### LOVD-version 3000-30b ### Full data download ### To import, do not remove or alter this header ### ## Filter: (gene_public = LRSAM1) # charset = UTF-8 ## Genes ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{name}}" "{{chromosome}}" "{{chrom_band}}" "{{imprinting}}" "{{refseq_genomic}}" "{{refseq_UD}}" "{{reference}}" "{{url_homepage}}" "{{url_external}}" "{{allow_download}}" "{{id_hgnc}}" "{{id_entrez}}" "{{id_omim}}" "{{show_hgmd}}" "{{show_genecards}}" "{{show_genetests}}" "{{show_orphanet}}" "{{note_index}}" "{{note_listing}}" "{{refseq}}" "{{refseq_url}}" "{{disclaimer}}" "{{disclaimer_text}}" "{{header}}" "{{header_align}}" "{{footer}}" "{{footer_align}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{updated_by}}" "{{updated_date}}" "LRSAM1" "leucine rich repeat and sterile alpha motif containing 1" "9" "q34.13" "unknown" "LRG_373" "UD_132610404630" "" "https://www.LOVD.nl/LRSAM1" "" "1" "25135" "90678" "610933" "1" "1" "1" "1" "Establishment of this gene variant database (LSDB) was supported by the Leiden University Medical Center (LUMC), Leiden, Nederland." "" "g" "https://databases.lovd.nl/shared/refseq/LRSAM1_codingDNA.html" "1" "" "" "-1" "" "-1" "00001" "2013-05-03 00:00:00" "00006" "2019-01-23 12:24:22" "00000" "2025-07-08 13:22:38" ## Transcripts ## Do not remove or alter this header ## ## Count = 1 "{{id}}" "{{geneid}}" "{{name}}" "{{id_mutalyzer}}" "{{id_ncbi}}" "{{id_ensembl}}" "{{id_protein_ncbi}}" "{{id_protein_ensembl}}" "{{id_protein_uniprot}}" "{{remarks}}" "{{position_c_mrna_start}}" "{{position_c_mrna_end}}" "{{position_c_cds_end}}" "{{position_g_mrna_start}}" "{{position_g_mrna_end}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00025365" "LRSAM1" "transcript variant 1" "001" "NM_138361.5" "" "NP_612370.3" "" "" "" "-631" "2774" "2172" "130213765" "130265780" "00006" "2019-01-23 12:23:44" "" "" ## Diseases ## Do not remove or alter this header ## ## Count = 4 "{{id}}" "{{symbol}}" "{{name}}" "{{inheritance}}" "{{id_omim}}" "{{tissues}}" "{{features}}" "{{remarks}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "00198" "?" "unclassified / mixed" "" "" "" "" "" "00006" "2013-09-13 14:21:47" "00006" "2024-11-23 09:38:12" "03647" "CMT2P" "Charcot-Marie-Tooth disease, type 2P (CMT-2P)" "AD;AR" "614436" "" "" "" "00006" "2014-09-25 23:29:40" "00006" "2021-12-10 21:51:32" "05113" "CMT" "Charcot-Marie-Tooth disease (CMT)" "" "" "" "" "" "00006" "2016-01-11 01:40:57" "" "" "05157" "HMSN" "neuropathy, motor and sensory, hereditary (HMSN)" "" "" "" "" "" "00006" "2016-04-15 10:26:05" "" "" ## Genes_To_Diseases ## Do not remove or alter this header ## ## Count = 1 "{{geneid}}" "{{diseaseid}}" "LRSAM1" "03647" ## Individuals ## Do not remove or alter this header ## ## Count = 36 "{{id}}" "{{fatherid}}" "{{motherid}}" "{{panelid}}" "{{panel_size}}" "{{license}}" "{{owned_by}}" "{{Individual/Reference}}" "{{Individual/Remarks}}" "{{Individual/Gender}}" "{{Individual/Consanguinity}}" "{{Individual/Origin/Geographic}}" "{{Individual/Age_of_death}}" "{{Individual/VIP}}" "{{Individual/Data_av}}" "{{Individual/Treatment}}" "{{Individual/Origin/Population}}" "{{Individual/Individual_ID}}" "00080827" "" "" "" "1" "" "01758" "{PMID:Trujillano 2017:27848944}" "unaffected heterozygous carrier mother, father not available" "" "" "" "" "0" "" "" "" "" "00210165" "" "" "" "1" "" "01164" "" "" "M" "" "Germany" "" "0" "" "" "" "" "00218353" "" "" "" "7" "" "00006" "{PMID:Guernsey 2010:20865121}" "6-generation family, 7 affected (F, 6m), unaffected heterozygous carrier parents/relatives" "F;M" "yes" "Canada" "" "0" "" "" "Canadian, rural eastern" "20865121-Fam" "00218354" "" "" "" "11" "" "00006" "{PMID:Weterman 2012:22012984}, {PMID:Aerts 2015:26900582}" "3-generation family, 11 affected (5F, 6M) heterozygous carriers" "F;M" "no" "Netherlands" "" "0" "" "" "" "22012984-Fam" "00218356" "" "" "" "22" "" "00006" "{PMID:Nicolaou 2013:22781092}" "6-generation family, 22 affected heterozygous carriers (10F, 12M)" "F;M" "" "Italy" "" "0" "" "" "Sardian" "22781092" "00218357" "" "" "" "13" "" "00006" "{PMID:Peeters 2016:27686364}" "2-generation family, 13 affected heterozygous carriers (6F, 7M)" "F;M" "no" "Spain" "" "0" "" "" "" "27686364-Fam" "00218361" "" "" "" "6" "" "00006" "{PMID:Zhao 2018:29341362}" "4-generation family, 6 affected heterozygous carriers (F, 5M)" "F;M" "no" "China" "" "0" "" "" "" "29341362-Fam" "00218376" "" "" "" "8" "" "00006" "{PMID:Hu 2016:27615052}" "4-generation family, 8 affected heterozygous carriers (4F, 4M)" "F;M" "no" "United States" "" "0" "" "" "" "27615052_Fam" "00218377" "" "" "" "3" "" "00006" "{PMID:Engeholm 2014:24894446}" "4-generation family, 3 affected heterozygous carriers (2F, M)" "F;M" "no" "Germany" "" "0" "" "" "" "24894446-Fam" "00219001" "" "" "" "1" "" "00006" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "analysis 612 patients" "F" "" "(Germany)" "" "0" "" "" "" "28902413-Pat11" "00240384" "" "" "" "1" "" "01807" "" "" "F" "" "" "" "0" "" "" "" "" "00295655" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00306993" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00306995" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00306996" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00306997" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00306998" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00306999" "" "" "" "1" "" "01164" "" "" "F" "" "" "" "0" "" "" "" "" "00307000" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307001" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307002" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307003" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307004" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307005" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307006" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307007" "" "" "" "1" "" "01164" "" "" "M" "" "" "" "0" "" "" "" "" "00307128" "" "" "" "1" "" "01164" "" "submission for publication Reilich et al, 2020 (submitted)" "?" "?" "" "" "0" "" "" "" "" "00307129" "" "" "" "1" "" "01164" "" "submission for publication Reilich et al, 2020 (submitted)" "F" "?" "" "" "0" "" "" "" "105556" "00307130" "" "" "" "1" "" "01164" "" "submission for publication Reilich et al, 2020 (submitted)" "?" "?" "" "" "0" "" "" "" "" "00307131" "" "" "" "1" "" "01164" "" "submission for publication Reilich et al, 2020 (submitted)" "?" "?" "" "" "0" "" "" "" "" "00307132" "" "" "" "1" "" "01164" "submission for publication Reilich et al, 2020 (submitted)" "" "M" "?" "Germany" "" "0" "" "" "" "140851" "00307137" "" "" "" "1" "" "01164" "submission for publication Reilich et al, 2020 (submitted)" "" "?" "?" "" "" "0" "" "" "" "" "00327628" "" "" "" "1" "" "01741" "" "" "" "" "" "" "" "" "" "" "" "00374778" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-1738" "00374779" "" "" "" "1" "" "00006" "{PMID:Ganapathy 2019:31069529}" "" "" "" "India" "" "0" "" "" "" "S-661" "00420595" "" "" "" "1" "" "01741" "" "" "M" "" "Germany" "" "" "" "" "" "" ## Individuals_To_Diseases ## Do not remove or alter this header ## ## Count = 35 "{{individualid}}" "{{diseaseid}}" "00080827" "03647" "00218353" "05113" "00218354" "05113" "00218356" "05113" "00218357" "05113" "00218361" "05113" "00218376" "05113" "00218377" "05113" "00219001" "05113" "00240384" "00198" "00295655" "00198" "00306993" "00198" "00306995" "00198" "00306996" "00198" "00306997" "00198" "00306998" "00198" "00306999" "00198" "00307000" "00198" "00307001" "00198" "00307002" "00198" "00307003" "00198" "00307004" "00198" "00307005" "00198" "00307006" "00198" "00307007" "00198" "00307128" "03647" "00307129" "03647" "00307130" "03647" "00307131" "03647" "00307132" "03647" "00307137" "03647" "00327628" "03647" "00374778" "00198" "00374779" "00198" "00420595" "05157" ## Phenotypes ## Do not remove or alter this header ## ## Note: Only showing Phenotype columns active for Diseases 00198, 03647, 05113, 05157 ## Count = 35 "{{id}}" "{{diseaseid}}" "{{individualid}}" "{{owned_by}}" "{{Phenotype/Inheritance}}" "{{Phenotype/Age}}" "{{Phenotype/Additional}}" "{{Phenotype/Age/Onset}}" "{{Phenotype/Age/Diagnosis}}" "{{Phenotype/Onset}}" "{{Phenotype/Protein}}" "{{Phenotype/Tumor/MSI}}" "{{Phenotype/Enzyme/CPK}}" "{{Phenotype/Heart/Myocardium}}" "{{Phenotype/Lung}}" "{{Phenotype/Diagnosis/Definite}}" "{{Phenotype/Diagnosis/Initial}}" "{{Phenotype/Diagnosis/Criteria}}" "0000060396" "03647" "00080827" "01758" "Familial, autosomal dominant" "" "Charcot-Marie-Tooth disease, axonal, type 2P (OMIM:614436)" "" "" "" "" "" "" "" "" "" "" "" "0000158738" "00198" "00210165" "01164" "Unknown" "" "HP:0002460 (Distal muscle weakness); HP:0003198 (Myopathy)" "" "" "" "" "" "" "" "" "" "" "" "0000166796" "05113" "00218353" "00006" "Familial, autosomal recessive" "" "see paper; similar to autosomal recessive axonal CMT" "" "" "" "" "" "" "" "" "CMT-2P" "Charcot-Marie-Tooth disease" "" "0000166797" "05113" "00218354" "00006" "Familial, autosomal dominant" "" "see paper; phenotype includes late-onset Parkinson’s disease, ..." "" "" "" "" "" "" "" "" "CMT-2P" "axonal neuropathy" "" "0000166799" "05113" "00218356" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "CMT-2P" "Charcot-Marie-Tooth disease" "" "0000166800" "05113" "00218357" "00006" "Familial, autosomal dominant" "" "see paper; mild and quiescent lower-limb axonal sensorimotor neuropathy; MRI lower-limb musculature shows fatty atrophy, ..." "" "" "" "" "" "" "" "" "CMT-2P" "Charcot-Marie-Tooth disease" "" "0000166803" "05113" "00218361" "00006" "Familial, autosomal dominant" "" "see paper; difficulty walking, slowly progressive weakness lower limbs, atrophy distal parts lower limbs (III1), tendon reflexes depressed or absent, with mild stocking sensory loss to pricking pain or vibration feet, talipes cavus deformity (II4), no clawhand deformity, numbness and tingling in feet, no cranial nerve involvement, no cerebellar or pyramidal signs, ..." "" "" "difficulty walking" "" "" "" "" "" "CMT-2P" "Charcot-Marie-Tooth disease" "" "0000166816" "05113" "00218376" "00006" "Familial, autosomal dominant" "" "see paper; ..." "" "" "" "" "" "" "" "" "CMT-2P" "axonal polyneuropathy" "" "0000166817" "05113" "00218377" "00006" "Familial, autosomal dominant" "" "see paper; axonal CMT, ..." "" "" "" "" "" "" "" "" "CMT-2P" "Charcot-Marie-Tooth disease" "" "0000167558" "05113" "00219001" "00006" "Familial, autosomal dominant" "" "CMT2P" "" "" "" "" "" "" "" "" "CMT-2P" "Charcot-Marie-Tooth diseae" "" "0000180449" "00198" "00240384" "01807" "Unknown" "" "Cerebellar atrophy (HP:0001272); Polyneuropathy (HP:0001271); Sensory ataxia (HP:0010871)" "" "" "" "" "" "" "" "" "" "" "" "0000223219" "00198" "00295655" "01164" "Unknown" "" "Peripheral axonal neuropathy (HP:0003477); Pes cavus (HP:0001761)" "" "" "" "" "" "" "" "" "" "" "" "0000232814" "00198" "00306993" "01164" "Unknown" "" "Multifocal epileptiform discharges (HP:0010841); Abnormality of muscle physiology (HP:0011804); Seizures (HP:0001250); Muscular hypotonia (HP:0001252); Spasticity (HP:0001257); Global developmental delay (HP:0001263); Abnormality of nervous system physiology (HP:0012638); Neurodevelopmental abnormality (HP:0012759); Hypertonia (HP:0001276); Dystonia (HP:0001332); Generalized myoclonic seizures (HP:0002123); EEG abnormality (HP:0002353); Abnormality of the musculature (HP:0003011); Muscular dystrophy (HP:0003560); Hearing impairment (HP:0000365); Abnormal muscle tone (HP:0003808)" "" "" "" "" "" "" "" "" "" "" "" "0000232816" "00198" "00306995" "01164" "Unknown" "" "Bilateral ptosis (HP:0001488); Myopathy (HP:0003198)" "" "" "" "" "" "" "" "" "" "" "" "0000232817" "00198" "00306996" "01164" "Unknown" "" "Paraplegia/paraparesis (HP:0010551); Skeletal muscle atrophy (HP:0003202)" "" "" "" "" "" "" "" "" "" "" "" "0000232818" "00198" "00306997" "01164" "Unknown" "" "Peripheral axonal neuropathy (HP:0003477); Limb-girdle muscle atrophy (HP:0003797); Sensorimotor neuropathy (HP:0007141)" "" "" "" "" "" "" "" "" "" "" "" "0000232819" "00198" "00306998" "01164" "Unknown" "" "Renal cyst (HP:0000107); Polyneuropathy (HP:0001271); Rheumatoid arthritis (HP:0001370); Transient ischemic attack (HP:0002326); Hashimoto thyroiditis (HP:0000872); Tibialis muscle weakness (HP:0008963)" "" "" "" "" "" "" "" "" "" "" "" "0000232820" "00198" "00306999" "01164" "Unknown" "" "Abnormality of nervous system morphology (HP:0012639); Sensorimotor neuropathy (HP:0007141)" "" "" "" "" "" "" "" "" "" "" "" "0000232821" "00198" "00307000" "01164" "Unknown" "" "Abnormal peripheral nervous system morphology (HP:0000759); Sensory neuropathy (HP:0000763)" "" "" "" "" "" "" "" "" "" "" "" "0000232822" "00198" "00307001" "01164" "Unknown" "" "Mixed demyelinating and axonal polyneuropathy (HP:0007327)" "" "" "" "" "" "" "" "" "" "" "" "0000232824" "00198" "00307002" "01164" "Unknown" "" "Lower limb pain (HP:0012514); Gait disturbance (HP:0001288); Pes cavus (HP:0001761); Hand tremor (HP:0002378); Muscle stiffness (HP:0003552); Limb fasciculations (HP:0007289)" "" "" "" "" "" "" "" "" "" "" "" "0000232826" "00198" "00307003" "01164" "Unknown" "" "Muscle cramps (HP:0003394); Paresthesia (HP:0003401); Peripheral axonal neuropathy (HP:0003477)" "" "" "" "" "" "" "" "" "" "" "" "0000232827" "00198" "00307004" "01164" "Unknown" "" "Ataxia (HP:0001251)" "" "" "" "" "" "" "" "" "" "" "" "0000232828" "00198" "00307005" "01164" "Unknown" "" "Peripheral neuropathy (HP:0009830)" "" "" "" "" "" "" "" "" "" "" "" "0000232829" "00198" "00307006" "01164" "Unknown" "" "Elevated serum creatine phosphokinase (HP:0003236); Muscular dystrophy (HP:0003560)" "" "" "" "" "" "" "" "" "" "" "" "0000232830" "00198" "00307007" "01164" "Unknown" "" "Vitamin B12 deficiency (HP:0100502); Vitamin D deficiency (HP:0100512); Abnormal enzyme/coenzyme activity (HP:0012379); Obesity (HP:0001513); Hypomagnesemia (HP:0002917); Depression (HP:0000716)" "" "" "" "" "" "" "" "" "" "" "" "0000232933" "03647" "00307128" "01164" "Unknown" "" "Distal limb muscle weakness due to peripheral neuropathy" "" "" "" "" "" "" "" "" "" "" "" "0000232934" "03647" "00307129" "01164" "Unknown" "" "Weakness of foot dorsiflexion and lowering since the 30th year of life, distally emphasized sensorimotor axonal PNP. FA: Brother of the father also PNP since 70th year, father died with 29 years without symptoms of PNP, daughter also affected (known since 28th year)" "" "" "30y" "" "" "" "" "" "" "" "" "0000232935" "03647" "00307130" "01164" "Unknown" "" "Axonal degeneration/regeneration on nerve biops" "" "" "" "" "" "" "" "" "" "" "" "0000232936" "03647" "00307131" "01164" "Unknown" "" "Distal sensory loss, Foot drop" "" "" "" "" "" "" "" "" "" "" "" "0000232937" "03647" "00307132" "01164" "Unknown" "" "Hereditary polyneuropathy, sensorimotor primary axonal PNP (sensory > motor), father also affected" "" "" "" "" "" "" "" "" "" "58y" "" "0000232942" "03647" "00307137" "01164" "Unknown" "" "Hereditary polyneuropathy" "" "" "" "" "" "" "" "" "" "" "" "0000269988" "00198" "00374778" "00006" "Familial, autosomal recessive" "" "" "" "" "" "" "" "" "" "" "" "neuropathy" "" "0000269989" "00198" "00374779" "00006" "Familial, autosomal dominant" "" "" "" "" "" "" "" "" "" "" "" "neuropathy" "" "0000311843" "05157" "00420595" "01741" "Unknown" "" "" "" "" "" "" "" "" "" "" "" "progressive polyneuropathy" "" ## Screenings ## Do not remove or alter this header ## ## Count = 36 "{{id}}" "{{individualid}}" "{{variants_found}}" "{{owned_by}}" "{{created_by}}" "{{created_date}}" "{{edited_by}}" "{{edited_date}}" "{{Screening/Technique}}" "{{Screening/Template}}" "{{Screening/Tissue}}" "{{Screening/Remarks}}" "0000080939" "00080827" "1" "01758" "00006" "2016-09-07 13:24:08" "" "" "SEQ;SEQ-NG" "DNA" "" "" "0000211241" "00210165" "1" "01164" "01164" "2018-12-27 15:47:12" "" "" "SEQ-NG" "DNA" "" "" "0000219422" "00218353" "1" "00006" "00006" "2019-01-23 16:38:27" "" "" "arraySNP;RT-PCR;SEQ" "DNA;RNA" "" "" "0000219423" "00218354" "1" "00006" "00006" "2019-01-23 16:53:11" "" "" "arraySNP;SEQ;SEQ-NG" "DNA" "" "" "0000219426" "00218356" "1" "00006" "00006" "2019-01-23 20:12:28" "" "" "arraySNP;RT-PCR;SEQ" "DNA;RNA" "" "" "0000219427" "00218357" "1" "00006" "00006" "2019-01-23 20:33:03" "" "" "SEQ;SEQ-NG" "DNA" "" "WGS" "0000219430" "00218361" "1" "00006" "00006" "2019-01-24 08:39:47" "" "" "SEQ" "DNA" "" "" "0000219445" "00218376" "1" "00006" "00006" "2019-01-24 16:08:02" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted gene panel" "0000219446" "00218377" "1" "00006" "00006" "2019-01-24 16:25:29" "" "" "RT-PCR;SEQ" "DNA;RNA" "" "" "0000220073" "00219001" "1" "00006" "00006" "2019-02-05 12:23:36" "" "" "SEQ;SEQ-NG" "DNA" "" "targeted multigene panel" "0000241494" "00240384" "1" "01807" "01807" "2019-06-19 12:41:15" "" "" "SEQ" "DNA" "" "" "0000296827" "00295655" "1" "01164" "01164" "2020-03-22 12:43:43" "" "" "SEQ-NG-S" "DNA" "" "" "0000308130" "00306993" "1" "01164" "01164" "2020-07-27 09:48:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308132" "00306995" "1" "01164" "01164" "2020-07-27 09:50:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308133" "00306996" "1" "01164" "01164" "2020-07-27 09:51:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308134" "00306997" "1" "01164" "01164" "2020-07-27 09:52:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308135" "00306998" "1" "01164" "01164" "2020-07-27 09:53:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308136" "00306999" "1" "01164" "01164" "2020-07-27 09:54:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308137" "00307000" "1" "01164" "01164" "2020-07-27 09:55:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308138" "00307001" "1" "01164" "01164" "2020-07-27 09:56:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308139" "00307002" "1" "01164" "01164" "2020-07-27 09:57:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308140" "00307003" "1" "01164" "01164" "2020-07-27 09:58:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308141" "00307004" "1" "01164" "01164" "2020-07-27 09:59:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308142" "00307005" "1" "01164" "01164" "2020-07-27 10:00:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308143" "00307006" "1" "01164" "01164" "2020-07-27 10:01:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308144" "00307007" "1" "01164" "01164" "2020-07-27 10:02:01" "" "" "SEQ-NG-S" "DNA" "" "" "0000308270" "00307128" "1" "01164" "01164" "2020-08-03 16:43:16" "" "" "SEQ-NG-I" "DNA" "" "" "0000308271" "00307129" "1" "01164" "01164" "2020-08-03 16:50:15" "" "" "SEQ-NG-I" "DNA" "" "" "0000308272" "00307130" "1" "01164" "01164" "2020-08-03 16:55:09" "" "" "SEQ-NG-I" "DNA" "" "" "0000308273" "00307131" "1" "01164" "01164" "2020-08-03 16:59:38" "" "" "SEQ-NG-I" "DNA" "" "" "0000308274" "00307132" "1" "01164" "01164" "2020-08-03 17:07:30" "" "" "SEQ-NG-I" "DNA" "" "" "0000308279" "00307137" "1" "01164" "01164" "2020-08-03 17:12:20" "" "" "SEQ-NG-I" "DNA" "" "" "0000328843" "00327628" "1" "01741" "01741" "2021-01-25 14:07:26" "" "" "SEQ-NG" "DNA" "" "" "0000375972" "00374778" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000375973" "00374779" "1" "00006" "00006" "2021-05-24 20:06:48" "" "" "SEQ-NG" "DNA" "" "TruSight One panel" "0000421904" "00420595" "1" "01741" "01741" "2022-11-02 12:33:23" "" "" "SEQ-NG" "DNA" "blood" "" ## Screenings_To_Genes ## Do not remove or alter this header ## ## Count = 30 "{{screeningid}}" "{{geneid}}" "0000080939" "LRSAM1" "0000219422" "LRSAM1" "0000219423" "LRSAM1" "0000219426" "LRSAM1" "0000219427" "LRSAM1" "0000219430" "LRSAM1" "0000219445" "LRSAM1" "0000219446" "LRSAM1" "0000220073" "LRSAM1" "0000308270" "LRSAM1" "0000308271" "LRSAM1" "0000308272" "LRSAM1" "0000308273" "LRSAM1" "0000308274" "LRSAM1" "0000308279" "LRSAM1" "0000328843" "LRSAM1" "0000375972" "LRSAM1" "0000375973" "LRSAM1" "0000421904" "AARS" "0000421904" "GARS" "0000421904" "GDAP1" "0000421904" "HSPB1" "0000421904" "HSPB8" "0000421904" "IGHMBP2" "0000421904" "LMNA" "0000421904" "LRSAM1" "0000421904" "MFN2" "0000421904" "MPZ" "0000421904" "PMP22" "0000421904" "RAB7A" ## Variants_On_Genome ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Count = 102 "{{id}}" "{{allele}}" "{{effectid}}" "{{chromosome}}" "{{position_g_start}}" "{{position_g_end}}" "{{type}}" "{{average_frequency}}" "{{owned_by}}" "{{VariantOnGenome/DBID}}" "{{VariantOnGenome/DNA}}" "{{VariantOnGenome/Frequency}}" "{{VariantOnGenome/Reference}}" "{{VariantOnGenome/Restriction_site}}" "{{VariantOnGenome/Published_as}}" "{{VariantOnGenome/Remarks}}" "{{VariantOnGenome/Genetic_origin}}" "{{VariantOnGenome/Segregation}}" "{{VariantOnGenome/dbSNP}}" "{{VariantOnGenome/VIP}}" "{{VariantOnGenome/Methylation}}" "{{VariantOnGenome/ISCN}}" "{{VariantOnGenome/DNA/hg38}}" "{{VariantOnGenome/ClinVar}}" "{{VariantOnGenome/ClinicalClassification}}" "{{VariantOnGenome/ClinicalClassification/Method}}" "0000130025" "21" "70" "9" "130265081" "130265093" "del" "0" "01758" "LRSAM1_000001" "g.130265081_130265093del" "" "{PMID:Trujillano 2017:27848944}" "" "" "" "Germline" "" "" "0" "" "" "g.127502802_127502814del" "" "likely pathogenic" "ACMG" "0000246794" "0" "10" "9" "130242166" "130242166" "subst" "0.780759" "02330" "LRSAM1_000010" "g.130242166A>G" "" "" "" "LRSAM1(NM_138361.5):c.952A>G (p.N318D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127479887A>G" "" "benign" "" "0000246797" "0" "10" "9" "130259618" "130259618" "subst" "0.776867" "02330" "LRSAM1_000014" "g.130259618A>C" "" "" "" "LRSAM1(NM_138361.5):c.1912+5A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127497339A>C" "" "benign" "" "0000246862" "0" "30" "9" "130242179" "130242179" "subst" "0.00386443" "02330" "LRSAM1_000011" "g.130242179A>G" "" "" "" "LRSAM1(NM_138361.5):c.965A>G (p.Q322R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127479900A>G" "" "likely benign" "" "0000248410" "0" "10" "9" "130242166" "130242166" "subst" "0.780759" "02325" "LRSAM1_000010" "g.130242166A>G" "" "" "" "LRSAM1(NM_138361.5):c.952A>G (p.N318D)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127479887A>G" "" "benign" "" "0000248440" "0" "10" "9" "130259618" "130259618" "subst" "0.776867" "02325" "LRSAM1_000014" "g.130259618A>C" "" "" "" "LRSAM1(NM_138361.5):c.1912+5A>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127497339A>C" "" "benign" "" "0000279499" "0" "50" "9" "130248054" "130248054" "subst" "0.000117774" "02330" "LRSAM1_000012" "g.130248054G>A" "" "" "" "LRSAM1(NM_138361.5):c.1199G>A (p.R400Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127485775G>A" "" "VUS" "" "0000279500" "0" "10" "9" "130258380" "130258380" "subst" "0.0175007" "02330" "LRSAM1_000013" "g.130258380C>T" "" "" "" "LRSAM1(NM_138361.5):c.1830+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127496101C>T" "" "benign" "" "0000279501" "0" "10" "9" "130219669" "130219669" "subst" "0.590304" "02330" "LRSAM1_000002" "g.130219669C>T" "" "" "" "LRSAM1(NM_138361.5):c.249C>T (p.I83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127457390C>T" "" "benign" "" "0000279502" "0" "10" "9" "130219680" "130219680" "subst" "8.14127E-6" "02330" "LRSAM1_000003" "g.130219680G>A" "" "" "" "LRSAM1(NM_138361.5):c.252+8G>A" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127457401G>A" "" "benign" "" "0000279503" "0" "10" "9" "130230038" "130230038" "subst" "0.00767982" "02330" "LRSAM1_000004" "g.130230038C>T" "" "" "" "LRSAM1(NM_138361.5):c.548C>T (p.S183L)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127467759C>T" "" "benign" "" "0000279504" "0" "10" "9" "130236065" "130236065" "subst" "0" "02330" "LRSAM1_000005" "g.130236065T>C" "" "" "" "LRSAM1(NM_138361.5):c.620-15T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127473786T>C" "" "benign" "" "0000279505" "0" "30" "9" "130241667" "130241667" "subst" "4.06085E-6" "02330" "LRSAM1_000006" "g.130241667G>A" "" "" "" "LRSAM1(NM_138361.5):c.786G>A (p.Q262=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127479388G>A" "" "likely benign" "" "0000282350" "0" "10" "9" "130219669" "130219669" "subst" "0.590304" "02325" "LRSAM1_000002" "g.130219669C>T" "" "" "" "LRSAM1(NM_138361.5):c.249C>T (p.I83=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127457390C>T" "" "benign" "" "0000286047" "0" "10" "9" "130258380" "130258380" "subst" "0.0175007" "02326" "LRSAM1_000013" "g.130258380C>T" "" "" "" "LRSAM1(NM_138361.5):c.1830+6C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127496101C>T" "" "benign" "" "0000342075" "0" "50" "9" "130224641" "130224641" "subst" "2.43641E-5" "02327" "LRSAM1_000007" "g.130224641C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127462362C>T" "" "VUS" "" "0000347885" "0" "70" "9" "130265060" "130265060" "subst" "0" "02327" "LRSAM1_000008" "g.130265060T>G" "" "" "" "LRSAM1(NM_138361.5):c.2054T>G (p.M685R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "0" "" "" "g.127502781T>G" "" "likely pathogenic" "" "0000442700" "0" "70" "9" "130263333" "130263333" "dup" "0" "01164" "LRSAM1_000015" "g.130263333dup" "" "" "" "" "ACMG grading: PM2,PVS1" "Germline" "" "rs775965001" "0" "" "" "g.127501054dup" "" "likely pathogenic" "ACMG" "0000454269" "3" "90" "9" "130263288" "130263288" "subst" "1.21915E-5" "00006" "LRSAM1_000016" "g.130263288G>A" "" "{PMID:Guernsey 2010:20865121}" "" "" "gene localized by homozygosity mapping" "Germline" "yes" "" "0" "" "" "g.127501009G>A" "" "pathogenic (recessive)" "" "0000454270" "1" "90" "9" "130265127" "130265128" "dup" "0" "00006" "LRSAM1_000009" "g.130265127_130265128dup" "" "{PMID:Weterman 2012:22012984}" "" "2121_2122insGC (Leu708Argfx28)" "gene mapped using linkage (LOD score 5.12); variant not in 676 control chromosomes" "Germline" "yes" "" "0" "" "" "g.127502848_127502849dup" "" "pathogenic (dominant)" "" "0000454276" "1" "90" "9" "130265052" "130265052" "subst" "0" "00006" "LRSAM1_000017" "g.130265052G>A" "" "{PMID:Nicolaou 2013:22781092}" "" "" "" "Germline" "yes" "" "0" "" "" "g.127502773G>A" "" "pathogenic (dominant)" "" "0000454277" "0" "90" "9" "130265087" "130265087" "subst" "0" "00006" "LRSAM1_000018" "g.130265087G>A" "" "{PMID:Peeters 2016:27686364}" "" "" "" "Germline" "yes" "" "0" "" "" "g.127502808G>A" "" "pathogenic (dominant)" "" "0000454282" "1" "90" "9" "130263397" "130263400" "del" "0" "00006" "LRSAM1_000019" "g.130263397_130263400del" "" "{PMID:Zhao 2018:29341362}" "" "" "" "Germline" "yes" "" "0" "" "" "g.127501118_127501121del" "" "pathogenic (dominant)" "" "0000454300" "1" "90" "9" "130265086" "130265086" "subst" "4.17021E-6" "00006" "LRSAM1_000020" "g.130265086T>C" "" "{PMID:Hu 2016:27615052}" "" "" "tested variant in vitro" "Germline" "yes" "" "0" "" "" "g.127502807T>C" "" "pathogenic (dominant)" "" "0000454302" "1" "90" "9" "130263423" "130263423" "subst" "0" "00006" "LRSAM1_000021" "g.130263423G>T" "" "{PMID:Engeholm 2014:24894446}" "" "" "" "Germline" "yes" "" "0" "" "" "g.127501144G>T" "" "pathogenic (dominant)" "" "0000454966" "1" "90" "9" "130265052" "130265052" "subst" "0" "00006" "LRSAM1_000017" "g.130265052G>A" "1/612 cases" "{PMID:Dohrn 2017:28902413}, {DOI:Dohrn 2017:10.1111/jnc.14217}" "" "" "" "Germline" "" "" "0" "" "" "g.127502773G>A" "" "pathogenic" "" "0000487470" "0" "70" "9" "130230017" "130230017" "subst" "0" "01807" "LRSAM1_000022" "g.130230017A>G" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.127467738A>G" "" "likely pathogenic" "" "0000487471" "0" "70" "9" "130263409" "130263409" "subst" "0" "01807" "LRSAM1_000023" "g.130263409G>A" "" "" "" "" "" "Unknown" "" "" "0" "" "" "g.127501130G>A" "" "likely pathogenic" "" "0000536280" "0" "30" "9" "130221269" "130221269" "subst" "0" "02330" "LRSAM1_000024" "g.130221269C>G" "" "" "" "LRSAM1(NM_138361.5):c.253-13C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127458990C>G" "" "likely benign" "" "0000536281" "0" "50" "9" "130221313" "130221313" "subst" "0.000260239" "02330" "LRSAM1_000025" "g.130221313C>T" "" "" "" "LRSAM1(NM_138361.5):c.284C>T (p.A95V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127459034C>T" "" "VUS" "" "0000536283" "0" "50" "9" "130230083" "130230083" "subst" "3.93687E-5" "02330" "LRSAM1_000027" "g.130230083C>T" "" "" "" "LRSAM1(NM_138361.5):c.593C>T (p.A198V)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127467804C>T" "" "VUS" "" "0000536284" "0" "50" "9" "130230110" "130230110" "subst" "0" "02327" "LRSAM1_000028" "g.130230110G>A" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127467831G>A" "" "VUS" "" "0000536285" "0" "10" "9" "130242109" "130242109" "subst" "0.414035" "02330" "LRSAM1_000029" "g.130242109C>T" "" "" "" "LRSAM1(NM_138361.5):c.904-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127479830C>T" "" "benign" "" "0000536286" "0" "10" "9" "130242109" "130242109" "subst" "0.414035" "02325" "LRSAM1_000029" "g.130242109C>T" "" "" "" "LRSAM1(NM_138361.5):c.904-9C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127479830C>T" "" "benign" "" "0000536287" "0" "30" "9" "130242179" "130242179" "subst" "0.00386443" "02326" "LRSAM1_000011" "g.130242179A>G" "" "" "" "LRSAM1(NM_138361.5):c.965A>G (p.Q322R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127479900A>G" "" "likely benign" "" "0000536288" "0" "30" "9" "130248080" "130248080" "subst" "0.000426424" "02330" "LRSAM1_000030" "g.130248080C>G" "" "" "" "LRSAM1(NM_138361.5):c.1225C>G (p.Q409E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127485801C>G" "" "likely benign" "" "0000536289" "0" "10" "9" "130251743" "130251743" "subst" "0.00118204" "02330" "LRSAM1_000031" "g.130251743G>A" "" "" "" "LRSAM1(NM_138361.5):c.1368G>A (p.A456=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127489464G>A" "" "benign" "" "0000536290" "0" "90" "9" "130255104" "130255104" "subst" "0" "01943" "LRSAM1_000032" "g.130255104G>A" "" "" "" "LRSAM1(NM_138361.5):c.1527G>A (p.W509*)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127492825G>A" "" "pathogenic" "" "0000536291" "0" "30" "9" "130257631" "130257631" "subst" "2.43657E-5" "02330" "LRSAM1_000033" "g.130257631G>A" "" "" "" "LRSAM1(NM_138361.5):c.1632G>A (p.Q544=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127495352G>A" "" "likely benign" "" "0000536292" "0" "10" "9" "130263438" "130263438" "subst" "0" "02325" "FAM129B_000003" "g.130263438T>C" "" "" "" "LRSAM1(NM_138361.5):c.2046+16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127501159T>C" "" "benign" "" "0000536293" "0" "50" "9" "130265060" "130265060" "subst" "0" "02330" "LRSAM1_000008" "g.130265060T>G" "" "" "" "LRSAM1(NM_138361.5):c.2054T>G (p.M685R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127502781T>G" "" "VUS" "" "0000536294" "0" "50" "9" "130265093" "130265093" "subst" "0" "02330" "FAM129B_000004" "g.130265093G>C" "" "" "" "LRSAM1(NM_001384142.1):c.2087G>C (p.C696S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127502814G>C" "" "VUS" "" "0000536295" "0" "10" "9" "130265163" "130265163" "subst" "0.00185815" "02330" "FAM129B_000005" "g.130265163C>T" "" "" "" "LRSAM1(NM_138361.5):c.2157C>T (p.I719=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127502884C>T" "" "benign" "" "0000611857" "0" "10" "9" "130243453" "130243453" "subst" "0.00136808" "02330" "LRSAM1_000034" "g.130243453T>C" "" "" "" "LRSAM1(NM_138361.5):c.1044-9T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127481174T>C" "" "benign" "" "0000611858" "0" "50" "9" "130255166" "130255166" "subst" "2.03494E-5" "02330" "LRSAM1_000035" "g.130255166G>A" "" "" "" "LRSAM1(NM_138361.5):c.1589G>A (p.R530Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127492887G>A" "" "VUS" "" "0000611859" "0" "50" "9" "130258324" "130258324" "subst" "0.000212628" "02327" "LRSAM1_000036" "g.130258324C>T" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127496045C>T" "" "VUS" "" "0000611860" "0" "30" "9" "130259561" "130259561" "subst" "0.000492519" "02330" "LRSAM1_000037" "g.130259561C>T" "" "" "" "LRSAM1(NM_138361.5):c.1860C>T (p.H620=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127497282C>T" "" "likely benign" "" "0000611861" "0" "90" "9" "130265060" "130265060" "subst" "0" "02326" "LRSAM1_000008" "g.130265060T>G" "" "" "" "LRSAM1(NM_138361.5):c.2054T>G (p.M685R)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127502781T>G" "" "pathogenic" "" "0000611862" "0" "70" "9" "130265094" "130265094" "subst" "0" "02326" "FAM129B_000007" "g.130265094C>G" "" "" "" "LRSAM1(NM_138361.5):c.2088C>G (p.C696W)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127502815C>G" "" "likely pathogenic" "" "0000611863" "0" "50" "9" "130265110" "130265139" "dup" "0" "02330" "FAM129B_000008" "g.130265110_130265139dup" "" "" "" "LRSAM1(NM_138361.5):c.2104_2133dupCCACTGCGCACCTGCCCGCTGTGCCGCCAG (p.P702_Q711dup)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127502831_127502860dup" "" "VUS" "" "0000622162" "0" "30" "9" "130259561" "130259561" "subst" "0.000492519" "02326" "LRSAM1_000037" "g.130259561C>T" "" "" "" "LRSAM1(NM_138361.5):c.1860C>T (p.H620=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127497282C>T" "" "likely benign" "" "0000622163" "0" "30" "9" "130263350" "130263350" "subst" "0.00049165" "02330" "FAM129B_000006" "g.130263350T>C" "" "" "" "LRSAM1(NM_138361.5):c.1974T>C (p.S658=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127501071T>C" "" "likely benign" "" "0000653543" "0" "70" "9" "130263414" "130263414" "del" "0" "01164" "LRSAM1_000038" "g.130263414del" "" "" "" "" "ACMG: PVS1,PM2" "Germline" "" "" "0" "" "" "g.127501135del" "" "likely pathogenic" "ACMG" "0000656221" "0" "30" "9" "130221297" "130221297" "subst" "0.00129294" "02326" "LRSAM1_000039" "g.130221297G>A" "" "" "" "LRSAM1(NM_138361.5):c.268G>A (p.D90N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127459018G>A" "" "likely benign" "" "0000656222" "0" "30" "9" "130223551" "130223551" "subst" "0.000288353" "02326" "LRSAM1_000040" "g.130223551G>T" "" "" "" "LRSAM1(NM_138361.5):c.406+15G>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "g.127461272G>T" "" "likely benign" "" "0000674970" "0" "70" "9" "130236109" "130236109" "subst" "0" "01164" "LRSAM1_000045" "g.130236109C>T" "" "" "" "" "ACMG grading: PVS1,PM2" "Germline" "" "rs868415081" "0" "" "" "g.127473830C>T" "" "likely pathogenic" "ACMG" "0000674973" "0" "70" "9" "130245284" "130245284" "subst" "0" "01164" "LRSAM1_000047" "g.130245284C>T" "" "" "" "" "ACMG grading: PVS1,PM2" "Germline" "" "rs752177472" "0" "" "" "g.127483005C>T" "" "likely pathogenic" "ACMG" "0000674974" "0" "50" "9" "130230076" "130230076" "subst" "0.000434043" "01164" "LRSAM1_000026" "g.130230076G>A" "" "" "" "" "" "Germline" "" "rs148059394" "0" "" "" "g.127467797G>A" "" "VUS" "" "0000674975" "0" "70" "9" "130263328" "130263328" "dup" "0" "01164" "LRSAM1_000049" "g.130263328dup" "" "" "" "" "ACMG grading: PVS1,PM2" "Germline" "" "rs775965001" "0" "" "" "g.127501054dup" "" "likely pathogenic" "ACMG" "0000674976" "0" "50" "9" "130265096" "130265096" "subst" "0" "01164" "LRSAM1_000053" "g.130265096A>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.127502817A>G" "" "VUS" "" "0000674977" "0" "70" "9" "130263387" "130263387" "del" "0" "01164" "LRSAM1_000050" "g.130263387del" "" "" "" "2011delC" "ACMG grading: PVS1,PM2" "Germline" "" "" "0" "" "" "g.127501108del" "" "likely pathogenic" "ACMG" "0000674978" "0" "70" "9" "130263387" "130263387" "del" "0" "01164" "LRSAM1_000050" "g.130263387del" "" "" "" "2011delC" "ACMG grading: PVS1,PM2" "Germline" "" "" "0" "" "" "g.127501108del" "" "likely pathogenic" "ACMG" "0000674979" "0" "50" "9" "130224621" "130224621" "subst" "6.90305E-5" "01164" "LRSAM1_000043" "g.130224621C>T" "" "" "" "" "" "Germline" "" "rs142085060" "0" "" "" "g.127462342C>T" "" "VUS" "" "0000674980" "0" "70" "9" "130263387" "130263387" "subst" "0" "01164" "LRSAM1_000051" "g.130263387C>T" "" "" "" "" "" "Germline" "" "rs876661247" "0" "" "" "g.127501108C>T" "" "likely pathogenic" "" "0000674981" "0" "50" "9" "130241774" "130241774" "subst" "1.21969E-5" "01164" "LRSAM1_000046" "g.130241774C>T" "" "" "" "" "" "Germline" "" "rs747368361" "0" "" "" "g.127479495C>T" "" "VUS" "" "0000674982" "0" "50" "9" "130265074" "130265074" "subst" "0" "01164" "LRSAM1_000052" "g.130265074T>C" "" "" "" "" "ACMG grading: PM2,PP3" "Germline" "" "rs879253755" "0" "" "" "g.127502795T>C" "" "VUS" "ACMG" "0000674983" "3" "70" "9" "130224653" "130224653" "subst" "0" "01164" "LRSAM1_000044" "g.130224653G>C" "" "" "" "" "ACMG grading: PVS1,PM2" "Germline" "" "" "0" "" "" "g.127462374G>C" "" "likely pathogenic" "ACMG" "0000674984" "0" "50" "9" "130219626" "130219626" "subst" "8.12354E-6" "01164" "LRSAM1_000042" "g.130219626C>G" "" "" "" "" "" "Germline" "" "rs942116544" "0" "" "" "g.127457347C>G" "" "VUS" "" "0000674985" "0" "70" "9" "130250037" "130250037" "subst" "0" "01164" "LRSAM1_000048" "g.130250037C>T" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.127487758C>T" "" "likely pathogenic" "" "0000674986" "0" "50" "9" "130219592" "130219592" "subst" "0" "01164" "LRSAM1_000041" "g.130219592C>G" "" "" "" "" "" "Germline" "" "" "0" "" "" "g.127457313C>G" "" "VUS" "" "0000675170" "3" "70" "9" "130263289" "130263290" "del" "0" "01164" "LRSAM1_000054" "g.130263289_130263290del" "" "" "" "" "submission for publication Reilich et al, 2020 (submitted)" "Germline" "?" "" "0" "" "" "g.127501010_127501011del" "" "pathogenic (recessive)" "ACMG" "0000675171" "0" "70" "9" "130263414" "130263414" "del" "0" "01164" "LRSAM1_000038" "g.130263414del" "" "" "" "2038delG" "submission for publication Reilich et al, 2020 (submitted)" "Germline" "?" "" "0" "" "" "g.127501135del" "" "likely pathogenic (dominant)" "ACMG" "0000675172" "0" "70" "9" "130265052" "130265052" "subst" "0" "01164" "LRSAM1_000017" "g.130265052G>A" "" "" "" "c.2047-1G>A, (p.Ala683Profs*3); Nicolaou, et al., 2013; Dohrn, et al., 2017" "submission for publication Reilich et al, 2020 (submitted)" "Germline" "?" "" "0" "" "" "g.127502773G>A" "" "likely pathogenic (dominant)" "ACMG" "0000675173" "0" "70" "9" "130265074" "130265074" "subst" "0" "01164" "LRSAM1_000052" "g.130265074T>C" "" "" "" "" "submission for publication Reilich et al, 2020 (submitted)" "Germline" "?" "" "0" "" "" "g.127502795T>C" "" "likely pathogenic (dominant)" "ACMG" "0000675174" "0" "70" "9" "130265080" "130265080" "subst" "0" "01164" "LRSAM1_000055" "g.130265080C>A" "" "" "" "" "submission for publication Reilich et al, 2020 (submitted); amino acid change from histidine to asparagine, therefore RING domain 675-710 altered at aa 692" "Germline" "?" "" "0" "" "" "g.127502801C>A" "" "likely pathogenic (dominant)" "ACMG" "0000675180" "0" "70" "9" "130265052" "130265179" "del" "0" "01164" "LRSAM1_000056" "g.(130263423_130265052)_(130265179_?)del" "" "" "" "deletion Ex25; Mortreux, et al., 2019" "submission for publication Reilich et al, 2020 (submitted); Truncated protein without RING domain" "Germline" "?" "" "0" "" "" "g.(127501144_127502773)_(127502900_?)del" "" "likely pathogenic (dominant)" "ACMG" "0000678523" "0" "30" "9" "130221297" "130221297" "subst" "0.00129294" "02330" "LRSAM1_000039" "g.130221297G>A" "" "" "" "LRSAM1(NM_138361.5):c.268G>A (p.D90N)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000678524" "0" "10" "9" "130263351" "130263351" "subst" "0.00465277" "02330" "FAM129B_000009" "g.130263351G>A" "" "" "" "LRSAM1(NM_138361.5):c.1975G>A (p.V659M)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000712965" "0" "50" "9" "130257672" "130257672" "subst" "0" "01741" "LRSAM1_000057" "g.130257672A>G" "" "" "" "" "" "Germline/De novo (untested)" "" "" "" "" "" "" "" "VUS" "" "0000722264" "0" "50" "9" "130230076" "130230076" "subst" "0.000434043" "02329" "LRSAM1_000026" "g.130230076G>A" "" "" "" "LRSAM1(NM_138361.5):c.586G>A (p.G196S)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000722265" "0" "30" "9" "130241795" "130241795" "subst" "1.63048E-5" "02330" "LRSAM1_000058" "g.130241795C>T" "" "" "" "LRSAM1(NM_138361.5):c.903+11C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722266" "0" "30" "9" "130242240" "130242240" "subst" "8.12282E-5" "02330" "LRSAM1_000059" "g.130242240G>T" "" "" "" "LRSAM1(NM_138361.5):c.1026G>T (p.L342=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000722267" "0" "30" "9" "130242241" "130242241" "subst" "8.12255E-5" "02330" "LRSAM1_000060" "g.130242241C>T" "" "" "" "LRSAM1(NM_138361.5):c.1027C>T (p.L343=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000787323" "3" "50" "9" "0" "0" "" "0" "00006" "PTCH1_000000" "g.?" "" "{PMID:Ganapathy 2019:31069529}" "" "c.284C>T (Ala95Val)" "" "Germline" "" "rs570248730" "0" "" "" "" "{CV-RCV:000649924.1}" "VUS" "" "0000787324" "0" "50" "9" "0" "0" "" "0" "00006" "PTCH1_000000" "g.?" "" "{PMID:Ganapathy 2019:31069529}" "" "c.1198C>T (Arg400Trp)" "" "Germline" "" "rs749575647" "0" "" "" "" "" "VUS" "" "0000852110" "0" "50" "9" "130224581" "130224581" "subst" "4.06072E-5" "02326" "LRSAM1_000062" "g.130224581C>T" "" "" "" "LRSAM1(NM_138361.5):c.457C>T (p.R153C)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852111" "0" "50" "9" "130236077" "130236077" "subst" "9.74564E-5" "02330" "LRSAM1_000063" "g.130236077C>T" "" "" "" "LRSAM1(NM_138361.5):c.620-3C>T" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000852112" "0" "50" "9" "130259578" "130259578" "subst" "2.03656E-5" "02330" "LRSAM1_000064" "g.130259578T>G" "" "" "" "LRSAM1(NM_138361.5):c.1877T>G (p.V626G)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000861394" "0" "90" "9" "130221337" "130221347" "del" "0" "01943" "LRSAM1_000061" "g.130221337_130221347del" "" "" "" "LRSAM1(NM_138361.5):c.308_318delTGACTGCCCTC (p.L103Pfs*29)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "pathogenic" "" "0000888625" "0" "30" "9" "130263350" "130263350" "subst" "0.00049165" "02326" "FAM129B_000006" "g.130263350T>C" "" "" "" "LRSAM1(NM_138361.5):c.1974T>C (p.S658=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000888626" "0" "10" "9" "130263438" "130263438" "subst" "0" "02330" "FAM129B_000003" "g.130263438T>C" "" "" "" "LRSAM1(NM_138361.5):c.2046+16T>C" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0000896746" "0" "70" "9" "130263409" "130263409" "subst" "0" "01741" "LRSAM1_000023" "g.130263409G>A" "" "" "" "" "" "Germline" "" "" "0" "" "" "" "" "likely pathogenic" "" "0000913083" "0" "50" "9" "130258261" "130258261" "subst" "0.000188004" "02330" "LRSAM1_000065" "g.130258261C>A" "" "" "" "LRSAM1(NM_001384142.1):c.1717C>A (p.Q573K)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000929533" "0" "30" "9" "130241205" "130241205" "subst" "0.000239615" "02330" "LRSAM1_000066" "g.130241205C>G" "" "" "" "LRSAM1(NM_138361.5):c.751-8C>G" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000929534" "0" "30" "9" "130255092" "130255092" "subst" "6.92013E-5" "02330" "LRSAM1_000067" "g.130255092G>A" "" "" "" "LRSAM1(NM_138361.5):c.1515G>A (p.S505=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "likely benign" "" "0000949188" "0" "50" "9" "130221290" "130221290" "subst" "1.6262E-5" "02330" "LRSAM1_000068" "g.130221290T>G" "" "" "" "LRSAM1(NM_001384142.1):c.261T>G (p.D87E)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000978398" "0" "50" "9" "130263418" "130263418" "subst" "8.17949E-5" "02330" "FAM129B_000010" "g.130263418G>A" "" "" "" "LRSAM1(NM_001384142.1):c.2042G>A (p.R681Q)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997490" "0" "50" "9" "130223492" "130223492" "subst" "2.43637E-5" "02325" "LRSAM1_000069" "g.130223492G>A" "" "" "" "LRSAM1(NM_138361.5):c.362G>A (p.R121H)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997491" "0" "50" "9" "130242262" "130242262" "subst" "0" "01804" "LRSAM1_000070" "g.130242262G>T" "" "" "" "LRSAM1(NM_001005373.3):c.1043+5G>T (p.?)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0000997492" "0" "50" "9" "130269185" "130269185" "del" "0" "01804" "FAM129B_000011" "g.130269185del" "" "" "" "FAM129B(NM_022833.2):c.2180delG (p.(Ser727fs))" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "VUS" "" "0001025586" "0" "10" "9" "130263326" "130263326" "subst" "0.0001219" "02330" "FAM129B_000013" "g.130263326G>A" "" "" "" "LRSAM1(NM_001384142.1):c.1950G>A (p.T650=)" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" "0001046177" "0" "10" "9" "130257493" "130257493" "subst" "0" "02327" "LRSAM1_000071" "g.130257493A>G" "" "" "" "" "VKGL data sharing initiative Nederland" "CLASSIFICATION record" "" "" "" "" "" "" "" "benign" "" ## Variants_On_Transcripts ## Do not remove or alter this header ## ## Please note that not necessarily all variants found in the given individuals are shown. This output is restricted to variants in the selected gene. ## Note: Only showing Variants_On_Transcript columns active for Genes LRSAM1 ## Count = 102 "{{id}}" "{{transcriptid}}" "{{effectid}}" "{{position_c_start}}" "{{position_c_start_intron}}" "{{position_c_end}}" "{{position_c_end_intron}}" "{{VariantOnTranscript/DNA}}" "{{VariantOnTranscript/RNA}}" "{{VariantOnTranscript/Protein}}" "{{VariantOnTranscript/Exon}}" "0000130025" "00025365" "00" "2075" "0" "2087" "0" "c.2075_2087del" "r.(?)" "p.(His692Profs*39)" "" "0000246794" "00025365" "10" "952" "0" "952" "0" "c.952A>G" "r.(?)" "p.(Asn318Asp)" "" "0000246797" "00025365" "10" "1912" "5" "1912" "5" "c.1912+5A>C" "r.spl?" "p.?" "" "0000246862" "00025365" "30" "965" "0" "965" "0" "c.965A>G" "r.(?)" "p.(Gln322Arg)" "" "0000248410" "00025365" "10" "952" "0" "952" "0" "c.952A>G" "r.(?)" "p.(Asn318Asp)" "" "0000248440" "00025365" "10" "1912" "5" "1912" "5" "c.1912+5A>C" "r.spl?" "p.?" "" "0000279499" "00025365" "50" "1199" "0" "1199" "0" "c.1199G>A" "r.(?)" "p.(Arg400Gln)" "" "0000279500" "00025365" "10" "1830" "6" "1830" "6" "c.1830+6C>T" "r.(=)" "p.(=)" "" "0000279501" "00025365" "10" "249" "0" "249" "0" "c.249C>T" "r.(?)" "p.(Ile83=)" "" "0000279502" "00025365" "10" "252" "8" "252" "8" "c.252+8G>A" "r.(=)" "p.(=)" "" "0000279503" "00025365" "10" "548" "0" "548" "0" "c.548C>T" "r.(?)" "p.(Ser183Leu)" "" "0000279504" "00025365" "10" "620" "-15" "620" "-15" "c.620-15T>C" "r.(=)" "p.(=)" "" "0000279505" "00025365" "30" "786" "0" "786" "0" "c.786G>A" "r.(?)" "p.(Gln262=)" "" "0000282350" "00025365" "10" "249" "0" "249" "0" "c.249C>T" "r.(?)" "p.(Ile83=)" "" "0000286047" "00025365" "10" "1830" "6" "1830" "6" "c.1830+6C>T" "r.(=)" "p.(=)" "" "0000342075" "00025365" "50" "517" "0" "517" "0" "c.517C>T" "r.(?)" "p.(Arg173Ter)" "" "0000347885" "00025365" "70" "2054" "0" "2054" "0" "c.2054T>G" "r.(?)" "p.(Met685Arg)" "" "0000442700" "00025365" "70" "1957" "0" "1957" "0" "c.1957dup" "r.(?)" "p.(Gln653Profs*5)" "" "0000454269" "00025365" "90" "1913" "-1" "1913" "-1" "c.1913-1G>A" "r.1913_1914del" "p.Glu638Alafs*7" "" "0000454270" "00025365" "90" "2121" "0" "2122" "0" "c.2121_2122dup" "r.(?)" "p.(Leu708Argfs*28)" "" "0000454276" "00025365" "90" "2047" "-1" "2047" "-1" "c.2047-1G>A" "r.2047del" "p.Ala683Profs*3" "24i" "0000454277" "00025365" "90" "2081" "0" "2081" "0" "c.2081G>A" "r.(?)" "p.(Cys694Tyr)" "25" "0000454282" "00025365" "90" "2021" "0" "2024" "0" "c.2021_2024del" "r.(?)" "p.(Glu674Valfs*11)" "" "0000454300" "00025365" "90" "2080" "0" "2080" "0" "c.2080T>C" "r.(?)" "p.(Cys694Arg)" "" "0000454302" "00025365" "90" "2046" "1" "2046" "1" "c.2046+1G>T" "r.2046_2047ins[u;2046+2_2046+63]" "p.Glu682_Ala683ins21" "24i" "0000454966" "00025365" "90" "2047" "-1" "2047" "-1" "c.2047-1G>A" "r.(?)" "p.?" "" "0000487470" "00025365" "70" "529" "-2" "529" "-2" "c.529-2A>G" "r.spl" "p.?" "" "0000487471" "00025365" "70" "2033" "0" "2033" "0" "c.2033G>A" "r.(?)" "p.(Cys678Tyr)" "" "0000536280" "00025365" "30" "253" "-13" "253" "-13" "c.253-13C>G" "r.(=)" "p.(=)" "" "0000536281" "00025365" "50" "284" "0" "284" "0" "c.284C>T" "r.(?)" "p.(Ala95Val)" "" "0000536283" "00025365" "50" "593" "0" "593" "0" "c.593C>T" "r.(?)" "p.(Ala198Val)" "" "0000536284" "00025365" "50" "619" "1" "619" "1" "c.619+1G>A" "r.spl?" "p.?" "" "0000536285" "00025365" "10" "904" "-9" "904" "-9" "c.904-9C>T" "r.(=)" "p.(=)" "" "0000536286" "00025365" "10" "904" "-9" "904" "-9" "c.904-9C>T" "r.(=)" "p.(=)" "" "0000536287" "00025365" "30" "965" "0" "965" "0" "c.965A>G" "r.(?)" "p.(Gln322Arg)" "" "0000536288" "00025365" "30" "1225" "0" "1225" "0" "c.1225C>G" "r.(?)" "p.(Gln409Glu)" "" "0000536289" "00025365" "10" "1368" "0" "1368" "0" "c.1368G>A" "r.(?)" "p.(Ala456=)" "" "0000536290" "00025365" "90" "1527" "0" "1527" "0" "c.1527G>A" "r.(?)" "p.(Trp509Ter)" "" "0000536291" "00025365" "30" "1632" "0" "1632" "0" "c.1632G>A" "r.(?)" "p.(Gln544=)" "" "0000536292" "00025365" "10" "2046" "16" "2046" "16" "c.2046+16T>C" "r.(=)" "p.(=)" "" "0000536293" "00025365" "50" "2054" "0" "2054" "0" "c.2054T>G" "r.(?)" "p.(Met685Arg)" "" "0000536294" "00025365" "50" "2087" "0" "2087" "0" "c.2087G>C" "r.(?)" "p.(Cys696Ser)" "" "0000536295" "00025365" "10" "2157" "0" "2157" "0" "c.2157C>T" "r.(?)" "p.(Ile719=)" "" "0000611857" "00025365" "10" "1044" "-9" "1044" "-9" "c.1044-9T>C" "r.(=)" "p.(=)" "" "0000611858" "00025365" "50" "1589" "0" "1589" "0" "c.1589G>A" "r.(?)" "p.(Arg530Gln)" "" "0000611859" "00025365" "50" "1780" "0" "1780" "0" "c.1780C>T" "r.(?)" "p.(Arg594Cys)" "" "0000611860" "00025365" "30" "1860" "0" "1860" "0" "c.1860C>T" "r.(?)" "p.(His620=)" "" "0000611861" "00025365" "90" "2054" "0" "2054" "0" "c.2054T>G" "r.(?)" "p.(Met685Arg)" "" "0000611862" "00025365" "70" "2088" "0" "2088" "0" "c.2088C>G" "r.(?)" "p.(Cys696Trp)" "" "0000611863" "00025365" "50" "2104" "0" "2133" "0" "c.2104_2133dup" "r.(?)" "p.(Pro702_Gln711dup)" "" "0000622162" "00025365" "30" "1860" "0" "1860" "0" "c.1860C>T" "r.(?)" "p.(His620=)" "" "0000622163" "00025365" "30" "1974" "0" "1974" "0" "c.1974T>C" "r.(?)" "p.(Ser658=)" "" "0000653543" "00025365" "70" "2038" "0" "2038" "0" "c.2038del" "r.(?)" "p.(Glu680AsnfsTer6)" "" "0000656221" "00025365" "30" "268" "0" "268" "0" "c.268G>A" "r.(?)" "p.(Asp90Asn)" "" "0000656222" "00025365" "30" "406" "15" "406" "15" "c.406+15G>T" "r.(=)" "p.(=)" "" "0000674970" "00025365" "70" "649" "0" "649" "0" "c.649C>T" "r.(?)" "p.(Gln217*)" "" "0000674973" "00025365" "70" "1144" "0" "1144" "0" "c.1144C>T" "r.(?)" "p.(Arg382*)" "" "0000674974" "00025365" "50" "586" "0" "586" "0" "c.586G>A" "r.(?)" "p.(Gly196Ser)" "" "0000674975" "00025365" "70" "1957" "0" "1957" "0" "c.1957dup" "r.(?)" "p.(Gln653Profs*5)" "" "0000674976" "00025365" "50" "2090" "0" "2090" "0" "c.2090A>G" "r.(?)" "p.(Gln697Arg)" "" "0000674977" "00025365" "70" "2011" "0" "2011" "0" "c.2011del" "r.(?)" "p.(Gln671Argfs*15)" "" "0000674978" "00025365" "70" "2011" "0" "2011" "0" "c.2011del" "r.(?)" "p.(Gln671Argfs*15)" "" "0000674979" "00025365" "50" "497" "0" "497" "0" "c.497C>T" "r.(?)" "p.(Pro166Leu)" "" "0000674980" "00025365" "70" "2011" "0" "2011" "0" "c.2011C>T" "r.(?)" "p.(Gln671*)" "" "0000674981" "00025365" "50" "893" "0" "893" "0" "c.893C>T" "r.(?)" "p.(Thr298Met)" "" "0000674982" "00025365" "50" "2068" "0" "2068" "0" "c.2068T>C" "r.(?)" "p.(Cys690Arg)" "" "0000674983" "00025365" "70" "528" "1" "528" "1" "c.528+1G>C" "r.spl" "p.?" "" "0000674984" "00025365" "50" "206" "0" "206" "0" "c.206C>G" "r.(?)" "p.(Ser69Cys)" "" "0000674985" "00025365" "70" "1342" "0" "1342" "0" "c.1342C>T" "r.(?)" "p.(Gln448*)" "" "0000674986" "00025365" "50" "175" "-3" "175" "-3" "c.175-3C>G" "r.spl?" "p.?" "" "0000675170" "00025365" "70" "1913" "0" "1914" "0" "c.1913_1914del" "r.(?)" "p.(Glu638Alafs*7)" "" "0000675171" "00025365" "70" "2038" "0" "2038" "0" "c.2038del" "r.(?)" "p.(Glu680Asnfs*6)" "" "0000675172" "00025365" "70" "2047" "-1" "2047" "-1" "c.2047-1G>A" "r.spl" "p.?" "" "0000675173" "00025365" "70" "2068" "0" "2068" "0" "c.2068T>C" "r.(?)" "p.(Cys690Arg)" "" "0000675174" "00025365" "70" "2074" "0" "2074" "0" "c.2074C>A" "r.(?)" "p.(His692Asn)" "" "0000675180" "00025365" "70" "2047" "-1" "2173" "0" "c.(2046+1_2047-1)_(*1_?)del" "r.?" "p.?" "" "0000678523" "00025365" "30" "268" "0" "268" "0" "c.268G>A" "r.(?)" "p.(Asp90Asn)" "" "0000678524" "00025365" "10" "1975" "0" "1975" "0" "c.1975G>A" "r.(?)" "p.(Val659Met)" "" "0000712965" "00025365" "50" "1673" "0" "1673" "0" "c.1673A>G" "r.(?)" "p.(Gln558Arg)" "21" "0000722264" "00025365" "50" "586" "0" "586" "0" "c.586G>A" "r.(?)" "p.(Gly196Ser)" "" "0000722265" "00025365" "30" "903" "11" "903" "11" "c.903+11C>T" "r.(=)" "p.(=)" "" "0000722266" "00025365" "30" "1026" "0" "1026" "0" "c.1026G>T" "r.(?)" "p.(Leu342=)" "" "0000722267" "00025365" "30" "1027" "0" "1027" "0" "c.1027C>T" "r.(?)" "p.(Leu343=)" "" "0000787323" "00025365" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "6" "0000787324" "00025365" "50" "0" "0" "0" "0" "c.?" "r.?" "p.?" "16" "0000852110" "00025365" "50" "457" "0" "457" "0" "c.457C>T" "r.(?)" "p.(Arg153Cys)" "" "0000852111" "00025365" "50" "620" "-3" "620" "-3" "c.620-3C>T" "r.spl?" "p.?" "" "0000852112" "00025365" "50" "1877" "0" "1877" "0" "c.1877T>G" "r.(?)" "p.(Val626Gly)" "" "0000861394" "00025365" "90" "308" "0" "318" "0" "c.308_318del" "r.(?)" "p.(Leu103Profs*29)" "" "0000888625" "00025365" "30" "1974" "0" "1974" "0" "c.1974T>C" "r.(?)" "p.(Ser658=)" "" "0000888626" "00025365" "10" "2046" "16" "2046" "16" "c.2046+16T>C" "r.(=)" "p.(=)" "" "0000896746" "00025365" "70" "2033" "0" "2033" "0" "c.2033G>A" "r.(?)" "p.(Cys678Tyr)" "24" "0000913083" "00025365" "50" "1717" "0" "1717" "0" "c.1717C>A" "r.(?)" "p.(Gln573Lys)" "" "0000929533" "00025365" "30" "751" "-8" "751" "-8" "c.751-8C>G" "r.(=)" "p.(=)" "" "0000929534" "00025365" "30" "1515" "0" "1515" "0" "c.1515G>A" "r.(?)" "p.(Ser505=)" "" "0000949188" "00025365" "50" "261" "0" "261" "0" "c.261T>G" "r.(?)" "p.(Asp87Glu)" "" "0000978398" "00025365" "50" "2042" "0" "2042" "0" "c.2042G>A" "r.(?)" "p.(Arg681Gln)" "" "0000997490" "00025365" "50" "362" "0" "362" "0" "c.362G>A" "r.(?)" "p.(Arg121His)" "" "0000997491" "00025365" "50" "1043" "5" "1043" "5" "c.1043+5G>T" "r.spl?" "p.?" "" "0000997492" "00025365" "50" "6179" "0" "6179" "0" "c.*4007del" "r.(?)" "p.(=)" "" "0001025586" "00025365" "10" "1950" "0" "1950" "0" "c.1950G>A" "r.(?)" "p.(Thr650=)" "" "0001046177" "00025365" "10" "1600" "-106" "1600" "-106" "c.1600-106A>G" "r.(=)" "p.(=)" "" ## Screenings_To_Variants ## Do not remove or alter this header ## ## Count = 38 "{{screeningid}}" "{{variantid}}" "0000080939" "0000130025" "0000211241" "0000442700" "0000219422" "0000454269" "0000219423" "0000454270" "0000219426" "0000454276" "0000219427" "0000454277" "0000219430" "0000454282" "0000219445" "0000454300" "0000219446" "0000454302" "0000220073" "0000454966" "0000241494" "0000487470" "0000241494" "0000487471" "0000296827" "0000653543" "0000308130" "0000674970" "0000308132" "0000674973" "0000308133" "0000674974" "0000308134" "0000674975" "0000308135" "0000674976" "0000308136" "0000674977" "0000308136" "0000674978" "0000308137" "0000674979" "0000308138" "0000674980" "0000308139" "0000674981" "0000308140" "0000674982" "0000308141" "0000674983" "0000308142" "0000674984" "0000308143" "0000674985" "0000308144" "0000674986" "0000308270" "0000675170" "0000308271" "0000675171" "0000308272" "0000675172" "0000308273" "0000675173" "0000308274" "0000675174" "0000308279" "0000675180" "0000328843" "0000712965" "0000375972" "0000787323" "0000375973" "0000787324" "0000421904" "0000896746"