "1093" "2441" "c.1093+2440_1093+2441del" "r.(=)" "p.(=)" "" "0000147035" "00025774" "90" "138" "0" "138" "0" "c.138G>A" "r.(?)" "p.(Trp46*)" "" "0000147035" "00000468" "00" "138" "0" "138" "0" "c.138G>A" "r.(?)" "p.(Trp46*)" "2" "0000147036" "00025774" "90" "14" "0" "14" "0" "c.14del" "r.(?)" "p.(Arg5Profs*15)" "" "0000147036" "00000468" "00" "14" "0" "14" "0" "c.14del" "r.(?)" "p.(Arg5Profs*15)" "" "0000147037" "00025774" "10" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147037" "00000468" "00" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147038" "00025774" "30" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147038" "00000468" "00" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147039" "00025774" "90" "327" "0" "327" "0" "c.327T>A" "r.(?)" "p.(Tyr109*)" "" "0000147039" "00000468" "90" "327" "0" "327" "0" "c.327T>A" "r.(?)" "p.(Tyr109*)" "3" "0000147040" "00025774" "90" "30" "0" "36" "0" "c.30_36del" "r.(?)" "p.(Gly13Phefs*5)" "" "0000147040" "00000468" "00" "36" "0" "42" "0" "c.36_42del" "r.(?)" "p.(Gly13Phefs*5)" "" "0000147041" "00025774" "90" "440" "0" "440" "0" "c.440T>A" "r.(?)" "p.(Leu147*)" "" "0000147041" "00000468" "00" "440" "0" "440" "0" "c.440T>A" "r.(?)" "p.(Leu147*)" "" "0000147042" "00025774" "90" "470" "0" "470" "0" "c.470C>G" "r.(?)" "p.(Ser157*)" "" "0000147042" "00000468" "00" "470" "0" "470" "0" "c.470C>G" "r.(?)" "p.(Ser157*)" "" "0000147043" "00025774" "90" "520" "0" "520" "0" "c.520C>T" "r.(?)" "p.(Gln174*)" "" "0000147043" "00000468" "00" "520" "0" "520" "0" "c.520C>T" "r.(?)" "p.(Gln174*)" "" "0000147044" "00025774" "90" "571" "0" "571" "0" "c.571del" "r.(?)" "p.(Asp192Thrfs*50)" "" "0000147044" "00000468" "00" "573" "0" "573" "0" "c.573del" "r.(?)" "p.(Asp192Thrfs*50)" "" "0000147045" "00025774" "90" "64" "1" "64" "1" "c.64+1G>T" "r.spl?" "p.?" "" "0000147045" "00000468" "90" "64" "1" "64" "1" "c.64+1G>T" "r.4_64del" "p.Val2Glufs*12" "1i" "0000147046" "00025774" "90" "65" "-2" "65" "-2" "c.65-2A>G" "r.spl?" "p.?" "" "0000147046" "00000468" "90" "65" "-2" "65" "-2" "c.65-2A>G" "r.65_183del" "p.Gly22Glufs*14" "1i" "0000147047" "00025774" "90" "716" "0" "716" "0" "c.716del" "r.(?)" "p.(Leu239Argfs*3)" "" "0000147047" "00000468" "00" "716" "0" "716" "0" "c.716del" "r.(?)" "p.(Leu239Argfs*3)" "" "0000147048" "00025774" "90" "741" "1" "741" "1" "c.741+1G>A" "r.spl?" "p.?" "" "0000147048" "00000468" "00" "741" "1" "741" "1" "c.741+1G>A" "r.spl?" "p.?" "" "0000147049" "00025774" "90" "742" "-6" "745" "0" "c.742-6_745del" "r.spl?" "p.?" "" "0000147049" "00000468" "00" "742" "-4" "747" "0" "c.742-4_747del" "r.spl?" "p.?" "" "0000147050" "00025774" "90" "864" "1" "864" "4" "c.864+1_864+4del" "r.spl?" "p.?" "" "0000147050" "00000468" "90" "864" "3" "864" "6" "c.864+3_864+6del" "r.742_864del" "p.Val248_Val288del" "6i" "0000147051" "00025774" "90" "864" "5" "864" "5" "c.864+5G>C" "r.spl?" "p.?" "" "0000147051" "00000468" "00" "864" "5" "864" "5" "c.864+5G>C" "r.spl?" "p.?" "" "0000147052" "00025774" "90" "865" "-2" "865" "-2" "c.865-2A>G" "r.spl?" "p.?" "" "0000147052" "00000468" "90" "865" "-2" "865" "-2" "c.865-2A>G" "r.0" "p.0" "6i" "0000147054" "00025774" "30" "927" "0" "927" "0" "c.927C>T" "r.(=)" "p.(=)" "" "0000147054" "00000468" "00" "927" "0" "927" "0" "c.927C>T" "r.(=)" "p.(=)" "" "0000147055" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147055" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.spl" "p.(Val310Ile)" "7" "0000147056" "00025774" "70" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147056" "00000468" "00" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147057" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147057" "00000468" "00" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000147058" "00025774" "70" "929" "-1" "929" "-1" "c.929-1G>A" "r.spl?" "p.?" "" "0000147058" "00000468" "00" "929" "-1" "929" "-1" "c.929-1G>A" "r.spl?" "p.?" "" "0000147059" "00025774" "90" "961" "0" "961" "0" "c.961T>C" "r.(?)" "p.(Trp321Arg)" "" "0000147059" "00000468" "00" "961" "0" "961" "0" "c.961T>C" "r.(?)" "p.(Trp321Arg)" "" "0000147060" "00025774" "90" "974" "0" "974" "0" "c.974delinsAA" "r.(?)" "p.(Leu325Glnfs*25)" "" "0000147060" "00000468" "00" "974" "0" "974" "0" "c.974delinsAA" "r.(?)" "p.(Leu325Glnfs*25)" "" "0000147061" "00025774" "30" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147061" "00000468" "00" "156" "0" "156" "0" "c.156A>T" "r.(=)" "p.(=)" "" "0000147062" "00025774" "50" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000147062" "00000468" "00" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000147063" "00025774" "77" "65" "-2" "65" "-2" "c.65-2A>G" "r.spl?" "p.?" "" "0000147063" "00000468" "00" "65" "-2" "65" "-2" "c.65-2A>G" "r.spl?" "p.?" "" "0000147064" "00025774" "90" "1094" "-4946" "1094" "-4946" "c.1094-4946A>G" "r.(=)" "p.(=)" "" "0000147064" "00000468" "00" "1093" "5322" "1093" "5322" "c.1093+5322A>G" "r.(=)" "p.(=)" "" "0000147077" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.spl" "p.(Val310Ile)" "7" "0000175168" "00025774" "90" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000175168" "00000468" "00" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000175187" "00025774" "90" "741" "1" "741" "1" "c.741+1G>T" "r.spl?" "p.?" "" "0000175187" "00000468" "00" "741" "1" "741" "1" "c.741+1G>T" "r.spl" "p.?" "" "0000175194" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000175194" "00000468" "00" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000175211" "00025774" "70" "239" "0" "239" "0" "c.239G>T" "r.(?)" "p.(Gly80Val)" "" "0000175211" "00000468" "00" "239" "0" "239" "0" "c.239G>T" "r.(?)" "p.(Gly80Val)" "" "0000247722" "00025774" "10" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000247722" "00000468" "10" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000247731" "00025774" "10" "85" "0" "85" "0" "c.85T>C" "r.(?)" "p.(Leu29=)" "" "0000247731" "00000468" "10" "85" "0" "85" "0" "c.85T>C" "r.(?)" "p.(Leu29=)" "" "0000247744" "00025774" "10" "929" "-5" "929" "-5" "c.929-5T>C" "r.spl?" "p.?" "" "0000247744" "00000468" "10" "929" "-5" "929" "-5" "c.929-5T>C" "r.spl?" "p.?" "" "0000247799" "00025774" "30" "65" "-13" "65" "-13" "c.65-13T>A" "r.(=)" "p.(=)" "" "0000247799" "00000468" "30" "65" "-13" "65" "-13" "c.65-13T>A" "r.(=)" "p.(=)" "" "0000247884" "00025774" "30" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000247884" "00000468" "30" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000249622" "00025774" "90" "807" "0" "807" "0" "c.807del" "r.(?)" "p.(Ala270LeufsTer13)" "" "0000249622" "00000468" "90" "807" "0" "807" "0" "c.807del" "r.(?)" "p.(Ala270LeufsTer13)" "" "0000249824" "00025774" "50" "269" "0" "269" "0" "c.269T>A" "r.(?)" "p.(Val90Glu)" "" "0000249824" "00000468" "50" "269" "0" "269" "0" "c.269T>A" "r.(?)" "p.(Val90Glu)" "" "0000250723" "00025774" "30" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000250723" "00000468" "30" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000252821" "00025774" "50" "398" "-5" "398" "-5" "c.398-5del" "r.spl?" "p.?" "" "0000252821" "00000468" "50" "398" "-5" "398" "-5" "c.398-5del" "r.spl?" "p.?" "" "0000253075" "00025774" "10" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000253075" "00000468" "10" "755" "0" "755" "0" "c.755T>G" "r.(?)" "p.(Ile252Ser)" "" "0000253716" "00025774" "10" "1142" "0" "1142" "0" "c.1142T>C" "r.(?)" "p.(Val381Ala)" "" "0000253716" "00000468" "10" "1094" "-2788" "1094" "-2788" "c.1094-2788T>C" "r.(=)" "p.(=)" "" "0000254405" "00025774" "30" "1191" "0" "1191" "0" "c.1191T>C" "r.(?)" "p.(Phe397=)" "" "0000254405" "00000468" "30" "1094" "-2739" "1094" "-2739" "c.1094-2739T>C" "r.(=)" "p.(=)" "" "0000255169" "00025774" "30" "4027" "0" "4027" "0" "c.*2794T>C" "r.(=)" "p.(=)" "" "0000255169" "00000468" "30" "1191" "0" "1191" "0" "c.1191T>C" "r.(?)" "p.(Tyr397=)" "" "0000255340" "00025774" "30" "398" "-5" "398" "-5" "c.398-5T>C" "r.spl?" "p.?" "" "0000255340" "00000468" "30" "398" "-5" "398" "-5" "c.398-5T>C" "r.spl?" "p.?" "" "0000255659" "00025774" "90" "127" "0" "127" "0" "c.127del" "r.(?)" "p.(Tyr43MetfsTer6)" "" "0000255659" "00000468" "90" "127" "0" "127" "0" "c.127del" "r.(?)" "p.(Tyr43MetfsTer6)" "" "0000278729" "00025774" "10" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "" "0000278729" "00000468" "10" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "" "0000278730" "00025774" "30" "3911" "0" "3911" "0" "c.*2678G>A" "r.(=)" "p.(=)" "" "0000278730" "00000468" "30" "1094" "-19" "1094" "-19" "c.1094-19G>A" "r.(=)" "p.(=)" "" "0000278731" "00025774" "10" "1093" "2416" "1093" "2416" "c.1093+2416C>T" "r.(=)" "p.(=)" "" "0000278731" "00000468" "10" "1093" "2416" "1093" "2416" "c.1093+2416C>T" "r.(=)" "p.(=)" "" "0000278732" "00025774" "10" "1093" "2450" "1093" "2450" "c.1093+2450G>A" "r.(=)" "p.(=)" "" "0000278732" "00000468" "10" "1093" "2450" "1093" "2450" "c.1093+2450G>A" "r.(=)" "p.(=)" "" "0000278733" "00025774" "10" "3979" "0" "3979" "0" "c.*2746A>G" "r.(=)" "p.(=)" "" "0000278733" "00000468" "10" "1143" "0" "1143" "0" "c.1143A>G" "r.(?)" "p.(Ala381=)" "" "0000278734" "00025774" "30" "115" "0" "118" "0" "c.115_118del" "r.(?)" "p.(Ala39LeufsTer9)" "" "0000278734" "00000468" "30" "115" "0" "118" "0" "c.115_118del" "r.(?)" "p.(Ala39LeufsTer9)" "" "0000278735" "00025774" "10" "156" "0" "156" "0" "c.156A>T" "r.(?)" "p.(Val52=)" "" "0000278735" "00000468" "10" "156" "0" "156" "0" "c.156A>T" "r.(?)" "p.(Val52=)" "" "0000278736" "00025774" "10" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000278736" "00000468" "10" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000278737" "00025774" "10" "372" "0" "372" "0" "c.372A>G" "r.(?)" "p.(Thr124=)" "" "0000278737" "00000468" "10" "372" "0" "372" "0" "c.372A>G" "r.(?)" "p.(Thr124=)" "" "0000278738" "00025774" "10" "397" "16" "397" "16" "c.397+16del" "r.(=)" "p.(=)" "" "0000278738" "00000468" "10" "397" "16" "397" "16" "c.397+16del" "r.(=)" "p.(=)" "" "0000278739" "00025774" "10" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Leu14=)" "" "0000278739" "00000468" "10" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Leu14=)" "" "0000278740" "00025774" "10" "504" "0" "504" "0" "c.504C>T" "r.(?)" "p.(Tyr168=)" "" "0000278740" "00000468" "10" "504" "0" "504" "0" "c.504C>T" "r.(?)" "p.(Tyr168=)" "" "0000278741" "00025774" "10" "591" "0" "591" "0" "c.591G>A" "r.(?)" "p.(Val197=)" "" "0000278741" "00000468" "10" "591" "0" "591" "0" "c.591G>A" "r.(?)" "p.(Val197=)" "" "0000278742" "00025774" "10" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000278742" "00000468" "10" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000278743" "00025774" "30" "714" "0" "714" "0" "c.714G>T" "r.(?)" "p.(Gly238=)" "" "0000278743" "00000468" "30" "714" "0" "714" "0" "c.714G>T" "r.(?)" "p.(Gly238=)" "" "0000278744" "00025774" "10" "741" "11" "741" "11" "c.741+11C>T" "r.(=)" "p.(=)" "" "0000278744" "00000468" "10" "741" "11" "741" "11" "c.741+11C>T" "r.(=)" "p.(=)" "" "0000278745" "00025774" "10" "742" "-10" "742" "-8" "c.742-10_742-8del" "r.(=)" "p.(=)" "" "0000278745" "00000468" "10" "742" "-10" "742" "-8" "c.742-10_742-8del" "r.(=)" "p.(=)" "" "0000278746" "00025774" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000278746" "00000468" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000278748" "00025774" "30" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000278748" "00000468" "30" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000282104" "00025774" "10" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "" "0000282104" "00000468" "10" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "" "0000282105" "00025774" "50" "1067" "0" "1067" "0" "c.1067A>G" "r.(?)" "p.(Asn356Ser)" "" "0000282105" "00000468" "50" "1067" "0" "1067" "0" "c.1067A>G" "r.(?)" "p.(Asn356Ser)" "" "0000282106" "00025774" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000282106" "00000468" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000282107" "00025774" "30" "209" "0" "209" "0" "c.209G>T" "r.(?)" "p.(Gly70Val)" "" "0000282107" "00000468" "30" "209" "0" "209" "0" "c.209G>T" "r.(?)" "p.(Gly70Val)" "" "0000282108" "00025774" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000282108" "00000468" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000282109" "00025774" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000282109" "00000468" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000282110" "00025774" "30" "74" "0" "74" "0" "c.74G>A" "r.(?)" "p.(Arg25Gln)" "" "0000282110" "00000468" "30" "74" "0" "74" "0" "c.74G>A" "r.(?)" "p.(Arg25Gln)" "" "0000282111" "00025774" "30" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000282111" "00000468" "30" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000282112" "00025774" "90" "966" "0" "966" "0" "c.966dup" "r.(?)" "p.(Ala323CysfsTer27)" "" "0000282112" "00000468" "90" "966" "0" "966" "0" "c.966dup" "r.(?)" "p.(Ala323CysfsTer27)" "" "0000285908" "00025774" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000285908" "00000468" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000285909" "00025774" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000285909" "00000468" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000285910" "00025774" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000285910" "00000468" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000285911" "00025774" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000285911" "00000468" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000285912" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000285912" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000285913" "00025774" "70" "929" "-1" "929" "-1" "c.929-1G>A" "r.spl?" "p.?" "" "0000285913" "00000468" "70" "929" "-1" "929" "-1" "c.929-1G>A" "r.spl?" "p.?" "" "0000290845" "00025774" "30" "3911" "0" "3911" "0" "c.*2678G>A" "r.(=)" "p.(=)" "" "0000290845" "00000468" "30" "1094" "-19" "1094" "-19" "c.1094-19G>A" "r.(=)" "p.(=)" "" "0000290846" "00025774" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000290846" "00000468" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000290847" "00025774" "50" "112" "0" "112" "0" "c.112A>T" "r.(?)" "p.(Asn38Tyr)" "" "0000290847" "00000468" "50" "112" "0" "112" "0" "c.112A>T" "r.(?)" "p.(Asn38Tyr)" "" "0000290848" "00025774" "10" "3979" "0" "3979" "0" "c.*2746A>G" "r.(=)" "p.(=)" "" "0000290848" "00000468" "10" "1143" "0" "1143" "0" "c.1143A>G" "r.(?)" "p.(Ala381=)" "" "0000290849" "00025774" "30" "3988" "0" "3988" "0" "c.*2755G>C" "r.(=)" "p.(=)" "" "0000290849" "00000468" "30" "1152" "0" "1152" "0" "c.1152G>C" "r.(?)" "p.(Val384=)" "" "0000290850" "00025774" "10" "156" "0" "156" "0" "c.156A>T" "r.(?)" "p.(Val52=)" "" "0000290850" "00000468" "10" "156" "0" "156" "0" "c.156A>T" "r.(?)" "p.(Val52=)" "" "0000290851" "00025774" "10" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000290851" "00000468" "10" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000290852" "00025774" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000290852" "00000468" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000290853" "00025774" "30" "591" "0" "591" "0" "c.591G>A" "r.(?)" "p.(Val197=)" "" "0000290853" "00000468" "30" "591" "0" "591" "0" "c.591G>A" "r.(?)" "p.(Val197=)" "" "0000290854" "00025774" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000290854" "00000468" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000290855" "00025774" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273Lys)" "" "0000290855" "00000468" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273Lys)" "" "0000335362" "00025774" "50" "1211" "0" "1211" "0" "c.1211A>T" "r.(?)" "p.(His404Leu)" "" "0000335362" "00000468" "50" "1094" "-2719" "1094" "-2719" "c.1094-2719A>T" "r.(=)" "p.(=)" "" "0000335363" "00025774" "50" "1142" "0" "1142" "0" "c.1142T>C" "r.(?)" "p.(Val381Ala)" "" "0000335363" "00000468" "50" "1094" "-2788" "1094" "-2788" "c.1094-2788T>C" "r.(=)" "p.(=)" "" "0000335366" "00025774" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000335366" "00000468" "30" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000335367" "00025774" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000335367" "00000468" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000350858" "00025774" "30" "929" "-5" "929" "-5" "c.929-5T>C" "r.spl?" "p.?" "" "0000350858" "00000468" "30" "929" "-5" "929" "-5" "c.929-5T>C" "r.spl?" "p.?" "" "0000437560" "00000468" "90" "487" "0" "487" "0" "c.487del" "r.(?)" "p.(Asp163fs)" "" "0000443919" "00000468" "90" "815" "0" "815" "0" "c.815T>C" "r.(?)" "p.(Leu272Pro)" "" "0000470483" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "7" "0000487095" "00000468" "10" "661" "0" "661" "0" "c.661G>M" "r.(?)" "p.(Gly221Arg)" "" "0000573251" "00025774" "30" "4004" "0" "4004" "0" "c.*2771A>G" "r.(=)" "p.(=)" "" "0000573251" "00000468" "30" "1168" "0" "1168" "0" "c.1168A>G" "r.(?)" "p.(Ile390Val)" "" "0000573252" "00025774" "30" "4004" "0" "4004" "0" "c.*2771A>G" "r.(=)" "p.(=)" "" "0000573252" "00000468" "30" "1168" "0" "1168" "0" "c.1168A>G" "r.(?)" "p.(Ile390Val)" "" "0000573253" "00025774" "30" "4004" "0" "4004" "0" "c.*2771A>G" "r.(=)" "p.(=)" "" "0000573253" "00000468" "30" "1168" "0" "1168" "0" "c.1168A>G" "r.(?)" "p.(Ile390Val)" "" "0000573255" "00025774" "30" "1094" "-19" "1094" "-19" "c.1094-19G>A" "r.(=)" "p.(=)" "" "0000573255" "00000468" "30" "1094" "-2855" "1094" "-2855" "c.1094-2855G>A" "r.(=)" "p.(=)" "" "0000573256" "00025774" "30" "1093" "4512" "1093" "4512" "c.1093+4512C>T" "r.(=)" "p.(=)" "" "0000573256" "00000468" "30" "1093" "4512" "1093" "4512" "c.1093+4512C>T" "r.(=)" "p.(=)" "" "0000573257" "00025774" "50" "1093" "3456" "1093" "3456" "c.1093+3456C>T" "r.(=)" "p.(=)" "" "0000573257" "00000468" "50" "1093" "3456" "1093" "3456" "c.1093+3456C>T" "r.(=)" "p.(=)" "" "0000573258" "00025774" "10" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573258" "00000468" "10" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573259" "00025774" "10" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573259" "00000468" "10" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573261" "00025774" "30" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573261" "00000468" "30" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573262" "00025774" "30" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573262" "00000468" "30" "1093" "2514" "1093" "2514" "c.1093+2514G>A" "r.(=)" "p.(=)" "" "0000573263" "00025774" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000573263" "00000468" "50" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000573264" "00025774" "70" "1018" "0" "1021" "0" "c.1018_1021del" "r.(?)" "p.(Ser340GlufsTer5)" "" "0000573264" "00000468" "70" "1018" "0" "1021" "0" "c.1018_1021del" "r.(?)" "p.(Ser340GlufsTer5)" "" "0000573265" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000573265" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000573266" "00025774" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000573266" "00000468" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000573267" "00025774" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000573267" "00000468" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000573268" "00025774" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000573268" "00000468" "10" "927" "0" "927" "0" "c.927C>T" "r.(?)" "p.(Ser309=)" "" "0000573269" "00025774" "30" "865" "-8" "865" "-8" "c.865-8del" "r.(=)" "p.(=)" "" "0000573269" "00000468" "30" "865" "-8" "865" "-8" "c.865-8del" "r.(=)" "p.(=)" "" "0000573270" "00025774" "30" "864" "13" "864" "14" "c.864+13_864+14insA" "r.(=)" "p.(=)" "" "0000573270" "00000468" "30" "864" "13" "864" "14" "c.864+13_864+14insA" "r.(=)" "p.(=)" "" "0000573271" "00025774" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273Lys)" "" "0000573271" "00000468" "50" "818" "0" "818" "0" "c.818G>A" "r.(?)" "p.(Arg273Lys)" "" "0000573272" "00025774" "50" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573272" "00000468" "50" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573273" "00025774" "30" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573273" "00000468" "30" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573274" "00025774" "50" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573274" "00000468" "50" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573275" "00025774" "50" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573275" "00000468" "50" "778" "0" "778" "0" "c.778C>T" "r.(?)" "p.(His260Tyr)" "" "0000573276" "00025774" "30" "742" "-16" "742" "-16" "c.742-16T>C" "r.(=)" "p.(=)" "" "0000573276" "00000468" "30" "742" "-16" "742" "-16" "c.742-16T>C" "r.(=)" "p.(=)" "" "0000573277" "00025774" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573277" "00000468" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573278" "00025774" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573278" "00000468" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573280" "00025774" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573280" "00000468" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573281" "00025774" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573281" "00000468" "30" "586" "0" "586" "0" "c.586A>T" "r.(?)" "p.(Thr196Ser)" "" "0000573282" "00025774" "90" "557" "-1" "557" "-1" "c.557-1G>C" "r.spl?" "p.?" "" "0000573282" "00000468" "90" "557" "-1" "557" "-1" "c.557-1G>C" "r.spl?" "p.?" "" "0000573283" "00025774" "30" "453" "0" "453" "0" "c.453T>C" "r.(?)" "p.(Phe151=)" "" "0000573283" "00000468" "30" "453" "0" "453" "0" "c.453T>C" "r.(?)" "p.(Phe151=)" "" "0000573284" "00025774" "50" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Ser)" "" "0000573284" "00000468" "50" "422" "0" "422" "0" "c.422T>C" "r.(?)" "p.(Leu141Ser)" "" "0000573285" "00025774" "30" "398" "-4" "398" "-4" "c.398-4A>G" "r.spl?" "p.?" "" "0000573285" "00000468" "30" "398" "-4" "398" "-4" "c.398-4A>G" "r.spl?" "p.?" "" "0000573286" "00025774" "30" "398" "-5" "398" "-5" "c.398-5T>C" "r.spl?" "p.?" "" "0000573286" "00000468" "30" "398" "-5" "398" "-5" "c.398-5T>C" "r.spl?" "p.?" "" "0000573287" "00025774" "10" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Ala129Thr)" "" "0000573287" "00000468" "10" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Ala129Thr)" "" "0000573288" "00025774" "30" "358" "0" "358" "0" "c.358A>G" "r.(?)" "p.(Thr120Ala)" "" "0000573288" "00000468" "30" "358" "0" "358" "0" "c.358A>G" "r.(?)" "p.(Thr120Ala)" "" "0000573289" "00025774" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000573289" "00000468" "30" "339" "0" "339" "0" "c.339C>T" "r.(?)" "p.(Ser113=)" "" "0000573290" "00025774" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000573290" "00000468" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000573291" "00025774" "30" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Arg53Cys)" "" "0000573291" "00000468" "30" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Arg53Cys)" "" "0000573293" "00025774" "50" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Arg25Trp)" "" "0000573293" "00000468" "50" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Arg25Trp)" "" "0000573294" "00025774" "30" "65" "-20" "65" "-20" "c.65-20A>T" "r.(=)" "p.(=)" "" "0000573294" "00000468" "30" "65" "-20" "65" "-20" "c.65-20A>T" "r.(=)" "p.(=)" "" "0000573295" "00025774" "30" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Leu14=)" "" "0000573295" "00000468" "30" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Leu14=)" "" "0000573296" "00025774" "50" "4" "0" "4" "0" "c.4G>C" "r.(?)" "p.(Val2Leu)" "" "0000573296" "00000468" "50" "4" "0" "4" "0" "c.4G>C" "r.(?)" "p.(Val2Leu)" "" "0000573297" "00025774" "30" "-4" "0" "-4" "0" "c.-4G>C" "r.(?)" "p.(=)" "" "0000573297" "00000468" "30" "-4" "0" "-4" "0" "c.-4G>C" "r.(?)" "p.(=)" "" "0000573298" "00025774" "10" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "" "0000573298" "00000468" "10" "-23" "0" "-15" "0" "c.-23_-15del" "r.(?)" "p.(=)" "" "0000573299" "00025774" "10" "-23" "0" "-15" "0" "c.-23_-15dup" "r.(?)" "p.(=)" "" "0000573299" "00000468" "10" "-23" "0" "-15" "0" "c.-23_-15dup" "r.(?)" "p.(=)" "" "0000618943" "00025774" "10" "3979" "0" "3979" "0" "c.*2746A>G" "r.(=)" "p.(=)" "" "0000618943" "00000468" "10" "1143" "0" "1143" "0" "c.1143A>G" "r.(?)" "p.(Ala381=)" "" "0000618944" "00025774" "30" "3911" "0" "3911" "0" "c.*2678G>A" "r.(=)" "p.(=)" "" "0000618944" "00000468" "30" "1094" "-19" "1094" "-19" "c.1094-19G>A" "r.(=)" "p.(=)" "" "0000618945" "00025774" "30" "1142" "0" "1142" "0" "c.1142T>C" "r.(?)" "p.(Val381Ala)" "" "0000618945" "00000468" "30" "1094" "-2788" "1094" "-2788" "c.1094-2788T>C" "r.(=)" "p.(=)" "" "0000618946" "00025774" "30" "1117" "0" "1119" "0" "c.1117_1119del" "r.(?)" "p.(Asp373del)" "" "0000618946" "00000468" "30" "1094" "-2813" "1094" "-2811" "c.1094-2813_1094-2811del" "r.(=)" "p.(=)" "" "0000618948" "00025774" "30" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000618948" "00000468" "30" "1091" "0" "1091" "0" "c.1091C>T" "r.(?)" "p.(Thr364Ile)" "" "0000618949" "00025774" "30" "929" "-5" "929" "-5" "c.929-5T>C" "r.spl?" "p.?" "" "0000618949" "00000468" "30" "929" "-5" "929" "-5" "c.929-5T>C" "r.spl?" "p.?" "" "0000618950" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000618950" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000618951" "00025774" "30" "771" "0" "771" "0" "c.771T>C" "r.(?)" "p.(Asn257=)" "" "0000618951" "00000468" "30" "771" "0" "771" "0" "c.771T>C" "r.(?)" "p.(Asn257=)" "" "0000618953" "00025774" "10" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000618953" "00000468" "10" "661" "0" "661" "0" "c.661G>A" "r.(?)" "p.(Gly221Arg)" "" "0000618955" "00025774" "10" "562" "0" "562" "0" "c.562C>T" "r.(?)" "p.(Leu188=)" "" "0000618955" "00000468" "10" "562" "0" "562" "0" "c.562C>T" "r.(?)" "p.(Leu188=)" "" "0000624400" "00025774" "30" "907" "0" "907" "0" "c.907A>G" "r.(?)" "p.(Met303Val)" "" "0000624400" "00000468" "30" "907" "0" "907" "0" "c.907A>G" "r.(?)" "p.(Met303Val)" "" "0000652791" "00025774" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000652791" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000652792" "00025774" "70" "183" "5" "183" "5" "c.183+5G>A" "r.spl?" "p.?" "" "0000652792" "00000468" "70" "183" "5" "183" "5" "c.183+5G>A" "r.spl?" "p.?" "" "0000653088" "00025774" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000653088" "00000468" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000659063" "00025774" "50" "1142" "0" "1142" "0" "c.1142T>C" "r.(?)" "p.(Val381Ala)" "" "0000659063" "00000468" "50" "1094" "-2788" "1094" "-2788" "c.1094-2788T>C" "r.(=)" "p.(=)" "" "0000670149" "00025774" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000670149" "00000468" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000682053" "00025774" "30" "3969" "0" "3969" "0" "c.*2736T>C" "r.(=)" "p.(=)" "" "0000682053" "00000468" "30" "1133" "0" "1133" "0" "c.1133T>C" "r.(?)" "p.(Ile378Thr)" "" "0000682054" "00025774" "10" "865" "-8" "865" "-8" "c.865-8del" "r.(=)" "p.(=)" "" "0000682054" "00000468" "10" "865" "-8" "865" "-8" "c.865-8del" "r.(=)" "p.(=)" "" "0000682055" "00025774" "30" "267" "0" "267" "0" "c.267A>C" "r.(?)" "p.(Ala89=)" "" "0000682055" "00000468" "30" "267" "0" "267" "0" "c.267A>C" "r.(?)" "p.(Ala89=)" "" "0000682056" "00025774" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000682056" "00000468" "50" "188" "0" "188" "0" "c.188C>T" "r.(?)" "p.(Thr63Ile)" "" "0000693311" "00025774" "50" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Arg25Trp)" "" "0000693311" "00000468" "50" "73" "0" "73" "0" "c.73C>T" "r.(?)" "p.(Arg25Trp)" "" "0000700032" "00000468" "90" "29" "0" "29" "0" "c.29del" "r.(?)" "p.(Pro10Argfs*10)" "" "0000700033" "00000468" "90" "124" "0" "124" "0" "c.124del" "r.(?)" "p.(Leu42Phefs*7)" "" "0000700034" "00000468" "90" "222" "0" "223" "0" "c.222_223del" "r.(?)" "p.(Tyr74*)" "" "0000700035" "00000468" "90" "270" "0" "274" "0" "c.270_274del" "r.(?)" "p.(Gln91Argfs*20)" "" "0000700036" "00000468" "50" "517" "0" "517" "0" "c.517G>A" "r.(?)" "p.(Val173Ile)" "" "0000700037" "00000468" "90" "795" "0" "795" "0" "c.795C>A" "r.(?)" "p.(Cys265*)" "" "0000700038" "00000468" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293*)" "" "0000700039" "00000468" "90" "929" "-2" "929" "-2" "c.929-2A>G" "r.spl" "p.?" "" "0000700040" "00000468" "90" "973" "0" "973" "0" "c.973del" "r.(?)" "p.(Leu325Trpfs*21)" "" "0000700041" "00000468" "70" "1058" "0" "1058" "0" "c.1058A>C" "r.(?)" "p.(Gln353Pro)" "" "0000700892" "00000468" "50" "56" "0" "56" "0" "c.56T>G" "r.(?)" "p.(Leu19Arg)" "" "0000700893" "00000468" "90" "128" "0" "129" "0" "c.128_129dup" "r.(?)" "p.(Ala44Metfs*6)" "" "0000700894" "00000468" "70" "183" "1" "183" "1" "c.183+1G>A" "r.spl" "p.?" "" "0000700895" "00000468" "50" "371" "0" "371" "0" "c.371C>T" "r.(?)" "p.(Thr124Ile)" "" "0000700896" "00000468" "50" "517" "0" "517" "0" "c.517G>A" "r.(?)" "p.(Val173Ile)" "" "0000700897" "00000468" "50" "824" "0" "824" "0" "c.824A>G" "r.(?)" "p.(Asn275Ser)" "" "0000700898" "00000468" "90" "864" "1" "864" "1" "c.864+1G>T" "r.spl" "p.?" "" "0000700899" "00000468" "90" "928" "0" "928" "0" "c.928G>A" "r.(?)" "p.(Val310Ile)" "" "0000700900" "00000468" "70" "929" "-1" "929" "-1" "c.929-1G>A" "r.spl" "p.?" "" "0000701537" "00000468" "50" "472" "0" "472" "0" "c.472A>G" "r.(?)" "p.(Thr158Ala)" "" "0000701538" "00000468" "50" "842" "0" "842" "0" "c.842A>G" "r.(?)" "p.(Tyr281Cys)" "" "0000728372" "00025774" "50" "1211" "0" "1211" "0" "c.1211A>T" "r.(?)" "p.(His404Leu)" "" "0000728372" "00000468" "50" "1094" "-2719" "1094" "-2719" "c.1094-2719A>T" "r.(=)" "p.(=)" "" "0000728373" "00025774" "30" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Arg53Cys)" "" "0000728373" "00000468" "30" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Arg53Cys)" "" "0000790007" "00000468" "90" "139" "0" "139" "0" "c.139C>T" "r.(?)" "p.(Gln47Ter)" "" "0000790018" "00000468" "70" "35" "0" "52" "0" "c.35_52del" "r.(?)" "p.(Ser12_Val17del)" "" "0000809826" "00025774" "30" "589" "0" "589" "0" "c.589G>C" "r.(?)" "p.(Val197Leu)" "" "0000809826" "00000468" "30" "589" "0" "589" "0" "c.589G>C" "r.(?)" "p.(Val197Leu)" "" "0000809827" "00025774" "50" "449" "0" "449" "0" "c.449T>A" "r.(?)" "p.(Leu150His)" "" "0000809827" "00000468" "50" "449" "0" "449" "0" "c.449T>A" "r.(?)" "p.(Leu150His)" "" "0000809828" "00025774" "50" "358" "0" "358" "0" "c.358A>G" "r.(?)" "p.(Thr120Ala)" "" "0000809828" "00000468" "50" "358" "0" "358" "0" "c.358A>G" "r.(?)" "p.(Thr120Ala)" "" "0000809829" "00025774" "10" "213" "0" "213" "0" "c.213T>C" "r.(?)" "p.(Thr71=)" "" "0000809829" "00000468" "10" "213" "0" "213" "0" "c.213T>C" "r.(?)" "p.(Thr71=)" "" "0000809830" "00025774" "30" "49" "0" "49" "0" "c.49G>A" "r.(?)" "p.(Val17Ile)" "" "0000809830" "00000468" "30" "49" "0" "49" "0" "c.49G>A" "r.(?)" "p.(Val17Ile)" "" "0000809831" "00025774" "10" "-4" "0" "-4" "0" "c.-4G>C" "r.(?)" "p.(=)" "" "0000809831" "00000468" "10" "-4" "0" "-4" "0" "c.-4G>C" "r.(?)" "p.(=)" "" "0000856308" "00025774" "30" "3988" "0" "3988" "0" "c.*2755G>C" "r.(=)" "p.(=)" "" "0000856308" "00000468" "30" "1152" "0" "1152" "0" "c.1152G>C" "r.(?)" "p.(Val384=)" "" "0000856309" "00025774" "30" "741" "11" "741" "11" "c.741+11C>T" "r.(=)" "p.(=)" "" "0000856309" "00000468" "30" "741" "11" "741" "11" "c.741+11C>T" "r.(=)" "p.(=)" "" "0000856311" "00025774" "50" "166" "0" "166" "0" "c.166A>G" "r.(?)" "p.(Thr56Ala)" "" "0000856311" "00000468" "50" "166" "0" "166" "0" "c.166A>G" "r.(?)" "p.(Thr56Ala)" "" "0000856312" "00025774" "30" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Leu14=)" "" "0000856312" "00000468" "30" "42" "0" "42" "0" "c.42C>T" "r.(?)" "p.(Leu14=)" "" "0000874698" "00025774" "70" "669" "0" "669" "0" "c.669T>G" "r.(?)" "p.(Tyr223*)" "" "0000874698" "00000468" "70" "669" "0" "669" "0" "c.669T>G" "r.(?)" "p.(Tyr223*)" "" "0000895898" "00025774" "30" "742" "-10" "742" "-8" "c.742-10_742-8del" "r.(=)" "p.(=)" "" "0000895898" "00000468" "30" "742" "-10" "742" "-8" "c.742-10_742-8del" "r.(=)" "p.(=)" "" "0000895899" "00025774" "30" "517" "0" "517" "0" "c.517G>A" "r.(?)" "p.(Val173Ile)" "" "0000895899" "00000468" "30" "517" "0" "517" "0" "c.517G>A" "r.(?)" "p.(Val173Ile)" "" "0000895900" "00025774" "50" "373" "0" "375" "0" "c.373_375del" "r.(?)" "p.(Thr125del)" "" "0000895900" "00000468" "50" "373" "0" "375" "0" "c.373_375del" "r.(?)" "p.(Thr125del)" "" "0000895901" "00025774" "50" "183" "9" "183" "9" "c.183+9A>G" "r.(=)" "p.(=)" "" "0000895901" "00000468" "50" "183" "9" "183" "9" "c.183+9A>G" "r.(=)" "p.(=)" "" "0000895902" "00025774" "30" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Arg53Cys)" "" "0000895902" "00000468" "30" "157" "0" "157" "0" "c.157C>T" "r.(?)" "p.(Arg53Cys)" "" "0000895903" "00025774" "10" "65" "-20" "65" "-18" "c.65-20_65-18del" "r.(=)" "p.(=)" "" "0000895903" "00000468" "10" "65" "-20" "65" "-18" "c.65-20_65-18del" "r.(=)" "p.(=)" "" "0000908879" "00000468" "90" "928" "3" "928" "3" "c.928+3A>T" "r.865_928del" "p.Lys289Phefs*36" "" "0000915592" "00025774" "30" "591" "0" "591" "0" "c.591G>A" "r.(?)" "p.(Val197=)" "" "0000915592" "00000468" "30" "591" "0" "591" "0" "c.591G>A" "r.(?)" "p.(Val197=)" "" "0000915593" "00025774" "30" "504" "0" "504" "0" "c.504C>T" "r.(?)" "p.(Tyr168=)" "" "0000915593" "00000468" "30" "504" "0" "504" "0" "c.504C>T" "r.(?)" "p.(Tyr168=)" "" "0000915594" "00025774" "90" "205" "0" "205" "0" "c.205del" "r.(?)" "p.(His69Metfs*4)" "" "0000915594" "00000468" "90" "205" "0" "205" "0" "c.205del" "r.(?)" "p.(His69Metfs*4)" "" "0000927248" "00025774" "30" "85" "0" "85" "0" "c.85T>C" "r.(?)" "p.(Leu29=)" "" "0000927248" "00000468" "30" "85" "0" "85" "0" "c.85T>C" "r.(?)" "p.(Leu29=)" "" "0000927670" "00025774" "70" "783" "0" "783" "0" "c.783del" "r.(?)" "p.(Thr262GlnfsTer21)" "" "0000931333" "00025774" "10" "64" "11" "64" "11" "c.64+11G>C" "r.(=)" "p.(=)" "" "0000931333" "00000468" "10" "64" "11" "64" "11" "c.64+11G>C" "r.(=)" "p.(=)" "" "0000951670" "00025774" "50" "907" "0" "907" "0" "c.907A>G" "r.(?)" "p.(Met303Val)" "" "0000951670" "00000468" "50" "907" "0" "907" "0" "c.907A>G" "r.(?)" "p.(Met303Val)" "" "0000955389" "00025774" "90" "-180" "0" "6408" "0" "c.-180_*5175del" "r.0" "p.0" "_1_9_" "0000955391" "00025774" "90" "-180" "0" "6408" "0" "c.-180_*5175del" "r.0" "p.0" "_1_9_" "0000955391" "00000468" "90" "0" "0" "0" "0" "c.?" "r.0" "p.0" "" "0000959822" "00025774" "50" "1093" "289" "1093" "289" "c.1093+289C>T" "r.(?)" "p.(?)" "" "0000970677" "00025774" "30" "1142" "0" "1142" "0" "c.1142T>C" "r.(?)" "p.(Val381Ala)" "" "0000970677" "00000468" "30" "1094" "-2788" "1094" "-2788" "c.1094-2788T>C" "r.(=)" "p.(=)" "" "0000984420" "00025774" "30" "742" "-7" "742" "-5" "c.742-7_742-5del" "r.spl?" "p.?" "" "0000984420" "00000468" "30" "742" "-7" "742" "-5" "c.742-7_742-5del" "r.spl?" "p.?" "" "0000984421" "00025774" "10" "74" "0" "74" "0" "c.74G>A" "r.(?)" "p.(Arg25Gln)" "" "0000984421" "00000468" "10" "74" "0" "74" "0" "c.74G>A" "r.(?)" "p.(Arg25Gln)" "" "0000984422" "00025774" "30" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000984422" "00000468" "30" "9" "0" "9" "0" "c.9C>T" "r.(?)" "p.(Cys3=)" "" "0000989640" "00025774" "50" "10" "0" "10" "0" "c.10T>C" "r.(?)" "p.(Phe4Leu)" "" "0000989640" "00000468" "50" "10" "0" "10" "0" "c.10T>C" "r.(?)" "p.(Phe4Leu)" "" "0001006388" "00025774" "10" "4027" "0" "4027" "0" "c.*2794T>C" "r.(=)" "p.(=)" "" "0001006388" "00000468" "10" "1191" "0" "1191" "0" "c.1191T>C" "r.(?)" "p.(Tyr397=)" "" "0001006389" "00025774" "30" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Ala129Thr)" "" "0001006389" "00000468" "30" "385" "0" "385" "0" "c.385G>A" "r.(?)" "p.(Ala129Thr)" "" "0001010193" "00025774" "70" "865" "-1" "865" "-1" "c.865-1G>C" "r.spl" "p.?" "" "0001010193" "00000468" "70" "865" "-1" "865" "-1" "c.865-1G>C" "r.spl" "p.?" "" "0001010208" "00025774" "90" "398" "0" "356547" "0" "c.(?_398)_(*355314_?)del" "r.?" "p.?" "" "0001010208" "00000468" "90" "398" "0" "353711" "0" "c.(?_398)_(*352475_?)del" "r.?" "p.?" "" "0001010210" "00025774" "90" "973" "0" "973" "0" "c.973del" "r.(?)" "p.(Leu325TrpfsTer21)" "" "0001010210" "00000468" "90" "973" "0" "973" "0" "c.973del" "r.(?)" "p.(Leu325TrpfsTer21)" "" "0001010211" "00025774" "90" "467" "0" "467" "0" "c.467T>C" "r.(?)" "p.(Leu156Ser)" "" "0001010211" "00000468" "90" "467" "0" "467" "0" "c.467T>C" "r.(?)" "p.(Leu156Ser)" "" "0001012939" "00025774" "90" "877" "0" "877" "0" "c.877C>T" "r.(?)" "p.(Arg293Ter)" "" "0001058192" "00025774" "90" "865" "-1" "865" "-1" "c.865-1G>A" "r.(?)" "p.(?)" "" "0001067769" "00025774" "50" "5784" "0" "5784" "0" "c.*4551C>A" "r.(=)" "p.(=)" "" "0001067769" "00000468" "50" "2948" "0" "2948" "0" "c.*1712C>A" "r.(=)" "p.(=)" "" "0001067770" "00025774" "50" "1193" "0" "1193" "0" "c.1193T>C" "r.(?)" "p.(Ile398Thr)" "" "0001067770" "00000468" "50" "1094" "-2737" "1094" "-2737" "c.1094-2737T>C" "r.(=)" "p.(=)" "" "0001067771" "00025774" "50" "1093" "3834" "1093" "3834" "c.1093+3834G>A" "r.(=)" "p.(=)" "" "0001067771" "00000468" "50" "1093" "3834" "1093" "3834" "c.1093+3834G>A" "r.(=)" "p.(=)" "" "0001067772" "00025774" "30" "1093" "2999" "1093" "3005" "c.1093+2999_1093+3005del" "r.(=)" "p.(=)" "" "0001067772" "00000468" "30" "1093" "2999" "1093" "3005" "c.1093+2999_1093+3005del" "r.(=)" "p.(=)" "" "0001074281" "00000468" "70" "741" "1" "741" "1" "c.741+1G>A" "r.spl" "p.?" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 145 "{{screeningid}}" "{{variantid}}" "0000000209" "0000002135" "0000056398" "0000086640" "0000088225" "0000141557" "0000088226" "0000141558" "0000088227" "0000141559" "0000088228" "0000141560" "0000088229" "0000141561" "0000088230" "0000141562" "0000088231" "0000141563" "0000088232" "0000141564" "0000088233" "0000141565" "0000088234" "0000141566" "0000088235" "0000141567" "0000088236" "0000141568" "0000088237" "0000141569" "0000088238" "0000141570" "0000088239" "0000141571" "0000088239" "0000141623" "0000088240" "0000141572" "0000088241" "0000141573" "0000088242" "0000141574" "0000088243" "0000141575" "0000088244" "0000141576" "0000088245" "0000141577" "0000088246" "0000141578" "0000088247" "0000141579" "0000088248" "0000141580" "0000088249" "0000141581" "0000088250" "0000141582" "0000088251" "0000141583" "0000088252" "0000141584" "0000088253" "0000141585" "0000088291" "0000141624" "0000088292" "0000141625" "0000088293" "0000141626" "0000088294" "0000141627" "0000088295" "0000141628" "0000088296" "0000141629" "0000088297" "0000141630" "0000088298" "0000141631" "0000088299" "0000141632" "0000088300" "0000141633" "0000088301" "0000141635" "0000088302" "0000141636" "0000088303" "0000141637" "0000088304" "0000141638" "0000088305" "0000141639" "0000088306" "0000141640" "0000088307" "0000141641" "0000089100" "0000147005" "0000089101" "0000147006" "0000089102" "0000147007" "0000089103" "0000147008" "0000089104" "0000147009" "0000089105" "0000147010" "0000089106" "0000147011" "0000089107" "0000147012" "0000089108" "0000147013" "0000089109" "0000147014" "0000089110" "0000147015" "0000089114" "0000147018" "0000089115" "0000147019" "0000089116" "0000147020" "0000089117" "0000147021" "0000089118" "0000147022" "0000089119" "0000147023" "0000089120" "0000147024" "0000089121" "0000147025" "0000089128" "0000147032" "0000089129" "0000147033" "0000089130" "0000147034" "0000089131" "0000147035" "0000089132" "0000147036" "0000089133" "0000147037" "0000089134" "0000147038" "0000089135" "0000147039" "0000089136" "0000147040" "0000089137" "0000147041" "0000089138" "0000147042" "0000089139" "0000147043" "0000089140" "0000147044" "0000089141" "0000147045" "0000089142" "0000147046" "0000089143" "0000147047" "0000089144" "0000147048" "0000089145" "0000147049" "0000089146" "0000147050" "0000089147" "0000147051" "0000089148" "0000147052" "0000089150" "0000147054" "0000089151" "0000147055" "0000089152" "0000147056" "0000089153" "0000147057" "0000089154" "0000147058" "0000089155" "0000147059" "0000089156" "0000147060" "0000089157" "0000147061" "0000089157" "0000147062" "0000089157" "0000147063" "0000089166" "0000147077" "0000109089" "0000175187" "0000109093" "0000175194" "0000109099" "0000175168" "0000109119" "0000175211" "0000207853" "0000437560" "0000212271" "0000443919" "0000229305" "0000470483" "0000241235" "0000487095" "0000296102" "0000652791" "0000296103" "0000652792" "0000296399" "0000653088" "0000306461" "0000670149" "0000317426" "0000700032" "0000317427" "0000700033" "0000317428" "0000700034" "0000317429" "0000700035" "0000317430" "0000700036" "0000317431" "0000700037" "0000317432" "0000700038" "0000317433" "0000700039" "0000317434" "0000700040" "0000317435" "0000700041" "0000318286" "0000700892" "0000318287" "0000700893" "0000318288" "0000700894" "0000318289" "0000700895" "0000318290" "0000700896" "0000318291" "0000700897" "0000318292" "0000700898" "0000318293" "0000700899" "0000318294" "0000700900" "0000318931" "0000701537" "0000318932" "0000701538" "0000377602" "0000790007" "0000377613" "0000790018" "0000416570" "0000874698" "0000429406" "0000908879" "0000446952" "0000955389" "0000446954" "0000955391" "0000454739" "0000989640" "0000456457" "0001010193" "0000456523" "0001010208" "0000456525" "0001010210" "0000456526" "0001010211" "0000478550" "0001074281"